#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SPRR3	6707	hgsc.bcm.edu	37	1	152975659	152975682	+	In_Frame_Del	DEL	GAGCCAGGCTGTACCAAGGTCCCT	GAGCCAGGCTGTACCAAGGTCCCT	-	rs568163793|rs553429466|rs74134624	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	GAGCCAGGCTGTACCAAGGTCCCT	GAGCCAGGCTGTACCAAGGTCCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr1:152975659_152975682delGAGCCAGGCTGTACCAAGGTCCCT	ENST00000295367.4	+	2	205_228	c.163_186delGAGCCAGGCTGTACCAAGGTCCCT	c.(163-186)gagccaggctgtaccaaggtccctdel	p.EPGCTKVP95del	SPRR3_ENST00000542696.1_In_Frame_Del_p.EPGCTKVP87del|SPRR3_ENST00000331860.3_In_Frame_Del_p.EPGCTKVP95del	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	95	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAAGATTCCAGAGCCAGGCTGTACCAAGGTCCCTGAGCCAGGCT	0.562																																					p.54_62del		Atlas-Indel	.											SPRR3,colon,carcinoma,+2,1	SPRR3	45	1	0			c.162_185del						PASS	.		,	2036,1952		740,556,698					,	-1.4	0.0		dbSNP_130	70	3135,4775		852,1431,1672	no	coding,coding	SPRR3	NM_005416.2,NM_001097589.1	,	1592,1987,2370	A1A1,A1R,RR		39.6334,48.9468,43.4611	,	,		5171,6727				SO:0001651	inframe_deletion	6707	exon2			.	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.163_186delGAGCCAGGCTGTACCAAGGTCCCT	1.37:g.152975659_152975682delGAGCCAGGCTGTACCAAGGTCCCT	ENSP00000295367:p.Glu95_Pro102del	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	113	36	0.318584	NM_001097589	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	In_Frame_Del	DEL	ENST00000295367.4	37	CCDS1033.1																																																																																			.	.	weak		0.562	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
SLC35A2	7355	hgsc.bcm.edu	37	X	48762343	48762346	+	Frame_Shift_Del	DEL	GCCG	GCCG	-			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	GCCG	GCCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chrX:48762343_48762346delGCCG	ENST00000247138.5	-	4	843_846	c.840_843delCGGC	c.(838-843)ttcggcfs	p.FG280fs	SLC35A2_ENST00000445167.2_Intron|SLC35A2_ENST00000376515.3_Intron|SLC35A2_ENST00000413561.2_Frame_Shift_Del_p.FG219fs|SLC35A2_ENST00000376529.3_Intron|SLC35A2_ENST00000376521.1_Frame_Shift_Del_p.FG280fs|SLC35A2_ENST00000452555.2_Frame_Shift_Del_p.FG308fs	NM_005660.1	NP_005651.1	P78381	S35A2_HUMAN	solute carrier family 35 (UDP-galactose transporter), member A2	280					galactose metabolic process (GO:0006012)|transmembrane transport (GO:0055085)|UDP-galactose transport (GO:0015785)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	sugar:proton symporter activity (GO:0005351)|UDP-galactose transmembrane transporter activity (GO:0005459)			breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(2)	15						CCAGTAGCCCGCCGAAGGCCTGGT	0.603																																					p.281_282del		Pindel,Atlas-Indel	.											.	SLC35A2	46	.	0			c.841_844del						PASS	.																																			SO:0001589	frameshift_variant	7355	exon4			.	D88146	CCDS14311.1, CCDS35247.1, CCDS43937.1, CCDS65253.1, CCDS65254.1, CCDS75973.1, CCDS75974.1, CCDS75975.1	Xp11.23-p11.22	2013-05-22			ENSG00000102100	ENSG00000102100		"""Solute carriers"""	11022	protein-coding gene	gene with protein product		314375	"""solute carrier family 35 (UDP-galactose transporter), member 2"""	UGALT		8128316	Standard	NM_001042498		Approved	UGAT, UGT, UGT1, UGT2, UGTL	uc004dlo.1	P78381	OTTHUMG00000024129	ENST00000247138.5:c.840_843delCGGC	X.37:g.48762343_48762346delGCCG	ENSP00000247138:p.Phe280fs	Somatic	54	.	.		WXS	Illumina HiSeq	Phase_I	47	13	0.277	NM_001042498	A8K2L9|A8K9V1|B4DE11|B4DPT2|E7EW45|Q8IV21|Q92553	Frame_Shift_Del	DEL	ENST00000247138.5	37	CCDS14311.1																																																																																			.	.	none		0.603	SLC35A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060790.1	NM_005660	
NEFH	4744	hgsc.bcm.edu	37	22	29885581	29885604	+	In_Frame_Del	DEL	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs79235463|rs200984527|rs370803228	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr22:29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENST00000310624.6	+	4	1985_2008	c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	c.(1951-1977)aaggccaagtccccagagaaggaagag>aag	p.AKSPEKEE652del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	658	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCTGAGAAGGCCAAGTCCCCAGAGAAGGAAGAGGCCAAGTC	0.562																																					p.651_658del		Atlas-Indel	.											.	NEFH	178	.	0			c.1951_1974del						PASS	.																																			SO:0001651	inframe_deletion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	22.37:g.29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENSP00000311997:p.Ala652_Glu659del	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	42	18	0.428571	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	weak		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
FRAS1	80144	hgsc.bcm.edu	37	4	79176419	79176419	+	Frame_Shift_Del	DEL	G	G	-			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr4:79176419delG	ENST00000325942.6	+	6	933	c.493delG	c.(493-495)gtgfs	p.V165fs	FRAS1_ENST00000264899.6_Frame_Shift_Del_p.V165fs|FRAS1_ENST00000264895.6_Frame_Shift_Del_p.V165fs	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	165	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TGAAGGCCATGTGTTTCAGGA	0.537																																					p.H164fs		Atlas-Indel	.											.	FRAS1	779	.	0			c.492delT						PASS	.						54.0	55.0	55.0					4																	79176419		1937	4123	6060	SO:0001589	frameshift_variant	80144	exon6			.	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.493delG	4.37:g.79176419delG	ENSP00000326330:p.Val165fs	Somatic	194	0	0		WXS	Illumina HiSeq	Phase_I	133	27	0.203008	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Frame_Shift_Del	DEL	ENST00000325942.6	37	CCDS54772.1																																																																																			.	.	none		0.537	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382417	24382418	+	IGR	INS	-	-	CTGCTGCTC	rs185449787		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chrX:24382417_24382418insCTGCTGCTC								AC004552.1 (15394 upstream) : PDK3 (100919 downstream)																							tgctgctgctgctgctgctgct	0.619																																					p.A514delinsAAAP		Atlas-Indel	.											.	.	.	.	0			c.1540_1541insCTGCTGCTC						PASS	.																																			SO:0001628	intergenic_variant	100130302	exon1			.																													X.37:g.24382417_24382418insCTGCTGCTC		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	80	40	0.5	NM_001136234		In_Frame_Ins	INS		37																																																																																				.	.	alt	0	0.619								
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346593	39346595	+	In_Frame_Del	DEL	CCT	CCT	-	rs377187211|rs148036927|rs11283848	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	CCT	CCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr17:39346593_39346595delCCT	ENST00000398470.1	+	1	455_457	c.455_457delCCT	c.(454-459)acctgc>agc	p.152_153TC>S	KRTAP9-1_ENST00000377723.3_Intron|KRTAP9-1_ENST00000318329.5_In_Frame_Del_p.69_70TC>S	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	152	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)		p.T152_C153>S(2)		breast(1)|lung(3)	4						TGCCAGCCCACCTGCTGTGGGTC	0.581																																					p.152_152del		Atlas-Indel	.											KRTAP9-1_ENST00000398470,colon,carcinoma,0,2	KRTAP9-1	34	2	2	Complex - deletion inframe(2)	breast(2)	c.454_456del						PASS	.																																			SO:0001651	inframe_deletion	728318	exon1			.	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	ENST00000398470.1:c.455_457delCCT	17.37:g.39346593_39346595delCCT	ENSP00000381488:p.Thr152_Cys153delinsSer	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	64	25	0.390625	NM_001190460		In_Frame_Del	DEL	ENST00000398470.1	37	CCDS56029.1																																																																																			.	.	weak		0.581	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
C11orf40	143501	hgsc.bcm.edu	37	11	4592706	4592707	+	Frame_Shift_Ins	INS	-	-	AC	rs80310454|rs67702097|rs141600462	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr11:4592706_4592707insAC	ENST00000307616.1	-	4	599_600	c.600_601insGT	c.(598-603)tgtatgfs	p.M201fs		NM_144663.1	NP_653264.1	Q8WZ69	CK040_HUMAN	chromosome 11 open reading frame 40	201										large_intestine(3)|lung(1)|ovary(2)|stomach(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;4.28e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		acacgatccatacagtttttcc	0.426																																					p.M201fs		Pindel	.											.	C11orf40	37	.	0			c.601_602insGT						PASS	.			2670,1456		925,820,318						-0.7	0.0		dbSNP_130	78	4274,3706		1320,1634,1036	no	frameshift	C11orf40	NM_144663.1		2245,2454,1354	A1A1,A1R,RR		46.4411,35.2884,42.64				6944,5162				SO:0001589	frameshift_variant	143501	exon4			.		CCDS31354.1	11p15.5	2005-10-03			ENSG00000171987	ENSG00000171987			23986	protein-coding gene	gene with protein product							Standard	NM_144663		Approved	NOV1	uc010qyg.2	Q8WZ69	OTTHUMG00000165345	ENST00000307616.1:c.599_600dupGT	11.37:g.4592707_4592708dupAC	ENSP00000302918:p.Met201fs	Somatic	113	.	.		WXS	Illumina HiSeq	Phase_I	91	29	0.319	NM_144663		Frame_Shift_Ins	INS	ENST00000307616.1	37	CCDS31354.1																																																																																			-|0.377;AC|0.623	0.623	strong		0.426	C11orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383529.1	NM_144663	
TUBB8	347688	hgsc.bcm.edu	37	10	95169	95169	+	Missense_Mutation	SNP	T	T	G	rs199817418	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr10:95169T>G	ENST00000309812.4	-	1	72	c.10A>C	c.(10-12)Atc>Ctc	p.I4L	TUBB8_ENST00000413237.3_Intron|TUBB8_ENST00000447903.2_Intron|TUBB8_ENST00000332708.5_Missense_Mutation_p.I4L	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	4					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GTGAGCACGATCTCCCTCATG	0.667																																					p.I4L	Pancreas(192;2041 3010 9013 18103)	Atlas-SNP	.											TUBB8,colon,carcinoma,0,2	TUBB8	62	2	0			c.A10C						scavenged	.						18.0	17.0	17.0					10																	95169		2196	4294	6490	SO:0001583	missense	347688	exon1			GCACGATCTCCCT	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.10A>C	10.37:g.95169T>G	ENSP00000311042:p.Ile4Leu	Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	46	5	0.108696	NM_177987	Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	T	7.968	0.748352	0.15710	.	.	ENSG00000173876	ENST00000440680;ENST00000328974;ENST00000309812;ENST00000332708	T;T	0.75704	-0.96;-0.76	0.109	0.109	0.14578	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.64402	U	0.000017	T	0.73938	0.3651	M	0.88450	2.955	0.80722	D	1	B;B	0.09022	0.0;0.002	B;B	0.27608	0.001;0.081	T	0.68334	-0.5436	10	0.87932	D	0	.	4.6217	0.12455	0.0:4.0E-4:0.0:0.9996	.	4;4	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	L	4	ENSP00000311042:I4L;ENSP00000371071:I4L	ENSP00000311042:I4L	I	-	1	0	RP11-631M21.2	85169	1.000000	0.71417	0.020000	0.16555	0.020000	0.10135	2.326000	0.43849	0.156000	0.19299	0.155000	0.16302	ATC	T|0.980;G|0.020	0.020	strong		0.667	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	
MKI67	4288	hgsc.bcm.edu	37	10	129906253	129906253	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr10:129906253G>T	ENST00000368654.3	-	13	4226	c.3851C>A	c.(3850-3852)gCg>gAg	p.A1284E	MKI67_ENST00000368653.3_Missense_Mutation_p.A924E	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1284	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				ATTCCTGCACGCTAAGAGTTC	0.493																																					p.A1284E		Atlas-SNP	.											MKI67,rectum,carcinoma,+1,2	MKI67	363	2	0			c.C3851A						scavenged	.						260.0	245.0	250.0					10																	129906253		2203	4300	6503	SO:0001583	missense	4288	exon13			CTGCACGCTAAGA	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.3851C>A	10.37:g.129906253G>T	ENSP00000357643:p.Ala1284Glu	Somatic	335	0	0		WXS	Illumina HiSeq	Phase_I	265	3	0.0113208	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	G	8.168	0.790945	0.16258	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02787	4.16;4.16	2.12	1.15	0.20763	.	0.885835	0.09189	N	0.836254	T	0.07413	0.0187	L	0.61218	1.895	0.09310	N	1	D;D;D	0.76494	0.99;0.988;0.999	P;P;D	0.67900	0.843;0.763;0.954	T	0.20140	-1.0284	10	0.02654	T	1	.	5.0774	0.14638	0.1828:0.0:0.8172:0.0	.	1283;924;1284	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	E	1284;924;1283	ENSP00000357643:A1284E;ENSP00000357642:A924E	ENSP00000357642:A924E	A	-	2	0	MKI67	129796243	.	.	0.000000	0.03702	0.002000	0.02628	.	.	0.415000	0.25817	0.462000	0.41574	GCG	.	.	none		0.493	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
RGPD3	653489	hgsc.bcm.edu	37	2	107049632	107049632	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr2:107049632G>A	ENST00000409886.3	-	16	2402	c.2315C>T	c.(2314-2316)gCg>gTg	p.A772V	RGPD3_ENST00000304514.7_Missense_Mutation_p.A772V	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	772					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTCTGAATCCGCATTTCGCAA	0.373																																					p.A772V		Atlas-SNP	.											RGPD3_ENST00000304514,bladder,carcinoma,+1,6	RGPD3	316	6	0			c.C2315T						scavenged	.						90.0	75.0	80.0					2																	107049632		692	1590	2282	SO:0001583	missense	653489	exon16			GAATCCGCATTTC		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2315C>T	2.37:g.107049632G>A	ENSP00000386588:p.Ala772Val	Somatic	497	2	0.00402414		WXS	Illumina HiSeq	Phase_I	426	5	0.0117371	NM_001144013	B8ZZM4	Missense_Mutation	SNP	ENST00000409886.3	37	CCDS46379.1	.	.	.	.	.	.	.	.	.	.	.	3.284	-0.146450	0.06627	.	.	ENSG00000153165	ENST00000409886;ENST00000452099;ENST00000304514	T;T	0.23348	1.91;1.91	2.34	1.42	0.22433	.	.	.	.	.	T	0.19127	0.0459	L	0.47716	1.5	0.22947	N	0.998528	B	0.15141	0.012	B	0.06405	0.002	T	0.16778	-1.0391	9	0.37606	T	0.19	-0.1623	4.3139	0.10984	0.2042:0.0:0.7958:0.0	.	772	A6NKT7	RGPD3_HUMAN	V	772;530;772	ENSP00000386588:A772V;ENSP00000303659:A772V	ENSP00000303659:A772V	A	-	2	0	RGPD3	106416064	0.918000	0.31147	0.919000	0.36401	0.028000	0.11728	0.415000	0.21181	1.308000	0.44962	0.173000	0.16961	GCG	.	.	none		0.373	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
TBC1D29	26083	hgsc.bcm.edu	37	17	28890361	28890361	+	Missense_Mutation	SNP	G	G	A	rs372824382		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr17:28890361G>A	ENST00000580161.1	+	6	2868	c.371G>A	c.(370-372)cGg>cAg	p.R124Q	TBC1D29_ENST00000579181.1_Missense_Mutation_p.R124Q|RP11-218M11.1_ENST00000563063.1_lincRNA|TBC1D29_ENST00000584297.1_3'UTR			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	124							Rab GTPase activator activity (GO:0005097)	p.R124Q(1)		breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				GCCTTGAGCCGGGGAGACAAG	0.567																																					p.R124Q		Atlas-SNP	.											TBC1D29,NS,carcinoma,0,3	TBC1D29	19	3	1	Substitution - Missense(1)	prostate(1)	c.G371A						scavenged	.						78.0	68.0	71.0					17																	28890361		2203	4300	6503	SO:0001583	missense	26083	exon5			TGAGCCGGGGAGA	BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.371G>A	17.37:g.28890361G>A	ENSP00000462799:p.Arg124Gln	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	66	2	0.030303	NM_015594		Missense_Mutation	SNP	ENST00000580161.1	37	CCDS32606.1	.	.	.	.	.	.	.	.	.	.	.	2.991	-0.208219	0.06180	.	.	ENSG00000197689	ENST00000329040	.	.	.	.	.	.	.	.	.	.	.	T	0.14399	0.0348	N	0.08118	0	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.14559	-1.0468	7	0.33141	T	0.24	.	3.9265	0.09265	0.6657:0.0:0.3343:0.0	.	124	Q9UFV1	TBC29_HUMAN	Q	124	.	ENSP00000330052:R124Q	R	+	2	0	TBC1D29	25914487	0.090000	0.21635	0.024000	0.17045	0.025000	0.11179	-1.180000	0.03088	-1.657000	0.01492	-1.643000	0.00768	CGG	.	.	alt		0.567	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443632.1	NM_015594	
