#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MTSS1	9788	hgsc.bcm.edu	37	8	125565316	125565318	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:125565316_125565318delCTC	ENST00000518547.1	-	14	2656_2658	c.2183_2185delGAG	c.(2182-2187)ggagaa>gaa	p.G728del	MTSS1_ENST00000378017.3_In_Frame_Del_p.G703del|MTSS1_ENST00000431961.2_In_Frame_Del_p.G446del|MTSS1_ENST00000395508.2_In_Frame_Del_p.G502del|MTSS1_ENST00000523587.1_5'UTR|MTSS1_ENST00000524090.1_In_Frame_Del_p.G618del|MTSS1_ENST00000325064.5_In_Frame_Del_p.G732del|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000354184.4_In_Frame_Del_p.G446del	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	728	WH2. {ECO:0000255|PROSITE- ProRule:PRU00406}.				actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			AGCATGTCTTCTCCTTGTGGAGT	0.562																																					p.728_729del	Esophageal Squamous(160;622 1893 3862 8546 12509)	Pindel,Atlas-Indel	.											.	MTSS1	79	.	0			c.2184_2186del						PASS	.																																			SO:0001651	inframe_deletion	9788	exon14			.	AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.2183_2185delGAG	8.37:g.125565316_125565318delCTC	ENSP00000429064:p.Gly728del	Somatic	204	.	.		WXS	Illumina HiSeq	Phase_I	220	43	0.195	NM_014751	J3KNK6|Q8TCA2|Q96RX2	In_Frame_Del	DEL	ENST00000518547.1	37	CCDS6353.1																																																																																			.	.	none		0.562	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751	
DGKB	1607	hgsc.bcm.edu	37	7	14775822	14775822	+	Intron	DEL	G	G	-	rs370443019|rs66786499|rs139628753	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr7:14775822delG	ENST00000403951.2	-	5	588				DGKB_ENST00000399322.3_Intron|DGKB_ENST00000407950.1_Intron|DGKB_ENST00000406247.3_Intron|DGKB_ENST00000444700.2_Intron|DGKB_ENST00000258767.5_Intron|DGKB_ENST00000403963.1_Intron|DGKB_ENST00000402815.1_Intron			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.?(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TCTATTGTCTGGAAAAAAAAA	0.328													?|GG|G|unsure	2796	0.558307	0.239	0.5432	5008	,	,		17163	0.5655		0.831	False		,,,				2504	0.7127				.		Atlas-Indel	.											.	DGKB	166	.	1	Unknown(1)	stomach(1)	c.169-2C>-						PASS	.		,	1129,2347		197,735,806	25.0	13.0	16.0		,	5.9	1.0	7	dbSNP_134	32	6344,1464		2573,1198,133	no	intron,intron	DGKB	NM_145695.2,NM_004080.2	,	2770,1933,939	A1A1,A1R,RR		18.75,32.4799,33.7735	,	,	14775822	7473,3811	1786	4015	5801	SO:0001627	intron_variant	1607	exon5			.	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.169-3C>-	7.37:g.14775822delG		Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	139	103	0.741007	NM_004080	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Splice_Site	DEL	ENST00000403951.2	37	CCDS47547.1																																																																																			G|0.405;-|0.595	0.595	strong		0.328	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080	
TOX	9760	hgsc.bcm.edu	37	8	59750643	59750643	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:59750643delT	ENST00000361421.1	-	5	1141	c.921delA	c.(919-921)aaafs	p.K307fs		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	307						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				CCCTTACCTGTTTTTGCTCTT	0.473																																					p.Q308fs	Pancreas(161;610 1969 17913 21374 22725)	Pindel,Atlas-Indel	.											.	TOX	83	.	0			c.922delC						PASS	.						90.0	89.0	90.0					8																	59750643		2203	4300	6503	SO:0001589	frameshift_variant	9760	exon5			.		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.921delA	8.37:g.59750643delT	ENSP00000354842:p.Lys307fs	Somatic	112	.	.		WXS	Illumina HiSeq	Phase_I	83	19	0.229	NM_014729	Q96AV5	Frame_Shift_Del	DEL	ENST00000361421.1	37	CCDS34897.1																																																																																			.	.	none		0.473	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378307.1	NM_014729	
MAML3	55534	hgsc.bcm.edu	37	4	140811112	140811123	+	In_Frame_Del	DEL	TGCTGCTGCTGT	TGCTGCTGCTGT	-	rs62344938|rs62344939		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	TGCTGCTGCTGT	TGCTGCTGCTGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr4:140811112_140811123delTGCTGCTGCTGT	ENST00000509479.2	-	2	2323_2334	c.1467_1478delACAGCAGCAGCA	c.(1465-1479)caacagcagcagcag>cag	p.489_493QQQQQ>Q	MAML3_ENST00000398940.1_In_Frame_Del_p.28_32QQQQQ>Q|MAML3_ENST00000327122.5_In_Frame_Del_p.333_337QQQQQ>Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					ctgctgctgctgctgctgctgttgctgttgct	0.547																																					p.490_493del		Atlas-Indel	.											.	MAML3	192	.	0			c.1468_1479del						PASS	.			852,3360		97,658,1351						1.5	1.0		dbSNP_130	17	2205,5999		132,1941,2029	no	coding	MAML3	NM_018717.4		229,2599,3380	A1A1,A1R,RR		26.8771,20.2279,24.6215				3057,9359				SO:0001651	inframe_deletion	55534	exon2			.	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1467_1478delACAGCAGCAGCA	4.37:g.140811112_140811123delTGCTGCTGCTGT	ENSP00000421180:p.Gln505_Gln508del	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	120	23	0.191667	NM_018717		In_Frame_Del	DEL	ENST00000509479.2	37	CCDS54805.1																																																																																			.	.	alt		0.547	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
CSNK2A1	1457	hgsc.bcm.edu	37	20	470463	470463	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr20:470463delC	ENST00000217244.3	-	10	1059	c.684delG	c.(682-684)cggfs	p.R228fs	CSNK2A1_ENST00000400217.2_Frame_Shift_Del_p.R92fs|CSNK2A1_ENST00000400227.3_Frame_Shift_Del_p.R228fs|CSNK2A1_ENST00000349736.5_Frame_Shift_Del_p.R228fs	NM_177559.2	NP_808227.1	P68400	CSK21_HUMAN	casein kinase 2, alpha 1 polypeptide	228	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|chaperone-mediated protein folding (GO:0061077)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	ATP binding (GO:0005524)|Hsp90 protein binding (GO:0051879)|protein N-terminus binding (GO:0047485)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)			ATGGCTCCTTCCGAAAGATCA	0.373																																					p.K229fs		Pindel,Atlas-Indel	.											.	CSNK2A1	36	.	0			c.685delA						PASS	.						103.0	92.0	96.0					20																	470463		2203	4300	6503	SO:0001589	frameshift_variant	1457	exon9			.	M55265	CCDS13003.1, CCDS13004.1	20p13	2013-01-17			ENSG00000101266	ENSG00000101266			2457	protein-coding gene	gene with protein product		115440				2174700, 1766873	Standard	NM_177559		Approved		uc002wdx.1	P68400	OTTHUMG00000031636	ENST00000217244.3:c.684delG	20.37:g.470463delC	ENSP00000217244:p.Arg228fs	Somatic	79	.	.		WXS	Illumina HiSeq	Phase_I	91	18	0.198	NM_001895	B4DYS6|D3DVV8|P19138|P20426|Q14013|Q5U065	Frame_Shift_Del	DEL	ENST00000217244.3	37	CCDS13003.1																																																																																			.	.	none		0.373	CSNK2A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077466.1	NM_001895	
SETD1B	23067	hgsc.bcm.edu	37	12	122242657	122242658	+	Frame_Shift_Ins	INS	-	-	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:122242657_122242658insC	ENST00000604567.1	+	2	82_83	c.14_15insC	c.(13-18)caccccfs	p.HP5fs	SETD1B_ENST00000542440.1_Frame_Shift_Ins_p.HP5fs|SETD1B_ENST00000267197.5_Frame_Shift_Ins_p.HP5fs|RHOF_ENST00000545544.1_5'Flank|RP11-347I19.8_ENST00000609067.1_lincRNA			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	5					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.H8fs*27(2)		NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						GAGAACAGTCACCCCCCCCACC	0.629																																					p.H5fs		Atlas-Indel	.											.	SETD1B	105	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.14_15insC						PASS	.			9,1819		1,7,906						1.9	1.0			42	13,3745		3,7,1869	no	frameshift	SETD1B	NM_015048.1		4,14,2775	A1A1,A1R,RR		0.3459,0.4923,0.3938				22,5564				SO:0001589	frameshift_variant	23067	exon1			.	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.22dupC	12.37:g.122242665_122242665dupC	ENSP00000474253:p.His5fs	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	83	27	0.325301	NM_015048	F6MFW1	Frame_Shift_Ins	INS	ENST00000604567.1	37																																																																																				.	.	none		0.629	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
CYP3A43	64816	hgsc.bcm.edu	37	7	99453289	99453290	+	Frame_Shift_Ins	INS	-	-	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr7:99453289_99453290insA	ENST00000354829.2	+	8	849_850	c.746_747insA	c.(745-750)ttaaaafs	p.LK249fs	CYP3A43_ENST00000444905.1_Intron|CYP3A43_ENST00000342499.4_Intron|CYP3A43_ENST00000417625.1_Frame_Shift_Ins_p.LK139fs|CYP3A43_ENST00000222382.5_Frame_Shift_Ins_p.LK249fs|CYP3A43_ENST00000312017.5_Frame_Shift_Ins_p.LK249fs|CYP3A43_ENST00000415413.1_Intron|CYP3A43_ENST00000477658.1_3'UTR	NM_022820.3|NM_057095.1	NP_073731.1|NP_476436.1	Q9HB55	CP343_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 43	249			Missing (in allele CYP3A43*2).		small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)				Dexamethasone(DB01234)|Dolutegravir(DB08930)|Ethosuximide(DB00593)|Oxazepam(DB00842)|Phenelzine(DB00780)|Praziquantel(DB01058)|Rifampicin(DB01045)|Rifapentine(DB01201)|Testosterone(DB00624)|Troleandomycin(DB01361)|Zalcitabine(DB00943)	ACCCATTTTTTAAAAAATTCCA	0.312																																					p.L249fs		Atlas-Indel	.											CYP3A43,NS,carcinoma,0,1	CYP3A43	52	1	0			c.746_747insA						PASS	.																																			SO:0001589	frameshift_variant	64816	exon8			.	AF319634	CCDS5675.1, CCDS5676.1, CCDS5677.1, CCDS64723.1	7q21.1	2007-12-14	2003-01-14		ENSG00000021461	ENSG00000021461		"""Cytochrome P450s"""	17450	protein-coding gene	gene with protein product		606534	"""cytochrome P450, subfamily IIIA, polypeptide 43"""			11160876, 11266076	Standard	NM_022820		Approved		uc003ury.1	Q9HB55	OTTHUMG00000156498	ENST00000354829.2:c.752dupA	7.37:g.99453295_99453295dupA	ENSP00000346887:p.Leu249fs	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	128	31	0.242188	NM_022820	Q495Y1|Q75MK2|Q75MK3|Q9HB52|Q9HB53|Q9HB54|Q9HB57	Frame_Shift_Ins	INS	ENST00000354829.2	37	CCDS5676.1																																																																																			.	.	none		0.312	CYP3A43-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000344379.1		
TNFAIP3	7128	hgsc.bcm.edu	37	6	138200459	138200460	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:138200459_138200460delTG	ENST00000237289.4	+	7	1943_1944	c.1877_1878delTG	c.(1876-1878)ctgfs	p.L626fs		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	626	Interaction with TNIP1. {ECO:0000250}.|Required for proteosomal degradation of UBE2N and UBE2D3, TRAF6 deubiquitination, and TAX1BP1 interaction with UBE2N. {ECO:0000250}.|Sufficient for inhibitory activity of TNF-induced NF-kappa-B activity. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.C627fs*44(1)|p.L626fs*45(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		TTTTGCACACTGTGTTTCATCG	0.51			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																p.626_626del	GBM(130;153 1739 22295 28918 47987)	Atlas-Indel	.		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	.	TNFAIP3	340	.	27	Whole gene deletion(25)|Deletion - Frameshift(2)	haematopoietic_and_lymphoid_tissue(27)	c.1876_1877del						PASS	.																																			SO:0001589	frameshift_variant	7128	exon7			.	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1877_1878delTG	6.37:g.138200461_138200462delTG	ENSP00000237289:p.Leu626fs	Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	91	17	0.186813	NM_001270508	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Frame_Shift_Del	DEL	ENST00000237289.4	37	CCDS5187.1																																																																																			.	.	none		0.510	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1		
TRAK1	22906	hgsc.bcm.edu	37	3	42251577	42251578	+	Intron	INS	-	-	GGA	rs10634555|rs35624871		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:42251577_42251578insGGA	ENST00000327628.5	+	14	2363				TRAK1_ENST00000396175.1_Intron|TRAK1_ENST00000487159.1_Intron|TRAK1_ENST00000341421.3_In_Frame_Ins_p.640_641insE	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1						endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.E640delE(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						CCAGCGGCCACggaggaggagg	0.629																																					p.T688delinsTE	GBM(44;195 884 22595 31865 41850)	Pindel	.											TRAK1,caecum,carcinoma,0,1	TRAK1	188	1	1	Deletion - In frame(1)	kidney(1)	c.2063_2064insGGA						PASS	.																																			SO:0001627	intron_variant	22906	exon14			.		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.1963+100->GGA	3.37:g.42251584_42251586dupGGA		Somatic	41	.	.		WXS	Illumina HiSeq	Phase_I	52	12	0.231	NM_001265608	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	In_Frame_Ins	INS	ENST00000327628.5	37	CCDS43072.1																																																																																			.	.	strong		0.629	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
NHLRC2	374354	hgsc.bcm.edu	37	10	115636657	115636657	+	Silent	SNP	A	A	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr10:115636657A>C	ENST00000369301.3	+	3	921	c.709A>C	c.(709-711)Aga>Cga	p.R237R		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	237										breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		AGTTACTGATAGATTGGTAAT	0.353																																					p.R237R		Atlas-SNP	.											.	NHLRC2	56	.	0			c.A709C						PASS	.						58.0	60.0	59.0					10																	115636657		2185	4291	6476	SO:0001819	synonymous_variant	374354	exon3			ACTGATAGATTGG	AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.709A>C	10.37:g.115636657A>C		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	75	13	0.173333	NM_198514	Q8N1H1|Q8N5A6	Silent	SNP	ENST00000369301.3	37	CCDS7585.1																																																																																			.	.	none		0.353	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050446.1	NM_198514	
DEFA3	1668	hgsc.bcm.edu	37	8	6873603	6873603	+	Missense_Mutation	SNP	T	T	G	rs145076681		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:6873603T>G	ENST00000327857.2	-	3	285	c.194A>C	c.(193-195)gAc>gCc	p.D65A	DEFA1B_ENST00000535841.1_Intron	NM_005217.3	NP_005208.1	P59666	DEF3_HUMAN	defensin, alpha 3, neutrophil-specific	65					antibacterial humoral response (GO:0019731)|defense response to fungus (GO:0050832)|defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular estrogen receptor signaling pathway (GO:0030520)|killing of cells of other organism (GO:0031640)	azurophil granule lumen (GO:0035578)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.D65A(1)		endometrium(1)|prostate(2)	3				COAD - Colon adenocarcinoma(149;0.0561)|READ - Rectum adenocarcinoma(644;0.118)		GCAATAGCAGTCCATGTTTTT	0.498																																					p.D65A		Atlas-SNP	.											DEFA3,NS,carcinoma,0,1	DEFA3	7	1	1	Substitution - Missense(1)	prostate(1)	c.A194C						scavenged	.						156.0	118.0	130.0					8																	6873603		1957	4128	6085	SO:0001583	missense	1668	exon3			TAGCAGTCCATGT	M23281	CCDS5962.1	8p23.1	2009-08-05			ENSG00000239839	ENSG00000239839		"""Defensins, alpha"""	2762	protein-coding gene	gene with protein product		604522		DEF3		8477861, 17214878, 15944200	Standard	NM_005217		Approved	HNP-3		P59666	OTTHUMG00000090381	ENST00000327857.2:c.194A>C	8.37:g.6873603T>G	ENSP00000328359:p.Asp65Ala	Somatic	238	30	0.12605		WXS	Illumina HiSeq	Phase_I	247	41	0.165992	NM_005217	P11479|Q14125	Missense_Mutation	SNP	ENST00000327857.2	37	CCDS5962.1	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.042516	0.00402	.	.	ENSG00000239839	ENST00000327857	T	0.41400	1.0	1.01	-2.03	0.07365	.	.	.	.	.	T	0.15046	0.0363	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.24154	-1.0168	7	0.08179	T	0.78	.	0.1742	0.00116	0.3008:0.2168:0.2655:0.217	.	65	P59666	DEF3_HUMAN	A	65	ENSP00000328359:D65A	ENSP00000328359:D65A	D	-	2	0	DEFA3	6861013	0.002000	0.14202	0.000000	0.03702	0.011000	0.07611	-0.189000	0.09629	-1.937000	0.01047	-0.806000	0.03193	GAC	T|0.167;G|0.833	0.833	strong		0.498	DEFA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206753.2	NM_005217	
MUC6	4588	hgsc.bcm.edu	37	11	1017576	1017576	+	Missense_Mutation	SNP	G	G	T	rs372353242		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:1017576G>T	ENST00000421673.2	-	31	5275	c.5225C>A	c.(5224-5226)aCg>aAg	p.T1742K		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1742	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTTTTGGCCGTGCTAAATGA	0.537																																					p.T1742K		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,+1,2	MUC6	408	2	0			c.C5225A						PASS	.						688.0	670.0	676.0					11																	1017576		2188	4282	6470	SO:0001583	missense	4588	exon31			TTGGCCGTGCTAA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5225C>A	11.37:g.1017576G>T	ENSP00000406861:p.Thr1742Lys	Somatic	501	0	0		WXS	Illumina HiSeq	Phase_I	566	48	0.0848057	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	-	7.936	0.741705	0.15642	.	.	ENSG00000184956	ENST00000421673	T	0.25414	1.8	2.32	-2.37	0.06643	.	.	.	.	.	T	0.38532	0.1044	M	0.62723	1.935	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	T	0.23547	-1.0185	9	0.59425	D	0.04	.	3.4316	0.07430	0.3783:0.0:0.4408:0.1809	.	1742	Q6W4X9	MUC6_HUMAN	K	1742	ENSP00000406861:T1742K	ENSP00000406861:T1742K	T	-	2	0	MUC6	1007576	0.010000	0.17322	0.000000	0.03702	0.004000	0.04260	0.978000	0.29488	-0.611000	0.05709	-0.643000	0.03959	ACG	.	.	alt		0.537	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
NUDT8	254552	hgsc.bcm.edu	37	11	67395800	67395800	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:67395800C>T	ENST00000376693.2	-	3	408	c.399G>A	c.(397-399)tcG>tcA	p.S133S	RP11-655M14.13_ENST00000533311.1_lincRNA|NUDT8_ENST00000301490.4_Silent_p.S133S	NM_001243750.1	NP_001230679.1	Q8WV74	NUDT8_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 8	133	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(1)|prostate(1)|skin(1)	4						TCACCTCCTCCGAGTTGGGCC	0.622																																					p.S133S		Atlas-SNP	.											.	NUDT8	12	.	0			c.G399A						PASS	.						122.0	91.0	102.0					11																	67395800		2200	4294	6494	SO:0001819	synonymous_variant	254552	exon3			CTCCTCCGAGTTG	AI743601	CCDS8174.1, CCDS58151.1	11q13.2	2008-07-21			ENSG00000167799	ENSG00000167799		"""Nudix motif containing"""	8055	protein-coding gene	gene with protein product						11415433	Standard	NM_181843		Approved	FLJ41567	uc001omo.2	Q8WV74	OTTHUMG00000167292	ENST00000376693.2:c.399G>A	11.37:g.67395800C>T		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	49	12	0.244898	NM_181843	Q6ZW59	Silent	SNP	ENST00000376693.2	37	CCDS58151.1																																																																																			.	.	none		0.622	NUDT8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394036.1	NM_181843	
MUC17	140453	hgsc.bcm.edu	37	7	100679782	100679782	+	Missense_Mutation	SNP	A	A	G	rs71525815		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr7:100679782A>G	ENST00000306151.4	+	3	5149	c.5085A>G	c.(5083-5085)atA>atG	p.I1695M		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1695	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TAACAAGTATAACTGTCAGAA	0.473																																					p.I1695M		Atlas-SNP	.											MUC17,colon,carcinoma,0,1	MUC17	804	1	0			c.A5085G						scavenged	.						175.0	193.0	187.0					7																	100679782		2203	4300	6503	SO:0001583	missense	140453	exon3			AAGTATAACTGTC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5085A>G	7.37:g.100679782A>G	ENSP00000302716:p.Ile1695Met	Somatic	69	4	0.057971		WXS	Illumina HiSeq	Phase_I	69	8	0.115942	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	a	0.007	-1.936922	0.00484	.	.	ENSG00000169876	ENST00000306151	T	0.02216	4.39	0.331	-0.661	0.11417	.	.	.	.	.	T	0.01320	0.0043	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49322	-0.8952	8	0.44086	T	0.13	.	.	.	.	.	1695	Q685J3	MUC17_HUMAN	M	1695	ENSP00000302716:I1695M	ENSP00000302716:I1695M	I	+	3	3	MUC17	100466502	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.838000	0.01687	-2.680000	0.00409	-1.981000	0.00455	ATA	.	.	none		0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC4	4585	hgsc.bcm.edu	37	3	195509525	195509525	+	Missense_Mutation	SNP	G	G	A	rs550606134		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:195509525G>A	ENST00000463781.3	-	2	9385	c.8926C>T	c.(8926-8928)Cct>Tct	p.P2976S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P2976S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P2976S(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TCAGGAAGAGGGGTGGCGTGA	0.587													.|||	1	0.000199681	0.0008	0.0	5008	,	,		9881	0.0		0.0	False		,,,				2504	0.0				p.P2976S		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	2	Substitution - Missense(2)	endometrium(2)	c.C8926T						scavenged	.						18.0	10.0	12.0					3																	195509525		663	1548	2211	SO:0001583	missense	4585	exon2			GAAGAGGGGTGGC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8926C>T	3.37:g.195509525G>A	ENSP00000417498:p.Pro2976Ser	Somatic	158	3	0.0189873		WXS	Illumina HiSeq	Phase_I	158	10	0.0632911	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	5.257	0.232935	0.09969	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.28069	1.63;1.63	.	.	.	.	.	.	.	.	T	0.24392	0.0591	N	0.08118	0	0.09310	N	1	D	0.63880	0.993	D	0.70227	0.968	T	0.10428	-1.0630	7	.	.	.	.	1.6626	0.02795	0.4559:0.0:0.2522:0.2919	.	2848	E7ESK3	.	S	2976	ENSP00000417498:P2976S;ENSP00000420243:P2976S	.	P	-	1	0	MUC4	196994304	.	.	0.004000	0.12327	0.000000	0.00434	.	.	-0.437000	0.07243	0.000000	0.15137	CCT	.	.	none		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CDH26	60437	hgsc.bcm.edu	37	20	58569512	58569512	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr20:58569512C>T	ENST00000244047.5	+	11	1945	c.1634C>T	c.(1633-1635)gCg>gTg	p.A545V	CDH26_ENST00000244049.3_5'Flank|CDH26_ENST00000348616.4_Missense_Mutation_p.A545V|CDH26_ENST00000350849.6_5'Flank|CDH26_ENST00000497614.1_3'UTR			Q8IXH8	CAD26_HUMAN	cadherin 26	545					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			TGGGGAAATGCGGAGGACACA	0.483																																					p.A545V		Atlas-SNP	.											CDH26_ENST00000244047,caecum,carcinoma,-1,2	CDH26	229	2	0			c.C1634T						PASS	.						47.0	45.0	45.0					20																	58569512		2203	4300	6503	SO:0001583	missense	60437	exon11			GAAATGCGGAGGA	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1634C>T	20.37:g.58569512C>T	ENSP00000244047:p.Ala545Val	Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	50	10	0.2	NM_177980	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	ENST00000244047.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.035|8.035	0.762688|0.762688	0.15914|0.15914	.|.	.|.	ENSG00000124215|ENSG00000124215	ENST00000244047;ENST00000348616|ENST00000370991	T;T|.	0.60797|.	0.16;0.16|.	4.14|4.14	-2.75|-2.75	0.05914|0.05914	Cadherin-like (1);|.	1.199730|.	0.06092|.	N|.	0.663775|.	T|T	0.12817|0.12817	0.0311|0.0311	N|N	0.05199|0.05199	-0.095|-0.095	0.09310|0.09310	N|N	1|1	B;B|.	0.20368|.	0.044;0.019|.	B;B|.	0.16289|.	0.015;0.01|.	T|T	0.25328|0.25328	-1.0135|-1.0135	10|5	0.05525|.	T|.	0.97|.	.|.	3.2617|3.2617	0.06851|0.06851	0.2957:0.3011:0.0:0.4032|0.2957:0.3011:0.0:0.4032	.|.	545;545|.	Q8IXH8;Q8IXH8-4|.	CAD26_HUMAN;.|.	V|W	545|137	ENSP00000244047:A545V;ENSP00000339390:A545V|.	ENSP00000244047:A545V|.	A|R	+|+	2|1	0|2	CDH26|CDH26	58002907|58002907	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-1.140000|-1.140000	0.03210|0.03210	-0.411000|-0.411000	0.07530|0.07530	0.655000|0.655000	0.94253|0.94253	GCG|CGG	.	.	none		0.483	CDH26-201	KNOWN	basic	protein_coding	protein_coding		NM_177980	
OR5H14	403273	hgsc.bcm.edu	37	3	97869007	97869007	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:97869007A>G	ENST00000437310.1	+	1	838	c.778A>G	c.(778-780)Atg>Gtg	p.M260V	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M260V(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						CTTCATGTATATGGGCTCTGC	0.433																																					p.M260V		Atlas-SNP	.											OR5H14,NS,carcinoma,0,1	OR5H14	56	1	1	Substitution - Missense(1)	prostate(1)	c.A778G						scavenged	.						56.0	52.0	53.0					3																	97869007		2203	4299	6502	SO:0001583	missense	403273	exon1			ATGTATATGGGCT		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.778A>G	3.37:g.97869007A>G	ENSP00000401706:p.Met260Val	Somatic	254	2	0.00787402		WXS	Illumina HiSeq	Phase_I	256	7	0.0273438	NM_001005514	B9EH15	Missense_Mutation	SNP	ENST00000437310.1	37	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.909460	0.00003	.	.	ENSG00000236032	ENST00000437310	T	0.35048	1.33	2.49	1.59	0.23543	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42294	N	0.000735	T	0.09905	0.0243	N	0.01242	-0.935	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22871	-1.0204	10	0.20519	T	0.43	.	3.293	0.06956	0.2754:0.2221:0.5025:0.0	.	260	A6NHG9	O5H14_HUMAN	V	260	ENSP00000401706:M260V	ENSP00000401706:M260V	M	+	1	0	OR5H14	99351697	0.000000	0.05858	0.855000	0.33649	0.006000	0.05464	-1.435000	0.02423	-0.017000	0.14103	-3.163000	0.00057	ATG	.	.	none		0.433	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
PPP1R12C	54776	hgsc.bcm.edu	37	19	55628609	55628609	+	Silent	SNP	A	A	G	rs66707428	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr19:55628609A>G	ENST00000263433.3	-	1	318	c.303T>C	c.(301-303)ggT>ggC	p.G101G	PPP1R12C_ENST00000376393.2_Silent_p.G101G	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GGGCGCTGATACCGTCGGCGT	0.781													N|||	1009	0.201478	0.2806	0.0965	5008	,	,		7556	0.2738		0.1093	False		,,,				2504	0.1892				p.G101G		Atlas-SNP	.											.	PPP1R12C	46	.	0			c.T303C						PASS	.						1.0	2.0	1.0					19																	55628609		1184	2666	3850	SO:0001819	synonymous_variant	54776	exon1			GCTGATACCGTCG	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.303T>C	19.37:g.55628609A>G		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	8	4	0.5	NM_017607		Silent	SNP	ENST00000263433.3	37	CCDS12916.1																																																																																			A|0.808;G|0.192	0.192	strong		0.781	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607	
KRTAP4-12	83755	hgsc.bcm.edu	37	17	39280162	39280162	+	Silent	SNP	A	A	G	rs28515113	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:39280162A>G	ENST00000394014.1	-	1	257	c.213T>C	c.(211-213)tgT>tgC	p.C71C		NM_031854.2	NP_114060.1	Q9BQ66	KR412_HUMAN	keratin associated protein 4-12	71	31 X 5 AA repeats of C-C-[GRQVIL]-[SPTR]- [VSTQPC].					keratin filament (GO:0045095)		p.C71C(3)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGGTGGTCCTACAGCAGGTGG	0.677													A|||	863	0.172324	0.4357	0.1138	5008	,	,		14227	0.1389		0.0477	False		,,,				2504	0.0204				p.C71C		Atlas-SNP	.											KRTAP4-12,colon,carcinoma,0,3	KRTAP4-12	32	3	3	Substitution - coding silent(3)	large_intestine(3)	c.T213C						scavenged	.	A		192,3702		9,174,1764	31.0	55.0	47.0		213	-2.0	0.0	17	dbSNP_125	47	5,8543		0,5,4269	no	coding-synonymous	KRTAP4-12	NM_031854.2		9,179,6033	GG,GA,AA		0.0585,4.9307,1.5833		71/202	39280162	197,12245	1947	4274	6221	SO:0001819	synonymous_variant	83755	exon1			GGTCCTACAGCAG	AJ406943	CCDS32649.1	17q21.2	2013-06-25			ENSG00000213416	ENSG00000213416		"""Keratin associated proteins"""	16776	protein-coding gene	gene with protein product						11279113	Standard	NM_031854		Approved	KAP4.12	uc002hwa.3	Q9BQ66	OTTHUMG00000133632	ENST00000394014.1:c.213T>C	17.37:g.39280162A>G		Somatic	62	1	0.016129		WXS	Illumina HiSeq	Phase_I	71	7	0.0985916	NM_031854	A3KMC5|Q495I0	Silent	SNP	ENST00000394014.1	37	CCDS32649.1																																																																																			A|0.891;G|0.109	0.109	strong		0.677	KRTAP4-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257777.1		
TBX5	6910	hgsc.bcm.edu	37	12	114836488	114836488	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:114836488G>A	ENST00000310346.4	-	5	1066	c.400C>T	c.(400-402)Cgc>Tgc	p.R134C	TBX5_ENST00000526441.1_Missense_Mutation_p.R134C|TBX5_ENST00000552726.1_5'UTR|TBX5_ENST00000405440.2_Missense_Mutation_p.R134C|TBX5_ENST00000349716.5_Missense_Mutation_p.R84C	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	134					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		ACGTACAGGCGGCCAGGCATG	0.622																																					p.R134C	NSCLC(152;1358 1980 4050 23898 40356)	Atlas-SNP	.											.	TBX5	188	.	0			c.C400T						PASS	.						48.0	41.0	43.0					12																	114836488		2203	4300	6503	SO:0001583	missense	6910	exon5			ACAGGCGGCCAGG	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.400C>T	12.37:g.114836488G>A	ENSP00000309913:p.Arg134Cys	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	118	51	0.432203	NM_000192	A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	ENST00000310346.4	37	CCDS9173.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.275640	0.59649	.	.	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440;ENST00000526441	D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72	4.56	3.66	0.41972	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.93864	0.8037	M	0.73430	2.235	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.973;1.0	D	0.92576	0.6070	10	0.38643	T	0.18	.	10.5224	0.44927	0.0:0.1237:0.6601:0.2162	.	134;134	Q99593-2;Q99593	.;TBX5_HUMAN	C	84;134;31;134;134	ENSP00000337723:R84C;ENSP00000309913:R134C;ENSP00000384152:R134C;ENSP00000433292:R134C	ENSP00000309913:R134C	R	-	1	0	TBX5	113320871	0.990000	0.36364	0.980000	0.43619	0.586000	0.36452	2.065000	0.41442	1.231000	0.43661	0.655000	0.94253	CGC	.	.	none		0.622	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	NM_080717	
CCDC185	164127	hgsc.bcm.edu	37	1	223567173	223567173	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:223567173C>T	ENST00000366875.3	+	1	459	c.356C>T	c.(355-357)cCg>cTg	p.P119L		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		119	Pro-rich.									breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		AAGCCCCGCCCGGCTTGGCAG	0.726																																					p.P119L		Atlas-SNP	.											.	C1orf65	71	.	0			c.C356T						PASS	.						4.0	6.0	6.0					1																	223567173		1859	3868	5727	SO:0001583	missense	164127	exon1			CCCGCCCGGCTTG																												ENST00000366875.3:c.356C>T	1.37:g.223567173C>T	ENSP00000355840:p.Pro119Leu	Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	30	6	0.2	NM_152610	Q8N746|Q8NA93	Missense_Mutation	SNP	ENST00000366875.3	37	CCDS1537.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.382072	0.24944	.	.	ENSG00000178395	ENST00000366875	T	0.17854	2.25	4.48	-4.17	0.03857	.	.	.	.	.	T	0.07728	0.0194	N	0.24115	0.695	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.36065	-0.9763	9	0.33141	T	0.24	.	0.34	0.00332	0.279:0.29:0.1491:0.2819	.	119	Q8N715	CA065_HUMAN	L	119	ENSP00000355840:P119L	ENSP00000355840:P119L	P	+	2	0	C1orf65	221633796	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.205000	0.01232	-0.870000	0.04047	-0.230000	0.12252	CCG	.	.	none		0.726	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092718.1		
CCDC150	284992	hgsc.bcm.edu	37	2	197531530	197531530	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:197531530G>A	ENST00000389175.4	+	7	985	c.850G>A	c.(850-852)Gaa>Aaa	p.E284K	CCDC150_ENST00000472405.2_Intron|CCDC150_ENST00000423093.2_Intron|CCDC150_ENST00000272831.7_Intron	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	284										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						AAAAAAAAAAGAAGAGTTGGA	0.373																																					p.E284K		Atlas-SNP	.											CCDC150,NS,carcinoma,0,1	CCDC150	96	1	0			c.G850A						scavenged	.						47.0	46.0	46.0					2																	197531530		1808	4075	5883	SO:0001583	missense	284992	exon7			AAAAAAGAAGAGT		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.850G>A	2.37:g.197531530G>A	ENSP00000373827:p.Glu284Lys	Somatic	346	9	0.0260116		WXS	Illumina HiSeq	Phase_I	440	15	0.0340909	NM_001080539	Q6P5U6|Q6P663|Q8N8V5	Missense_Mutation	SNP	ENST00000389175.4	37	CCDS46478.1	.	.	.	.	.	.	.	.	.	.	G	3.295	-0.144035	0.06627	.	.	ENSG00000144395	ENST00000389175	T	0.30448	1.53	5.32	1.43	0.22495	.	1.910860	0.02255	N	0.066994	T	0.15998	0.0385	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.22034	-1.0228	10	0.06099	T	0.92	0.4604	8.7566	0.34650	0.3193:0.0:0.6807:0.0	.	284	Q8NCX0	CC150_HUMAN	K	284	ENSP00000373827:E284K	ENSP00000373827:E284K	E	+	1	0	CCDC150	197239775	0.052000	0.20516	0.000000	0.03702	0.897000	0.52465	1.422000	0.34826	0.371000	0.24564	0.655000	0.94253	GAA	.	.	none		0.373	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335377.2	NM_001080539	
NT5C	30833	hgsc.bcm.edu	37	17	73127683	73127683	+	Silent	SNP	T	T	C	rs4788867	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:73127683T>C	ENST00000245552.2	-	1	207	c.120A>G	c.(118-120)caA>caG	p.Q40Q	NT5C_ENST00000582160.1_5'Flank|NT5C_ENST00000582170.1_Silent_p.Q40Q|NT5C_ENST00000579082.1_5'UTR|NT5C_ENST00000578337.1_5'Flank	NM_014595.2	NP_055410.1	Q8TCD5	NT5C_HUMAN	5', 3'-nucleotidase, cytosolic	40					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|pyrimidine nucleotide binding (GO:0019103)					all_lung(278;0.14)|Lung NSC(278;0.168)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Lamivudine(DB00709)	AGCCGCGGCGTTGCTCCAGCG	0.766													C|||	2491	0.497404	0.4372	0.5115	5008	,	,		10373	0.2817		0.66	False		,,,				2504	0.6237				p.Q40Q		Atlas-SNP	.											.	NT5C	3	.	0			c.A120G						PASS	.						1.0	1.0	1.0					17																	73127683		1084	2247	3331	SO:0001819	synonymous_variant	30833	exon1			GCGGCGTTGCTCC	AF154829	CCDS11715.1	17q25	2011-03-29	2002-05-23		ENSG00000125458	ENSG00000125458	3.1.3.5		17144	protein-coding gene	gene with protein product		191720	"""5' nucleotidase, deoxy (pyrimidine), cytosolic type C"", ""uridine 5-prime monophosphate hydrolase 2"""	UMPH2		10899995	Standard	NM_014595		Approved	DNT1, DNT-1, PN-I, cdN, dNT-1	uc002jmx.3	Q8TCD5		ENST00000245552.2:c.120A>G	17.37:g.73127683T>C		Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	8	7	0.875	NM_001252377	Q96HS6|Q9NP82	Silent	SNP	ENST00000245552.2	37	CCDS11715.1																																																																																			T|0.501;C|0.499	0.499	strong		0.766	NT5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445853.1		
MSANTD3	91283	hgsc.bcm.edu	37	9	103204249	103204249	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr9:103204249C>T	ENST00000395067.2	+	2	300	c.29C>T	c.(28-30)gCc>gTc	p.A10V	MSANTD3-TMEFF1_ENST00000502978.1_5'Flank|MSANTD3_ENST00000374885.1_Missense_Mutation_p.A10V|TMEFF1_ENST00000334943.6_5'Flank	NM_001198805.1|NM_001198806.1|NM_080655.2	NP_001185734.1|NP_001185735.1|NP_542386.1	Q96H12	MSD3_HUMAN	Myb/SANT-like DNA-binding domain containing 3	10										endometrium(2)|lung(2)	4						ATAAAGCCTGCCAAATACTTC	0.393																																					p.A10V		Atlas-SNP	.											.	MSANTD3	10	.	0			c.C29T						PASS	.						59.0	56.0	57.0					9																	103204249		2203	4300	6503	SO:0001583	missense	91283	exon2			AGCCTGCCAAATA	BC008993	CCDS6749.1, CCDS56579.1	9q31.1	2012-03-13	2012-03-13	2012-03-13	ENSG00000066697	ENSG00000066697			23370	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 30"""	C9orf30			Standard	NM_080655		Approved	MGC17337		Q96H12	OTTHUMG00000020365	ENST00000395067.2:c.29C>T	9.37:g.103204249C>T	ENSP00000378506:p.Ala10Val	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	69	18	0.26087	NM_001198805	B2RC35|Q5T726|Q5T727|Q5T728	Missense_Mutation	SNP	ENST00000395067.2	37	CCDS6749.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.798673	0.90538	.	.	ENSG00000066697	ENST00000395067;ENST00000398977;ENST00000374885;ENST00000374886	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	T	0.74612	0.3739	L	0.43923	1.385	0.47905	D	0.999541	D	0.65815	0.995	D	0.76071	0.987	T	0.73895	-0.3838	8	0.54805	T	0.06	-10.9805	19.1261	0.93384	0.0:1.0:0.0:0.0	.	10	Q96H12	CI030_HUMAN	V	10	.	ENSP00000364020:A10V	A	+	2	0	C9orf30	102244070	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.267000	0.65530	2.779000	0.95612	0.655000	0.94253	GCC	.	.	none		0.393	MSANTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053410.1	NM_080655	
NEGR1	257194	hgsc.bcm.edu	37	1	72400774	72400774	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:72400774G>T	ENST00000357731.5	-	2	636	c.397C>A	c.(397-399)Cta>Ata	p.L133I	NEGR1_ENST00000467479.1_5'UTR|NEGR1_ENST00000306821.3_Missense_Mutation_p.L5I|NEGR1_ENST00000434200.1_Missense_Mutation_p.L131I	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	133	Ig-like C2-type 1.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		TGCACAGTTAGATGCACCTGC	0.388																																					p.L133I		Atlas-SNP	.											.	NEGR1	60	.	0			c.C397A						PASS	.						100.0	90.0	94.0					1																	72400774		2203	4300	6503	SO:0001583	missense	257194	exon2			CAGTTAGATGCAC	AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.397C>A	1.37:g.72400774G>T	ENSP00000350364:p.Leu133Ile	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	167	33	0.197605	NM_173808	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	ENST00000357731.5	37	CCDS661.1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.418704	0.62622	.	.	ENSG00000172260	ENST00000357731;ENST00000306821;ENST00000434200	T;T;T	0.57436	0.4;1.15;0.4	5.71	3.71	0.42584	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.59432	0.2193	M	0.73753	2.245	0.52099	D	0.999944	D;D	0.69078	0.995;0.997	D;D	0.67382	0.951;0.951	T	0.64462	-0.6402	10	0.59425	D	0.04	-6.5201	10.2474	0.43350	0.2176:0.0:0.7824:0.0	.	131;133	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	I	133;5;131	ENSP00000350364:L133I;ENSP00000305938:L5I;ENSP00000413294:L131I	ENSP00000305938:L5I	L	-	1	2	NEGR1	72173362	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	1.024000	0.30077	1.349000	0.45751	0.655000	0.94253	CTA	.	.	none		0.388	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026722.4	NM_173808	
DUOX1	53905	hgsc.bcm.edu	37	15	45427482	45427482	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr15:45427482G>A	ENST00000321429.4	+	6	895	c.488G>A	c.(487-489)cGg>cAg	p.R163Q	DUOX1_ENST00000389037.3_Missense_Mutation_p.R163Q	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	163	Peroxidase-like; mediates peroxidase activity.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		AGCAATCCCCGGGACCCGGTG	0.736																																					p.R163Q		Atlas-SNP	.											.	DUOX1	125	.	0			c.G488A						PASS	.						8.0	10.0	9.0					15																	45427482		2133	4212	6345	SO:0001583	missense	53905	exon6			ATCCCCGGGACCC	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.488G>A	15.37:g.45427482G>A	ENSP00000317997:p.Arg163Gln	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	77	16	0.207792	NM_017434	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	ENST00000321429.4	37	CCDS32221.1	.	.	.	.	.	.	.	.	.	.	.	29.0	4.966816	0.92855	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	T;T	0.72394	-0.65;-0.65	3.55	3.55	0.40652	.	0.000000	0.85682	D	0.000000	D	0.87684	0.6239	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91007	0.4847	10	0.87932	D	0	-29.494	13.0686	0.59048	0.0:0.0:1.0:0.0	.	163	Q9NRD9	DUOX1_HUMAN	Q	163	ENSP00000317997:R163Q;ENSP00000373689:R163Q	ENSP00000317997:R163Q	R	+	2	0	DUOX1	43214774	1.000000	0.71417	0.994000	0.49952	0.739000	0.42172	4.852000	0.62904	1.976000	0.57569	0.454000	0.30748	CGG	.	.	none		0.736	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
ISLR	3671	hgsc.bcm.edu	37	15	74468257	74468257	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr15:74468257A>G	ENST00000249842.3	+	2	1415	c.1058A>G	c.(1057-1059)gAc>gGc	p.D353G	ISLR_ENST00000395118.1_Missense_Mutation_p.D353G|RP11-665J16.1_ENST00000561647.1_RNA	NM_005545.3	NP_005536.1	O14498	ISLR_HUMAN	immunoglobulin superfamily containing leucine-rich repeat	353					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	20						GGTGGTGAGGACACACTGGGG	0.627																																					p.D353G		Atlas-SNP	.											.	ISLR	49	.	0			c.A1058G						PASS	.						92.0	75.0	81.0					15																	74468257		2198	4297	6495	SO:0001583	missense	3671	exon2			GTGAGGACACACT	AB003184	CCDS10260.1	15q23-q24	2013-01-11			ENSG00000129009	ENSG00000129009		"""Immunoglobulin superfamily / I-set domain containing"""	6133	protein-coding gene	gene with protein product		602059				9325048	Standard	NM_005545		Approved	HsT17563	uc002axh.1	O14498	OTTHUMG00000137623	ENST00000249842.3:c.1058A>G	15.37:g.74468257A>G	ENSP00000249842:p.Asp353Gly	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	53	11	0.207547	NM_201526		Missense_Mutation	SNP	ENST00000249842.3	37	CCDS10260.1	.	.	.	.	.	.	.	.	.	.	A	6.017	0.371486	0.11409	.	.	ENSG00000129009	ENST00000249842;ENST00000395118	T;T	0.64260	-0.09;-0.09	4.54	4.54	0.55810	.	0.000000	0.44902	U	0.000416	T	0.39784	0.1091	N	0.08118	0	0.34788	D	0.735477	B	0.30793	0.295	B	0.27608	0.081	T	0.50693	-0.8798	10	0.21014	T	0.42	.	13.8818	0.63686	1.0:0.0:0.0:0.0	.	353	O14498	ISLR_HUMAN	G	353	ENSP00000249842:D353G;ENSP00000378550:D353G	ENSP00000249842:D353G	D	+	2	0	ISLR	72255310	0.998000	0.40836	0.339000	0.25562	0.004000	0.04260	4.428000	0.59894	1.687000	0.51057	0.402000	0.26972	GAC	.	.	none		0.627	ISLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269044.1	NM_005545	
NCOR1	9611	hgsc.bcm.edu	37	17	16097825	16097825	+	Missense_Mutation	SNP	T	T	G	rs73281920	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:16097825T>G	ENST00000268712.3	-	2	316	c.59A>C	c.(58-60)tAt>tCt	p.Y20S	NCOR1_ENST00000395851.1_Missense_Mutation_p.Y20S|NCOR1_ENST00000395848.1_Missense_Mutation_p.Y20S|RN7SL442P_ENST00000473804.2_RNA	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	20	Interaction with ZBTB33 and HEXIM1.			Y -> S (in Ref. 2; AAO32942). {ECO:0000305}.	CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.Y20F(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GTGAGGAGGATAACGACTTTG	0.428																																					p.Y20S		Atlas-SNP	.											NCOR1,NS,carcinoma,0,1	NCOR1	240	1	1	Substitution - Missense(1)	lung(1)	c.A59C						scavenged	.						215.0	146.0	169.0					17																	16097825		2203	4300	6503	SO:0001583	missense	9611	exon1			GGAGGATAACGAC	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.59A>C	17.37:g.16097825T>G	ENSP00000268712:p.Tyr20Ser	Somatic	43	1	0.0232558		WXS	Illumina HiSeq	Phase_I	75	7	0.0933333	NM_001190438	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	37	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	T	12.33	1.906660	0.33628	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510;ENST00000436828;ENST00000430577	T;T;T	0.60548	0.21;0.79;0.18	5.24	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.72220	0.3433	M	0.69823	2.125	0.80722	D	1	D;D;D;D;P;D;P	0.89917	1.0;1.0;1.0;1.0;0.745;0.992;0.739	D;D;D;D;B;D;P	0.91635	0.999;0.999;0.997;0.999;0.265;0.988;0.453	T	0.73285	-0.4031	10	0.87932	D	0	.	9.9889	0.41858	0.0:0.08:0.0:0.92	.	20;20;20;20;20;20;20	E7EU93;E7EV02;Q3B773;E7EW50;E9PGV6;O75376;O75376-2	.;.;.;.;.;NCOR1_HUMAN;.	S	20	ENSP00000268712:Y20S;ENSP00000379192:Y20S;ENSP00000379189:Y20S	ENSP00000268712:Y20S	Y	-	2	0	NCOR1	16038550	1.000000	0.71417	0.570000	0.28473	0.981000	0.71138	5.149000	0.64863	0.829000	0.34733	0.455000	0.32223	TAT	T|0.921;G|0.079	0.079	strong		0.428	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
USP9X	8239	hgsc.bcm.edu	37	X	41056722	41056722	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chrX:41056722T>A	ENST00000324545.8	+	29	4972	c.4339T>A	c.(4339-4341)Ttt>Att	p.F1447I	USP9X_ENST00000378308.2_Missense_Mutation_p.F1447I	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	1447					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						TGAGAAAAAATTTCATATTGG	0.363																																					p.F1447I	Ovarian(172;1807 2695 35459 49286)	Atlas-SNP	.											.	USP9X	385	.	0			c.T4339A						PASS	.						72.0	71.0	72.0					X																	41056722		2050	4201	6251	SO:0001583	missense	8239	exon29			AAAAAATTTCATA	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.4339T>A	X.37:g.41056722T>A	ENSP00000316357:p.Phe1447Ile	Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	157	71	0.452229	NM_001039591	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	ENST00000324545.8	37	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	T	16.70	3.194592	0.58017	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.02787	4.16;4.16	5.3	5.3	0.74995	.	0.105859	0.64402	D	0.000002	T	0.02494	0.0076	N	0.14661	0.345	0.40695	D	0.982439	B;B	0.16166	0.016;0.002	B;B	0.20384	0.029;0.008	T	0.57136	-0.7863	10	0.21540	T	0.41	.	14.4424	0.67327	0.0:0.0:0.0:1.0	.	1447;1447	Q93008-1;Q93008	.;USP9X_HUMAN	I	1447	ENSP00000367558:F1447I;ENSP00000316357:F1447I	ENSP00000316357:F1447I	F	+	1	0	USP9X	40941666	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.694000	0.84235	1.859000	0.53934	0.339000	0.21740	TTT	.	.	none		0.363	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		Atlas-SNP	.											.	CCDC102A	22	.	0			c.C286T						PASS	.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	6	6	1	NM_033212	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999	0.999	strong		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
KCNJ12	3768	hgsc.bcm.edu	37	17	21319439	21319439	+	Missense_Mutation	SNP	T	T	G	rs76684759	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:21319439T>G	ENST00000583088.1	+	3	1680	c.785T>G	c.(784-786)aTc>aGc	p.I262S	KCNJ12_ENST00000331718.5_Missense_Mutation_p.I262S	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	262				RI -> HS (in Ref. 2; AAC50615). {ECO:0000305}.	muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.I262S(1)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CTGGACCGCATCTTTCTGGTG	0.622										Prostate(3;0.18)																											p.I262S		Atlas-SNP	.											KCNJ12,NS,carcinoma,0,1	.	.	1	1	Substitution - Missense(1)	lung(1)	c.T785G						scavenged	.						126.0	94.0	105.0					17																	21319439		2203	4300	6503	SO:0001583	missense	100134444	exon3			ACCGCATCTTTCT	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.785T>G	17.37:g.21319439T>G	ENSP00000463778:p.Ile262Ser	Somatic	106	20	0.188679		WXS	Illumina HiSeq	Phase_I	115	18	0.156522	NM_001194958	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.198903	0.79015	.	.	ENSG00000184185	ENST00000331718	D	0.94758	-3.51	5.43	5.43	0.79202	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.97532	0.9192	M	0.88031	2.925	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.98350	1.0543	10	0.72032	D	0.01	.	15.4739	0.75461	0.0:0.0:0.0:1.0	.	262	Q14500	IRK12_HUMAN	S	262	ENSP00000328150:I262S	ENSP00000328150:I262S	I	+	2	0	KCNJ12	21260032	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.898000	0.87363	2.065000	0.61736	0.533000	0.62120	ATC	T|0.500;G|0.500	0.500	strong		0.622	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
ANGPTL7	10218	hgsc.bcm.edu	37	1	11253778	11253778	+	Missense_Mutation	SNP	G	G	A	rs376924013		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:11253778G>A	ENST00000376819.3	+	3	858	c.619G>A	c.(619-621)Gaa>Aaa	p.E207K	ANGPTL7_ENST00000476934.1_3'UTR|MTOR_ENST00000361445.4_Intron	NM_021146.2	NP_066969.1	O43827	ANGL7_HUMAN	angiopoietin-like 7	207	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)				endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|stomach(1)	10	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.39e-06)|COAD - Colon adenocarcinoma(227;0.000244)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0487)		GCTGGGGAACGAACACATCCA	0.597																																					p.E207K		Atlas-SNP	.											.	ANGPTL7	23	.	0			c.G619A						PASS	.	G	,LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	84.0	76.0	79.0		,619	5.8	0.7	1		79	0,8600		0,0,4300	no	intron,missense	MTOR,ANGPTL7	NM_004958.3,NM_021146.2	,56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,benign	,207/347	11253778	1,13005	2203	4300	6503	SO:0001583	missense	10218	exon3			GGGAACGAACACA	Y16132	CCDS128.1	1p36	2013-02-06			ENSG00000171819	ENSG00000171819		"""Fibrinogen C domain containing"""	24078	protein-coding gene	gene with protein product						9727400, 11682471	Standard	NM_021146		Approved	CDT6, AngX	uc001ase.4	O43827	OTTHUMG00000002002	ENST00000376819.3:c.619G>A	1.37:g.11253778G>A	ENSP00000366015:p.Glu207Lys	Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	55	7	0.127273	NM_021146	B2R9B2|F1T0A6|Q4ZGK4	Missense_Mutation	SNP	ENST00000376819.3	37	CCDS128.1	.	.	.	.	.	.	.	.	.	.	G	32	5.130708	0.94473	2.27E-4	0.0	ENSG00000171819	ENST00000376819	D	0.84660	-1.88	5.81	5.81	0.92471	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.089808	0.85682	D	0.000000	D	0.86301	0.5900	M	0.77103	2.36	0.80722	D	1	P	0.46656	0.882	B	0.39465	0.3	D	0.87083	0.2167	10	0.46703	T	0.11	.	20.0833	0.97789	0.0:0.0:1.0:0.0	.	207	O43827	ANGL7_HUMAN	K	207	ENSP00000366015:E207K	ENSP00000366015:E207K	E	+	1	0	ANGPTL7	11176365	1.000000	0.71417	0.698000	0.30274	0.938000	0.57974	8.031000	0.88826	2.756000	0.94617	0.655000	0.94253	GAA	.	.	none		0.597	ANGPTL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005564.1	NM_021146	
OR5L1	219437	hgsc.bcm.edu	37	11	55579421	55579421	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:55579421T>C	ENST00000333973.2	+	1	568	c.479T>C	c.(478-480)tTg>tCg	p.L160S		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				CTGATTCATTTGTGCTTAGCT	0.443																																					p.L160S		Atlas-SNP	.											.	OR5L1	145	.	0			c.T479C						PASS	.						218.0	191.0	200.0					11																	55579421		2200	4296	6496	SO:0001583	missense	219437	exon1			TTCATTTGTGCTT	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.479T>C	11.37:g.55579421T>C	ENSP00000335529:p.Leu160Ser	Somatic	407	0	0		WXS	Illumina HiSeq	Phase_I	404	57	0.141089	NM_001004738	B2RNK6|Q6IFD0	Missense_Mutation	SNP	ENST00000333973.2	37	CCDS31509.1	.	.	.	.	.	.	.	.	.	.	t	9.888	1.203401	0.22121	.	.	ENSG00000186117	ENST00000333973	T	0.00130	8.69	4.18	-3.36	0.04913	GPCR, rhodopsin-like superfamily (1);	0.749235	0.11513	N	0.556535	T	0.00109	0.0003	N	0.13272	0.32	0.09310	N	1	B	0.25105	0.118	B	0.33392	0.163	T	0.10154	-1.0642	10	0.62326	D	0.03	-5.254	7.8224	0.29294	0.1535:0.6254:0.0:0.2211	.	160	Q8NGL2	OR5L1_HUMAN	S	160	ENSP00000335529:L160S	ENSP00000335529:L160S	L	+	2	0	OR5L1	55335997	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-0.162000	0.10012	-0.600000	0.05790	0.358000	0.22013	TTG	.	.	none		0.443	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738	
SLC45A2	51151	hgsc.bcm.edu	37	5	33964023	33964023	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr5:33964023A>C	ENST00000296589.4	-	3	807	c.661T>G	c.(661-663)Ttc>Gtc	p.F221V	SLC45A2_ENST00000382102.3_Missense_Mutation_p.F221V|SLC45A2_ENST00000345083.5_Intron|SLC45A2_ENST00000342059.3_Missense_Mutation_p.F162V|SLC45A2_ENST00000509381.1_Intron	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	221			Missing (in OCA4). {ECO:0000269|PubMed:14722913}.		developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						AATGCAGAGAAGAAGAACATG	0.498																																					p.F221V	Ovarian(31;380 859 8490 22203 49048)	Atlas-SNP	.											.	SLC45A2	100	.	0			c.T661G						PASS	.						112.0	109.0	110.0					5																	33964023		2203	4300	6503	SO:0001583	missense	51151	exon3			CAGAGAAGAAGAA	AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.661T>G	5.37:g.33964023A>C	ENSP00000296589:p.Phe221Val	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	125	23	0.184	NM_016180	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000296589.4	37	CCDS3901.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.579386	0.86645	.	.	ENSG00000164175	ENST00000296589;ENST00000342059;ENST00000382102;ENST00000510600	D;T;D;D	0.92495	-3.05;-1.29;-3.05;-3.05	5.93	5.93	0.95920	Major facilitator superfamily domain, general substrate transporter (1);	0.045176	0.85682	D	0.000000	D	0.94663	0.8279	M	0.75884	2.315	0.80722	D	1	P;B	0.50066	0.931;0.443	P;B	0.59115	0.852;0.326	D	0.93153	0.6551	10	0.22706	T	0.39	-18.1182	15.3582	0.74443	1.0:0.0:0.0:0.0	.	221;221	Q9UMX9-4;Q9UMX9	.;S45A2_HUMAN	V	221;162;221;46	ENSP00000296589:F221V;ENSP00000341014:F162V;ENSP00000371534:F221V;ENSP00000424010:F46V	ENSP00000296589:F221V	F	-	1	0	SLC45A2	33999780	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	4.984000	0.63838	2.270000	0.75569	0.460000	0.39030	TTC	.	.	none		0.498	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180	