KRTAP4-8	728224	hgsc.bcm.edu	37	17	39254054	39254054	+	Missense_Mutation	SNP	A	A	T	rs76270529		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr17:39254054A>T	ENST00000333822.4	-	1	339	c.283T>A	c.(283-285)Tgc>Agc	p.C95S		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	95	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.C95S(4)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						ctggagatgcagcagcTAGGG	0.677																																					p.C95S		Atlas-SNP	.											KRTAP4-8,rectum,carcinoma,0,8	KRTAP4-8	57	8	4	Substitution - Missense(4)	endometrium(3)|kidney(1)	c.T283A						scavenged	.						7.0	11.0	10.0					17																	39254054		685	1582	2267	SO:0001583	missense	728224	exon1			AGATGCAGCAGCT	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.283T>A	17.37:g.39254054A>T	ENSP00000328444:p.Cys95Ser	Somatic	70	2	0.0285714		WXS	Illumina HiSeq	Phase_I	65	7	0.107692	NM_031960	A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	CCDS45674.1	.	.	.	.	.	.	.	.	.	.	.	15.18	2.755714	0.49362	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.02280	4.36	3.11	2.01	0.26516	.	0.000000	0.52532	U	0.000067	T	0.04497	0.0123	M	0.83223	2.63	0.25182	N	0.99019	B	0.21606	0.058	B	0.27887	0.084	T	0.21793	-1.0235	10	0.54805	T	0.06	.	6.3859	0.21559	0.8715:0.0:0.1285:0.0	.	95	Q9BYQ9	KRA48_HUMAN	S	95;80	ENSP00000328444:C95S	ENSP00000414561:C80S	C	-	1	0	KRTAP4-8	36507580	0.999000	0.42202	0.393000	0.26258	0.649000	0.38597	3.122000	0.50446	0.404000	0.25506	0.374000	0.22700	TGC	A|0.500;T|0.500	0.500	weak		0.677	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1	NM_031960	
HLA-DRB5	3127	hgsc.bcm.edu	37	6	32487353	32487353	+	Missense_Mutation	SNP	T	T	C	rs114293611	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr6:32487353T>C	ENST00000374975.3	-	3	508	c.446A>G	c.(445-447)aAt>aGt	p.N149S		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5									p.N149S(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						ATAGAAACCATTCACAGAGCA	0.537													T|||	2089	0.417133	0.559	0.415	5008	,	,		9822	0.3304		0.4414	False		,,,				2504	0.2914				p.N149S		Atlas-SNP	.											HLA-DRB5,NS,lymphoid_neoplasm,0,1	HLA-DRB5	31	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.A446G						scavenged	.	T	SER/ASN	1237,2619		353,531,1044	42.0	53.0	49.0		446	-9.4	0.0	6	dbSNP_132	49	2078,6142		542,994,2574	no	missense	HLA-DRB5	NM_002125.3	46	895,1525,3618	CC,CT,TT		25.2798,32.0799,27.4511	benign	149/267	32487353	3315,8761	1928	4110	6038	SO:0001583	missense	3127	exon3			AAACCATTCACAG		CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.446A>G	6.37:g.32487353T>C	ENSP00000364114:p.Asn149Ser	Somatic	79	12	0.151899		WXS	Illumina HiSeq	Phase_I	84	12	0.142857	NM_002125		Missense_Mutation	SNP	ENST00000374975.3	37	CCDS4751.1	1029	0.47115384615384615	246	0.5	177	0.4889502762430939	256	0.44755244755244755	350	0.46174142480211083	.	0.054	-1.240602	0.01493	0.320799	0.252798	ENSG00000198502	ENST00000374975	T	0.02606	4.23	4.69	-9.39	0.00619	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.532611	0.22458	N	0.059800	T	0.00210	0.0006	N	0.01242	-0.935	0.80722	P	0.0	B;B	0.10296	0.0;0.003	B;B	0.13407	0.009;0.005	T	0.39643	-0.9604	9	0.12766	T	0.61	.	3.7772	0.08665	0.0982:0.418:0.1992:0.2846	.	76;149	Q29973;Q30154	.;DRB5_HUMAN	S	149	ENSP00000364114:N149S	ENSP00000364114:N149S	N	-	2	0	HLA-DRB5	32595331	0.000000	0.05858	0.004000	0.12327	0.270000	0.26580	-1.167000	0.03126	-1.562000	0.01682	-1.365000	0.01206	AAT	T|0.525;C|0.475	0.475	strong		0.537	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
TTK	7272	hgsc.bcm.edu	37	6	80751906	80751906	+	Missense_Mutation	SNP	G	G	A	rs539988632		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr6:80751906G>A	ENST00000369798.2	+	22	2672	c.2561G>A	c.(2560-2562)aGg>aAg	p.R854K	TTK_ENST00000509894.1_Missense_Mutation_p.R853K|TTK_ENST00000230510.3_Missense_Mutation_p.R853K	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	854					chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.R838K(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		GAAAAAAAAAGGGGAAAAAAA	0.308													G|||	1	0.000199681	0.0	0.0	5008	,	,		15015	0.0		0.001	False		,,,				2504	0.0				p.R854K		Atlas-SNP	.											TTK_ENST00000369798,NS,carcinoma,+1,7	TTK	199	7	1	Substitution - Missense(1)	ovary(1)	c.G2561A						scavenged	.						48.0	51.0	50.0					6																	80751906		2203	4286	6489	SO:0001583	missense	7272	exon22			AAAAAAGGGGAAA		CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2561G>A	6.37:g.80751906G>A	ENSP00000358813:p.Arg854Lys	Somatic	279	0	0		WXS	Illumina HiSeq	Phase_I	166	4	0.0240964	NM_003318	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	ENST00000369798.2	37	CCDS4993.1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.513029	0.00975	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.65732	-0.17;-0.17;-0.17	5.6	4.71	0.59529	.	0.346876	0.32134	N	0.006539	T	0.26484	0.0647	L	0.36672	1.1	0.09310	N	1	B;B	0.21520	0.057;0.057	B;B	0.17722	0.019;0.019	T	0.22103	-1.0226	10	0.05721	T	0.95	.	14.7704	0.69671	0.0:0.0:0.8545:0.1455	.	854;853	P33981;A8K8U5	TTK_HUMAN;.	K	853;853;854	ENSP00000422936:R853K;ENSP00000230510:R853K;ENSP00000358813:R854K	ENSP00000230510:R853K	R	+	2	0	TTK	80808625	0.994000	0.37717	0.003000	0.11579	0.004000	0.04260	2.330000	0.43885	1.339000	0.45563	0.561000	0.74099	AGG	.	.	none		0.308	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2		
RNASEH2B	79621	hgsc.bcm.edu	37	13	51530597	51530597	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr13:51530597T>A	ENST00000336617.3	+	11	1325	c.926T>A	c.(925-927)aTt>aAt	p.I309N	RNASEH2B_ENST00000422660.1_Intron|RNASEH2B_ENST00000495244.2_3'UTR	NM_024570.3	NP_078846.2	Q5TBB1	RNH2B_HUMAN	ribonuclease H2, subunit B	309					in utero embryonic development (GO:0001701)|negative regulation of gene expression (GO:0010629)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of DNA damage checkpoint (GO:2000001)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|ribonucleotide metabolic process (GO:0009259)|RNA catabolic process (GO:0006401)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)	RNA-DNA hybrid ribonuclease activity (GO:0004523)			endometrium(2)|liver(1)|lung(1)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(7;1.03e-07)|Breast(56;0.00122)|Lung NSC(96;0.00143)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;9e-08)		AAAAAAAAAATTGGAAAGGTT	0.313																																					p.I309N		Atlas-SNP	.											RNASEH2B,NS,carcinoma,0,2	RNASEH2B	26	2	0			c.T926A						scavenged	.						17.0	19.0	18.0					13																	51530597		2183	4279	6462	SO:0001583	missense	79621	exon11			AAAAAATTGGAAA	AK021774	CCDS9425.1, CCDS45047.1	13q14.3	2014-09-17	2006-08-17	2006-08-17	ENSG00000136104	ENSG00000136104			25671	protein-coding gene	gene with protein product		610326	"""deleted in lymphocytic leukemia 8"", ""Aicardi-Goutieres syndrome 2"""	DLEU8, AGS2		16845400	Standard	NM_001142279		Approved	FLJ11712	uc001vfa.4	Q5TBB1	OTTHUMG00000016937	ENST00000336617.3:c.926T>A	13.37:g.51530597T>A	ENSP00000337623:p.Ile309Asn	Somatic	338	3	0.00887574		WXS	Illumina HiSeq	Phase_I	302	8	0.0264901	NM_024570	G3XAJ1|Q05DR2|Q6PK48|Q9HAF7	Missense_Mutation	SNP	ENST00000336617.3	37	CCDS9425.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.784|8.784	0.928909|0.928909	0.18131|0.18131	.|.	.|.	ENSG00000136104|ENSG00000136104	ENST00000336617|ENST00000539292	D|.	0.96716|.	-4.1|.	5.24|5.24	-0.506|-0.506	0.11989|0.11989	.|.	.|2.449670	.|0.02044	.|N	.|0.049521	T|T	0.22859|0.22859	0.0552|0.0552	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	0.999999|0.999999	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.19778|0.19778	-1.0295|-1.0295	9|7	0.36615|0.54805	T|T	0.2|0.06	26.5704|26.5704	3.18|3.18	0.06581|0.06581	0.3209:0.1761:0.0:0.503|0.3209:0.1761:0.0:0.503	.|.	309|.	Q5TBB1|.	RNH2B_HUMAN|.	N|M	309|307	ENSP00000337623:I309N|.	ENSP00000337623:I309N|ENSP00000441268:L307M	I|L	+|+	2|1	0|2	RNASEH2B|RNASEH2B	50428598|50428598	0.732000|0.732000	0.28121|0.28121	0.256000|0.256000	0.24389|0.24389	0.447000|0.447000	0.32167|0.32167	0.200000|0.200000	0.17257|0.17257	0.011000|0.011000	0.14865|0.14865	-0.256000|-0.256000	0.11100|0.11100	ATT|TTG	.	.	none		0.313	RNASEH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045006.3	NM_024570	
GPR125	166647	hgsc.bcm.edu	37	4	22446632	22446632	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr4:22446632G>T	ENST00000334304.5	-	6	939	c.670C>A	c.(670-672)Cca>Aca	p.P224T	GPR125_ENST00000502482.1_Missense_Mutation_p.P224T|GPR125_ENST00000508133.1_5'Flank|GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	224	LRRCT.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				CCTGTGACTGGTTGGGCCTGC	0.463																																					p.P224T		Atlas-SNP	.											GPR125,NS,carcinoma,+2,1	GPR125	118	1	0			c.C670A						PASS	.						130.0	114.0	119.0					4																	22446632		2203	4300	6503	SO:0001583	missense	166647	exon6			TGACTGGTTGGGC	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.670C>A	4.37:g.22446632G>T	ENSP00000334952:p.Pro224Thr	Somatic	189	0	0		WXS	Illumina HiSeq	Phase_I	142	28	0.197183	NM_145290	Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	ENST00000334304.5	37	CCDS33964.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.336957	0.41398	.	.	ENSG00000152990	ENST00000334304;ENST00000502482	T;T	0.57273	0.56;0.41	5.83	5.83	0.93111	Cysteine-rich flanking region, C-terminal (1);	0.107611	0.64402	D	0.000007	T	0.42607	0.1210	N	0.25485	0.75	0.48288	D	0.999629	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.12837	0.005;0.008;0.002	T	0.18903	-1.0322	10	0.42905	T	0.14	-3.1626	15.7745	0.78204	0.0:0.0:0.8556:0.1444	.	99;224;224	Q8IWK6-3;Q8IWK6-2;Q8IWK6	.;.;GP125_HUMAN	T	224	ENSP00000334952:P224T;ENSP00000421006:P224T	ENSP00000334952:P224T	P	-	1	0	GPR125	22055730	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.556000	0.53734	2.763000	0.94921	0.585000	0.79938	CCA	.	.	none		0.463	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3		
TLL2	7093	hgsc.bcm.edu	37	10	98157024	98157024	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr10:98157024C>T	ENST00000357947.3	-	11	1528	c.1303G>A	c.(1303-1305)Gtc>Atc	p.V435I	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	435	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		TCCGTGGAGACGAGGGGCTCC	0.577																																					p.V435I		Atlas-SNP	.											.	TLL2	122	.	0			c.G1303A						PASS	.						58.0	52.0	54.0					10																	98157024		2203	4300	6503	SO:0001583	missense	7093	exon11			TGGAGACGAGGGG	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1303G>A	10.37:g.98157024C>T	ENSP00000350630:p.Val435Ile	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	46	14	0.304348	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	CCDS7449.1	.	.	.	.	.	.	.	.	.	.	C	0.647	-0.810936	0.02798	.	.	ENSG00000095587	ENST00000357947	T	0.34472	1.36	5.11	-8.58	0.00897	CUB (5);	1.421770	0.05282	N	0.519613	T	0.12774	0.0310	N	0.13168	0.305	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.25813	-1.0121	10	0.02654	T	1	.	2.9319	0.05802	0.0942:0.1609:0.3118:0.433	.	435	Q9Y6L7	TLL2_HUMAN	I	435	ENSP00000350630:V435I	ENSP00000350630:V435I	V	-	1	0	TLL2	98147014	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.251000	0.08818	-1.951000	0.01029	-1.275000	0.01399	GTC	.	.	none		0.577	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
CST2	1470	hgsc.bcm.edu	37	20	23805952	23805952	+	Silent	SNP	G	G	C	rs146039211	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr20:23805952G>C	ENST00000304725.2	-	2	307	c.237C>G	c.(235-237)ggC>ggG	p.G79G		NM_001322.2	NP_001313.1	P09228	CYTT_HUMAN	cystatin SA	79					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|cervix(1)|large_intestine(1)|liver(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	10						AATTCACCCCGCCCACGATCT	0.542																																					p.G79G	Pancreas(193;496 3017 22514 29918)	Atlas-SNP	.											CST2,NS,adenoma,-1,1	CST2	39	1	0			c.C237G						scavenged	.						226.0	176.0	193.0					20																	23805952		2203	4300	6503	SO:0001819	synonymous_variant	1470	exon2			CACCCCGCCCACG	M19671	CCDS13161.1	20p11.2	2007-11-29			ENSG00000170369	ENSG00000170369			2474	protein-coding gene	gene with protein product	"""cystatin 2"""	123856					Standard	NM_001322		Approved		uc002wtq.1	P09228	OTTHUMG00000032086	ENST00000304725.2:c.237C>G	20.37:g.23805952G>C		Somatic	58	3	0.0517241		WXS	Illumina HiSeq	Phase_I	54	3	0.0555556	NM_001322	Q9UCQ7	Silent	SNP	ENST00000304725.2	37	CCDS13161.1																																																																																			G|0.999;A|0.001	.	alt		0.542	CST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078352.2		
FLG	2312	hgsc.bcm.edu	37	1	152285144	152285144	+	Silent	SNP	G	G	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr1:152285144G>T	ENST00000368799.1	-	3	2253	c.2218C>A	c.(2218-2220)Cga>Aga	p.R740R	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	740	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGACCCTCGGTGTCCACTG	0.572									Ichthyosis																												p.R740R		Atlas-SNP	.											FLG,NS,carcinoma,+1,1	FLG	900	1	0			c.C2218A						scavenged	.						357.0	373.0	367.0					1																	152285144		2203	4300	6503	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	ACCCTCGGTGTCC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2218C>A	1.37:g.152285144G>T		Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	161	2	0.0124224	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																			.	.	none		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
PABPC1	26986	hgsc.bcm.edu	37	8	101724606	101724606	+	Missense_Mutation	SNP	G	G	A	rs202060459		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr8:101724606G>A	ENST00000318607.5	-	7	2084	c.956C>T	c.(955-957)aCa>aTa	p.T319I	PABPC1_ENST00000522387.1_Missense_Mutation_p.T287I|PABPC1_ENST00000519596.1_5'UTR|PABPC1_ENST00000519004.1_Missense_Mutation_p.T274I	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	319	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)	p.T319I(2)		breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			ACTAGTGATTGTACCAAATGG	0.284																																					p.T319I		Atlas-SNP	.											PABPC1,NS,carcinoma,0,2	PABPC1	76	2	2	Substitution - Missense(2)	kidney(1)|endometrium(1)	c.C956T						scavenged	.						154.0	166.0	162.0					8																	101724606		2203	4298	6501	SO:0001583	missense	26986	exon7			GTGATTGTACCAA	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.956C>T	8.37:g.101724606G>A	ENSP00000313007:p.Thr319Ile	Somatic	404	0	0		WXS	Illumina HiSeq	Phase_I	336	4	0.0119048	NM_002568	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.768189|4.768189	0.90020|0.90020	.|.	.|.	ENSG00000070756|ENSG00000070756	ENST00000519100|ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387	.|T;T;T	.|0.16196	.|2.36;2.36;2.36	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.64402	.|D	.|0.000009	.|T	.|0.37652	.|0.1011	M|M	0.62154|0.62154	1.92|1.92	0.80722|0.80722	D|D	1|1	.|P;P;D	.|0.54964	.|0.917;0.784;0.969	.|P;B;P	.|0.56916	.|0.747;0.442;0.809	.|T	.|0.03784	.|-1.1004	.|10	.|0.87932	.|D	.|0	.|.	20.0919|20.0919	0.97823|0.97823	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|287;319;319	.|E7ERJ7;B3KT93;P11940	.|.;.;PABP1_HUMAN	X|I	188|319;319;274;287	.|ENSP00000313007:T319I;ENSP00000429594:T274I;ENSP00000429395:T287I	.|ENSP00000313007:T319I	Q|T	-|-	1|2	0|0	PABPC1|PABPC1	101793782|101793782	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.776000|9.776000	0.99001|0.99001	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	CAA|ACA	.	.	weak		0.284	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
KCNN3	3782	hgsc.bcm.edu	37	1	154842330	154842330	+	Silent	SNP	T	T	C			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr1:154842330T>C	ENST00000271915.4	-	1	426	c.111A>G	c.(109-111)caA>caG	p.Q37Q	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	37	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgttgctgctgct	0.677																																					p.Q37Q		Atlas-SNP	.											KCNN3,rectum,carcinoma,0,1	KCNN3	141	1	0			c.A111G						scavenged	.						8.0	8.0	8.0					1																	154842330		1936	3838	5774	SO:0001819	synonymous_variant	3782	exon1			CTGCTGTTGCTGC	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.111A>G	1.37:g.154842330T>C		Somatic	86	2	0.0232558		WXS	Illumina HiSeq	Phase_I	97	4	0.0412371	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	ENST00000271915.4	37	CCDS30880.1																																																																																			.	.	none		0.677	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
HLA-C	3107	hgsc.bcm.edu	37	6	31239613	31239613	+	Missense_Mutation	SNP	C	C	T	rs2308538	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr6:31239613C>T	ENST00000376228.5	-	2	120	c.106G>A	c.(106-108)Gtg>Atg	p.V36M	HLA-C_ENST00000383329.3_Missense_Mutation_p.V36M	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	36	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)	p.V36M(2)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						GGCCGGGACACGGCGGTGTCG	0.721																																					p.V36M		Atlas-SNP	.											HLA-C_ENST00000383329,NS,carcinoma,0,2	HLA-C	92	2	2	Substitution - Missense(2)	prostate(2)	c.G106A						scavenged	.						19.0	19.0	19.0					6																	31239613		1490	2687	4177	SO:0001583	missense	3107	exon2			GGGACACGGCGGT	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.106G>A	6.37:g.31239613C>T	ENSP00000365402:p.Val36Met	Somatic	55	1	0.0181818		WXS	Illumina HiSeq	Phase_I	64	7	0.109375	NM_002117	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	13.07|13.07	2.127655|2.127655	0.37533|0.37533	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000415537|ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	.|T;T	.|0.01092	.|5.35;5.35	2.16|2.16	2.16|2.16	0.27623|0.27623	.|MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.|0.224693	.|0.20953	.|U	.|0.082710	T|T	0.01661|0.01661	0.0053|0.0053	M|M	0.63843|0.63843	1.955|1.955	0.23747|0.23747	N|N	0.996957|0.996957	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;0.999;0.999;1.0	T|T	0.53236|0.53236	-0.8467|-0.8467	5|10	.|0.30854	.|T	.|0.27	.|.	7.8706|7.8706	0.29563|0.29563	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|36;36;36;36	.|A2AEA4;A6H578;A2AEA2;P10321	.|.;.;.;1C07_HUMAN	H|M	35|36;36;36;73	.|ENSP00000365402:V36M;ENSP00000372819:V36M	.|ENSP00000365402:V36M	R|V	-|-	2|1	0|0	HLA-C|HLA-C	31347592|31347592	0.000000|0.000000	0.05858|0.05858	0.780000|0.780000	0.31762|0.31762	0.007000|0.007000	0.05969|0.05969	0.465000|0.465000	0.22004|0.22004	1.524000|1.524000	0.49035|0.49035	0.305000|0.305000	0.20034|0.20034	CGT|GTG	T|0.155;C|0.845	0.155	strong		0.721	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
MUC6	4588	hgsc.bcm.edu	37	11	1017068	1017068	+	Silent	SNP	C	C	T	rs78992004		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr11:1017068C>T	ENST00000421673.2	-	31	5783	c.5733G>A	c.(5731-5733)acG>acA	p.T1911T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1911	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AAGTTTTGGCCGTGCTAAATG	0.552																																					p.T1911T		Atlas-SNP	.											MUC6,NS,carcinoma,-1,1	MUC6	408	1	0			c.G5733A						scavenged	.																																			SO:0001819	synonymous_variant	4588	exon31			TTTGGCCGTGCTA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5733G>A	11.37:g.1017068C>T		Somatic	571	68	0.119089		WXS	Illumina HiSeq	Phase_I	413	47	0.113801	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																			C|0.500;T|0.500	0.500	weak		0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
OR1S2	219958	hgsc.bcm.edu	37	11	57971203	57971203	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr11:57971203C>G	ENST00000302592.6	-	1	450	c.451G>C	c.(451-453)Gcc>Ccc	p.A151P		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				CCGAACCTGGCCCGCATGAAA	0.473																																					p.A151P		Atlas-SNP	.											OR1S2,NS,carcinoma,0,3	OR1S2	119	3	0			c.G451C						scavenged	.						163.0	154.0	157.0					11																	57971203		2201	4296	6497	SO:0001583	missense	219958	exon1			ACCTGGCCCGCAT	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.451G>C	11.37:g.57971203C>G	ENSP00000305469:p.Ala151Pro	Somatic	223	4	0.0179372		WXS	Illumina HiSeq	Phase_I	184	12	0.0652174	NM_001004459	Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	CCDS31545.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.753352	0.00085	.	.	ENSG00000197887	ENST00000302592	T	0.34275	1.37	4.47	-1.08	0.09936	GPCR, rhodopsin-like superfamily (1);	0.857144	0.09920	N	0.738596	T	0.04770	0.0129	N	0.00089	-2.185	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30149	-0.9988	10	0.02654	T	1	.	0.1523	0.00094	0.2967:0.2321:0.2346:0.2366	.	151	Q8NGQ3	OR1S2_HUMAN	P	151	ENSP00000305469:A151P	ENSP00000305469:A151P	A	-	1	0	OR1S2	57727779	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.298000	0.02756	-0.572000	0.06006	-0.120000	0.15030	GCC	.	.	none		0.473	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
GLP2R	9340	hgsc.bcm.edu	37	17	9745901	9745901	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr17:9745901G>A	ENST00000262441.5	+	4	985	c.472G>A	c.(472-474)Gaa>Aaa	p.E158K	GLP2R_ENST00000574745.1_5'UTR	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	158					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)	p.E158K(1)		endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	GGATGACTCCGAATGCTCCGA	0.547																																					p.E158K		Atlas-SNP	.											GLP2R,rectum,carcinoma,0,1	GLP2R	90	1	1	Substitution - Missense(1)	large_intestine(1)	c.G472A						PASS	.						130.0	104.0	113.0					17																	9745901		2203	4300	6503	SO:0001583	missense	9340	exon4			GACTCCGAATGCT	AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.472G>A	17.37:g.9745901G>A	ENSP00000262441:p.Glu158Lys	Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	33	7	0.212121	NM_004246	Q4VAT3	Missense_Mutation	SNP	ENST00000262441.5	37	CCDS11150.1	.	.	.	.	.	.	.	.	.	.	G	35	5.538263	0.96460	.	.	ENSG00000065325	ENST00000396206;ENST00000304773;ENST00000262441	T	0.37915	1.17	5.06	5.06	0.68205	GPCR, family 2, extracellular hormone receptor domain (1);	0.000000	0.39341	N	0.001387	T	0.54711	0.1875	M	0.74258	2.255	0.53688	D	0.999978	P	0.50156	0.932	P	0.54026	0.74	T	0.59621	-0.7420	10	0.72032	D	0.01	.	17.3704	0.87376	0.0:0.0:1.0:0.0	.	158	O95838	GLP2R_HUMAN	K	158;133;158	ENSP00000262441:E158K	ENSP00000262441:E158K	E	+	1	0	GLP2R	9686626	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	6.102000	0.71486	2.643000	0.89663	0.655000	0.94253	GAA	.	.	none		0.547	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4		
COL14A1	7373	hgsc.bcm.edu	37	8	121282320	121282320	+	Silent	SNP	C	C	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr8:121282320C>A	ENST00000297848.3	+	26	3390	c.3120C>A	c.(3118-3120)tcC>tcA	p.S1040S	COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000247781.3_Silent_p.S945S|COL14A1_ENST00000309791.4_Silent_p.S1040S	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TGGATGGATCCTGGAGCATTG	0.428																																					p.S1040S		Atlas-SNP	.											COL14A1,NS,carcinoma,+1,1	COL14A1	292	1	0			c.C3120A						PASS	.						135.0	123.0	127.0					8																	121282320		2203	4299	6502	SO:0001819	synonymous_variant	7373	exon26			TGGATCCTGGAGC		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.3120C>A	8.37:g.121282320C>A		Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	65	16	0.246154	NM_021110		Silent	SNP	ENST00000297848.3	37	CCDS34938.1																																																																																			.	.	none		0.428	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
OR1S2	219958	hgsc.bcm.edu	37	11	57970967	57970967	+	Silent	SNP	G	G	A	rs138762515		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr11:57970967G>A	ENST00000302592.6	-	1	686	c.687C>T	c.(685-687)ttC>ttT	p.F229F		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F229F(1)		endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				AGACATAGGAGAAGAAGATGA	0.438																																					p.F229F		Atlas-SNP	.											OR1S2,NS,carcinoma,0,2	OR1S2	119	2	1	Substitution - coding silent(1)	kidney(1)	c.C687T						scavenged	.						154.0	129.0	138.0					11																	57970967		2201	4296	6497	SO:0001819	synonymous_variant	219958	exon1			ATAGGAGAAGAAG	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.687C>T	11.37:g.57970967G>A		Somatic	108	9	0.0833333		WXS	Illumina HiSeq	Phase_I	76	11	0.144737	NM_001004459	Q6IFG5|Q96R85	Silent	SNP	ENST00000302592.6	37	CCDS31545.1																																																																																			G|0.999;A|0.001	0.001	weak		0.438	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
EPG5	57724	hgsc.bcm.edu	37	18	43514836	43514836	+	Silent	SNP	G	G	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr18:43514836G>A	ENST00000282041.5	-	11	2230	c.2196C>T	c.(2194-2196)agC>agT	p.S732S		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	732					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						GCAGGTTCTCGCTCTCCACCT	0.597																																					p.S732S		Atlas-SNP	.											.	EPG5	199	.	0			c.C2196T						PASS	.						56.0	59.0	58.0					18																	43514836		2028	4189	6217	SO:0001819	synonymous_variant	57724	exon11			GTTCTCGCTCTCC	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.2196C>T	18.37:g.43514836G>A		Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	156	28	0.179487	NM_020964	A2BDF3|Q9H8C8	Silent	SNP	ENST00000282041.5	37	CCDS11926.2																																																																																			.	.	none		0.597	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
ACE2	59272	hgsc.bcm.edu	37	X	15612969	15612969	+	Splice_Site	SNP	C	C	T	rs201900069		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chrX:15612969C>T	ENST00000252519.3	-	2	446	c.344G>A	c.(343-345)cGg>cAg	p.R115Q	ACE2_ENST00000427411.1_Splice_Site_p.R115Q			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	115					angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	CAAACGTACCCGTTTGCTCTT	0.388													C|||	1	0.000264901	0.0	0.0	3775	,	,		13925	0.001		0.0	False		,,,				2504	0.0				p.R115Q		Atlas-SNP	.											.	ACE2	87	.	0			c.G344A						PASS	.	C	GLN/ARG	0,3835		0,0,1632,571	180.0	167.0	172.0		344	-3.8	0.0	X		172	1,6727		0,1,2427,1872	no	missense-near-splice	ACE2	NM_021804.2	43	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	benign	115/806	15612969	1,10562	2203	4300	6503	SO:0001630	splice_region_variant	59272	exon3			CGTACCCGTTTGC	AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.345+1G>A	X.37:g.15612969C>T		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	58	33	0.568965	NM_021804	C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Missense_Mutation	SNP	ENST00000252519.3	37	CCDS14169.1	1	6.027727546714888E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	4.400	0.073831	0.08485	0.0	1.49E-4	ENSG00000130234	ENST00000252519;ENST00000427411	T;T	0.34072	1.38;1.38	6.02	-3.77	0.04346	.	0.724147	0.13392	N	0.391291	T	0.16769	0.0403	N	0.16266	0.395	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.21518	-1.0243	10	0.20046	T	0.44	-2.3109	7.4188	0.27061	0.1206:0.2584:0.0:0.6211	.	115	Q9BYF1	ACE2_HUMAN	Q	115	ENSP00000252519:R115Q;ENSP00000389326:R115Q	ENSP00000252519:R115Q	R	-	2	0	ACE2	15522890	0.018000	0.18449	0.005000	0.12908	0.151000	0.21798	0.082000	0.14847	-1.172000	0.02762	-1.013000	0.02462	CGG	C|0.999;T|0.001	0.001	strong		0.388	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055867.1		Missense_Mutation
GPR171	29909	hgsc.bcm.edu	37	3	150916504	150916504	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr3:150916504T>C	ENST00000309180.5	-	3	900	c.670A>G	c.(670-672)Aac>Gac	p.N224D	MED12L_ENST00000474524.1_Intron|MED12L_ENST00000273432.4_Intron	NM_013308.3	NP_037440.3	O14626	GP171_HUMAN	G protein-coupled receptor 171	224					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(4)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	15			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AAAAGTATGTTGATGAGAGCC	0.388																																					p.N224D		Atlas-SNP	.											.	GPR171	36	.	0			c.A670G						PASS	.						90.0	88.0	89.0					3																	150916504		2203	4300	6503	SO:0001583	missense	29909	exon3			GTATGTTGATGAG	AF002986	CCDS3155.1	3q25.1	2012-08-21			ENSG00000174946	ENSG00000174946		"""GPCR / Class A : Orphans"""	30057	protein-coding gene	gene with protein product	"""platelet activating receptor homolog"""					9370294	Standard	NM_013308		Approved	H963	uc003eyq.4	O14626	OTTHUMG00000159861	ENST00000309180.5:c.670A>G	3.37:g.150916504T>C	ENSP00000308479:p.Asn224Asp	Somatic	231	0	0		WXS	Illumina HiSeq	Phase_I	242	39	0.161157	NM_013308	D3DNJ4|Q8IV06	Missense_Mutation	SNP	ENST00000309180.5	37	CCDS3155.1	.	.	.	.	.	.	.	.	.	.	T	11.80	1.746709	0.30955	.	.	ENSG00000174946	ENST00000309180	T	0.37235	1.21	5.61	4.43	0.53597	GPCR, rhodopsin-like superfamily (1);	0.478447	0.21746	N	0.069745	T	0.38585	0.1046	L	0.58810	1.83	0.24759	N	0.992934	B	0.21905	0.062	B	0.30716	0.119	T	0.31586	-0.9938	10	0.42905	T	0.14	-9.7024	12.6935	0.56990	0.0:0.0:0.3884:0.6116	.	224	O14626	GP171_HUMAN	D	224	ENSP00000308479:N224D	ENSP00000308479:N224D	N	-	1	0	GPR171	152399194	0.979000	0.34478	0.581000	0.28614	0.653000	0.38743	2.825000	0.48096	0.910000	0.36722	0.528000	0.53228	AAC	.	.	none		0.388	GPR171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357793.1	NM_013308	
CBWD6	644019	hgsc.bcm.edu	37	9	69247582	69247582	+	Splice_Site	SNP	G	G	C	rs201502273		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr9:69247582G>C	ENST00000377457.5	-	5	536		c.e5-1		CBWD6_ENST00000382399.4_Intron|CBWD6_ENST00000377449.1_Splice_Site	NM_001085457.1	NP_001078926.1	Q4V339	CBWD6_HUMAN	COBW domain containing 6								ATP binding (GO:0005524)			lung(4)	4						GCCACTGCACGTGAAAATATA	0.289																																					.		Atlas-SNP	.											CBWD6,NS,neuroblastoma,0,1	CBWD6	19	1	0			c.431-1C>G						scavenged	.						19.0	13.0	15.0					9																	69247582		1960	3639	5599	SO:0001630	splice_region_variant	644019	exon6			CTGCACGTGAAAA		CCDS43827.1	9q13	2006-06-30			ENSG00000204790	ENSG00000204790			31978	protein-coding gene	gene with protein product							Standard	NM_001085457		Approved	OTTHUMG00000066820	uc004afj.4	Q4V339	OTTHUMG00000066820	ENST00000377457.5:c.431-1C>G	9.37:g.69247582G>C		Somatic	187	2	0.0106952		WXS	Illumina HiSeq	Phase_I	225	7	0.0311111	NM_001085457		Splice_Site	SNP	ENST00000377457.5	37	CCDS43827.1	.	.	.	.	.	.	.	.	.	.	g	8.385	0.838326	0.16891	.	.	ENSG00000204790	ENST00000377457;ENST00000377450;ENST00000377449;ENST00000377445;ENST00000536466	.	.	.	2.63	2.63	0.31362	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.326	0.37993	0.0:0.7769:0.2231:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CBWD6	68537402	1.000000	0.71417	1.000000	0.80357	0.305000	0.27757	5.187000	0.65087	0.454000	0.26884	-1.123000	0.02005	.	G|0.500;C|0.500	0.500	weak		0.289	CBWD6-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143172.2	XM_928822	Intron
ZNF880	400713	hgsc.bcm.edu	37	19	52888050	52888050	+	Missense_Mutation	SNP	A	A	G	rs76053634	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr19:52888050A>G	ENST00000422689.2	+	4	1232	c.1217A>G	c.(1216-1218)cAa>cGa	p.Q406R		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	406					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						ACGGGAGAGCAACCTTACAAA	0.398																																					p.Q406R		Atlas-SNP	.											ZNF880,colon,carcinoma,0,2	ZNF880	45	2	0			c.A1217G						scavenged	.						70.0	64.0	66.0					19																	52888050		1568	3582	5150	SO:0001583	missense	400713	exon4			GAGAGCAACCTTA	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1217A>G	19.37:g.52888050A>G	ENSP00000406318:p.Gln406Arg	Somatic	50	4	0.08		WXS	Illumina HiSeq	Phase_I	32	5	0.15625	NM_001145434	B4DNA6	Missense_Mutation	SNP	ENST00000422689.2	37	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	A	4.567	0.105370	0.08731	.	.	ENSG00000221923	ENST00000422689	T	0.15718	2.4	1.84	1.84	0.25277	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04182	0.0116	N	0.00392	-1.555	0.19775	N	0.999952	B	0.17667	0.023	B	0.23150	0.044	T	0.43360	-0.9396	8	.	.	.	.	8.4442	0.32833	1.0:0.0:0.0:0.0	.	406	Q6PDB4	ZN880_HUMAN	R	406	ENSP00000406318:Q406R	.	Q	+	2	0	ZNF880	57579862	0.002000	0.14202	0.418000	0.26571	0.177000	0.22998	0.149000	0.16243	0.834000	0.34852	0.450000	0.29827	CAA	A|0.867;G|0.133	0.133	strong		0.398	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434	
ASXL3	80816	hgsc.bcm.edu	37	18	31324277	31324277	+	Missense_Mutation	SNP	G	G	A	rs576992025		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr18:31324277G>A	ENST00000269197.5	+	12	4465	c.4465G>A	c.(4465-4467)Gtc>Atc	p.V1489I		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1489					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GTCTCTGACTGTCTCCGTTGA	0.562											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V1489I		Atlas-SNP	.											.	ASXL3	405	.	0			c.G4465A						PASS	.						47.0	50.0	49.0					18																	31324277		2202	4300	6502	SO:0001583	missense	80816	exon12			CTGACTGTCTCCG	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.4465G>A	18.37:g.31324277G>A	ENSP00000269197:p.Val1489Ile	Somatic	67	0	0	823	WXS	Illumina HiSeq	Phase_I	55	22	0.4	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.477762	0.44044	.	.	ENSG00000141431	ENST00000269197	T	0.15487	2.42	6.16	6.16	0.99307	.	.	.	.	.	T	0.13372	0.0324	L	0.27053	0.805	0.27072	N	0.963301	B	0.23540	0.087	B	0.20577	0.03	T	0.08289	-1.0729	9	0.46703	T	0.11	.	10.2745	0.43501	0.0701:0.0:0.7846:0.1453	.	1489	Q9C0F0	ASXL3_HUMAN	I	1489	ENSP00000269197:V1489I	ENSP00000269197:V1489I	V	+	1	0	ASXL3	29578275	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.272000	0.43373	2.937000	0.99478	0.650000	0.86243	GTC	.	.	none		0.562	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