TTC13	79573	hgsc.bcm.edu	37	1	231093993	231093993	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:231093993T>C	ENST00000366661.4	-	3	426	c.419A>G	c.(418-420)aAt>aGt	p.N140S	TTC13_ENST00000414259.1_Missense_Mutation_p.N140S|TTC13_ENST00000366662.4_Missense_Mutation_p.N140S	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13	140										central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		TGTGCTGTCATTATCAGTGGC	0.373																																					p.N140S		Atlas-SNP	.											.	TTC13	74	.	0			c.A419G						PASS	.						132.0	123.0	126.0					1																	231093993		2203	4300	6503	SO:0001583	missense	79573	exon3			CTGTCATTATCAG		CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.419A>G	1.37:g.231093993T>C	ENSP00000355621:p.Asn140Ser	Somatic	167	0	0		WXS	Illumina HiSeq	Phase_I	168	27	0.160714	NM_001122835	B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Missense_Mutation	SNP	ENST00000366661.4	37	CCDS1588.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.57|13.57	2.276579|2.276579	0.40294|0.40294	.|.	.|.	ENSG00000143643|ENSG00000143643	ENST00000522821|ENST00000366661;ENST00000366662;ENST00000414259	.|T;T;T	.|0.53206	.|0.85;0.65;0.63	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.29556|0.29556	0.0737|0.0737	N|N	0.19112|0.19112	0.55|0.55	0.49389|0.49389	D|D	0.99978|0.99978	.|P;P;P	.|0.46395	.|0.877;0.739;0.495	.|B;B;B	.|0.36464	.|0.192;0.225;0.084	T|T	0.12863|0.12863	-1.0531|-1.0531	5|10	.|0.11182	.|T	.|0.66	-0.015|-0.015	15.4063|15.4063	0.74881|0.74881	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|140;140;140	.|E9PGV4;Q8NBP0-2;Q8NBP0	.|.;.;TTC13_HUMAN	V|S	129|140	.|ENSP00000355621:N140S;ENSP00000355622:N140S;ENSP00000416631:N140S	.|ENSP00000355621:N140S	M|N	-|-	1|2	0|0	TTC13|TTC13	229160616|229160616	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	5.206000|5.206000	0.65192|0.65192	2.279000|2.279000	0.76181|0.76181	0.533000|0.533000	0.62120|0.62120	ATG|AAT	.	.	none		0.373	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092229.2	NM_024525	
U2AF1	7307	hgsc.bcm.edu	37	21	44513242	44513242	+	Silent	SNP	C	C	T	rs560573558	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr21:44513242C>T	ENST00000291552.4	-	8	785	c.693G>A	c.(691-693)tcG>tcA	p.S231S	U2AF1_ENST00000486519.1_5'Flank|U2AF1_ENST00000380276.2_Silent_p.S231S|U2AF1_ENST00000398137.1_Silent_p.S158S|U2AF1_ENST00000459639.1_Silent_p.S158S	NM_006758.2	NP_006749.1	Q01081	U2AF1_HUMAN	U2 small nuclear RNA auxiliary factor 1	231	Arg/Gly/Ser-rich (RS domain).				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(111)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	126						CACGATCTCTCGACCGCCTCC	0.577			Mis		"""CLL, MDS"""																																p.S231S		Atlas-SNP	.		Dom	yes		21	21q22.3	7307	U2 small nuclear RNA auxiliary factor 1		L	U2AF1_ENST00000380276,NS,neuroblastoma,-1,4	U2AF1	322	4	0			c.G693A						PASS	.						52.0	55.0	54.0					21																	44513242		2203	4300	6503	SO:0001819	synonymous_variant	7307	exon8			ATCTCTCGACCGC	BC001177	CCDS13694.1, CCDS33574.1, CCDS42948.1	21q22.3	2014-09-17	2006-04-11		ENSG00000160201	ENSG00000160201		"""RNA binding motif (RRM) containing"""	12453	protein-coding gene	gene with protein product		191317	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein"", ""U2(RNU2) small nuclear RNA auxiliary factor 1"""	U2AFBP		8660980, 7956352	Standard	NM_006758		Approved	U2AF35, RNU2AF1, RN	uc002zdb.1	Q01081	OTTHUMG00000086836	ENST00000291552.4:c.693G>A	21.37:g.44513242C>T		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	62	8	0.129032	NM_001025203	Q701P4|Q71RF1	Silent	SNP	ENST00000291552.4	37	CCDS13694.1																																																																																			.	.	none		0.577	U2AF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195541.1	NM_006758	
CELF3	11189	hgsc.bcm.edu	37	1	151678722	151678722	+	Silent	SNP	T	T	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:151678722T>C	ENST00000290583.4	-	10	1897	c.1104A>G	c.(1102-1104)caA>caG	p.Q368Q	RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000290585.4_Silent_p.Q318Q|CELF3_ENST00000470688.1_5'UTR|CELF3_ENST00000392706.3_Silent_p.Q163Q	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	368	Gln-rich.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						gctgctgctgttgctgctgct	0.657																																					p.Q368Q		Atlas-SNP	.											CELF3,caecum,carcinoma,0,1	CELF3	49	1	0			c.A1104G						scavenged	.						19.0	20.0	20.0					1																	151678722		2200	4297	6497	SO:0001819	synonymous_variant	11189	exon10			CTGCTGTTGCTGC	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.1104A>G	1.37:g.151678722T>C		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	89	3	0.0337079	NM_007185	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Silent	SNP	ENST00000290583.4	37	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	4.938	0.174339	0.09391	.	.	ENSG00000159409	ENST00000420342	.	.	.	3.25	1.39	0.22231	.	.	.	.	.	T	0.36496	0.0969	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19943	-1.0290	4	.	.	.	-0.0118	5.4728	0.16680	0.0:0.7409:0.0:0.2591	.	.	.	.	S	369	.	.	N	-	2	0	CELF3	149945346	0.076000	0.21285	1.000000	0.80357	0.644000	0.38419	-0.812000	0.04496	0.416000	0.25844	-0.389000	0.06534	AAC	.	.	none		0.657	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185	
BTG1	694	hgsc.bcm.edu	37	12	92537899	92537899	+	Missense_Mutation	SNP	G	G	A	rs544927217		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:92537899G>A	ENST00000256015.3	-	2	834	c.473C>T	c.(472-474)aCg>aTg	p.T158M	C12orf79_ENST00000551563.2_5'Flank|C12orf79_ENST00000551843.1_5'Flank|C12orf79_ENST00000549802.1_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|C12orf79_ENST00000546975.1_5'Flank|RP11-796E2.4_ENST00000499685.2_RNA	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	158					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)			haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				GGAAGGGCTCGTTCTGCCCAA	0.428			T	MYC	BCLL						OREG0022024	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T158M		Atlas-SNP	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	.	BTG1	30	.	0			c.C473T						PASS	.						94.0	81.0	85.0					12																	92537899		2203	4300	6503	SO:0001583	missense	694	exon2			GGGCTCGTTCTGC		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.473C>T	12.37:g.92537899G>A	ENSP00000256015:p.Thr158Met	Somatic	92	0	0	1291	WXS	Illumina HiSeq	Phase_I	146	18	0.123288	NM_001731	P31607	Missense_Mutation	SNP	ENST00000256015.3	37	CCDS9043.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.671909	0.67928	.	.	ENSG00000133639	ENST00000256015;ENST00000552315	T;T	0.36878	1.81;1.23	5.27	5.27	0.74061	Anti-proliferative protein (1);	0.000000	0.85682	D	0.000000	T	0.49712	0.1573	L	0.46157	1.445	0.80722	D	1	D	0.76494	0.999	P	0.56216	0.794	T	0.50233	-0.8852	10	0.87932	D	0	-3.6362	19.0956	0.93249	0.0:0.0:1.0:0.0	.	158	P62324	BTG1_HUMAN	M	158;83	ENSP00000256015:T158M;ENSP00000447551:T83M	ENSP00000256015:T158M	T	-	2	0	BTG1	91062030	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.601000	0.82783	2.733000	0.93635	0.650000	0.86243	ACG	.	.	none		0.428	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
UGT1A9	54600	hgsc.bcm.edu	37	2	234580967	234580967	+	Silent	SNP	A	A	G	rs28946876	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:234580967A>G	ENST00000354728.4	+	1	469	c.387A>G	c.(385-387)aaA>aaG	p.K129K	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Silent_p.K129K			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	129					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	GTTTGTTTAAAGACAAAAAAT	0.313																																					p.K129K		Atlas-SNP	.											UGT1A9,colon,carcinoma,0,1	UGT1A9	79	1	0			c.A387G						scavenged	.						99.0	101.0	101.0					2																	234580967		2203	4300	6503	SO:0001819	synonymous_variant	54600	exon1			GTTTAAAGACAAA	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.387A>G	2.37:g.234580967A>G		Somatic	145	3	0.0206897		WXS	Illumina HiSeq	Phase_I	162	9	0.0555556	NM_021027	B8K285|P36509|Q9HAX0	Silent	SNP	ENST00000354728.4	37	CCDS2505.1																																																																																			.	.	alt		0.313	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027	
RGL3	57139	hgsc.bcm.edu	37	19	11508197	11508197	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr19:11508197G>A	ENST00000380456.3	-	17	1886	c.1823C>T	c.(1822-1824)gCg>gTg	p.A608V	RGL3_ENST00000568628.1_5'UTR|RGL3_ENST00000393423.3_Missense_Mutation_p.A614V	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	608					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						GCTCTGCTGCGCCGGGAGGGG	0.677																																					p.A614V	GBM(174;751 2067 17998 27979 33959)	Atlas-SNP	.											RGL3_ENST00000380456,NS,carcinoma,0,2	RGL3	100	2	0			c.C1841T						PASS	.						17.0	19.0	19.0					19																	11508197		2199	4287	6486	SO:0001583	missense	57139	exon17			TGCTGCGCCGGGA	BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.1823C>T	19.37:g.11508197G>A	ENSP00000369823:p.Ala608Val	Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	71	25	0.352113	NM_001161616	B5ME84|B7ZL22|Q0P6G0	Missense_Mutation	SNP	ENST00000380456.3	37	CCDS32910.1	.	.	.	.	.	.	.	.	.	.	G	8.583	0.882799	0.17467	.	.	ENSG00000205517	ENST00000342684;ENST00000393423;ENST00000380456	T;T	0.44083	0.93;0.93	4.48	1.04	0.20106	.	0.474496	0.23534	N	0.047147	T	0.17874	0.0429	N	0.14661	0.345	0.09310	N	0.999998	B;B;B;P	0.52692	0.037;0.037;0.021;0.955	B;B;B;B	0.35655	0.007;0.007;0.004;0.207	T	0.19484	-1.0304	10	0.59425	D	0.04	.	4.9404	0.13963	0.0:0.4382:0.3657:0.1961	.	608;614;614;405	Q3MIN7;B5ME84;B7ZL22;Q8TEP0	RGL3_HUMAN;.;.;.	V	405;614;608	ENSP00000377075:A614V;ENSP00000369823:A608V	ENSP00000344665:A405V	A	-	2	0	RGL3	11369197	0.572000	0.26668	0.198000	0.23420	0.011000	0.07611	1.182000	0.32029	0.214000	0.20742	-0.321000	0.08615	GCG	.	.	none		0.677	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421208.3	XM_290867	
PABPC3	5042	hgsc.bcm.edu	37	13	25671795	25671795	+	Missense_Mutation	SNP	C	C	T	rs113416318	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr13:25671795C>T	ENST00000281589.3	+	1	1496	c.1459C>T	c.(1459-1461)Cgt>Tgt	p.R487C		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	487					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AGTGGGTCCACGTCctgcagc	0.522													c|||	175	0.0349441	0.0537	0.0403	5008	,	,		21647	0.0119		0.0159	False		,,,				2504	0.0491				p.R487C		Atlas-SNP	.											PABPC3,rectum,carcinoma,0,1	PABPC3	129	1	0			c.C1459T						scavenged	.																																			SO:0001583	missense	5042	exon1			GGTCCACGTCCTG	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1459C>T	13.37:g.25671795C>T	ENSP00000281589:p.Arg487Cys	Somatic	73	2	0.0273973		WXS	Illumina HiSeq	Phase_I	82	5	0.0609756	NM_030979	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.862076	0.51482	.	.	ENSG00000151846	ENST00000281589	T	0.31247	1.5	0.875	0.875	0.19130	.	0.135300	0.32190	U	0.006459	T	0.29556	0.0737	L	0.59436	1.845	0.58432	D	0.999997	D	0.58970	0.984	P	0.45660	0.489	T	0.12630	-1.0540	10	0.72032	D	0.01	.	7.5489	0.27783	0.0:1.0:0.0:0.0	.	487	Q9H361	PABP3_HUMAN	C	487	ENSP00000281589:R487C	ENSP00000281589:R487C	R	+	1	0	PABPC3	24569795	1.000000	0.71417	0.944000	0.38274	0.640000	0.38277	4.773000	0.62331	0.759000	0.33084	0.313000	0.20887	CGT	C|0.988;T|0.012	0.012	strong		0.522	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
UBN1	29855	hgsc.bcm.edu	37	16	4910954	4910954	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr16:4910954A>G	ENST00000396658.4	+	6	1664	c.961A>G	c.(961-963)Agt>Ggt	p.S321G	UBN1_ENST00000262376.6_Missense_Mutation_p.S321G|UBN1_ENST00000585857.1_3'UTR|UBN1_ENST00000590769.1_Missense_Mutation_p.S321G|UBN1_ENST00000545171.1_Missense_Mutation_p.S321G	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	321					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						GCATCTGCTCAGTGAGTCTCC	0.552																																					p.S321G		Atlas-SNP	.											.	UBN1	88	.	0			c.A961G						PASS	.						110.0	99.0	102.0					16																	4910954		2197	4300	6497	SO:0001583	missense	29855	exon7			CTGCTCAGTGAGT	AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.961A>G	16.37:g.4910954A>G	ENSP00000379894:p.Ser321Gly	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	100	53	0.53	NM_001079514	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	ENST00000396658.4	37	CCDS10525.1	.	.	.	.	.	.	.	.	.	.	A	11.90	1.775994	0.31411	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.46451	1.46;0.87;1.46	5.77	5.77	0.91146	.	0.199192	0.56097	D	0.000028	T	0.29945	0.0749	L	0.28274	0.84	0.32091	N	0.591818	B;B	0.22346	0.063;0.068	B;B	0.15484	0.013;0.009	T	0.31641	-0.9936	10	0.33141	T	0.24	-9.2052	12.0518	0.53511	0.871:0.0:0.0:0.129	.	321;321	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	G	321	ENSP00000262376:S321G;ENSP00000442379:S321G;ENSP00000379894:S321G	ENSP00000262376:S321G	S	+	1	0	UBN1	4850955	0.822000	0.29219	1.000000	0.80357	0.997000	0.91878	1.248000	0.32827	2.326000	0.78906	0.533000	0.62120	AGT	.	.	none		0.552	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1	NM_016936	
PIM1	5292	hgsc.bcm.edu	37	6	37138332	37138332	+	5'UTR	SNP	C	C	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:37138332C>G	ENST00000373509.5	+	0	354					NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase						apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CGTCCCTGCGCCGACATCCTG	0.697			T	BCL6	NHL																																p.A85G		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C254G						PASS	.						22.0	22.0	22.0					6																	37138332		2198	4297	6495	SO:0001623	5_prime_UTR_variant	5292	exon1			CCTGCGCCGACAT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.-20C>G	6.37:g.37138332C>G		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	52	19	0.365385	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.697	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
KRTAP10-4	386672	hgsc.bcm.edu	37	21	45994293	45994293	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr21:45994293A>G	ENST00000400374.3	+	1	688	c.658A>G	c.(658-660)Acc>Gcc	p.T220A	TSPEAR_ENST00000397916.1_5'Flank|TSPEAR_ENST00000323084.4_Intron	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	220	36 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						GGCTTGCTGCACCTCCTCCTC	0.647																																					p.T220A		Atlas-SNP	.											KRTAP10-4,NS,carcinoma,0,1	KRTAP10-4	44	1	0			c.A658G						scavenged	.						56.0	61.0	59.0					21																	45994293		2203	4298	6501	SO:0001583	missense	386672	exon1			TGCTGCACCTCCT	AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.658A>G	21.37:g.45994293A>G	ENSP00000383225:p.Thr220Ala	Somatic	140	8	0.0571429		WXS	Illumina HiSeq	Phase_I	145	11	0.0758621	NM_198687	Q08AS0	Missense_Mutation	SNP	ENST00000400374.3	37	CCDS42957.1	.	.	.	.	.	.	.	.	.	.	N	2.519	-0.311273	0.05422	.	.	ENSG00000215454	ENST00000400374	T	0.01323	5.01	3.66	-1.09	0.09904	.	.	.	.	.	T	0.01156	0.0038	L	0.52126	1.63	0.09310	N	1	B	0.29909	0.261	B	0.27262	0.078	T	0.46978	-0.9152	9	0.08381	T	0.77	.	0.4631	0.00519	0.3833:0.1645:0.1271:0.325	.	220	P60372	KR104_HUMAN	A	220	ENSP00000383225:T220A	ENSP00000383225:T220A	T	+	1	0	KRTAP10-4	44818721	0.000000	0.05858	0.160000	0.22671	0.945000	0.59286	-0.838000	0.04372	-0.024000	0.13941	0.352000	0.21897	ACC	.	.	none		0.647	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128045.1	NM_198687	
IGLL5	100423062	hgsc.bcm.edu	37	22	23235998	23235998	+	Splice_Site	SNP	G	G	A	rs201857114	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr22:23235998G>A	ENST00000526893.1	+	2	599	c.325G>A	c.(325-327)Ggt>Agt	p.G109S	IGLC1_ENST00000390321.2_RNA|IGLL5_ENST00000532223.2_Splice_Site_p.G110S|IGLJ1_ENST00000390320.2_RNA|IGLL5_ENST00000531372.1_Intron	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	109	J region (By similarity to lambda light- chain).					extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CACCGTCCTAGGTAAGTGGCT	0.592													G|||	4	0.000798722	0.0023	0.0	5008	,	,		12894	0.001		0.0	False		,,,				2504	0.0				p.G109S		Atlas-SNP	.											.	IGLL5	26	.	0			c.G325A						PASS	.	G	SER/GLY	0,4270		0,0,2135	88.0	100.0	96.0		325	2.4	1.0	22		96	1,8505		0,1,4252	yes	missense-near-splice	IGLL5	NM_001178126.1	56	0,1,6387	AA,AG,GG		0.0118,0.0,0.0078	benign	109/215	23235998	1,12775	2135	4253	6388	SO:0001630	splice_region_variant	100423062	exon2			GTCCTAGGTAAGT	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.325+1G>A	22.37:g.23235998G>A		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	74	20	0.27027	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.395359	0.25205	0.0	1.18E-4	ENSG00000254709	ENST00000532223;ENST00000526893	T;T	0.00570	6.51;6.51	3.51	2.43	0.29744	Immunoglobulin-like fold (1);	.	.	.	.	T	0.00580	0.0019	.	.	.	0.80722	D	1	B	0.25772	0.134	B	0.32624	0.149	T	0.67356	-0.5691	8	0.52906	T	0.07	.	8.0064	0.30327	0.0:0.0:0.7569:0.2431	.	109	B9A064	IGLL5_HUMAN	S	110;109	ENSP00000436353:G110S;ENSP00000431254:G109S	ENSP00000431254:G109S	G	+	1	0	IGLL5	21565998	0.993000	0.37304	0.977000	0.42913	0.289000	0.27227	2.340000	0.43974	0.781000	0.33589	0.491000	0.48974	GGT	.	.	weak		0.592	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	Missense_Mutation
ZNF8	7554	hgsc.bcm.edu	37	19	58805974	58805974	+	Missense_Mutation	SNP	A	A	G	rs202096304		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr19:58805974A>G	ENST00000196548.5	+	4	931	c.800A>G	c.(799-801)aAc>aGc	p.N267S	AC010642.1_ENST00000591325.1_3'UTR|ZNF8_ENST00000608843.1_Missense_Mutation_p.N267S			P17098	ZNF8_HUMAN	zinc finger protein 8	267					BMP signaling pathway (GO:0030509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.N267S(1)		autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	19		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		AAGTCGTTTAACCATAACGCA	0.488																																					p.N267S		Atlas-SNP	.											ZNF8,NS,carcinoma,0,1	ZNF8	60	1	1	Substitution - Missense(1)	lung(1)	c.A800G						scavenged	.	A	SER/ASN	0,4406		0,0,2203	89.0	83.0	85.0		800	4.3	1.0	19		85	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF8	NM_021089.2	46	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	267/576	58805974	1,13005	2203	4300	6503	SO:0001583	missense	7554	exon4			CGTTTAACCATAA	M29581	CCDS12974.1	19q13.43	2013-01-08	2006-05-09					"""Zinc fingers, C2H2-type"", ""-"""	13154	protein-coding gene	gene with protein product		194532	"""zinc finger protein 8 (clone HF.18)"""			2106481	Standard	NM_021089		Approved	HF.18, Zfp128	uc002qry.1	P17098		ENST00000196548.5:c.800A>G	19.37:g.58805974A>G	ENSP00000196548:p.Asn267Ser	Somatic	42	1	0.0238095		WXS	Illumina HiSeq	Phase_I	64	2	0.03125	NM_021089	Q6PI99	Missense_Mutation	SNP	ENST00000196548.5	37	CCDS12974.1	.	.	.	.	.	.	.	.	.	.	A	7.641	0.680842	0.14907	0.0	1.16E-4	ENSG00000083842	ENST00000196548	T	0.07216	3.21	4.26	4.26	0.50523	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.53938	D	0.000053	T	0.04272	0.0118	N	0.01197	-0.965	0.29136	N	0.879298	D	0.57257	0.979	P	0.54664	0.758	T	0.26608	-1.0098	10	0.02654	T	1	-29.5913	10.101	0.42504	1.0:0.0:0.0:0.0	.	267	P17098	ZNF8_HUMAN	S	267	ENSP00000196548:N267S	ENSP00000196548:N267S	N	+	2	0	ZNF8	63497786	0.000000	0.05858	1.000000	0.80357	0.983000	0.72400	-1.135000	0.03225	2.157000	0.67596	0.524000	0.50904	AAC	A|0.999;G|0.001	0.001	weak		0.488	ZNF8-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000459135.1	NM_021089	
TSC22D1	8848	hgsc.bcm.edu	37	13	45009000	45009000	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr13:45009000A>C	ENST00000458659.2	-	3	3474	c.2984T>G	c.(2983-2985)tTg>tGg	p.L995W	TSC22D1_ENST00000501704.2_Intron|RP11-71C5.2_ENST00000426579.2_RNA|TSC22D1_ENST00000261489.2_Missense_Mutation_p.L66W	NM_183422.3	NP_904358.2	Q15714	T22D1_HUMAN	TSC22 domain family, member 1	995					negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		CGCATACATCAAATGGCTTTT	0.378																																					p.L995W		Atlas-SNP	.											.	TSC22D1	88	.	0			c.T2984G						PASS	.						104.0	113.0	110.0					13																	45009000		2203	4300	6503	SO:0001583	missense	8848	exon3			TACATCAAATGGC	AJ222700	CCDS9392.1, CCDS31966.1, CCDS58291.1, CCDS73565.1	13q14	2008-02-05	2005-03-01	2005-03-03	ENSG00000102804	ENSG00000102804			16826	protein-coding gene	gene with protein product		607715	"""transforming growth factor beta 1 induced transcript 4"""	TGFB1I4		8651929, 9022669	Standard	NM_183422		Approved	TSC22, MGC17597	uc001uzn.4	Q15714	OTTHUMG00000016838	ENST00000458659.2:c.2984T>G	13.37:g.45009000A>C	ENSP00000397435:p.Leu995Trp	Somatic	202	0	0		WXS	Illumina HiSeq	Phase_I	187	57	0.304813	NM_183422	B3KRL7|B9EGI0|O00666|Q6AHX5|Q6IBU1|Q8NCN1|Q96JS5	Missense_Mutation	SNP	ENST00000458659.2	37	CCDS31966.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.977062	0.74360	.	.	ENSG00000102804	ENST00000458659;ENST00000261489	D	0.83075	-1.68	5.72	5.72	0.89469	.	0.569269	0.14836	N	0.295563	D	0.90783	0.7106	M	0.76938	2.355	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.71870	0.975;0.937	D	0.90788	0.4684	10	0.87932	D	0	.	14.02	0.64547	1.0:0.0:0.0:0.0	.	995;66	Q15714;Q15714-2	T22D1_HUMAN;.	W	995;66	ENSP00000397435:L995W	ENSP00000261489:L66W	L	-	2	0	TSC22D1	43907000	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.287000	0.95975	2.188000	0.69820	0.529000	0.55759	TTG	.	.	none		0.378	TSC22D1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044743.2	NM_006022	
RBM38	55544	hgsc.bcm.edu	37	20	55967801	55967801	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr20:55967801A>C	ENST00000356208.5	+	2	504	c.329A>C	c.(328-330)tAt>tCt	p.Y110S	RBM38_ENST00000440234.2_Missense_Mutation_p.Y110S|RP4-800J21.3_ENST00000417346.1_RNA|RBM38_ENST00000371219.2_Missense_Mutation_p.Y29S	NM_017495.5	NP_059965.2	Q9H0Z9	RBM38_HUMAN	RNA binding motif protein 38	110	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell cycle (GO:0007049)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|regulation of myotube differentiation (GO:0010830)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Lung NSC(12;0.00242)|all_lung(29;0.00767)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.55e-12)|Epithelial(14;9.49e-09)|all cancers(14;5.01e-08)			AACCTGGCATATCTGGGCGCC	0.617																																					p.Y110S		Atlas-SNP	.											.	RBM38	19	.	0			c.A329C						PASS	.						48.0	58.0	55.0					20																	55967801		1976	4180	6156	SO:0001583	missense	55544	exon2			TGGCATATCTGGG	X75314	CCDS46617.1, CCDS46618.1	20q13.31	2013-02-12	2006-07-11	2006-07-11	ENSG00000132819	ENSG00000132819		"""RNA binding motif (RRM) containing"""	15818	protein-coding gene	gene with protein product		612428	"""RNA-binding region (RNP1, RRM) containing 1"""	RNPC1			Standard	NM_017495		Approved	HSRNASEB, SEB4D, seb4B, dJ800J21.2	uc010zzj.2	Q9H0Z9	OTTHUMG00000032820	ENST00000356208.5:c.329A>C	20.37:g.55967801A>C	ENSP00000348538:p.Tyr110Ser	Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	125	35	0.28	NM_183425	A6NDK1|A6NMU6|Q15350|Q15351|Q9BYK3|Q9BYK4	Missense_Mutation	SNP	ENST00000356208.5	37	CCDS46617.1	.	.	.	.	.	.	.	.	.	.	A	19.73	3.881598	0.72294	.	.	ENSG00000132819	ENST00000356208;ENST00000440234;ENST00000371219	T;T;T	0.73789	-0.78;-0.78;2.07	5.11	5.11	0.69529	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.50599	0.1625	N	0.02247	-0.625	0.80722	D	1	B	0.13145	0.007	B	0.20184	0.028	T	0.48864	-0.8997	10	0.21014	T	0.42	3.4076	14.5578	0.68113	1.0:0.0:0.0:0.0	.	110	Q9H0Z9	RBM38_HUMAN	S	110;110;29	ENSP00000348538:Y110S;ENSP00000407848:Y110S;ENSP00000360263:Y29S	ENSP00000345248:Y87S	Y	+	2	0	RBM38	55401207	1.000000	0.71417	0.988000	0.46212	0.980000	0.70556	8.638000	0.91019	1.915000	0.55452	0.533000	0.62120	TAT	.	.	none		0.617	RBM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079843.4	NM_183425	
MUC16	94025	hgsc.bcm.edu	37	19	9018508	9018508	+	Missense_Mutation	SNP	T	T	G	rs74488264		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr19:9018508T>G	ENST00000397910.4	-	24	37869	c.37666A>C	c.(37666-37668)Aag>Cag	p.K12556Q		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12558	SEA 4. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCCTCATACTTCAGGTTGGTG	0.512																																					p.K12556Q		Atlas-SNP	.											MUC16_ENST00000397910,colon,carcinoma,+2,2	MUC16	4315	2	0			c.A37666C						scavenged	.						234.0	198.0	209.0					19																	9018508		1978	4180	6158	SO:0001583	missense	94025	exon24			CATACTTCAGGTT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37666A>C	19.37:g.9018508T>G	ENSP00000381008:p.Lys12556Gln	Somatic	97	1	0.0103093		WXS	Illumina HiSeq	Phase_I	97	7	0.0721649	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	8.033	0.762173	0.15914	.	.	ENSG00000181143	ENST00000397910	T	0.29397	1.57	2.01	-4.02	0.04034	.	.	.	.	.	T	0.05547	0.0146	N	0.00138	-2.015	.	.	.	B	0.20052	0.041	B	0.09377	0.004	T	0.32534	-0.9903	8	0.87932	D	0	.	2.4995	0.04630	0.3117:0.0:0.2615:0.4268	.	12556	B5ME49	.	Q	12556	ENSP00000381008:K12556Q	ENSP00000381008:K12556Q	K	-	1	0	MUC16	8879508	0.000000	0.05858	0.008000	0.14137	0.336000	0.28762	-1.612000	0.02061	-0.971000	0.03564	0.164000	0.16699	AAG	T|0.500;G|0.500	0.500	weak		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
WAS	7454	hgsc.bcm.edu	37	X	48547156	48547156	+	Silent	SNP	T	T	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chrX:48547156T>C	ENST00000376701.4	+	10	1114	c.1039T>C	c.(1039-1041)Ttg>Ctg	p.L347L		NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	347					actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				CCCTGTACCTTTGGGGATTGC	0.701			"""Mis, N, F, S"""			lymphoma																															p.L347L		Atlas-SNP	.		X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Wiskott-Aldrich syndrome		L	.	WAS	51	.	0			c.T1039C						PASS	.						7.0	7.0	7.0					X																	48547156		2147	4185	6332	SO:0001819	synonymous_variant	7454	exon10			GTACCTTTGGGGA	AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.1039T>C	X.37:g.48547156T>C		Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	184	95	0.516304	NM_000377	Q9BU11|Q9UNJ9	Silent	SNP	ENST00000376701.4	37	CCDS14303.1																																																																																			.	.	none		0.701	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083379.1	NM_000377	
CASR	846	hgsc.bcm.edu	37	3	122003487	122003487	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:122003487C>T	ENST00000490131.1	+	7	3058	c.2686C>T	c.(2686-2688)Cgc>Tgc	p.R896C	CASR_ENST00000498619.1_Missense_Mutation_p.R906C|AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000296154.5_Missense_Mutation_p.R896C	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	896	Interaction with RNF19A.				anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CAACGTCTCCCGCAAGCGGTC	0.657																																					p.R906C		Atlas-SNP	.											CASR,colon,carcinoma,0,1	CASR	190	1	0			c.C2716T						PASS	.						30.0	31.0	31.0					3																	122003487		2203	4299	6502	SO:0001583	missense	846	exon7			GTCTCCCGCAAGC	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2686C>T	3.37:g.122003487C>T	ENSP00000418685:p.Arg896Cys	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	61	13	0.213115	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.288301	0.59976	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.89810	-2.57;-2.57;-2.57	5.89	4.94	0.65067	.	0.051558	0.64402	D	0.000001	D	0.89469	0.6724	L	0.32530	0.975	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	P;P	0.56088	0.791;0.791	D	0.90626	0.4563	10	0.87932	D	0	.	16.9209	0.86164	0.1363:0.8637:0.0:0.0	.	906;896	E7ENE0;P41180	.;CASR_HUMAN	C	896;906;896	ENSP00000418685:R896C;ENSP00000420194:R906C;ENSP00000296154:R896C	ENSP00000296154:R896C	R	+	1	0	CASR	123486177	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.573000	0.60893	2.793000	0.96121	0.561000	0.74099	CGC	.	.	none		0.657	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
ABL1	25	hgsc.bcm.edu	37	9	133729485	133729485	+	Silent	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr9:133729485G>A	ENST00000318560.5	+	2	495	c.114G>A	c.(112-114)gaG>gaA	p.E38E		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	38	CAP.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	CTGACTTTGAGCCTCAGGGTC	0.463			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																p.E57E		Atlas-SNP	.		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	.	ABL1	1632	.	0			c.G171A						PASS	.						99.0	103.0	102.0					9																	133729485		2203	4300	6503	SO:0001819	synonymous_variant	25	exon2			CTTTGAGCCTCAG	M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.114G>A	9.37:g.133729485G>A		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	116	21	0.181034	NM_007313	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Silent	SNP	ENST00000318560.5	37	CCDS35166.1																																																																																			.	.	none		0.463	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313	
MUC6	4588	hgsc.bcm.edu	37	11	1017974	1017974	+	Missense_Mutation	SNP	C	C	G	rs200353019		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:1017974C>G	ENST00000421673.2	-	31	4877	c.4827G>C	c.(4825-4827)caG>caC	p.Q1609H		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1609	Approximate repeats.|Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.Q1609H(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GAAGTGTGGTCTGAGGGTGTG	0.547																																					p.Q1609H		Atlas-SNP	.											MUC6_ENST00000421673,colon,carcinoma,0,2	MUC6	408	2	2	Substitution - Missense(2)	large_intestine(2)	c.G4827C						scavenged	.						473.0	441.0	452.0					11																	1017974		2186	4282	6468	SO:0001583	missense	4588	exon31			TGTGGTCTGAGGG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4827G>C	11.37:g.1017974C>G	ENSP00000406861:p.Gln1609His	Somatic	331	4	0.0120846		WXS	Illumina HiSeq	Phase_I	333	5	0.015015	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	5.277	0.236564	0.10023	.	.	ENSG00000184956	ENST00000421673	T	0.35421	1.31	2.39	0.333	0.15943	.	.	.	.	.	T	0.26702	0.0653	L	0.52011	1.625	0.09310	N	1	B	0.25486	0.127	B	0.27715	0.082	T	0.28681	-1.0036	9	0.22109	T	0.4	.	3.4702	0.07565	0.0:0.5042:0.2173:0.2785	.	1609	Q6W4X9	MUC6_HUMAN	H	1609	ENSP00000406861:Q1609H	ENSP00000406861:Q1609H	Q	-	3	2	MUC6	1007974	0.000000	0.05858	0.003000	0.11579	0.027000	0.11550	-2.394000	0.01054	-0.057000	0.13199	-0.710000	0.03640	CAG	.	.	weak		0.547	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MESDC2	23184	hgsc.bcm.edu	37	15	81271769	81271769	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr15:81271769A>C	ENST00000261758.4	-	3	582	c.496T>G	c.(496-498)Tac>Gac	p.Y166D	MESDC2_ENST00000560244.1_5'Flank	NM_015154.1	NP_055969.1	Q14696	MESD_HUMAN	mesoderm development candidate 2	166	Escort domain. {ECO:0000250}.				mesoderm development (GO:0007498)|protein folding (GO:0006457)|protein localization to cell surface (GO:0034394)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(5)|ovary(1)|urinary_tract(1)	8						TCCCAGGCGTAGCTCCCATCG	0.532																																					p.Y166D		Atlas-SNP	.											.	MESDC2	23	.	0			c.T496G						PASS	.						75.0	70.0	72.0					15																	81271769		2203	4300	6503	SO:0001583	missense	23184	exon3			AGGCGTAGCTCCC	D42039	CCDS32308.1	15q13	2008-07-18							13520	protein-coding gene	gene with protein product		607783				7788527, 11247670	Standard	NM_015154		Approved	KIAA0081, BOCA, MESD	uc002bfy.1	Q14696		ENST00000261758.4:c.496T>G	15.37:g.81271769A>C	ENSP00000261758:p.Tyr166Asp	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	50	17	0.34	NM_015154	B4DW84|D3DW96|Q969U1	Missense_Mutation	SNP	ENST00000261758.4	37	CCDS32308.1	.	.	.	.	.	.	.	.	.	.	A	17.53	3.413065	0.62511	.	.	ENSG00000117899	ENST00000261758	.	.	.	5.9	5.9	0.94986	.	0.142736	0.48286	D	0.000198	T	0.58075	0.2097	L	0.56769	1.78	0.50171	D	0.999853	P	0.41232	0.743	B	0.41174	0.349	T	0.58393	-0.7644	9	0.37606	T	0.19	-5.1443	16.378	0.83412	1.0:0.0:0.0:0.0	.	166	Q14696	MESD_HUMAN	D	166	.	ENSP00000261758:Y166D	Y	-	1	0	MESDC2	79058824	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.304000	0.51866	2.277000	0.76020	0.529000	0.55759	TAC	.	.	none		0.532	MESDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417673.2	NM_015154	
FAM21A	387680	hgsc.bcm.edu	37	10	51863831	51863831	+	Missense_Mutation	SNP	G	G	C	rs201489423	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr10:51863831G>C	ENST00000282633.5	+	18	1710	c.1665G>C	c.(1663-1665)aaG>aaC	p.K555N	FAM21A_ENST00000351071.6_Missense_Mutation_p.K555N|FAM21A_ENST00000399339.2_Missense_Mutation_p.K467N|FAM21A_ENST00000314664.7_Missense_Mutation_p.K555N	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	555					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)		p.K555N(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						GTGCGAGTAAGTTAAAAGGTG	0.373																																					p.K555N		Atlas-SNP	.											FAM21A,NS,carcinoma,0,1	FAM21A	32	1	1	Substitution - Missense(1)	prostate(1)	c.G1665C						scavenged	.																																			SO:0001583	missense	387680	exon18			GAGTAAGTTAAAA	BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.1665G>C	10.37:g.51863831G>C	ENSP00000282633:p.Lys555Asn	Somatic	826	8	0.00968523		WXS	Illumina HiSeq	Phase_I	914	21	0.0229759	NM_001005751	A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	ENST00000282633.5	37	CCDS41527.1	.	.	.	.	.	.	.	.	.	.	C	6.739	0.505070	0.12822	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633;ENST00000399339	.	.	.	3.2	3.2	0.36748	.	0.179758	0.47455	D	0.000237	T	0.75766	0.3894	M	0.77616	2.38	0.38837	D	0.955976	B;B;D;B;B	0.69078	0.008;0.01;0.997;0.049;0.028	B;B;D;B;B	0.80764	0.016;0.019;0.994;0.079;0.017	T	0.78021	-0.2367	9	0.48119	T	0.1	-3.197	10.2638	0.43443	0.0:0.0:1.0:0.0	.	555;555;467;555;449	E7ESD2;Q641Q2-2;F8W7U3;Q641Q2;Q5T1D7	.;.;.;FA21A_HUMAN;.	N	555;555;449;555;467	.	ENSP00000282633:K555N	K	+	3	2	FAM21A	51533837	0.997000	0.39634	0.828000	0.32881	0.253000	0.25986	3.117000	0.50407	1.510000	0.48803	0.184000	0.17185	AAG	.	.	weak		0.373	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276917.2	NM_001005751	
CTC-497E21.3	0	hgsc.bcm.edu	37	11	13031220	13031220	+	lincRNA	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:13031220C>T	ENST00000533002.1	-	0	0																											CGACGTTGTGCGAGTGCTTTT	0.682																																					p.R33X		Atlas-SNP	.											.	.	.	.	0			c.C97T						PASS	.						10.0	14.0	13.0					11																	13031220		1905	4098	6003			644943	exon1			GTTGTGCGAGTGC																													11.37:g.13031220C>T		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	66	17	0.257576	NM_001080521		Nonsense_Mutation	SNP	ENST00000533002.1	37																																																																																				.	.	none		0.682	CTC-497E21.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000387000.1		
TLDC2	140711	hgsc.bcm.edu	37	20	35517718	35517718	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr20:35517718T>C	ENST00000217320.3	+	6	621	c.577T>C	c.(577-579)Ttc>Ctc	p.F193L	TLDC2_ENST00000602922.1_Missense_Mutation_p.F193L	NM_080628.1	NP_542195.1	A0PJX2	TLDC2_HUMAN	TBC/LysM-associated domain containing 2	193	TLD.																TTGCCCGACCTTCAACAACGA	0.617																																					p.F193L		Atlas-SNP	.											C20orf118,NS,carcinoma,-2,1	C20orf118	21	1	0			c.T577C						PASS	.						77.0	68.0	71.0					20																	35517718		2203	4300	6503	SO:0001583	missense	140711	exon6			CCGACCTTCAACA	AL079335	CCDS33465.1	20q11.23	2013-03-14	2013-03-14	2013-03-14	ENSG00000101342	ENSG00000101342			16112	protein-coding gene	gene with protein product	"""hypothetical protein LOC140711"", ""TLD domain containing 2"""		"""chromosome 20 open reading frame 118"""	C20orf118			Standard	NM_080628		Approved	dJ132F21.2	uc002xgg.1	A0PJX2	OTTHUMG00000032400	ENST00000217320.3:c.577T>C	20.37:g.35517718T>C	ENSP00000217320:p.Phe193Leu	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	119	5	0.0420168	NM_080628	B3KVU8	Missense_Mutation	SNP	ENST00000217320.3	37	CCDS33465.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.149620	0.78001	.	.	ENSG00000101342	ENST00000217320	T	0.57595	0.39	5.41	5.41	0.78517	TLDc (2);	0.000000	0.85682	D	0.000000	T	0.80166	0.4573	H	0.95504	3.68	0.53005	D	0.999964	D	0.89917	1.0	D	0.83275	0.996	D	0.86032	0.1514	10	0.87932	D	0	-19.3697	13.6557	0.62338	0.0:0.0:0.0:1.0	.	193	A0PJX2	CT118_HUMAN	L	193	ENSP00000217320:F193L	ENSP00000217320:F193L	F	+	1	0	C20orf118	34951132	1.000000	0.71417	1.000000	0.80357	0.330000	0.28571	6.242000	0.72376	2.044000	0.60594	0.533000	0.62120	TTC	.	.	none		0.617	TLDC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079060.2	NM_080628	
ARHGAP21	57584	hgsc.bcm.edu	37	10	24910129	24910129	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr10:24910129G>C	ENST00000396432.2	-	9	1181	c.695C>G	c.(694-696)aCc>aGc	p.T232S	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.T19S	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	231					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TGGTGTACTGGTTTGCTGTTT	0.488																																					p.T232S		Atlas-SNP	.											ARHGAP21,NS,carcinoma,+1,1	ARHGAP21	185	1	0			c.C695G						PASS	.						103.0	91.0	95.0					10																	24910129		2203	4300	6503	SO:0001583	missense	57584	exon9			GTACTGGTTTGCT	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.695C>G	10.37:g.24910129G>C	ENSP00000379709:p.Thr232Ser	Somatic	304	0	0		WXS	Illumina HiSeq	Phase_I	357	87	0.243697	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	G	1.164	-0.642809	0.03531	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.43294	2.92;2.92;0.95;0.97	5.35	2.34	0.29019	.	1.015580	0.07822	N	0.959901	T	0.31638	0.0803	L	0.31294	0.92	0.09310	N	0.999997	B;B	0.13145	0.007;0.005	B;B	0.17722	0.019;0.008	T	0.26155	-1.0111	10	0.27082	T	0.32	.	9.346	0.38109	0.1111:0.2519:0.637:0.0	.	222;231	F8W9U9;Q5T5U3	.;RHG21_HUMAN	S	232;221;19;222;232;67	ENSP00000379709:T232S;ENSP00000365604:T19S;ENSP00000365592:T222S;ENSP00000405018:T232S	ENSP00000365604:T19S	T	-	2	0	ARHGAP21	24950135	0.930000	0.31532	0.329000	0.25429	0.430000	0.31655	1.225000	0.32551	0.713000	0.32060	0.650000	0.86243	ACC	.	.	none		0.488	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
ITPR1	3708	hgsc.bcm.edu	37	3	4722294	4722294	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:4722294C>T	ENST00000443694.2	+	22	2980	c.2980C>T	c.(2980-2982)Cga>Tga	p.R994*	ITPR1_ENST00000354582.6_Nonsense_Mutation_p.R1009*|ITPR1_ENST00000302640.8_Nonsense_Mutation_p.R994*|ITPR1_ENST00000357086.4_Nonsense_Mutation_p.R1000*|ITPR1_ENST00000456211.2_Nonsense_Mutation_p.R985*|ITPR1_ENST00000423119.2_Nonsense_Mutation_p.R1000*|ITPR1_ENST00000544951.1_Intron			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1009					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.R985*(1)		NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TATATTTAAGCGAGAGTTTGA	0.398																																					p.R1000X		Atlas-SNP	.											ITPR1,rectum,carcinoma,0,1	ITPR1	659	1	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2998T						scavenged	.						110.0	107.0	108.0					3																	4722294		1874	4092	5966	SO:0001587	stop_gained	3708	exon25			TTTAAGCGAGAGT	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.2980C>T	3.37:g.4722294C>T	ENSP00000401671:p.Arg994*	Somatic	101	1	0.00990099		WXS	Illumina HiSeq	Phase_I	103	26	0.252427	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Nonsense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	C	41	8.817682	0.98964	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	.	.	.	4.62	3.74	0.42951	.	0.449318	0.22299	N	0.061883	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	12.1324	0.53950	0.3112:0.6888:0.0:0.0	.	.	.	.	X	1009;994;1009;1000;1000;985;994	.	ENSP00000306253:R994X	R	+	1	2	ITPR1	4697294	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	0.841000	0.27613	1.141000	0.42275	0.491000	0.48974	CGA	.	.	none		0.398	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
PRAMEF2	65122	hgsc.bcm.edu	37	1	12921277	12921277	+	Silent	SNP	A	A	G	rs3204826	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:12921277A>G	ENST00000240189.2	+	4	1155	c.1068A>G	c.(1066-1068)ttA>ttG	p.L356L		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	356					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.L356F(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCCTCGTGTTAGAGGGCTGTC	0.542													.|||	93	0.0185703	0.0091	0.0115	5008	,	,		23369	0.0437		0.008	False		,,,				2504	0.0215				p.L356L		Atlas-SNP	.											PRAMEF2,NS,carcinoma,0,1	PRAMEF2	85	1	1	Substitution - Missense(1)	prostate(1)	c.A1068G						scavenged	.						161.0	158.0	159.0					1																	12921277		2201	4291	6492	SO:0001819	synonymous_variant	65122	exon4			CGTGTTAGAGGGC		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.1068A>G	1.37:g.12921277A>G		Somatic	283	4	0.0141343		WXS	Illumina HiSeq	Phase_I	287	8	0.0278746	NM_023014		Silent	SNP	ENST00000240189.2	37	CCDS149.1																																																																																			A|0.996;G|0.004	0.004	strong		0.542	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014	
CCDC171	203238	hgsc.bcm.edu	37	9	15745534	15745534	+	Missense_Mutation	SNP	G	G	A	rs570101221		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr9:15745534G>A	ENST00000380701.3	+	18	2904	c.2576G>A	c.(2575-2577)cGt>cAt	p.R859H	CCDC171_ENST00000297641.3_Missense_Mutation_p.R859H	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	859																	GAGCAGTTGCGTTGTTTACAA	0.343													G|||	1	0.000199681	0.0	0.0	5008	,	,		14338	0.0		0.0	False		,,,				2504	0.001				p.R859H		Atlas-SNP	.											.	.	.	.	0			c.G2576A						PASS	.						187.0	183.0	185.0					9																	15745534		2203	4300	6503	SO:0001583	missense	203238	exon18			AGTTGCGTTGTTT	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.2576G>A	9.37:g.15745534G>A	ENSP00000370077:p.Arg859His	Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	101	20	0.19802	NM_173550	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	ENST00000380701.3	37	CCDS6481.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.33|19.33	3.806863|3.806863	0.70797|0.70797	.|.	.|.	ENSG00000164989|ENSG00000164989	ENST00000297641;ENST00000380689;ENST00000380701|ENST00000449575	T;T|.	0.15952|.	2.38;2.38|.	5.03|5.03	4.12|4.12	0.48240|0.48240	.|.	0.205040|.	0.41712|.	D|.	0.000833|.	T|T	0.43322|0.43322	0.1242|0.1242	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	B;B;B|.	0.25007|.	0.116;0.071;0.049|.	B;B;B|.	0.19391|.	0.025;0.011;0.017|.	T|T	0.24657|0.24657	-1.0154|-1.0154	10|5	0.38643|.	T|.	0.18|.	-7.835|-7.835	11.9773|11.9773	0.53100|0.53100	0.1426:0.0:0.8574:0.0|0.1426:0.0:0.8574:0.0	.|.	867;126;859|.	B7ZM22;A6NK04;Q6TFL3|.	.;.;CI093_HUMAN|.	H|I	859;126;859|99	ENSP00000297641:R859H;ENSP00000370077:R859H|.	ENSP00000297641:R859H|.	R|V	+|+	2|1	0|0	C9orf93|C9orf93	15735534|15735534	0.688000|0.688000	0.27680|0.27680	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	1.853000|1.853000	0.39358|0.39358	2.351000|2.351000	0.79841|0.79841	0.591000|0.591000	0.81541|0.81541	CGT|GTT	.	.	none		0.343	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
UGT2B17	7367	hgsc.bcm.edu	37	4	69433904	69433904	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr4:69433904C>T	ENST00000317746.2	-	1	341	c.299G>A	c.(298-300)aGt>aAt	p.S100N		NM_001077.3	NP_001068.1	O75795	UDB17_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B17	100					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(14)|ovary(2)|prostate(1)	30					Losartan(DB00678)	TTTTGAAATACTATATGTCCA	0.264																																					p.S100N	Melanoma(18;649 833 28984 37818 38500)	Atlas-SNP	.											.	UGT2B17	34	.	0			c.G299A						PASS	.						44.0	49.0	47.0					4																	69433904		2056	3898	5954	SO:0001583	missense	7367	exon1			GAAATACTATATG	U59209	CCDS3523.1	4q13	2008-02-05	2005-07-20		ENSG00000197888	ENSG00000197888		"""UDP glucuronosyltransferases"""	12547	protein-coding gene	gene with protein product		601903	"""UDP glycosyltransferase 2 family, polypeptide B17"""			8798464	Standard	NM_001077		Approved		uc021xov.1	O75795	OTTHUMG00000129305	ENST00000317746.2:c.299G>A	4.37:g.69433904C>T	ENSP00000320401:p.Ser100Asn	Somatic	306	0	0		WXS	Illumina HiSeq	Phase_I	366	88	0.240437	NM_001077		Missense_Mutation	SNP	ENST00000317746.2	37	CCDS3523.1	.	.	.	.	.	.	.	.	.	.	c	2.171	-0.389799	0.04932	.	.	ENSG00000197888	ENST00000317746	T	0.58940	0.3	2.41	1.19	0.21007	.	0.508000	0.17225	U	0.182199	T	0.24509	0.0594	N	0.02802	-0.49	0.09310	N	1	.	.	.	.	.	.	T	0.13495	-1.0507	8	0.22109	T	0.4	.	4.3641	0.11216	0.0:0.3431:0.0:0.6569	.	.	.	.	N	100	ENSP00000320401:S100N	ENSP00000320401:S100N	S	-	2	0	UGT2B17	69116499	0.001000	0.12720	0.001000	0.08648	0.017000	0.09413	0.888000	0.28268	0.205000	0.20568	-0.451000	0.05528	AGT	.	.	none		0.264	UGT2B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251436.1	NM_001077	
CCDC82	79780	hgsc.bcm.edu	37	11	96117597	96117597	+	Silent	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:96117597G>A	ENST00000278520.5	-	3	743	c.315C>T	c.(313-315)aaC>aaT	p.N105N	CCDC82_ENST00000423339.2_Silent_p.N105N|CCDC82_ENST00000542662.1_Silent_p.N105N|CCDC82_ENST00000525786.1_5'Flank			Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	105								p.N105N(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		ATGTTGAACCGTTGCCAGAGT	0.338																																					p.N105N		Atlas-SNP	.											CCDC82,NS,carcinoma,0,1	CCDC82	63	1	1	Substitution - coding silent(1)	endometrium(1)	c.C315T						scavenged	.						194.0	185.0	188.0					11																	96117597		2201	4297	6498	SO:0001819	synonymous_variant	79780	exon4			TGAACCGTTGCCA	AF245436	CCDS8307.1	11q21	2006-03-09			ENSG00000149231	ENSG00000149231			26282	protein-coding gene	gene with protein product						12477932	Standard	NM_024725		Approved	FLJ23518	uc001pfx.4	Q8N4S0	OTTHUMG00000167678	ENST00000278520.5:c.315C>T	11.37:g.96117597G>A		Somatic	428	0	0		WXS	Illumina HiSeq	Phase_I	484	7	0.0144628	NM_024725	B3KPU7|Q8WV71|Q9H2Q5|Q9H5E3	Silent	SNP	ENST00000278520.5	37	CCDS8307.1																																																																																			.	.	none		0.338	CCDC82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395542.2	NM_024725	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230310	23230310	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr22:23230310T>A	ENST00000526893.1	+	1	351	c.77T>A	c.(76-78)cTg>cAg	p.L26Q	IGLL5_ENST00000532223.2_Missense_Mutation_p.L26Q|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Missense_Mutation_p.L26Q	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	26						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CGCTGGCCCCTGCTGCTGCTG	0.662																																					p.L26Q		Atlas-SNP	.											.	IGLL5	26	.	0			c.T77A						PASS	.																																			SO:0001583	missense	100423062	exon1			GGCCCCTGCTGCT	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.77T>A	22.37:g.23230310T>A	ENSP00000431254:p.Leu26Gln	Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	107	20	0.186916	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	T	14.31	2.497679	0.44455	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00792	5.69;5.7	3.81	1.57	0.23409	.	.	.	.	.	T	0.01124	0.0037	L	0.32530	0.975	0.09310	N	1	D	0.76494	0.999	P	0.61800	0.894	T	0.26121	-1.0112	9	0.02654	T	1	.	3.9146	0.09217	0.0:0.1156:0.2159:0.6685	.	26	B9A064	IGLL5_HUMAN	Q	26	ENSP00000436353:L26Q;ENSP00000431254:L26Q	ENSP00000431254:L26Q	L	+	2	0	IGLL5	21560310	0.019000	0.18553	0.000000	0.03702	0.079000	0.17450	2.550000	0.45811	0.262000	0.21774	0.523000	0.50628	CTG	.	.	none		0.662	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
PIM1	5292	hgsc.bcm.edu	37	6	37138420	37138420	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:37138420C>T	ENST00000373509.5	+	1	442	c.69C>T	c.(67-69)acC>acT	p.T23T		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	114					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	TGCACGCCACCAAGCTGGCGC	0.731			T	BCL6	NHL																																p.T114T		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C342T						PASS	.						23.0	26.0	25.0					6																	37138420		2198	4290	6488	SO:0001819	synonymous_variant	5292	exon1			CGCCACCAAGCTG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.69C>T	6.37:g.37138420C>T		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	66	26	0.393939	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.731	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
DENND3	22898	hgsc.bcm.edu	37	8	142178188	142178188	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:142178188C>T	ENST00000262585.2	+	13	1877	c.1599C>T	c.(1597-1599)taC>taT	p.Y533Y	DENND3_ENST00000424248.1_Silent_p.Y481Y|DENND3_ENST00000519811.1_Silent_p.Y613Y	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	533					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			TGCAGGCATACCATGCCCACT	0.537																																					p.Y533Y		Atlas-SNP	.											.	DENND3	127	.	0			c.C1599T						PASS	.						136.0	122.0	126.0					8																	142178188		2203	4300	6503	SO:0001819	synonymous_variant	22898	exon13			GGCATACCATGCC	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.1599C>T	8.37:g.142178188C>T		Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	163	12	0.0736196	NM_014957	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Silent	SNP	ENST00000262585.2	37	CCDS34947.1	.	.	.	.	.	.	.	.	.	.	C	0.032	-1.328256	0.01309	.	.	ENSG00000105339	ENST00000518668	.	.	.	5.36	1.0	0.19881	.	.	.	.	.	T	0.58308	0.2113	.	.	.	0.53688	D	0.999971	.	.	.	.	.	.	T	0.52902	-0.8513	4	.	.	.	-9.2619	10.3492	0.43924	0.0:0.6493:0.0:0.3507	.	.	.	.	S	538	.	.	P	+	1	0	DENND3	142247370	0.999000	0.42202	0.004000	0.12327	0.001000	0.01503	0.623000	0.24447	0.272000	0.22027	-0.379000	0.06801	CCA	.	.	none		0.537	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
OR5M10	390167	hgsc.bcm.edu	37	11	56345100	56345100	+	Missense_Mutation	SNP	G	G	A	rs182443406	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:56345100G>A	ENST00000526812.2	-	1	163	c.98C>T	c.(97-99)gCg>gTg	p.A33V		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						TAGGTAGATCGCCAGGAACAC	0.488																																					p.A33V		Atlas-SNP	.											.	OR5M10	56	.	0			c.C98T						PASS	.						172.0	164.0	166.0					11																	56345100		1943	4142	6085	SO:0001583	missense	390167	exon1			TAGATCGCCAGGA	BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.98C>T	11.37:g.56345100G>A	ENSP00000436004:p.Ala33Val	Somatic	221	0	0		WXS	Illumina HiSeq	Phase_I	193	54	0.279793	NM_001004741	B9EIL9	Missense_Mutation	SNP	ENST00000526812.2	37	CCDS53630.1	.	.	.	.	.	.	.	.	.	.	G	0.508	-0.867878	0.02590	.	.	ENSG00000254834	ENST00000526812	T	0.01304	5.03	4.04	-3.41	0.04839	.	.	.	.	.	T	0.00440	0.0014	N	0.00538	-1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46020	-0.9221	9	0.02654	T	1	.	6.0359	0.19708	0.4:0.3341:0.266:0.0	.	33	Q6IEU7	OR5MA_HUMAN	V	33	ENSP00000436004:A33V	ENSP00000436004:A33V	A	-	2	0	OR5M10	56101676	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.474000	0.06607	-0.336000	0.08438	-1.035000	0.02400	GCG	G|0.999;T|0.001	.	alt		0.488	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391609.1	NM_001004741	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230348	23230348	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr22:23230348C>T	ENST00000526893.1	+	1	389	c.115C>T	c.(115-117)Ctg>Ttg	p.L39L	IGLL5_ENST00000532223.2_Silent_p.L39L|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Silent_p.L39L	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	39						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCATGGCCTGCTGCGCCCAAT	0.687																																					p.L39L		Atlas-SNP	.											.	IGLL5	26	.	0			c.C115T						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			GGCCTGCTGCGCC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.115C>T	22.37:g.23230348C>T		Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	113	19	0.168142	NM_001178126		Silent	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.687	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
ARL13B	200894	hgsc.bcm.edu	37	3	93768309	93768309	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:93768309C>G	ENST00000394222.3	+	8	1359	c.1084C>G	c.(1084-1086)Ctt>Gtt	p.L362V	ARL13B_ENST00000539730.1_Missense_Mutation_p.L83V|DHFRL1_ENST00000481631.1_Intron|ARL13B_ENST00000471138.1_Missense_Mutation_p.L362V|ARL13B_ENST00000303097.7_Missense_Mutation_p.L255V|ARL13B_ENST00000535334.1_Missense_Mutation_p.L259V	NM_001174150.1	NP_001167621.1	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 13B	362					cilium assembly (GO:0042384)|dorsal/ventral pattern formation (GO:0009953)|formation of radial glial scaffolds (GO:0021943)|heart looping (GO:0001947)|interneuron migration from the subpallium to the cortex (GO:0021830)|left/right axis specification (GO:0070986)|neural tube patterning (GO:0021532)|nonmotile primary cilium assembly (GO:0035058)|small GTPase mediated signal transduction (GO:0007264)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|intracellular (GO:0005622)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(2)	10						GGTAGAACCACTTAATATAGA	0.373																																					p.L362V		Atlas-SNP	.											.	ARL13B	52	.	0			c.C1084G						PASS	.						84.0	83.0	83.0					3																	93768309		2203	4300	6503	SO:0001583	missense	200894	exon8			GAACCACTTAATA	AL713789	CCDS2924.1, CCDS2925.1, CCDS54615.1	3q11	2014-05-09	2005-11-18	2005-11-18	ENSG00000169379	ENSG00000169379		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25419	protein-coding gene	gene with protein product		608922	"""ADP-ribosylation factor-like 2-like 1"""	ARL2L1		15314642, 18674751	Standard	NR_033427		Approved	DKFZp761H079, JBTS8	uc003drf.3	Q3SXY8	OTTHUMG00000159012	ENST00000394222.3:c.1084C>G	3.37:g.93768309C>G	ENSP00000377769:p.Leu362Val	Somatic	420	0	0		WXS	Illumina HiSeq	Phase_I	416	92	0.221154	NM_182896	D3DN29|G3V1S8|Q504W8|Q8TCL5	Missense_Mutation	SNP	ENST00000394222.3	37	CCDS2925.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.484787	0.01027	.	.	ENSG00000169379	ENST00000535334;ENST00000303097;ENST00000394222;ENST00000471138;ENST00000539730	T;T;T;T;T	0.62498	1.74;0.02;0.22;0.22;1.06	5.12	-1.85	0.07784	.	0.388487	0.26424	N	0.024448	T	0.24236	0.0587	N	0.03324	-0.35	0.53005	D	0.999964	B;B;B;B	0.10296	0.003;0.0;0.001;0.001	B;B;B;B	0.08055	0.003;0.002;0.002;0.003	T	0.32877	-0.9890	10	0.02654	T	1	-4.0133	3.8052	0.08774	0.1835:0.3115:0.4052:0.0998	.	259;362;255;362	G3V1S8;B4DLH1;Q3SXY8-2;Q3SXY8	.;.;.;AR13B_HUMAN	V	259;255;362;362;83	ENSP00000445145:L259V;ENSP00000306225:L255V;ENSP00000377769:L362V;ENSP00000420780:L362V;ENSP00000437977:L83V	ENSP00000306225:L255V	L	+	1	0	ARL13B	95250999	0.391000	0.25221	0.952000	0.39060	0.483000	0.33249	0.432000	0.21461	-0.084000	0.12595	-1.058000	0.02302	CTT	.	.	none		0.373	ARL13B-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352904.1	NM_182896	
RPL13	6137	hgsc.bcm.edu	37	16	89629371	89629371	+	Missense_Mutation	SNP	G	G	A	rs139252401		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr16:89629371G>A	ENST00000393099.3	+	5	806	c.557G>A	c.(556-558)cGt>cAt	p.R186H	RPL13_ENST00000311528.5_Missense_Mutation_p.R186H|RPL13_ENST00000452368.3_Missense_Mutation_p.R139H|SNORD68_ENST00000363214.1_RNA|RPL13_ENST00000567815.1_Missense_Mutation_p.R186H	NM_033251.2	NP_150254.1	P26373	RL13_HUMAN	ribosomal protein L13	186					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|cytosolic ribosome (GO:0022626)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(3)|skin(1)|upper_aerodigestive_tract(2)	6		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		CGTATGGCCCGTGCCAACGCC	0.493																																					p.R186H		Atlas-SNP	.											.	RPL13	11	.	0			c.G557A						PASS	.	G	HIS/ARG,HIS/ARG	0,4396		0,0,2198	33.0	37.0	35.0		557,557	3.6	0.9	16	dbSNP_134	35	1,8593	1.2+/-3.3	0,1,4296	no	missense,missense	RPL13	NM_000977.3,NM_033251.2	29,29	0,1,6494	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	186/212,186/212	89629371	1,12989	2198	4297	6495	SO:0001583	missense	6137	exon6			TGGCCCGTGCCAA	AB007172	CCDS10979.1, CCDS58492.1	16q24.3	2011-04-06			ENSG00000167526	ENSG00000167526		"""L ribosomal proteins"""	10303	protein-coding gene	gene with protein product		113703				9582194	Standard	NM_000977		Approved	D16S444E, BBC1, L13	uc002fnm.2	P26373	OTTHUMG00000133770	ENST00000393099.3:c.557G>A	16.37:g.89629371G>A	ENSP00000376811:p.Arg186His	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	148	46	0.310811	NM_000977	B4DLX3|F5H1S2|Q3KQT8|Q567Q8|Q9BPX0	Missense_Mutation	SNP	ENST00000393099.3	37	CCDS10979.1	.	.	.	.	.	.	.	.	.	.	G	19.25	3.791435	0.70452	0.0	1.16E-4	ENSG00000167526	ENST00000311528;ENST00000452368;ENST00000393099	T;T;T	0.56103	1.22;0.48;1.22	4.52	3.57	0.40892	.	0.000000	0.85682	U	0.000000	T	0.52484	0.1737	L	0.55834	1.745	0.80722	D	1	P;B	0.49559	0.925;0.362	P;B	0.46144	0.505;0.091	T	0.57236	-0.7846	10	0.62326	D	0.03	-12.1465	12.6145	0.56569	0.0813:0.0:0.9187:0.0	.	139;186	F5H1S2;P26373	.;RL13_HUMAN	H	186;139;186	ENSP00000307889:R186H;ENSP00000438959:R139H;ENSP00000376811:R186H	ENSP00000307889:R186H	R	+	2	0	RPL13	88156872	1.000000	0.71417	0.886000	0.34754	0.819000	0.46315	9.688000	0.98670	1.041000	0.40125	0.462000	0.41574	CGT	G|1.000;A|0.000	0.000	weak		0.493	RPL13-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258294.2	NM_000977	
MYD88	4615	hgsc.bcm.edu	37	3	38182337	38182337	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:38182337C>T	ENST00000495303.1	+	2	462	c.457C>T	c.(457-459)Cag>Tag	p.Q153*	MYD88_ENST00000396334.3_Missense_Mutation_p.P258L|MYD88_ENST00000481122.1_3'UTR|MYD88_ENST00000424893.1_Missense_Mutation_p.P213L|MYD88_ENST00000443433.2_Nonsense_Mutation_p.Q198*|MYD88_ENST00000417037.2_Missense_Mutation_p.P266L	NM_001172566.1	NP_001166037.1	Q99836	MYD88_HUMAN	myeloid differentiation primary response 88	0	Intermediate domain. {ECO:0000250}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|establishment of endothelial intestinal barrier (GO:0090557)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to molecule of fungal origin (GO:0002238)|response to peptidoglycan (GO:0032494)|response to virus (GO:0009615)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|type I interferon biosynthetic process (GO:0045351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)	death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|TIR domain binding (GO:0070976)			breast(1)|haematopoietic_and_lymphoid_tissue(226)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	237				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		AGCCTCTCTCCAGGTAAGCTC	0.552			Mis		ABC-DLBCL																																p.Q198X		Atlas-SNP	.		Dom	yes		3	3p22	4615	myeloid differentiation primary response gene (88)		L	.	MYD88	900	.	0			c.C592T						PASS	.						125.0	119.0	121.0					3																	38182337		2203	4300	6503	SO:0001587	stop_gained	4615	exon3			TCTCTCCAGGTAA	U84408	CCDS2674.2, CCDS54565.1, CCDS54566.1, CCDS54567.1, CCDS54568.1	3p22	2014-09-17	2012-11-15		ENSG00000172936	ENSG00000172936			7562	protein-coding gene	gene with protein product		602170	"""myeloid differentiation primary response gene (88)"""			9013863	Standard	NM_002468		Approved		uc003chx.3	Q99836	OTTHUMG00000131083	ENST00000495303.1:c.457C>T	3.37:g.38182337C>T	ENSP00000417848:p.Gln153*	Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	96	45	0.46875	NM_001172569	B4DKH8|B4DKU4|B4DQ60|B4DQ72|J3KPU4|J3KQ87|J3KQJ6|P78397|Q53XS7	Nonsense_Mutation	SNP	ENST00000495303.1	37	CCDS54568.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.149061|5.149061	0.94645|0.94645	.|.	.|.	ENSG00000172936|ENSG00000172936	ENST00000417037;ENST00000396334;ENST00000424893;ENST00000421516;ENST00000415158|ENST00000495303;ENST00000443433	T;T;T;T|.	0.07216|.	3.49;3.21;3.21;3.49|.	5.61|5.61	5.61|5.61	0.85477|0.85477	Toll/interleukin-1 receptor homology (TIR) domain (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.79028|.	0.4377|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	T|.	0.80730|.	-0.1252|.	9|.	0.02654|0.87932	T|D	1|0	-8.5502|-8.5502	18.9993|18.9993	0.92826|0.92826	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	200;245;234|.	Q99836-2;Q99836;B4E3D6|.	.;MYD88_HUMAN;.|.	L|X	266;258;213;265;234|153;198	ENSP00000401399:P266L;ENSP00000379625:P258L;ENSP00000389979:P213L;ENSP00000391753:P265L|.	ENSP00000379625:P258L|ENSP00000390565:Q198X	P|Q	+|+	2|1	0|0	MYD88|MYD88	38157341|38157341	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	7.375000|7.375000	0.79646|0.79646	2.815000|2.815000	0.96918|0.96918	0.561000|0.561000	0.74099|0.74099	CCA|CAG	.	.	none		0.552	MYD88-008	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000342700.1	NM_002468	
GRID2	2895	hgsc.bcm.edu	37	4	94376873	94376873	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr4:94376873T>G	ENST00000282020.4	+	11	1864	c.1606T>G	c.(1606-1608)Ttt>Gtt	p.F536V	GRID2_ENST00000510992.1_Missense_Mutation_p.F441V	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	536					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TGTGGTGGACTTTACGACACG	0.433																																					p.F536V		Atlas-SNP	.											.	GRID2	233	.	0			c.T1606G						PASS	.						143.0	131.0	135.0					4																	94376873		2203	4300	6503	SO:0001583	missense	2895	exon11			GTGGACTTTACGA	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1606T>G	4.37:g.94376873T>G	ENSP00000282020:p.Phe536Val	Somatic	178	0	0		WXS	Illumina HiSeq	Phase_I	184	47	0.255435	NM_001510	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	T	28.4	4.913732	0.92178	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.54479	0.57;0.57	5.97	5.97	0.96955	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.82761	0.5107	H	0.97516	4.02	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.85130	0.997;0.997	D	0.88958	0.3391	10	0.87932	D	0	.	16.4608	0.84044	0.0:0.0:0.0:1.0	.	441;536	E9PH24;O43424	.;GRID2_HUMAN	V	536;441	ENSP00000282020:F536V;ENSP00000421257:F441V	ENSP00000282020:F536V	F	+	1	0	GRID2	94595896	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.040000	0.89188	2.288000	0.76882	0.533000	0.62120	TTT	.	.	none		0.433	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
GRHPR	9380	hgsc.bcm.edu	37	9	37424900	37424900	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr9:37424900G>C	ENST00000318158.6	+	2	227	c.142G>C	c.(142-144)Ggt>Cgt	p.G48R	GRHPR_ENST00000607784.1_Missense_Mutation_p.G48R|GRHPR_ENST00000493368.1_3'UTR	NM_012203.1	NP_036335.1	Q9UBQ7	GRHPR_HUMAN	glyoxylate reductase/hydroxypyruvate reductase	48					cellular nitrogen compound metabolic process (GO:0034641)|dicarboxylic acid metabolic process (GO:0043648)|excretion (GO:0007588)|glyoxylate metabolic process (GO:0046487)|metabolic process (GO:0008152)|oxidation-reduction process (GO:0055114)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisomal matrix (GO:0005782)	carboxylic acid binding (GO:0031406)|glycerate dehydrogenase activity (GO:0008465)|glyoxylate reductase (NADP) activity (GO:0030267)|hydroxypyruvate reductase activity (GO:0016618)|NAD binding (GO:0051287)|NADPH binding (GO:0070402)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12				GBM - Glioblastoma multiforme(29;0.00687)		GCTAGAGCGAGGTGTGGCGGG	0.662																																					p.G48R		Atlas-SNP	.											.	GRHPR	35	.	0			c.G142C						PASS	.						50.0	47.0	48.0					9																	37424900		2203	4300	6503	SO:0001583	missense	9380	exon2			GAGCGAGGTGTGG	AF134895	CCDS6609.1	9q12	2012-07-13			ENSG00000137106	ENSG00000137106	1.1.1.79, 1.1.1.81		4570	protein-coding gene	gene with protein product	"""primary hyperoxaluria type 2"""	604296		GLXR		10524214, 10484776	Standard	XM_005251631		Approved	PH2	uc003zzu.1	Q9UBQ7	OTTHUMG00000019914	ENST00000318158.6:c.142G>C	9.37:g.37424900G>C	ENSP00000313432:p.Gly48Arg	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	41	18	0.439024	NM_012203	Q5T945|Q9H3E9|Q9H636|Q9UKX1	Missense_Mutation	SNP	ENST00000318158.6	37	CCDS6609.1	.	.	.	.	.	.	.	.	.	.	G	9.113	1.007054	0.19199	.	.	ENSG00000137106	ENST00000377824;ENST00000318158	D;D	0.82803	-1.65;-1.65	5.98	-1.73	0.08081	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	0.355960	0.35805	N	0.002974	T	0.55417	0.1919	N	0.02379	-0.575	0.18873	N	0.999986	B	0.11235	0.004	B	0.23150	0.044	T	0.49995	-0.8879	10	0.15066	T	0.55	-4.7328	8.5821	0.33634	0.1811:0.4099:0.409:0.0	.	48	Q9UBQ7	GRHPR_HUMAN	R	48	ENSP00000367055:G48R;ENSP00000313432:G48R	ENSP00000313432:G48R	G	+	1	0	GRHPR	37414900	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	0.078000	0.14761	-0.336000	0.08438	-0.181000	0.13052	GGT	.	.	none		0.662	GRHPR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052442.1	NM_012203	
CDC42BPG	55561	hgsc.bcm.edu	37	11	64591992	64591992	+	Missense_Mutation	SNP	G	G	A	rs138706676		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:64591992G>A	ENST00000342711.5	-	37	4608	c.4609C>T	c.(4609-4611)Cgg>Tgg	p.R1537W		NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						CTTCGGGGCCGTTCTGAGACC	0.582																																					p.R1537W		Atlas-SNP	.											.	CDC42BPG	101	.	0			c.C4609T						PASS	.	G	TRP/ARG	1,4401	2.1+/-5.4	0,1,2200	45.0	49.0	48.0		4609	2.2	1.0	11	dbSNP_134	48	0,8594		0,0,4297	no	missense	CDC42BPG	NM_017525.2	101	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1537/1552	64591992	1,12995	2201	4297	6498	SO:0001583	missense	55561	exon37			GGGGCCGTTCTGA	AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.4609C>T	11.37:g.64591992G>A	ENSP00000345133:p.Arg1537Trp	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	137	29	0.211679	NM_017525		Missense_Mutation	SNP	ENST00000342711.5	37	CCDS31601.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.338643	0.41398	2.27E-4	0.0	ENSG00000171219	ENST00000342711	T	0.71579	-0.58	4.33	2.24	0.28232	.	0.238745	0.21940	N	0.066899	T	0.64735	0.2625	L	0.36672	1.1	0.26162	N	0.979986	D	0.76494	0.999	P	0.50082	0.63	T	0.58042	-0.7706	10	0.59425	D	0.04	.	8.9266	0.35643	0.0:0.0:0.5967:0.4033	.	1537	Q6DT37	MRCKG_HUMAN	W	1537	ENSP00000345133:R1537W	ENSP00000345133:R1537W	R	-	1	2	CDC42BPG	64348568	0.951000	0.32395	0.989000	0.46669	0.948000	0.59901	1.490000	0.35573	0.939000	0.37446	0.555000	0.69702	CGG	G|1.000;A|0.000	0.000	weak		0.582	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
GGA2	23062	hgsc.bcm.edu	37	16	23521643	23521643	+	Splice_Site	SNP	G	G	C	rs17844840|rs1071685	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr16:23521643G>C	ENST00000309859.4	-	1	172	c.90C>G	c.(88-90)ctC>ctG	p.L30L	GGA2_ENST00000567468.1_Splice_Site_p.L30L	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	30					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		GCTACTCACTGAGCCACAGCT	0.781													G|||	3460	0.690895	0.5756	0.7291	5008	,	,		7234	0.6964		0.8131	False		,,,				2504	0.6881				p.L30L		Atlas-SNP	.											.	GGA2	49	.	0			c.C90G						PASS	.						1.0	1.0	1.0					16																	23521643		725	1470	2195	SO:0001630	splice_region_variant	23062	exon1			CTCACTGAGCCAC	AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.91+1C>G	16.37:g.23521643G>C		Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	13	7	0.538462	NM_015044	D3DWF0|O14564|Q9NYN2|Q9UPS2	Silent	SNP	ENST00000309859.4	37	CCDS10611.1																																																																																			G|0.291;C|0.709	0.709	strong		0.781	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1		Silent
MUC6	4588	hgsc.bcm.edu	37	11	1017483	1017483	+	Missense_Mutation	SNP	T	T	G	rs79986665		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:1017483T>G	ENST00000421673.2	-	31	5368	c.5318A>C	c.(5317-5319)cAc>cCc	p.H1773P		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1773	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGTACTGGTGTGGTTGGGGGT	0.577																																					p.H1773P		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,0,2	MUC6	408	2	0			c.A5318C						scavenged	.						544.0	541.0	542.0					11																	1017483		2199	4294	6493	SO:0001583	missense	4588	exon31			CTGGTGTGGTTGG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5318A>C	11.37:g.1017483T>G	ENSP00000406861:p.His1773Pro	Somatic	435	101	0.232184		WXS	Illumina HiSeq	Phase_I	426	92	0.215962	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	T	4.174	0.030796	0.08101	.	.	ENSG00000184956	ENST00000421673	T	0.17528	2.27	2.91	0.844	0.18943	.	.	.	.	.	T	0.04907	0.0132	N	0.01109	-1.01	0.09310	N	1	B	0.15930	0.015	B	0.14023	0.01	T	0.43065	-0.9414	9	0.22706	T	0.39	.	6.6218	0.22808	0.0:0.1732:0.4682:0.3586	.	1773	Q6W4X9	MUC6_HUMAN	P	1773	ENSP00000406861:H1773P	ENSP00000406861:H1773P	H	-	2	0	MUC6	1007483	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.094000	0.11094	0.066000	0.16515	-0.743000	0.03520	CAC	T|0.500;G|0.500	0.500	weak		0.577	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
ETAA1	54465	hgsc.bcm.edu	37	2	67630426	67630426	+	Silent	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:67630426G>A	ENST00000272342.5	+	5	742	c.612G>A	c.(610-612)gaG>gaA	p.E204E	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	204						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						ATATGGAAGAGCTAGATGTGA	0.259																																					p.E204E		Atlas-SNP	.											.	ETAA1	88	.	0			c.G612A						PASS	.						29.0	36.0	34.0					2																	67630426		2180	4273	6453	SO:0001819	synonymous_variant	54465	exon5			GGAAGAGCTAGAT	AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.612G>A	2.37:g.67630426G>A		Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	160	34	0.2125	NM_019002	Q05BT7|Q53SC4	Silent	SNP	ENST00000272342.5	37	CCDS1882.1																																																																																			.	.	none		0.259	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002	
DUOX2	50506	hgsc.bcm.edu	37	15	45404810	45404810	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr15:45404810C>T	ENST00000603300.1	-	4	469	c.267G>A	c.(265-267)acG>acA	p.T89T	DUOX2_ENST00000389039.6_Silent_p.T89T|DUOXA2_ENST00000323030.5_5'Flank	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	89	Peroxidase-like; mediates peroxidase activity. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CTATGCCCCGCGTGGCTGCGT	0.672																																					p.T89T		Atlas-SNP	.											.	DUOX2	137	.	0			c.G267A						PASS	.						26.0	30.0	29.0					15																	45404810		2191	4277	6468	SO:0001819	synonymous_variant	50506	exon4			GCCCCGCGTGGCT	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.267G>A	15.37:g.45404810C>T		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	82	16	0.195122	NM_014080	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Silent	SNP	ENST00000603300.1	37	CCDS10117.1																																																																																			.	.	none		0.672	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230394	23230394	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr22:23230394C>T	ENST00000526893.1	+	1	435	c.161C>T	c.(160-162)gCc>gTc	p.A54V	IGLL5_ENST00000532223.2_Missense_Mutation_p.A54V|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Missense_Mutation_p.A54V	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	54						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GACCCTGGAGCCTCAGTTGGA	0.667																																					p.A54V		Atlas-SNP	.											.	IGLL5	26	.	0			c.C161T						PASS	.																																			SO:0001583	missense	100423062	exon1			CTGGAGCCTCAGT	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.161C>T	22.37:g.23230394C>T	ENSP00000431254:p.Ala54Val	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	92	13	0.141304	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	C	15.92	2.975826	0.53720	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00617	6.19;6.19	3.92	-1.07	0.09968	.	.	.	.	.	T	0.00552	0.0018	L	0.29908	0.895	0.09310	N	1	B	0.21821	0.061	B	0.11329	0.006	T	0.47071	-0.9145	9	0.87932	D	0	.	2.5676	0.04787	0.1918:0.3543:0.3485:0.1053	.	54	B9A064	IGLL5_HUMAN	V	54	ENSP00000436353:A54V;ENSP00000431254:A54V	ENSP00000431254:A54V	A	+	2	0	IGLL5	21560394	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.197000	0.17197	-0.079000	0.12707	-0.152000	0.13540	GCC	.	.	none		0.667	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
PRSS3	5646	hgsc.bcm.edu	37	9	33797962	33797962	+	Silent	SNP	A	A	G	rs374178684		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr9:33797962A>G	ENST00000361005.5	+	3	507	c.507A>G	c.(505-507)aaA>aaG	p.K169K	PRSS3_ENST00000429677.3_Silent_p.K105K|PRSS3_ENST00000342836.4_Silent_p.K126K|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000379405.3_Silent_p.K112K	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	169	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			TGCTGATCAAACTCTCCTCAC	0.567																																					p.K169K		Atlas-SNP	.											PRSS3_ENST00000361005,NS,neuroblastoma,0,3	PRSS3	79	3	0			c.A507G						scavenged	.						266.0	201.0	223.0					9																	33797962		2203	4300	6503	SO:0001819	synonymous_variant	5646	exon3			GATCAAACTCTCC		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.507A>G	9.37:g.33797962A>G		Somatic	118	1	0.00847458		WXS	Illumina HiSeq	Phase_I	158	5	0.0316456	NM_007343	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Silent	SNP	ENST00000361005.5	37	CCDS47958.1																																																																																			.	.	weak		0.567	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
OR8B2	26595	hgsc.bcm.edu	37	11	124252524	124252524	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:124252524C>A	ENST00000375013.2	-	1	734	c.716G>T	c.(715-717)aGt>aTt	p.S239I		NM_001005468.1	NP_001005468.1	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B, member 2	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(13)|ovary(1)	23		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		GCTACAAGTACTGAAGGCTTT	0.383																																					p.S239I		Atlas-SNP	.											.	OR8B2	42	.	0			c.G716T						PASS	.						56.0	61.0	59.0					11																	124252524		2196	4280	6476	SO:0001583	missense	26595	exon1			CAAGTACTGAAGG	AB065826	CCDS31708.1	11q24.1	2012-08-09			ENSG00000204293	ENSG00000204293		"""GPCR / Class A : Olfactory receptors"""	8471	protein-coding gene	gene with protein product							Standard	XM_005271500		Approved		uc010sai.2	Q96RD0	OTTHUMG00000165982	ENST00000375013.2:c.716G>T	11.37:g.124252524C>A	ENSP00000364152:p.Ser239Ile	Somatic	383	0	0		WXS	Illumina HiSeq	Phase_I	357	69	0.193277	NM_001005468	Q8NGH2	Missense_Mutation	SNP	ENST00000375013.2	37	CCDS31708.1	.	.	.	.	.	.	.	.	.	.	c	17.43	3.388312	0.61956	.	.	ENSG00000204293	ENST00000375013	T	0.00302	8.2	3.81	3.81	0.43845	GPCR, rhodopsin-like superfamily (1);	0.080815	0.53938	D	0.000051	T	0.00695	0.0023	H	0.95151	3.63	0.19300	N	0.999979	P	0.51933	0.949	P	0.54210	0.745	T	0.13176	-1.0519	10	0.87932	D	0	.	10.3825	0.44121	0.0:0.6742:0.3258:0.0	.	239	Q96RD0	OR8B2_HUMAN	I	239	ENSP00000364152:S239I	ENSP00000364152:S239I	S	-	2	0	OR8B2	123757734	0.105000	0.21958	0.391000	0.26233	0.558000	0.35554	0.590000	0.23954	2.126000	0.65437	0.505000	0.49811	AGT	.	.	none		0.383	OR8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387290.1	NM_001005468	
C3orf35	339883	hgsc.bcm.edu	37	3	37458937	37458937	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:37458937C>T	ENST00000328376.5	+	5	1159	c.180C>T	c.(178-180)ggC>ggT	p.G60G	C3orf35_ENST00000452017.2_Silent_p.G60G|C3orf35_ENST00000425932.1_Silent_p.G60G|C3orf35_ENST00000425564.2_Silent_p.G60G|C3orf35_ENST00000426078.1_Silent_p.G60G|C3orf35_ENST00000481400.1_Intron	NM_178339.2	NP_848029.2	Q8IVJ8	APRG1_HUMAN	chromosome 3 open reading frame 35	60						integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	11						GCCTGCAGGGCAGTGCTCAGC	0.463																																					p.G60G		Atlas-SNP	.											C3orf35,NS,carcinoma,+2,1	C3orf35	21	1	0			c.C180T						PASS	.						116.0	112.0	113.0					3																	37458937		1902	4110	6012	SO:0001819	synonymous_variant	339883	exon5			GCAGGGCAGTGCT	AJ493599	CCDS43065.1, CCDS46792.1	3p22.3	2014-05-22			ENSG00000198590	ENSG00000198590			24082	protein-coding gene	gene with protein product	"""AP20 region protein"", ""APRG1 tumor suppressor candidate"""	611429				12543795	Standard	NM_178342		Approved	APRG1	uc003cha.4	Q8IVJ8	OTTHUMG00000155923	ENST00000328376.5:c.180C>T	3.37:g.37458937C>T		Somatic	161	0	0		WXS	Illumina HiSeq	Phase_I	145	29	0.2	NM_178342	B7ZMA0|Q8IVJ5|Q8IVJ9	Silent	SNP	ENST00000328376.5	37	CCDS43065.1																																																																																			.	.	none		0.463	C3orf35-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342344.2	NM_178338	
MUC17	140453	hgsc.bcm.edu	37	7	100679390	100679390	+	Missense_Mutation	SNP	A	A	G	rs150982179		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr7:100679390A>G	ENST00000306151.4	+	3	4757	c.4693A>G	c.(4693-4695)Acc>Gcc	p.T1565A		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1565	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAGCATGCAAACCTCAACTTA	0.488																																					p.T1565A		Atlas-SNP	.											MUC17,NS,carcinoma,-2,1	MUC17	804	1	0			c.A4693G						scavenged	.						265.0	248.0	254.0					7																	100679390		2203	4300	6503	SO:0001583	missense	140453	exon3			ATGCAAACCTCAA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4693A>G	7.37:g.100679390A>G	ENSP00000302716:p.Thr1565Ala	Somatic	89	1	0.011236		WXS	Illumina HiSeq	Phase_I	102	4	0.0392157	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	A	1.177	-0.639202	0.03557	.	.	ENSG00000169876	ENST00000306151	T	0.01887	4.58	0.364	0.364	0.16124	.	.	.	.	.	T	0.01092	0.0036	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.06405	0.002	T	0.47586	-0.9106	8	0.06236	T	0.91	.	.	.	.	.	1565	Q685J3	MUC17_HUMAN	A	1565	ENSP00000302716:T1565A	ENSP00000302716:T1565A	T	+	1	0	MUC17	100466110	0.012000	0.17670	0.001000	0.08648	0.002000	0.02628	1.128000	0.31369	0.391000	0.25143	0.102000	0.15555	ACC	.	.	weak		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
LILRA6	79168	hgsc.bcm.edu	37	19	54744722	54744722	+	Missense_Mutation	SNP	T	T	C	rs56257556	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr19:54744722T>C	ENST00000396365.2	-	5	979	c.940A>G	c.(940-942)Aac>Gac	p.N314D	LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000419410.2_Missense_Mutation_p.N314D|LILRA6_ENST00000440558.2_Missense_Mutation_p.N314D|LILRA6_ENST00000270464.5_Intron|LILRA6_ENST00000391735.3_3'UTR|LILRA6_ENST00000245621.5_Missense_Mutation_p.N314D	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	314	Ig-like C2-type 1.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ATCAGGATGTTCAGGGGGTCG	0.682																																					p.N314D		Atlas-SNP	.											LILRA6,NS,carcinoma,+2,1	LILRA6	75	1	0			c.A940G						scavenged	.						22.0	32.0	29.0					19																	54744722		2100	4147	6247	SO:0001583	missense	79168	exon5			GGATGTTCAGGGG	AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.940A>G	19.37:g.54744722T>C	ENSP00000379651:p.Asn314Asp	Somatic	67	4	0.0597015		WXS	Illumina HiSeq	Phase_I	113	8	0.0707965	NM_024318		Missense_Mutation	SNP	ENST00000396365.2	37	CCDS42610.1	207	0.09478021978021978	73	0.1483739837398374	41	0.1132596685082873	19	0.033216783216783216	74	0.09762532981530343	T	0	-2.690915	0.00100	.	.	ENSG00000244482	ENST00000440558;ENST00000419410;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T;T	0.13778	2.56;2.56;2.56;2.56	2.16	1.1	0.20463	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.389073	0.18849	N	0.129445	T	0.00012	0.0000	N	0.00022	-2.725	0.80722	D	1	B;B;B;B	0.17852	0.002;0.024;0.0;0.0	B;B;B;B	0.28385	0.002;0.089;0.0;0.001	T	0.46020	-0.9221	10	0.02654	T	1	.	5.0417	0.14462	0.0:0.8181:0.0:0.1819	rs56257556	314;314;314;314	C9JFH3;Q6PI73;F8WCY4;D3YTC4	.;LIRA6_HUMAN;.;.	D	314	ENSP00000390120:N314D;ENSP00000411227:N314D;ENSP00000379651:N314D;ENSP00000245621:N314D	ENSP00000245621:N314D	N	-	1	0	LILRA6	59436534	0.686000	0.27661	0.905000	0.35620	0.042000	0.13812	1.191000	0.32138	0.467000	0.27218	-1.232000	0.01568	AAC	CATCAGGATGTT|0.500;GATCAGGATGTC|0.500	.	alt		0.682	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318	
CXCR4	7852	hgsc.bcm.edu	37	2	136873448	136873448	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:136873448C>T	ENST00000241393.3	-	2	154	c.50G>A	c.(49-51)gGc>gAc	p.G17D	CXCR4_ENST00000409817.1_Missense_Mutation_p.G21D|CXCR4_ENST00000466288.1_5'UTR	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	17	Important for chemokine binding, signaling and HIV-1 coreceptor activity.				activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	GTCCCCTGAGCCCATTTCCTC	0.403																																					p.G21D		Atlas-SNP	.											.	CXCR4	51	.	0			c.G62A						PASS	.						74.0	79.0	78.0					2																	136873448		2203	4300	6503	SO:0001583	missense	7852	exon1			CCTGAGCCCATTT	AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.50G>A	2.37:g.136873448C>T	ENSP00000241393:p.Gly17Asp	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	126	39	0.309524	NM_001008540	B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Missense_Mutation	SNP	ENST00000241393.3	37	CCDS46420.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291560	0.59976	.	.	ENSG00000121966	ENST00000409817;ENST00000241393	T;T	0.59502	0.26;0.26	5.88	5.88	0.94601	CXC chemokine receptor, type 4, N-terminal (1);	0.151224	0.50627	D	0.000111	T	0.48607	0.1509	L	0.27053	0.805	0.80722	D	1	B;B	0.15930	0.006;0.015	B;B	0.16289	0.015;0.011	T	0.30534	-0.9975	10	0.27082	T	0.32	.	20.2228	0.98330	0.0:1.0:0.0:0.0	.	17;21	P61073;P61073-2	CXCR4_HUMAN;.	D	21;17	ENSP00000386884:G21D;ENSP00000241393:G17D	ENSP00000241393:G17D	G	-	2	0	CXCR4	136589918	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	5.359000	0.66074	2.789000	0.95967	0.655000	0.94253	GGC	.	.	none		0.403	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1		
OR5L1	219437	hgsc.bcm.edu	37	11	55579419	55579419	+	Silent	SNP	T	T	C	rs34948392	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:55579419T>C	ENST00000333973.2	+	1	566	c.477T>C	c.(475-477)caT>caC	p.H159H		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H159H(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				CTCTGATTCATTTGTGCTTAG	0.443													N|||	525	0.104832	0.1884	0.0461	5008	,	,		22589	0.0813		0.0924	False		,,,				2504	0.0706				p.H159H		Atlas-SNP	.											OR5L1,NS,carcinoma,+2,3	OR5L1	145	3	1	Substitution - coding silent(1)	stomach(1)	c.T477C						scavenged	.	C		670,3730		63,544,1593	217.0	191.0	200.0		477	-4.7	0.0	11	dbSNP_126	200	725,7867		32,661,3603	no	coding-synonymous	OR5L1	NM_001004738.1		95,1205,5196	CC,CT,TT		8.4381,15.2273,10.7374		159/312	55579419	1395,11597	2200	4296	6496	SO:0001819	synonymous_variant	219437	exon1			GATTCATTTGTGC	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.477T>C	11.37:g.55579419T>C		Somatic	408	1	0.00245098		WXS	Illumina HiSeq	Phase_I	401	56	0.139651	NM_001004738	B2RNK6|Q6IFD0	Silent	SNP	ENST00000333973.2	37	CCDS31509.1																																																																																			T|0.896;C|0.104	0.104	strong		0.443	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738	
FMN2	56776	hgsc.bcm.edu	37	1	240371373	240371373	+	Silent	SNP	A	A	T	rs199766654	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:240371373A>T	ENST00000319653.9	+	5	3491	c.3261A>T	c.(3259-3261)ccA>ccT	p.P1087P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1087	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GCATACCCCCACCTCCCCCTC	0.726																																					p.P1087P		Atlas-SNP	.											FMN2,rectum,carcinoma,0,1	FMN2	451	1	0			c.A3261T						scavenged	.						4.0	5.0	4.0					1																	240371373		1745	3543	5288	SO:0001819	synonymous_variant	56776	exon5			ACCCCCACCTCCC	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3261A>T	1.37:g.240371373A>T		Somatic	47	4	0.0851064		WXS	Illumina HiSeq	Phase_I	43	12	0.27907	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			A|0.994;T|0.006	0.006	strong		0.726	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230440	23230440	+	Splice_Site	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr22:23230440G>A	ENST00000526893.1	+	1	480		c.e1+1		IGLL5_ENST00000532223.2_Splice_Site|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Splice_Site	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5							extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						TGTGGGGCAGGTAAGGGGCAA	0.627																																					.		Atlas-SNP	.											.	IGLL5	26	.	0			c.100+1G>A						PASS	.																																			SO:0001630	splice_region_variant	100423062	exon1			GGGCAGGTAAGGG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.206+1G>A	22.37:g.23230440G>A		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	61	14	0.229508	NM_001256296		Splice_Site	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	10.15	1.271539	0.23221	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	.	.	.	3.92	3.92	0.45320	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.74	0.51788	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IGLL5	21560440	1.000000	0.71417	1.000000	0.80357	0.199000	0.23934	1.700000	0.37815	2.481000	0.83766	0.643000	0.83706	.	.	.	none		0.627	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	Intron
FAM72B	653820	hgsc.bcm.edu	37	1	120846059	120846059	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:120846059G>A	ENST00000369390.3	+	3	1124	c.295G>A	c.(295-297)Gga>Aga	p.G99R	FAM72B_ENST00000355228.4_Missense_Mutation_p.G59R|FAM72B_ENST00000471903.2_3'UTR	NM_001100910.1	NP_001094380.1	Q86X60	FA72B_HUMAN	family with sequence similarity 72, member B	99										large_intestine(1)|lung(2)	3	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)		CTGCAACAACGGACACTTCTG	0.388																																					p.G99R		Atlas-SNP	.											FAM72B,NS,carcinoma,0,1	FAM72B	10	1	0			c.G295A						scavenged	.						345.0	316.0	325.0					1																	120846059		1870	4114	5984	SO:0001583	missense	653820	exon3			AACAACGGACACT	AL357493	CCDS72848.1	1p12	2014-05-06			ENSG00000188610	ENSG00000188610			24805	protein-coding gene	gene with protein product		614711					Standard	NM_001100910		Approved	RP11-439A17.6	uc009whp.3	Q86X60	OTTHUMG00000185025	ENST00000369390.3:c.295G>A	1.37:g.120846059G>A	ENSP00000358397:p.Gly99Arg	Somatic	789	4	0.00506971		WXS	Illumina HiSeq	Phase_I	808	9	0.0111386	NM_001100910	B2RPQ5|Q5QP15	Missense_Mutation	SNP	ENST00000369390.3	37	CCDS41374.1	.	.	.	.	.	.	.	.	.	.	g	18.03	3.532588	0.64972	.	.	ENSG00000188610	ENST00000369392;ENST00000369390;ENST00000452190;ENST00000355228	T;T;T	0.38401	1.14;1.14;1.14	2.54	2.54	0.30619	.	0.000000	0.85682	U	0.000000	T	0.36166	0.0957	M	0.83603	2.65	0.54753	D	0.999989	D;B	0.63880	0.993;0.295	P;B	0.49361	0.608;0.056	T	0.42548	-0.9445	10	0.54805	T	0.06	.	10.8119	0.46551	0.0:0.0:1.0:0.0	.	99;59	Q86X60;Q86X60-2	FA72B_HUMAN;.	R	70;99;70;59	ENSP00000358397:G99R;ENSP00000392882:G70R;ENSP00000347368:G59R	ENSP00000347368:G59R	G	+	1	0	FAM72B	120647582	1.000000	0.71417	0.995000	0.50966	0.956000	0.61745	7.236000	0.78154	1.431000	0.47355	0.398000	0.26397	GGA	.	.	weak		0.388	FAM72B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098437.1		
PIM1	5292	hgsc.bcm.edu	37	6	37138946	37138946	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:37138946G>A	ENST00000373509.5	+	4	659	c.286G>A	c.(286-288)Gtg>Atg	p.V96M		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	187					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GCTGAAGAAGGTGAGCTCGGG	0.652			T	BCL6	NHL																																p.V187M		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.G559A						PASS	.						80.0	89.0	86.0					6																	37138946		2203	4300	6503	SO:0001583	missense	5292	exon4			AAGAAGGTGAGCT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.286G>A	6.37:g.37138946G>A	ENSP00000362608:p.Val96Met	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	58	18	0.310345	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.518058	0.85495	.	.	ENSG00000137193	ENST00000373509	T	0.66638	-0.22	4.14	4.14	0.48551	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.077156	0.51477	D	0.000084	T	0.54191	0.1843	N	0.25426	0.745	0.54753	D	0.999985	P	0.37015	0.578	P	0.46076	0.503	T	0.65327	-0.6195	10	0.87932	D	0	.	16.5618	0.84568	0.0:0.0:1.0:0.0	.	187	P11309	PIM1_HUMAN	M	96	ENSP00000362608:V96M	ENSP00000362608:V96M	V	+	1	0	PIM1	37246924	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.549000	0.98106	2.283000	0.76528	0.549000	0.68633	GTG	.	.	none		0.652	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
NBPF10	100132406	hgsc.bcm.edu	37	1	145323667	145323667	+	Missense_Mutation	SNP	C	C	G	rs199626421		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:145323667C>G	ENST00000342960.5	+	27	3539	c.3504C>G	c.(3502-3504)gaC>gaG	p.D1168E	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	755						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.D1168E(1)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TTAAAAAGGACGAAGAAGAGG	0.468																																					p.D1168E		Atlas-SNP	.											NBPF10,NS,carcinoma,0,6	NBPF10	221	6	1	Substitution - Missense(1)	kidney(1)	c.C3504G						scavenged	.																																			SO:0001583	missense	100132406	exon27			AAAGGACGAAGAA	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.3504C>G	1.37:g.145323667C>G	ENSP00000345684:p.Asp1168Glu	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	60	10	0.166667	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	8.960	0.970347	0.18659	.	.	ENSG00000163386	ENST00000342960	T	0.03272	3.99	.	.	.	.	.	.	.	.	T	0.01905	0.0060	L	0.60455	1.87	0.09310	N	1	.	.	.	.	.	.	T	0.41716	-0.9493	5	0.42905	T	0.14	.	.	.	.	.	.	.	.	E	1168	ENSP00000345684:D1168E	ENSP00000345684:D1168E	D	+	3	2	NBPF10	144035024	0.003000	0.15002	0.002000	0.10522	0.088000	0.18126	0.035000	0.13797	-0.430000	0.07318	0.152000	0.16155	GAC	.	.	weak		0.468	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
ISCU	23479	hgsc.bcm.edu	37	12	108956417	108956417	+	Missense_Mutation	SNP	T	T	G	rs67681514|rs10778647	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:108956417T>G	ENST00000311893.9	+	1	41	c.19T>G	c.(19-21)Ttc>Gtc	p.F7V	SART3_ENST00000431469.2_5'Flank|ISCU_ENST00000431221.2_Missense_Mutation_p.F7V|ISCU_ENST00000547005.1_Missense_Mutation_p.F7V|SART3_ENST00000228284.3_5'Flank|ISCU_ENST00000539593.1_Missense_Mutation_p.F7V|SART3_ENST00000546611.1_5'Flank|ISCU_ENST00000392807.4_5'UTR|ISCU_ENST00000338291.4_5'UTR|ISCU_ENST00000535729.1_Missense_Mutation_p.F7V|SART3_ENST00000552221.1_5'Flank	NM_213595.2	NP_998760.1	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme	7				F -> G (in Ref. 1; AAG37428 and 3; AAH11906). {ECO:0000305}.	iron-sulfur cluster assembly (GO:0016226)|nitrogen fixation (GO:0009399)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|iron-sulfur cluster binding (GO:0051536)|protein complex scaffold (GO:0032947)			kidney(2)|large_intestine(2)|lung(4)|prostate(2)|urinary_tract(1)	11						GGCTGGGGCTTTCCGTCTGAG	0.746													G|||	4477	0.89397	0.8396	0.8775	5008	,	,		9082	0.9544		0.8678	False		,,,				2504	0.9438				p.F7V		Atlas-SNP	.											.	ISCU	19	.	0			c.T19G						PASS	.						2.0	3.0	3.0					12																	108956417		1074	2745	3819	SO:0001583	missense	23479	exon1			GGGGCTTTCCGTC	U47101	CCDS9118.1, CCDS44966.1, CCDS73518.1	12q24.1	2013-08-05	2013-08-05	2006-10-24	ENSG00000136003	ENSG00000136003			29882	protein-coding gene	gene with protein product		611911	"""NifU-like N-terminal domain containing"", ""IscU iron-sulfur cluster scaffold homolog (E. coli)"", ""iron-sulfur cluster scaffold homolog (E. coli)"""	NIFUN		8875867, 11060020	Standard	XM_005268760		Approved	ISU2, hnifU, IscU	uc010sxc.2	Q9H1K1	OTTHUMG00000168420	ENST00000311893.9:c.19T>G	12.37:g.108956417T>G	ENSP00000310623:p.Phe7Val	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	8	8	1	NM_213595	Q6P713|Q99617|Q9H1K2	Missense_Mutation	SNP	ENST00000311893.9	37	CCDS44966.1	1931	0.8841575091575091	428	0.8699186991869918	313	0.8646408839779005	539	0.9423076923076923	651	0.8588390501319261	G	10.60	1.395545	0.25205	.	.	ENSG00000136003	ENST00000535729;ENST00000431221;ENST00000547005;ENST00000311893;ENST00000539593	T;T;T;T;T	0.62364	0.03;0.05;0.03;0.07;0.06	4.95	4.95	0.65309	.	0.282027	0.39341	N	0.001397	T	0.00012	0.0000	N	0.08118	0	0.09310	P	0.9999999999944561	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.33240	-0.9876	9	0.17369	T	0.5	.	11.0295	0.47763	0.0:0.0:0.8142:0.1858	rs10778647;rs59554812	7;7;7;7	B3KQ30;Q9H1K1;B4DNC9;F5H5N2	.;ISCU_HUMAN;.;.	V	7	ENSP00000445598:F7V;ENSP00000411108:F7V;ENSP00000446606:F7V;ENSP00000310623:F7V;ENSP00000443272:F7V	ENSP00000310623:F7V	F	+	1	0	ISCU	107480547	0.093000	0.21703	0.631000	0.29282	0.038000	0.13279	2.348000	0.44045	1.467000	0.48044	-0.121000	0.15023	TTC	GG|0.500;TT|0.500	.	alt		0.746	ISCU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399693.1	NM_014301	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230386	23230386	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr22:23230386C>T	ENST00000526893.1	+	1	427	c.153C>T	c.(151-153)gaC>gaT	p.D51D	IGLL5_ENST00000532223.2_Silent_p.D51D|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Silent_p.D51D	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	51						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GGGACCCAGACCCTGGAGCCT	0.677																																					p.T16I		Atlas-SNP	.											.	IGLL5	26	.	0			c.C47T						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			CCCAGACCCTGGA	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.153C>T	22.37:g.23230386C>T		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	95	14	0.147368	NM_001256296		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.677	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
HHIP	64399	hgsc.bcm.edu	37	4	145658962	145658962	+	Silent	SNP	G	G	A	rs35379077	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr4:145658962G>A	ENST00000296575.3	+	13	2611	c.1956G>A	c.(1954-1956)ccG>ccA	p.P652P		NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	652	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		GTGTTAGACCGAACAAGTGCC	0.448																																					p.P652P		Atlas-SNP	.											.	HHIP	100	.	0			c.G1956A						PASS	.	G		0,4406		0,0,2203	145.0	123.0	131.0		1956	-10.8	0.2	4	dbSNP_126	131	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	HHIP	NM_022475.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		652/701	145658962	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	64399	exon13			TAGACCGAACAAG	AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.1956G>A	4.37:g.145658962G>A		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	134	35	0.261194	NM_022475	Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Silent	SNP	ENST00000296575.3	37	CCDS3762.1																																																																																			G|1.000;A|0.000	0.000	strong		0.448	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364887.2		
CACNA1E	777	hgsc.bcm.edu	37	1	181689418	181689418	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:181689418C>T	ENST00000367573.2	+	14	1828	c.1828C>T	c.(1828-1830)Ctc>Ttc	p.L610F	CACNA1E_ENST00000526775.1_Missense_Mutation_p.L610F|CACNA1E_ENST00000357570.5_Missense_Mutation_p.L561F|CACNA1E_ENST00000367567.4_Missense_Mutation_p.L217F|CACNA1E_ENST00000367570.1_Missense_Mutation_p.L610F|CACNA1E_ENST00000358338.5_Missense_Mutation_p.L561F|CACNA1E_ENST00000360108.3_Missense_Mutation_p.L610F	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	610					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GCTTTTCCTCCTCTTCCTCTT	0.463																																					p.L610F		Atlas-SNP	.											.	CACNA1E	778	.	0			c.C1828T						PASS	.						230.0	205.0	213.0					1																	181689418		1997	4164	6161	SO:0001583	missense	777	exon14			TTCCTCCTCTTCC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1828C>T	1.37:g.181689418C>T	ENSP00000356545:p.Leu610Phe	Somatic	293	0	0		WXS	Illumina HiSeq	Phase_I	262	38	0.145038	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	32	5.182207	0.94885	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98732	-5.1;-5.1;-5.1;-5.1;-5.1;-5.1;-5.1	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.99263	0.9743	M	0.88105	2.93	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	D	0.99285	1.0897	10	0.87932	D	0	.	18.2263	0.89918	0.0:1.0:0.0:0.0	.	610;610	Q15878-2;Q15878-3	.;.	F	610;610;561;561;217;610;610	ENSP00000356542:L610F;ENSP00000434814:L610F;ENSP00000350183:L561F;ENSP00000351101:L561F;ENSP00000356539:L217F;ENSP00000353222:L610F;ENSP00000356545:L610F	ENSP00000350183:L561F	L	+	1	0	CACNA1E	179956041	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.711000	0.84669	2.391000	0.81399	0.563000	0.77884	CTC	.	.	none		0.463	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
ADCK1	57143	hgsc.bcm.edu	37	14	78392248	78392248	+	Nonsense_Mutation	SNP	C	C	T	rs142956948	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr14:78392248C>T	ENST00000238561.5	+	9	1249	c.1150C>T	c.(1150-1152)Cga>Tga	p.R384*	ADCK1_ENST00000556560.1_3'UTR|ADCK1_ENST00000341211.5_Nonsense_Mutation_p.R316*	NM_020421.3	NP_065154.2	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1	391	Protein kinase.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R316*(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(2)	25			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		GCTGACGGCGCGATCGTGGGA	0.602													C|||	2	0.000399361	0.0	0.0	5008	,	,		17780	0.0		0.002	False		,,,				2504	0.0				p.R384X		Atlas-SNP	.											ADCK1,colon,carcinoma,0,1	ADCK1	81	1	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1150T						scavenged	.						150.0	153.0	152.0					14																	78392248		2203	4300	6503	SO:0001587	stop_gained	57143	exon9			ACGGCGCGATCGT	AK096919	CCDS9869.1, CCDS45144.1	14q24	2005-10-30							19038	protein-coding gene	gene with protein product						12471243	Standard	NM_020421		Approved	FLJ39600	uc001xui.3	Q86TW2		ENST00000238561.5:c.1150C>T	14.37:g.78392248C>T	ENSP00000238561:p.Arg384*	Somatic	84	1	0.0119048		WXS	Illumina HiSeq	Phase_I	92	17	0.184783	NM_020421	B3KUD5|Q6PD65|Q9UIE6	Nonsense_Mutation	SNP	ENST00000238561.5	37	CCDS9869.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	21.1	4.096859	0.76870	.	.	ENSG00000063761	ENST00000238561;ENST00000341211	.	.	.	5.26	4.38	0.52667	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-41.0779	13.4374	0.61092	0.3432:0.6568:0.0:0.0	.	.	.	.	X	384;316	.	ENSP00000238561:R384X	R	+	1	2	ADCK1	77462001	1.000000	0.71417	0.911000	0.35937	0.100000	0.18952	4.008000	0.57103	1.215000	0.43411	-0.165000	0.13383	CGA	C|0.999;T|0.001	0.001	strong		0.602	ADCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413864.1	NM_020421	
DLC1	10395	hgsc.bcm.edu	37	8	12957770	12957770	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:12957770C>T	ENST00000276297.4	-	9	2485	c.2076G>A	c.(2074-2076)ttG>ttA	p.L692L	DLC1_ENST00000358919.2_Silent_p.L255L|DLC1_ENST00000512044.2_Silent_p.L289L|DLC1_ENST00000520226.1_Silent_p.L181L	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	692					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CGCTGATGATCAACCCCAGCT	0.572																																					p.L692L		Atlas-SNP	.											.	DLC1	411	.	0			c.G2076A						PASS	.						88.0	83.0	84.0					8																	12957770		2203	4300	6503	SO:0001819	synonymous_variant	10395	exon9			GATGATCAACCCC	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.2076G>A	8.37:g.12957770C>T		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	103	21	0.203883	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Silent	SNP	ENST00000276297.4	37	CCDS5989.1																																																																																			.	.	none		0.572	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
TRIM4	89122	hgsc.bcm.edu	37	7	99507230	99507230	+	Missense_Mutation	SNP	C	C	T	rs188783002		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr7:99507230C>T	ENST00000355947.2	-	3	654	c.525G>A	c.(523-525)atG>atA	p.M175I	TRIM4_ENST00000349062.2_Missense_Mutation_p.M149I|TRIM4_ENST00000354241.5_Missense_Mutation_p.M149I	NM_033017.3	NP_148977.2	Q9C037	TRIM4_HUMAN	tripartite motif containing 4	175					protein trimerization (GO:0070206)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	17	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				CCTGTAAATGCATGACTTTCT	0.453																																					p.M175I		Atlas-SNP	.											.	TRIM4	33	.	0			c.G525A						PASS	.						250.0	204.0	220.0					7																	99507230		2203	4300	6503	SO:0001583	missense	89122	exon3			TAAATGCATGACT	AF220023	CCDS5678.1, CCDS5679.1	7q22-q31.1	2013-01-09	2011-01-25		ENSG00000146833	ENSG00000146833		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16275	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM4"", ""tripartite motif protein 4"""		"""tripartite motif-containing 4"""			11331580	Standard	NM_033017		Approved	RNF87	uc003use.3	Q9C037	OTTHUMG00000156648	ENST00000355947.2:c.525G>A	7.37:g.99507230C>T	ENSP00000348216:p.Met175Ile	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	141	25	0.177305	NM_033017	A4D298|Q75MK1|Q96F06|Q9C036	Missense_Mutation	SNP	ENST00000355947.2	37	CCDS5679.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.528|1.528	-0.545076|-0.545076	0.04024|0.04024	.|.	.|.	ENSG00000146833|ENSG00000146833	ENST00000447480|ENST00000355947;ENST00000349062;ENST00000542799;ENST00000354241	.|T;T;T	.|0.66995	.|-0.11;-0.08;-0.24	2.55|2.55	-0.256|-0.256	0.12984|0.12984	.|.	.|.	.|.	.|.	.|.	T|T	0.46983|0.46983	0.1421|0.1421	N|N	0.25647|0.25647	0.755|0.755	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.09377	.|0.004;0.0;0.0	T|T	0.26258|0.26258	-1.0108|-1.0108	5|9	.|0.33141	.|T	.|0.24	.|.	5.0163|5.0163	0.14337|0.14337	0.0:0.5468:0.0:0.4532|0.0:0.5468:0.0:0.4532	.|.	.|149;149;175	.|Q9C037-3;Q9C037-2;Q9C037	.|.;.;TRIM4_HUMAN	T|I	51|175;149;5;149	.|ENSP00000348216:M175I;ENSP00000275736:M149I;ENSP00000346186:M149I	.|ENSP00000275736:M149I	A|M	-|-	1|3	0|0	TRIM4|TRIM4	99345166|99345166	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.579000|-0.579000	0.05834|0.05834	-0.071000|-0.071000	0.12886|0.12886	-0.262000|-0.262000	0.10625|0.10625	GCA|ATG	C|1.000;A|0.000	.	alt		0.453	TRIM4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345050.1	NM_033017	