PDE4DIP	9659	hgsc.bcm.edu	37	1	144857010	144857010	+	Missense_Mutation	SNP	T	T	C	rs3853916		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr1:144857010T>C	ENST00000369354.3	-	40	6664	c.6475A>G	c.(6475-6477)Acc>Gcc	p.T2159A	PDE4DIP_ENST00000369359.4_Missense_Mutation_p.T2295A|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.T2159A|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.T2053A|RP4-791M13.4_ENST00000532137.1_RNA|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.T2244A|PDE4DIP_ENST00000524974.1_5'UTR			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	2159					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.T2159A(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TTGGGAGGGGTCTTCATTACT	0.443			T	PDGFRB	MPD																																p.T2159A		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	PDE4DIP,NS,carcinoma,0,1	PDE4DIP	817	1	1	Substitution - Missense(1)	prostate(1)	c.A6475G						scavenged	.						76.0	72.0	74.0					1																	144857010		2203	4296	6499	SO:0001583	missense	9659	exon40			GAGGGGTCTTCAT	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.6475A>G	1.37:g.144857010T>C	ENSP00000358360:p.Thr2159Ala	Somatic	557	6	0.010772		WXS	Illumina HiSeq	Phase_I	562	12	0.0213523	NM_014644	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	.	12.27	1.889088	0.33348	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.01613	4.73;4.83;4.84;4.84;4.84	4.16	-0.82	0.10826	.	.	.	.	.	T	0.00637	0.0021	L	0.40543	1.245	0.09310	N	1	B;B	0.18461	0.015;0.028	B;B	0.12837	0.006;0.008	T	0.41893	-0.9483	9	0.49607	T	0.09	.	7.8317	0.29347	0.0:0.3889:0.0:0.6111	rs3853916;rs4067557	2053;2159	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	A	2053;2159;2159;2244;2295	ENSP00000327209:T2053A;ENSP00000358360:T2159A;ENSP00000358363:T2159A;ENSP00000435654:T2244A;ENSP00000358366:T2295A	ENSP00000327209:T2053A	T	-	1	0	PDE4DIP	143568367	0.002000	0.14202	0.005000	0.12908	0.631000	0.37964	-0.164000	0.09983	-0.097000	0.12307	0.369000	0.22263	ACC	.	.	weak		0.443	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
FCGBP	8857	hgsc.bcm.edu	37	19	40376323	40376323	+	Missense_Mutation	SNP	A	A	G	rs377439998		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr19:40376323A>G	ENST00000221347.6	-	25	11988	c.11981T>C	c.(11980-11982)gTc>gCc	p.V3994A	FCGBP_ENST00000595713.1_5'Flank	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3994	Cys-rich.					extracellular vesicular exosome (GO:0070062)		p.V3994A(3)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CTCATAGTAGACACCATTGTG	0.562																																					p.V3994A		Atlas-SNP	.											FCGBP,NS,carcinoma,0,3	FCGBP	416	3	3	Substitution - Missense(3)	endometrium(2)|upper_aerodigestive_tract(1)	c.T11981C						scavenged	.						65.0	59.0	61.0					19																	40376323		2199	4300	6499	SO:0001583	missense	8857	exon25			TAGTAGACACCAT	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.11981T>C	19.37:g.40376323A>G	ENSP00000221347:p.Val3994Ala	Somatic	67	3	0.0447761		WXS	Illumina HiSeq	Phase_I	64	5	0.078125	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	a	2.731	-0.264330	0.05754	.	.	ENSG00000090920	ENST00000221347	T	0.04360	3.64	3.4	-5.71	0.02413	von Willebrand factor, type C (1);	.	.	.	.	T	0.02418	0.0074	N	0.20483	0.58	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.49322	-0.8952	9	0.09590	T	0.72	.	7.1668	0.25695	0.2551:0.2893:0.4556:0.0	.	3994	Q9Y6R7	FCGBP_HUMAN	A	3994	ENSP00000221347:V3994A	ENSP00000221347:V3994A	V	-	2	0	FCGBP	45068163	0.000000	0.05858	0.034000	0.17996	0.099000	0.18886	1.012000	0.29924	-0.821000	0.04312	-0.850000	0.03035	GTC	.	.	weak		0.562	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
LAMA1	284217	hgsc.bcm.edu	37	18	6978310	6978310	+	Silent	SNP	C	C	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr18:6978310C>T	ENST00000389658.3	-	43	6168	c.6075G>A	c.(6073-6075)acG>acA	p.T2025T		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2025	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CGTCCCTCAGCGTGCTCACCG	0.537																																					p.T2025T		Atlas-SNP	.											LAMA1,NS,carcinoma,-1,1	LAMA1	458	1	0			c.G6075A						PASS	.						113.0	102.0	106.0					18																	6978310		2203	4300	6503	SO:0001819	synonymous_variant	284217	exon43			CCTCAGCGTGCTC	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.6075G>A	18.37:g.6978310C>T		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	151	29	0.192053	NM_005559		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																			.	.	none		0.537	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
MLXIP	22877	hgsc.bcm.edu	37	12	122612486	122612486	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr12:122612486G>T	ENST00000319080.7	+	3	709	c.577G>T	c.(577-579)Gtg>Ttg	p.V193L						MLX interacting protein											NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		GGACGGCTCTGTGGACGTAGA	0.607																																					p.V193L	Esophageal Squamous(105;787 1493 16200 18566 52466)	Atlas-SNP	.											.	MLXIP	46	.	0			c.G577T						PASS	.						113.0	120.0	118.0					12																	122612486		2014	4189	6203	SO:0001583	missense	22877	exon3			GGCTCTGTGGACG	AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.577G>T	12.37:g.122612486G>T	ENSP00000312834:p.Val193Leu	Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	41	13	0.317073	NM_014938		Missense_Mutation	SNP	ENST00000319080.7	37		.	.	.	.	.	.	.	.	.	.	G	22.8	4.334205	0.81801	.	.	ENSG00000175727	ENST00000319080	T	0.14766	2.48	5.53	5.53	0.82687	.	0.068042	0.64402	D	0.000013	T	0.27524	0.0676	.	.	.	0.80722	D	1	P	0.49961	0.93	P	0.49887	0.625	T	0.00697	-1.1605	9	0.59425	D	0.04	-19.7812	19.4566	0.94895	0.0:0.0:1.0:0.0	.	193	Q9HAP2	MLXIP_HUMAN	L	193	ENSP00000312834:V193L	ENSP00000312834:V193L	V	+	1	0	MLXIP	121178440	0.989000	0.36119	0.990000	0.47175	0.674000	0.39518	1.896000	0.39789	2.590000	0.87494	0.655000	0.94253	GTG	.	.	none		0.607	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401718.2	NM_014938	
LILRA1	11024	hgsc.bcm.edu	37	19	55106239	55106239	+	Silent	SNP	G	G	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr19:55106239G>A	ENST00000251372.3	+	4	362	c.180G>A	c.(178-180)ctG>ctA	p.L60L	LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron|LILRA1_ENST00000453777.1_Silent_p.L60L	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	60	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)	p.L60L(3)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		AGTACCGTCTGTATAGAGAAA	0.572																																					p.L60L		Atlas-SNP	.											LILRA1,NS,carcinoma,0,3	LILRA1	105	3	3	Substitution - coding silent(3)	kidney(3)	c.G180A						scavenged	.						124.0	119.0	121.0					19																	55106239		2203	4300	6503	SO:0001819	synonymous_variant	11024	exon4			CCGTCTGTATAGA	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.180G>A	19.37:g.55106239G>A		Somatic	116	1	0.00862069		WXS	Illumina HiSeq	Phase_I	94	7	0.0744681	NM_006863	O75018|Q3MJA6	Silent	SNP	ENST00000251372.3	37	CCDS12901.1																																																																																			.	.	none		0.572	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863	
KLHL6	89857	hgsc.bcm.edu	37	3	183273174	183273174	+	Missense_Mutation	SNP	G	G	A	rs548549593	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr3:183273174G>A	ENST00000341319.3	-	1	303	c.268C>T	c.(268-270)Ctt>Ttt	p.L90F		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	90	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			GCTGCGGCAAGCACCACGCGG	0.507													G|||	2	0.000399361	0.0015	0.0	5008	,	,		15549	0.0		0.0	False		,,,				2504	0.0				p.L90F		Atlas-SNP	.											.	KLHL6	100	.	0			c.C268T						PASS	.						99.0	89.0	92.0					3																	183273174		2203	4300	6503	SO:0001583	missense	89857	exon1			CGGCAAGCACCAC	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.268C>T	3.37:g.183273174G>A	ENSP00000341342:p.Leu90Phe	Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	152	66	0.434211	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	G	28.2	4.901455	0.92035	.	.	ENSG00000172578	ENST00000341319	D	0.89681	-2.55	5.56	5.56	0.83823	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.96876	0.8980	H	0.97659	4.05	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98014	1.0367	10	0.87932	D	0	.	19.5245	0.95199	0.0:0.0:1.0:0.0	.	90	Q8WZ60	KLHL6_HUMAN	F	90	ENSP00000341342:L90F	ENSP00000341342:L90F	L	-	1	0	KLHL6	184755868	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.900000	0.87376	2.608000	0.88229	0.655000	0.94253	CTT	.	.	none		0.507	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
KMT2D	8085	hgsc.bcm.edu	37	12	49435033	49435033	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr12:49435033G>A	ENST00000301067.7	-	31	6519	c.6520C>T	c.(6520-6522)Cag>Tag	p.Q2174*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2174	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q2174*(1)|p.Q1904*(1)									AAGGGGTCCTGCGAAGGCACT	0.706																																					p.Q2174X		Atlas-SNP	.											MLL2_ENST00000301067,NS,lymphoid_neoplasm,0,2	MLL2	1173	2	2	Substitution - Nonsense(2)	haematopoietic_and_lymphoid_tissue(2)	c.C6520T						PASS	.						6.0	9.0	8.0					12																	49435033		1816	3965	5781	SO:0001587	stop_gained	8085	exon31			GGTCCTGCGAAGG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.6520C>T	12.37:g.49435033G>A	ENSP00000301067:p.Gln2174*	Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	29	10	0.344828	NM_003482	O14687	Nonsense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	45	11.616333	0.99583	.	.	ENSG00000167548	ENST00000301067	.	.	.	4.09	4.09	0.47781	.	0.000000	0.31381	N	0.007760	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.9318	0.79668	0.0:0.0:1.0:0.0	.	.	.	.	X	2174	.	ENSP00000301067:Q2174X	Q	-	1	0	MLL2	47721300	0.995000	0.38212	1.000000	0.80357	0.891000	0.51852	2.306000	0.43673	2.210000	0.71456	0.561000	0.74099	CAG	.	.	none		0.706	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
PRKG1	5592	hgsc.bcm.edu	37	10	54048530	54048530	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr10:54048530T>C	ENST00000401604.2	+	15	1903	c.1709T>C	c.(1708-1710)aTa>aCa	p.I570T	PRKG1-AS1_ENST00000426785.2_RNA|PRKG1_ENST00000373975.2_Missense_Mutation_p.I288T|PRKG1_ENST00000373985.1_Missense_Mutation_p.I558T|PRKG1_ENST00000373980.4_Missense_Mutation_p.I585T|PRKG1-AS1_ENST00000452247.2_RNA			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	570	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		TATAACATCATATTGAGGGGG	0.348																																					p.I585T		Atlas-SNP	.											.	PRKG1	167	.	0			c.T1754C						PASS	.						100.0	103.0	102.0					10																	54048530		2203	4300	6503	SO:0001583	missense	5592	exon15			ACATCATATTGAG		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.1709T>C	10.37:g.54048530T>C	ENSP00000384200:p.Ile570Thr	Somatic	167	0	0		WXS	Illumina HiSeq	Phase_I	136	33	0.242647	NM_006258	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	ENST00000401604.2	37	CCDS44399.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.377284	0.82682	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000332193;ENST00000373975	T;T;T	0.11821	2.74;2.74;2.74	5.26	5.26	0.73747	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.36963	0.0986	M	0.85299	2.745	0.80722	D	1	P;D;D	0.56521	0.806;0.97;0.976	P;P;P	0.57283	0.702;0.721;0.817	T	0.37572	-0.9700	10	0.66056	D	0.02	-16.6233	14.8289	0.70132	0.0:0.0:0.0:1.0	.	288;585;570	B3KSF3;Q13976-2;Q13976	.;.;KGP1_HUMAN	T	570;558;585;288;182	ENSP00000384200:I570T;ENSP00000363097:I558T;ENSP00000363092:I585T	ENSP00000327642:I288T	I	+	2	0	PRKG1	53718536	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	8.040000	0.89188	1.978000	0.57642	0.533000	0.62120	ATA	.	.	none		0.348	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ABCA1	19	hgsc.bcm.edu	37	9	107571802	107571802	+	Missense_Mutation	SNP	C	C	T	rs189206655		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr9:107571802C>T	ENST00000374736.3	-	30	4613	c.4219G>A	c.(4219-4221)Gcc>Acc	p.A1407T		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1407			A -> T (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.A1407T(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	TTGGTGAGGGCGTTTAAGAGT	0.517													C|||	1	0.000199681	0.0	0.0014	5008	,	,		14853	0.0		0.0	False		,,,				2504	0.0				p.A1407T		Atlas-SNP	.											ABCA1,caecum,carcinoma,0,4	ABCA1	244	4	1	Substitution - Missense(1)	large_intestine(1)	c.G4219A						scavenged	.						110.0	106.0	107.0					9																	107571802		2203	4300	6503	SO:0001583	missense	19	exon30			TGAGGGCGTTTAA	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.4219G>A	9.37:g.107571802C>T	ENSP00000363868:p.Ala1407Thr	Somatic	169	1	0.00591716		WXS	Illumina HiSeq	Phase_I	136	22	0.161765	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	18.47	3.630940	0.67015	.	.	ENSG00000165029	ENST00000374736	D	0.95949	-3.86	5.68	5.68	0.88126	.	0.046614	0.85682	D	0.000000	D	0.93979	0.8072	L	0.49699	1.58	0.80722	D	1	B	0.24186	0.099	B	0.30716	0.119	D	0.90832	0.4717	10	0.18276	T	0.48	.	19.8476	0.96716	0.0:1.0:0.0:0.0	.	1407	O95477	ABCA1_HUMAN	T	1407	ENSP00000363868:A1407T	ENSP00000363868:A1407T	A	-	1	0	ABCA1	106611623	0.995000	0.38212	0.947000	0.38551	0.336000	0.28762	3.225000	0.51246	2.704000	0.92352	0.650000	0.86243	GCC	C|1.000;T|0.000	0.000	strong		0.517	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
LAMA3	3909	hgsc.bcm.edu	37	18	21508671	21508671	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr18:21508671C>T	ENST00000313654.9	+	64	8619	c.8378C>T	c.(8377-8379)gCc>gTc	p.A2793V	LAMA3_ENST00000399516.3_Missense_Mutation_p.A2737V|LAMA3_ENST00000269217.6_Missense_Mutation_p.A1184V|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000587184.1_Missense_Mutation_p.A1128V	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2793	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CACCTCCAGGCCTCATTTGGA	0.428																																					p.A2793V		Atlas-SNP	.											.	LAMA3	397	.	0			c.C8378T						PASS	.						188.0	161.0	170.0					18																	21508671		2203	4300	6503	SO:0001583	missense	3909	exon64			TCCAGGCCTCATT	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8378C>T	18.37:g.21508671C>T	ENSP00000324532:p.Ala2793Val	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	174	20	0.114943	NM_198129	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	C	6.801	0.516865	0.13005	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.14766	2.48;2.48;2.48	5.84	3.09	0.35607	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	.	.	.	.	T	0.08268	0.0206	L	0.33485	1.01	0.24198	N	0.995527	P;P;B;B	0.40431	0.666;0.717;0.002;0.028	B;B;B;B	0.37480	0.194;0.251;0.004;0.01	T	0.13361	-1.0512	9	0.05959	T	0.93	.	7.515	0.27596	0.0:0.659:0.0:0.341	.	1128;1184;2737;2793	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	V	2793;2737;1184	ENSP00000324532:A2793V;ENSP00000382432:A2737V;ENSP00000269217:A1184V	ENSP00000269217:A1184V	A	+	2	0	LAMA3	19762669	0.827000	0.29292	0.996000	0.52242	0.815000	0.46073	0.444000	0.21661	0.378000	0.24764	-0.136000	0.14681	GCC	.	.	none		0.428	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
PTCHD3	374308	hgsc.bcm.edu	37	10	27703150	27703150	+	Silent	SNP	C	C	T	rs369428695		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr10:27703150C>T	ENST00000438700.3	-	1	147	c.30G>A	c.(28-30)ccG>ccA	p.P10P		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	10					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						GCTCCGGCCCCGGCCTGGGCT	0.622																																					p.P10P		Atlas-SNP	.											.	PTCHD3	140	.	0			c.G30A						PASS	.	C		1,4405	2.1+/-5.4	0,1,2202	42.0	51.0	48.0		30	-0.9	0.0	10		48	0,8598		0,0,4299	no	coding-synonymous	PTCHD3	NM_001034842.3		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		10/768	27703150	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	374308	exon1			CGGCCCCGGCCTG	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.30G>A	10.37:g.27703150C>T		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	55	18	0.327273	NM_001034842	I3L499|Q6ZU28	Silent	SNP	ENST00000438700.3	37	CCDS31173.1																																																																																			.	.	none		0.622	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