CNPY2	10330	hgsc.bcm.edu	37	12	56712936	56712936	+	5'Flank	SNP	G	G	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:56712936G>C	ENST00000273308.4	-	0	0				PAN2_ENST00000548043.1_Silent_p.V1104V|PAN2_ENST00000549090.1_Intron|PAN2_ENST00000440411.3_Silent_p.V1100V|PAN2_ENST00000425394.2_Silent_p.V1104V|PAN2_ENST00000257931.5_Silent_p.V1103V	NM_014255.5	NP_055070.1	Q9Y2B0	CNPY2_HUMAN	canopy FGF signaling regulator 2						negative regulation of gene expression (GO:0010629)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of low-density lipoprotein particle clearance (GO:0010988)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)				large_intestine(2)|lung(2)	4						GGAACAGGTAGACAGTGTCAA	0.493																																					p.V1104V		Atlas-SNP	.											.	PAN2	107	.	0			c.C3312G						PASS	.						100.0	92.0	95.0					12																	56712936		2203	4300	6503	SO:0001631	upstream_gene_variant	9924	exon24			CAGGTAGACAGTG	AB015631	CCDS8914.1	12q15	2013-07-23	2013-07-23	2007-10-22		ENSG00000257727			13529	protein-coding gene	gene with protein product		605861	"""transmembrane protein 4"", ""canopy 2 homolog (zebrafish)"""	TMEM4		10072769, 15905959	Standard	NM_001190991		Approved	HP10390, ZSIG9, Cnpy2	uc001sku.2	Q9Y2B0	OTTHUMG00000170330		12.37:g.56712936G>C	Exception_encountered	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	131	30	0.229008	NM_001127460	B2R7B9|Q9UHE9	Silent	SNP	ENST00000273308.4	37	CCDS8914.1																																																																																			.	.	none		0.493	CNPY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408546.1	NM_014255	
RBFOX1	54715	hgsc.bcm.edu	37	16	7759118	7759118	+	Silent	SNP	C	C	T	rs372365163		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr16:7759118C>T	ENST00000550418.1	+	15	2044	c.1056C>T	c.(1054-1056)taC>taT	p.Y352Y	RBFOX1_ENST00000552089.1_Missense_Mutation_p.T387M|RBFOX1_ENST00000553186.1_Silent_p.Y325Y|RBFOX1_ENST00000547338.1_Silent_p.Y352Y|RBFOX1_ENST00000436368.2_Silent_p.Y373Y|RBFOX1_ENST00000355637.4_Missense_Mutation_p.T391M|RBFOX1_ENST00000311745.5_Silent_p.Y373Y|RBFOX1_ENST00000535565.2_Missense_Mutation_p.T327M|RBFOX1_ENST00000340209.4_Silent_p.Y357Y|RBFOX1_ENST00000547372.1_Missense_Mutation_p.T413M|RBFOX1_ENST00000422070.4_Silent_p.Y395Y	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	352					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						CCCCCACCTACGGCGTTGGTG	0.547																																					p.T391M	Ovarian(157;934 2567 15163 39509)	Atlas-SNP	.											RBFOX1_ENST00000550418,NS,carcinoma,0,3	RBFOX1	341	3	0			c.C1172T						PASS	.	C	,,,,,MET/THR	0,4394		0,0,2197	161.0	145.0	151.0		975,1056,1056,1119,1119,1172	5.7	1.0	16		151	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,missense	RBFOX1	NM_001142333.1,NM_001142334.1,NM_018723.3,NM_145891.2,NM_145892.2,NM_145893.2	,,,,,81	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	,,,,,	325/371,352/398,352/398,373/419,373/393,391/396	7759118	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	54715	exon13			CACCTACGGCGTT	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.1056C>T	16.37:g.7759118C>T		Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	193	96	0.497409	NM_145893	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	37	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.585513	0.66105	0.0	1.16E-4	ENSG00000078328	ENST00000547372;ENST00000535565;ENST00000552089;ENST00000355637	T;T	0.32515	1.45;1.68	5.65	5.65	0.86999	.	.	.	.	.	T	0.61286	0.2335	.	.	.	0.80722	D	1	D;P	0.89917	1.0;0.94	D;B	0.83275	0.996;0.37	T	0.64816	-0.6318	8	0.87932	D	0	-6.3857	19.7329	0.96190	0.0:1.0:0.0:0.0	.	327;391	F5H0M1;Q9NWB1-5	.;.	M	413;327;387;391	ENSP00000446842:T413M;ENSP00000347855:T391M	ENSP00000347855:T391M	T	+	2	0	RBFOX1	7699119	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.476000	0.66793	2.661000	0.90470	0.557000	0.71058	ACG	.	.	weak		0.547	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891	
PRAMEF1	65121	hgsc.bcm.edu	37	1	12854479	12854479	+	Missense_Mutation	SNP	C	C	G	rs1063775	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:12854479C>G	ENST00000332296.7	+	3	806	c.703C>G	c.(703-705)Cgc>Ggc	p.R235G	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	235					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAAGAATCTTCGCAAACTCGT	0.438													c|||	502	0.10024	0.115	0.0519	5008	,	,		29731	0.0685		0.0785	False		,,,				2504	0.1697				p.R235G		Atlas-SNP	.											PRAMEF1,NS,carcinoma,-1,2	PRAMEF1	78	2	0			c.C703G						scavenged	.						158.0	163.0	161.0					1																	12854479		2203	4300	6503	SO:0001583	missense	65121	exon3			AATCTTCGCAAAC	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.703C>G	1.37:g.12854479C>G	ENSP00000332134:p.Arg235Gly	Somatic	364	15	0.0412088		WXS	Illumina HiSeq	Phase_I	374	17	0.0454545	NM_023013	Q9UQP2	Missense_Mutation	SNP	ENST00000332296.7	37	CCDS148.1	.	.	.	.	.	.	.	.	.	.	.	6.921	0.539576	0.13250	.	.	ENSG00000116721	ENST00000332296	T	0.21543	2.0	1.61	1.61	0.23674	.	2.269980	0.01911	N	0.039880	T	0.27594	0.0678	M	0.74467	2.265	0.09310	N	0.999992	B	0.09022	0.002	B	0.06405	0.002	T	0.26916	-1.0089	10	0.39692	T	0.17	.	6.6557	0.22986	0.0:1.0:0.0:0.0	.	235	O95521	PRAM1_HUMAN	G	235	ENSP00000332134:R235G	ENSP00000332134:R235G	R	+	1	0	PRAMEF1	12777066	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	-0.124000	0.10595	1.196000	0.43129	0.436000	0.28706	CGC	C|0.811;G|0.187;T|0.002	0.187	strong		0.438	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013	
CSNK2A3	283106	hgsc.bcm.edu	37	11	11373697	11373697	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:11373697A>C	ENST00000528848.2	-	1	1207	c.970T>G	c.(970-972)Ttc>Gtc	p.F324V	GALNT18_ENST00000227756.4_Intron|RP11-567I13.1_ENST00000526867.1_RNA	NM_001256686.1	NP_001243615.1	Q8NEV1	CSK23_HUMAN	casein kinase 2, alpha 3 polypeptide	324	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)										ACAGTGTAGAAATAGGGGTGC	0.552																																					p.F324V		Atlas-SNP	.											.	.	.	.	0			c.T970G						PASS	.																																			SO:0001583	missense	283106	exon1			TGTAGAAATAGGG	X64692	CCDS59224.1	11p15.3	2013-01-18	2013-01-17	2013-01-17	ENSG00000254598	ENSG00000254598			2458	protein-coding gene	gene with protein product			"""casein kinase 2, alpha 1 polypeptide pseudogene"""	CSNK2A1P		12102635, 1610905, 20625391	Standard	NM_001256686		Approved		uc001mjp.4	Q8NEV1	OTTHUMG00000165708	ENST00000528848.2:c.970T>G	11.37:g.11373697A>C	ENSP00000473553:p.Phe324Val	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	74	19	0.256757	NM_001256686		Missense_Mutation	SNP	ENST00000528848.2	37	CCDS59224.1																																																																																			.	.	none		0.552	CSNK2A3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385850.3	NM_001256686	
BCL11A	53335	hgsc.bcm.edu	37	2	60689133	60689133	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:60689133G>A	ENST00000335712.6	-	4	1141	c.914C>T	c.(913-915)cCa>cTa	p.P305L	BCL11A_ENST00000537768.1_Intron|BCL11A_ENST00000358510.4_Missense_Mutation_p.P271L|BCL11A_ENST00000538214.1_Missense_Mutation_p.P271L|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000356842.4_Missense_Mutation_p.P305L|BCL11A_ENST00000359629.5_Intron	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	305	Pro-rich.				B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			CATAGCCATTGGATTCAACCG	0.632			T	IGH@	B-CLL																																p.P305L		Atlas-SNP	.		Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	BCL11A_ENST00000356842,caecum,carcinoma,0,5	BCL11A	298	5	0			c.C914T						PASS	.						50.0	56.0	54.0					2																	60689133		2203	4300	6503	SO:0001583	missense	53335	exon4			GCCATTGGATTCA	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.914C>T	2.37:g.60689133G>A	ENSP00000338774:p.Pro305Leu	Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	54	18	0.333333	NM_018014	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	37	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.691230	0.48097	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000335712;ENST00000358510	T;T;T;T	0.12569	2.87;2.67;2.83;2.68	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.35480	0.0933	L	0.58101	1.795	0.80722	D	1	D;P;P;D	0.67145	0.983;0.728;0.83;0.996	D;B;P;P	0.64410	0.925;0.277;0.49;0.889	T	0.01053	-1.1467	10	0.66056	D	0.02	-0.8491	20.139	0.98050	0.0:0.0:1.0:0.0	.	271;271;305;305	F5H2Y4;Q9H165-6;Q9H165;D9YZV9	.;.;BC11A_HUMAN;.	L	305;341;271;305;271	ENSP00000349300:P305L;ENSP00000438303:P271L;ENSP00000338774:P305L;ENSP00000351307:P271L	ENSP00000338774:P305L	P	-	2	0	BCL11A	60542637	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.764000	0.94973	0.655000	0.94253	CCA	.	.	none		0.632	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893	
POM121L12	285877	hgsc.bcm.edu	37	7	53104001	53104001	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr7:53104001C>T	ENST00000408890.4	+	1	653	c.637C>T	c.(637-639)Cgg>Tgg	p.R213W		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	213										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CCTGCAGCCCCGGCCCTCTGC	0.672																																					p.R213W		Atlas-SNP	.											POM121L12,NS,carcinoma,-2,1	POM121L12	146	1	0			c.C637T						PASS	.						45.0	55.0	52.0					7																	53104001		1974	4130	6104	SO:0001583	missense	285877	exon1			CAGCCCCGGCCCT		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.637C>T	7.37:g.53104001C>T	ENSP00000386133:p.Arg213Trp	Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	51	15	0.294118	NM_182595	Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	37	CCDS43584.1	.	.	.	.	.	.	.	.	.	.	C	7.515	0.655388	0.14580	.	.	ENSG00000221900	ENST00000408890	T	0.11277	2.79	1.8	0.644	0.17776	.	.	.	.	.	T	0.17450	0.0419	L	0.34521	1.04	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.13602	-1.0503	9	0.87932	D	0	.	4.709	0.12863	0.627:0.373:0.0:0.0	.	213	Q8N7R1	P1L12_HUMAN	W	213	ENSP00000386133:R213W	ENSP00000386133:R213W	R	+	1	2	POM121L12	53071495	0.000000	0.05858	0.069000	0.20011	0.053000	0.15095	-0.015000	0.12634	0.178000	0.19917	-0.397000	0.06425	CGG	.	.	none		0.672	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595	
UPK3B	80761	hgsc.bcm.edu	37	7	76143285	76143285	+	Silent	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr7:76143285A>G	ENST00000257632.5	+	3	776	c.648A>G	c.(646-648)cgA>cgG	p.R216R	UPK3B_ENST00000419923.2_Silent_p.R216R|UPK3B_ENST00000334348.3_Missense_Mutation_p.D188G|UPK3B_ENST00000448265.3_Silent_p.R216R|UPK3B_ENST00000394849.1_Silent_p.R161R|UPK3B_ENST00000443097.2_Missense_Mutation_p.D188G			Q9BT76	UPK3B_HUMAN	uroplakin 3B	216					negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				GGATCCATCGACACCTGGCCA	0.647																																					p.D188G		Atlas-SNP	.											.	UPK3B	15	.	0			c.A563G						PASS	.						169.0	121.0	137.0					7																	76143285		2203	4300	6503	SO:0001819	synonymous_variant	80761	exon5			CCATCGACACCTG	BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000257632.5:c.648A>G	7.37:g.76143285A>G		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	112	30	0.267857	NM_182684	A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	Missense_Mutation	SNP	ENST00000257632.5	37	CCDS5588.1	.	.	.	.	.	.	.	.	.	.	.	13.57	2.275948	0.40294	.	.	ENSG00000243566	ENST00000334348;ENST00000443097	T;T	0.58940	0.3;0.3	4.87	4.87	0.63330	.	.	.	.	.	T	0.60945	0.2308	.	.	.	0.34163	D	0.668931	P	0.39282	0.666	P	0.47134	0.539	T	0.71965	-0.4433	8	0.45353	T	0.12	.	11.8846	0.52594	1.0:0.0:0.0:0.0	.	188	A6NHH5	.	G	188	ENSP00000334938:D188G;ENSP00000444585:D188G	ENSP00000334938:D188G	D	+	2	0	UPK3B	75981221	1.000000	0.71417	1.000000	0.80357	0.217000	0.24651	4.525000	0.60559	1.831000	0.53308	0.260000	0.18958	GAC	.	.	none		0.647	UPK3B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313978.2	NM_030570	
AHCYL1	10768	hgsc.bcm.edu	37	1	110561015	110561015	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:110561015C>T	ENST00000369799.5	+	12	1511	c.1144C>T	c.(1144-1146)Cgg>Tgg	p.R382W	AHCYL1_ENST00000359172.3_Missense_Mutation_p.R335W|AHCYL1_ENST00000393614.4_Missense_Mutation_p.R335W	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1	382	NAD binding. {ECO:0000250}.				mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		TGTAGTGACACGGGAGCACTT	0.443																																					p.R382W		Atlas-SNP	.											.	AHCYL1	49	.	0			c.C1144T						PASS	.						87.0	75.0	79.0					1																	110561015		2203	4300	6503	SO:0001583	missense	10768	exon12			GTGACACGGGAGC	U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.1144C>T	1.37:g.110561015C>T	ENSP00000358814:p.Arg382Trp	Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	139	32	0.230216	NM_006621	B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Missense_Mutation	SNP	ENST00000369799.5	37	CCDS818.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070240	0.76301	.	.	ENSG00000168710	ENST00000369799;ENST00000359172;ENST00000393614	T;T;T	0.78126	-1.15;-1.13;-1.13	5.62	4.69	0.59074	S-adenosyl-L-homocysteine hydrolase, NAD binding (1);	0.000000	0.85682	D	0.000000	D	0.87958	0.6309	M	0.93328	3.405	0.80722	D	1	D	0.65815	0.995	D	0.67900	0.954	D	0.90425	0.4420	10	0.56958	D	0.05	-15.4423	13.7117	0.62672	0.3369:0.6631:0.0:0.0	.	382	O43865	SAHH2_HUMAN	W	382;335;335	ENSP00000358814:R382W;ENSP00000352092:R335W;ENSP00000377238:R335W	ENSP00000352092:R335W	R	+	1	2	AHCYL1	110362538	0.997000	0.39634	0.982000	0.44146	0.998000	0.95712	3.533000	0.53561	1.328000	0.45358	0.655000	0.94253	CGG	.	.	none		0.443	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032243.1		
PLK2	10769	hgsc.bcm.edu	37	5	57755718	57755718	+	Silent	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr5:57755718G>A	ENST00000274289.3	-	1	369	c.69C>T	c.(67-69)ggC>ggT	p.G23G	PLK2_ENST00000502671.1_5'Flank	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	23					G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		CGCAACCCTTGCCCAGCGCCT	0.697																																					p.G23G		Atlas-SNP	.											.	PLK2	71	.	0			c.C69T						PASS	.						18.0	21.0	20.0					5																	57755718		2203	4294	6497	SO:0001819	synonymous_variant	10769	exon1			ACCCTTGCCCAGC		CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.69C>T	5.37:g.57755718G>A		Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	151	29	0.192053	NM_006622	O60679|Q96CV7|Q9UE61	Silent	SNP	ENST00000274289.3	37	CCDS3974.1																																																																																			.	.	none		0.697	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214150.1	NM_006622	
ITGAV	3685	hgsc.bcm.edu	37	2	187521026	187521026	+	Silent	SNP	A	A	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:187521026A>C	ENST00000261023.3	+	17	1891	c.1617A>C	c.(1615-1617)cgA>cgC	p.R539R	AC017101.10_ENST00000453665.1_RNA|ITGAV_ENST00000374907.3_Silent_p.R503R|ITGAV_ENST00000433736.2_Silent_p.R493R	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	539					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	GAGCAATTCGACGAGCACTGT	0.423																																					p.R539R	Melanoma(58;108 1995 6081)	Atlas-SNP	.											ITGAV,rectum,carcinoma,+2,1	ITGAV	124	1	0			c.A1617C						PASS	.						199.0	197.0	198.0					2																	187521026		2203	4300	6503	SO:0001819	synonymous_variant	3685	exon17			AATTCGACGAGCA		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1617A>C	2.37:g.187521026A>C		Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	192	36	0.1875	NM_002210	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Silent	SNP	ENST00000261023.3	37	CCDS2292.1																																																																																			.	.	none		0.423	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210	
CNTRL	11064	hgsc.bcm.edu	37	9	123922502	123922502	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr9:123922502A>G	ENST00000373855.1	+	32	5271	c.5011A>G	c.(5011-5013)Aca>Gca	p.T1671A	CNTRL_ENST00000373844.1_Missense_Mutation_p.T116A|CNTRL_ENST00000373850.1_Missense_Mutation_p.T1119A|CNTRL_ENST00000238341.5_Missense_Mutation_p.T1671A|CNTRL_ENST00000373845.2_3'UTR			Q7Z7A1	CNTRL_HUMAN	centriolin	1671					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AACTCAACTTACACTTATAAA	0.308																																					p.T1671A		Atlas-SNP	.											.	CNTRL	161	.	0			c.A5011G						PASS	.						68.0	78.0	74.0					9																	123922502		2203	4291	6494	SO:0001583	missense	11064	exon30			CAACTTACACTTA	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.5011A>G	9.37:g.123922502A>G	ENSP00000362962:p.Thr1671Ala	Somatic	297	0	0		WXS	Illumina HiSeq	Phase_I	385	89	0.231169	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	A	6.384	0.438895	0.12104	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373850;ENST00000431571;ENST00000373845;ENST00000373844	T;T;T	0.28454	1.61;1.61;1.61	5.62	-2.39	0.06602	.	.	.	.	.	T	0.10637	0.0260	N	0.04880	-0.145	0.20821	N	0.999849	B	0.02656	0.0	B	0.01281	0.0	T	0.36672	-0.9738	9	0.08179	T	0.78	.	5.5625	0.17152	0.3011:0.0:0.4108:0.2881	.	1671	Q7Z7A1	CNTRL_HUMAN	A	1671;1671;1671;427;1119;340;353;116	ENSP00000362962:T1671A;ENSP00000238341:T1671A;ENSP00000362956:T1119A	ENSP00000238341:T1671A	T	+	1	0	CNTRL	122962323	0.022000	0.18835	0.991000	0.47740	0.958000	0.62258	-0.238000	0.08977	-0.267000	0.09325	-0.462000	0.05337	ACA	.	.	none		0.308	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
KRTAP4-6	81871	hgsc.bcm.edu	37	17	39296167	39296167	+	Silent	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:39296167A>G	ENST00000345847.4	-	1	572	c.573T>C	c.(571-573)atT>atC	p.I191I		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	191						keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						GGCAGGTGGAAATGACACAGG	0.627																																					p.I191I		Atlas-SNP	.											KRTAP4-6,bladder,carcinoma,0,9	KRTAP4-6	46	9	0			c.T573C						scavenged	.																																			SO:0001819	synonymous_variant	81871	exon1			GGTGGAAATGACA	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.573T>C	17.37:g.39296167A>G		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	123	4	0.0325203	NM_030976	Q9BYR1	Silent	SNP	ENST00000345847.4	37	CCDS54125.1																																																																																			.	.	none		0.627	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
TRIM48	79097	hgsc.bcm.edu	37	11	55032663	55032663	+	Missense_Mutation	SNP	T	T	C	rs200778682	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:55032663T>C	ENST00000417545.2	+	2	418	c.332T>C	c.(331-333)aTt>aCt	p.I111T		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	95						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						ATGTGTGGCATTCACAGGGAG	0.498																																					p.I111T		Atlas-SNP	.											TRIM48_ENST00000417545,NS,carcinoma,0,4	TRIM48	149	4	0			c.T332C						scavenged	.						98.0	90.0	93.0					11																	55032663		2188	4256	6444	SO:0001583	missense	79097	exon2			GTGGCATTCACAG	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.332T>C	11.37:g.55032663T>C	ENSP00000402414:p.Ile111Thr	Somatic	297	3	0.010101		WXS	Illumina HiSeq	Phase_I	293	6	0.0204778	NM_024114	Q9BUW4	Missense_Mutation	SNP	ENST00000417545.2	37	CCDS7947.2	.	.	.	.	.	.	.	.	.	.	c	0	-2.612529	0.00120	.	.	ENSG00000150244	ENST00000417545	T	0.40476	1.03	0.596	0.596	0.17496	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, B-box (3);	.	.	.	.	T	0.13114	0.0318	N	0.03324	-0.35	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28038	-1.0056	9	0.02654	T	1	.	1.7225	0.02915	0.3221:0.4182:0.0:0.2597	.	95	Q8IWZ4	TRI48_HUMAN	T	111	ENSP00000402414:I111T	ENSP00000402414:I111T	I	+	2	0	TRIM48	54789239	0.000000	0.05858	0.154000	0.22540	0.130000	0.20726	-4.117000	0.00292	-0.174000	0.10743	-1.141000	0.01876	ATT	T|0.996;C|0.004	0.004	strong		0.498	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1		
ISCU	23479	hgsc.bcm.edu	37	12	108956418	108956418	+	Missense_Mutation	SNP	T	T	G	rs67681514|rs10778648	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:108956418T>G	ENST00000311893.9	+	1	42	c.20T>G	c.(19-21)tTc>tGc	p.F7C	SART3_ENST00000431469.2_5'Flank|ISCU_ENST00000431221.2_Missense_Mutation_p.F7C|ISCU_ENST00000547005.1_Missense_Mutation_p.F7C|SART3_ENST00000228284.3_5'Flank|ISCU_ENST00000539593.1_Missense_Mutation_p.F7C|SART3_ENST00000546611.1_5'Flank|ISCU_ENST00000392807.4_5'UTR|ISCU_ENST00000338291.4_5'UTR|ISCU_ENST00000535729.1_Missense_Mutation_p.F7C|SART3_ENST00000552221.1_5'Flank	NM_213595.2	NP_998760.1	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme	7				F -> G (in Ref. 1; AAG37428 and 3; AAH11906). {ECO:0000305}.	iron-sulfur cluster assembly (GO:0016226)|nitrogen fixation (GO:0009399)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|iron-sulfur cluster binding (GO:0051536)|protein complex scaffold (GO:0032947)			kidney(2)|large_intestine(2)|lung(4)|prostate(2)|urinary_tract(1)	11						GCTGGGGCTTTCCGTCTGAGG	0.746													G|||	4477	0.89397	0.8396	0.8775	5008	,	,		9287	0.9544		0.8678	False		,,,				2504	0.9438				p.F7C		Atlas-SNP	.											.	ISCU	19	.	0			c.T20G						PASS	.						2.0	3.0	3.0					12																	108956418		1070	2757	3827	SO:0001583	missense	23479	exon1			GGGCTTTCCGTCT	U47101	CCDS9118.1, CCDS44966.1, CCDS73518.1	12q24.1	2013-08-05	2013-08-05	2006-10-24	ENSG00000136003	ENSG00000136003			29882	protein-coding gene	gene with protein product		611911	"""NifU-like N-terminal domain containing"", ""IscU iron-sulfur cluster scaffold homolog (E. coli)"", ""iron-sulfur cluster scaffold homolog (E. coli)"""	NIFUN		8875867, 11060020	Standard	XM_005268760		Approved	ISU2, hnifU, IscU	uc010sxc.2	Q9H1K1	OTTHUMG00000168420	ENST00000311893.9:c.20T>G	12.37:g.108956418T>G	ENSP00000310623:p.Phe7Cys	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	8	8	1	NM_213595	Q6P713|Q99617|Q9H1K2	Missense_Mutation	SNP	ENST00000311893.9	37	CCDS44966.1	1910	0.8745421245421245	424	0.8617886178861789	310	0.856353591160221	540	0.9440559440559441	636	0.8390501319261213	G	12.33	1.905794	0.33628	.	.	ENSG00000136003	ENST00000535729;ENST00000431221;ENST00000547005;ENST00000311893;ENST00000539593	T;T;T;T;T	0.64085	-0.08;-0.07;-0.08;-0.04;-0.05	4.95	4.95	0.65309	.	0.282027	0.39341	N	0.001397	T	0.00012	0.0000	N	0.08118	0	0.09310	P	0.9999999999988616	B;B;B;B	0.12630	0.003;0.004;0.003;0.006	B;B;B;B	0.06405	0.001;0.0;0.001;0.002	T	0.31558	-0.9939	9	0.38643	T	0.18	.	11.0295	0.47763	0.0:0.0:0.8142:0.1858	rs10778648;rs60304236	7;7;7;7	B3KQ30;Q9H1K1;B4DNC9;F5H5N2	.;ISCU_HUMAN;.;.	C	7	ENSP00000445598:F7C;ENSP00000411108:F7C;ENSP00000446606:F7C;ENSP00000310623:F7C;ENSP00000443272:F7C	ENSP00000310623:F7C	F	+	2	0	ISCU	107480548	0.080000	0.21391	0.698000	0.30274	0.062000	0.15995	0.932000	0.28884	1.467000	0.48044	-0.121000	0.15023	TTC	T|0.126;G|0.874	0.874	strong		0.746	ISCU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399693.1	NM_014301	
UCKL1	54963	hgsc.bcm.edu	37	20	62576008	62576008	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr20:62576008C>T	ENST00000354216.6	-	6	776	c.734G>A	c.(733-735)cGc>cAc	p.R245H	MIR647_ENST00000384823.1_RNA|UCKL1_ENST00000358711.3_Missense_Mutation_p.R245H|UCKL1_ENST00000369892.3_Missense_Mutation_p.R245H|UCKL1_ENST00000369908.5_Missense_Mutation_p.R230H|UCKL1_ENST00000492660.1_5'Flank	NM_017859.3	NP_060329.2	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	245					CTP salvage (GO:0044211)|UMP salvage (GO:0044206)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|uridine kinase activity (GO:0004849)			endometrium(3)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GTCCCGGCCGCGCTCACTGAT	0.607																																					p.R245H		Atlas-SNP	.											.	UCKL1	28	.	0			c.G734A						PASS	.						133.0	83.0	100.0					20																	62576008		2198	4298	6496	SO:0001583	missense	54963	exon6			CGGCCGCGCTCAC	AK000524	CCDS13547.1, CCDS54479.1	20q13.33	2012-09-20	2004-07-13	2004-07-13	ENSG00000198276	ENSG00000198276			15938	protein-coding gene	gene with protein product		610866	"""uridine kinase-like 1"""	URKL1			Standard	NM_017859		Approved	FLJ20517	uc010gkn.3	Q9NWZ5	OTTHUMG00000033003	ENST00000354216.6:c.734G>A	20.37:g.62576008C>T	ENSP00000346155:p.Arg245His	Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	132	38	0.287879	NM_017859	B7Z8N2|Q5JWV0|Q70AQ5|Q8N524|Q9H3Z2	Missense_Mutation	SNP	ENST00000354216.6	37	CCDS13547.1	.	.	.	.	.	.	.	.	.	.	C	33	5.253488	0.95336	.	.	ENSG00000198276	ENST00000354216;ENST00000369892;ENST00000358711;ENST00000369908	.	.	.	5.84	4.9	0.64082	Phosphoribulokinase/uridine kinase (1);	0.000000	0.85682	D	0.000000	D	0.91399	0.7286	H	0.99758	4.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.995	D	0.95029	0.8167	9	0.87932	D	0	-20.8731	14.9695	0.71223	0.0:0.9316:0.0:0.0684	.	230;245	B7Z8N2;Q9NWZ5	.;UCKL1_HUMAN	H	245;245;245;230	.	ENSP00000346155:R245H	R	-	2	0	UCKL1	62046452	1.000000	0.71417	0.322000	0.25334	0.878000	0.50629	5.657000	0.67996	1.489000	0.48450	0.561000	0.74099	CGC	.	.	none		0.607	UCKL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080236.1	NM_017859	
DNAH5	1767	hgsc.bcm.edu	37	5	13845064	13845064	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr5:13845064A>G	ENST00000265104.4	-	32	5257	c.5153T>C	c.(5152-5154)tTc>tCc	p.F1718S		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1718	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TGAGACGAAGAAAAACCGAGG	0.438									Kartagener syndrome																												p.F1718S		Atlas-SNP	.											DNAH5,scalp,malignant_melanoma,-1,1	DNAH5	868	1	0			c.T5153C						scavenged	.						76.0	78.0	77.0					5																	13845064		2203	4300	6503	SO:0001583	missense	1767	exon32	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	ACGAAGAAAAACC	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.5153T>C	5.37:g.13845064A>G	ENSP00000265104:p.Phe1718Ser	Somatic	78	1	0.0128205		WXS	Illumina HiSeq	Phase_I	82	28	0.341463	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.068037	0.76301	.	.	ENSG00000039139	ENST00000265104	T	0.65549	-0.16	4.85	4.85	0.62838	Dynein heavy chain, domain-2 (1);	0.052439	0.85682	D	0.000000	D	0.84822	0.5557	H	0.97707	4.06	0.80722	D	1	P	0.42735	0.788	P	0.58013	0.831	D	0.89587	0.3825	10	0.87932	D	0	.	14.5198	0.67842	1.0:0.0:0.0:0.0	.	1718	Q8TE73	DYH5_HUMAN	S	1718	ENSP00000265104:F1718S	ENSP00000265104:F1718S	F	-	2	0	DNAH5	13898064	1.000000	0.71417	1.000000	0.80357	0.484000	0.33280	9.141000	0.94612	1.840000	0.53500	0.529000	0.55759	TTC	.	.	none		0.438	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
TTYH2	94015	hgsc.bcm.edu	37	17	72233625	72233625	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:72233625G>A	ENST00000269346.4	+	4	681	c.607G>A	c.(607-609)Gac>Aac	p.D203N	TTYH2_ENST00000529107.1_Missense_Mutation_p.D182N	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	203						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						CAAGCTATCCGACCAGACTGG	0.577																																					p.D203N		Atlas-SNP	.											.	TTYH2	63	.	0			c.G607A						PASS	.						68.0	61.0	64.0					17																	72233625		2203	4300	6503	SO:0001583	missense	94015	exon4			CTATCCGACCAGA		CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.607G>A	17.37:g.72233625G>A	ENSP00000269346:p.Asp203Asn	Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	45	25	0.555556	NM_032646	B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Missense_Mutation	SNP	ENST00000269346.4	37	CCDS32717.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.256174	0.22965	.	.	ENSG00000141540	ENST00000269346;ENST00000529107	T;T	0.11063	2.81;2.81	5.52	-5.84	0.02318	.	0.886322	0.10208	N	0.702443	T	0.05868	0.0153	N	0.20610	0.595	0.09310	N	1	B;B	0.26975	0.165;0.011	B;B	0.22601	0.04;0.014	T	0.33929	-0.9849	10	0.41790	T	0.15	-7.3003	10.3533	0.43950	0.6543:0.1034:0.2424:0.0	.	182;203	B4DKD1;Q9BSA4	.;TTYH2_HUMAN	N	203;182	ENSP00000269346:D203N;ENSP00000433089:D182N	ENSP00000269346:D203N	D	+	1	0	TTYH2	69745220	0.006000	0.16342	0.038000	0.18304	0.152000	0.21847	0.352000	0.20113	-0.870000	0.04047	-0.734000	0.03567	GAC	.	.	none		0.577	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387459.1		
OC90	729330	hgsc.bcm.edu	37	8	133045291	133045291	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:133045291T>C	ENST00000443356.2	-	12	988	c.902A>G	c.(901-903)gAa>gGa	p.E301G	OC90_ENST00000262283.5_Missense_Mutation_p.E497G|OC90_ENST00000254627.3_Missense_Mutation_p.E285G|OC90_ENST00000603859.1_Missense_Mutation_p.E285G			Q02509	OC90_HUMAN	otoconin 90	301					lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			CTCACCTTTTTCAGTGGTCTC	0.493																																					p.E285G		Atlas-SNP	.											OC90_ENST00000262283,NS,carcinoma,-1,2	OC90	163	2	0			c.A854G						PASS	.						69.0	75.0	73.0					8																	133045291		2013	4178	6191	SO:0001583	missense	729330	exon11			CCTTTTTCAGTGG	Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.902A>G	8.37:g.133045291T>C	ENSP00000390050:p.Glu301Gly	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	64	9	0.140625	NM_001080399	B4DNG8	Missense_Mutation	SNP	ENST00000443356.2	37		.	.	.	.	.	.	.	.	.	.	T	0.567	-0.842871	0.02671	.	.	ENSG00000253117;ENSG00000253117;ENSG00000258417	ENST00000254627;ENST00000443356;ENST00000262283	T;T;T	0.30182	1.61;1.57;1.54	4.67	1.77	0.24775	.	1.009930	0.07936	N	0.978315	T	0.09024	0.0223	N	0.01168	-0.975	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.32322	-0.9911	10	0.02654	T	1	-0.7969	6.2646	0.20919	0.0:0.5341:0.3643:0.1016	.	285;301	Q02509-2;Q02509	.;OC90_HUMAN	G	285;301;497	ENSP00000254627:E285G;ENSP00000390050:E301G;ENSP00000262283:E497G	ENSP00000254627:E285G	E	-	2	0	RP11-240B13.2;OC90	133114473	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.862000	0.27899	0.395000	0.25257	-0.242000	0.12053	GAA	.	.	none		0.493	OC90-201	KNOWN	basic	protein_coding	protein_coding		NM_001080399	
MERTK	10461	hgsc.bcm.edu	37	2	112779062	112779062	+	Silent	SNP	C	C	T	rs149178674		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:112779062C>T	ENST00000295408.4	+	17	2510	c.2253C>T	c.(2251-2253)ggC>ggT	p.G751G	MERTK_ENST00000409780.1_Silent_p.G575G|MERTK_ENST00000421804.2_Silent_p.G751G			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	751	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G751G(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						TTTACAGTGGCGATTATTACC	0.478																																					p.G751G		Atlas-SNP	.											MERTK,colon,carcinoma,0,1	MERTK	112	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C2253T						PASS	.	C		1,4405	2.1+/-5.4	0,1,2202	151.0	145.0	147.0		2253	-10.5	0.1	2	dbSNP_134	147	0,8600		0,0,4300	no	coding-synonymous	MERTK	NM_006343.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		751/1000	112779062	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10461	exon17			CAGTGGCGATTAT	U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.2253C>T	2.37:g.112779062C>T		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	88	20	0.227273	NM_006343	Q9HBB4	Silent	SNP	ENST00000295408.4	37	CCDS2094.1																																																																																			C|1.000;T|0.000	0.000	weak		0.478	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2		
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493791	77493791	+	Silent	SNP	C	C	T	rs377151545		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr14:77493791C>T	ENST00000238647.3	-	1	1243	c.345G>A	c.(343-345)caG>caA	p.Q115Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	115	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						gctgctgctgctgttgctgct	0.697																																					p.Q115Q		Atlas-SNP	.											.	IRF2BPL	40	.	0			c.G345A						PASS	.						2.0	2.0	2.0					14																	77493791		1245	2269	3514	SO:0001819	synonymous_variant	64207	exon1			CTGCTGCTGTTGC	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.345G>A	14.37:g.77493791C>T		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	46	10	0.217391	NM_024496	Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	ENST00000238647.3	37	CCDS9854.1																																																																																			.	.	none		0.697	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
SULT1C2	6819	hgsc.bcm.edu	37	2	108917339	108917339	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:108917339C>G	ENST00000437390.2	+	4	542	c.365C>G	c.(364-366)aCt>aGt	p.T122S	SULT1C2_ENST00000251481.6_Missense_Mutation_p.T108S|SULT1C2_ENST00000409880.1_Intron|SULT1C2_ENST00000326853.5_Intron			O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 2	114					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						ATACTAAAGACTCACCTTTCC	0.478																																					p.T108S		Atlas-SNP	.											.	SULT1C2	82	.	0			c.C323G						PASS	.						180.0	200.0	194.0					2																	108917339		2203	4300	6503	SO:0001583	missense	6819	exon4			TAAAGACTCACCT	U66036, AF186255	CCDS2075.1, CCDS2076.1	2q12.3	2010-09-30	2007-03-16	2007-03-16	ENSG00000198203	ENSG00000198203		"""Sulfotransferases, cytosolic"""	11456	protein-coding gene	gene with protein product		602385	"""sulfotransferase family, cytosolic, 1C, member 1"""	SULT1C1		9169148, 10783263	Standard	NM_001056		Approved	ST1C1	uc002tdx.3	O00338	OTTHUMG00000153215	ENST00000437390.2:c.365C>G	2.37:g.108917339C>G	ENSP00000399651:p.Thr122Ser	Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	113	34	0.300885	NM_001056	Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	ENST00000437390.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.75|15.75	2.925506|2.925506	0.52759|0.52759	.|.	.|.	ENSG00000198203|ENSG00000198203	ENST00000409067|ENST00000251481;ENST00000437390	.|D;D	.|0.84516	.|-1.86;-1.86	4.31|4.31	4.31|4.31	0.51392|0.51392	.|Sulfotransferase domain (1);	.|.	.|.	.|.	.|.	T|T	0.81912|0.81912	0.4923|0.4923	L|L	0.47016|0.47016	1.485|1.485	0.36646|0.36646	D|D	0.877121|0.877121	.|B;B	.|0.13594	.|0.008;0.002	.|B;B	.|0.27715	.|0.082;0.03	T|T	0.79773|0.79773	-0.1662|-0.1662	5|9	.|0.23891	.|T	.|0.37	.|.	15.9394|15.9394	0.79743|0.79743	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|122;108	.|B4DLP0;O00338	.|.;ST1C2_HUMAN	E|S	104|108;122	.|ENSP00000251481:T108S;ENSP00000399651:T122S	.|ENSP00000251481:T108S	D|T	+|+	3|2	2|0	SULT1C2|SULT1C2	108283771|108283771	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.891000|0.891000	0.51852|0.51852	4.926000|4.926000	0.63433|0.63433	2.225000|2.225000	0.72522|0.72522	0.591000|0.591000	0.81541|0.81541	GAC|ACT	.	.	none		0.478	SULT1C2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000329969.2	NM_176825	
UBR4	23352	hgsc.bcm.edu	37	1	19494536	19494536	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:19494536G>A	ENST00000375254.3	-	28	3911	c.3884C>T	c.(3883-3885)aCt>aTt	p.T1295I	UBR4_ENST00000375226.2_Missense_Mutation_p.T1295I|UBR4_ENST00000375267.2_Missense_Mutation_p.T1295I|UBR4_ENST00000375217.2_Missense_Mutation_p.T1295I	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1295					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AAGATCTCCAGTCAACCTGAC	0.483																																					p.T1295I		Atlas-SNP	.											.	UBR4	415	.	0			c.C3884T						PASS	.						123.0	121.0	122.0					1																	19494536		2203	4300	6503	SO:0001583	missense	23352	exon28			TCTCCAGTCAACC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.3884C>T	1.37:g.19494536G>A	ENSP00000364403:p.Thr1295Ile	Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	70	18	0.257143	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.153495	0.57259	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.82	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.44435	0.1293	N	0.11927	0.2	0.80722	D	1	P	0.42039	0.769	B	0.41299	0.353	T	0.36986	-0.9725	10	0.09843	T	0.71	.	15.8923	0.79309	0.0:0.0:0.8634:0.1366	.	1295	Q5T4S7	UBR4_HUMAN	I	1295;1295;1295;1295;5;511	ENSP00000364403:T1295I;ENSP00000364416:T1295I;ENSP00000364365:T1295I;ENSP00000364374:T1295I	ENSP00000364365:T1295I	T	-	2	0	UBR4	19367123	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.633000	0.83260	1.434000	0.47414	0.655000	0.94253	ACT	.	.	none		0.483	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
POTEH	23784	hgsc.bcm.edu	37	22	16287663	16287663	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr22:16287663T>C	ENST00000343518.6	-	1	274	c.223A>G	c.(223-225)Agc>Ggc	p.S75G		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	75										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CTCTTGCCGCTCCCCCTGCAC	0.582																																					p.S75G		Atlas-SNP	.											POTEH,colon,carcinoma,+2,2	POTEH	114	2	0			c.A223G						scavenged	.						88.0	103.0	98.0					22																	16287663		2089	3885	5974	SO:0001583	missense	23784	exon1			TGCCGCTCCCCCT	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.223A>G	22.37:g.16287663T>C	ENSP00000340610:p.Ser75Gly	Somatic	757	10	0.01321		WXS	Illumina HiSeq	Phase_I	780	15	0.0192308	NM_001136213	A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	ENST00000343518.6	37	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	.	6.051	0.377727	0.11466	.	.	ENSG00000198062	ENST00000343518;ENST00000355872	T	0.33865	1.39	.	.	.	.	.	.	.	.	T	0.32071	0.0817	L	0.52573	1.65	0.09310	N	1	B	0.26041	0.14	B	0.32805	0.153	T	0.40572	-0.9556	7	0.87932	D	0	.	.	.	.	.	75	Q6S545	POTEH_HUMAN	G	75	ENSP00000340610:S75G	ENSP00000340610:S75G	S	-	1	0	POTEH	14667663	0.008000	0.16893	0.070000	0.20053	0.071000	0.16799	0.280000	0.18790	0.129000	0.18514	0.128000	0.15822	AGC	.	.	none		0.582	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
EP400	57634	hgsc.bcm.edu	37	12	132547093	132547093	+	Silent	SNP	A	A	G	rs10902490|rs528214697	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:132547093A>G	ENST00000333577.4	+	48	8398	c.8289A>G	c.(8287-8289)caA>caG	p.Q2763Q	EP400_ENST00000330386.6_Silent_p.Q2646Q|EP400_ENST00000389561.2_Silent_p.Q2727Q|EP400_ENST00000389562.2_Silent_p.Q2726Q|EP400_ENST00000332482.4_Silent_p.Q2690Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2763	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2726Q(9)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacaacagcagcagc	0.567																																					p.Q2727Q		Atlas-SNP	.											EP400,NS,carcinoma,0,15	EP400	370	15	9	Substitution - coding silent(9)	lung(3)|kidney(2)|endometrium(2)|central_nervous_system(2)	c.A8181G						PASS	.						25.0	29.0	28.0					12																	132547093		2173	4217	6390	SO:0001819	synonymous_variant	57634	exon47			GCAACAACAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8289A>G	12.37:g.132547093A>G		Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	91	9	0.0989011	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				A|0.500;G|0.500	0.500	weak		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
PIM1	5292	hgsc.bcm.edu	37	6	37139191	37139191	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:37139191C>T	ENST00000373509.5	+	4	904	c.531C>T	c.(529-531)ctC>ctT	p.L177L		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	268	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	TTATCGACCTCAATCGCGGCG	0.637			T	BCL6	NHL																																p.L268L		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C804T						PASS	.						37.0	38.0	37.0					6																	37139191		2203	4300	6503	SO:0001819	synonymous_variant	5292	exon4			CGACCTCAATCGC		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.531C>T	6.37:g.37139191C>T		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	90	28	0.311111	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.637	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
TADA2B	93624	hgsc.bcm.edu	37	4	7056150	7056150	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr4:7056150G>A	ENST00000310074.7	+	2	821	c.632G>A	c.(631-633)cGg>cAg	p.R211Q	TADA2B_ENST00000512388.1_Missense_Mutation_p.R136Q|TADA2B_ENST00000515646.1_Missense_Mutation_p.R119Q	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	211					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						ATGTACGTGCGGAAGCTGAAA	0.582																																					p.R211Q		Atlas-SNP	.											TADA2B,rectum,carcinoma,-1,1	TADA2B	29	1	0			c.G632A						PASS	.						83.0	89.0	87.0					4																	7056150		2034	4200	6234	SO:0001583	missense	93624	exon2			ACGTGCGGAAGCT	AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.632G>A	4.37:g.7056150G>A	ENSP00000308022:p.Arg211Gln	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	81	22	0.271605	NM_152293	A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Missense_Mutation	SNP	ENST00000310074.7	37	CCDS47007.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277741	0.59758	.	.	ENSG00000173011	ENST00000506692;ENST00000310074;ENST00000512388;ENST00000515646;ENST00000510704	T;T;T;T;T	0.44881	0.91;0.99;0.99;0.99;0.99	5.29	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.52725	0.1752	L	0.39633	1.23	0.80722	D	1	D;D	0.89917	1.0;0.975	D;B	0.70227	0.968;0.31	T	0.44590	-0.9318	10	0.24483	T	0.36	-38.7557	14.8658	0.70416	0.0:0.0:0.8552:0.1448	.	136;211	Q86TJ2-2;Q86TJ2	.;TAD2B_HUMAN	Q	119;211;136;119;119	ENSP00000422398:R119Q;ENSP00000308022:R211Q;ENSP00000423947:R136Q;ENSP00000423181:R119Q;ENSP00000425731:R119Q	ENSP00000308022:R211Q	R	+	2	0	TADA2B	7107051	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	9.325000	0.96381	1.163000	0.42636	0.561000	0.74099	CGG	.	.	none		0.582	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358687.2	NM_152293	
NAV3	89795	hgsc.bcm.edu	37	12	78571048	78571048	+	Missense_Mutation	SNP	G	G	T	rs555983392		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:78571048G>T	ENST00000397909.2	+	27	5425	c.5252G>T	c.(5251-5253)gGt>gTt	p.G1751V	NAV3_ENST00000228327.6_Missense_Mutation_p.G1751V|NAV3_ENST00000266692.7_Missense_Mutation_p.G1574V|NAV3_ENST00000536525.2_Missense_Mutation_p.G1751V			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1751						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CATAATGCTGGTGACTGTGGC	0.443										HNSCC(70;0.22)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		17214	0.0		0.0	False		,,,				2504	0.0				p.G1751V		Atlas-SNP	.											.	NAV3	506	.	0			c.G5252T						PASS	.						121.0	112.0	115.0					12																	78571048		1909	4132	6041	SO:0001583	missense	89795	exon27			ATGCTGGTGACTG	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.5252G>T	12.37:g.78571048G>T	ENSP00000381007:p.Gly1751Val	Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	171	68	0.397661	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.01|12.01	1.808147|1.808147	0.31961|0.31961	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788|ENST00000552895	D;D;D;D;D|.	0.93076|.	-3.16;-3.16;-3.16;-3.16;-3.16|.	5.95|5.95	5.01|5.01	0.66863|0.66863	.|.	0.000000|.	0.40818|.	U|.	0.001019|.	T|T	0.52468|0.52468	0.1736|0.1736	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	P;B;P;B|.	0.50617|.	0.57;0.001;0.937;0.017|.	B;B;B;B|.	0.43536|.	0.147;0.003;0.423;0.008|.	T|T	0.43147|0.43147	-0.9409|-0.9409	10|5	0.56958|.	D|.	0.05|.	-13.5845|-13.5845	10.0624|10.0624	0.42284|0.42284	0.0709:0.1386:0.7906:0.0|0.0709:0.1386:0.7906:0.0	.|.	1751;1574;1751;1751|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	V|C	1751;1751;1751;1574;365;373|645	ENSP00000446132:G1751V;ENSP00000381007:G1751V;ENSP00000228327:G1751V;ENSP00000266692:G1574V;ENSP00000448303:G373V|.	ENSP00000228327:G1751V|.	G|W	+|+	2|3	0|0	NAV3|NAV3	77095179|77095179	0.914000|0.914000	0.31030|0.31030	0.895000|0.895000	0.35142|0.35142	0.183000|0.183000	0.23260|0.23260	2.930000|2.930000	0.48924|0.48924	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	GGT|TGG	.	.	none		0.443	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
MPEG1	219972	hgsc.bcm.edu	37	11	58978306	58978306	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:58978306C>T	ENST00000361050.3	-	1	2118	c.2033G>A	c.(2032-2034)gGc>gAc	p.G678D		NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	678						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				CTTCCGGGTGCCGTAGATGGC	0.547																																					p.G678D		Atlas-SNP	.											MPEG1,NS,carcinoma,-1,1	MPEG1	72	1	0			c.G2033A						PASS	.						133.0	135.0	134.0					11																	58978306		2039	4175	6214	SO:0001583	missense	219972	exon1			CGGGTGCCGTAGA	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.2033G>A	11.37:g.58978306C>T	ENSP00000354335:p.Gly678Asp	Somatic	158	0	0		WXS	Illumina HiSeq	Phase_I	208	57	0.274038	NM_001039396	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	ENST00000361050.3	37	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	C	16.17	3.047131	0.55110	.	.	ENSG00000197629	ENST00000361050	T	0.23950	1.88	5.54	4.61	0.57282	.	0.370520	0.28510	N	0.015081	T	0.41396	0.1157	M	0.64997	1.995	0.34444	D	0.699936	D	0.59767	0.986	P	0.56398	0.797	T	0.59273	-0.7485	10	0.66056	D	0.02	-20.5924	12.8488	0.57846	0.1634:0.8366:0.0:0.0	.	678	Q2M385	MPEG1_HUMAN	D	678	ENSP00000354335:G678D	ENSP00000354335:G678D	G	-	2	0	MPEG1	58734882	0.025000	0.19082	0.349000	0.25694	0.852000	0.48524	2.436000	0.44819	1.286000	0.44565	0.655000	0.94253	GGC	.	.	none		0.547	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
SORL1	6653	hgsc.bcm.edu	37	11	121323082	121323082	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:121323082C>A	ENST00000260197.7	+	1	171	c.42C>A	c.(40-42)ttC>ttA	p.F14L	RP11-730K11.1_ENST00000529160.1_RNA|RP11-730K11.1_ENST00000501964.1_RNA	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	14					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GACTCCCGTTCCTATTCACCC	0.697																																					p.F14L		Atlas-SNP	.											.	SORL1	218	.	0			c.C42A						PASS	.						12.0	11.0	12.0					11																	121323082		2181	4277	6458	SO:0001583	missense	6653	exon1			CCCGTTCCTATTC	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.42C>A	11.37:g.121323082C>A	ENSP00000260197:p.Phe14Leu	Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	55	12	0.218182	NM_003105	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.826352	0.50739	.	.	ENSG00000137642	ENST00000260197	D	0.90444	-2.67	3.8	3.8	0.43715	.	0.671312	0.13420	N	0.389241	T	0.78861	0.4350	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.70861	-0.4757	10	0.13470	T	0.59	.	11.0822	0.48066	0.0:1.0:0.0:0.0	.	14	Q92673	SORL_HUMAN	L	14	ENSP00000260197:F14L	ENSP00000260197:F14L	F	+	3	2	SORL1	120828292	1.000000	0.71417	0.996000	0.52242	0.978000	0.69477	1.878000	0.39608	1.985000	0.57927	0.442000	0.29010	TTC	.	.	none		0.697	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
PRAMEF1	65121	hgsc.bcm.edu	37	1	12854356	12854356	+	Missense_Mutation	SNP	T	T	C	rs61775051		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:12854356T>C	ENST00000332296.7	+	3	683	c.580T>C	c.(580-582)Tat>Cat	p.Y194H	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	194					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCCGATTAAATATCTCAGAAA	0.403																																					p.Y194H		Atlas-SNP	.											PRAMEF1,NS,carcinoma,-2,2	PRAMEF1	78	2	0			c.T580C						scavenged	.						217.0	230.0	226.0					1																	12854356		2202	4300	6502	SO:0001583	missense	65121	exon3			ATTAAATATCTCA	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.580T>C	1.37:g.12854356T>C	ENSP00000332134:p.Tyr194His	Somatic	439	26	0.0592255		WXS	Illumina HiSeq	Phase_I	478	33	0.0690377	NM_023013	Q9UQP2	Missense_Mutation	SNP	ENST00000332296.7	37	CCDS148.1	.	.	.	.	.	.	.	.	.	.	.	4.661	0.122825	0.08931	.	.	ENSG00000116721	ENST00000332296	T	0.14516	2.5	1.74	0.543	0.17179	.	1.116300	0.06718	N	0.774313	T	0.08537	0.0212	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.39461	-0.9613	10	0.39692	T	0.17	.	3.7512	0.08568	0.6501:0.0:0.0:0.3499	rs61775051	194	O95521	PRAM1_HUMAN	H	194	ENSP00000332134:Y194H	ENSP00000332134:Y194H	Y	+	1	0	PRAMEF1	12776943	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.383000	0.20651	0.121000	0.18284	-0.731000	0.03576	TAT	T|0.500;C|0.500	0.500	strong		0.403	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013	
IGLL5	100423062	hgsc.bcm.edu	37	22	23235999	23235999	+	Splice_Site	SNP	G	G	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr22:23235999G>C	ENST00000526893.1	+	2	599		c.e2+1		IGLC1_ENST00000390321.2_RNA|IGLL5_ENST00000532223.2_Splice_Site|IGLJ1_ENST00000390320.2_RNA|IGLL5_ENST00000531372.1_Intron	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5							extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						ACCGTCCTAGGTAAGTGGCTC	0.587																																					.		Atlas-SNP	.											.	IGLL5	26	.	0			c.325+1G>C						PASS	.						88.0	100.0	96.0					22																	23235999		2136	4255	6391	SO:0001630	splice_region_variant	100423062	exon2			TCCTAGGTAAGTG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.325+1G>C	22.37:g.23235999G>C		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	75	21	0.28	NM_001178126		Splice_Site	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	9.342	1.063224	0.19987	.	.	ENSG00000254709	ENST00000532223;ENST00000526893	.	.	.	3.51	3.51	0.40186	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7103	0.45980	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IGLL5	21565999	1.000000	0.71417	0.997000	0.53966	0.297000	0.27493	4.982000	0.63825	1.990000	0.58119	0.491000	0.48974	.	.	.	none		0.587	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	Intron
OSBPL10	114884	hgsc.bcm.edu	37	3	32022601	32022601	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:32022601G>A	ENST00000396556.2	-	1	193	c.71C>T	c.(70-72)gCt>gTt	p.A24V	OSBPL10_ENST00000438237.2_Missense_Mutation_p.A24V|ZNF860_ENST00000360311.4_5'Flank	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	24					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		CGCCGAGGTAGCACGgctgct	0.781																																					p.A24V		Atlas-SNP	.											.	OSBPL10	160	.	0			c.C71T						PASS	.						2.0	2.0	2.0					3																	32022601		815	1738	2553	SO:0001583	missense	114884	exon1			GAGGTAGCACGGC	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.71C>T	3.37:g.32022601G>A	ENSP00000379804:p.Ala24Val	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	114	32	0.280702	NM_017784	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.860887	0.51482	.	.	ENSG00000144645	ENST00000396556;ENST00000438237	T;T	0.22539	1.95;2.28	4.02	3.12	0.35913	.	1.483920	0.05400	N	0.540468	T	0.15652	0.0377	N	0.14661	0.345	0.27329	N	0.956829	B;B	0.12630	0.006;0.006	B;B	0.09377	0.002;0.004	T	0.24657	-1.0154	10	0.49607	T	0.09	-5.9363	10.905	0.47076	0.0:0.0:0.8107:0.1893	.	24;24	B4E212;Q9BXB5	.;OSB10_HUMAN	V	24	ENSP00000379804:A24V;ENSP00000406124:A24V	ENSP00000379804:A24V	A	-	2	0	OSBPL10	31997605	0.989000	0.36119	1.000000	0.80357	0.924000	0.55760	1.025000	0.30090	1.010000	0.39314	0.298000	0.19748	GCT	.	.	none		0.781	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
MUC6	4588	hgsc.bcm.edu	37	11	1016851	1016851	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:1016851T>C	ENST00000421673.2	-	31	6000	c.5950A>G	c.(5950-5952)Atg>Gtg	p.M1984V		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1984	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTTGCAGTCATAGGACCTGTG	0.582																																					p.M1984V		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,+2,2	MUC6	408	2	0			c.A5950G						scavenged	.						1531.0	1522.0	1525.0					11																	1016851		2203	4298	6501	SO:0001583	missense	4588	exon31			CAGTCATAGGACC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5950A>G	11.37:g.1016851T>C	ENSP00000406861:p.Met1984Val	Somatic	659	23	0.0349014		WXS	Illumina HiSeq	Phase_I	668	25	0.0374251	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	1.757	-0.487796	0.04352	.	.	ENSG00000184956	ENST00000421673	T	0.17370	2.28	2.75	-1.23	0.09465	.	.	.	.	.	T	0.10809	0.0264	L	0.43152	1.355	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45205	-0.9277	9	0.06365	T	0.9	.	7.0983	0.25321	0.0:0.1589:0.2688:0.5723	.	1984	Q6W4X9	MUC6_HUMAN	V	1984	ENSP00000406861:M1984V	ENSP00000406861:M1984V	M	-	1	0	MUC6	1006851	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.137000	0.00588	-0.732000	0.04856	-2.319000	0.00253	ATG	.	.	none		0.582	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
GRM2	2912	hgsc.bcm.edu	37	3	51749480	51749480	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:51749480G>T	ENST00000395052.3	+	4	1925	c.1691G>T	c.(1690-1692)gGc>gTc	p.G564V	GRM2_ENST00000475478.1_3'UTR|GRM2_ENST00000442933.2_Intron	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	564					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ATCCGCTGGGGCGATGCCTGG	0.622																																					p.G564V		Atlas-SNP	.											GRM2,caecum,carcinoma,-1,1	GRM2	91	1	0			c.G1691T						PASS	.						48.0	44.0	45.0					3																	51749480		2202	4300	6502	SO:0001583	missense	2912	exon4			GCTGGGGCGATGC	L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.1691G>T	3.37:g.51749480G>T	ENSP00000378492:p.Gly564Val	Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	75	18	0.24	NM_000839	B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	37	CCDS2834.1	.	.	.	.	.	.	.	.	.	.	G	10.15	1.272267	0.23221	.	.	ENSG00000164082	ENST00000395052	D	0.89123	-2.47	5.3	4.43	0.53597	.	0.113989	0.64402	D	0.000013	D	0.83133	0.5188	L	0.43923	1.385	0.80722	D	1	B	0.20887	0.049	B	0.14023	0.01	T	0.78650	-0.2121	10	0.41790	T	0.15	.	9.2087	0.37304	0.2103:0.0:0.7897:0.0	.	564	Q14416	GRM2_HUMAN	V	564	ENSP00000378492:G564V	ENSP00000378492:G564V	G	+	2	0	GRM2	51724520	0.997000	0.39634	0.990000	0.47175	0.837000	0.47467	3.121000	0.50438	1.398000	0.46701	0.561000	0.74099	GGC	.	.	none		0.622	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1		
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493794	77493794	+	Silent	SNP	T	T	C	rs377151545|rs28718623|rs71125518	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr14:77493794T>C	ENST00000238647.3	-	1	1240	c.342A>G	c.(340-342)caA>caG	p.Q114Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	114	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						gctgctgctgttgctgctgct	0.697													T|||	1146	0.228834	0.1649	0.1758	5008	,	,		5976	0.2659		0.2614	False		,,,				2504	0.2812				p.Q114Q		Atlas-SNP	.											.	IRF2BPL	40	.	0			c.A342G						PASS	.	-		160,2330		6,148,1091	2.0	2.0	2.0		342	0.6	0.0	14	dbSNP_125	2	324,4012		7,310,1851	no	coding-synonymous	IRF2BPL	NM_024496.2		13,458,2942	CC,CT,TT		7.4723,6.4257,7.0905		114/797	77493794	484,6342	1245	2168	3413	SO:0001819	synonymous_variant	64207	exon1			CTGCTGTTGCTGC	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.342A>G	14.37:g.77493794T>C		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	28	25	0.892857	NM_024496	Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	ENST00000238647.3	37	CCDS9854.1																																																																																			.	.	weak		0.697	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
CD79B	974	hgsc.bcm.edu	37	17	62006799	62006799	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:62006799A>G	ENST00000006750.3	-	5	678	c.586T>C	c.(586-588)Tac>Cac	p.Y196H	CD79B_ENST00000392795.3_Missense_Mutation_p.Y197H|CD79B_ENST00000349817.2_Missense_Mutation_p.Y92H	NM_000626.2|NM_021602.2	NP_000617.1|NP_067613.1	P40259	CD79B_HUMAN	CD79b molecule, immunoglobulin-associated beta	196	ITAM. {ECO:0000255|PROSITE- ProRule:PRU00379}.				B cell receptor signaling pathway (GO:0050853)|immune response (GO:0006955)|signal transduction (GO:0007165)	B cell receptor complex (GO:0019815)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)	p.Y196H(2)|p.Y196N(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	15						CTTACCTCGTAGGTGTGATCT	0.632			"""Mis, O"""		DLBCL																																p.Y197H		Atlas-SNP	.		Dom	yes		17	17q23	974	"""CD79b molecule, immunoglobulin-associated beta"""		L	CD79B,NS,lymphoid_neoplasm,0,13	CD79B	38	13	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)	c.T589C						scavenged	.						94.0	74.0	81.0					17																	62006799		2203	4300	6503	SO:0001583	missense	974	exon5			CCTCGTAGGTGTG	L27587	CCDS11655.1, CCDS11656.1, CCDS42372.1	17q23	2014-09-17	2006-03-28			ENSG00000007312		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1699	protein-coding gene	gene with protein product		147245	"""CD79B antigen (immunoglobulin-associated beta)"""	IGB		9545642	Standard	XM_005257858		Approved	B29	uc002jdp.1	P40259		ENST00000006750.3:c.586T>C	17.37:g.62006799A>G	ENSP00000006750:p.Tyr196His	Somatic	67	1	0.0149254		WXS	Illumina HiSeq	Phase_I	77	36	0.467532	NM_001039933	Q53FS2|Q9BU06	Missense_Mutation	SNP	ENST00000006750.3	37	CCDS11655.1	.	.	.	.	.	.	.	.	.	.	A	14.26	2.482264	0.44147	.	.	ENSG00000007312	ENST00000349817;ENST00000392795;ENST00000006750	D;D;D	0.96651	-4.08;-4.08;-4.08	4.2	4.2	0.49525	.	0.000000	0.64402	D	0.000002	D	0.95601	0.8570	N	0.24115	0.695	0.45172	D	0.998183	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	D	0.95387	0.8478	10	0.87932	D	0	-12.4743	9.5967	0.39578	1.0:0.0:0.0:0.0	.	92;196	P40259-2;P40259	.;CD79B_HUMAN	H	92;197;196	ENSP00000245862:Y92H;ENSP00000376544:Y197H;ENSP00000006750:Y196H	ENSP00000006750:Y196H	Y	-	1	0	CD79B	59360531	1.000000	0.71417	0.995000	0.50966	0.298000	0.27526	4.559000	0.60796	1.782000	0.52362	0.358000	0.22013	TAC	.	.	none		0.632	CD79B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417711.1		
HECTD1	25831	hgsc.bcm.edu	37	14	31626395	31626395	+	Silent	SNP	G	G	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr14:31626395G>T	ENST00000399332.1	-	11	2225	c.1737C>A	c.(1735-1737)atC>atA	p.I579I	HECTD1_ENST00000553700.1_Silent_p.I579I	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	579					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		CAGTTGCAGTGATTTCCACTA	0.323																																					p.I579I		Atlas-SNP	.											.	HECTD1	159	.	0			c.C1737A						PASS	.						181.0	171.0	174.0					14																	31626395		1847	4099	5946	SO:0001819	synonymous_variant	25831	exon11			TGCAGTGATTTCC	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.1737C>A	14.37:g.31626395G>T		Somatic	194	0	0		WXS	Illumina HiSeq	Phase_I	320	79	0.246875	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Silent	SNP	ENST00000399332.1	37	CCDS41939.1																																																																																			.	.	none		0.323	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
PIM1	5292	hgsc.bcm.edu	37	6	37138625	37138625	+	Nonsense_Mutation	SNP	C	C	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:37138625C>G	ENST00000373509.5	+	2	532	c.159C>G	c.(157-159)taC>taG	p.Y53*		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	144					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)	p.Y53Y(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GCTCGGTCTACTCAGGCATCC	0.721			T	BCL6	NHL																																p.Y144X		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,carcinoma,+2,2	PIM1	71	2	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	c.C432G						PASS	.						20.0	29.0	26.0					6																	37138625		2183	4281	6464	SO:0001587	stop_gained	5292	exon2			GGTCTACTCAGGC		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.159C>G	6.37:g.37138625C>G	ENSP00000362608:p.Tyr53*	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	82	42	0.512195	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Nonsense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	39	7.820184	0.98507	.	.	ENSG00000137193	ENST00000373509	.	.	.	4.64	3.49	0.39957	.	0.347466	0.27618	N	0.018561	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.3647	0.32380	0.0:0.7776:0.0:0.2224	.	.	.	.	X	53	.	ENSP00000362608:Y53X	Y	+	3	2	PIM1	37246603	0.705000	0.27846	0.996000	0.52242	0.994000	0.84299	0.438000	0.21559	2.294000	0.77228	0.549000	0.68633	TAC	.	.	none		0.721	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240549	39240549	+	Missense_Mutation	SNP	C	C	G	rs200397258	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:39240549C>G	ENST00000391417.4	+	1	91	c.91C>G	c.(91-93)Cag>Gag	p.Q31E		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	31	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						CAGCTGCTGTCAGACCACCTG	0.632													c|||	90	0.0179712	0.0416	0.013	5008	,	,		15484	0.0198		0.004	False		,,,				2504	0.002				p.Q31E		Atlas-SNP	.											KRTAP4-9_ENST00000377734,right_lower_lobe,carcinoma,0,2	KRTAP4-7	49	2	0			c.C91G						scavenged	.						16.0	23.0	21.0					17																	39240549		692	1591	2283	SO:0001583	missense	100132476	exon1			TGCTGTCAGACCA	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.91C>G	17.37:g.39240549C>G	ENSP00000375236:p.Gln31Glu	Somatic	53	2	0.0377358		WXS	Illumina HiSeq	Phase_I	52	4	0.0769231	NM_033061	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	1.541	-0.541861	0.04053	.	.	ENSG00000240871;ENSG00000212722	ENST00000391417;ENST00000377734	T	0.00597	6.31	3.51	-5.02	0.02982	.	0.616411	0.13532	U	0.380865	T	0.00384	0.0012	.	.	.	0.09310	N	1	B	0.25105	0.118	B	0.16289	0.015	T	0.39722	-0.9600	9	0.27785	T	0.31	.	7.7095	0.28669	0.3855:0.2289:0.3856:0.0	.	31	Q9BYR0	KRA47_HUMAN	E	31	ENSP00000375236:Q31E	ENSP00000375236:Q31E	Q	+	1	0	KRTAP4-9;KRTAP4-7	36494075	0.065000	0.20965	0.000000	0.03702	0.181000	0.23173	-0.407000	0.07178	-1.274000	0.02421	-0.505000	0.04504	CAG	.	.	weak		0.632	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
PIM1	5292	hgsc.bcm.edu	37	6	37138901	37138901	+	Splice_Site	SNP	C	C	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:37138901C>A	ENST00000373509.5	+	4	614	c.241C>A	c.(241-243)Cct>Act	p.P81T		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	172					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GCCCCTGCAGCCTAATGGCAC	0.667			T	BCL6	NHL																																p.P172T		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C514A						PASS	.						45.0	52.0	50.0					6																	37138901		2203	4299	6502	SO:0001630	splice_region_variant	5292	exon4			CTGCAGCCTAATG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.241-1C>A	6.37:g.37138901C>A		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	52	28	0.538462	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977235	0.34848	.	.	ENSG00000137193	ENST00000373509	T	0.62941	-0.01	4.28	4.28	0.50868	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.230218	0.35525	N	0.003156	T	0.33673	0.0871	L	0.28608	0.87	0.41062	D	0.98538	B	0.10296	0.003	B	0.11329	0.006	T	0.15521	-1.0434	9	.	.	.	.	15.0358	0.71744	0.0:1.0:0.0:0.0	.	172	P11309	PIM1_HUMAN	T	81	ENSP00000362608:P81T	.	P	+	1	0	PIM1	37246879	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	4.378000	0.59568	2.371000	0.80710	0.549000	0.68633	CCT	.	.	none		0.667	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		Missense_Mutation
PCDHB7	56129	hgsc.bcm.edu	37	5	140554142	140554142	+	Missense_Mutation	SNP	T	T	G	rs13174866		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr5:140554142T>G	ENST00000231137.3	+	1	1900	c.1726T>G	c.(1726-1728)Ttg>Gtg	p.L576V		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	576	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.		L -> V (in dbSNP:rs13174866).		homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L576V(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACCGAGCCGTTGCCCCGGGC	0.706																																					p.L576V		Atlas-SNP	.											PCDHB7,NS,carcinoma,0,1	PCDHB7	231	1	1	Substitution - Missense(1)	prostate(1)	c.T1726G						scavenged	.						31.0	41.0	37.0					5																	140554142		2147	4229	6376	SO:0001583	missense	56129	exon1			GAGCCGTTGCCCC	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1726T>G	5.37:g.140554142T>G	ENSP00000231137:p.Leu576Val	Somatic	43	1	0.0232558		WXS	Illumina HiSeq	Phase_I	56	4	0.0714286	NM_018940	A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.992149	0.00439	.	.	ENSG00000113212	ENST00000231137	T	0.62498	0.02	4.3	-0.0538	0.13816	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.28632	0.0709	N	0.01789	-0.72	0.26682	N	0.971522	B	0.06786	0.001	B	0.12156	0.007	T	0.27400	-1.0075	9	0.02654	T	1	.	10.3392	0.43868	0.0:0.4572:0.3179:0.2249	rs13174866;rs17844470	576	Q9Y5E2	PCDB7_HUMAN	V	576	ENSP00000231137:L576V	ENSP00000231137:L576V	L	+	1	2	PCDHB7	140534326	0.880000	0.30214	0.995000	0.50966	0.341000	0.28922	0.694000	0.25512	-0.325000	0.08577	-1.785000	0.00643	TTG	T|1.000;|0.000	.	weak		0.706	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
TPTE2	93492	hgsc.bcm.edu	37	13	20056679	20056679	+	Missense_Mutation	SNP	T	T	G	rs200244531		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr13:20056679T>G	ENST00000400230.2	-	4	172	c.128A>C	c.(127-129)gAa>gCa	p.E43A	TPTE2_ENST00000400103.2_Missense_Mutation_p.E43A|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000457266.2_Missense_Mutation_p.E43A|TPTE2_ENST00000382977.4_Missense_Mutation_p.E43A|TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000382975.4_Missense_Mutation_p.E43A|TPTE2_ENST00000382978.1_Missense_Mutation_p.E43A			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	43					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.E43A(1)		NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		GGAAAGTCGTTCTAACATACT	0.313																																					p.E43A		Atlas-SNP	.											TPTE2_ENST00000400230,NS,carcinoma,0,1	TPTE2	225	1	1	Substitution - Missense(1)	kidney(1)	c.A128C						scavenged	.						52.0	51.0	51.0					13																	20056679		2201	4299	6500	SO:0001583	missense	93492	exon5			AGTCGTTCTAACA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.128A>C	13.37:g.20056679T>G	ENSP00000383089:p.Glu43Ala	Somatic	306	2	0.00653595		WXS	Illumina HiSeq	Phase_I	396	7	0.0176768	NM_199254	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	T	2.387	-0.340821	0.05243	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.94931	-3.56;-3.53;-3.47;-3.47;-3.56;-3.53	2.06	0.858	0.19030	.	0.878504	0.09602	U	0.780065	D	0.86159	0.5866	N	0.21448	0.665	0.09310	N	1	B;B	0.28850	0.225;0.0	B;B	0.19946	0.027;0.0	T	0.74598	-0.3612	9	.	.	.	-0.5937	3.8365	0.08896	0.0:0.192:0.0:0.808	.	43;43	A8MX64;Q6XPS3	.;TPTE2_HUMAN	A	43	ENSP00000372438:E43A;ENSP00000382974:E43A;ENSP00000383089:E43A;ENSP00000372437:E43A;ENSP00000372435:E43A;ENSP00000442218:E43A	.	E	-	2	0	TPTE2	18954679	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.422000	0.21296	0.241000	0.21283	0.383000	0.25322	GAA	.	.	weak		0.313	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
MYH8	4626	hgsc.bcm.edu	37	17	10304053	10304053	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:10304053G>A	ENST00000403437.2	-	27	3483	c.3389C>T	c.(3388-3390)gCg>gTg	p.A1130V	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1130					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GGCTCGGGACGCCCTCTCTGC	0.552									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.A1130V		Atlas-SNP	.											.	MYH8	346	.	0			c.C3389T						PASS	.						45.0	51.0	49.0					17																	10304053		2203	4300	6503	SO:0001583	missense	4626	exon27	Familial Cancer Database	Carney Complex Variant	CGGGACGCCCTCT		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.3389C>T	17.37:g.10304053G>A	ENSP00000384330:p.Ala1130Val	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	106	14	0.132075	NM_002472	Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867713	0.51588	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.79554	-1.28	5.38	5.38	0.77491	Myosin tail (1);	0.171371	0.27595	U	0.018674	D	0.83834	0.5340	M	0.82132	2.575	0.53688	D	0.999977	B	0.22146	0.065	B	0.27170	0.077	T	0.81955	-0.0696	10	0.72032	D	0.01	.	19.3244	0.94256	0.0:0.0:1.0:0.0	.	1130	P13535	MYH8_HUMAN	V	1130	ENSP00000384330:A1130V	ENSP00000252173:A1130V	A	-	2	0	MYH8	10244778	1.000000	0.71417	1.000000	0.80357	0.280000	0.26924	9.499000	0.97975	2.794000	0.96219	0.655000	0.94253	GCG	.	.	none		0.552	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
FAF1	11124	hgsc.bcm.edu	37	1	51121170	51121170	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:51121170T>A	ENST00000396153.2	-	8	1139	c.688A>T	c.(688-690)Atc>Ttc	p.I230F	FAF1_ENST00000371778.4_Missense_Mutation_p.I230F	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	230					apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.0?(1)		breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		CGAACGGGGATACTTGTAAGG	0.368																																					p.I230F		Atlas-SNP	.											.	FAF1	64	.	1	Whole gene deletion(1)	thyroid(1)	c.A688T						PASS	.						125.0	118.0	121.0					1																	51121170		2203	4300	6503	SO:0001583	missense	11124	exon8			CGGGGATACTTGT	AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.688A>T	1.37:g.51121170T>A	ENSP00000379457:p.Ile230Phe	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	83	20	0.240964	NM_007051	Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Missense_Mutation	SNP	ENST00000396153.2	37	CCDS554.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.901931	0.92035	.	.	ENSG00000185104	ENST00000396153;ENST00000371778	T;T	0.33216	1.42;1.42	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.58061	0.2096	M	0.75085	2.285	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.61103	-0.7130	10	0.87932	D	0	-11.8054	16.8222	0.85835	0.0:0.0:0.0:1.0	.	230	Q9UNN5	FAF1_HUMAN	F	230	ENSP00000379457:I230F;ENSP00000360843:I230F	ENSP00000360843:I230F	I	-	1	0	FAF1	50893758	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	6.615000	0.74201	2.371000	0.80710	0.533000	0.62120	ATC	.	.	none		0.368	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021807.1	NM_007051	
PIM1	5292	hgsc.bcm.edu	37	6	37138380	37138380	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:37138380C>T	ENST00000373509.5	+	1	402	c.29C>T	c.(28-30)gCc>gTc	p.A10V		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	101					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	AACTCGCTTGCCCACCTGCGC	0.731			T	BCL6	NHL																																p.A101V		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,1	PIM1	71	1	0			c.C302T						scavenged	.						30.0	31.0	31.0					6																	37138380		2202	4297	6499	SO:0001583	missense	5292	exon1			CGCTTGCCCACCT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.29C>T	6.37:g.37138380C>T	ENSP00000362608:p.Ala10Val	Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	65	8	0.123077	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.223561	0.58668	.	.	ENSG00000137193	ENST00000373509	T	0.69806	-0.43	4.2	4.2	0.49525	.	0.229124	0.22580	N	0.058236	T	0.33206	0.0855	N	0.08118	0	0.45439	D	0.998418	P	0.40834	0.73	B	0.34779	0.189	T	0.49579	-0.8925	10	0.52906	T	0.07	.	17.0668	0.86561	0.0:1.0:0.0:0.0	.	101	P11309	PIM1_HUMAN	V	10	ENSP00000362608:A10V	ENSP00000362608:A10V	A	+	2	0	PIM1	37246358	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.592000	0.46171	2.289000	0.77006	0.542000	0.68232	GCC	.	.	none		0.731	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
CHRM3	1131	hgsc.bcm.edu	37	1	240072488	240072488	+	Silent	SNP	C	C	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:240072488C>A	ENST00000255380.4	+	5	2516	c.1737C>A	c.(1735-1737)gtC>gtA	p.V579V		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	579					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	GACAGTCGGTCATTTTTCACA	0.488																																					p.V579V		Atlas-SNP	.											.	CHRM3	118	.	0			c.C1737A						PASS	.						43.0	44.0	44.0					1																	240072488		2203	4300	6503	SO:0001819	synonymous_variant	1131	exon5			GTCGGTCATTTTT	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1737C>A	1.37:g.240072488C>A		Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	120	29	0.241667	NM_000740	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Silent	SNP	ENST00000255380.4	37	CCDS1616.1																																																																																			.	.	none		0.488	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740	
C2orf81	388963	hgsc.bcm.edu	37	2	74642293	74642293	+	Silent	SNP	A	A	G	rs376727648		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:74642293A>G	ENST00000517883.1	-	1	1417	c.726T>C	c.(724-726)tcT>tcC	p.S242S	C2orf81_ENST00000290390.5_Silent_p.S310S			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	303										endometrium(3)|kidney(1)	4						CGCCGCCCACAGAGGGGTAGG	0.706																																					p.S310S		Atlas-SNP	.											C2orf81,NS,carcinoma,0,1	C2orf81	23	1	0			c.T930C						scavenged	.																																			SO:0001819	synonymous_variant	388963	exon4			GCCCACAGAGGGG	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.726T>C	2.37:g.74642293A>G		Somatic	75	1	0.0133333		WXS	Illumina HiSeq	Phase_I	97	14	0.14433	NM_001145054		Silent	SNP	ENST00000517883.1	37																																																																																				.	.	weak		0.706	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
KLHL18	23276	hgsc.bcm.edu	37	3	47385186	47385186	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:47385186G>A	ENST00000232766.5	+	10	1500	c.1480G>A	c.(1480-1482)Gcc>Acc	p.A494T	KLHL18_ENST00000455924.2_Missense_Mutation_p.A382T	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	494										endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		CCTCAGCATTGCCGAGATGTA	0.642																																					p.A494T		Atlas-SNP	.											.	KLHL18	46	.	0			c.G1480A						PASS	.						83.0	84.0	84.0					3																	47385186		2203	4300	6503	SO:0001583	missense	23276	exon10			AGCATTGCCGAGA	AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.1480G>A	3.37:g.47385186G>A	ENSP00000232766:p.Ala494Thr	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	57	12	0.210526	NM_025010	A8K612|Q7Z3E8|Q8N125	Missense_Mutation	SNP	ENST00000232766.5	37	CCDS33749.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.737796	0.89573	.	.	ENSG00000114648	ENST00000232766;ENST00000455924	T;T	0.77489	-1.1;-1.1	5.06	5.06	0.68205	Galactose oxidase, beta-propeller (1);	0.056309	0.64402	D	0.000001	T	0.73513	0.3596	L	0.39633	1.23	0.80722	D	1	P	0.42161	0.772	B	0.40982	0.345	T	0.78145	-0.2318	10	0.87932	D	0	.	17.6032	0.88031	0.0:0.0:1.0:0.0	.	494	O94889	KLH18_HUMAN	T	494;382	ENSP00000232766:A494T;ENSP00000405585:A382T	ENSP00000232766:A494T	A	+	1	0	KLHL18	47360190	1.000000	0.71417	0.876000	0.34364	0.904000	0.53231	7.711000	0.84669	2.636000	0.89361	0.491000	0.48974	GCC	.	.	none		0.642	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344493.1	NM_025010	
GPR149	344758	hgsc.bcm.edu	37	3	154139229	154139229	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:154139229C>T	ENST00000389740.2	-	3	1321	c.1222G>A	c.(1222-1224)Ggg>Agg	p.G408R		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	408					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTATAAATCCCATAACTTTTT	0.313																																					p.G408R		Atlas-SNP	.											.	GPR149	134	.	0			c.G1222A						PASS	.						41.0	39.0	40.0					3																	154139229		1801	4065	5866	SO:0001583	missense	344758	exon3			AAATCCCATAACT	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1222G>A	3.37:g.154139229C>T	ENSP00000374390:p.Gly408Arg	Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	134	26	0.19403	NM_001038705		Missense_Mutation	SNP	ENST00000389740.2	37	CCDS43162.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.239708	0.79800	.	.	ENSG00000174948	ENST00000389740	.	.	.	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.78214	0.4248	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81086	-0.1092	9	0.87932	D	0	-15.4694	17.8046	0.88598	0.0:1.0:0.0:0.0	.	408	Q86SP6	GP149_HUMAN	R	408	.	ENSP00000374390:G408R	G	-	1	0	GPR149	155621923	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	6.717000	0.74707	2.392000	0.81423	0.454000	0.30748	GGG	.	.	none		0.313	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580	
ATRNL1	26033	hgsc.bcm.edu	37	10	116931103	116931103	+	Intron	SNP	A	A	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr10:116931103A>T	ENST00000355044.3	+	8	1474				ATRNL1_ENST00000529665.1_3'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1						G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		GTTTTTCTCTAATAAAATCTT	0.239																																					p.L467L		Atlas-SNP	.											.	ATRNL1	219	.	0			c.A1401T						PASS	.																																			SO:0001627	intron_variant	26033	exon8			TTCTCTAATAAAA	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.1348+53A>T	10.37:g.116931103A>T		Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	202	20	0.0990099	NM_001276282	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	ENST00000355044.3	37	CCDS7592.1																																																																																			.	.	none		0.239	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
OR2T2	401992	hgsc.bcm.edu	37	1	248616764	248616764	+	Silent	SNP	C	C	T	rs376553658		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:248616764C>T	ENST00000342927.3	+	1	688	c.666C>T	c.(664-666)atC>atT	p.I222I		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACACGCACATCCTCCTGACTG	0.542																																					p.I222I		Atlas-SNP	.											OR2T2,NS,carcinoma,0,1	OR2T2	73	1	0			c.C666T						scavenged	.						182.0	125.0	144.0					1																	248616764		2186	4264	6450	SO:0001819	synonymous_variant	401992	exon1			GCACATCCTCCTG	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.666C>T	1.37:g.248616764C>T		Somatic	343	6	0.0174927		WXS	Illumina HiSeq	Phase_I	356	14	0.0393258	NM_001004136	B2RNM1|B9EH01	Silent	SNP	ENST00000342927.3	37	CCDS31116.1																																																																																			C|0.500;T|0.500	0.500	strong		0.542	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136	
LIMCH1	22998	hgsc.bcm.edu	37	4	41648713	41648713	+	Missense_Mutation	SNP	C	C	T	rs143733086		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr4:41648713C>T	ENST00000313860.7	+	12	1522	c.1468C>T	c.(1468-1470)Cgg>Tgg	p.R490W	LIMCH1_ENST00000512632.1_Missense_Mutation_p.R490W|LIMCH1_ENST00000512820.1_Missense_Mutation_p.R478W|LIMCH1_ENST00000509277.1_Missense_Mutation_p.R324W|LIMCH1_ENST00000508501.1_Missense_Mutation_p.R490W|LIMCH1_ENST00000381753.4_Missense_Mutation_p.R324W|LIMCH1_ENST00000396595.3_Missense_Mutation_p.R336W|LIMCH1_ENST00000512946.1_Missense_Mutation_p.R490W|LIMCH1_ENST00000503057.1_Missense_Mutation_p.R875W|LIMCH1_ENST00000511496.1_Missense_Mutation_p.R331W|LIMCH1_ENST00000514096.1_Missense_Mutation_p.R331W|LIMCH1_ENST00000513024.1_Missense_Mutation_p.R319W	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1	490					actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)	p.R875W(1)|p.R490W(1)		central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						GAAATACCTGCGGCAACAGTC	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		20033	0.001		0.0	False		,,,				2504	0.0				p.R490W		Atlas-SNP	.											LIMCH1_ENST00000503057,NS,carcinoma,0,1	LIMCH1	233	1	2	Substitution - Missense(2)	prostate(2)	c.C1468T						PASS	.						220.0	224.0	223.0					4																	41648713		2203	4300	6503	SO:0001583	missense	22998	exon12			TACCTGCGGCAAC	AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.1468C>T	4.37:g.41648713C>T	ENSP00000316891:p.Arg490Trp	Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	150	8	0.0533333	NM_014988	A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Missense_Mutation	SNP	ENST00000313860.7	37	CCDS33977.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	18.78	3.697333	0.68386	.	.	ENSG00000064042	ENST00000513024;ENST00000508501;ENST00000512946;ENST00000313860;ENST00000512632;ENST00000512820;ENST00000503057;ENST00000511496;ENST00000313875;ENST00000514096;ENST00000509277;ENST00000396595;ENST00000381753	T;T;T;T;T;T;T;T;T;T;T;T	0.55930	0.94;1.15;1.1;1.16;0.94;1.16;0.52;0.49;0.52;0.94;0.94;0.53	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.70133	0.3189	M	0.68952	2.095	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.91635	0.982;0.982;0.987;0.995;0.996;0.997;0.995;0.999;0.997;0.999;0.997	T	0.72384	-0.4310	10	0.87932	D	0	-18.4384	13.7854	0.63105	0.2558:0.7442:0.0:0.0	.	241;324;490;324;336;875;319;478;490;490;490	B7Z3G0;E9PDJ9;D6RD46;Q9UPQ0-9;Q9UPQ0-6;G5EA03;Q9UPQ0-5;Q9UPQ0-4;E9PHM7;Q9UPQ0-2;Q9UPQ0	.;.;.;.;.;.;.;.;.;.;LIMC1_HUMAN	W	319;490;490;490;490;478;875;331;874;331;324;336;324	ENSP00000425222:R319W;ENSP00000424825:R490W;ENSP00000424645:R490W;ENSP00000316891:R490W;ENSP00000427045:R490W;ENSP00000424437:R478W;ENSP00000425631:R875W;ENSP00000421242:R331W;ENSP00000426334:R331W;ENSP00000422864:R324W;ENSP00000379840:R336W;ENSP00000371172:R324W	ENSP00000316891:R490W	R	+	1	2	LIMCH1	41343470	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.662000	0.37418	2.675000	0.91044	0.591000	0.81541	CGG	C|1.000;T|0.000	0.000	strong		0.498	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361249.2	NM_014988	
OR5D16	390144	hgsc.bcm.edu	37	11	55606497	55606497	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:55606497A>T	ENST00000378396.1	+	1	270	c.270A>T	c.(268-270)gaA>gaT	p.E90D		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				TGGTTGTAGAAGATAGAACCA	0.418																																					p.E90D		Atlas-SNP	.											OR5D16,NS,carcinoma,+2,1	OR5D16	94	1	0			c.A270T						scavenged	.						199.0	195.0	196.0					11																	55606497		2201	4296	6497	SO:0001583	missense	390144	exon1			TGTAGAAGATAGA	AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.270A>T	11.37:g.55606497A>T	ENSP00000367649:p.Glu90Asp	Somatic	306	2	0.00653595		WXS	Illumina HiSeq	Phase_I	317	70	0.22082	NM_001005496	Q6IF65|Q96RB4	Missense_Mutation	SNP	ENST00000378396.1	37	CCDS31512.1	.	.	.	.	.	.	.	.	.	.	.	11.61	1.689090	0.29962	.	.	ENSG00000205029	ENST00000378396	T	0.09817	2.94	4.05	1.4	0.22301	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.08670	0.0215	L	0.39566	1.225	0.09310	N	1	B	0.21452	0.056	B	0.28784	0.094	T	0.37572	-0.9700	9	0.45353	T	0.12	-3.3486	1.9721	0.03408	0.5741:0.1682:0.0953:0.1625	.	90	Q8NGK9	OR5DG_HUMAN	D	90	ENSP00000367649:E90D	ENSP00000367649:E90D	E	+	3	2	OR5D16	55363073	0.000000	0.05858	0.355000	0.25773	0.899000	0.52679	-1.669000	0.01958	0.553000	0.29044	0.433000	0.28618	GAA	.	.	none		0.418	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496	
PIM1	5292	hgsc.bcm.edu	37	6	37140867	37140867	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:37140867A>T	ENST00000373509.5	+	5	1076	c.703A>T	c.(703-705)Atg>Ttg	p.M235L	PIM1_ENST00000468243.1_3'UTR	NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	326	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GCTGTATGATATGGTGTGTGG	0.552			T	BCL6	NHL																																p.M326L		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,trunk,malignant_melanoma,-2,1	PIM1	71	1	0			c.A976T						PASS	.						143.0	132.0	136.0					6																	37140867		2203	4300	6503	SO:0001583	missense	5292	exon5			TATGATATGGTGT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.703A>T	6.37:g.37140867A>T	ENSP00000362608:p.Met235Leu	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	155	80	0.516129	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	A	35	5.493129	0.96339	.	.	ENSG00000137193	ENST00000373509	T	0.10573	2.86	5.35	5.35	0.76521	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.042575	0.85682	D	0.000000	T	0.03390	0.0098	N	0.04387	-0.21	0.54753	D	0.999985	P	0.34934	0.476	B	0.40101	0.319	T	0.48937	-0.8990	10	0.49607	T	0.09	.	14.5991	0.68427	1.0:0.0:0.0:0.0	.	326	P11309	PIM1_HUMAN	L	235	ENSP00000362608:M235L	ENSP00000362608:M235L	M	+	1	0	PIM1	37248845	1.000000	0.71417	0.945000	0.38365	0.975000	0.68041	8.930000	0.92872	2.149000	0.67028	0.482000	0.46254	ATG	.	.	none		0.552	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
CDH7	1005	hgsc.bcm.edu	37	18	63529970	63529970	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr18:63529970C>A	ENST00000397968.2	+	11	2107	c.1681C>A	c.(1681-1683)Cca>Aca	p.P561T	CDH7_ENST00000323011.3_Missense_Mutation_p.P561T|RP11-389J22.1_ENST00000581987.1_RNA|CDH7_ENST00000536984.2_Missense_Mutation_p.P561T	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	561	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				TTACTATCTGCCAATTTTCAT	0.498																																					p.P561T		Atlas-SNP	.											.	CDH7	362	.	0			c.C1681A						PASS	.						145.0	117.0	127.0					18																	63529970		2203	4300	6503	SO:0001583	missense	1005	exon11			TATCTGCCAATTT	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1681C>A	18.37:g.63529970C>A	ENSP00000381058:p.Pro561Thr	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	167	30	0.179641	NM_004361	Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129597	0.77549	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.42900	0.96;0.96;0.96	5.37	5.37	0.77165	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	L	0.46885	1.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.62732	-0.6792	10	0.87932	D	0	.	19.0909	0.93227	0.0:1.0:0.0:0.0	.	561;561	F5H5X9;Q9ULB5	.;CADH7_HUMAN	T	561	ENSP00000319166:P561T;ENSP00000443030:P561T;ENSP00000381058:P561T	ENSP00000319166:P561T	P	+	1	0	CDH7	61680950	1.000000	0.71417	0.991000	0.47740	0.476000	0.33039	7.792000	0.85828	2.528000	0.85240	0.591000	0.81541	CCA	.	.	none		0.498	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
EIF2B3	8891	hgsc.bcm.edu	37	1	45341357	45341357	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:45341357A>G	ENST00000360403.2	-	9	1112	c.986T>C	c.(985-987)tTg>tCg	p.L329S	EIF2B3_ENST00000372183.3_Missense_Mutation_p.L329S	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa	329					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					AGCAGACAGCAATTTGGGCAC	0.527																																					p.L329S	Colon(26;357 658 2581 11857 12657)	Atlas-SNP	.											.	EIF2B3	43	.	0			c.T986C						PASS	.						148.0	136.0	140.0					1																	45341357		2203	4300	6503	SO:0001583	missense	8891	exon9			GACAGCAATTTGG	AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.986T>C	1.37:g.45341357A>G	ENSP00000353575:p.Leu329Ser	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	125	7	0.056	NM_020365	B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Missense_Mutation	SNP	ENST00000360403.2	37	CCDS517.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.19|15.19	2.758999|2.758999	0.49468|0.49468	.|.	.|.	ENSG00000070785|ENSG00000070785	ENST00000439363|ENST00000360403;ENST00000372183	.|T;D	.|0.94138	.|0.54;-3.36	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.92583|0.92583	0.7644|0.7644	M|M	0.77103|0.77103	2.36|2.36	0.54753|0.54753	D|D	0.999987|0.999987	.|B;B	.|0.27192	.|0.171;0.006	.|B;B	.|0.34991	.|0.193;0.017	D|D	0.88823|0.88823	0.3300|0.3300	5|10	.|0.06365	.|T	.|0.9	-1.4932|-1.4932	15.0974|15.0974	0.72247|0.72247	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|329;329	.|Q9NR50-2;Q9NR50	.|.;EI2BG_HUMAN	R|S	150|329	.|ENSP00000353575:L329S;ENSP00000361257:L329S	.|ENSP00000353575:L329S	C|L	-|-	1|2	0|0	EIF2B3|EIF2B3	45113944|45113944	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	6.176000|6.176000	0.71955|0.71955	2.045000|2.045000	0.60652|0.60652	0.533000|0.533000	0.62120|0.62120	TGC|TTG	.	.	none		0.527	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023724.1	NM_020365	
IRF4	3662	hgsc.bcm.edu	37	6	393318	393318	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:393318C>T	ENST00000380956.4	+	2	292	c.166C>T	c.(166-168)Cac>Tac	p.H56Y	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	56					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		CCCCTGGAAGCACGCGGGCAA	0.687			T	IGH@	MM																																p.H56Y		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65	.	0			c.C166T						PASS	.						32.0	30.0	30.0					6																	393318		2202	4299	6501	SO:0001583	missense	3662	exon2			TGGAAGCACGCGG	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.166C>T	6.37:g.393318C>T	ENSP00000370343:p.His56Tyr	Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	101	20	0.19802	NM_001195286	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	37	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	C	31	5.080588	0.94050	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.98493	-4.96	4.58	4.58	0.56647	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.092628	0.85682	D	0.000000	D	0.99272	0.9746	H	0.94847	3.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98982	1.0805	10	0.87932	D	0	-31.5343	17.6301	0.88104	0.0:1.0:0.0:0.0	.	56;56;56	F2Z3D5;Q15306-2;Q15306	.;.;IRF4_HUMAN	Y	56;86	ENSP00000370343:H56Y	ENSP00000370343:H56Y	H	+	1	0	IRF4	338318	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.954000	0.76001	2.399000	0.81585	0.306000	0.20318	CAC	.	.	none		0.687	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
HKR1	284459	hgsc.bcm.edu	37	19	37853921	37853921	+	Silent	SNP	A	A	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr19:37853921A>T	ENST00000324411.4	+	6	1493	c.1224A>T	c.(1222-1224)tcA>tcT	p.S408S	HKR1_ENST00000589392.1_Silent_p.S390S|HKR1_ENST00000544914.1_Silent_p.S135S|HKR1_ENST00000541583.2_Silent_p.S347S|HKR1_ENST00000392153.3_Silent_p.S389S|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000591471.1_Silent_p.S135S	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	408					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGACACATTCAGGAGAGAAGC	0.522																																					p.S408S		Atlas-SNP	.											.	HKR1	74	.	0			c.A1224T						PASS	.						99.0	102.0	101.0					19																	37853921		2203	4300	6503	SO:0001819	synonymous_variant	284459	exon6			ACATTCAGGAGAG	M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1224A>T	19.37:g.37853921A>T		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	53	16	0.301887	NM_181786	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Silent	SNP	ENST00000324411.4	37	CCDS12502.1																																																																																			.	.	none		0.522	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786	
AMOTL2	51421	hgsc.bcm.edu	37	3	134089710	134089710	+	Missense_Mutation	SNP	C	C	T	rs554025750	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:134089710C>T	ENST00000422605.2	-	2	732	c.566G>A	c.(565-567)cGc>cAc	p.R189H	AMOTL2_ENST00000511759.1_Intron|AMOTL2_ENST00000514516.1_Missense_Mutation_p.R247H|AMOTL2_ENST00000249883.5_Missense_Mutation_p.R189H|AMOTL2_ENST00000513145.1_Missense_Mutation_p.R189H			Q9Y2J4	AMOL2_HUMAN	angiomotin like 2	189					hippo signaling (GO:0035329)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|tight junction (GO:0005923)				endometrium(8)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	19						CTGCTGGTTGCGGGCCAGCTG	0.667													C|||	2	0.000399361	0.0	0.0029	5008	,	,		14670	0.0		0.0	False		,,,				2504	0.0				p.R189H		Atlas-SNP	.											.	AMOTL2	52	.	0			c.G566A						PASS	.						22.0	28.0	26.0					3																	134089710		2201	4295	6496	SO:0001583	missense	51421	exon2			TGGTTGCGGGCCA	AF175966	CCDS33860.1, CCDS63783.1, CCDS63784.1	3q21-q22	2008-07-18			ENSG00000114019	ENSG00000114019			17812	protein-coding gene	gene with protein product	"""Leman coiled-coil protein"", ""angiomotin-like protein 2"""	614658					Standard	NM_016201		Approved	LCCP	uc003eqg.1	Q9Y2J4	OTTHUMG00000159777	ENST00000422605.2:c.566G>A	3.37:g.134089710C>T	ENSP00000409999:p.Arg189His	Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	69	14	0.202899	NM_016201	A8K6F1|B7Z5Q1|E9PHW3|Q53EP1|Q96F99|Q9UKB4	Missense_Mutation	SNP	ENST00000422605.2	37		.	.	.	.	.	.	.	.	.	.	C	20.6	4.015558	0.75161	.	.	ENSG00000114019	ENST00000249883;ENST00000422605;ENST00000514516;ENST00000513145;ENST00000510560	T;T;T;T;T	0.15834	2.39;2.39;2.39;2.39;2.39	4.52	4.52	0.55395	.	0.281504	0.36066	N	0.002805	T	0.14184	0.0343	L	0.40543	1.245	0.41298	D	0.987023	P;P;P	0.37352	0.591;0.591;0.456	B;B;B	0.28139	0.086;0.086;0.039	T	0.08472	-1.0720	10	0.30078	T	0.28	-17.0703	17.6366	0.88124	0.0:1.0:0.0:0.0	.	189;189;247	Q9Y2J4-3;Q9Y2J4-2;E9PHW3	.;.;.	H	189;189;247;189;189	ENSP00000249883:R189H;ENSP00000409999:R189H;ENSP00000424765:R247H;ENSP00000425475:R189H;ENSP00000427184:R189H	ENSP00000249883:R189H	R	-	2	0	AMOTL2	135572400	0.910000	0.30920	1.000000	0.80357	0.740000	0.42216	4.318000	0.59190	2.207000	0.71202	0.455000	0.32223	CGC	.	.	none		0.667	AMOTL2-014	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000358149.1	NM_016201	
DOCK5	80005	hgsc.bcm.edu	37	8	25181469	25181469	+	Splice_Site	SNP	T	T	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:25181469T>C	ENST00000276440.7	+	17	1763		c.e17+2			NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5						positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GTTTATAAGGTGGTGCTAACA	0.443																																					.	Pancreas(145;34 1887 3271 10937 30165)	Atlas-SNP	.											.	DOCK5	167	.	0			c.1719+2T>C						PASS	.						69.0	61.0	63.0					8																	25181469		2203	4300	6503	SO:0001630	splice_region_variant	80005	exon17			ATAAGGTGGTGCT		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.1719+2T>C	8.37:g.25181469T>C		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	79	14	0.177215	NM_024940	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Splice_Site	SNP	ENST00000276440.7	37	CCDS6047.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.581236	0.86748	.	.	ENSG00000147459	ENST00000276440;ENST00000444569	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9649	0.79961	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOCK5	25237386	1.000000	0.71417	0.989000	0.46669	0.962000	0.63368	7.997000	0.88414	2.232000	0.73038	0.533000	0.62120	.	.	.	none		0.443	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	Intron
HEPH	9843	hgsc.bcm.edu	37	X	65480101	65480101	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chrX:65480101A>G	ENST00000343002.2	+	18	3860	c.3196A>G	c.(3196-3198)Aca>Gca	p.T1066A	HEPH_ENST00000374727.3_Missense_Mutation_p.T1069A|HEPH_ENST00000441993.2_Missense_Mutation_p.T1069A|HEPH_ENST00000419594.1_Missense_Mutation_p.T877A|HEPH_ENST00000519389.1_Missense_Mutation_p.T1120A|HEPH_ENST00000336279.5_Missense_Mutation_p.T799A			Q9BQS7	HEPH_HUMAN	hephaestin	1066	Plastocyanin-like 6.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						TTTTTCTCGAACAGGTAAGTC	0.473																																					p.T1120A		Atlas-SNP	.											.	HEPH	224	.	0			c.A3358G						PASS	.						92.0	74.0	80.0					X																	65480101		2203	4300	6503	SO:0001583	missense	9843	exon19			TCTCGAACAGGTA	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.3196A>G	X.37:g.65480101A>G	ENSP00000343939:p.Thr1066Ala	Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	56	30	0.535714	NM_138737	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37		.	.	.	.	.	.	.	.	.	.	A	4.208	0.037327	0.08148	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002	D;D;D;D;D;D	0.99245	-5.62;-5.61;-5.62;-5.58;-5.62;-5.61	4.81	-0.296	0.12824	Cupredoxin (1);	1.165000	0.06166	N	0.676881	D	0.94434	0.8209	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.14805	0.001;0.011;0.0	B;B;B	0.06405	0.0;0.002;0.002	D	0.92975	0.6401	10	0.09338	T	0.73	.	4.6493	0.12587	0.3017:0.2357:0.4627:0.0	.	1120;877;1066	E9PHN8;E7ES21;Q9BQS7	.;.;HEPH_HUMAN	A	1120;1069;799;1069;877;1066	ENSP00000430620:T1120A;ENSP00000363859:T1069A;ENSP00000337418:T799A;ENSP00000411687:T1069A;ENSP00000413211:T877A;ENSP00000343939:T1066A	ENSP00000337418:T799A	T	+	1	0	HEPH	65396826	0.000000	0.05858	0.021000	0.16686	0.161000	0.22273	0.012000	0.13287	-0.060000	0.13132	0.486000	0.48141	ACA	.	.	none		0.473	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737	
NAA11	84779	hgsc.bcm.edu	37	4	80246356	80246356	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr4:80246356C>T	ENST00000286794.4	-	1	848	c.676G>A	c.(676-678)Gat>Aat	p.D226N	NAA11_ENST00000513733.1_5'UTR	NM_032693.2	NP_116082.1	Q9BSU3	NAA11_HUMAN	N(alpha)-acetyltransferase 11, NatA catalytic subunit	226					N-terminal protein amino acid acetylation (GO:0006474)	NatA complex (GO:0031415)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|skin(2)	23						GAGGTGGAATCCGAGCTTTCT	0.527																																					p.D226N		Atlas-SNP	.											.	NAA11	43	.	0			c.G676A						PASS	.						59.0	60.0	60.0					4																	80246356		2081	4216	6297	SO:0001583	missense	84779	exon1			TGGAATCCGAGCT		CCDS47084.1	4q21.23	2010-05-07	2010-01-14	2010-01-14		ENSG00000156269	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	28125	protein-coding gene	gene with protein product			"""ARD1 homolog B (S. cerevisiae)"""	ARD1B		16638120, 19660095	Standard	NM_032693		Approved	ARD2, hARD2	uc003hlt.4	Q9BSU3		ENST00000286794.4:c.676G>A	4.37:g.80246356C>T	ENSP00000286794:p.Asp226Asn	Somatic	196	0	0		WXS	Illumina HiSeq	Phase_I	171	38	0.222222	NM_032693	Q66K19|Q6P479	Missense_Mutation	SNP	ENST00000286794.4	37	CCDS47084.1	.	.	.	.	.	.	.	.	.	.	C	6.267	0.417331	0.11870	.	.	ENSG00000156269	ENST00000286794	T	0.60040	0.22	4.95	0.0217	0.14130	.	0.589208	0.15884	N	0.239915	T	0.41949	0.1181	L	0.42245	1.32	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21280	-1.0250	10	0.28530	T	0.3	-1.0315	5.6297	0.17504	0.0:0.4997:0.2646:0.2357	.	226	Q9BSU3	NAA11_HUMAN	N	226	ENSP00000286794:D226N	ENSP00000286794:D226N	D	-	1	0	NAA11	80465380	0.373000	0.25073	0.001000	0.08648	0.002000	0.02628	0.690000	0.25451	-0.135000	0.11495	0.655000	0.94253	GAT	.	.	none		0.527	NAA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362922.1		
MUC5B	727897	hgsc.bcm.edu	37	11	1268579	1268579	+	Missense_Mutation	SNP	T	T	G	rs190148881	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:1268579T>G	ENST00000529681.1	+	31	10527	c.10469T>G	c.(10468-10470)gTg>gGg	p.V3490G	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.V3493G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3490	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.|V -> G (in Ref. 4; CAA96577). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.V3469G(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTTCCACGGTGACTTCCCAC	0.667																																					p.V3490G		Atlas-SNP	.											MUC5B,NS,carcinoma,0,5	MUC5B	473	5	1	Substitution - Missense(1)	skin(1)	c.T10469G						scavenged	.						101.0	122.0	115.0					11																	1268579		2134	4215	6349	SO:0001583	missense	727897	exon31			CCACGGTGACTTC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.10469T>G	11.37:g.1268579T>G	ENSP00000436812:p.Val3490Gly	Somatic	128	1	0.0078125		WXS	Illumina HiSeq	Phase_I	138	10	0.0724638	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	29	0.013278388278388278	10	0.02032520325203252	7	0.019337016574585635	2	0.0034965034965034965	10	0.013192612137203167	t	2.632	-0.286071	0.05605	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.21932	1.98;2.17	1.44	-1.72	0.08107	.	.	.	.	.	T	0.10165	0.0249	L	0.43152	1.355	0.09310	N	1	P;P	0.44090	0.826;0.563	P;B	0.48571	0.582;0.032	T	0.14504	-1.0470	9	0.87932	D	0	.	2.5883	0.04836	0.0:0.381:0.2946:0.3243	.	4018;3493	A7Y9J9;E9PBJ0	.;.	G	3490;3493;3462;3395	ENSP00000436812:V3490G;ENSP00000415793:V3493G	ENSP00000343037:V3462G	V	+	2	0	MUC5B	1225155	0.000000	0.05858	0.001000	0.08648	0.089000	0.18198	-2.439000	0.01016	-0.179000	0.10654	0.246000	0.17985	GTG	T|0.984;G|0.016	0.016	strong		0.667	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
NOX4	50507	hgsc.bcm.edu	37	11	89177362	89177362	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:89177362A>G	ENST00000263317.4	-	5	626	c.388T>C	c.(388-390)Ttc>Ctc	p.F130L	NOX4_ENST00000532825.1_Missense_Mutation_p.F106L|NOX4_ENST00000531342.1_Intron|NOX4_ENST00000542487.1_Missense_Mutation_p.F106L|NOX4_ENST00000375979.3_Intron|NOX4_ENST00000534731.1_Missense_Mutation_p.F130L|NOX4_ENST00000413594.2_Missense_Mutation_p.F151L|NOX4_ENST00000343727.5_Missense_Mutation_p.F106L|NOX4_ENST00000527626.1_Intron|NOX4_ENST00000424319.1_Missense_Mutation_p.F106L|NOX4_ENST00000527956.1_Missense_Mutation_p.F106L|NOX4_ENST00000535633.1_Missense_Mutation_p.F106L|NOX4_ENST00000528341.1_Missense_Mutation_p.F105L|NOX4_ENST00000525196.1_Missense_Mutation_p.F130L			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	130	Ferric oxidoreductase.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				TTCACTGAGAAGTTGAGGGCA	0.453																																					p.F130L		Atlas-SNP	.											NOX4,NS,carcinoma,+1,1	NOX4	101	1	0			c.T388C						PASS	.						137.0	117.0	124.0					11																	89177362		2201	4299	6500	SO:0001583	missense	50507	exon5			CTGAGAAGTTGAG	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.388T>C	11.37:g.89177362A>G	ENSP00000263317:p.Phe130Leu	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	104	28	0.269231	NM_001143836	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	ENST00000263317.4	37	CCDS8285.1	.	.	.	.	.	.	.	.	.	.	A	17.40	3.379180	0.61735	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000525196;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000528341;ENST00000413594	D;D;D;D;D;D;D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7	5.16	5.16	0.70880	Flavoprotein transmembrane component (1);	0.113019	0.64402	D	0.000011	D	0.91452	0.7302	L	0.31526	0.94	0.58432	D	0.999991	B;B;D;B;B	0.57257	0.017;0.395;0.979;0.01;0.144	B;B;D;B;B	0.71414	0.057;0.249;0.973;0.008;0.269	D	0.90606	0.4548	9	.	.	.	-16.4589	14.2622	0.66092	1.0:0.0:0.0:0.0	.	106;105;130;130;130	E9PMY6;E9PPP2;E9PI95;Q9NPH5-6;Q9NPH5	.;.;.;.;NOX4_HUMAN	L	106;106;106;130;130;130;106;106;106;105;151	ENSP00000412446:F106L;ENSP00000440172:F106L;ENSP00000344747:F106L;ENSP00000436892:F130L;ENSP00000436716:F130L;ENSP00000263317:F130L;ENSP00000434924:F106L;ENSP00000433797:F106L;ENSP00000439373:F106L;ENSP00000436970:F105L;ENSP00000405705:F151L	.	F	-	1	0	NOX4	88817010	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.714000	0.84703	2.070000	0.61991	0.460000	0.39030	TTC	.	.	none		0.453	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	NM_016931	
EPHA3	2042	hgsc.bcm.edu	37	3	89499497	89499497	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:89499497G>T	ENST00000336596.2	+	15	2892	c.2667G>T	c.(2665-2667)aaG>aaT	p.K889N	EPHA3_ENST00000494014.1_Missense_Mutation_p.K889N	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	889					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.K889K(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GCAGCCTGAAGATCATCACCA	0.438										TSP Lung(6;0.00050)																											p.K889N		Atlas-SNP	.											EPHA3,NS,carcinoma,0,1	EPHA3	501	1	1	Substitution - coding silent(1)	ovary(1)	c.G2667T						PASS	.						68.0	63.0	65.0					3																	89499497		2203	4300	6503	SO:0001583	missense	2042	exon15			CCTGAAGATCATC	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2667G>T	3.37:g.89499497G>T	ENSP00000337451:p.Lys889Asn	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	120	32	0.266667	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.751796	0.49362	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	T;T	0.62232	0.04;0.04	5.66	4.67	0.58626	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.71525	0.3350	M	0.72353	2.195	0.80722	D	1	D	0.71674	0.998	D	0.75020	0.985	T	0.73043	-0.4107	9	.	.	.	.	3.6688	0.08266	0.3385:0.0:0.6615:0.0	.	889	P29320	EPHA3_HUMAN	N	889	ENSP00000337451:K889N;ENSP00000419190:K889N	.	K	+	3	2	EPHA3	89582187	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.415000	0.52700	2.673000	0.90976	0.650000	0.86243	AAG	.	.	none		0.438	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