BRAP	8315	hgsc.bcm.edu	37	12	112103531	112103531	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr12:112103531G>A	ENST00000327551.6	-	6	858	c.718C>T	c.(718-720)Cgc>Tgc	p.R240C	BRAP_ENST00000419234.4_Missense_Mutation_p.R270C|BRAP_ENST00000539060.1_Missense_Mutation_p.R91C			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						TCGTCCATGCGCTCCAGACAC	0.557																																					p.R270C	Pancreas(146;846 1904 7830 25130 26065)	Atlas-SNP	.											.	BRAP	42	.	0			c.C808T						PASS	.						161.0	105.0	124.0					12																	112103531		2203	4300	6503	SO:0001583	missense	8315	exon6			CCATGCGCTCCAG	AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.718C>T	12.37:g.112103531G>A	ENSP00000330813:p.Arg240Cys	Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	78	17	0.217949	NM_006768	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	ENST00000327551.6	37		.	.	.	.	.	.	.	.	.	.	G	19.21	3.783685	0.70222	.	.	ENSG00000089234	ENST00000419234;ENST00000539060;ENST00000327551;ENST00000547043	T;T;T	0.43294	0.95;0.95;0.95	5.22	4.25	0.50352	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	T	0.53190	0.1781	L	0.35593	1.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.993;0.997	T	0.57493	-0.7802	10	0.87932	D	0	-12.2466	14.8944	0.70633	0.0:0.0:0.8067:0.1933	.	91;270	B4DRM1;Q7Z569	.;BRAP_HUMAN	C	270;91;240;52	ENSP00000403524:R270C;ENSP00000441659:R91C;ENSP00000330813:R240C	ENSP00000330813:R240C	R	-	1	0	BRAP	110587914	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	3.515000	0.53429	2.431000	0.82371	0.305000	0.20034	CGC	.	.	none		0.557	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404994.2		
MT-CYB	4519	hgsc.bcm.edu	37	M	15172	15172	+	Silent	SNP	G	G	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chrM:15172G>A	ENST00000361789.2	+	1	426	c.426G>A	c.(424-426)ggG>ggA	p.G142G	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	142					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						TCATTCTGAGGGGCCACAGTA	0.473											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.G142G		Atlas-SNP	.											.	.	.	.	0			c.G426A						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			CTGAGGGGCCACA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.426G>A	M.37:g.15172G>A		Somatic	6	0	0	585	WXS	Illumina HiSeq	Phase_I	8	4	0.5	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Silent	SNP	ENST00000361789.2	37																																																																																				.	.	none		0.473	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
UBC	7316	hgsc.bcm.edu	37	12	125397358	125397358	+	Silent	SNP	T	T	C			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr12:125397358T>C	ENST00000536769.1	-	1	2536	c.960A>G	c.(958-960)gaA>gaG	p.E320E	MIR5188_ENST00000583467.1_RNA|UBC_ENST00000546120.1_Silent_p.E244E|UBC_ENST00000339647.5_Silent_p.E320E|UBC_ENST00000538617.1_Intron|UBC_ENST00000536661.1_5'Flank			P0CG48	UBC_HUMAN	ubiquitin C	320	Ubiquitin-like 5. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)	p.E320E(1)		breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		TCGGCTCCACTTCGAGAGTGA	0.522																																					p.E320E		Atlas-SNP	.											UBC,NS,carcinoma,0,2	UBC	79	2	1	Substitution - coding silent(1)	prostate(1)	c.A960G						scavenged	.						92.0	81.0	85.0					12																	125397358		2202	4282	6484	SO:0001819	synonymous_variant	7316	exon2			CTCCACTTCGAGA		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000536769.1:c.960A>G	12.37:g.125397358T>C		Somatic	465	6	0.0129032		WXS	Illumina HiSeq	Phase_I	377	6	0.0159151	NM_021009	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	ENST00000536769.1	37	CCDS9260.1																																																																																			.	.	none		0.522	UBC-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400177.1	NM_021009	
TRIM48	79097	hgsc.bcm.edu	37	11	55032663	55032663	+	Missense_Mutation	SNP	T	T	C	rs200778682	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr11:55032663T>C	ENST00000417545.2	+	2	418	c.332T>C	c.(331-333)aTt>aCt	p.I111T		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	95						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						ATGTGTGGCATTCACAGGGAG	0.498																																					p.I111T		Atlas-SNP	.											TRIM48_ENST00000417545,NS,carcinoma,0,4	TRIM48	149	4	0			c.T332C						scavenged	.						98.0	90.0	93.0					11																	55032663		2188	4256	6444	SO:0001583	missense	79097	exon2			GTGGCATTCACAG	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.332T>C	11.37:g.55032663T>C	ENSP00000402414:p.Ile111Thr	Somatic	621	9	0.0144928		WXS	Illumina HiSeq	Phase_I	499	12	0.0240481	NM_024114	Q9BUW4	Missense_Mutation	SNP	ENST00000417545.2	37	CCDS7947.2	.	.	.	.	.	.	.	.	.	.	c	0	-2.612529	0.00120	.	.	ENSG00000150244	ENST00000417545	T	0.40476	1.03	0.596	0.596	0.17496	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, B-box (3);	.	.	.	.	T	0.13114	0.0318	N	0.03324	-0.35	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28038	-1.0056	9	0.02654	T	1	.	1.7225	0.02915	0.3221:0.4182:0.0:0.2597	.	95	Q8IWZ4	TRI48_HUMAN	T	111	ENSP00000402414:I111T	ENSP00000402414:I111T	I	+	2	0	TRIM48	54789239	0.000000	0.05858	0.154000	0.22540	0.130000	0.20726	-4.117000	0.00292	-0.174000	0.10743	-1.141000	0.01876	ATT	T|0.996;C|0.004	0.004	strong		0.498	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1		
MUC4	4585	hgsc.bcm.edu	37	3	195511911	195511911	+	Silent	SNP	G	G	A	rs200732241		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr3:195511911G>A	ENST00000463781.3	-	2	6999	c.6540C>T	c.(6538-6540)acC>acT	p.T2180T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.T2180T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T2180T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAA	0.587																																					p.T2180T		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	2	Substitution - coding silent(2)	endometrium(2)	c.C6540T						scavenged	.						8.0	14.0	12.0					3																	195511911		633	1518	2151	SO:0001819	synonymous_variant	4585	exon2			AGTGTCGGTGACA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6540C>T	3.37:g.195511911G>A		Somatic	126	5	0.0396825		WXS	Illumina HiSeq	Phase_I	129	3	0.0232558	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			G|0.998;A|0.002	0.002	weak		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ZNF799	90576	hgsc.bcm.edu	37	19	12501466	12501466	+	Silent	SNP	A	A	G			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr19:12501466A>G	ENST00000430385.3	-	4	1946	c.1746T>C	c.(1744-1746)caT>caC	p.H582H	ZNF799_ENST00000419318.1_Silent_p.H550H|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	582					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						TCTCTCCAGTATGAGTTTTTT	0.393																																					p.H582H		Atlas-SNP	.											ZNF799_ENST00000430385,NS,malignant_melanoma,0,2	ZNF799	111	2	0			c.T1746C						scavenged	.						74.0	78.0	76.0					19																	12501466		2202	4295	6497	SO:0001819	synonymous_variant	90576	exon4			TCCAGTATGAGTT	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1746T>C	19.37:g.12501466A>G		Somatic	360	1	0.00277778		WXS	Illumina HiSeq	Phase_I	317	4	0.0126183	NM_001080821		Silent	SNP	ENST00000430385.3	37	CCDS45989.1																																																																																			.	.	none		0.393	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821	
NCOA3	8202	hgsc.bcm.edu	37	20	46254225	46254225	+	Splice_Site	SNP	G	G	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr20:46254225G>T	ENST00000371998.3	+	5	548	c.357G>T	c.(355-357)caG>caT	p.Q119H	NCOA3_ENST00000371997.3_Splice_Site_p.Q119H|NCOA3_ENST00000372004.3_Splice_Site_p.Q119H|NCOA3_ENST00000341724.6_Splice_Site_p.Q119H			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	119	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TTTTACTTCAGGCAAGTATAA	0.343																																					p.Q119H		Atlas-SNP	.											.	NCOA3	156	.	0			c.G357T						PASS	.						76.0	71.0	73.0					20																	46254225		2203	4300	6503	SO:0001630	splice_region_variant	8202	exon5			ACTTCAGGCAAGT	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.357+1G>T	20.37:g.46254225G>T		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	83	4	0.0481928	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	ENST00000371998.3	37	CCDS13407.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672296	0.88348	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.02606	4.23;4.39;4.39;4.24	5.62	5.62	0.85841	PAS (2);PAS fold (1);	0.000000	0.85682	D	0.000000	T	0.18425	0.0442	M	0.79926	2.475	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.998;0.983;0.998	T	0.00077	-1.2116	10	0.87932	D	0	-11.5155	19.6585	0.95853	0.0:0.0:1.0:0.0	.	119;123;119;119;119	Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;NCOA3_HUMAN	H	119	ENSP00000342123:Q119H;ENSP00000361073:Q119H;ENSP00000361066:Q119H;ENSP00000361065:Q119H	ENSP00000345671:Q119H	Q	+	3	2	NCOA3	45687632	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	8.004000	0.88535	2.657000	0.90304	0.467000	0.42956	CAG	.	.	none		0.343	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	Missense_Mutation
COLEC12	81035	hgsc.bcm.edu	37	18	333015	333015	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr18:333015C>T	ENST00000400256.3	-	7	2152	c.1945G>A	c.(1945-1947)Gag>Aag	p.E649K		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	649	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				ACCTGTTCCTCTCTAGTGTTT	0.368																																					p.E649K		Atlas-SNP	.											.	COLEC12	121	.	0			c.G1945A						PASS	.						75.0	81.0	79.0					18																	333015		2203	4300	6503	SO:0001583	missense	81035	exon7			GTTCCTCTCTAGT	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.1945G>A	18.37:g.333015C>T	ENSP00000383115:p.Glu649Lys	Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	172	20	0.116279	NM_130386	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	ENST00000400256.3	37	CCDS32782.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318823	0.81469	.	.	ENSG00000158270	ENST00000400256	T	0.20598	2.06	5.68	5.68	0.88126	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.85682	D	0.000000	T	0.27063	0.0663	M	0.74881	2.28	0.80722	D	1	P	0.41008	0.735	B	0.38156	0.266	T	0.02877	-1.1099	10	0.39692	T	0.17	-25.494	14.0139	0.64513	0.0:0.9279:0.0:0.0721	.	649	Q5KU26	COL12_HUMAN	K	649	ENSP00000383115:E649K	ENSP00000383115:E649K	E	-	1	0	COLEC12	323015	1.000000	0.71417	0.959000	0.39883	0.647000	0.38526	5.691000	0.68249	2.686000	0.91538	0.650000	0.86243	GAG	.	.	none		0.368	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1		
NCOA3	8202	hgsc.bcm.edu	37	20	46279839	46279839	+	Silent	SNP	G	G	A	rs147879509|rs2664555|rs397778717|rs3830809		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr20:46279839G>A	ENST00000371998.3	+	20	3956	c.3765G>A	c.(3763-3765)caG>caA	p.Q1255Q	NCOA3_ENST00000371997.3_Silent_p.Q1246Q|NCOA3_ENST00000372004.3_Silent_p.Q1251Q|NCOA3_ENST00000341724.6_Silent_p.Q1181Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1255	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q1255delQ(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						agcagcaacagcagcagcagc	0.557																																					p.Q1255Q		Atlas-SNP	.											NCOA3,rectum,carcinoma,0,1	NCOA3	156	1	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.G3765A						scavenged	.						41.0	44.0	43.0					20																	46279839		2202	4300	6502	SO:0001819	synonymous_variant	8202	exon20			GCAACAGCAGCAG	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3765G>A	20.37:g.46279839G>A		Somatic	53	1	0.0188679		WXS	Illumina HiSeq	Phase_I	61	11	0.180328	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																			.	.	weak		0.557	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
MAGI2	9863	hgsc.bcm.edu	37	7	79082348	79082348	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr7:79082348A>T	ENST00000354212.4	-	1	542	c.289T>A	c.(289-291)Tgt>Agt	p.C97S	MAGI2-AS3_ENST00000446159.1_RNA|MAGI2-AS3_ENST00000429408.1_RNA|MAGI2-AS3_ENST00000448195.1_RNA|MAGI2-AS3_ENST00000422093.1_RNA|MAGI2-AS3_ENST00000424477.1_RNA|MAGI2_ENST00000522391.1_Missense_Mutation_p.C97S|MAGI2-AS3_ENST00000414797.1_RNA|MAGI2-AS3_ENST00000426835.1_RNA|MAGI2_ENST00000419488.1_Missense_Mutation_p.C97S|MAGI2-AS3_ENST00000451809.1_RNA	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	97	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TGCTTGACACACTTGAGCCGG	0.647																																					p.C97S		Atlas-SNP	.											.	MAGI2	246	.	0			c.T289A						PASS	.						45.0	48.0	47.0					7																	79082348		2203	4300	6503	SO:0001583	missense	9863	exon1			TGACACACTTGAG	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.289T>A	7.37:g.79082348A>T	ENSP00000346151:p.Cys97Ser	Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	27	12	0.444444	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	A	18.90	3.720746	0.68959	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.10005	3.03;3.03;2.92	5.39	5.39	0.77823	PDZ/DHR/GLGF (3);	.	.	.	.	T	0.15435	0.0372	L	0.50919	1.6	0.80722	D	1	P;P	0.49358	0.923;0.454	P;B	0.48454	0.578;0.192	T	0.01739	-1.1284	9	0.35671	T	0.21	.	10.6966	0.45903	0.8401:0.1599:0.0:0.0	.	97;97	Q86UL8-2;Q86UL8	.;MAGI2_HUMAN	S	97	ENSP00000405766:C97S;ENSP00000346151:C97S;ENSP00000428389:C97S	ENSP00000346151:C97S	C	-	1	0	MAGI2	78920284	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.133000	0.77259	2.033000	0.60031	0.402000	0.26972	TGT	.	.	none		0.647	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
MUC21	394263	hgsc.bcm.edu	37	6	30955191	30955191	+	Silent	SNP	G	G	C	rs56644482		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr6:30955191G>C	ENST00000376296.3	+	2	1480	c.1239G>C	c.(1237-1239)gtG>gtC	p.V413V	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	413	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAGCACAGTGTCCAGTGGGG	0.627																																					p.V413V		Atlas-SNP	.											MUC21,NS,carcinoma,0,2	MUC21	98	2	0			c.G1239C						scavenged	.						145.0	140.0	142.0					6																	30955191		2203	4300	6503	SO:0001819	synonymous_variant	394263	exon2			CACAGTGTCCAGT	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1239G>C	6.37:g.30955191G>C		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	48	3	0.0625	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																			.	.	none		0.627	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
CLCN1	1180	hgsc.bcm.edu	37	7	143049009	143049009	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr7:143049009C>T	ENST00000343257.2	+	23	3005	c.2918C>T	c.(2917-2919)cCc>cTc	p.P973L		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	973					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					TTGCAGGGCCCCAGCCTGCGA	0.632																																					p.P973L		Atlas-SNP	.											.	CLCN1	141	.	0			c.C2918T						PASS	.						76.0	77.0	77.0					7																	143049009		2203	4300	6503	SO:0001583	missense	1180	exon23			AGGGCCCCAGCCT	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.2918C>T	7.37:g.143049009C>T	ENSP00000339867:p.Pro973Leu	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	102	16	0.156863	NM_000083	A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.392032	0.62066	.	.	ENSG00000188037	ENST00000343257	D	0.85088	-1.94	4.49	4.49	0.54785	.	0.191462	0.34002	N	0.004352	D	0.89008	0.6593	M	0.62723	1.935	0.43065	D	0.994695	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.88115	0.2828	10	0.46703	T	0.11	.	7.2092	0.25925	0.0:0.8406:0.0:0.1594	.	172;973	Q75L28;P35523	.;CLCN1_HUMAN	L	973	ENSP00000339867:P973L	ENSP00000339867:P973L	P	+	2	0	CLCN1	142759131	0.998000	0.40836	1.000000	0.80357	0.974000	0.67602	2.063000	0.41423	2.202000	0.70862	0.561000	0.74099	CCC	.	.	none		0.632	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	