RGPD8	727851	hgsc.bcm.edu	37	2	113147238	113147238	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:113147238A>G	ENST00000302558.3	-	20	3475	c.3284T>C	c.(3283-3285)cTa>cCa	p.L1095P	RGPD8_ENST00000409750.1_Missense_Mutation_p.L955P	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	1095	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)			endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						CAGCATTCTTAGTTTGCCATT	0.418																																					p.L1095P		Atlas-SNP	.											RGPD8_ENST00000302558,NS,carcinoma,0,2	RGPD8	81	2	0			c.T3284C						scavenged	.						1.0	1.0	1.0					2																	113147238		3	5	8	SO:0001583	missense	727851	exon20			ATTCTTAGTTTGC	AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.3284T>C	2.37:g.113147238A>G	ENSP00000306637:p.Leu1095Pro	Somatic	66	3	0.0454545		WXS	Illumina HiSeq	Phase_I	68	8	0.117647	NM_001164463	Q5CZA8	Missense_Mutation	SNP	ENST00000302558.3	37	CCDS46394.1	.	.	.	.	.	.	.	.	.	.	-	0.070	-1.203988	0.01581	.	.	ENSG00000169629	ENST00000302558;ENST00000409750	T;T	0.44083	0.93;0.93	2.3	2.3	0.28687	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.39682	0.1087	M	0.70595	2.14	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.36890	-0.9729	9	0.48119	T	0.1	-0.3282	8.205	0.31449	1.0:0.0:0.0:0.0	.	1095	O14715	RGPD8_HUMAN	P	1095;955	ENSP00000306637:L1095P;ENSP00000386511:L955P	ENSP00000306637:L1095P	L	-	2	0	RGPD8	112863709	1.000000	0.71417	0.884000	0.34674	0.576000	0.36127	7.271000	0.78506	1.068000	0.40764	0.128000	0.15822	CTA	.	.	weak		0.418	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375951.1	XM_001722279	
USP32	84669	hgsc.bcm.edu	37	17	58288802	58288802	+	Silent	SNP	A	A	G	rs373498551		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:58288802A>G	ENST00000300896.4	-	20	2447	c.2253T>C	c.(2251-2253)tgT>tgC	p.C751C	USP32_ENST00000592339.1_Silent_p.C421C	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	751	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.C751C(3)		NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			TGTTACTAACACACTGGATGC	0.433																																					p.C751C		Atlas-SNP	.											USP32,NS,carcinoma,0,3	USP32	128	3	3	Substitution - coding silent(3)	prostate(3)	c.T2253C						scavenged	.						129.0	118.0	122.0					17																	58288802		2202	4300	6502	SO:0001819	synonymous_variant	84669	exon20			ACTAACACACTGG	AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.2253T>C	17.37:g.58288802A>G		Somatic	260	2	0.00769231		WXS	Illumina HiSeq	Phase_I	282	4	0.0141844	NM_032582	Q7Z5T3|Q9BX85|Q9Y591	Silent	SNP	ENST00000300896.4	37	CCDS32697.1																																																																																			.	.	weak		0.433	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449235.2	NM_032582	
PCSK2	5126	hgsc.bcm.edu	37	20	17240884	17240884	+	Splice_Site	SNP	G	G	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr20:17240884G>T	ENST00000262545.2	+	2	492		c.e2-1		PCSK2_ENST00000377899.1_Splice_Site|PCSK2_ENST00000536609.1_Intron	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2						cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ACTCTCCACAGCTTCCCTTTG	0.552																																					.		Atlas-SNP	.											.	PCSK2	112	.	0			c.121-1G>T						PASS	.						145.0	128.0	134.0					20																	17240884		2203	4300	6503	SO:0001630	splice_region_variant	5126	exon3			TCCACAGCTTCCC	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.178-1G>T	20.37:g.17240884G>T		Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	50	10	0.2	NM_001201528	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Splice_Site	SNP	ENST00000262545.2	37	CCDS13125.1	.	.	.	.	.	.	.	.	.	.	G	13.59	2.282721	0.40394	.	.	ENSG00000125851	ENST00000377899;ENST00000262545	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5997	0.68432	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PCSK2	17188884	1.000000	0.71417	1.000000	0.80357	0.420000	0.31355	6.453000	0.73488	2.513000	0.84729	0.655000	0.94253	.	.	.	none		0.552	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	Intron
SCN7A	6332	hgsc.bcm.edu	37	2	167313511	167313511	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:167313511T>C	ENST00000409855.1	-	10	1285	c.1159A>G	c.(1159-1161)Agt>Ggt	p.S387G		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	387					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.S387G(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	AAGAACAAACTTGCCATATAA	0.353																																					p.S387G		Atlas-SNP	.											SCN7A_ENST00000409855,NS,lymphoid_neoplasm,0,2	SCN7A	410	2	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.A1159G						PASS	.						76.0	65.0	68.0					2																	167313511		1818	4080	5898	SO:0001583	missense	6332	exon10			ACAAACTTGCCAT	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1159A>G	2.37:g.167313511T>C	ENSP00000386796:p.Ser387Gly	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	187	44	0.235294	NM_002976		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.687193	0.88639	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992;ENST00000441411	D;D;D	0.98550	-4.99;-4.99;-4.99	5.35	5.35	0.76521	Ion transport (1);	0.201865	0.35262	N	0.003327	D	0.98220	0.9411	L	0.46157	1.445	0.37219	D	0.905164	D	0.63046	0.992	D	0.76071	0.987	D	0.99956	1.1628	10	0.87932	D	0	.	13.2728	0.60170	0.0:0.0:0.0:1.0	.	387	Q01118	SCN7A_HUMAN	G	387	ENSP00000386796:S387G;ENSP00000413699:S387G;ENSP00000403846:S387G	ENSP00000259060:S387G	S	-	1	0	SCN7A	167021757	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.937000	0.87672	2.006000	0.58801	0.454000	0.30748	AGT	.	.	none		0.353	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
FAM171B	165215	hgsc.bcm.edu	37	2	187559050	187559050	+	Silent	SNP	A	A	G	rs2370705	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:187559050A>G	ENST00000304698.5	+	1	353	c.150A>G	c.(148-150)caA>caG	p.Q50Q	AC017101.10_ENST00000453665.1_RNA	NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	50	Gln-rich.					integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						agcagcagcaacaacaacaac	0.637																																					p.Q50Q		Atlas-SNP	.											FAM171B,colon,carcinoma,0,2	FAM171B	146	2	0			c.A150G						scavenged	.						25.0	27.0	27.0					2																	187559050		2202	4300	6502	SO:0001819	synonymous_variant	165215	exon1			GCAGCAACAACAA	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.150A>G	2.37:g.187559050A>G		Somatic	52	1	0.0192308		WXS	Illumina HiSeq	Phase_I	70	12	0.171429	NM_177454	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Silent	SNP	ENST00000304698.5	37	CCDS33347.1																																																																																			A|0.462;G|0.538	0.538	strong		0.637	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
DTX1	1840	hgsc.bcm.edu	37	12	113496132	113496132	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:113496132C>T	ENST00000257600.3	+	1	638	c.135C>T	c.(133-135)tgC>tgT	p.C45C		NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	45	WWE 1. {ECO:0000255|PROSITE- ProRule:PRU00248}.				cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						CCACCGTGTGCCACCACATTG	0.647																																					p.C45C		Atlas-SNP	.											.	DTX1	83	.	0			c.C135T						PASS	.						103.0	90.0	94.0					12																	113496132		2203	4300	6503	SO:0001819	synonymous_variant	1840	exon1			CGTGTGCCACCAC	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.135C>T	12.37:g.113496132C>T		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	89	10	0.11236	NM_004416	O60630|Q9BS04	Silent	SNP	ENST00000257600.3	37	CCDS9164.1																																																																																			.	.	none		0.647	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2		
OSBPL10	114884	hgsc.bcm.edu	37	3	32022625	32022625	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:32022625C>G	ENST00000396556.2	-	1	169	c.47G>C	c.(46-48)aGc>aCc	p.S16T	OSBPL10_ENST00000438237.2_Missense_Mutation_p.S16T|ZNF860_ENST00000360311.4_5'Flank	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	16					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		gcggctgctgctgttgctACC	0.791																																					p.S16T		Atlas-SNP	.											.	OSBPL10	160	.	0			c.G47C						PASS	.						2.0	3.0	2.0					3																	32022625		679	1485	2164	SO:0001583	missense	114884	exon1			CTGCTGCTGTTGC	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.47G>C	3.37:g.32022625C>G	ENSP00000379804:p.Ser16Thr	Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	148	33	0.222973	NM_017784	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.672276	0.47781	.	.	ENSG00000144645	ENST00000396556;ENST00000438237	T;T	0.23552	1.9;2.21	3.91	3.91	0.45181	.	0.842884	0.09989	N	0.729989	T	0.16685	0.0401	N	0.14661	0.345	0.27041	N	0.964015	P;P	0.51791	0.948;0.948	B;B	0.40534	0.332;0.332	T	0.05971	-1.0853	10	0.28530	T	0.3	.	13.8256	0.63348	0.0:1.0:0.0:0.0	.	16;16	B4E212;Q9BXB5	.;OSB10_HUMAN	T	16	ENSP00000379804:S16T;ENSP00000406124:S16T	ENSP00000379804:S16T	S	-	2	0	OSBPL10	31997629	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	2.735000	0.47377	2.196000	0.70406	0.298000	0.19748	AGC	.	.	none		0.791	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
HRNR	388697	hgsc.bcm.edu	37	1	152187485	152187485	+	Missense_Mutation	SNP	C	C	T	rs571489109	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:152187485C>T	ENST00000368801.2	-	3	6695	c.6620G>A	c.(6619-6621)cGt>cAt	p.R2207H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2207					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTGGAAGAACGACCTGAGCC	0.597													c|||	3	0.000599042	0.0008	0.0014	5008	,	,		38924	0.0		0.0	False		,,,				2504	0.001				p.R2207H		Atlas-SNP	.											HRNR,trunk,malignant_melanoma,-1,1	HRNR	403	1	0			c.G6620A						scavenged	.						24.0	37.0	32.0					1																	152187485		2153	4277	6430	SO:0001583	missense	388697	exon3			GAAGAACGACCTG	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.6620G>A	1.37:g.152187485C>T	ENSP00000357791:p.Arg2207His	Somatic	261	0	0		WXS	Illumina HiSeq	Phase_I	272	16	0.0588235	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	-	7.903	0.734868	0.15574	.	.	ENSG00000197915	ENST00000368801	T	0.17854	2.25	3.18	-2.56	0.06268	.	.	.	.	.	T	0.03178	0.0093	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.44159	-0.9346	9	0.45353	T	0.12	.	4.6072	0.12383	0.0:0.3414:0.1691:0.4895	.	2207	Q86YZ3	HORN_HUMAN	H	2207	ENSP00000357791:R2207H	ENSP00000357791:R2207H	R	-	2	0	HRNR	150454109	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.838000	0.04372	-0.349000	0.08274	-0.506000	0.04501	CGT	.	.	none		0.597	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
UGT1A9	54600	hgsc.bcm.edu	37	2	234581002	234581002	+	Missense_Mutation	SNP	C	C	G	rs76167146	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:234581002C>G	ENST00000354728.4	+	1	504	c.422C>G	c.(421-423)tCt>tGt	p.S141C	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Missense_Mutation_p.S141C			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	141					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	AAGGAGAGTTCTTTTGATGCA	0.358																																					p.S141C		Atlas-SNP	.											UGT1A9,NS,carcinoma,0,1	UGT1A9	79	1	0			c.C422G						scavenged	.						125.0	125.0	125.0					2																	234581002		2203	4300	6503	SO:0001583	missense	54600	exon1			AGAGTTCTTTTGA	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.422C>G	2.37:g.234581002C>G	ENSP00000346768:p.Ser141Cys	Somatic	139	3	0.0215827		WXS	Illumina HiSeq	Phase_I	149	9	0.0604027	NM_021027	B8K285|P36509|Q9HAX0	Missense_Mutation	SNP	ENST00000354728.4	37	CCDS2505.1	.	.	.	.	.	.	.	.	.	.	C	5.531	0.282927	0.10458	.	.	ENSG00000241119	ENST00000354728	T	0.62639	0.01	3.41	3.41	0.39046	.	.	.	.	.	T	0.61375	0.2342	M	0.81942	2.565	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.12837	0.008;0.008	T	0.58036	-0.7707	9	0.66056	D	0.02	.	6.3779	0.21517	0.334:0.5079:0.1581:0.0	.	141;141	Q5DSZ5;O60656	.;UD19_HUMAN	C	141	ENSP00000346768:S141C	ENSP00000346768:S141C	S	+	2	0	UGT1A9	234245741	0.000000	0.05858	0.866000	0.34008	0.471000	0.32888	0.356000	0.20181	1.907000	0.55213	0.440000	0.28878	TCT	C|0.943;G|0.057	0.057	strong		0.358	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027	
CD209	30835	hgsc.bcm.edu	37	19	7810925	7810925	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr19:7810925G>A	ENST00000315599.7	-	4	249	c.227C>T	c.(226-228)gCg>gTg	p.A76V	CD209_ENST00000354397.6_Missense_Mutation_p.A76V|CD209_ENST00000593660.1_Missense_Mutation_p.A52V|CD209_ENST00000301357.8_Missense_Mutation_p.A32V|CD209_ENST00000394161.5_Intron|CD209_ENST00000601951.1_Missense_Mutation_p.A52V|CD209_ENST00000602261.1_Missense_Mutation_p.A76V|CD209_ENST00000601256.1_Missense_Mutation_p.A52V|CD209_ENST00000204801.8_Missense_Mutation_p.A32V|CD209_ENST00000394173.4_Missense_Mutation_p.A76V|CD209_ENST00000315591.8_Missense_Mutation_p.A52V|CD209_ENST00000593821.1_Missense_Mutation_p.A32V	NM_001144895.1|NM_001144897.1|NM_021155.3	NP_001138367.1|NP_001138369.1|NP_066978.1	Q9NNX6	CD209_HUMAN	CD209 molecule	76					antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|heterophilic cell-cell adhesion (GO:0007157)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of T cell proliferation (GO:0042129)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|virion binding (GO:0046790)			endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CTGGTAGATCGCGTCTTGCCT	0.507																																					p.A76V		Atlas-SNP	.											CD209_ENST00000315599,caecum,carcinoma,+1,2	CD209	166	2	0			c.C227T						scavenged	.						174.0	172.0	173.0					19																	7810925		2203	4300	6503	SO:0001583	missense	30835	exon4			TAGATCGCGTCTT	M98457	CCDS12186.1, CCDS45949.1, CCDS45950.1, CCDS45951.1, CCDS45952.1, CCDS59344.1, CCDS59345.1	19p13	2011-08-30	2006-03-28			ENSG00000090659		"""C-type lectin domain containing"", ""CD molecules"""	1641	protein-coding gene	gene with protein product		604672	"""CD209 antigen"""			1518869	Standard	NM_021155		Approved	DC-SIGN, CDSIGN, DC-SIGN1, CLEC4L	uc002mht.2	Q9NNX6		ENST00000315599.7:c.227C>T	19.37:g.7810925G>A	ENSP00000315477:p.Ala76Val	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	156	6	0.0384615	NM_021155	A8KAM4|A8MVQ9|G5E9C4|Q2TB19|Q96QP7|Q96QP8|Q96QP9|Q96QQ0|Q96QQ1|Q96QQ2|Q96QQ3|Q96QQ4|Q96QQ5|Q96QQ6|Q96QQ7|Q96QQ8	Missense_Mutation	SNP	ENST00000315599.7	37	CCDS12186.1	.	.	.	.	.	.	.	.	.	.	g	0.297	-0.976144	0.02215	.	.	ENSG00000090659	ENST00000315599;ENST00000354397;ENST00000315591;ENST00000204801;ENST00000394173;ENST00000301357;ENST00000540789	T;T;T;T;T;T	0.16897	4.08;4.46;4.11;4.1;2.31;4.12	0.734	-1.47	0.08772	.	.	.	.	.	T	0.18087	0.0434	N	0.22421	0.69	0.80722	D	1	B;B;B;D;B;B;B;B;B;B;B	0.63046	0.007;0.021;0.014;0.992;0.301;0.027;0.006;0.007;0.011;0.086;0.026	B;B;B;D;B;B;B;B;B;B;B	0.66716	0.002;0.013;0.008;0.946;0.146;0.008;0.008;0.002;0.008;0.011;0.009	T	0.32455	-0.9906	8	0.30078	T	0.28	.	.	.	.	.	76;76;52;32;32;52;76;76;52;52;76	B2R907;Q9NNX6-2;Q9NNX6-12;Q9NNX6-7;Q9NNX6-8;Q9NNX6-6;G5E9C4;Q9NNX6;Q9NNX6-11;Q9NNX6-10;Q9NNX6-5	.;.;.;.;.;.;.;CD209_HUMAN;.;.;.	V	76;76;52;32;76;32;60	ENSP00000315477:A76V;ENSP00000346373:A76V;ENSP00000315407:A52V;ENSP00000204801:A32V;ENSP00000377728:A76V;ENSP00000301357:A32V	ENSP00000204801:A32V	A	-	2	0	CD209	7716925	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.828000	0.04419	-1.812000	0.01227	-1.986000	0.00452	GCG	.	.	none		0.507	CD209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462241.1	NM_021155	
CCDC166	100130274	hgsc.bcm.edu	37	8	144790043	144790043	+	Silent	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:144790043G>A	ENST00000542437.1	-	1	236	c.237C>T	c.(235-237)taC>taT	p.Y79Y	RP11-429J17.4_ENST00000527579.1_RNA	NM_001162914.1	NP_001156386.1	P0CW27	CC166_HUMAN	coiled-coil domain containing 166	79																	GCGCGCTCACGTAGCTGGCGT	0.692																																					p.Y79Y		Atlas-SNP	.											.	CCDC166	1	.	0			c.C237T						PASS	.						11.0	13.0	13.0					8																	144790043		691	1589	2280	SO:0001819	synonymous_variant	100130274	exon1			GCTCACGTAGCTG		CCDS55280.1	8q24.3	2011-06-20			ENSG00000255181	ENSG00000255181			41910	protein-coding gene	gene with protein product							Standard	NM_001162914		Approved		uc011lkr.2	P0CW27	OTTHUMG00000165148	ENST00000542437.1:c.237C>T	8.37:g.144790043G>A		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	46	17	0.369565	NM_001162914		Silent	SNP	ENST00000542437.1	37	CCDS55280.1	.	.	.	.	.	.	.	.	.	.	G	2.657	-0.280613	0.05642	.	.	ENSG00000255181	ENST00000533508	.	.	.	4.2	-1.04	0.10068	.	.	.	.	.	T	0.23649	0.0572	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.28522	-1.0041	4	.	.	.	.	4.8957	0.13749	0.4288:0.0:0.4339:0.1372	.	.	.	.	M	61	.	.	T	-	2	0	CCDC166	144862031	0.000000	0.05858	0.833000	0.33012	0.306000	0.27790	-0.552000	0.06020	-0.153000	0.11137	-0.291000	0.09656	ACG	.	.	none		0.692	CCDC166-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001162914	
RAB3D	9545	hgsc.bcm.edu	37	19	11446354	11446354	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr19:11446354C>T	ENST00000222120.3	-	3	594	c.334G>A	c.(334-336)Gct>Act	p.A112T	RAB3D_ENST00000589655.1_Missense_Mutation_p.A112T	NM_004283.3	NP_004274.1	O95716	RAB3D_HUMAN	RAB3D, member RAS oncogene family	112					exocytosis (GO:0006887)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)|zymogen granule (GO:0042588)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|ovary(2)	14						TCCTGCACAGCGGCAAAGGAT	0.602																																					p.A112T		Atlas-SNP	.											RAB3D,NS,carcinoma,+1,1	RAB3D	24	1	0			c.G334A						PASS	.						137.0	127.0	130.0					19																	11446354		2203	4300	6503	SO:0001583	missense	9545	exon3			GCACAGCGGCAAA	AF081353	CCDS12257.1	19p13.2	2012-10-02			ENSG00000105514	ENSG00000105514		"""RAB, member RAS oncogene"""	9779	protein-coding gene	gene with protein product	"""Rab3D upregulated with myeloid differentiation"", ""glioblastoma overexpressed"""	604350		GOV		10023084, 10072586	Standard	NM_004283		Approved	RAB16, D2-2, RAD3D	uc002mqx.3	O95716	OTTHUMG00000180835	ENST00000222120.3:c.334G>A	19.37:g.11446354C>T	ENSP00000222120:p.Ala112Thr	Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	71	15	0.211268	NM_004283		Missense_Mutation	SNP	ENST00000222120.3	37	CCDS12257.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.485743	0.84854	.	.	ENSG00000105514	ENST00000222120	T	0.76839	-1.05	4.64	4.64	0.57946	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.80701	0.4673	N	0.21194	0.64	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	D	0.83509	0.0079	10	0.72032	D	0.01	.	16.7878	0.85578	0.0:1.0:0.0:0.0	.	112	O95716	RAB3D_HUMAN	T	112	ENSP00000222120:A112T	ENSP00000222120:A112T	A	-	1	0	RAB3D	11307354	1.000000	0.71417	0.635000	0.29338	0.771000	0.43674	7.499000	0.81566	2.584000	0.87258	0.462000	0.41574	GCT	.	.	none		0.602	RAB3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453211.1	NM_004283	
RHOBTB1	9886	hgsc.bcm.edu	37	10	62631996	62631996	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr10:62631996T>G	ENST00000337910.5	-	10	2205	c.1868A>C	c.(1867-1869)aAc>aCc	p.N623T	RHOBTB1_ENST00000357917.4_Missense_Mutation_p.N623T|RHOBTB1_ENST00000490827.1_5'UTR	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	623					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					ACTGTTGTAGTTGGTGCAGAT	0.483																																					p.N623T		Atlas-SNP	.											.	RHOBTB1	61	.	0			c.A1868C						PASS	.						163.0	153.0	156.0					10																	62631996		2203	4300	6503	SO:0001583	missense	9886	exon10			TTGTAGTTGGTGC	AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.1868A>C	10.37:g.62631996T>G	ENSP00000338671:p.Asn623Thr	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	104	24	0.230769	NM_014836		Missense_Mutation	SNP	ENST00000337910.5	37	CCDS7261.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.771859	0.90108	.	.	ENSG00000072422	ENST00000357917;ENST00000337910	T;T	0.22743	1.94;1.94	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.43545	0.1252	M	0.88775	2.98	0.80722	D	1	P	0.45078	0.85	P	0.48770	0.589	T	0.53872	-0.8377	10	0.87932	D	0	.	15.7833	0.78281	0.0:0.0:0.0:1.0	.	623	O94844	RHBT1_HUMAN	T	623	ENSP00000350595:N623T;ENSP00000338671:N623T	ENSP00000338671:N623T	N	-	2	0	RHOBTB1	62302002	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.036000	0.88901	2.133000	0.65898	0.459000	0.35465	AAC	.	.	none		0.483	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048220.1		
C1QBP	708	hgsc.bcm.edu	37	17	5336352	5336352	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:5336352A>C	ENST00000225698.4	-	6	913	c.832T>G	c.(832-834)Ttt>Gtt	p.F278V	C1QBP_ENST00000574444.1_Missense_Mutation_p.F174V|CTC-524C5.2_ENST00000575890.1_RNA	NM_001212.3	NP_001203.1	Q07021	C1QBP_HUMAN	complement component 1, q subcomponent binding protein	278					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|mature ribosome assembly (GO:0042256)|mRNA processing (GO:0006397)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of mitochondrial translation (GO:0070131)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of trophoblast cell migration (GO:1901165)|regulation of complement activation (GO:0030449)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adrenergic receptor binding (GO:0031690)|complement component C1q binding (GO:0001849)|hyaluronic acid binding (GO:0005540)|kininogen binding (GO:0030984)|mitochondrial ribosome binding (GO:0097177)|mRNA binding (GO:0003729)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			lung(2)|ovary(1)	3					Hyaluronan(DB08818)	CTCTTGACAAAACTCTTGAGG	0.493																																					p.F278V		Atlas-SNP	.											.	C1QBP	12	.	0			c.T832G						PASS	.						78.0	76.0	77.0					17																	5336352		2203	4300	6503	SO:0001583	missense	708	exon6			TGACAAAACTCTT	X75913	CCDS11071.1	17p13.3	2009-05-07				ENSG00000108561			1243	protein-coding gene	gene with protein product	"""C1q globular domain-binding protein"", ""hyaluronan-binding protein 1"", ""splicing factor SF2-associated protein"""	601269		HABP1		8567680, 8195709	Standard	NM_001212		Approved	gC1Q-R, gC1qR, p32, SF2p32	uc002gby.1	Q07021		ENST00000225698.4:c.832T>G	17.37:g.5336352A>C	ENSP00000225698:p.Phe278Val	Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	93	24	0.258065	NM_001212	Q2HXR8|Q9NNY8	Missense_Mutation	SNP	ENST00000225698.4	37	CCDS11071.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.140421	0.77775	.	.	ENSG00000108561	ENST00000225698	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.84759	0.5543	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.88015	0.2765	9	0.87932	D	0	-7.3523	15.1895	0.73032	1.0:0.0:0.0:0.0	.	278	Q07021	C1QBP_HUMAN	V	278	.	ENSP00000225698:F278V	F	-	1	0	C1QBP	5277076	1.000000	0.71417	0.974000	0.42286	0.385000	0.30292	9.186000	0.94906	2.181000	0.69327	0.533000	0.62120	TTT	.	.	none		0.493	C1QBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439388.1	NM_001212	
BTG1	694	hgsc.bcm.edu	37	12	92537992	92537992	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:92537992G>A	ENST00000256015.3	-	2	741	c.380C>T	c.(379-381)gCc>gTc	p.A127V	C12orf79_ENST00000551563.2_5'Flank|C12orf79_ENST00000551843.1_5'Flank|C12orf79_ENST00000549802.1_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|C12orf79_ENST00000546975.1_5'Flank|RP11-796E2.4_ENST00000499685.2_RNA	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	127					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)			haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				TGCTGGTGAGGCTTCATACAG	0.517			T	MYC	BCLL						OREG0022024	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A127V		Atlas-SNP	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	.	BTG1	30	.	0			c.C380T						PASS	.						111.0	99.0	103.0					12																	92537992		2203	4300	6503	SO:0001583	missense	694	exon2			GGTGAGGCTTCAT		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.380C>T	12.37:g.92537992G>A	ENSP00000256015:p.Ala127Val	Somatic	93	0	0	1291	WXS	Illumina HiSeq	Phase_I	158	33	0.208861	NM_001731	P31607	Missense_Mutation	SNP	ENST00000256015.3	37	CCDS9043.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.783019	0.49891	.	.	ENSG00000133639	ENST00000256015;ENST00000552315	T;T	0.31769	1.89;1.48	5.8	5.8	0.92144	Anti-proliferative protein (1);	0.052045	0.85682	D	0.000000	T	0.47875	0.1469	L	0.51422	1.61	0.40184	D	0.977322	P	0.37688	0.605	P	0.51297	0.665	T	0.33189	-0.9878	10	0.52906	T	0.07	-8.3568	20.0608	0.97674	0.0:0.0:1.0:0.0	.	127	P62324	BTG1_HUMAN	V	127;52	ENSP00000256015:A127V;ENSP00000447551:A52V	ENSP00000256015:A127V	A	-	2	0	BTG1	91062123	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	9.413000	0.97351	2.733000	0.93635	0.650000	0.86243	GCC	.	.	none		0.517	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
CACNA1F	778	hgsc.bcm.edu	37	X	49083586	49083586	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chrX:49083586C>T	ENST00000376265.2	-	9	1183	c.1122G>A	c.(1120-1122)gaG>gaA	p.E374E	CACNA1F_ENST00000376251.1_Silent_p.E309E|CACNA1F_ENST00000323022.5_Silent_p.E374E	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	374					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CCTTGGAGAACTCCCTGAGGG	0.562																																					p.E374E		Atlas-SNP	.											.	CACNA1F	218	.	0			c.G1122A						PASS	.						18.0	14.0	15.0					X																	49083586		2185	4254	6439	SO:0001819	synonymous_variant	778	exon9			GGAGAACTCCCTG	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.1122G>A	X.37:g.49083586C>T		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	45	18	0.4	NM_001256789	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Silent	SNP	ENST00000376265.2	37	CCDS35253.1																																																																																			.	.	none		0.562	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183	
MAML2	84441	hgsc.bcm.edu	37	11	95825374	95825374	+	Silent	SNP	T	T	C	rs60727839|rs543548810|rs112603485|rs141671766	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:95825374T>C	ENST00000524717.1	-	2	3105	c.1821A>G	c.(1819-1821)caA>caG	p.Q607Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	607					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q607Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgttgctgctgct	0.532			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q607Q		Atlas-SNP	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,NS,carcinoma,0,1	MAML2	94	1	1	Substitution - coding silent(1)	endometrium(1)	c.A1821G						scavenged	.						27.0	35.0	33.0					11																	95825374		2008	3974	5982	SO:0001819	synonymous_variant	84441	exon2			CTGCTGTTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1821A>G	11.37:g.95825374T>C		Somatic	134	4	0.0298507		WXS	Illumina HiSeq	Phase_I	195	6	0.0307692	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			C|1.000;|0.000	1.000	weak		0.532	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
BEND5	79656	hgsc.bcm.edu	37	1	49208438	49208438	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:49208438C>T	ENST00000371833.3	-	4	837	c.751G>A	c.(751-753)Gcc>Acc	p.A251T	AGBL4_ENST00000371839.1_Intron|BEND5_ENST00000476096.1_Intron|AGBL4_ENST00000371838.1_Intron	NM_024603.2	NP_078879.2	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	251						Golgi apparatus (GO:0005794)				large_intestine(5)|lung(2)|skin(1)	8						AGATCAATGGCGGGACCTAGG	0.443																																					p.A251T		Atlas-SNP	.											.	BEND5	93	.	0			c.G751A						PASS	.						61.0	62.0	61.0					1																	49208438		2203	4300	6503	SO:0001583	missense	79656	exon4			CAATGGCGGGACC	BC007932	CCDS552.2	1p33	2012-11-22	2008-10-03	2008-10-03	ENSG00000162373	ENSG00000162373		"""BEN domain containing"""	25668	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 165"""	C1orf165		12477932	Standard	NM_024603		Approved	FLJ11588	uc001crx.4	Q7L4P6	OTTHUMG00000008153	ENST00000371833.3:c.751G>A	1.37:g.49208438C>T	ENSP00000360899:p.Ala251Thr	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	98	7	0.0714286	NM_024603	D3DQ27|Q96A62|Q9HAI3	Missense_Mutation	SNP	ENST00000371833.3	37	CCDS552.2	.	.	.	.	.	.	.	.	.	.	C	15.38	2.817313	0.50633	.	.	ENSG00000162373	ENST00000371833	.	.	.	5.45	5.45	0.79879	.	0.297443	0.39544	N	0.001321	T	0.36138	0.0956	N	0.12182	0.205	0.42004	D	0.990908	B	0.21147	0.052	B	0.08055	0.003	T	0.21586	-1.0241	8	.	.	.	-28.0768	11.8067	0.52158	0.0:0.9211:0.0:0.0789	.	251	Q7L4P6	BEND5_HUMAN	T	251	.	.	A	-	1	0	BEND5	48981025	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.067000	0.57527	2.838000	0.97847	0.591000	0.81541	GCC	.	.	none		0.443	BEND5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022323.1	NM_024603	
GIN1	54826	hgsc.bcm.edu	37	5	102442522	102442522	+	Silent	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr5:102442522G>A	ENST00000399004.2	-	3	325	c.231C>T	c.(229-231)tgC>tgT	p.C77C	GIN1_ENST00000511400.1_5'Flank|GIN1_ENST00000508629.1_Silent_p.C77C	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	77					DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		CATTTTCATGGCATTCTCTTA	0.353																																					p.C77C		Atlas-SNP	.											.	GIN1	53	.	0			c.C231T						PASS	.						103.0	95.0	98.0					5																	102442522		1844	4092	5936	SO:0001819	synonymous_variant	54826	exon3			TTCATGGCATTCT	BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.231C>T	5.37:g.102442522G>A		Somatic	430	0	0		WXS	Illumina HiSeq	Phase_I	492	31	0.0630081	NM_017676	B2RXF7|B4DIV4|Q6AI03|Q96BR2	Silent	SNP	ENST00000399004.2	37	CCDS43349.1																																																																																			.	.	none		0.353	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370478.3	NM_017676	
SLC7A2	6542	hgsc.bcm.edu	37	8	17406346	17406346	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:17406346G>C	ENST00000494857.1	+	5	910	c.692G>C	c.(691-693)aGt>aCt	p.S231T	SLC7A2_ENST00000522656.1_Missense_Mutation_p.S231T|SLC7A2_ENST00000470360.1_Missense_Mutation_p.S271T|SLC7A2_ENST00000398090.3_Missense_Mutation_p.S271T|SLC7A2_ENST00000004531.10_Missense_Mutation_p.S271T	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	231					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	ATATCAGCAAGTGCCAGGTAA	0.323																																					p.S271T		Atlas-SNP	.											.	SLC7A2	157	.	0			c.G812C						PASS	.						118.0	125.0	123.0					8																	17406346		2203	4300	6503	SO:0001583	missense	6542	exon4			CAGCAAGTGCCAG	D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.692G>C	8.37:g.17406346G>C	ENSP00000419140:p.Ser231Thr	Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	211	49	0.232227	NM_001164771	B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Missense_Mutation	SNP	ENST00000494857.1	37	CCDS34852.1	.	.	.	.	.	.	.	.	.	.	G	1.700	-0.501731	0.04261	.	.	ENSG00000003989	ENST00000494857;ENST00000522656;ENST00000470360;ENST00000004531;ENST00000398090	D;D;D;D;D	0.88046	-2.17;-2.17;-2.33;-2.18;-2.33	4.68	-4.3	0.03710	Amino acid permease domain (1);	1.206210	0.05361	N	0.533658	T	0.72622	0.3483	N	0.20401	0.57	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.09377	0.004;0.004;0.004	T	0.55471	-0.8136	10	0.25106	T	0.35	.	3.0652	0.06212	0.2122:0.4456:0.1431:0.1991	.	271;271;231	P52569-3;P52569-2;P52569	.;.;CTR2_HUMAN	T	231;231;271;271;271	ENSP00000419140:S231T;ENSP00000430464:S231T;ENSP00000419873:S271T;ENSP00000004531:S271T;ENSP00000381164:S271T	ENSP00000004531:S271T	S	+	2	0	SLC7A2	17450725	0.000000	0.05858	0.163000	0.22734	0.993000	0.82548	-1.404000	0.02494	-0.607000	0.05738	0.650000	0.86243	AGT	.	.	none		0.323	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253367.3	NM_003046	
ATG4C	84938	hgsc.bcm.edu	37	1	63282305	63282305	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:63282305G>A	ENST00000317868.4	+	4	427	c.220G>A	c.(220-222)Gga>Aga	p.G74R	ATG4C_ENST00000371120.3_Missense_Mutation_p.G74R	NM_032852.3	NP_116241.2	Q96DT6	ATG4C_HUMAN	autophagy related 4C, cysteine peptidase	74					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|protein targeting to membrane (GO:0006612)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)		ATG4C/FBXO38(2)	NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(3)|ovary(1)|prostate(2)	19						CGTAATTGCAGGAAATGTAGA	0.373																																					p.G74R		Atlas-SNP	.											ATG4C_ENST00000317868,NS,carcinoma,-1,4	ATG4C	96	4	0			c.G220A						PASS	.						74.0	73.0	74.0					1																	63282305		2203	4300	6503	SO:0001583	missense	84938	exon4			ATTGCAGGAAATG	AK027773	CCDS623.1	1p31.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000125703	ENSG00000125703			16040	protein-coding gene	gene with protein product		611339	"""AUT (S. cerevisiae)-like 1, cysteine endopeptidase; AUT-like 1, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog C (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog C (S. cerevisiae)"""	AUTL1, APG4C		12446702	Standard	NM_032852		Approved	FLJ14867, AUTL3	uc001dau.3	Q96DT6	OTTHUMG00000009142	ENST00000317868.4:c.220G>A	1.37:g.63282305G>A	ENSP00000322159:p.Gly74Arg	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	142	33	0.232394	NM_178221	A6NLR8|D3DQ58|Q96K04	Missense_Mutation	SNP	ENST00000317868.4	37	CCDS623.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.155852	0.57259	.	.	ENSG00000125703	ENST00000317868;ENST00000371120;ENST00000443289;ENST00000540025;ENST00000371118	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.31638	0.0803	M	0.69248	2.105	0.80722	D	1	B	0.24092	0.097	B	0.30105	0.111	T	0.15983	-1.0418	10	0.42905	T	0.14	-25.7434	13.6326	0.62204	0.0745:0.0:0.9255:0.0	.	74	Q96DT6	ATG4C_HUMAN	R	74	ENSP00000322159:G74R;ENSP00000360161:G74R;ENSP00000396614:G74R;ENSP00000360159:G74R	ENSP00000322159:G74R	G	+	1	0	ATG4C	63054893	1.000000	0.71417	0.989000	0.46669	0.904000	0.53231	7.605000	0.82844	2.631000	0.89168	0.655000	0.94253	GGA	.	.	none		0.373	ATG4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025332.2	NM_032852	
SLC28A3	64078	hgsc.bcm.edu	37	9	86917281	86917281	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr9:86917281C>T	ENST00000376238.4	-	5	407	c.358G>A	c.(358-360)Gcc>Acc	p.A120T	SLC28A3_ENST00000495823.1_5'Flank|SLC28A3_ENST00000537648.1_Missense_Mutation_p.A51T	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	120					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	AGCACACAGGCCGAAATCACC	0.502																																					p.A120T	Ovarian(106;425 1539 34835 42413 43572)	Atlas-SNP	.											.	SLC28A3	72	.	0			c.G358A						PASS	.						81.0	66.0	71.0					9																	86917281		2203	4300	6503	SO:0001583	missense	64078	exon5			CACAGGCCGAAAT	AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.358G>A	9.37:g.86917281C>T	ENSP00000365413:p.Ala120Thr	Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	37	10	0.27027	NM_001199633	A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Missense_Mutation	SNP	ENST00000376238.4	37	CCDS6670.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751503	0.89753	.	.	ENSG00000197506	ENST00000376238;ENST00000537648	D;D	0.84070	-1.8;-1.8	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.91352	0.7272	M	0.80422	2.495	0.47183	D	0.99934	D;D	0.69078	0.997;0.997	D;D	0.74348	0.983;0.983	D	0.91859	0.5498	10	0.66056	D	0.02	-18.4347	17.9616	0.89087	0.0:1.0:0.0:0.0	.	51;120	B4E2S8;Q9HAS3	.;S28A3_HUMAN	T	120;51	ENSP00000365413:A120T;ENSP00000446438:A51T	ENSP00000365413:A120T	A	-	1	0	SLC28A3	86107101	1.000000	0.71417	0.999000	0.59377	0.883000	0.51084	5.949000	0.70257	2.775000	0.95449	0.655000	0.94253	GCC	.	.	none		0.502	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052874.1	NM_022127	
C15orf43	145645	hgsc.bcm.edu	37	15	45270701	45270701	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr15:45270701G>A	ENST00000340827.3	+	7	555	c.538G>A	c.(538-540)Gat>Aat	p.D180N		NM_152448.2	NP_689661.1	Q8NHR7	CO043_HUMAN	chromosome 15 open reading frame 43	180										NS(1)|breast(2)|large_intestine(1)|lung(2)|skin(2)	8		all_cancers(109;3.68e-08)|all_epithelial(112;1.05e-06)|Lung NSC(122;1.42e-05)|all_lung(180;0.000112)|Melanoma(134;0.0192)		all cancers(107;7.64e-17)|GBM - Glioblastoma multiforme(94;2.03e-06)		TATATCAATTGATGCCATGAA	0.299																																					p.D180N		Atlas-SNP	.											.	C15orf43	19	.	0			c.G538A						PASS	.						47.0	50.0	49.0					15																	45270701		2193	4284	6477	SO:0001583	missense	145645	exon7			TCAATTGATGCCA	BC029537	CCDS10115.1	15q21.1	2006-02-03			ENSG00000167014	ENSG00000167014			28520	protein-coding gene	gene with protein product							Standard	NM_152448		Approved	MGC33951	uc001zuk.4	Q8NHR7	OTTHUMG00000131264	ENST00000340827.3:c.538G>A	15.37:g.45270701G>A	ENSP00000340644:p.Asp180Asn	Somatic	397	0	0		WXS	Illumina HiSeq	Phase_I	498	109	0.218875	NM_152448		Missense_Mutation	SNP	ENST00000340827.3	37	CCDS10115.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.653183	0.47362	.	.	ENSG00000167014	ENST00000340827	T	0.67523	-0.27	4.05	3.12	0.35913	.	0.199441	0.32106	N	0.006577	T	0.68220	0.2977	L	0.29908	0.895	0.26427	N	0.976005	D	0.67145	0.996	D	0.77557	0.99	T	0.57825	-0.7744	10	0.52906	T	0.07	.	7.923	0.29857	0.1204:0.0:0.8796:0.0	.	180	Q8NHR7	CO043_HUMAN	N	180	ENSP00000340644:D180N	ENSP00000340644:D180N	D	+	1	0	C15orf43	43057993	1.000000	0.71417	1.000000	0.80357	0.644000	0.38419	2.150000	0.42254	0.813000	0.34350	0.298000	0.19748	GAT	.	.	none		0.299	C15orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254032.1	NM_152448	
HIST1H4K	8362	hgsc.bcm.edu	37	6	27799065	27799065	+	Missense_Mutation	SNP	T	T	C	rs561516608	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:27799065T>C	ENST00000357549.2	-	1	240	c.241A>G	c.(241-243)Acg>Gcg	p.T81A		NM_003541.2	NP_003532.1	P62805	H4_HUMAN	histone cluster 1, H4k	81					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|lung(3)|ovary(1)|prostate(1)	7						GCGGTGACCGTCTTGCGCTTG	0.607																																					p.T81A		Atlas-SNP	.											.	HIST1H4K	15	.	0			c.A241G						PASS	.						24.0	27.0	26.0					6																	27799065		2199	4276	6475	SO:0001583	missense	8362	exon1			TGACCGTCTTGCG	X60483	CCDS4631.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197914	ENSG00000273542		"""Histones / Replication-dependent"""	4784	protein-coding gene	gene with protein product		602825	"""H4 histone family, member D"", ""histone 1, H4k"""	H4FD		9439656, 12408966	Standard	NM_003541		Approved	H4/d, H4F2iii, dJ160A22.1	uc003njr.3	P62805	OTTHUMG00000014488	ENST00000357549.2:c.241A>G	6.37:g.27799065T>C	ENSP00000350159:p.Thr81Ala	Somatic	353	1	0.00283286		WXS	Illumina HiSeq	Phase_I	341	128	0.375367	NM_003541	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000357549.2	37	CCDS4631.1	.	.	.	.	.	.	.	.	.	.	.	28.3	4.910440	0.92107	.	.	ENSG00000197914	ENST00000357549	T	0.78003	-1.14	4.25	4.25	0.50352	.	0.000000	0.53938	U	0.000047	T	0.78824	0.4344	.	.	.	0.36651	D	0.877411	.	.	.	.	.	.	T	0.82376	-0.0488	7	0.62326	D	0.03	.	12.857	0.57890	0.0:0.0:0.0:1.0	.	.	.	.	A	81	ENSP00000350159:T81A	ENSP00000350159:T81A	T	-	1	0	HIST1H4K	27907044	1.000000	0.71417	0.992000	0.48379	0.939000	0.58152	7.204000	0.77872	1.679000	0.50963	0.528000	0.53228	ACG	.	.	none		0.607	HIST1H4K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040156.1	NM_003541	
HIST2H2AC	8338	hgsc.bcm.edu	37	1	149858804	149858804	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:149858804C>G	ENST00000331380.2	+	1	280	c.280C>G	c.(280-282)Ctg>Gtg	p.L94V	HIST2H2BE_ENST00000369155.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_003517.2	NP_003508.1	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	94						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|ovary(1)|skin(1)	20	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CGACGAGGAACTGAACAAGCT	0.592																																					p.L94V		Atlas-SNP	.											HIST2H2AC,NS,carcinoma,-2,3	HIST2H2AC	75	3	0			c.C280G						PASS	.						70.0	71.0	70.0					1																	149858804		2203	4298	6501	SO:0001583	missense	8338	exon1			GAGGAACTGAACA	AY131973	CCDS937.1	1q21.2	2011-01-27	2006-10-11	2003-02-21	ENSG00000184260	ENSG00000184260		"""Histones / Replication-dependent"""	4738	protein-coding gene	gene with protein product		602797	"""H2A histone family, member Q"", ""histone 2, H2ac"""	H2A, H2AFQ		1469070, 9439656, 12408966	Standard	NM_003517		Approved	H2A/q	uc001etd.3	Q16777	OTTHUMG00000035825	ENST00000331380.2:c.280C>G	1.37:g.149858804C>G	ENSP00000332194:p.Leu94Val	Somatic	219	0	0		WXS	Illumina HiSeq	Phase_I	272	68	0.25	NM_003517	Q6DRA7|Q8IUE5	Missense_Mutation	SNP	ENST00000331380.2	37	CCDS937.1	.	.	.	.	.	.	.	.	.	.	C	7.491	0.650732	0.14516	.	.	ENSG00000184260	ENST00000331380	T	0.52983	0.64	5.67	3.82	0.43975	Histone-fold (2);Histone H2A (1);	0.000000	0.38778	N	0.001568	T	0.68997	0.3062	H	0.95917	3.74	0.33693	D	0.613536	D	0.71674	0.998	D	0.80764	0.994	T	0.78391	-0.2222	10	0.87932	D	0	.	11.0346	0.47793	0.0:0.8491:0.0:0.1509	.	94	Q16777	H2A2C_HUMAN	V	94	ENSP00000332194:L94V	ENSP00000332194:L94V	L	+	1	2	HIST2H2AC	148125428	1.000000	0.71417	0.199000	0.23439	0.005000	0.04900	5.888000	0.69758	0.771000	0.33359	-0.136000	0.14681	CTG	.	.	none		0.592	HIST2H2AC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087128.1	NM_003517	
ZNF721	170960	hgsc.bcm.edu	37	4	435533	435533	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr4:435533A>G	ENST00000338977.5	-	2	2735	c.2687T>C	c.(2686-2688)cTt>cCt	p.L896P	ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000511833.2_Missense_Mutation_p.L908P|ZNF721_ENST00000507078.1_Intron			Q8TF20	ZN721_HUMAN	zinc finger protein 721	896					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						ATGTGCATAAAGATTTGCAGA	0.368																																					p.I908T		Atlas-SNP	.											.	ZNF721	205	.	0			c.T2723C						PASS	.						62.0	65.0	64.0					4																	435533		2011	4220	6231	SO:0001583	missense	170960	exon3			GCATAAAGATTTG	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.2687T>C	4.37:g.435533A>G	ENSP00000340524:p.Leu896Pro	Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	135	38	0.281481	NM_133474	Q69YG7	Missense_Mutation	SNP	ENST00000338977.5	37		.	.	.	.	.	.	.	.	.	.	A	10.93	1.489800	0.26686	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	T;T	0.42900	0.96;0.96	0.539	-1.08	0.09936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.67325	0.2881	H	0.96430	3.82	0.09310	N	0.999993	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.70716	0.934;0.934;0.97	T	0.56347	-0.7994	9	0.72032	D	0.01	.	3.4437	0.07473	0.654:0.0:0.0:0.346	.	896;908;908	Q8TF20;D9N162;Q8TF20-2	ZN721_HUMAN;.;.	P	896;908	ENSP00000340524:L896P;ENSP00000428878:L908P	ENSP00000340524:L896P	L	-	2	0	ZNF721	425533	0.792000	0.28813	0.001000	0.08648	0.017000	0.09413	6.207000	0.72159	-0.660000	0.05352	0.172000	0.16884	CTT	.	.	none		0.368	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
CCND2	894	hgsc.bcm.edu	37	12	4383227	4383227	+	Silent	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:4383227G>A	ENST00000261254.3	+	1	290	c.21G>A	c.(19-21)gaG>gaA	p.E7E	RP11-264F23.4_ENST00000537370.1_RNA|RP11-264F23.3_ENST00000539135.1_RNA	NM_001759.3	NP_001750.1	P30279	CCND2_HUMAN	cyclin D2	7					cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)	chromatin (GO:0000785)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			TGTGCCACGAGGTGGACCCGG	0.637			T	IGL@	"""NHL,CLL"""																																p.E7E		Atlas-SNP	.		Dom	yes		12	12p13	894	cyclin D2		L	.	CCND2	50	.	0			c.G21A						PASS	.						29.0	28.0	28.0					12																	4383227		2202	4298	6500	SO:0001819	synonymous_variant	894	exon1			CCACGAGGTGGAC	AF518005	CCDS8524.1	12p13	2008-08-04			ENSG00000118971	ENSG00000118971			1583	protein-coding gene	gene with protein product	"""G1/S-specific cyclin D2"""	123833				1386335	Standard	NM_001759		Approved		uc001qmo.3	P30279	OTTHUMG00000168123	ENST00000261254.3:c.21G>A	12.37:g.4383227G>A		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	83	21	0.253012	NM_001759	A8K531|Q13955|Q5U035	Silent	SNP	ENST00000261254.3	37	CCDS8524.1																																																																																			.	.	none		0.637	CCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398287.1	NM_001759	
FOXD4L1	200350	hgsc.bcm.edu	37	2	114256859	114256859	+	Missense_Mutation	SNP	C	C	T	rs189095552	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:114256859C>T	ENST00000306507.5	+	1	199	c.26C>T	c.(25-27)cCt>cTt	p.P9L		NM_012184.4	NP_036316.1	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	9					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P9L(2)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(2)	26						GCTGAGCGCCCTCGCTCCACA	0.647																																					p.P9L		Atlas-SNP	.											FOXD4L1,NS,malignant_melanoma,0,2	FOXD4L1	48	2	2	Substitution - Missense(2)	NS(1)|skin(1)	c.C26T						scavenged	.						24.0	34.0	31.0					2																	114256859		2142	4164	6306	SO:0001583	missense	200350	exon1			AGCGCCCTCGCTC	AF452723	CCDS2117.1	2q14.1	2008-02-05			ENSG00000184492	ENSG00000184492			18521	protein-coding gene	gene with protein product		611084				12421752, 15233989	Standard	NM_012184		Approved	FOXD5	uc002tjw.4	Q9NU39	OTTHUMG00000131359	ENST00000306507.5:c.26C>T	2.37:g.114256859C>T	ENSP00000302756:p.Pro9Leu	Somatic	179	2	0.0111732		WXS	Illumina HiSeq	Phase_I	164	5	0.0304878	NM_012184	B3KWN1|B9EGF3	Missense_Mutation	SNP	ENST00000306507.5	37	CCDS2117.1	265	0.12133699633699634	29	0.05894308943089431	63	0.17403314917127072	122	0.21328671328671328	51	0.06728232189973615	.	0	-2.671754	0.00104	.	.	ENSG00000184492	ENST00000306507	D	0.93307	-3.2	2.57	0.149	0.14863	.	.	.	.	.	T	0.00178	0.0005	N	0.01168	-0.975	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16988	-1.0384	8	0.18276	T	0.48	.	6.9208	0.24387	0.0:0.5889:0.0:0.4111	rs2757969;rs4644326	9	Q9NU39	FX4L1_HUMAN	L	9	ENSP00000302756:P9L	ENSP00000302756:P9L	P	+	2	0	FOXD4L1	113973329	0.000000	0.05858	0.270000	0.24601	0.060000	0.15804	-0.419000	0.07071	-0.116000	0.11893	-1.461000	0.01025	CCT	.	.	weak		0.647	FOXD4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254148.1	NM_012184	
PIM1	5292	hgsc.bcm.edu	37	6	37138355	37138355	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:37138355C>T	ENST00000373509.5	+	1	377	c.4C>T	c.(4-6)Ctc>Ttc	p.L2F		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	93					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)	p.L2V(1)|p.L2F(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GGTTGGGATGCTCTTGTCCAA	0.701			T	BCL6	NHL																																p.L93F		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,3	PIM1	71	3	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.C277T						PASS	.						30.0	30.0	30.0					6																	37138355		2201	4298	6499	SO:0001583	missense	5292	exon1			GGGATGCTCTTGT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.4C>T	6.37:g.37138355C>T	ENSP00000362608:p.Leu2Phe	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	64	19	0.296875	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.693535	0.88735	.	.	ENSG00000137193	ENST00000373509	T	0.71222	-0.55	4.05	4.05	0.47172	.	0.000000	0.32147	N	0.006517	T	0.61899	0.2384	N	0.08118	0	0.48830	D	0.999711	D	0.76494	0.999	D	0.66196	0.942	T	0.73933	-0.3826	10	0.72032	D	0.01	.	16.7252	0.85419	0.0:1.0:0.0:0.0	.	93	P11309	PIM1_HUMAN	F	2	ENSP00000362608:L2F	ENSP00000362608:L2F	L	+	1	0	PIM1	37246333	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.672000	0.61597	2.211000	0.71520	0.542000	0.68232	CTC	.	.	none		0.701	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
HIPK3	10114	hgsc.bcm.edu	37	11	33374879	33374879	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:33374879C>T	ENST00000303296.4	+	17	3718	c.3413C>T	c.(3412-3414)gCc>gTc	p.A1138V	HIPK3_ENST00000525975.1_Missense_Mutation_p.A1117V|HIPK3_ENST00000456517.1_Missense_Mutation_p.A1117V|HIPK3_ENST00000379016.3_Missense_Mutation_p.A1117V|AL122015.1_ENST00000411202.1_RNA	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	1138					apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						CACCTGTTAGCCTCTCCGTGT	0.522																																					p.A1138V		Atlas-SNP	.											.	HIPK3	92	.	0			c.C3413T						PASS	.						220.0	181.0	194.0					11																	33374879		2202	4298	6500	SO:0001583	missense	10114	exon17			TGTTAGCCTCTCC	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.3413C>T	11.37:g.33374879C>T	ENSP00000304226:p.Ala1138Val	Somatic	242	0	0		WXS	Illumina HiSeq	Phase_I	261	54	0.206897	NM_005734	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	ENST00000303296.4	37	CCDS7884.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.618437	0.87359	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	T;T;T;T	0.61274	0.12;0.15;0.12;0.12	6.16	5.25	0.73442	.	0.000000	0.64402	D	0.000013	T	0.74207	0.3686	M	0.61703	1.905	0.58432	D	0.999994	D;D	0.76494	0.999;0.985	D;P	0.72075	0.976;0.871	T	0.77395	-0.2604	10	0.72032	D	0.01	.	17.5986	0.88020	0.0:0.8766:0.1234:0.0	.	1117;1138	Q9H422-2;Q9H422	.;HIPK3_HUMAN	V	1117;1138;1117;1117	ENSP00000431710:A1117V;ENSP00000304226:A1138V;ENSP00000368301:A1117V;ENSP00000398241:A1117V	ENSP00000304226:A1138V	A	+	2	0	HIPK3	33331455	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	7.263000	0.78421	1.605000	0.50152	-0.181000	0.13052	GCC	.	.	none		0.522	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734	
MSH3	4437	hgsc.bcm.edu	37	5	79950724	79950724	+	Missense_Mutation	SNP	G	G	C	rs70991168|rs2001675	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr5:79950724G>C	ENST00000265081.6	+	1	258	c.178G>C	c.(178-180)Gcc>Ccc	p.A60P	DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000439211.2_5'UTR	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	60	Poly-Ala.		Missing. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8942985}.		ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ggccgcagcggccgcagcgCC	0.706								Mismatch excision repair (MMR)					G|||	104	0.0207668	0.0703	0.0086	5008	,	,		6209	0.001		0.003	False		,,,				2504	0.001				p.A60P	Melanoma(88;1010 1399 13793 26548 36275)	Atlas-SNP	.											.	MSH3	129	.	0			c.G178C						PASS	.						5.0	6.0	6.0					5																	79950724		2048	3971	6019	SO:0001583	missense	4437	exon1			GCAGCGGCCGCAG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.178G>C	5.37:g.79950724G>C	ENSP00000265081:p.Ala60Pro	Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	58	14	0.241379	NM_002439	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	386	0.17673992673992675	112	0.22764227642276422	76	0.20994475138121546	57	0.09965034965034965	141	0.18601583113456466	G	4.951	0.176580	0.09443	.	.	ENSG00000113318	ENST00000265081	D	0.87256	-2.23	2.67	-0.189	0.13260	.	.	.	.	.	T	0.00073	0.0002	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.25667	0.131	B	0.26517	0.07	T	0.01956	-1.1240	7	.	.	.	.	8.8041	0.34927	0.0:0.0:0.6183:0.3817	rs2001675;rs2405878;rs13182328	60	P20585	MSH3_HUMAN	P	60	ENSP00000265081:A60P	.	A	+	1	0	MSH3	79986480	0.010000	0.17322	0.501000	0.27601	0.264000	0.26372	-0.184000	0.09698	-0.480000	0.06803	0.000000	0.15137	GCC	G|0.824;C|0.176	0.176	strong		0.706	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
SLC9B2	133308	hgsc.bcm.edu	37	4	103966055	103966055	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr4:103966055G>A	ENST00000394785.3	-	8	1619	c.988C>T	c.(988-990)Cgt>Tgt	p.R330C	SLC9B2_ENST00000339611.4_Missense_Mutation_p.R330C|SLC9B2_ENST00000503103.1_Missense_Mutation_p.R273C|SLC9B2_ENST00000503230.1_Missense_Mutation_p.R273C|SLC9B2_ENST00000362026.3_Missense_Mutation_p.R330C	NM_178833.4	NP_849155.2	Q86UD5	SL9B2_HUMAN	solute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2	330					ion transmembrane transport (GO:0034220)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	solute:proton antiporter activity (GO:0015299)										ACCTGGTCACGGCTTGGAAAG	0.408																																					p.R330C		Atlas-SNP	.											NHEDC2,colon,carcinoma,+1,2	.	.	2	0			c.C988T						PASS	.						143.0	156.0	151.0					4																	103966055		2203	4300	6503	SO:0001583	missense	133308	exon8			GGTCACGGCTTGG	AK172823	CCDS3662.1, CCDS75173.1, CCDS75174.1	4q24	2013-05-22	2012-03-22	2011-08-03	ENSG00000164038	ENSG00000164038		"""Solute carriers"""	25143	protein-coding gene	gene with protein product		611789	"""Na+/H+ exchanger domain containing 2"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 2"""	NHEDC2		18600791	Standard	XM_005262758		Approved	FLJ23984, NHA2	uc003hwy.3	Q86UD5	OTTHUMG00000131125	ENST00000394785.3:c.988C>T	4.37:g.103966055G>A	ENSP00000378265:p.Arg330Cys	Somatic	358	0	0		WXS	Illumina HiSeq	Phase_I	383	76	0.198433	NM_178833	B5ME52|Q6ZMD8|Q96D95	Missense_Mutation	SNP	ENST00000394785.3	37	CCDS3662.1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.076292	0.55753	.	.	ENSG00000164038	ENST00000362026;ENST00000506288;ENST00000339611;ENST00000394785;ENST00000503103;ENST00000503230	T;T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31;2.31	5.03	-2.47	0.06442	.	1.386590	0.04153	N	0.321639	T	0.26991	0.0661	L	0.56199	1.76	0.23287	N	0.997975	D;D;B;D	0.64830	0.994;0.971;0.146;0.98	P;P;B;P	0.57244	0.816;0.697;0.04;0.553	T	0.29640	-1.0005	10	0.54805	T	0.06	-0.6348	4.0241	0.09678	0.1963:0.0649:0.4217:0.3172	.	273;273;330;330	B7Z676;E9PE63;Q86UD5-2;Q86UD5	.;.;.;SL9B2_HUMAN	C	330;230;330;330;273;273	ENSP00000354574:R330C;ENSP00000421943:R230C;ENSP00000345241:R330C;ENSP00000378265:R330C;ENSP00000425385:R273C;ENSP00000422477:R273C	ENSP00000345241:R330C	R	-	1	0	SLC9B2	104185504	0.504000	0.26123	0.964000	0.40570	0.872000	0.50106	0.737000	0.26144	-0.290000	0.09025	-0.671000	0.03813	CGT	.	.	none		0.408	SLC9B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253805.1	NM_178833	
MCHR1	2847	hgsc.bcm.edu	37	22	41076964	41076964	+	Missense_Mutation	SNP	C	C	T	rs200627010		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr22:41076964C>T	ENST00000249016.4	+	2	997	c.301C>T	c.(301-303)Cgc>Tgc	p.R101C	MCHR1_ENST00000498400.1_3'UTR|MCHR1_ENST00000381433.2_Missense_Mutation_p.R101C	NM_005297.3	NP_005288.3	Q99705	MCHR1_HUMAN	melanin-concentrating hormone receptor 1	101					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|melanin-concentrating hormone receptor activity (GO:0030273)|neuropeptide receptor activity (GO:0008188)			endometrium(5)|large_intestine(7)|lung(6)|pancreas(1)|urinary_tract(1)	20						ATCACCTCCTCGCACGGGGAG	0.577																																					p.R101C		Atlas-SNP	.											MCHR1,NS,carcinoma,0,1	MCHR1	45	1	0			c.C301T						scavenged	.						123.0	95.0	105.0					22																	41076964		2203	4300	6503	SO:0001583	missense	2847	exon2			CCTCCTCGCACGG		CCDS14004.1	22q13.3	2014-06-05	2006-02-15	2006-02-15	ENSG00000128285	ENSG00000128285		"""GPCR / Class A : MCH receptors"""	4479	protein-coding gene	gene with protein product		601751	"""G protein-coupled receptor 24"""	GPR24			Standard	XM_005261581		Approved	SLC1, MCH1R	uc003ayz.3	Q99705	OTTHUMG00000150256	ENST00000249016.4:c.301C>T	22.37:g.41076964C>T	ENSP00000249016:p.Arg101Cys	Somatic	77	1	0.012987		WXS	Illumina HiSeq	Phase_I	82	21	0.256098	NM_005297	B2RBX6|Q5R3J1|Q96S47|Q9BV08	Missense_Mutation	SNP	ENST00000249016.4	37	CCDS14004.1	.	.	.	.	.	.	.	.	.	.	C	10.96	1.498061	0.26861	.	.	ENSG00000128285	ENST00000249016;ENST00000381433	T;T	0.36520	1.25;1.25	5.36	5.36	0.76844	.	0.229124	0.38959	N	0.001519	T	0.24928	0.0605	L	0.27053	0.805	0.22639	N	0.998904	B	0.22414	0.069	B	0.16722	0.016	T	0.10042	-1.0647	10	0.36615	T	0.2	.	10.3991	0.44218	0.0:0.9107:0.0:0.0893	.	101	Q99705	MCHR1_HUMAN	C	101	ENSP00000249016:R101C;ENSP00000370841:R101C	ENSP00000249016:R101C	R	+	1	0	MCHR1	39406910	0.001000	0.12720	0.423000	0.26634	0.033000	0.12548	0.312000	0.19397	2.669000	0.90835	0.655000	0.94253	CGC	.	.	weak		0.577	MCHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317142.1	NM_005297	
KLF4	9314	hgsc.bcm.edu	37	9	110250112	110250112	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr9:110250112G>A	ENST00000374672.4	-	3	1036	c.563C>T	c.(562-564)gCg>gTg	p.A188V		NM_004235.4	NP_004226.3	O43474	KLF4_HUMAN	Kruppel-like factor 4 (gut)	188	Pro-rich.				cellular response to cycloheximide (GO:0071409)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|epidermal cell differentiation (GO:0009913)|epidermis morphogenesis (GO:0048730)|fat cell differentiation (GO:0045444)|mesodermal cell fate determination (GO:0007500)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of muscle hyperplasia (GO:0014740)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic camera-type eye development (GO:0031077)|post-embryonic hemopoiesis (GO:0035166)|regulation of cell differentiation (GO:0045595)|response to retinoic acid (GO:0032526)|stem cell maintenance (GO:0019827)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001010)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(5)|large_intestine(1)|lung(3)|pancreas(1)|prostate(2)	16						GTTGATGTCCGCCAGGTTGAA	0.731																																					p.A188V		Atlas-SNP	.											.	KLF4	106	.	0			c.C563T						PASS	.						4.0	4.0	4.0					9																	110250112		2029	4039	6068	SO:0001583	missense	9314	exon3			ATGTCCGCCAGGT	AF022184	CCDS6770.2	9q31	2013-01-08			ENSG00000136826	ENSG00000136826		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6348	protein-coding gene	gene with protein product		602253				9422764, 16372018	Standard	NM_004235		Approved	EZF, GKLF	uc004bdg.3	O43474	OTTHUMG00000020449	ENST00000374672.4:c.563C>T	9.37:g.110250112G>A	ENSP00000363804:p.Ala188Val	Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	39	12	0.307692	NM_004235	B2R8S4|B3KT79|L0R3I6|L0R4N5|P78338|Q5T3J8|Q5T3J9|Q8N717|Q9UNP3	Missense_Mutation	SNP	ENST00000374672.4	37	CCDS6770.2	.	.	.	.	.	.	.	.	.	.	G	21.3	4.133999	0.77662	.	.	ENSG00000136826	ENST00000374672;ENST00000411706	T	0.05513	3.43	4.42	3.5	0.40072	.	0.000000	0.42964	D	0.000640	T	0.09379	0.0231	N	0.19112	0.55	0.30455	N	0.774841	D;D	0.69078	0.997;0.994	P;P	0.55161	0.77;0.652	T	0.03684	-1.1013	10	0.46703	T	0.11	.	13.8448	0.63461	0.0:0.1545:0.8455:0.0	.	188;188	O43474;O43474-1	KLF4_HUMAN;.	V	188;179	ENSP00000363804:A188V	ENSP00000363804:A188V	A	-	2	0	KLF4	109289933	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	8.439000	0.90308	1.031000	0.39867	0.655000	0.94253	GCG	.	.	none		0.731	KLF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053556.2	NM_004235	
NPY4R	5540	hgsc.bcm.edu	37	10	47086871	47086871	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr10:47086871T>G	ENST00000395716.1	+	2	173	c.88T>G	c.(88-90)Ttc>Gtc	p.F30V	NPY4R_ENST00000374312.1_Missense_Mutation_p.F30V			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	30					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)										CCCATACAACTTCTCTGAACA	0.517																																					p.F30V		Atlas-SNP	.											PPYR1,NS,carcinoma,-2,1	PPYR1	54	1	0			c.T88G						scavenged	.						162.0	149.0	153.0					10																	47086871		2203	4300	6503	SO:0001583	missense	5540	exon3			TACAACTTCTCTG		CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.88T>G	10.37:g.47086871T>G	ENSP00000379066:p.Phe30Val	Somatic	219	1	0.00456621		WXS	Illumina HiSeq	Phase_I	228	32	0.140351	NM_005972	Q13456|Q5ISU3|Q5T2X9|Q6FH06	Missense_Mutation	SNP	ENST00000395716.1	37	CCDS31193.1	.	.	.	.	.	.	.	.	.	.	T	7.764	0.706034	0.15172	.	.	ENSG00000204174	ENST00000374312;ENST00000395716	T;T	0.35421	1.31;1.31	4.78	2.33	0.28932	.	0.515322	0.21459	N	0.074187	T	0.27384	0.0672	L	0.60455	1.87	0.26222	N	0.979144	B	0.33022	0.394	B	0.23716	0.048	T	0.11817	-1.0572	10	0.31617	T	0.26	.	7.1302	0.25496	0.0:0.1902:0.0:0.8098	.	30	P50391	NPY4R_HUMAN	V	30	ENSP00000363431:F30V;ENSP00000379066:F30V	ENSP00000363431:F30V	F	+	1	0	PPYR1	46506877	0.994000	0.37717	0.987000	0.45799	0.266000	0.26442	1.294000	0.33365	0.357000	0.24183	-0.290000	0.09829	TTC	.	.	none		0.517	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047837.1		
MAGEB6	158809	hgsc.bcm.edu	37	X	26212458	26212458	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chrX:26212458A>T	ENST00000379034.1	+	2	644	c.495A>T	c.(493-495)aaA>aaT	p.K165N		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	165										breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						CAGGCTCAAAATATGATGTGG	0.488																																					p.K165N		Atlas-SNP	.											.	MAGEB6	91	.	0			c.A495T						PASS	.						53.0	48.0	50.0					X																	26212458		2202	4300	6502	SO:0001583	missense	158809	exon2			CTCAAAATATGAT	AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.495A>T	X.37:g.26212458A>T	ENSP00000368320:p.Lys165Asn	Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	65	30	0.461538	NM_173523	Q6GS19|Q9H219	Missense_Mutation	SNP	ENST00000379034.1	37	CCDS14217.1	.	.	.	.	.	.	.	.	.	.	A	6.511	0.462510	0.12342	.	.	ENSG00000176746	ENST00000379034	T	0.01947	4.54	1.74	-3.48	0.04739	.	.	.	.	.	T	0.01353	0.0044	N	0.24115	0.695	0.09310	N	1	P	0.47677	0.899	B	0.40009	0.316	T	0.31251	-0.9950	9	0.35671	T	0.21	.	0.7658	0.01015	0.2468:0.3792:0.1733:0.2007	.	165	Q8N7X4	MAGB6_HUMAN	N	165	ENSP00000368320:K165N	ENSP00000368320:K165N	K	+	3	2	MAGEB6	26122379	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.010000	0.12743	-1.568000	0.01670	0.376000	0.23039	AAA	.	.	none		0.488	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	NM_173523	
ZNF208	7757	hgsc.bcm.edu	37	19	22157027	22157027	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr19:22157027G>T	ENST00000397126.4	-	4	957	c.809C>A	c.(808-810)gCa>gAa	p.A270E	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGTAAGGATTGCAGATTGGTT	0.363																																					p.A270E		Atlas-SNP	.											.	ZNF208	817	.	0			c.C809A						PASS	.						33.0	36.0	35.0					19																	22157027		2135	4259	6394	SO:0001583	missense	7757	exon4			AGGATTGCAGATT	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.809C>A	19.37:g.22157027G>T	ENSP00000380315:p.Ala270Glu	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	97	5	0.0515464	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	G	10.36	1.329450	0.24167	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.15372	2.43	2.89	0.112	0.14623	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12008	0.0292	.	.	.	0.09310	N	1	B	0.31125	0.309	B	0.20577	0.03	T	0.18241	-1.0343	8	0.66056	D	0.02	.	10.6065	0.45398	0.0:0.3727:0.6273:0.0	.	270	O43345	ZN208_HUMAN	E	270	ENSP00000380315:A270E	ENSP00000380315:A270E	A	-	2	0	ZNF208	21948867	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.059000	0.14322	0.166000	0.19597	0.306000	0.20318	GCA	.	.	none		0.363	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZNF141	7700	hgsc.bcm.edu	37	4	367062	367062	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr4:367062G>A	ENST00000240499.7	+	4	985	c.836G>A	c.(835-837)gGa>gAa	p.G279E	ZNF141_ENST00000512994.1_Intron|ZNF141_ENST00000505939.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	279					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						ATTCATGCTGGAGAGAAACCC	0.358																																					p.G279E		Atlas-SNP	.											.	ZNF141	48	.	0			c.G836A						PASS	.						73.0	83.0	80.0					4																	367062		2203	4300	6503	SO:0001583	missense	7700	exon4			ATGCTGGAGAGAA	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.836G>A	4.37:g.367062G>A	ENSP00000240499:p.Gly279Glu	Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	118	24	0.20339	NM_003441	Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	37	CCDS33931.1	.	.	.	.	.	.	.	.	.	.	G	9.811	1.183068	0.21870	.	.	ENSG00000131127	ENST00000240499	T	0.25749	1.78	1.23	-0.229	0.13094	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23014	0.0556	L	0.39633	1.23	0.31083	N	0.711687	P	0.46020	0.871	P	0.47786	0.557	T	0.25152	-1.0140	8	.	.	.	.	5.6773	0.17755	0.0:0.0:0.6827:0.3173	.	279	Q15928	ZN141_HUMAN	E	279	ENSP00000240499:G279E	.	G	+	2	0	ZNF141	357062	0.755000	0.28372	0.043000	0.18650	0.306000	0.27790	0.515000	0.22801	-0.424000	0.07382	0.305000	0.20034	GGA	.	.	none		0.358	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
AIDA	64853	hgsc.bcm.edu	37	1	222885628	222885628	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:222885628C>T	ENST00000340020.6	-	1	238	c.32G>A	c.(31-33)cGc>cAc	p.R11H	AIDA_ENST00000541237.1_Intron|BROX_ENST00000539697.1_5'Flank|AIDA_ENST00000474863.1_5'UTR|AIDA_ENST00000355727.2_Missense_Mutation_p.R11H|BROX_ENST00000340934.5_5'Flank|BROX_ENST00000537020.1_5'Flank	NM_022831.2	NP_073742.2	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	11					dorsal/ventral pattern formation (GO:0009953)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|regulation of protein homodimerization activity (GO:0043496)	cytoplasm (GO:0005737)				kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10						GGCGCCCCAGCGCTGCAGCAG	0.672																																					p.R11H		Atlas-SNP	.											.	AIDA	23	.	0			c.G32A						PASS	.						14.0	13.0	14.0					1																	222885628		2197	4265	6462	SO:0001583	missense	64853	exon1			CCCCAGCGCTGCA	BC043142	CCDS1533.1	1q41	2008-05-22	2008-05-22	2008-05-22	ENSG00000186063	ENSG00000186063			25761	protein-coding gene	gene with protein product	"""axin interaction partner and dorsalization antagonist"""	612375	"""chromosome 1 open reading frame 80"""	C1orf80		8619474, 9110174, 17681137	Standard	NM_022831		Approved	FLJ12806	uc001hnn.3	Q96BJ3	OTTHUMG00000037653	ENST00000340020.6:c.32G>A	1.37:g.222885628C>T	ENSP00000339161:p.Arg11His	Somatic	168	0	0		WXS	Illumina HiSeq	Phase_I	175	35	0.2	NM_022831	A8K1F0|Q49A81|Q5JRA4|Q658P1|Q9H9E8	Missense_Mutation	SNP	ENST00000340020.6	37	CCDS1533.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.375314	0.61735	.	.	ENSG00000186063	ENST00000340020;ENST00000355727	.	.	.	5.19	5.19	0.71726	Axin interactor, dorsalization-associated protein, N-terminal (2);	0.063428	0.64402	D	0.000002	T	0.52725	0.1752	L	0.29908	0.895	0.80722	D	1	B	0.31077	0.307	B	0.41666	0.363	T	0.56583	-0.7955	9	0.59425	D	0.04	.	11.8464	0.52387	0.0:0.9189:0.0:0.0811	.	11	Q96BJ3	AIDA_HUMAN	H	11	.	ENSP00000339161:R11H	R	-	2	0	AIDA	220952251	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.068000	0.41471	2.435000	0.82474	0.549000	0.68633	CGC	.	.	none		0.672	AIDA-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091818.1	NM_022831	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230419	23230419	+	Silent	SNP	C	C	T	rs554734650	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr22:23230419C>T	ENST00000526893.1	+	1	460	c.186C>T	c.(184-186)agC>agT	p.S62S	IGLL5_ENST00000532223.2_Silent_p.S62S|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Silent_p.S62S	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	62						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GCCGATCCAGCCTGCGGAGCC	0.647													C|||	3	0.000599042	0.0008	0.0	5008	,	,		11441	0.001		0.001	False		,,,				2504	0.0				p.A27V		Atlas-SNP	.											.	IGLL5	26	.	0			c.C80T						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			ATCCAGCCTGCGG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.186C>T	22.37:g.23230419C>T		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	81	24	0.296296	NM_001256296		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.647	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
ACTG1	71	hgsc.bcm.edu	37	17	79478964	79478964	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:79478964G>C	ENST00000575842.1	-	2	754	c.328C>G	c.(328-330)Ctg>Gtg	p.L110V	RP13-766D20.2_ENST00000430912.1_RNA|ACTG1_ENST00000331925.2_Missense_Mutation_p.L110V|ACTG1_ENST00000575087.1_Missense_Mutation_p.L110V|AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000573283.1_Missense_Mutation_p.L110V			P63261	ACTG_HUMAN	actin, gamma 1	110					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			TTGGGGTTCAGGGGGGCCTCG	0.627																																					p.L110V		Atlas-SNP	.											.	ACTG1	55	.	0			c.C328G						PASS	.						43.0	54.0	50.0					17																	79478964		2203	4298	6501	SO:0001583	missense	71	exon3			GGTTCAGGGGGGC		CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.328C>G	17.37:g.79478964G>C	ENSP00000458162:p.Leu110Val	Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	154	7	0.0454545	NM_001614	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000575842.1	37	CCDS11782.1	.	.	.	.	.	.	.	.	.	.	G	8.995	0.978682	0.18812	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.94793	-3.52	4.51	0.962	0.19643	Actin/actin-like conserved site (1);	0.000000	0.53938	D	0.000044	D	0.97851	0.9294	H	0.97611	4.04	0.35790	D	0.822304	P	0.39748	0.686	D	0.68353	0.957	D	0.97599	1.0122	10	0.87932	D	0	.	6.7442	0.23453	0.4546:0.0:0.5454:0.0	.	110	P63261	ACTG_HUMAN	V	110	ENSP00000331514:L110V	ENSP00000331514:L110V	L	-	1	2	ACTG1	77093559	1.000000	0.71417	0.952000	0.39060	0.162000	0.22319	2.494000	0.45329	0.371000	0.24564	-0.217000	0.12591	CTG	.	.	none		0.627	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2	NM_001614	
DSG3	1830	hgsc.bcm.edu	37	18	29052745	29052745	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr18:29052745A>G	ENST00000257189.4	+	14	2178	c.2095A>G	c.(2095-2097)Agt>Ggt	p.S699G		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	699					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTTCATGGAAAGTTCTGGTAA	0.323																																					p.S699G		Atlas-SNP	.											.	DSG3	172	.	0			c.A2095G						PASS	.						82.0	80.0	81.0					18																	29052745		2203	4300	6503	SO:0001583	missense	1830	exon14			ATGGAAAGTTCTG	M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.2095A>G	18.37:g.29052745A>G	ENSP00000257189:p.Ser699Gly	Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	186	40	0.215054	NM_001944	A8K2V2	Missense_Mutation	SNP	ENST00000257189.4	37	CCDS11898.1	.	.	.	.	.	.	.	.	.	.	A	14.10	2.433730	0.43224	.	.	ENSG00000134757	ENST00000257189	T	0.46451	0.87	6.08	6.08	0.98989	.	0.216111	0.31784	N	0.007067	T	0.36303	0.0962	L	0.46157	1.445	0.29335	N	0.866406	B	0.21606	0.058	B	0.15052	0.012	T	0.35001	-0.9806	10	0.52906	T	0.07	.	10.6629	0.45712	0.8399:0.1601:0.0:0.0	.	699	P32926	DSG3_HUMAN	G	699	ENSP00000257189:S699G	ENSP00000257189:S699G	S	+	1	0	DSG3	27306743	0.925000	0.31364	1.000000	0.80357	0.988000	0.76386	2.357000	0.44125	2.333000	0.79357	0.482000	0.46254	AGT	.	.	none		0.323	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944	
MAST1	22983	hgsc.bcm.edu	37	19	12980018	12980018	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr19:12980018A>T	ENST00000251472.4	+	22	2951	c.2912A>T	c.(2911-2913)cAg>cTg	p.Q971L		NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						ATCACCATCCAGCGCTCGGGC	0.582																																					p.Q971L		Atlas-SNP	.											.	MAST1	214	.	0			c.A2912T						PASS	.						89.0	76.0	81.0					19																	12980018		2203	4300	6503	SO:0001583	missense	22983	exon22			CCATCCAGCGCTC	AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.2912A>T	19.37:g.12980018A>T	ENSP00000251472:p.Gln971Leu	Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	117	30	0.25641	NM_014975		Missense_Mutation	SNP	ENST00000251472.4	37	CCDS32921.1	.	.	.	.	.	.	.	.	.	.	A	17.67	3.447174	0.63178	.	.	ENSG00000105613	ENST00000251472	T	0.39997	1.05	5.01	5.01	0.66863	PDZ/DHR/GLGF (2);	0.066047	0.64402	D	0.000008	T	0.31358	0.0794	N	0.24115	0.695	0.58432	D	0.999999	B	0.09022	0.002	B	0.18561	0.022	T	0.12116	-1.0560	10	0.72032	D	0.01	-15.0771	12.6691	0.56857	1.0:0.0:0.0:0.0	.	971	Q9Y2H9	MAST1_HUMAN	L	971	ENSP00000251472:Q971L	ENSP00000251472:Q971L	Q	+	2	0	MAST1	12841018	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	6.242000	0.72376	1.886000	0.54624	0.379000	0.24179	CAG	.	.	none		0.582	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2	NM_014975	
FMN2	56776	hgsc.bcm.edu	37	1	240370998	240370998	+	Silent	SNP	A	A	G	rs199866405	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:240370998A>G	ENST00000319653.9	+	5	3116	c.2886A>G	c.(2884-2886)gcA>gcG	p.A962A		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	962	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TTCCCGGGGCAGGCATACCCC	0.697																																					p.A962A		Atlas-SNP	.											FMN2,NS,carcinoma,0,2	FMN2	451	2	0			c.A2886G						scavenged	.						21.0	23.0	23.0					1																	240370998		2200	4297	6497	SO:0001819	synonymous_variant	56776	exon5			CGGGGCAGGCATA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2886A>G	1.37:g.240370998A>G		Somatic	61	7	0.114754		WXS	Illumina HiSeq	Phase_I	55	12	0.218182	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			A|0.990;G|0.010	0.010	strong		0.697	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
ZBED1	9189	hgsc.bcm.edu	37	X	2408513	2408513	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chrX:2408513G>A	ENST00000381223.4	-	2	451	c.248C>T	c.(247-249)aCg>aTg	p.T83M	ZBED1_ENST00000381218.3_Missense_Mutation_p.T83M|ZBED1_ENST00000515319.1_5'Flank|ZBED1_ENST00000381222.2_Missense_Mutation_p.T83M|DHRSX_ENST00000334651.5_Intron	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	83					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CATCTGCTCCGTGTTGCTCTT	0.632																																					p.T83M		Atlas-SNP	.											.	ZBED1	64	.	0			c.C248T						PASS	.						195.0	174.0	181.0					X																	2408513		2203	4296	6499	SO:0001583	missense	9189	exon2			TGCTCCGTGTTGC	AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.248C>T	X.37:g.2408513G>A	ENSP00000370621:p.Thr83Met	Somatic	291	0	0		WXS	Illumina HiSeq	Phase_I	299	29	0.09699	NM_001171135	Q96BY4	Missense_Mutation	SNP	ENST00000381223.4	37	CCDS14118.1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.169287	0.57584	.	.	ENSG00000214717	ENST00000381223;ENST00000381222;ENST00000381218;ENST00000461691	.	.	.	2.62	2.62	0.31277	.	0.172732	0.35207	U	0.003379	T	0.63082	0.2481	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.70935	0.971	T	0.55842	-0.8077	8	0.48119	T	0.1	-26.8773	13.0583	0.58992	0.0:0.0:1.0:0.0	.	83	O96006	ZBED1_HUMAN	M	83	.	ENSP00000370616:T83M	T	-	2	0	ZBED1	2418513	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.339000	0.72969	1.086000	0.41228	0.425000	0.28330	ACG	.	.	none		0.632	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144310.3	NM_004729	
FOXC1	2296	hgsc.bcm.edu	37	6	1610903	1610903	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:1610903G>A	ENST00000380874.2	+	1	223	c.223G>A	c.(223-225)Gac>Aac	p.D75N		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	75				QPQPKDMV -> RSRSPRHG (in Ref. 5; AAK13575). {ECO:0000305}.	artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		GCAGCCCAAGGACATGGTGAA	0.652																																					p.D75N	Pancreas(133;719 1821 3197 26645 35015)	Atlas-SNP	.											.	FOXC1	19	.	0			c.G223A						PASS	.						46.0	48.0	47.0					6																	1610903		2203	4300	6503	SO:0001583	missense	2296	exon1			CCCAAGGACATGG	AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.223G>A	6.37:g.1610903G>A	ENSP00000370256:p.Asp75Asn	Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	47	13	0.276596	NM_001453	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Missense_Mutation	SNP	ENST00000380874.2	37	CCDS4473.1	.	.	.	.	.	.	.	.	.	.	g	28.2	4.901869	0.92035	.	.	ENSG00000054598	ENST00000541209;ENST00000380874	D	0.93076	-3.16	3.86	3.86	0.44501	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.41500	U	0.000880	D	0.95465	0.8527	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.96071	0.9046	10	0.72032	D	0.01	.	15.7496	0.77972	0.0:0.0:1.0:0.0	.	75	Q12948	FOXC1_HUMAN	N	75	ENSP00000370256:D75N	ENSP00000370256:D75N	D	+	1	0	FOXC1	1555902	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.589000	0.90817	1.842000	0.53543	0.457000	0.33378	GAC	.	.	none		0.652	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043450.1		
PARK2	5071	hgsc.bcm.edu	37	6	162206824	162206824	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:162206824C>G	ENST00000366898.1	-	7	953	c.851G>C	c.(850-852)gGc>gCc	p.G284A	PARK2_ENST00000366897.1_Missense_Mutation_p.G256A|PARK2_ENST00000366896.1_Missense_Mutation_p.G135A|PARK2_ENST00000366894.1_Missense_Mutation_p.G93A|PARK2_ENST00000338468.3_Missense_Mutation_p.G93A|PARK2_ENST00000366892.1_Missense_Mutation_p.G284A	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	284	SYT11 binding 2.		G -> R (in PARK2).		adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		CAGGGAGTAGCCAAGTTGAGG	0.433																																					p.G284A		Atlas-SNP	.											.	PARK2	96	.	0			c.G851C						PASS	.						94.0	82.0	86.0					6																	162206824		2203	4300	6503	SO:0001583	missense	5071	exon7			GAGTAGCCAAGTT		CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.851G>C	6.37:g.162206824C>G	ENSP00000355865:p.Gly284Ala	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	96	15	0.15625	NM_004562	A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Missense_Mutation	SNP	ENST00000366898.1	37	CCDS5281.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.514696	0.85389	.	.	ENSG00000185345	ENST00000366898;ENST00000366897;ENST00000366896;ENST00000366894;ENST00000338468;ENST00000392134;ENST00000366892;ENST00000366895	D;D;D;D;D;D	0.99828	-6.99;-6.99;-6.99;-6.99;-6.99;-6.99	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.99819	0.9920	M	0.82056	2.57	0.58432	D	0.999994	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.996;0.999;0.999;0.999	D	0.97538	1.0084	10	0.49607	T	0.09	.	17.7106	0.88321	0.0:1.0:0.0:0.0	.	284;135;256;284;93	O60260-5;Q5VVX3;Q5VVX4;O60260;Q8NI42	.;.;.;PRKN2_HUMAN;.	A	284;256;135;93;93;93;284;205	ENSP00000355865:G284A;ENSP00000355863:G256A;ENSP00000355862:G135A;ENSP00000355860:G93A;ENSP00000343589:G93A;ENSP00000355858:G284A	ENSP00000343589:G93A	G	-	2	0	PARK2	162126814	1.000000	0.71417	0.983000	0.44433	0.791000	0.44710	6.554000	0.73923	2.717000	0.92951	0.650000	0.86243	GGC	.	.	none		0.433	PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042995.1		
LPPR5	163404	hgsc.bcm.edu	37	1	99470000	99470000	+	Silent	SNP	G	G	A	rs148163708	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:99470000G>A	ENST00000263177.4	-	1	449	c.228C>T	c.(226-228)ccC>ccT	p.P76P	LPPR5_ENST00000534652.1_5'UTR|RP5-896L10.1_ENST00000425113.1_RNA|LPPR5_ENST00000370188.3_Silent_p.P76P	NM_001037317.1	NP_001032394.1	Q32ZL2	LPPR5_HUMAN		76						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)										CCACGAGCACGGGGACCCCGG	0.721																																					p.P76P		Atlas-SNP	.											.	.	.	.	0			c.C228T						PASS	.						12.0	14.0	14.0					1																	99470000		2197	4283	6480	SO:0001819	synonymous_variant	0	exon1			GAGCACGGGGACC																												ENST00000263177.4:c.228C>T	1.37:g.99470000G>A		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	66	17	0.257576	NM_001037317	A8MPX4|B7UCH3|Q32ZD0|Q3ZCU7	Silent	SNP	ENST00000263177.4	37	CCDS30778.1																																																																																			G|1.000;T|0.000	.	alt		0.721	LPPR5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393221.1		
DGAT2L6	347516	hgsc.bcm.edu	37	X	69424319	69424319	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chrX:69424319G>A	ENST00000333026.3	+	6	912	c.812G>A	c.(811-813)cGc>cAc	p.R271H		NM_198512.1	NP_940914.1	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	271					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(1)	12						GGCTTCACTCGCGGATCCTGG	0.502																																					p.R271H		Atlas-SNP	.											.	DGAT2L6	40	.	0			c.G812A						PASS	.						74.0	69.0	71.0					X																	69424319		2203	4300	6503	SO:0001583	missense	347516	exon6			TCACTCGCGGATC	AK129500	CCDS14397.1	Xq13.1	2008-02-05			ENSG00000184210	ENSG00000184210			23250	protein-coding gene	gene with protein product		300926				15671038	Standard	NM_198512		Approved	DC3, FLJ25989	uc004dxx.1	Q6ZPD8	OTTHUMG00000021774	ENST00000333026.3:c.812G>A	X.37:g.69424319G>A	ENSP00000328036:p.Arg271His	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	79	32	0.405063	NM_198512	Q6IEE2	Missense_Mutation	SNP	ENST00000333026.3	37	CCDS14397.1	.	.	.	.	.	.	.	.	.	.	G	4.247	0.044849	0.08196	.	.	ENSG00000184210	ENST00000333026	T	0.14022	2.54	4.98	1.3	0.21679	.	0.760798	0.11324	N	0.575729	T	0.10809	0.0264	L	0.39245	1.2	0.09310	N	1	B	0.09022	0.002	B	0.14023	0.01	T	0.32693	-0.9897	10	0.42905	T	0.14	-13.1803	5.2833	0.15688	0.2715:0.0:0.5826:0.1459	.	271	Q6ZPD8	DG2L6_HUMAN	H	271	ENSP00000328036:R271H	ENSP00000328036:R271H	R	+	2	0	DGAT2L6	69341044	0.000000	0.05858	0.750000	0.31169	0.053000	0.15095	-1.212000	0.02994	-0.055000	0.13244	-1.016000	0.02456	CGC	.	.	none		0.502	DGAT2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057067.1	NM_198512	
UAP1L1	91373	hgsc.bcm.edu	37	9	139973009	139973009	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr9:139973009C>T	ENST00000409858.3	+	3	582	c.550C>T	c.(550-552)Cac>Tac	p.H184Y	UAP1L1_ENST00000360271.3_Missense_Mutation_p.H61Y|UAP1L1_ENST00000476184.1_3'UTR	NM_207309.2	NP_997192.2	Q3KQV9	UAP1L_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1 like 1	184							uridylyltransferase activity (GO:0070569)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		CTTCAGGGAGCACAACTTCTT	0.622																																					p.H184Y		Atlas-SNP	.											.	UAP1L1	46	.	0			c.C550T						PASS	.						80.0	65.0	70.0					9																	139973009		2203	4300	6503	SO:0001583	missense	91373	exon3			AGGGAGCACAACT	AK022632	CCDS7028.2	9q34.3	2014-07-31	2014-07-31		ENSG00000197355	ENSG00000197355			28082	protein-coding gene	gene with protein product							Standard	NM_207309		Approved		uc010ncb.3	Q3KQV9	OTTHUMG00000020962	ENST00000409858.3:c.550C>T	9.37:g.139973009C>T	ENSP00000386935:p.His184Tyr	Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	78	16	0.205128	NM_207309	A2AMJ8|Q5SPZ2|Q69YQ3|Q6ZR38	Missense_Mutation	SNP	ENST00000409858.3	37	CCDS7028.2	.	.	.	.	.	.	.	.	.	.	C	17.70	3.454287	0.63290	.	.	ENSG00000197355	ENST00000409858;ENST00000360271	T;T	0.16897	2.31;2.31	5.01	2.9	0.33743	.	0.272139	0.42053	D	0.000779	T	0.47728	0.1461	M	0.93062	3.375	0.22017	N	0.99942	D;D	0.63880	0.993;0.978	D;P	0.64144	0.922;0.689	T	0.52283	-0.8596	10	0.87932	D	0	.	14.3374	0.66600	0.2808:0.7192:0.0:0.0	.	184;61	Q3KQV9;Q3KQV9-2	UAP1L_HUMAN;.	Y	184;61	ENSP00000386935:H184Y;ENSP00000353409:H61Y	ENSP00000353409:H61Y	H	+	1	0	UAP1L1	139092830	0.204000	0.23447	0.634000	0.29324	0.941000	0.58515	0.800000	0.27042	1.104000	0.41587	0.561000	0.74099	CAC	.	.	none		0.622	UAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055216.2	XM_038063	
HAS1	3036	hgsc.bcm.edu	37	19	52222861	52222861	+	Silent	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr19:52222861G>A	ENST00000222115.1	-	2	334	c.300C>T	c.(298-300)acC>acT	p.T100T	HAS1_ENST00000594621.1_5'Flank|HAS1_ENST00000540069.2_Silent_p.T99T|HAS1_ENST00000601714.1_Silent_p.T107T	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	100					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		AGGCGGAGATGGTCAGCGCCA	0.761																																					p.T100T	NSCLC(132;636 2450 45807 47979)	Atlas-SNP	.											.	HAS1	61	.	0			c.C300T						PASS	.						4.0	5.0	5.0					19																	52222861		1881	3592	5473	SO:0001819	synonymous_variant	3036	exon2			GGAGATGGTCAGC	U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.300C>T	19.37:g.52222861G>A		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	70	27	0.385714	NM_001523	Q14470|Q9NS49	Silent	SNP	ENST00000222115.1	37	CCDS12838.1																																																																																			.	.	none		0.761	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	NM_001523	
MUC6	4588	hgsc.bcm.edu	37	11	1016849	1016849	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:1016849C>G	ENST00000421673.2	-	31	6002	c.5952G>C	c.(5950-5952)atG>atC	p.M1984I		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1984	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.M1984I(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ATGTTGCAGTCATAGGACCTG	0.582																																					p.M1984I		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,0,2	MUC6	408	2	2	Substitution - Missense(2)	lung(2)	c.G5952C						scavenged	.						1544.0	1533.0	1537.0					11																	1016849		2203	4298	6501	SO:0001583	missense	4588	exon31			TGCAGTCATAGGA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5952G>C	11.37:g.1016849C>G	ENSP00000406861:p.Met1984Ile	Somatic	664	24	0.0361446		WXS	Illumina HiSeq	Phase_I	675	29	0.042963	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	c	0.326	-0.959077	0.02267	.	.	ENSG00000184956	ENST00000421673	T	0.17691	2.26	2.64	-5.29	0.02747	.	.	.	.	.	T	0.09598	0.0236	L	0.43152	1.355	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.27839	-1.0062	9	0.14656	T	0.56	.	1.5757	0.02624	0.1743:0.1847:0.3717:0.2692	.	1984	Q6W4X9	MUC6_HUMAN	I	1984	ENSP00000406861:M1984I	ENSP00000406861:M1984I	M	-	3	0	MUC6	1006849	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.496000	0.02291	-4.003000	0.00082	-2.547000	0.00178	ATG	.	.	none		0.582	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230436	23230436	+	Missense_Mutation	SNP	G	G	A	rs541593342	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr22:23230436G>A	ENST00000526893.1	+	1	477	c.203G>A	c.(202-204)gGc>gAc	p.G68D	IGLL5_ENST00000532223.2_Missense_Mutation_p.G68D|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Missense_Mutation_p.G68D	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	68						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						AGCCTGTGGGGCAGGTAAGGG	0.642													G|||	6	0.00119808	0.0023	0.0029	5008	,	,		11793	0.0		0.001	False		,,,				2504	0.0				p.G68D		Atlas-SNP	.											.	IGLL5	26	.	0			c.G203A						PASS	.																																			SO:0001583	missense	100423062	exon1			TGTGGGGCAGGTA	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.203G>A	22.37:g.23230436G>A	ENSP00000431254:p.Gly68Asp	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	66	7	0.106061	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	9.760	1.169735	0.21621	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00638	6.04;6.53	3.92	-2.62	0.06152	.	.	.	.	.	T	0.00524	0.0017	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46062	-0.9218	9	0.56958	D	0.05	.	1.8547	0.03176	0.21:0.1724:0.4462:0.1715	.	68	B9A064	IGLL5_HUMAN	D	68	ENSP00000436353:G68D;ENSP00000431254:G68D	ENSP00000431254:G68D	G	+	2	0	IGLL5	21560436	0.005000	0.15991	0.008000	0.14137	0.042000	0.13812	0.008000	0.13197	-0.478000	0.06823	-0.195000	0.12781	GGC	.	.	none		0.642	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
MAPKAPK2	9261	hgsc.bcm.edu	37	1	206858801	206858801	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:206858801G>A	ENST00000367103.3	+	1	420	c.227G>A	c.(226-228)gGc>gAc	p.G76D	MAPKAPK2_ENST00000294981.4_Missense_Mutation_p.G76D	NM_004759.4|NM_032960.3	NP_004750.1|NP_116584.2	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated protein kinase 2	76	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|arachidonic acid metabolic process (GO:0019369)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|G2 DNA damage checkpoint (GO:0031572)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|leukotriene metabolic process (GO:0006691)|macropinocytosis (GO:0044351)|MAPK cascade (GO:0000165)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of interleukin-6 production (GO:0032675)|regulation of tumor necrosis factor production (GO:0032680)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	19	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			GGCATCAACGGCAAAGTTTTG	0.607																																					p.G76D		Atlas-SNP	.											.	MAPKAPK2	45	.	0			c.G227A						PASS	.						46.0	48.0	47.0					1																	206858801		2203	4300	6503	SO:0001583	missense	9261	exon1			TCAACGGCAAAGT	U12779	CCDS1466.1, CCDS31001.1	1q32	2008-02-05			ENSG00000162889	ENSG00000162889			6887	protein-coding gene	gene with protein product		602006				8179591, 8280084	Standard	NM_004759		Approved		uc001hem.2	P49137	OTTHUMG00000036342	ENST00000367103.3:c.227G>A	1.37:g.206858801G>A	ENSP00000356070:p.Gly76Asp	Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	78	18	0.230769	NM_004759	Q5SY30|Q5SY41|Q8IYD6	Missense_Mutation	SNP	ENST00000367103.3	37	CCDS31001.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252052	0.80135	.	.	ENSG00000162889	ENST00000294981;ENST00000367103	T;T	0.80738	-1.41;-1.41	3.52	3.52	0.40303	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.92136	0.7507	H	0.95850	3.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93986	0.7262	9	0.87932	D	0	-15.4357	12.5833	0.56403	0.0:0.0:1.0:0.0	.	76;76	P49137;P49137-2	MAPK2_HUMAN;.	D	76	ENSP00000294981:G76D;ENSP00000356070:G76D	ENSP00000294981:G76D	G	+	2	0	MAPKAPK2	204925424	1.000000	0.71417	0.999000	0.59377	0.740000	0.42216	8.642000	0.91036	1.789000	0.52484	0.195000	0.17529	GGC	.	.	none		0.607	MAPKAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088465.1	NM_004759	
C2orf81	388963	hgsc.bcm.edu	37	2	74642291	74642291	+	Missense_Mutation	SNP	A	A	G	rs116859876	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:74642291A>G	ENST00000517883.1	-	1	1419	c.728T>C	c.(727-729)gTg>gCg	p.V243A	C2orf81_ENST00000290390.5_Missense_Mutation_p.V311A			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	304										endometrium(3)|kidney(1)	4						GGCGCCGCCCACAGAGGGGTA	0.711																																					p.V311A		Atlas-SNP	.											.	C2orf81	23	.	0			c.T932C						PASS	.						9.0	13.0	12.0					2																	74642291		690	1587	2277	SO:0001583	missense	388963	exon4			CCGCCCACAGAGG	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.728T>C	2.37:g.74642291A>G	ENSP00000431103:p.Val243Ala	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	92	13	0.141304	NM_001145054		Missense_Mutation	SNP	ENST00000517883.1	37		89	0.04075091575091575	42	0.08536585365853659	6	0.016574585635359115	39	0.06818181818181818	2	0.002638522427440633	a	0.382	-0.928405	0.02359	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	4.08	-8.16	0.01061	.	5.711590	0.00357	N	0.000021	T	0.00468	0.0015	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16424	-1.0403	9	0.09843	T	0.71	0.784	0.986	0.01446	0.1694:0.1757:0.2237:0.4311	.	311	G3XAA6	.	A	243;311	.	ENSP00000290390:V311A	V	-	2	0	C2orf81	74495799	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.588000	0.02106	-3.820000	0.00103	-0.499000	0.04595	GTG	A|0.959;G|0.041	0.041	strong		0.711	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
SRRM2	23524	hgsc.bcm.edu	37	16	2816224	2816224	+	Missense_Mutation	SNP	C	C	T	rs151100831	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr16:2816224C>T	ENST00000301740.8	+	11	6244	c.5695C>T	c.(5695-5697)Cgg>Tgg	p.R1899W		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1899	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CAGCCGGAGACGGTCAAGGTC	0.592																																					p.R1899W		Atlas-SNP	.											SRRM2,colon,carcinoma,0,1	SRRM2	263	1	0			c.C5695T						PASS	.						104.0	100.0	101.0					16																	2816224		2198	4300	6498	SO:0001583	missense	23524	exon11			CGGAGACGGTCAA	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5695C>T	16.37:g.2816224C>T	ENSP00000301740:p.Arg1899Trp	Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	73	42	0.575342	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	0.854	-0.737664	0.03111	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.26373	1.74	5.46	3.27	0.37495	.	0.000000	0.56097	D	0.000040	T	0.25717	0.0626	N	0.08118	0	0.31050	N	0.715362	D	0.89917	1.0	D	0.77557	0.99	T	0.10222	-1.0639	10	0.72032	D	0.01	-8.5524	7.212	0.25939	0.3166:0.5967:0.0:0.0867	.	1899	Q9UQ35	SRRM2_HUMAN	W	1899;1899;1151	ENSP00000301740:R1899W	ENSP00000301740:R1899W	R	+	1	2	SRRM2	2756225	0.982000	0.34865	0.993000	0.49108	0.970000	0.65996	1.597000	0.36729	1.280000	0.44463	0.650000	0.86243	CGG	C|0.999;A|0.001	.	alt		0.592	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
BTG2	7832	hgsc.bcm.edu	37	1	203274878	203274878	+	Splice_Site	SNP	T	T	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:203274878T>C	ENST00000290551.4	+	1	213		c.e1+2		RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2						anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			CACTCACAGGTGAGCGCATGC	0.706																																					.		Atlas-SNP	.											.	BTG2	16	.	0			c.142+2T>C						PASS	.						10.0	12.0	12.0					1																	203274878		1987	3852	5839	SO:0001630	splice_region_variant	7832	exon1			CACAGGTGAGCGC		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.142+2T>C	1.37:g.203274878T>C		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	79	14	0.177215	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Splice_Site	SNP	ENST00000290551.4	37	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	T	16.34	3.094946	0.56075	.	.	ENSG00000159388	ENST00000290551	.	.	.	4.23	4.23	0.50019	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2923	0.54825	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	BTG2	201541501	1.000000	0.71417	1.000000	0.80357	0.498000	0.33706	6.849000	0.75414	1.785000	0.52413	0.386000	0.25728	.	.	.	none		0.706	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	Intron
OR5L1	219437	hgsc.bcm.edu	37	11	55579424	55579424	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:55579424G>C	ENST00000333973.2	+	1	571	c.482G>C	c.(481-483)tGc>tCc	p.C161S		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				ATTCATTTGTGCTTAGCTCTT	0.448																																					p.C161S		Atlas-SNP	.											.	OR5L1	145	.	0			c.G482C						PASS	.						219.0	193.0	202.0					11																	55579424		2200	4296	6496	SO:0001583	missense	219437	exon1			ATTTGTGCTTAGC	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.482G>C	11.37:g.55579424G>C	ENSP00000335529:p.Cys161Ser	Somatic	413	0	0		WXS	Illumina HiSeq	Phase_I	403	61	0.151365	NM_001004738	B2RNK6|Q6IFD0	Missense_Mutation	SNP	ENST00000333973.2	37	CCDS31509.1	.	.	.	.	.	.	.	.	.	.	g	7.397	0.632046	0.14322	.	.	ENSG00000186117	ENST00000333973	T	0.35789	1.29	4.18	0.752	0.18398	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000023	T	0.14700	0.0355	N	0.02751	-0.505	0.09310	N	1	B	0.25105	0.118	B	0.33392	0.163	T	0.30707	-0.9969	10	0.21540	T	0.41	-20.2258	7.1232	0.25456	0.0:0.1433:0.3172:0.5395	.	161	Q8NGL2	OR5L1_HUMAN	S	161	ENSP00000335529:C161S	ENSP00000335529:C161S	C	+	2	0	OR5L1	55336000	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.323000	0.07997	0.187000	0.20147	0.435000	0.28638	TGC	.	.	none		0.448	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738	
PIM1	5292	hgsc.bcm.edu	37	6	37139038	37139038	+	Silent	SNP	G	G	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:37139038G>T	ENST00000373509.5	+	4	751	c.378G>T	c.(376-378)gtG>gtT	p.V126V		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	217					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CCGAGCCGGTGCAAGATCTCT	0.617			T	BCL6	NHL																																p.V217V		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.G651T						PASS	.						80.0	94.0	89.0					6																	37139038		2203	4300	6503	SO:0001819	synonymous_variant	5292	exon4			GCCGGTGCAAGAT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.378G>T	6.37:g.37139038G>T		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	87	12	0.137931	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.617	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
DLC1	10395	hgsc.bcm.edu	37	8	13356598	13356598	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:13356598T>C	ENST00000276297.4	-	2	1392	c.983A>G	c.(982-984)cAg>cGg	p.Q328R	DLC1_ENST00000511869.1_Missense_Mutation_p.Q328R|DLC1_ENST00000316609.5_Missense_Mutation_p.Q328R	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	328					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						TGTGGGTTCCTGGGTGGCCAG	0.408																																					p.Q328R		Atlas-SNP	.											DLC1_ENST00000511869,colon,carcinoma,+1,3	DLC1	411	3	0			c.A983G						PASS	.						134.0	119.0	124.0					8																	13356598		2203	4300	6503	SO:0001583	missense	10395	exon2			GGTTCCTGGGTGG	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.983A>G	8.37:g.13356598T>C	ENSP00000276297:p.Gln328Arg	Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	188	34	0.180851	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	T	19.33	3.807054	0.70797	.	.	ENSG00000164741	ENST00000276297;ENST00000316609;ENST00000511869	T;T;T	0.13538	3.49;2.58;2.6	4.97	4.97	0.65823	.	0.197118	0.25361	N	0.031236	T	0.31263	0.0791	L	0.54323	1.7	0.31199	N	0.69997	D;D;B	0.76494	0.977;0.999;0.079	P;D;B	0.68943	0.73;0.961;0.025	T	0.12630	-1.0540	10	0.48119	T	0.1	.	14.7808	0.69766	0.0:0.0:0.0:1.0	.	328;328;328	E9PF76;Q96QB1-3;Q96QB1	.;.;RHG07_HUMAN	R	328	ENSP00000276297:Q328R;ENSP00000321034:Q328R;ENSP00000425878:Q328R	ENSP00000276297:Q328R	Q	-	2	0	DLC1	13400969	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	2.786000	0.47790	2.228000	0.72767	0.533000	0.62120	CAG	.	.	none		0.408	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
SLA	6503	hgsc.bcm.edu	37	8	134057342	134057342	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:134057342A>G	ENST00000338087.5	-	7	1190	c.371T>C	c.(370-372)gTg>gCg	p.V124A	TG_ENST00000519543.1_Intron|SLA_ENST00000395352.3_Missense_Mutation_p.V141A|TG_ENST00000220616.4_Intron|TG_ENST00000542445.1_Intron|SLA_ENST00000427060.2_Missense_Mutation_p.V164A|TG_ENST00000377869.1_Intron|SLA_ENST00000517648.1_Intron|SLA_ENST00000524345.1_Missense_Mutation_p.V16A	NM_001045556.2	NP_001039021.1	Q13239	SLAP1_HUMAN	Src-like-adaptor	124	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				positive regulation of signal transduction (GO:0009967)	endosome (GO:0005768)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(6)|prostate(1)|skin(1)	17	all_epithelial(106;3.51e-21)|Lung NSC(106;4.24e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0279)|Breast(495;0.037)	BRCA - Breast invasive adenocarcinoma(115;0.000701)			CCTGTGTCTCACCGACAGTGA	0.572																																					p.V164A		Atlas-SNP	.											.	SLA	63	.	0			c.T491C						PASS	.						124.0	100.0	108.0					8																	134057342		2203	4300	6503	SO:0001583	missense	6503	exon5			TGTCTCACCGACA		CCDS6370.1, CCDS47922.1, CCDS47923.1, CCDS64977.1, CCDS64978.1	8q24.22	2013-09-19	2001-11-28		ENSG00000155926	ENSG00000155926		"""SH2 domain containing"""	10902	protein-coding gene	gene with protein product		601099	"""Src-like-adapter"""			8825655, 11179692	Standard	NM_001045556		Approved	SLA1	uc011ljd.2	Q13239	OTTHUMG00000164439	ENST00000338087.5:c.371T>C	8.37:g.134057342A>G	ENSP00000337548:p.Val124Ala	Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	86	27	0.313953	NM_006748	B7Z4J2|B7Z4L6|Q6FI01|Q9UMQ8	Missense_Mutation	SNP	ENST00000338087.5	37	CCDS6370.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.568259	0.86439	.	.	ENSG00000155926	ENST00000338087;ENST00000427060;ENST00000395352;ENST00000524345;ENST00000522119	D;D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78;-2.78	5.77	5.77	0.91146	SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.95837	0.8645	M	0.88979	2.995	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;1.0	D	0.96457	0.9338	10	0.87932	D	0	-32.0528	14.0378	0.64656	1.0:0.0:0.0:0.0	.	124;124;124	Q6FI01;Q5TZW1;Q13239	.;.;SLAP1_HUMAN	A	124;164;141;16;124	ENSP00000337548:V124A;ENSP00000394049:V164A;ENSP00000378759:V141A;ENSP00000427928:V16A;ENSP00000430596:V124A	ENSP00000337548:V124A	V	-	2	0	SLA	134126524	1.000000	0.71417	0.976000	0.42696	0.953000	0.61014	8.526000	0.90588	2.210000	0.71456	0.459000	0.35465	GTG	.	.	none		0.572	SLA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378771.1		
SLC8A1	6546	hgsc.bcm.edu	37	2	40655834	40655834	+	Silent	SNP	T	T	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:40655834T>C	ENST00000403092.1	-	2	1620	c.1587A>G	c.(1585-1587)gtA>gtG	p.V529V	SLC8A1_ENST00000332839.4_Silent_p.V529V|SLC8A1_ENST00000406391.2_Silent_p.V529V|SLC8A1_ENST00000542756.1_Silent_p.V529V|SLC8A1_ENST00000405901.3_Silent_p.V529V|SLC8A1_ENST00000402441.1_Silent_p.V529V|SLC8A1_ENST00000542024.1_Silent_p.V529V|SLC8A1_ENST00000405269.1_Silent_p.V529V|SLC8A1_ENST00000406785.2_Silent_p.V529V|SLC8A1_ENST00000408028.2_Silent_p.V529V			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	529	Calx-beta 2.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CAAAAATAGTTACAGTGGCAG	0.438																																					p.V529V		Atlas-SNP	.											.	SLC8A1	221	.	0			c.A1587G						PASS	.						111.0	110.0	111.0					2																	40655834		2203	4300	6503	SO:0001819	synonymous_variant	6546	exon1			AATAGTTACAGTG		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1587A>G	2.37:g.40655834T>C		Somatic	168	0	0		WXS	Illumina HiSeq	Phase_I	152	37	0.243421	NM_001252624	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Silent	SNP	ENST00000403092.1	37	CCDS1806.1																																																																																			.	.	none		0.438	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
NDST1	3340	hgsc.bcm.edu	37	5	149901306	149901306	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr5:149901306G>A	ENST00000261797.6	+	2	992	c.490G>A	c.(490-492)Gtg>Atg	p.V164M	NDST1_ENST00000523767.1_Missense_Mutation_p.V164M	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	164	Heparan sulfate N-deacetylase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGCCTACGGCGTGGGCATCAT	0.542																																					p.V164M		Atlas-SNP	.											.	NDST1	79	.	0			c.G490A						PASS	.						89.0	90.0	90.0					5																	149901306		2203	4300	6503	SO:0001583	missense	3340	exon2			TACGGCGTGGGCA	U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.490G>A	5.37:g.149901306G>A	ENSP00000261797:p.Val164Met	Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	31	9	0.290323	NM_001543	Q96E57	Missense_Mutation	SNP	ENST00000261797.6	37	CCDS34277.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.949559	0.92660	.	.	ENSG00000070614	ENST00000523767;ENST00000261797	T;T	0.58210	0.35;0.69	4.96	4.96	0.65561	.	0.185114	0.46145	D	0.000313	T	0.77883	0.4197	M	0.91612	3.225	0.80722	D	1	D;D;D	0.64830	0.994;0.984;0.994	D;P;D	0.65010	0.931;0.704;0.931	T	0.82653	-0.0351	9	.	.	.	.	18.7747	0.91907	0.0:0.0:1.0:0.0	.	164;164;164	E7EVJ3;P52848-2;P52848	.;.;NDST1_HUMAN	M	164	ENSP00000428604:V164M;ENSP00000261797:V164M	.	V	+	1	0	NDST1	149881499	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.539000	0.98076	2.733000	0.93635	0.655000	0.94253	GTG	.	.	none		0.542	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2	NM_001543	