POF1B	79983	hgsc.bcm.edu	37	X	84586012	84586012	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chrX:84586012C>T	ENST00000262753.4	-	7	942	c.797G>A	c.(796-798)cGt>cAt	p.R266H	POF1B_ENST00000373145.3_Missense_Mutation_p.R266H	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	266						tight junction (GO:0005923)				central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						CGTATTCTTACGGCTCAGATC	0.383																																					p.R266H		Atlas-SNP	.											.	POF1B	77	.	0			c.G797A						PASS	.						108.0	91.0	97.0					X																	84586012		2203	4300	6503	SO:0001583	missense	79983	exon7			TTCTTACGGCTCA	BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.797G>A	X.37:g.84586012C>T	ENSP00000262753:p.Arg266His	Somatic	200	0	0		WXS	Illumina HiSeq	Phase_I	185	93	0.502703	NM_024921	A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Missense_Mutation	SNP	ENST00000262753.4	37	CCDS14452.1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.365477	0.61513	.	.	ENSG00000124429	ENST00000262753;ENST00000373145;ENST00000276124	T;T	0.26067	1.76;1.76	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.48466	0.1501	L	0.58101	1.795	0.53688	D	0.999974	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.41680	-0.9495	10	0.54805	T	0.06	-0.0188	16.0996	0.81163	0.0:1.0:0.0:0.0	.	266;266	Q8WVV4-1;Q8WVV4	.;POF1B_HUMAN	H	266	ENSP00000262753:R266H;ENSP00000362238:R266H	ENSP00000262753:R266H	R	-	2	0	POF1B	84472668	1.000000	0.71417	0.845000	0.33349	0.209000	0.24338	4.530000	0.60595	2.404000	0.81709	0.600000	0.82982	CGT	.	.	none		0.383	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057391.2	NM_024921	
GRIA3	2892	hgsc.bcm.edu	37	X	122336604	122336604	+	Intron	SNP	C	C	G	rs72609489		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chrX:122336604C>G	ENST00000371251.1	+	2	320				GRIA3_ENST00000541091.1_Intron|GRIA3_ENST00000371264.3_Missense_Mutation_p.P129A|GRIA3_ENST00000371266.1_Missense_Mutation_p.P129A|GRIA3_ENST00000264357.5_Intron|GRIA3_ENST00000542149.1_Intron|GRIA3_ENST00000479118.1_Intron|GRIA3_ENST00000371256.5_Intron			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3						glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	ACCAGGTGGGCCCGCCAAAAC	0.502																																					p.P129A		Atlas-SNP	.											.	GRIA3	386	.	0			c.C385G						PASS	.																																			SO:0001627	intron_variant	2892	exon3			GGTGGGCCCGCCA	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.268+16762C>G	X.37:g.122336604C>G		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	62	5	0.0806452	NM_001256743	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	37	CCDS14604.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.14|13.14	2.147978|2.147978	0.37923|0.37923	.|.	.|.	ENSG00000125675|ENSG00000125675	ENST00000335161|ENST00000371266;ENST00000371264	.|.	.|.	.|.	4.06|4.06	-2.54|-2.54	0.06307|0.06307	.|.	.|.	.|.	.|.	.|.	.|T	.|0.25717	.|0.0626	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	.|T	.|0.25257	.|-1.0137	.|7	.|0.87932	.|D	.|0	.|.	2.4135|2.4135	0.04430|0.04430	0.1408:0.2377:0.4271:0.1944|0.1408:0.2377:0.4271:0.1944	rs11452643|rs11452643	.|129	.|Q4TT43	.|.	.|A	-1|129	.|.	.|ENSP00000360311:P129A	.|P	+|+	.|1	.|0	GRIA3|GRIA3	122164285|122164285	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.010000|0.010000	0.07245|0.07245	-0.972000|-0.972000	0.03802|0.03802	-0.750000|-0.750000	0.04740|0.04740	-0.278000|-0.278000	0.10074|0.10074	.|CCC	.	.	weak		0.502	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	
SPANXN2	494119	hgsc.bcm.edu	37	X	142795338	142795338	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chrX:142795338C>A	ENST00000370498.1	-	2	1093	c.340G>T	c.(340-342)Gac>Tac	p.D114Y		NM_001009615.1	NP_001009615.1	Q5MJ10	SPXN2_HUMAN	SPANX family, member N2	114										NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)					GAGTCCAGGTCTTCGTCCTCC	0.527																																					p.D114Y		Atlas-SNP	.											.	SPANXN2	67	.	0			c.G340T						PASS	.						56.0	53.0	54.0					X																	142795338		2199	4293	6492	SO:0001583	missense	494119	exon2			CCAGGTCTTCGTC		CCDS35419.1	Xq27.3	2012-06-12			ENSG00000203924	ENSG00000268988			33175	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 7"""	300665				14973187, 17012309	Standard	NM_001009615		Approved	SPANX-N2, CT11.7	uc004fbz.3	Q5MJ10	OTTHUMG00000022583	ENST00000370498.1:c.340G>T	X.37:g.142795338C>A	ENSP00000359529:p.Asp114Tyr	Somatic	183	0	0		WXS	Illumina HiSeq	Phase_I	139	37	0.266187	NM_001009615	Q0ZNM2	Missense_Mutation	SNP	ENST00000370498.1	37	CCDS35419.1	.	.	.	.	.	.	.	.	.	.	c	4.402	0.074349	0.08485	.	.	ENSG00000203924	ENST00000370498	T	0.08984	3.03	0.755	-1.51	0.08664	.	.	.	.	.	T	0.05181	0.0138	L	0.55481	1.735	0.09310	N	1	P	0.42993	0.797	B	0.25291	0.059	T	0.20042	-1.0287	8	0.87932	D	0	.	.	.	.	.	114	Q5MJ10	SPXN2_HUMAN	Y	114	ENSP00000359529:D114Y	ENSP00000359529:D114Y	D	-	1	0	SPANXN2	142623004	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	0.082000	0.14847	-1.317000	0.02292	0.173000	0.16961	GAC	.	.	none		0.527	SPANXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058621.2	NM_001009615	
RC3H1	149041	hgsc.bcm.edu	37	1	173951933	173951933	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr1:173951933A>T	ENST00000367696.2	-	5	1051	c.700T>A	c.(700-702)Ttt>Att	p.F234I	RC3H1_ENST00000258349.4_Missense_Mutation_p.F234I|RC3H1_ENST00000367694.2_Missense_Mutation_p.F234I			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	234					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						GCTTGAGGAAACCGTGGCTCC	0.433																																					p.F234I		Atlas-SNP	.											.	RC3H1	110	.	0			c.T700A						PASS	.						103.0	103.0	103.0					1																	173951933		2203	4300	6503	SO:0001583	missense	149041	exon4			GAGGAAACCGTGG	AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.700T>A	1.37:g.173951933A>T	ENSP00000356669:p.Phe234Ile	Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	158	73	0.462025	NM_172071	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	ENST00000367696.2	37	CCDS30940.1	.	.	.	.	.	.	.	.	.	.	A	35	5.463575	0.96257	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	D;D;D	0.95412	-3.7;-3.7;-3.7	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.97558	0.9200	M	0.78801	2.425	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.83275	0.991;0.991;0.996;0.982	D	0.98323	1.0529	10	0.87932	D	0	-16.8265	16.0858	0.81049	1.0:0.0:0.0:0.0	.	234;234;234;234	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	I	234	ENSP00000356669:F234I;ENSP00000258349:F234I;ENSP00000356667:F234I	ENSP00000258349:F234I	F	-	1	0	RC3H1	172218556	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.264000	0.75181	0.533000	0.62120	TTT	.	.	none		0.433	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071	
OR2T27	403239	hgsc.bcm.edu	37	1	248813483	248813483	+	Missense_Mutation	SNP	C	C	G	rs151290740	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr1:248813483C>G	ENST00000344889.3	-	1	702	c.703G>C	c.(703-705)Gga>Cga	p.G235R		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G235R(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACAGCCTTTCCCCTCCCCTCT	0.517													G|||	130	0.0259585	0.0492	0.0202	5008	,	,		19164	0.0258		0.0169	False		,,,				2504	0.0082				p.G235R		Atlas-SNP	.											OR2T27,trunk,malignant_melanoma,0,1	OR2T27	52	1	1	Substitution - Missense(1)	skin(1)	c.G703C						scavenged	.						50.0	32.0	38.0					1																	248813483		2180	4250	6430	SO:0001583	missense	403239	exon1			CCTTTCCCCTCCC		CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.703G>C	1.37:g.248813483C>G	ENSP00000342008:p.Gly235Arg	Somatic	65	5	0.0769231		WXS	Illumina HiSeq	Phase_I	27	3	0.111111	NM_001001824		Missense_Mutation	SNP	ENST00000344889.3	37	CCDS31124.1	173	0.07921245421245421	29	0.05894308943089431	26	0.0718232044198895	53	0.09265734265734266	65	0.08575197889182058	.	0.016	-1.514107	0.00975	.	.	ENSG00000187701	ENST00000344889	T	0.00044	8.83	3.42	1.39	0.22231	GPCR, rhodopsin-like superfamily (1);	0.906780	0.08978	N	0.866193	T	0.00012	0.0000	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.01570	-1.1322	9	0.27785	T	0.31	.	8.0276	0.30446	0.0:0.1494:0.5166:0.334	.	235	Q8NH04	O2T27_HUMAN	R	235	ENSP00000342008:G235R	ENSP00000342008:G235R	G	-	1	0	OR2T27	246880106	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.226000	0.09139	-0.045000	0.13468	-0.502000	0.04539	GGA	C|0.500;G|0.500	0.500	weak		0.517	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097124.1	NM_001001824	
FAM8A1	51439	hgsc.bcm.edu	37	6	17608511	17608511	+	Nonsense_Mutation	SNP	C	C	T	rs200041366		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr6:17608511C>T	ENST00000259963.3	+	5	1238	c.1183C>T	c.(1183-1185)Cga>Tga	p.R395*		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	395	RDD.					integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			TCAGCATAATCGAACAGCTTA	0.383																																					p.R395X		Atlas-SNP	.											FAM8A1,lower_third,carcinoma,-1,1	FAM8A1	26	1	0			c.C1183T						scavenged	.						109.0	104.0	106.0					6																	17608511		2203	4300	6503	SO:0001587	stop_gained	51439	exon5			CATAATCGAACAG	AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.1183C>T	6.37:g.17608511C>T	ENSP00000259963:p.Arg395*	Somatic	132	2	0.0151515		WXS	Illumina HiSeq	Phase_I	110	5	0.0454545	NM_016255	B2R725	Nonsense_Mutation	SNP	ENST00000259963.3	37	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	C	36	5.927702	0.97110	.	.	ENSG00000137414	ENST00000542476;ENST00000259963	.	.	.	5.63	4.76	0.60689	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.0172	8.5079	0.33199	0.2528:0.6721:0.0:0.0751	.	.	.	.	X	145;395	.	ENSP00000259963:R395X	R	+	1	2	FAM8A1	17716490	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.235000	0.51328	1.373000	0.46208	0.557000	0.71058	CGA	.	.	weak		0.383	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1		
CLSTN2	64084	hgsc.bcm.edu	37	3	140275464	140275464	+	Missense_Mutation	SNP	C	C	T	rs368537354		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr3:140275464C>T	ENST00000458420.3	+	11	1974	c.1784C>T	c.(1783-1785)aCg>aTg	p.T595M		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	595					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.T595M(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CAGTTCCCAACGGCGGGTGTG	0.572										HNSCC(16;0.037)																											p.T595M	GBM(45;858 913 3709 36904 37282)	Atlas-SNP	.											CLSTN2,caecum,carcinoma,-1,2	CLSTN2	190	2	1	Substitution - Missense(1)	large_intestine(1)	c.C1784T						PASS	.	C	MET/THR	0,4406		0,0,2203	114.0	102.0	106.0		1784	5.4	0.1	3		106	1,8599	1.2+/-3.3	0,1,4299	no	missense	CLSTN2	NM_022131.2	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	595/956	140275464	1,13005	2203	4300	6503	SO:0001583	missense	64084	exon11			TCCCAACGGCGGG	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.1784C>T	3.37:g.140275464C>T	ENSP00000402460:p.Thr595Met	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	89	13	0.146067	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.547528	0.65311	0.0	1.16E-4	ENSG00000158258	ENST00000458420	T	0.35973	1.28	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.65176	0.2666	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.68526	-0.5385	9	.	.	.	-12.9896	16.9972	0.86371	0.0:1.0:0.0:0.0	.	595	Q9H4D0	CSTN2_HUMAN	M	595	ENSP00000402460:T595M	.	T	+	2	0	CLSTN2	141758154	1.000000	0.71417	0.082000	0.20525	0.276000	0.26787	7.776000	0.85560	2.692000	0.91855	0.563000	0.77884	ACG	.	.	weak		0.572	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
CHIT1	1118	hgsc.bcm.edu	37	1	203186950	203186950	+	Nonsense_Mutation	SNP	C	C	T	rs201320385|rs3831317|rs150192398	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr1:203186950C>T	ENST00000367229.1	-	10	1107	c.1073G>A	c.(1072-1074)tGg>tAg	p.W358*	CHIT1_ENST00000255427.3_Nonsense_Mutation_p.W339*|CHIT1_ENST00000535569.1_Nonsense_Mutation_p.W349*|CHIT1_ENST00000484834.1_5'UTR	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	358					chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						GTCCAGTGCCCAGACCATGGC	0.632																																					p.W358X		Atlas-SNP	.											CHIT1,colon,carcinoma,0,2	CHIT1	61	2	0			c.G1073A						scavenged	.						60.0	52.0	54.0					1																	203186950		2203	4300	6503	SO:0001587	stop_gained	1118	exon10			AGTGCCCAGACCA	U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.1073G>A	1.37:g.203186950C>T	ENSP00000356198:p.Trp358*	Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	46	3	0.0652174	NM_003465	B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Nonsense_Mutation	SNP	ENST00000367229.1	37	CCDS1436.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918897	0.73098	.	.	ENSG00000133063	ENST00000367229;ENST00000255427;ENST00000535569	.	.	.	4.57	4.57	0.56435	.	0.000000	0.42053	D	0.000776	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.7042	15.2284	0.73369	0.0:1.0:0.0:0.0	.	.	.	.	X	358;339;349	.	ENSP00000255427:W339X	W	-	2	0	CHIT1	201453573	1.000000	0.71417	0.432000	0.26747	0.080000	0.17528	6.938000	0.75904	2.238000	0.73509	0.563000	0.77884	TGG	C|0.989;T|0.011	0.011	strong		0.632	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2	NM_003465	
SDHA	6389	hgsc.bcm.edu	37	5	256455	256455	+	Missense_Mutation	SNP	C	C	G	rs1126697		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr5:256455C>G	ENST00000264932.6	+	15	2030	c.1915C>G	c.(1915-1917)Ctg>Gtg	p.L639V	SDHA_ENST00000510361.1_Missense_Mutation_p.L591V|SDHA_ENST00000504309.1_Missense_Mutation_p.L558V|SDHA_ENST00000507522.1_Intron	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	639					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CAAGGTCACTCTGGAATATAG	0.418									Familial Paragangliomas																												p.L639V		Atlas-SNP	.											SDHA,NS,adenocarcinoma,0,1	SDHA	80	1	0			c.C1915G						scavenged	.						92.0	103.0	99.0					5																	256455		2203	4300	6503	SO:0001583	missense	6389	exon15	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	GTCACTCTGGAAT	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1915C>G	5.37:g.256455C>G	ENSP00000264932:p.Leu639Val	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	107	3	0.0280374	NM_004168	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	4.275|4.275	0.050102|0.050102	0.08243|0.08243	.|.	.|.	ENSG00000073578|ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361|ENST00000515815	D;D;D|.	0.82344|.	-1.6;-1.6;-1.6|.	4.12|4.12	-1.06|-1.06	0.10002|0.10002	Fumarate reductase/succinate dehydrogenase flavoprotein-like, C-terminal (1);Fumarate reductase/succinate dehydrogenase flavoprotein, C-terminal (1);|.	0.000000|.	0.64402|.	U|.	0.000014|.	T|T	0.53899|0.53899	0.1825|0.1825	L|L	0.50333|0.50333	1.59|1.59	0.50467|0.50467	D|D	0.999871|0.999871	B;B;D;B|.	0.57257|.	0.432;0.049;0.979;0.072|.	B;B;D;B|.	0.71414|.	0.344;0.085;0.973;0.063|.	T|T	0.47799|0.47799	-0.9089|-0.9089	10|5	0.72032|.	D|.	0.01|.	.|.	7.982|7.982	0.30190|0.30190	0.0:0.2524:0.0:0.7476|0.0:0.2524:0.0:0.7476	rs1126697;rs3181866;rs17414511|rs1126697;rs3181866;rs17414511	591;233;558;639|.	E9PBJ5;B3KYA5;D6RFM5;P31040|.	.;.;.;DHSA_HUMAN|.	V|C	639;494;558;591|121	ENSP00000264932:L639V;ENSP00000426514:L558V;ENSP00000427703:L591V|.	ENSP00000264932:L639V|.	L|S	+|+	1|2	2|0	SDHA|SDHA	309455|309455	0.152000|0.152000	0.22762|0.22762	0.492000|0.492000	0.27490|0.27490	0.237000|0.237000	0.25408|0.25408	0.546000|0.546000	0.23284|0.23284	-0.096000|-0.096000	0.12329|0.12329	-0.680000|-0.680000	0.03767|0.03767	CTG|TCT	C|0.998;G|0.002	0.002	weak		0.418	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
TPO	7173	hgsc.bcm.edu	37	2	1491693	1491693	+	Silent	SNP	G	G	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr2:1491693G>A	ENST00000345913.4	+	10	1789	c.1698G>A	c.(1696-1698)gtG>gtA	p.V566V	TPO_ENST00000349624.3_Silent_p.V393V|TPO_ENST00000329066.4_Silent_p.V566V|TPO_ENST00000346956.3_Silent_p.V566V|TPO_ENST00000382201.3_Intron|TPO_ENST00000497517.2_Intron|TPO_ENST00000337415.3_Silent_p.V566V|TPO_ENST00000382198.1_Silent_p.V393V	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	566					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCTCTTTGTGCTGTCCAATT	0.577																																					p.V566V		Atlas-SNP	.											.	TPO	224	.	0			c.G1698A						PASS	.						139.0	118.0	125.0					2																	1491693		2203	4300	6503	SO:0001819	synonymous_variant	7173	exon10			CTTTGTGCTGTCC		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1698G>A	2.37:g.1491693G>A		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	62	21	0.33871	NM_001206744	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Silent	SNP	ENST00000345913.4	37	CCDS1643.1																																																																																			.	.	none		0.577	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
EBLN2	55096	hgsc.bcm.edu	37	3	73111480	73111480	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr3:73111480A>C	ENST00000533473.1	+	1	671	c.248A>C	c.(247-249)aAc>aCc	p.N83T	PPP4R2_ENST00000356692.5_Intron|PPP4R2_ENST00000394284.3_Intron|PPP4R2_ENST00000295862.9_Intron	NM_018029.3	NP_060499.3	Q6P2I7	EBLN2_HUMAN	endogenous Bornavirus-like nucleoprotein 2	83										endometrium(1)|large_intestine(3)|lung(1)|prostate(1)	6						TCTGGGAAAAACAGACAGTAT	0.483																																					p.N83T		Atlas-SNP	.											.	EBLN2	18	.	0			c.A248C						PASS	.						34.0	34.0	34.0					3																	73111480		1943	4138	6081	SO:0001583	missense	55096	exon1			GGAAAAACAGACA		CCDS54608.1	3p13	2011-06-03			ENSG00000255423	ENSG00000255423			25493	protein-coding gene	gene with protein product	"""endogenous Borna-like N element 2"""	613250				20054395, 20686665	Standard	NM_018029		Approved		uc003dpj.3	Q6P2I7	OTTHUMG00000165897	ENST00000533473.1:c.248A>C	3.37:g.73111480A>C	ENSP00000432104:p.Asn83Thr	Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	144	8	0.0555556	NM_018029	Q8WWH3|Q9NW89	Missense_Mutation	SNP	ENST00000533473.1	37	CCDS54608.1	.	.	.	.	.	.	.	.	.	.	A	2.477	-0.320603	0.05386	.	.	ENSG00000255423	ENST00000533473	.	.	.	0.458	-0.848	0.10727	P40 nucleoprotein, subdomain 1, Borna disease virus (1);	.	.	.	.	T	0.14917	0.0360	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.10450	0.005	T	0.28038	-1.0056	7	0.20046	T	0.44	.	.	.	.	.	83	Q6P2I7	EBLN2_HUMAN	T	83	.	ENSP00000432104:N83T	N	+	2	0	EBLN2	73194170	0.030000	0.19436	0.004000	0.12327	0.004000	0.04260	-1.980000	0.01492	-0.352000	0.08237	-0.354000	0.07668	AAC	.	.	none		0.483	EBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386932.1	NM_018029	
KRTAP10-6	386674	hgsc.bcm.edu	37	21	46012160	46012160	+	Missense_Mutation	SNP	G	G	C	rs62220887		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr21:46012160G>C	ENST00000400368.1	-	1	226	c.206C>G	c.(205-207)cCa>cGa	p.P69R	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	69	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.P69R(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						ACAGGTCACTGGGCAGCAGGG	0.697																																					p.P69R		Atlas-SNP	.											KRTAP10-6,trunk,malignant_melanoma,0,1	KRTAP10-6	57	1	1	Substitution - Missense(1)	skin(1)	c.C206G						scavenged	.						8.0	9.0	8.0					21																	46012160		1799	3920	5719	SO:0001583	missense	386674	exon1			GTCACTGGGCAGC	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.206C>G	21.37:g.46012160G>C	ENSP00000383219:p.Pro69Arg	Somatic	74	22	0.297297		WXS	Illumina HiSeq	Phase_I	66	19	0.287879	NM_198688		Missense_Mutation	SNP	ENST00000400368.1	37	CCDS42959.1	194	0.08882783882783883	67	0.13617886178861788	26	0.0718232044198895	31	0.05419580419580419	70	0.09234828496042216	t	0.001	-3.563519	0.00008	.	.	ENSG00000188155	ENST00000400368	T	0.00873	5.59	0.427	-0.836	0.10770	.	.	.	.	.	T	0.00012	0.0000	N	0.25426	0.745	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49716	-0.8910	9	0.59425	D	0.04	.	0.1138	0.00058	0.2539:0.2389:0.2542:0.2531	rs62220887	69	P60371	KR106_HUMAN	R	69	ENSP00000383219:P69R	ENSP00000383219:P69R	P	-	2	0	KRTAP10-6	44836588	0.004000	0.15560	0.034000	0.17996	0.004000	0.04260	-0.105000	0.10907	-1.484000	0.01856	-1.228000	0.01579	CCA	G|0.911;C|0.089	0.089	strong		0.697	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
CAMSAP2	23271	hgsc.bcm.edu	37	1	200818866	200818866	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr1:200818866G>A	ENST00000236925.4	+	12	3051	c.3002G>A	c.(3001-3003)cGa>cAa	p.R1001Q	CAMSAP2_ENST00000358823.2_Missense_Mutation_p.R990Q|CAMSAP2_ENST00000413307.2_Missense_Mutation_p.R974Q			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	1001					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										CCTTTGAATCGAACCTTGACA	0.418																																					p.R990Q		Atlas-SNP	.											CAMSAP1L1,NS,carcinoma,+1,1	.	.	1	0			c.G2969A						PASS	.						100.0	105.0	103.0					1																	200818866		2203	4300	6503	SO:0001583	missense	23271	exon11			TGAATCGAACCTT	AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.3002G>A	1.37:g.200818866G>A	ENSP00000236925:p.Arg1001Gln	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	185	97	0.524324	NM_203459	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Missense_Mutation	SNP	ENST00000236925.4	37		.	.	.	.	.	.	.	.	.	.	G	23.4	4.407876	0.83340	.	.	ENSG00000118200	ENST00000358823;ENST00000413307;ENST00000236925	T;T;T	0.35973	1.32;1.28;1.32	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.62429	0.2427	M	0.73217	2.22	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.992;0.951;0.999	T	0.58070	-0.7701	10	0.44086	T	0.13	-15.275	20.3214	0.98679	0.0:0.0:1.0:0.0	.	974;1001;990	Q08AD1-2;Q08AD1;Q08AD1-3	.;CAMP2_HUMAN;.	Q	990;974;1001	ENSP00000351684:R990Q;ENSP00000416800:R974Q;ENSP00000236925:R1001Q	ENSP00000236925:R1001Q	R	+	2	0	CAMSAP1L1	199085489	1.000000	0.71417	0.991000	0.47740	0.996000	0.88848	7.844000	0.86867	2.804000	0.96469	0.655000	0.94253	CGA	.	.	none		0.418	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086956.2	NM_203459	
HIST1H1E	3008	hgsc.bcm.edu	37	6	26157030	26157030	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr6:26157030C>T	ENST00000304218.3	+	1	472	c.412C>T	c.(412-414)Ccc>Tcc	p.P138S	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	138					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						GGCGAAGAAGCCCAAGAAGGC	0.607																																					p.P138S		Atlas-SNP	.											.	HIST1H1E	69	.	0			c.C412T						PASS	.						13.0	20.0	18.0					6																	26157030		2197	4290	6487	SO:0001583	missense	3008	exon1			AAGAAGCCCAAGA	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.412C>T	6.37:g.26157030C>T	ENSP00000307705:p.Pro138Ser	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	72	16	0.222222	NM_005321	Q4VB25	Missense_Mutation	SNP	ENST00000304218.3	37	CCDS4586.1	.	.	.	.	.	.	.	.	.	.	.	3.287	-0.145748	0.06627	.	.	ENSG00000168298	ENST00000304218	T	0.27890	1.64	5.51	2.29	0.28610	.	0.547850	0.18939	N	0.126986	T	0.07863	0.0197	L	0.34521	1.04	0.50039	D	0.999848	B	0.06786	0.001	B	0.04013	0.001	T	0.18524	-1.0334	10	0.11182	T	0.66	-0.7372	10.3673	0.44033	0.0:0.6:0.3296:0.0704	.	138	P10412	H14_HUMAN	S	138	ENSP00000307705:P138S	ENSP00000307705:P138S	P	+	1	0	HIST1H1E	26265009	0.597000	0.26874	0.998000	0.56505	0.708000	0.40852	0.204000	0.17335	0.191000	0.20236	0.561000	0.74099	CCC	.	.	none		0.607	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
MROH2B	133558	hgsc.bcm.edu	37	5	41054902	41054902	+	Silent	SNP	T	T	G			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr5:41054902T>G	ENST00000399564.4	-	11	1524	c.1074A>C	c.(1072-1074)acA>acC	p.T358T	MROH2B_ENST00000506092.2_Intron	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	358																	CGATTTTGACTGTTCTTTCTA	0.368																																					p.T358T		Atlas-SNP	.											.	.	.	.	0			c.A1074C						PASS	.						147.0	138.0	141.0					5																	41054902		1834	4081	5915	SO:0001819	synonymous_variant	133558	exon11			TTTGACTGTTCTT		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1074A>C	5.37:g.41054902T>G		Somatic	192	0	0		WXS	Illumina HiSeq	Phase_I	154	44	0.285714	NM_173489	Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	ENST00000399564.4	37	CCDS47202.1																																																																																			.	.	none		0.368	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	
EP400	57634	hgsc.bcm.edu	37	12	132547093	132547093	+	Silent	SNP	A	A	G	rs10902490|rs528214697	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr12:132547093A>G	ENST00000333577.4	+	48	8398	c.8289A>G	c.(8287-8289)caA>caG	p.Q2763Q	EP400_ENST00000389561.2_Silent_p.Q2727Q|EP400_ENST00000389562.2_Silent_p.Q2726Q|EP400_ENST00000330386.6_Silent_p.Q2646Q|EP400_ENST00000332482.4_Silent_p.Q2690Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2763	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2726Q(9)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacaacagcagcagc	0.567																																					p.Q2727Q		Atlas-SNP	.											EP400,NS,carcinoma,0,15	EP400	370	15	9	Substitution - coding silent(9)	lung(3)|kidney(2)|endometrium(2)|central_nervous_system(2)	c.A8181G						scavenged	.						25.0	29.0	28.0					12																	132547093		2173	4217	6390	SO:0001819	synonymous_variant	57634	exon47			GCAACAACAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8289A>G	12.37:g.132547093A>G		Somatic	73	1	0.0136986		WXS	Illumina HiSeq	Phase_I	52	5	0.0961538	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				A|0.500;G|0.500	0.500	weak		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346591	39346591	+	Silent	SNP	C	C	T	rs76923645|rs148036927		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr17:39346591C>T	ENST00000398470.1	+	1	453	c.453C>T	c.(451-453)ccC>ccT	p.P151P	KRTAP9-1_ENST00000377723.3_Intron|KRTAP9-1_ENST00000318329.5_Silent_p.P68P	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	151	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)				breast(1)|lung(3)	4						CTTGCCAGCCCACCTGCTGTG	0.582																																					p.P151P		Atlas-SNP	.											KRTAP9-1_ENST00000398470,caecum,carcinoma,0,2	KRTAP9-1	34	2	0			c.C453T						scavenged	.																																			SO:0001819	synonymous_variant	728318	exon1			CCAGCCCACCTGC	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	ENST00000398470.1:c.453C>T	17.37:g.39346591C>T		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	63	24	0.380952	NM_001190460		Silent	SNP	ENST00000398470.1	37	CCDS56029.1																																																																																			C|0.500;T|0.500	0.500	weak		0.582	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
CARD11	84433	hgsc.bcm.edu	37	7	2977662	2977662	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr7:2977662A>T	ENST00000396946.4	-	8	1425	c.1022T>A	c.(1021-1023)cTg>cAg	p.L341Q		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	341					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CTTCTCCTCCAGGTACTGTGA	0.542			Mis		DLBCL																																p.L341Q		Atlas-SNP	.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11	339	.	0			c.T1022A						PASS	.						146.0	128.0	134.0					7																	2977662		2203	4300	6503	SO:0001583	missense	84433	exon8			TCCTCCAGGTACT	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1022T>A	7.37:g.2977662A>T	ENSP00000380150:p.Leu341Gln	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	62	14	0.225806	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	A	14.15	2.450208	0.43531	.	.	ENSG00000198286	ENST00000396946	T	0.38401	1.14	5.0	5.0	0.66597	.	0.000000	0.64402	D	0.000006	T	0.51415	0.1673	L	0.52905	1.665	0.53005	D	0.99996	D	0.76494	0.999	D	0.75020	0.985	T	0.53662	-0.8407	10	0.72032	D	0.01	-21.9678	9.3257	0.37990	0.8401:0.0:0.0:0.1599	.	341	Q9BXL7	CAR11_HUMAN	Q	341	ENSP00000380150:L341Q	ENSP00000380150:L341Q	L	-	2	0	CARD11	2944188	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.059000	0.76684	1.878000	0.54408	0.482000	0.46254	CTG	.	.	none		0.542	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
UGT2B7	7364	hgsc.bcm.edu	37	4	69978319	69978319	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr4:69978319G>A	ENST00000305231.7	+	6	1501	c.1455G>A	c.(1453-1455)tgG>tgA	p.W485*	UGT2B7_ENST00000508661.1_3'UTR	NM_001074.2	NP_001065.2	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	485					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	ACCTCACCTGGTTCCAGTACC	0.483																																					p.W485X		Atlas-SNP	.											.	UGT2B7	79	.	0			c.G1455A						PASS	.						177.0	167.0	170.0					4																	69978319		2203	4300	6503	SO:0001587	stop_gained	7364	exon6			CACCTGGTTCCAG	BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000305231.7:c.1455G>A	4.37:g.69978319G>A	ENSP00000304811:p.Trp485*	Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	112	35	0.3125	NM_001074	B2R810|Q6GTW0	Nonsense_Mutation	SNP	ENST00000305231.7	37	CCDS3526.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.407084	0.42715	.	.	ENSG00000171234	ENST00000305231	.	.	.	2.13	2.13	0.27403	.	0.000000	0.64402	U	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.956	0.41666	0.0:0.0:1.0:0.0	.	.	.	.	X	485	.	.	W	+	3	0	UGT2B7	70012908	1.000000	0.71417	0.982000	0.44146	0.254000	0.26022	8.547000	0.90665	1.192000	0.43071	0.306000	0.20318	TGG	.	.	none		0.483	UGT2B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251560.1	NM_001074	
HSPG2	3339	hgsc.bcm.edu	37	1	22182158	22182158	+	Silent	SNP	G	G	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr1:22182158G>A	ENST00000374695.3	-	46	5791	c.5712C>T	c.(5710-5712)ggC>ggT	p.G1904G	HSPG2_ENST00000430507.1_5'Flank	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1904	Ig-like C2-type 4.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GGAGCTGGCCGCCGGGGCCCC	0.672																																					p.G1904G		Atlas-SNP	.											.	HSPG2	311	.	0			c.C5712T						PASS	.						12.0	13.0	12.0					1																	22182158		2193	4281	6474	SO:0001819	synonymous_variant	3339	exon46			CTGGCCGCCGGGG	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.5712C>T	1.37:g.22182158G>A		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	39	8	0.205128	NM_005529	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	ENST00000374695.3	37	CCDS30625.1																																																																																			.	.	none		0.672	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
GOLGA6B	55889	hgsc.bcm.edu	37	15	72954595	72954595	+	Missense_Mutation	SNP	A	A	G	rs200411442	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr15:72954595A>G	ENST00000421285.3	+	11	850	c.850A>G	c.(850-852)Aag>Gag	p.K284E	RN7SL853P_ENST00000477951.2_RNA	NM_018652.4	NP_061122.4	A6NDN3	GOG6B_HUMAN	golgin A6 family, member B	284						Golgi apparatus (GO:0005794)		p.K284E(2)		NS(1)|breast(1)|endometrium(1)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	16						TTTCTCAGCTAAGCCCCCATC	0.522																																					p.K284E		Atlas-SNP	.											GOLGA6B,NS,carcinoma,0,2	GOLGA6B	30	2	2	Substitution - Missense(2)	prostate(2)	c.A850G						scavenged	.						36.0	35.0	35.0					15																	72954595		1854	3747	5601	SO:0001583	missense	55889	exon11			TCAGCTAAGCCCC		CCDS10245.2	15q24.1	2011-10-25	2010-02-12		ENSG00000215186	ENSG00000215186			32205	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6B"""				Standard	XM_006720604		Approved		uc010uks.1	A6NDN3	OTTHUMG00000133511	ENST00000421285.3:c.850A>G	15.37:g.72954595A>G	ENSP00000408132:p.Lys284Glu	Somatic	284	4	0.0140845		WXS	Illumina HiSeq	Phase_I	213	5	0.0234742	NM_018652	A8MYY7	Missense_Mutation	SNP	ENST00000421285.3	37	CCDS10245.2	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.289869	0.00248	.	.	ENSG00000215186	ENST00000421285	T	0.20598	2.06	0.69	-1.38	0.09027	.	.	.	.	.	T	0.03871	0.0109	N	0.00468	-1.46	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.33111	-0.9881	9	0.02654	T	1	.	6.2533	0.20859	0.2269:0.0:0.7731:0.0	.	284	A6NDN3	GOG6B_HUMAN	E	284	ENSP00000408132:K284E	ENSP00000408132:K284E	K	+	1	0	GOLGA6B	70741649	0.001000	0.12720	0.068000	0.19968	0.040000	0.13550	0.170000	0.16663	-1.260000	0.02465	-1.888000	0.00539	AAG	A|0.500;G|0.500	0.500	weak		0.522	GOLGA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257474.4	NM_018652	
OR2F2	135948	hgsc.bcm.edu	37	7	143633276	143633276	+	Silent	SNP	T	T	C			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr7:143633276T>C	ENST00000408955.2	+	1	1018	c.951T>C	c.(949-951)acT>acC	p.T317T		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	317						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					AGCTGGGAACTTGACTCATGA	0.433																																					p.T317T		Atlas-SNP	.											.	OR2F2	63	.	0			c.T951C						PASS	.						32.0	31.0	31.0					7																	143633276		1968	4195	6163	SO:0001819	synonymous_variant	135948	exon1			GGGAACTTGACTC		CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.951T>C	7.37:g.143633276T>C		Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	56	4	0.0714286	NM_001004685	A4D2G0|Q6IFP8	Silent	SNP	ENST00000408955.2	37	CCDS43666.1																																																																																			.	.	none		0.433	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349570.1		