HIST1H1C	3006	hgsc.bcm.edu	37	6	26056463	26056463	+	Missense_Mutation	SNP	G	G	A	rs79562358		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr6:26056463G>A	ENST00000343677.2	-	1	236	c.194C>T	c.(193-195)gCg>gTg	p.A65V		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	65	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						GGCAGCCAACGCTTTTTTCAG	0.562													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15415	0.0		0.0	False		,,,				2504	0.0				p.A65V		Atlas-SNP	.											.	HIST1H1C	80	.	0			c.C194T						PASS	.	G	VAL/ALA	0,4406		0,0,2203	82.0	91.0	88.0		194	5.7	1.0	6	dbSNP_131	88	1,8599	1.2+/-3.3	0,1,4299	no	missense	HIST1H1C	NM_005319.3	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	65/214	26056463	1,13005	2203	4300	6503	SO:0001583	missense	3006	exon1			GCCAACGCTTTTT	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.194C>T	6.37:g.26056463G>A	ENSP00000339566:p.Ala65Val	Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	182	72	0.395604	NM_005319	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	37	CCDS4577.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	18.31	3.594901	0.66219	0.0	1.16E-4	ENSG00000187837	ENST00000343677	T	0.22134	1.97	5.73	5.73	0.89815	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.111844	0.64402	D	0.000013	T	0.39036	0.1063	M	0.85099	2.735	0.58432	D	0.999992	D	0.62365	0.991	P	0.55667	0.781	T	0.27806	-1.0063	10	0.51188	T	0.08	-17.4652	19.2479	0.93909	0.0:0.0:1.0:0.0	.	65	P16403	H12_HUMAN	V	65	ENSP00000339566:A65V	ENSP00000339566:A65V	A	-	2	0	HIST1H1C	26164442	1.000000	0.71417	1.000000	0.80357	0.011000	0.07611	5.446000	0.66600	2.861000	0.98227	0.655000	0.94253	GCG	G|0.999;A|0.001	0.001	strong		0.562	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
RHBDF2	79651	hgsc.bcm.edu	37	17	74471179	74471179	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:74471179G>A	ENST00000313080.4	-	10	1520	c.1247C>T	c.(1246-1248)aCg>aTg	p.T416M	RHBDF2_ENST00000389760.4_Missense_Mutation_p.T387M|RHBDF2_ENST00000591885.1_Missense_Mutation_p.T387M	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	416					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.T416M(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						CACCAGCAGCGTGATGATGAC	0.622																																					p.T416M		Atlas-SNP	.											RHBDF2,colon,carcinoma,0,1	RHBDF2	57	1	1	Substitution - Missense(1)	large_intestine(1)	c.C1247T						PASS	.						93.0	66.0	75.0					17																	74471179		2202	4299	6501	SO:0001583	missense	79651	exon10			AGCAGCGTGATGA	BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.1247C>T	17.37:g.74471179G>A	ENSP00000322775:p.Thr416Met	Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	69	8	0.115942	NM_024599	A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	Missense_Mutation	SNP	ENST00000313080.4	37	CCDS32743.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.676691	0.47886	.	.	ENSG00000129667	ENST00000313080;ENST00000389760;ENST00000389762	T;T	0.11604	2.76;2.76	5.1	3.11	0.35812	.	0.051498	0.85682	D	0.000000	T	0.08358	0.0208	N	0.26092	0.79	0.58432	D	0.999997	D;D;P;P	0.55800	0.967;0.973;0.908;0.723	B;B;B;B	0.43052	0.268;0.406;0.223;0.131	T	0.31024	-0.9958	10	0.33940	T	0.23	-6.9882	10.8119	0.46551	0.1535:0.0:0.8465:0.0	.	387;362;416;387	B7Z8H4;Q6ZWP8;Q6PJF5;Q6PJF5-2	.;.;RHDF2_HUMAN;.	M	416;387;362	ENSP00000322775:T416M;ENSP00000374410:T387M	ENSP00000322775:T416M	T	-	2	0	RHBDF2	71982774	1.000000	0.71417	0.995000	0.50966	0.987000	0.75469	4.708000	0.61859	1.157000	0.42530	0.462000	0.41574	ACG	.	.	none		0.622	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450134.1	NM_024599	
MUC4	4585	hgsc.bcm.edu	37	3	195512531	195512531	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:195512531C>T	ENST00000463781.3	-	2	6379	c.5920G>A	c.(5920-5922)Gct>Act	p.A1974T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A1974T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A1974T(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAGCGTCGGTGACA	0.607																																					p.A1974T		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	1	Substitution - Missense(1)	endometrium(1)	c.G5920A						scavenged	.						52.0	43.0	46.0					3																	195512531		690	1590	2280	SO:0001583	missense	4585	exon2			AGGAAGCGTCGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5920G>A	3.37:g.195512531C>T	ENSP00000417498:p.Ala1974Thr	Somatic	313	4	0.0127796		WXS	Illumina HiSeq	Phase_I	317	6	0.0189274	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	6.041	0.375968	0.11409	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32515	1.45;1.46	.	.	.	.	.	.	.	.	T	0.08802	0.0218	N	0.08118	0	0.09310	N	1	P	0.45986	0.87	B	0.26310	0.068	T	0.27468	-1.0073	7	.	.	.	.	4.7077	0.12858	0.3536:0.6463:0.0:1.0E-4	.	1974	E7ESK3	.	T	1974	ENSP00000417498:A1974T;ENSP00000420243:A1974T	.	A	-	1	0	MUC4	196996926	0.000000	0.05858	0.001000	0.08648	0.032000	0.12392	-3.284000	0.00527	-0.833000	0.04245	0.064000	0.15345	GCT	.	.	none		0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ZFHX4	79776	hgsc.bcm.edu	37	8	77765620	77765620	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:77765620A>G	ENST00000521891.2	+	10	6911	c.6463A>G	c.(6463-6465)Agt>Ggt	p.S2155G	ZFHX4_ENST00000455469.2_Missense_Mutation_p.S2110G|ZFHX4_ENST00000518282.1_Missense_Mutation_p.S2129G|ZFHX4_ENST00000050961.6_Missense_Mutation_p.S2110G	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2110					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TAATTCTCCAAGTGAAGAACA	0.383										HNSCC(33;0.089)																											p.S2155G		Atlas-SNP	.											.	ZFHX4	878	.	0			c.A6463G						PASS	.						51.0	51.0	51.0					8																	77765620		1838	4076	5914	SO:0001583	missense	79776	exon10			TCTCCAAGTGAAG		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6463A>G	8.37:g.77765620A>G	ENSP00000430497:p.Ser2155Gly	Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	69	12	0.173913	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	12.86	2.063687	0.36373	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	D;D;D;D	0.92495	-3.05;-3.05;-3.05;-3.05	3.92	3.92	0.45320	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.52532	U	0.000072	D	0.89375	0.6697	L	0.48260	1.515	0.48395	D	0.999648	B;B;B	0.30179	0.271;0.229;0.229	B;B;B	0.34652	0.187;0.117;0.117	D	0.88251	0.2916	10	0.45353	T	0.12	.	13.2107	0.59822	1.0:0.0:0.0:0.0	.	2110;2110;2155	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	G	2155;2139;2110;2110;2129	ENSP00000430497:S2155G;ENSP00000399605:S2110G;ENSP00000050961:S2110G;ENSP00000430848:S2129G	ENSP00000050961:S2110G	S	+	1	0	ZFHX4	77928175	1.000000	0.71417	0.944000	0.38274	0.926000	0.56050	7.202000	0.77856	1.784000	0.52394	0.374000	0.22700	AGT	.	.	none		0.383	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ERG	2078	hgsc.bcm.edu	37	21	39775625	39775625	+	Missense_Mutation	SNP	G	G	A	rs140222241		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr21:39775625G>A	ENST00000417133.2	-	6	601	c.416C>T	c.(415-417)aCg>aTg	p.T139M	ERG_ENST00000398907.1_Missense_Mutation_p.T132M|ERG_ENST00000398910.1_Missense_Mutation_p.T139M|ERG_ENST00000442448.1_Missense_Mutation_p.T139M|ERG_ENST00000398905.1_Missense_Mutation_p.T132M|ERG_ENST00000398911.1_Missense_Mutation_p.T139M|ERG_ENST00000429727.2_Intron|ERG_ENST00000453032.2_Missense_Mutation_p.T40M|ERG_ENST00000398897.1_Missense_Mutation_p.T40M|ERG_ENST00000398919.2_Missense_Mutation_p.T139M|ERG_ENST00000288319.7_Missense_Mutation_p.T132M	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	0	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)		EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	ACTCCATAGCGTAGGATCTGA	0.517			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																p.T139M	Esophageal Squamous(130;336 1700 3010 3083 40589)	Atlas-SNP	.		Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	.	ERG	78	.	0			c.C416T						PASS	.	G	MET/THR,MET/THR,MET/THR,MET/THR	0,4406		0,0,2203	75.0	66.0	69.0		416,119,416,395	3.7	0.1	21	dbSNP_134	69	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	ERG	NM_001136154.1,NM_001136155.1,NM_004449.4,NM_182918.3	81,81,81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign	139/487,40/388,139/463,132/480	39775625	1,13005	2203	4300	6503	SO:0001583	missense	2078	exon6			CATAGCGTAGGAT		CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.416C>T	21.37:g.39775625G>A	ENSP00000414150:p.Thr139Met	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	97	27	0.278351	NM_001243432	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000417133.2	37	CCDS46648.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.740833	0.49151	0.0	1.16E-4	ENSG00000157554	ENST00000398905;ENST00000398907;ENST00000288319;ENST00000398897;ENST00000398911;ENST00000417133;ENST00000398910;ENST00000442448;ENST00000453032;ENST00000398919	T;T;T;T;T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54	4.55	3.66	0.41972	Sterile alpha motif/pointed domain (2);Pointed domain (3);	0.111389	0.64402	D	0.000011	T	0.37376	0.1001	N	0.24115	0.695	0.53688	D	0.999971	P;D;P;P;B	0.76494	0.776;0.999;0.741;0.547;0.338	P;D;B;B;B	0.66196	0.505;0.942;0.207;0.084;0.07	T	0.10894	-1.0610	10	0.39692	T	0.17	.	13.0918	0.59171	0.0784:0.0:0.9216:0.0	.	139;132;139;139;132	P11308;B5MDW0;P11308-6;P11308-1;P11308-4	ERG_HUMAN;.;.;.;.	M	132;132;132;40;139;139;139;139;40;139	ENSP00000381877:T132M;ENSP00000381879:T132M;ENSP00000288319:T132M;ENSP00000381871:T40M;ENSP00000381882:T139M;ENSP00000414150:T139M;ENSP00000381881:T139M;ENSP00000394694:T139M;ENSP00000396268:T40M;ENSP00000381891:T139M	ENSP00000288319:T132M	T	-	2	0	ERG	38697495	1.000000	0.71417	0.106000	0.21319	0.686000	0.39977	4.789000	0.62446	1.043000	0.40175	0.655000	0.94253	ACG	G|1.000;A|0.000	0.000	weak		0.517	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207532.2	NM_182918	
FAM205A	259308	hgsc.bcm.edu	37	9	34725438	34725438	+	Missense_Mutation	SNP	A	A	G	rs200810176	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr9:34725438A>G	ENST00000378788.3	-	4	1838	c.1799T>C	c.(1798-1800)tTg>tCg	p.L600S		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	600				L -> S (in Ref. 1; BAC86357). {ECO:0000305}.		integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.L600S(2)		breast(1)|endometrium(2)|kidney(1)	4						ATGGCGAATCAACTGTTTCTG	0.567													a|||	1131	0.225839	0.0204	0.183	5008	,	,		14798	0.4415		0.2306	False		,,,				2504	0.3067				p.L600S		Atlas-SNP	.											FAM205A_ENST00000378788,NS,carcinoma,0,2	FAM205A	45	2	2	Substitution - Missense(2)	endometrium(2)	c.T1799C						scavenged	.						36.0	21.0	26.0					9																	34725438		675	1215	1890	SO:0001583	missense	259308	exon4			CGAATCAACTGTT		CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.1799T>C	9.37:g.34725438A>G	ENSP00000417711:p.Leu600Ser	Somatic	6	6	1		WXS	Illumina HiSeq	Phase_I	20	17	0.85	NM_001141917	A8MVW7	Missense_Mutation	SNP	ENST00000378788.3	37	CCDS55305.1	.	.	.	.	.	.	.	.	.	.	a	12.00	1.806783	0.31961	.	.	ENSG00000205108	ENST00000378788	T	0.10860	2.83	4.28	3.13	0.36017	.	.	.	.	.	T	0.29288	0.0729	M	0.77486	2.375	0.80722	P	0.0	D	0.89917	1.0	D	0.91635	0.999	T	0.36915	-0.9728	8	0.62326	D	0.03	.	6.9156	0.24357	0.89:0.0:0.11:0.0	rs528197;rs3892233;rs528197	600	Q6ZU69	F205A_HUMAN	S	600	ENSP00000417711:L600S	ENSP00000417711:L600S	L	-	2	0	RP11-195F19.10	34715438	0.052000	0.20516	0.100000	0.21137	0.445000	0.32107	1.483000	0.35497	0.600000	0.29862	-0.378000	0.06908	TTG	.	.	weak		0.567	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001150.2	NM_001141917	
PLEKHM2	23207	hgsc.bcm.edu	37	1	16054583	16054583	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:16054583C>T	ENST00000375799.3	+	10	1997	c.1770C>T	c.(1768-1770)aaC>aaT	p.N590N	PLEKHM2_ENST00000375793.2_Silent_p.N570N|RP11-288I21.1_ENST00000453804.1_RNA	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	590					Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GAGTAGACAACAATCACCTGC	0.577																																					p.N590N		Atlas-SNP	.											.	PLEKHM2	94	.	0			c.C1770T						PASS	.						60.0	63.0	62.0					1																	16054583		2179	4272	6451	SO:0001819	synonymous_variant	23207	exon10			AGACAACAATCAC	AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.1770C>T	1.37:g.16054583C>T		Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	164	32	0.195122	NM_015164	O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Silent	SNP	ENST00000375799.3	37	CCDS44063.1																																																																																			.	.	none		0.577	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008463.1	NM_015164	
PLXNA1	5361	hgsc.bcm.edu	37	3	126747903	126747903	+	Silent	SNP	C	C	T	rs369457038		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:126747903C>T	ENST00000393409.2	+	25	4737	c.4737C>T	c.(4735-4737)aaC>aaT	p.N1579N	PLXNA1_ENST00000251772.4_Silent_p.N1556N	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1579					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		AGATTGACAACGATTGGAAGA	0.672																																					p.N1579N		Atlas-SNP	.											PLXNA1,NS,carcinoma,0,1	PLXNA1	185	1	0			c.C4737T						PASS	.	C		0,4406		0,0,2203	144.0	97.0	113.0		4737	-3.6	1.0	3		113	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PLXNA1	NM_032242.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1579/1897	126747903	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5361	exon25			TGACAACGATTGG	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.4737C>T	3.37:g.126747903C>T		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	46	15	0.326087	NM_032242		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																			.	.	weak		0.672	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
KMT2D	8085	hgsc.bcm.edu	37	12	49435941	49435941	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:49435941G>A	ENST00000301067.7	-	28	6039	c.6040C>T	c.(6040-6042)Cag>Tag	p.Q2014*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2014					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GTGGACAGCTGGCCCAACTCC	0.577																																					p.Q2014X		Atlas-SNP	.											MLL2_ENST00000301067,bladder,carcinoma,0,2	MLL2	1173	2	0			c.C6040T						PASS	.						50.0	54.0	53.0					12																	49435941		2121	4221	6342	SO:0001587	stop_gained	8085	exon28			ACAGCTGGCCCAA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.6040C>T	12.37:g.49435941G>A	ENSP00000301067:p.Gln2014*	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	69	16	0.231884	NM_003482	O14687	Nonsense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	45	11.794231	0.99604	.	.	ENSG00000167548	ENST00000301067	.	.	.	5.34	5.34	0.76211	.	0.000000	0.36338	N	0.002643	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.1167	0.59303	0.0:0.2705:0.7295:0.0	.	.	.	.	X	2014	.	ENSP00000301067:Q2014X	Q	-	1	0	MLL2	47722208	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.514000	0.60482	2.686000	0.91538	0.561000	0.74099	CAG	.	.	none		0.577	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
ZNF705G	100131980	hgsc.bcm.edu	37	8	7215921	7215921	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:7215921T>A	ENST00000400156.4	-	7	761	c.480A>T	c.(478-480)gaA>gaT	p.E160D	ZNF705G_ENST00000400078.2_Missense_Mutation_p.E160D			A8MUZ8	Z705G_HUMAN	zinc finger protein 705G	160					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(9)	9						GTTTATGTGGTTCAGTGGACA	0.373																																					p.E160D		Atlas-SNP	.											.	ZNF705G	24	.	0			c.A480T						PASS	.						100.0	113.0	109.0					8																	7215921		671	1591	2262	SO:0001583	missense	100131980	exon5			ATGTGGTTCAGTG		CCDS47773.1	8p23.1	2013-01-08			ENSG00000215372	ENSG00000215372		"""Zinc fingers, C2H2-type"", ""-"""	37134	protein-coding gene	gene with protein product							Standard	NM_001164457		Approved		uc022are.1	A8MUZ8	OTTHUMG00000165384	ENST00000400156.4:c.480A>T	8.37:g.7215921T>A	ENSP00000383020:p.Glu160Asp	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	95	26	0.273684	NM_001164457		Missense_Mutation	SNP	ENST00000400156.4	37		.	.	.	.	.	.	.	.	.	.	T	6.841	0.524397	0.13066	.	.	ENSG00000215372	ENST00000400156;ENST00000400078	T;T	0.01613	4.73;4.73	1.05	-2.1	0.07210	.	.	.	.	.	T	0.00875	0.0029	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.47045	-0.9147	7	0.21014	T	0.42	.	2.4681	0.04558	0.2824:0.0:0.199:0.5186	.	.	.	.	D	160	ENSP00000383020:E160D;ENSP00000445477:E160D	ENSP00000445477:E160D	E	-	3	2	ZNF705G	7203331	0.000000	0.05858	0.015000	0.15790	0.188000	0.23474	-1.804000	0.01738	-1.065000	0.03168	0.155000	0.16302	GAA	.	.	none		0.373	ZNF705G-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000383776.1	XM_001720517	
EIF2B3	8891	hgsc.bcm.edu	37	1	45341356	45341356	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:45341356C>A	ENST00000360403.2	-	9	1113	c.987G>T	c.(985-987)ttG>ttT	p.L329F	EIF2B3_ENST00000372183.3_Missense_Mutation_p.L329F	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa	329					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					GAGCAGACAGCAATTTGGGCA	0.522																																					p.L329F	Colon(26;357 658 2581 11857 12657)	Atlas-SNP	.											.	EIF2B3	43	.	0			c.G987T						PASS	.						151.0	137.0	142.0					1																	45341356		2203	4300	6503	SO:0001583	missense	8891	exon9			AGACAGCAATTTG	AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.987G>T	1.37:g.45341356C>A	ENSP00000353575:p.Leu329Phe	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	125	8	0.064	NM_020365	B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Missense_Mutation	SNP	ENST00000360403.2	37	CCDS517.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.69|16.69	3.192156|3.192156	0.58017|0.58017	.|.	.|.	ENSG00000070785|ENSG00000070785	ENST00000439363|ENST00000360403;ENST00000372183	.|T;D	.|0.94232	.|0.51;-3.38	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91181|0.91181	0.7222|0.7222	M|M	0.65975|0.65975	2.015|2.015	0.53688|0.53688	D|D	0.999975|0.999975	.|B;P	.|0.36712	.|0.171;0.566	.|B;B	.|0.40901	.|0.124;0.343	D|D	0.86913|0.86913	0.2062|0.2062	5|10	.|0.10377	.|T	.|0.69	-1.4932|-1.4932	9.8482|9.8482	0.41039|0.41039	0.0:0.8458:0.0:0.1542|0.0:0.8458:0.0:0.1542	.|.	.|329;329	.|Q9NR50-2;Q9NR50	.|.;EI2BG_HUMAN	F|F	150|329	.|ENSP00000353575:L329F;ENSP00000361257:L329F	.|ENSP00000353575:L329F	C|L	-|-	2|3	0|2	EIF2B3|EIF2B3	45113943|45113943	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	1.969000|1.969000	0.40510|0.40510	2.528000|2.528000	0.85240|0.85240	0.655000|0.655000	0.94253|0.94253	TGC|TTG	.	.	none		0.522	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023724.1	NM_020365	
BTG2	7832	hgsc.bcm.edu	37	1	203276287	203276287	+	Silent	SNP	C	C	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:203276287C>G	ENST00000290551.4	+	2	269	c.198C>G	c.(196-198)cgC>cgG	p.R66R	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	66					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			CCGGCTACCGCTGCATTCGCA	0.612																																					p.R66R		Atlas-SNP	.											BTG2,NS,carcinoma,+2,1	BTG2	16	1	0			c.C198G						PASS	.						46.0	48.0	47.0					1																	203276287		2203	4300	6503	SO:0001819	synonymous_variant	7832	exon2			CTACCGCTGCATT		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.198C>G	1.37:g.203276287C>G		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	66	14	0.212121	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Silent	SNP	ENST00000290551.4	37	CCDS1437.1																																																																																			.	.	none		0.612	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
MPEG1	219972	hgsc.bcm.edu	37	11	58979064	58979064	+	Silent	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:58979064G>A	ENST00000361050.3	-	1	1360	c.1275C>T	c.(1273-1275)atC>atT	p.I425I	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	425						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				CCTCCTCGTGGATCTGGGATA	0.542																																					p.I425I		Atlas-SNP	.											.	MPEG1	72	.	0			c.C1275T						PASS	.						75.0	72.0	73.0					11																	58979064		1934	4148	6082	SO:0001819	synonymous_variant	219972	exon1			CTCGTGGATCTGG	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.1275C>T	11.37:g.58979064G>A		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	73	16	0.219178	NM_001039396	Q2M1T6|Q8TEF8	Silent	SNP	ENST00000361050.3	37	CCDS41650.1																																																																																			.	.	none		0.542	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
NRF1	4899	hgsc.bcm.edu	37	7	129330335	129330335	+	Silent	SNP	G	G	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr7:129330335G>T	ENST00000393232.1	+	5	672	c.555G>T	c.(553-555)ctG>ctT	p.L185L	NRF1_ENST00000223190.4_Silent_p.L185L|NRF1_ENST00000353868.4_Silent_p.L185L|NRF1_ENST00000311967.2_Silent_p.L185L|NRF1_ENST00000393231.3_Silent_p.L185L|NRF1_ENST00000393230.2_Silent_p.L185L|NRF1_ENST00000539636.1_Silent_p.L24L	NM_005011.3	NP_005002.3	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	185					cellular lipid metabolic process (GO:0044255)|generation of precursor metabolites and energy (GO:0006091)|mitochondrion organization (GO:0007005)|organ regeneration (GO:0031100)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	24						ACTCAGAACTGCCGCCTCTCA	0.562																																					p.L185L		Atlas-SNP	.											.	NRF1	40	.	0			c.G555T						PASS	.						102.0	84.0	90.0					7																	129330335		2203	4300	6503	SO:0001819	synonymous_variant	4899	exon5			AGAACTGCCGCCT	L22454	CCDS5813.2	7q32	2008-07-18			ENSG00000106459	ENSG00000106459			7996	protein-coding gene	gene with protein product	"""alpha palindromic-binding protein"""	600879				2584221	Standard	NM_005011		Approved	EWG, ALPHA-PAL	uc003voz.3	Q16656	OTTHUMG00000143736	ENST00000393232.1:c.555G>T	7.37:g.129330335G>T		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	102	28	0.27451	NM_005011	A8K4C6|B4DDV6|Q15305|Q96AN2	Silent	SNP	ENST00000393232.1	37	CCDS5813.2																																																																																			.	.	none		0.562	NRF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289813.1	NM_001040110	
INPP4B	8821	hgsc.bcm.edu	37	4	143044563	143044563	+	Silent	SNP	A	A	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr4:143044563A>C	ENST00000513000.1	-	21	2332	c.1899T>G	c.(1897-1899)gcT>gcG	p.A633A	INPP4B_ENST00000509777.1_Silent_p.A633A|INPP4B_ENST00000308502.4_Silent_p.A633A|INPP4B_ENST00000262992.4_Silent_p.A633A|INPP4B_ENST00000508116.1_Silent_p.A633A	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	633					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					AAACCAATCCAGCAAGCTGAA	0.358																																					p.A633A		Atlas-SNP	.											.	INPP4B	132	.	0			c.T1899G						PASS	.						69.0	67.0	68.0					4																	143044563		2203	4300	6503	SO:0001819	synonymous_variant	8821	exon21			CAATCCAGCAAGC	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.1899T>G	4.37:g.143044563A>C		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	96	25	0.260417	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Silent	SNP	ENST00000513000.1	37	CCDS3757.1																																																																																			.	.	none		0.358	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230439	23230439	+	Splice_Site	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr22:23230439G>A	ENST00000526893.1	+	1	480	c.206G>A	c.(205-207)aGg>aAg	p.R69K	IGLL5_ENST00000532223.2_Splice_Site_p.S69N|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Splice_Site_p.R69K	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	69						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CTGTGGGGCAGGTAAGGGGCA	0.627																																					p.R69K		Atlas-SNP	.											.	IGLL5	26	.	0			c.G206A						PASS	.																																			SO:0001630	splice_region_variant	100423062	exon1			GGGGCAGGTAAGG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.206+1G>A	22.37:g.23230439G>A		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	64	15	0.234375	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.883|9.883	1.202015|1.202015	0.22121|0.22121	.|.	.|.	ENSG00000254709|ENSG00000254709	ENST00000526893;ENST00000531372|ENST00000532223	T|T	0.00801|0.00561	5.68|6.59	3.92|3.92	3.92|3.92	0.45320|0.45320	.|.	.|.	.|.	.|.	.|.	T|T	0.00637|0.00637	0.0021|0.0021	L|L	0.27053|0.27053	0.805|0.805	0.45718|0.45718	D|D	0.99862|0.99862	D|.	0.57571|.	0.98|.	D|.	0.67548|.	0.952|.	D|D	0.86314|0.86314	0.1688|0.1688	9|7	0.66056|0.28530	D|T	0.02|0.3	.|.	11.74|11.74	0.51788|0.51788	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	69|.	B9A064|.	IGLL5_HUMAN|.	K|N	69|69	ENSP00000431254:R69K|ENSP00000436353:S69N	ENSP00000431254:R69K|ENSP00000436353:S69N	R|S	+|+	2|2	0|0	IGLL5|IGLL5	21560439|21560439	0.985000|0.985000	0.35326|0.35326	1.000000|1.000000	0.80357|0.80357	0.199000|0.199000	0.23934|0.23934	1.700000|1.700000	0.37815|0.37815	2.481000|2.481000	0.83766|0.83766	0.643000|0.643000	0.83706|0.83706	AGG|AGC	.	.	none		0.627	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	Missense_Mutation
MUC17	140453	hgsc.bcm.edu	37	7	100679783	100679783	+	Missense_Mutation	SNP	A	A	C	rs71525815		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr7:100679783A>C	ENST00000306151.4	+	3	5150	c.5086A>C	c.(5086-5088)Act>Cct	p.T1696P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1696	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AACAAGTATAACTGTCAGAAC	0.478																																					p.T1696P		Atlas-SNP	.											MUC17,NS,carcinoma,-1,1	MUC17	804	1	0			c.A5086C						scavenged	.						176.0	194.0	188.0					7																	100679783		2203	4300	6503	SO:0001583	missense	140453	exon3			AGTATAACTGTCA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5086A>C	7.37:g.100679783A>C	ENSP00000302716:p.Thr1696Pro	Somatic	68	5	0.0735294		WXS	Illumina HiSeq	Phase_I	69	8	0.115942	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.755877	0.00085	.	.	ENSG00000169876	ENST00000306151	T	0.01854	4.6	0.331	-0.661	0.11417	.	.	.	.	.	T	0.00815	0.0027	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.55360	-0.8153	8	0.28530	T	0.3	.	.	.	.	.	1696	Q685J3	MUC17_HUMAN	P	1696	ENSP00000302716:T1696P	ENSP00000302716:T1696P	T	+	1	0	MUC17	100466503	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.363000	0.00128	-5.888000	0.00008	-5.590000	0.00000	ACT	.	.	none		0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
ARC	23237	hgsc.bcm.edu	37	8	143695199	143695199	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:143695199C>T	ENST00000356613.2	-	1	1634	c.434G>A	c.(433-435)cGc>cAc	p.R145H	ARC_ENST00000581404.1_5'Flank	NM_015193.4	NP_056008.1	O60936	NOL3_HUMAN	activity-regulated cytoskeleton-associated protein	0					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	13	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)				AACGGTGTGGCGGGCTGACTC	0.701																																					p.R145H		Atlas-SNP	.											.	ARC	34	.	0			c.G434A						PASS	.						7.0	9.0	8.0					8																	143695199		2139	4195	6334	SO:0001583	missense	23237	exon1			GTGTGGCGGGCTG	AF193421	CCDS34950.1	8q24.3	2008-08-01			ENSG00000198576	ENSG00000198576			648	protein-coding gene	gene with protein product		612461				10970730, 17466953	Standard	NM_015193		Approved	KIAA0278, Arg3.1	uc003ywn.2	Q7LC44	OTTHUMG00000134310	ENST00000356613.2:c.434G>A	8.37:g.143695199C>T	ENSP00000349022:p.Arg145His	Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	27	6	0.222222	NM_015193	B4DFL0|O60937	Missense_Mutation	SNP	ENST00000356613.2	37	CCDS34950.1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.614323	0.66672	.	.	ENSG00000198576	ENST00000356613	T	0.35789	1.29	4.56	3.68	0.42216	.	0.231396	0.26075	N	0.026492	T	0.24314	0.0589	L	0.27053	0.805	0.31343	N	0.683397	B	0.20459	0.045	B	0.11329	0.006	T	0.18524	-1.0334	10	0.87932	D	0	.	8.138	0.31067	0.0:0.7901:0.0:0.2099	.	145	Q7LC44	ARC_HUMAN	H	145	ENSP00000349022:R145H	ENSP00000349022:R145H	R	-	2	0	ARC	143692201	0.998000	0.40836	0.992000	0.48379	0.736000	0.42039	0.684000	0.25364	0.899000	0.36444	0.462000	0.41574	CGC	.	.	none		0.701	ARC-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259274.2		
BTG2	7832	hgsc.bcm.edu	37	1	203274867	203274867	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:203274867G>C	ENST00000290551.4	+	1	204	c.133G>C	c.(133-135)Gca>Cca	p.A45P	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	45					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.A45T(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			GCTCCAGGAGGCACTCACAGG	0.706																																					p.A45P		Atlas-SNP	.											BTG2,lymph_node,lymphoid_neoplasm,-1,2	BTG2	16	2	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G133C						PASS	.						11.0	13.0	13.0					1																	203274867		2020	3950	5970	SO:0001583	missense	7832	exon1			CAGGAGGCACTCA		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.133G>C	1.37:g.203274867G>C	ENSP00000290551:p.Ala45Pro	Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	86	15	0.174419	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.163593	0.78226	.	.	ENSG00000159388	ENST00000290551	T	0.25085	1.82	4.4	4.4	0.53042	Anti-proliferative protein (3);	0.078518	0.49916	D	0.000121	T	0.52008	0.1708	M	0.82630	2.6	0.47374	D	0.999406	D	0.62365	0.991	D	0.64687	0.928	T	0.58222	-0.7674	10	0.51188	T	0.08	-33.413	15.7078	0.77598	0.0:0.0:1.0:0.0	.	45	P78543	BTG2_HUMAN	P	45	ENSP00000290551:A45P	ENSP00000290551:A45P	A	+	1	0	BTG2	201541490	1.000000	0.71417	0.991000	0.47740	0.943000	0.58893	4.326000	0.59241	2.282000	0.76494	0.471000	0.43371	GCA	.	.	none		0.706	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
FAM171B	165215	hgsc.bcm.edu	37	2	187559053	187559053	+	Silent	SNP	A	A	G	rs2370706	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:187559053A>G	ENST00000304698.5	+	1	356	c.153A>G	c.(151-153)caA>caG	p.Q51Q	AC017101.10_ENST00000453665.1_RNA	NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	51	Gln-rich.					integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						agcagcaacaacaacaacaac	0.632																																					p.Q51Q		Atlas-SNP	.											FAM171B,NS,neuroblastoma,0,1	FAM171B	146	1	0			c.A153G						PASS	.						26.0	29.0	28.0					2																	187559053		2202	4300	6502	SO:0001819	synonymous_variant	165215	exon1			GCAACAACAACAA	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.153A>G	2.37:g.187559053A>G		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	75	9	0.12	NM_177454	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Silent	SNP	ENST00000304698.5	37	CCDS33347.1																																																																																			A|0.417;G|0.583	0.583	strong		0.632	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
MCC	4163	hgsc.bcm.edu	37	5	112824054	112824054	+	Missense_Mutation	SNP	C	C	T	rs199741976		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr5:112824054C>T	ENST00000408903.3	-	1	473	c.58G>A	c.(58-60)Ggc>Agc	p.G20S		NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.G20S(1)		endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ccgctgccgccgccgccgccg	0.756																																					p.G20S		Atlas-SNP	.											MCC_ENST00000408903,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	MCC	234	1	1	Substitution - Missense(1)	central_nervous_system(1)	c.G58A						scavenged	.						5.0	7.0	7.0					5																	112824054		1172	2822	3994	SO:0001583	missense	4163	exon1			TGCCGCCGCCGCC		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.58G>A	5.37:g.112824054C>T	ENSP00000386227:p.Gly20Ser	Somatic	21	3	0.142857		WXS	Illumina HiSeq	Phase_I	58	13	0.224138	NM_001085377	D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000408903.3	37	CCDS43351.1	.	.	.	.	.	.	.	.	.	.	C	6.041	0.375835	0.11409	.	.	ENSG00000171444	ENST00000408903	T	0.34472	1.36	2.05	2.05	0.26809	.	.	.	.	.	T	0.46405	0.1391	.	.	.	0.25816	N	0.984338	D	0.89917	1.0	D	0.71184	0.972	T	0.22626	-1.0211	8	0.32370	T	0.25	.	4.5587	0.12149	0.0:0.7053:0.0:0.2947	.	20	P23508-2	.	S	20	ENSP00000386227:G20S	ENSP00000386227:G20S	G	-	1	0	MCC	112851953	0.002000	0.14202	0.063000	0.19743	0.016000	0.09150	1.079000	0.30766	1.100000	0.41517	0.491000	0.48974	GGC	.	.	weak		0.756	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370839.1	NM_001085377	
MUC4	4585	hgsc.bcm.edu	37	3	195509650	195509650	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr3:195509650A>G	ENST00000463781.3	-	2	9260	c.8801T>C	c.(8800-8802)cTt>cCt	p.L2934P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L2934P	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAAGGCTGGTGAC	0.577																																					p.L2934P		Atlas-SNP	.											MUC4_ENST00000463781,trunk,malignant_melanoma,-1,2	MUC4	1505	2	0			c.T8801C						scavenged	.						9.0	8.0	8.0					3																	195509650		664	1511	2175	SO:0001583	missense	4585	exon2			GAGGAAAGGCTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8801T>C	3.37:g.195509650A>G	ENSP00000417498:p.Leu2934Pro	Somatic	208	3	0.0144231		WXS	Illumina HiSeq	Phase_I	215	8	0.0372093	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.742	-0.775893	0.02951	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35421	1.35;1.31	.	.	.	.	.	.	.	.	T	0.25901	0.0631	N	0.14661	0.345	0.09310	N	0.99999	D	0.57257	0.979	P	0.51487	0.671	T	0.15665	-1.0429	6	.	.	.	.	.	.	.	.	2806	E7ESK3	.	P	2934	ENSP00000417498:L2934P;ENSP00000420243:L2934P	.	L	-	2	0	MUC4	196994429	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.713000	0.05007	-0.000000	0.14550	0.000000	0.15137	CTT	.	.	none		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
KRTAP10-7	386675	hgsc.bcm.edu	37	21	46021011	46021011	+	Missense_Mutation	SNP	A	A	G	rs7283052		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr21:46021011A>G	ENST00000380102.2	+	1	515	c.490A>G	c.(490-492)Atc>Gtc	p.I164V	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	164	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.I164V(1)		breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						CTGTGTGCCCATCTGCTGCAA	0.612																																					p.I159V		Atlas-SNP	.											KRTAP10-7,trunk,malignant_melanoma,0,1	KRTAP10-7	41	1	1	Substitution - Missense(1)	skin(1)	c.A475G						scavenged	.						54.0	58.0	57.0					21																	46021011		2197	4272	6469	SO:0001583	missense	386675	exon2			GTGCCCATCTGCT	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.490A>G	21.37:g.46021011A>G	ENSP00000369445:p.Ile164Val	Somatic	247	16	0.0647773		WXS	Illumina HiSeq	Phase_I	291	30	0.103093	NM_198689	Q0VDJ8|Q70LJ2	Missense_Mutation	SNP	ENST00000380102.2	37		.	.	.	.	.	.	.	.	.	.	N	0.008	-1.901051	0.00517	.	.	ENSG00000205441	ENST00000380102	T	0.01209	5.17	3.93	-7.86	0.01187	.	.	.	.	.	T	0.00328	0.0010	N	0.00666	-1.275	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.43065	-0.9414	8	0.06625	T	0.88	.	2.9848	0.05964	0.4214:0.098:0.3665:0.114	rs7283052	159	P60409-2	.	V	164	ENSP00000369445:I164V	ENSP00000369445:I164V	I	+	1	0	KRTAP10-7	44845439	0.195000	0.23338	0.000000	0.03702	0.013000	0.08279	0.334000	0.19787	-1.989000	0.00979	-2.846000	0.00104	ATC	A|0.250;G|0.750	0.750	weak		0.612	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
OR10Q1	219960	hgsc.bcm.edu	37	11	57995634	57995634	+	Silent	SNP	G	G	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr11:57995634G>T	ENST00000316770.2	-	1	756	c.714C>A	c.(712-714)ggC>ggA	p.G238G		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	238						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				CCCGGCGGCGGCCCTCGGCAG	0.627																																					p.G238G		Atlas-SNP	.											.	OR10Q1	79	.	0			c.C714A						PASS	.						56.0	52.0	54.0					11																	57995634		2201	4295	6496	SO:0001819	synonymous_variant	219960	exon1			GCGGCGGCCCTCG	AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.714C>A	11.37:g.57995634G>T		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	70	12	0.171429	NM_001004471	Q6IFG4	Silent	SNP	ENST00000316770.2	37	CCDS31547.1																																																																																			.	.	none		0.627	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394706.1	NM_001004471	
EP400	57634	hgsc.bcm.edu	37	12	132547087	132547087	+	Silent	SNP	G	G	A	rs12366766	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:132547087G>A	ENST00000333577.4	+	48	8392	c.8283G>A	c.(8281-8283)caG>caA	p.Q2761Q	EP400_ENST00000330386.6_Silent_p.Q2644Q|EP400_ENST00000389561.2_Silent_p.Q2725Q|EP400_ENST00000389562.2_Silent_p.Q2724Q|EP400_ENST00000332482.4_Silent_p.Q2688Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2761	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2724Q(16)|p.Q2725Q(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcaacaacagc	0.562													G|||	37	0.00738818	0.0038	0.0072	5008	,	,		15585	0.002		0.0149	False		,,,				2504	0.0102				p.Q2725Q		Atlas-SNP	.											EP400,NS,carcinoma,0,20	EP400	370	20	17	Substitution - coding silent(17)	prostate(4)|kidney(4)|central_nervous_system(3)|lung(3)|endometrium(2)|urinary_tract(1)	c.G8175A						scavenged	.						28.0	31.0	30.0					12																	132547087		2199	4282	6481	SO:0001819	synonymous_variant	57634	exon47			GCAGCAGCAACAA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8283G>A	12.37:g.132547087G>A		Somatic	51	1	0.0196078		WXS	Illumina HiSeq	Phase_I	92	9	0.0978261	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				.	.	weak		0.562	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
MYOM2	9172	hgsc.bcm.edu	37	8	2057240	2057240	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr8:2057240G>T	ENST00000262113.4	+	25	3239	c.3098G>T	c.(3097-3099)cGc>cTc	p.R1033L	MYOM2_ENST00000523438.1_Missense_Mutation_p.R458L	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	1033					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.R1033H(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GGGCGGGTTCGCTTCTGGCTC	0.443																																					p.R1033L		Atlas-SNP	.											MYOM2,NS,carcinoma,0,1	MYOM2	251	1	1	Substitution - Missense(1)	lung(1)	c.G3098T						PASS	.						81.0	79.0	80.0					8																	2057240		2203	4300	6503	SO:0001583	missense	9172	exon25			GGGTTCGCTTCTG		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.3098G>T	8.37:g.2057240G>T	ENSP00000262113:p.Arg1033Leu	Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	190	38	0.2	NM_003970	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	g	34	5.316100	0.95655	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.41065	1.01;1.01	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.68577	0.3016	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66999	-0.5781	10	0.41790	T	0.15	.	20.0285	0.97531	0.0:0.0:1.0:0.0	.	1033	P54296	MYOM2_HUMAN	L	1033;458	ENSP00000262113:R1033L;ENSP00000428396:R458L	ENSP00000262113:R1033L	R	+	2	0	MYOM2	2044647	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.512000	0.98008	2.727000	0.93392	0.645000	0.84053	CGC	.	.	none		0.443	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
KRTAP1-4	728255	hgsc.bcm.edu	37	17	39186028	39186028	+	Silent	SNP	G	G	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:39186028G>T	ENST00000377747.4	-	1	328	c.303C>A	c.(301-303)tcC>tcA	p.S101S	KRTAP1-5_ENST00000361883.5_5'Flank	NM_001257305.1	NP_001244234.1	P0C5Y4	KRA14_HUMAN	keratin associated protein 1-4	101						keratin filament (GO:0045095)				lung(1)	1						GTCCACAGTAGGACGGGCGGC	0.642																																					p.S101S		Atlas-SNP	.											.	KRTAP1-4	4	.	0			c.C303A						PASS	.																																			SO:0001819	synonymous_variant	728255	exon1			ACAGTAGGACGGG	AC007455	CCDS58548.1	17q21.2	2010-06-22			ENSG00000204887	ENSG00000204887		"""Keratin associated proteins"""	18904	protein-coding gene	gene with protein product		608821					Standard	NM_001257305		Approved	KAP1.4	uc031raf.1	P0C5Y4	OTTHUMG00000133631	ENST00000377747.4:c.303C>A	17.37:g.39186028G>T		Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	144	40	0.277778	NM_001257305	A6NJ92	Silent	SNP	ENST00000377747.4	37	CCDS58548.1																																																																																			.	.	none		0.642	KRTAP1-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257776.3		
MT-CYB	4519	hgsc.bcm.edu	37	M	15884	15884	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chrM:15884G>A	ENST00000361789.2	+	1	1138	c.1138G>A	c.(1138-1140)Gcc>Acc	p.A380T	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	380					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						TACTCAAATGGGCCTGTCCTT	0.368																																					p.A380T		Atlas-SNP	.											.	.	.	.	0			c.G1138A						PASS	.																																			SO:0001583	missense	0	exon1			AAATGGGCCTGTC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.1138G>A	M.37:g.15884G>A	ENSP00000354554:p.Ala380Thr	Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	20	10	0.5	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																				.	.	none		0.368	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
RBMXL3	139804	hgsc.bcm.edu	37	X	114426552	114426552	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chrX:114426552G>A	ENST00000424776.3	+	1	2590	c.2548G>A	c.(2548-2550)Gac>Aac	p.D850N	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	850	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CAACAGTTACGACCGGAGCCA	0.652																																					p.D850N		Atlas-SNP	.											.	RBMXL3	83	.	0			c.G2548A						PASS	.						31.0	33.0	32.0					X																	114426552		692	1591	2283	SO:0001583	missense	139804	exon1			AGTTACGACCGGA	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.2548G>A	X.37:g.114426552G>A	ENSP00000417451:p.Asp850Asn	Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	37	16	0.432432	NM_001145346	B4DXC0	Missense_Mutation	SNP	ENST00000424776.3	37	CCDS55478.1	.	.	.	.	.	.	.	.	.	.	G	9.452	1.090827	0.20471	.	.	ENSG00000175718	ENST00000424776	T	0.05996	3.36	0.95	-1.9	0.07665	.	.	.	.	.	T	0.02012	0.0063	N	0.08118	0	0.09310	N	1	D	0.57571	0.98	B	0.29267	0.1	T	0.43798	-0.9369	9	0.87932	D	0	.	4.3373	0.11092	0.3229:0.0:0.6771:0.0	.	850	Q8N7X1	RMXL3_HUMAN	N	850	ENSP00000417451:D850N	ENSP00000417451:D850N	D	+	1	0	RBMXL3	114332808	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-1.910000	0.01584	-1.194000	0.02684	-1.199000	0.01669	GAC	.	.	none		0.652	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
SRRM1	10250	hgsc.bcm.edu	37	1	24996752	24996752	+	Silent	SNP	A	A	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr1:24996752A>T	ENST00000323848.9	+	15	2661	c.2346A>T	c.(2344-2346)ccA>ccT	p.P782P	SRRM1_ENST00000447431.2_Silent_p.P794P|SRRM1_ENST00000374389.4_Silent_p.P791P|SRRM1_ENST00000479034.1_3'UTR	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	782	Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		ACTGGTCACCAGCTGTACCGG	0.527																																					p.P782P	Ovarian(68;897 1494 3282 17478)	Atlas-SNP	.											.	SRRM1	81	.	0			c.A2346T						PASS	.						104.0	100.0	101.0					1																	24996752		2203	4300	6503	SO:0001819	synonymous_variant	10250	exon15			GTCACCAGCTGTA	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.2346A>T	1.37:g.24996752A>T		Somatic	222	0	0		WXS	Illumina HiSeq	Phase_I	202	57	0.282178	NM_005839	O60585|Q5VVN4	Silent	SNP	ENST00000323848.9	37	CCDS255.1																																																																																			.	.	none		0.527	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
SV2B	9899	hgsc.bcm.edu	37	15	91835705	91835705	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr15:91835705C>T	ENST00000394232.1	+	13	2445	c.1975C>T	c.(1975-1977)Ctg>Ttg	p.L659L	SV2B_ENST00000545111.2_Silent_p.L508L|SV2B_ENST00000330276.4_Silent_p.L659L	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	659					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			CCCCATCCTTCTGGCTGCTGC	0.507																																					p.L659L		Atlas-SNP	.											.	SV2B	98	.	0			c.C1975T						PASS	.						133.0	124.0	127.0					15																	91835705		2198	4298	6496	SO:0001819	synonymous_variant	9899	exon14			ATCCTTCTGGCTG	AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.1975C>T	15.37:g.91835705C>T		Somatic	211	0	0		WXS	Illumina HiSeq	Phase_I	218	53	0.243119	NM_014848	B4DH30|C6G489|O94840|Q6IAR8	Silent	SNP	ENST00000394232.1	37	CCDS10370.1																																																																																			.	.	none		0.507	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848	
EP400	57634	hgsc.bcm.edu	37	12	132547138	132547138	+	Silent	SNP	A	A	G	rs111782215|rs561398509	byFrequency	TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr12:132547138A>G	ENST00000333577.4	+	48	8443	c.8334A>G	c.(8332-8334)caA>caG	p.Q2778Q	EP400_ENST00000330386.6_Silent_p.Q2661Q|EP400_ENST00000389561.2_Silent_p.Q2742Q|EP400_ENST00000389562.2_Silent_p.Q2741Q|EP400_ENST00000332482.4_Silent_p.Q2705Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2778	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2741Q(3)|p.Q2742Q(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcaacagcagcagc	0.602													G|||	74	0.0147764	0.028	0.0086	5008	,	,		14914	0.0079		0.0119	False		,,,				2504	0.0112				p.Q2742Q		Atlas-SNP	.											EP400,NS,carcinoma,0,5	EP400	370	5	4	Substitution - coding silent(4)	prostate(2)|endometrium(1)|kidney(1)	c.A8226G						PASS	.						48.0	40.0	43.0					12																	132547138		2203	4300	6503	SO:0001819	synonymous_variant	57634	exon47			GCAGCAACAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8334A>G	12.37:g.132547138A>G		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	122	11	0.0901639	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				A|0.990;G|0.010	0.010	strong		0.602	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
GPD2	2820	hgsc.bcm.edu	37	2	157407178	157407178	+	Silent	SNP	G	G	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr2:157407178G>T	ENST00000310454.6	+	8	1263	c.891G>T	c.(889-891)gtG>gtT	p.V297V	GPD2_ENST00000409674.1_Silent_p.V297V|GPD2_ENST00000409125.4_Silent_p.V70V|GPD2_ENST00000540309.1_Silent_p.V297V|GPD2_ENST00000438166.2_Silent_p.V297V	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	297					camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						CGGACTCTGTGCGCAAAATGG	0.468																																					p.V297V		Atlas-SNP	.											.	GPD2	59	.	0			c.G891T						PASS	.						126.0	111.0	116.0					2																	157407178		2203	4300	6503	SO:0001819	synonymous_variant	2820	exon8			CTCTGTGCGCAAA		CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.891G>T	2.37:g.157407178G>T		Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	119	25	0.210084	NM_001083112	A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Silent	SNP	ENST00000310454.6	37	CCDS2202.1																																																																																			.	.	none		0.468	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254910.3		
FAM83G	644815	hgsc.bcm.edu	37	17	18907061	18907061	+	Silent	SNP	G	G	A			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr17:18907061G>A	ENST00000388995.6	-	2	517	c.294C>T	c.(292-294)ggC>ggT	p.G98G	SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000395645.3_Intron|SLC5A10_ENST00000395647.2_Intron|FAM83G_ENST00000585154.2_Silent_p.G98G|SLC5A10_ENST00000395642.1_Intron|FAM83G_ENST00000345041.4_Silent_p.G98G|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000395643.2_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	98					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						TGGCTTCCTCGCCGTCGCCGA	0.716																																					p.G98G		Atlas-SNP	.											.	FAM83G	51	.	0			c.C294T						PASS	.						10.0	12.0	11.0					17																	18907061		1868	4050	5918	SO:0001819	synonymous_variant	644815	exon2			TTCCTCGCCGTCG	AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.294C>T	17.37:g.18907061G>A		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	76	17	0.223684	NM_001039999	Q3KQZ4|Q6ZW60	Silent	SNP	ENST00000388995.6	37	CCDS42276.1																																																																																			.	.	none		0.716	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253108.4		
MAST4	375449	hgsc.bcm.edu	37	5	66462402	66462402	+	Silent	SNP	C	C	T			TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr5:66462402C>T	ENST00000403625.2	+	29	7690	c.7395C>T	c.(7393-7395)ttC>ttT	p.F2465F	MAST4_ENST00000405643.1_Silent_p.F2286F|MAST4_ENST00000403666.1_Silent_p.F2276F|MAST4_ENST00000404260.3_Silent_p.F2468F|MAST4_ENST00000261569.7_Silent_p.F2271F	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	2468						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CCTCCAGCTTCCCTGAAACCA	0.632											OREG0016638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F2465F		Atlas-SNP	.											.	MAST4	218	.	0			c.C7395T						PASS	.						17.0	21.0	20.0					5																	66462402		2005	4179	6184	SO:0001819	synonymous_variant	375449	exon29			CAGCTTCCCTGAA	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.7395C>T	5.37:g.66462402C>T		Somatic	99	0	0	1092	WXS	Illumina HiSeq	Phase_I	136	36	0.264706	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Silent	SNP	ENST00000403625.2	37	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	C	2.439	-0.328963	0.05314	.	.	ENSG00000069020	ENST00000443808	.	.	.	4.94	-2.72	0.05968	.	.	.	.	.	T	0.57710	0.2072	.	.	.	0.44207	D	0.997031	.	.	.	.	.	.	T	0.57046	-0.7878	4	.	.	.	-8.1125	12.3345	0.55058	0.0:0.7809:0.0:0.2191	.	.	.	.	S	1522	.	.	P	+	1	0	MAST4	66498158	0.030000	0.19436	0.223000	0.23860	0.279000	0.26890	0.023000	0.13533	-0.391000	0.07763	-0.379000	0.06801	CCC	.	.	none		0.632	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
GRHPR	9380	hgsc.bcm.edu	37	9	37424860	37424860	+	Missense_Mutation	SNP	G	G	T	rs180177304		TCGA-FF-A7CR-01A-11D-A382-10	TCGA-FF-A7CR-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f8b1d5ee-a86d-4505-96f8-3e8b0c050946	2bbed379-b7b8-4107-afe0-bfd42b041bb3	g.chr9:37424860G>T	ENST00000318158.6	+	2	187	c.102G>T	c.(100-102)tgG>tgT	p.W34C	GRHPR_ENST00000607784.1_Missense_Mutation_p.W34C|GRHPR_ENST00000493368.1_3'UTR	NM_012203.1	NP_036335.1	Q9UBQ7	GRHPR_HUMAN	glyoxylate reductase/hydroxypyruvate reductase	34					cellular nitrogen compound metabolic process (GO:0034641)|dicarboxylic acid metabolic process (GO:0043648)|excretion (GO:0007588)|glyoxylate metabolic process (GO:0046487)|metabolic process (GO:0008152)|oxidation-reduction process (GO:0055114)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisomal matrix (GO:0005782)	carboxylic acid binding (GO:0031406)|glycerate dehydrogenase activity (GO:0008465)|glyoxylate reductase (NADP) activity (GO:0030267)|hydroxypyruvate reductase activity (GO:0016618)|NAD binding (GO:0051287)|NADPH binding (GO:0070402)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12				GBM - Glioblastoma multiforme(29;0.00687)		TGGAGCAGTGGGACTCGGATG	0.677																																					p.W34C		Atlas-SNP	.											.	GRHPR	35	.	0			c.G102T						PASS	.						46.0	43.0	44.0					9																	37424860		2203	4300	6503	SO:0001583	missense	9380	exon2			GCAGTGGGACTCG	AF134895	CCDS6609.1	9q12	2012-07-13			ENSG00000137106	ENSG00000137106	1.1.1.79, 1.1.1.81		4570	protein-coding gene	gene with protein product	"""primary hyperoxaluria type 2"""	604296		GLXR		10524214, 10484776	Standard	XM_005251631		Approved	PH2	uc003zzu.1	Q9UBQ7	OTTHUMG00000019914	ENST00000318158.6:c.102G>T	9.37:g.37424860G>T	ENSP00000313432:p.Trp34Cys	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	46	18	0.391304	NM_012203	Q5T945|Q9H3E9|Q9H636|Q9UKX1	Missense_Mutation	SNP	ENST00000318158.6	37	CCDS6609.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.399816	0.83120	.	.	ENSG00000137106	ENST00000377824;ENST00000318158	D;D	0.83755	-1.76;-1.76	5.74	5.74	0.90152	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.87390	0.6165	M	0.86178	2.8	0.80722	D	1	P	0.43287	0.802	B	0.43478	0.421	D	0.87612	0.2504	10	0.44086	T	0.13	.	19.5878	0.95496	0.0:0.0:1.0:0.0	.	34	Q9UBQ7	GRHPR_HUMAN	C	34	ENSP00000367055:W34C;ENSP00000313432:W34C	ENSP00000313432:W34C	W	+	3	0	GRHPR	37414860	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	9.016000	0.93645	2.745000	0.94114	0.650000	0.86243	TGG	.	.	alt		0.677	GRHPR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052442.1	NM_012203	