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305785	39305785	+	Missense_Mutation	SNP	A	A	T	rs411367		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr17:39305785A>T	ENST00000343246.4	-	1	269	c.235T>A	c.(235-237)Tgc>Agc	p.C79S		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	79	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			tggcagcagcaggggcggcag	0.657																																					p.C79S		Atlas-SNP	.											KRTAP4-5,colon,carcinoma,0,3	KRTAP4-5	34	3	0			c.T235A						scavenged	.						12.0	18.0	16.0					17																	39305785		2089	4172	6261	SO:0001583	missense	85289	exon1			AGCAGCAGGGGCG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.235T>A	17.37:g.39305785A>T	ENSP00000340546:p.Cys79Ser	Somatic	37	1	0.027027		WXS	Illumina HiSeq	Phase_I	29	5	0.172414	NM_033188		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	773	0.35393772893772896	210	0.4268292682926829	126	0.34806629834254144	175	0.30594405594405594	262	0.34564643799472294	.	0.010	-1.763522	0.00651	.	.	ENSG00000198271	ENST00000343246	T	0.00534	6.74	2.78	-5.56	0.02529	.	0.768893	0.10092	N	0.717076	T	0.00012	0.0000	N	0.01431	-0.87	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.23297	-1.0192	9	0.02654	T	1	.	5.4481	0.16548	0.6146:0.0:0.1542:0.2312	rs411367;rs6503604	79	Q9BYR2	KRA45_HUMAN	S	79	ENSP00000340546:C79S	ENSP00000340546:C79S	C	-	1	0	KRTAP4-5	36559311	0.977000	0.34250	0.000000	0.03702	0.000000	0.00434	-0.260000	0.08708	-1.272000	0.02427	-2.057000	0.00402	TGC	A|0.646;T|0.354	0.354	strong		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
RPS6KA6	27330	hgsc.bcm.edu	37	X	83357092	83357092	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chrX:83357092C>A	ENST00000262752.2	-	18	1736	c.1729G>T	c.(1729-1731)Gga>Tga	p.G577*	RPS6KA6_ENST00000543399.1_Nonsense_Mutation_p.G577*|RPS6KA6_ENST00000495332.1_5'UTR	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	577	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						AAGAGAAGTCCATTTTCTCCT	0.358																																					p.G577X		Atlas-SNP	.											.	RPS6KA6	116	.	0			c.G1729T						PASS	.						135.0	115.0	122.0					X																	83357092		2203	4300	6503	SO:0001587	stop_gained	27330	exon18			GAAGTCCATTTTC	AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.1729G>T	X.37:g.83357092C>A	ENSP00000262752:p.Gly577*	Somatic	248	0	0		WXS	Illumina HiSeq	Phase_I	178	92	0.516854	NM_014496	B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Nonsense_Mutation	SNP	ENST00000262752.2	37	CCDS14451.1	.	.	.	.	.	.	.	.	.	.	C	39	7.488025	0.98316	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	.	.	.	5.11	5.11	0.69529	.	0.055100	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	17.9644	0.89096	0.0:1.0:0.0:0.0	.	.	.	.	X	577	.	ENSP00000262752:G577X	G	-	1	0	RPS6KA6	83243748	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.597000	0.82733	2.263000	0.75096	0.523000	0.50628	GGA	.	.	none		0.358	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	NM_014496	
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346622	39346622	+	Missense_Mutation	SNP	T	T	A	rs79470847		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr17:39346622T>A	ENST00000398470.1	+	1	484	c.484T>A	c.(484-486)Tgc>Agc	p.C162S	KRTAP9-1_ENST00000377723.3_Intron|KRTAP9-1_ENST00000318329.5_Splice_Site	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	162	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)				breast(1)|lung(3)	4						CTGCCAGCCTTGCTGCCACCC	0.607																																					p.C162S		Atlas-SNP	.											KRTAP9-1_ENST00000398470,caecum,carcinoma,0,2	KRTAP9-1	34	2	0			c.T484A						PASS	.																																			SO:0001583	missense	728318	exon1			CAGCCTTGCTGCC	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	ENST00000398470.1:c.484T>A	17.37:g.39346622T>A	ENSP00000381488:p.Cys162Ser	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	80	24	0.3	NM_001190460		Missense_Mutation	SNP	ENST00000398470.1	37	CCDS56029.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|A	6.687|6.687	0.495274|0.495274	0.12762|0.12762	.|.	.|.	ENSG00000240542|ENSG00000240542	ENST00000318329|ENST00000398470	.|T	.|0.02236	.|4.38	3.62|3.62	1.21|1.21	0.21127|0.21127	.|.	.|.	.|.	.|.	.|.	.|T	.|0.00815	.|0.0027	N|N	0.01257|0.01257	-0.925|-0.925	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.48186	.|-0.9057	.|7	.|0.20046	.|T	.|0.44	.|.	4.2082|4.2082	0.10498|0.10498	0.1788:0.109:0.0:0.7122|0.1788:0.109:0.0:0.7122	.|.	.|.	.|.	.|.	.|S	-1|162	.|ENSP00000381488:C162S	.|ENSP00000381488:C162S	.|C	+|+	.|1	.|0	KRTAP9-1|KRTAP9-1	36600148|36600148	0.954000|0.954000	0.32549|0.32549	0.003000|0.003000	0.11579|0.11579	0.039000|0.039000	0.13416|0.13416	0.874000|0.874000	0.28065|0.28065	0.072000|0.072000	0.16694|0.16694	0.460000|0.460000	0.39030|0.39030	.|TGC	T|0.500;A|0.500	0.500	weak		0.607	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
ATAD2	29028	hgsc.bcm.edu	37	8	124382182	124382182	+	Silent	SNP	A	A	G	rs139406007	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr8:124382182A>G	ENST00000287394.5	-	7	917	c.810T>C	c.(808-810)gaT>gaC	p.D270D	ATAD2_ENST00000521903.1_5'UTR|ATAD2_ENST00000534257.1_5'Flank	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	270	Asp-rich.				ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			catcatcatcatcgtcatcat	0.368													a|||	137	0.0273562	0.084	0.0216	5008	,	,		18741	0.001		0.005	False		,,,				2504	0.0051				p.D270D		Atlas-SNP	.											ATAD2,caecum,carcinoma,0,1	ATAD2	160	1	0			c.T810C						scavenged	.	G		202,4202	113.3+/-151.4	1,200,2001	248.0	189.0	209.0		810	-2.2	0.0	8	dbSNP_134	209	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	ATAD2	NM_014109.3		1,202,6299	GG,GA,AA		0.0233,4.5867,1.5687		270/1391	124382182	204,12800	2202	4300	6502	SO:0001819	synonymous_variant	29028	exon7			ATCATCATCGTCA	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.810T>C	8.37:g.124382182A>G		Somatic	213	0	0		WXS	Illumina HiSeq	Phase_I	152	3	0.0197368	NM_014109	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	ENST00000287394.5	37	CCDS6343.1																																																																																			A|0.986;G|0.014	0.014	strong		0.368	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
MAGI1	9223	hgsc.bcm.edu	37	3	65425591	65425591	+	Silent	SNP	T	T	C	rs374381483|rs79701778		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr3:65425591T>C	ENST00000497477.2	-	9	1232	c.1233A>G	c.(1231-1233)caA>caG	p.Q411Q	MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000402939.2_Silent_p.Q411Q|MAGI1_ENST00000330909.8_Silent_p.Q411Q|MAGI1_ENST00000483466.1_Silent_p.Q411Q			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	411	Poly-Gln.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		gctgctgctgttgctgctgct	0.542											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q411Q		Atlas-SNP	.											MAGI1_ENST00000402939,NS,carcinoma,0,3	MAGI1	481	3	0			c.A1233G						scavenged	.						61.0	60.0	61.0					3																	65425591		2191	4267	6458	SO:0001819	synonymous_variant	9223	exon9			CTGCTGTTGCTGC	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1233A>G	3.37:g.65425591T>C		Somatic	90	2	0.0222222	1084	WXS	Illumina HiSeq	Phase_I	93	5	0.0537634	NM_001033057	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Silent	SNP	ENST00000497477.2	37		.	.	.	.	.	.	.	.	.	.	T	1.469	-0.560380	0.03939	.	.	ENSG00000151276	ENST00000460329	.	.	.	2.82	-5.65	0.02459	.	.	.	.	.	T	0.27313	0.0670	.	.	.	0.21445	N	0.999683	.	.	.	.	.	.	T	0.31558	-0.9939	4	.	.	.	.	7.6202	0.28181	0.0:0.2714:0.1222:0.6064	.	.	.	.	S	292	.	.	N	-	2	0	MAGI1	65400631	0.067000	0.21026	0.000000	0.03702	0.001000	0.01503	-1.642000	0.02006	-1.408000	0.02040	-1.740000	0.00687	AAC	T|0.500;C|0.500	0.500	weak		0.542	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742	
CTNNA2	1496	hgsc.bcm.edu	37	2	80801387	80801387	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr2:80801387G>A	ENST00000402739.4	+	12	1846	c.1841G>A	c.(1840-1842)cGc>cAc	p.R614H	AC008067.2_ENST00000609950.1_RNA|CTNNA2_ENST00000343114.3_Missense_Mutation_p.R293H|CTNNA2_ENST00000540488.1_Missense_Mutation_p.R614H|CTNNA2_ENST00000361291.4_Missense_Mutation_p.R648H|CTNNA2_ENST00000541047.1_Missense_Mutation_p.R614H|AC008067.2_ENST00000430876.1_RNA|CTNNA2_ENST00000466387.1_Missense_Mutation_p.R614H|CTNNA2_ENST00000496558.1_Missense_Mutation_p.R614H	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	614					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.R614H(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GATGCCTCTCGCCTGGTGTAT	0.527																																					p.R614H		Atlas-SNP	.											CTNNA2_ENST00000466387,NS,carcinoma,+1,3	CTNNA2	462	3	1	Substitution - Missense(1)	prostate(1)	c.G1841A						PASS	.						172.0	164.0	167.0					2																	80801387		2149	4276	6425	SO:0001583	missense	1496	exon13			CCTCTCGCCTGGT		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1841G>A	2.37:g.80801387G>A	ENSP00000384638:p.Arg614His	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	106	29	0.273585	NM_001164883	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	G	35	5.472512	0.96274	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114	T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.75	5.75	0.90469	.	0.061993	0.64402	D	0.000005	T	0.67655	0.2916	M	0.80183	2.485	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	P;D;D;D	0.79784	0.791;0.993;0.987;0.987	T	0.68187	-0.5475	9	.	.	.	.	18.1307	0.89600	0.0:0.0:1.0:0.0	.	246;614;614;614	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	H	614;614;648;614;614;614;293	ENSP00000418191:R614H;ENSP00000419295:R614H;ENSP00000355398:R648H;ENSP00000384638:R614H;ENSP00000444675:R614H;ENSP00000441705:R614H;ENSP00000341500:R293H	.	R	+	2	0	CTNNA2	80654898	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.799000	0.99117	2.732000	0.93576	0.655000	0.94253	CGC	.	.	none		0.527	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
BAZ2B	29994	hgsc.bcm.edu	37	2	160285738	160285738	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr2:160285738C>T	ENST00000392783.2	-	11	2723	c.2228G>A	c.(2227-2229)cGt>cAt	p.R743H	BAZ2B_ENST00000355831.2_Missense_Mutation_p.R743H|BAZ2B_ENST00000343439.5_Missense_Mutation_p.R643H|BAZ2B_ENST00000392782.1_Missense_Mutation_p.R741H	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	743	MBD. {ECO:0000255|PROSITE- ProRule:PRU00338}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						ACGCAGTTCACGTTCATCTGT	0.274																																					p.R743H		Atlas-SNP	.											BAZ2B,NS,carcinoma,-1,1	BAZ2B	196	1	0			c.G2228A						scavenged	.						89.0	84.0	86.0					2																	160285738		1807	4073	5880	SO:0001583	missense	29994	exon11			AGTTCACGTTCAT	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.2228G>A	2.37:g.160285738C>T	ENSP00000376534:p.Arg743His	Somatic	561	2	0.00356506		WXS	Illumina HiSeq	Phase_I	463	102	0.220302	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	37	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	C	15.17	2.753579	0.49362	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	D;D;D;D	0.99479	-5.98;-5.98;-5.98;-2.02	5.05	3.23	0.37069	Methyl-CpG DNA binding (3);DNA-binding, integrase-type (1);	0.467765	0.15641	N	0.251909	D	0.97932	0.9320	L	0.50333	1.59	0.27152	N	0.961373	B;B;B;B	0.32245	0.039;0.167;0.067;0.361	B;B;B;B	0.26202	0.02;0.04;0.008;0.067	D	0.96004	0.8996	10	0.66056	D	0.02	-0.6977	10.7496	0.46200	0.0:0.8427:0.0:0.1573	.	547;643;741;743	Q9UIF8-4;Q9UIF8-2;Q9UIF8-5;Q9UIF8	.;.;.;BAZ2B_HUMAN	H	741;743;743;643	ENSP00000376533:R741H;ENSP00000376534:R743H;ENSP00000348087:R743H;ENSP00000339670:R643H	ENSP00000339670:R643H	R	-	2	0	BAZ2B	159993984	0.697000	0.27767	0.895000	0.35142	0.990000	0.78478	1.322000	0.33689	0.635000	0.30488	-0.142000	0.14014	CGT	.	.	none		0.274	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
ZC3H7A	29066	hgsc.bcm.edu	37	16	11855353	11855353	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr16:11855353C>T	ENST00000396516.2	-	18	2425	c.2228G>A	c.(2227-2229)cGg>cAg	p.R743Q	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.R743Q|ZC3H7A_ENST00000575984.1_5'Flank			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	743						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						CATCGCACGCCGGTCTTTGGT	0.428																																					p.R743Q		Atlas-SNP	.											ZC3H7A,NS,carcinoma,-1,1	ZC3H7A	72	1	0			c.G2228A						PASS	.						124.0	121.0	122.0					16																	11855353		2197	4300	6497	SO:0001583	missense	29066	exon19			GCACGCCGGTCTT	AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.2228G>A	16.37:g.11855353C>T	ENSP00000379773:p.Arg743Gln	Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	106	40	0.377358	NM_014153	D3DUG5|Q9NPE9	Missense_Mutation	SNP	ENST00000396516.2	37	CCDS10550.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.235201	0.79800	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.11385	2.78;2.78	5.66	5.66	0.87406	.	0.149940	0.56097	D	0.000027	T	0.16428	0.0395	L	0.61218	1.895	0.80722	D	1	P;P	0.48764	0.89;0.915	P;P	0.45276	0.454;0.475	T	0.00275	-1.1856	10	0.56958	D	0.05	.	12.1063	0.53813	0.0:0.9222:0.0:0.0778	.	464;743	Q9NXC8;Q8IWR0	.;Z3H7A_HUMAN	Q	743	ENSP00000347999:R743Q;ENSP00000379773:R743Q	ENSP00000347999:R743Q	R	-	2	0	ZC3H7A	11762854	0.996000	0.38824	0.911000	0.35937	0.989000	0.77384	3.366000	0.52343	2.665000	0.90641	0.563000	0.77884	CGG	.	.	none		0.428	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1	NM_014153	
MESP2	145873	hgsc.bcm.edu	37	15	90320144	90320144	+	Missense_Mutation	SNP	C	C	G	rs56192595|rs200021459|rs199821487	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr15:90320144C>G	ENST00000341735.3	+	1	556	c.556C>G	c.(556-558)Cag>Gag	p.Q186E	MESP2_ENST00000560219.1_Intron|MESP2_ENST00000558723.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	186	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q198_G205delQGQGQGQG(1)		kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			agggcaggggcaggggcaggg	0.786																																					p.Q186E		Atlas-SNP	.											.	MESP2	20	.	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.C556G						PASS	.						2.0	2.0	2.0					15																	90320144		1033	2283	3316	SO:0001583	missense	145873	exon1			CAGGGGCAGGGGC		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.556C>G	15.37:g.90320144C>G	ENSP00000342392:p.Gln186Glu	Somatic	9	0	0		WXS	Illumina HiSeq	Phase_I	18	6	0.333333	NM_001039958	Q7RTU2	Missense_Mutation	SNP	ENST00000341735.3	37	CCDS42078.1	.	.	.	.	.	.	.	.	.	.	-	2.714	-0.268135	0.05716	.	.	ENSG00000188095	ENST00000341735	T	0.81163	-1.46	1.25	0.212	0.15240	.	.	.	.	.	T	0.56963	0.2021	N	0.08118	0	0.09310	N	1	B	0.17852	0.024	B	0.21360	0.034	T	0.41680	-0.9495	9	0.14252	T	0.57	.	5.4957	0.16802	0.0:0.5895:0.4105:0.0	.	186	Q0VG99	MESP2_HUMAN	E	186	ENSP00000342392:Q186E	ENSP00000342392:Q186E	Q	+	1	0	MESP2	88121148	0.038000	0.19896	0.001000	0.08648	0.006000	0.05464	0.044000	0.13992	0.112000	0.17975	0.297000	0.19635	CAG	.	.	none		0.786	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416421.1	XM_085261	
C11orf84	144097	hgsc.bcm.edu	37	11	63585573	63585573	+	Missense_Mutation	SNP	G	G	A	rs373118347		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr11:63585573G>A	ENST00000294244.4	+	2	723	c.424G>A	c.(424-426)Gtg>Atg	p.V142M		NM_138471.1	NP_612480.1	Q9BUA3	CK084_HUMAN	chromosome 11 open reading frame 84	142										endometrium(3)|kidney(1)|lung(3)|skin(1)	8						CTTGCAAGACGTGAGAGCTGA	0.587																																					p.V142M		Atlas-SNP	.											.	C11orf84	33	.	0			c.G424A						PASS	.	G	MET/VAL	3,4399	6.2+/-15.9	0,3,2198	69.0	72.0	71.0		424	-6.3	0.0	11		71	0,8596		0,0,4298	no	missense	C11orf84	NM_138471.1	21	0,3,6496	AA,AG,GG		0.0,0.0682,0.0231	benign	142/382	63585573	3,12995	2201	4298	6499	SO:0001583	missense	144097	exon2			CAAGACGTGAGAG	BC007540	CCDS31594.1	11q13.1	2014-02-10			ENSG00000168005	ENSG00000168005			25115	protein-coding gene	gene with protein product						12477932	Standard	NM_138471		Approved		uc001nxt.3	Q9BUA3	OTTHUMG00000167746	ENST00000294244.4:c.424G>A	11.37:g.63585573G>A	ENSP00000294244:p.Val142Met	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	43	11	0.255814	NM_138471	Q68CV7|Q6PHS2|Q96IH0	Missense_Mutation	SNP	ENST00000294244.4	37	CCDS31594.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.175663	0.38413	6.82E-4	0.0	ENSG00000168005	ENST00000294244	T	0.47177	0.85	5.38	-6.3	0.02007	.	1.609270	0.03598	N	0.232943	T	0.18173	0.0436	N	0.08118	0	0.09310	N	1	P	0.46656	0.882	B	0.33690	0.168	T	0.30268	-0.9984	10	0.87932	D	0	-6.9248	1.2292	0.01940	0.4312:0.105:0.1743:0.2896	.	142	Q9BUA3	CK084_HUMAN	M	142	ENSP00000294244:V142M	ENSP00000294244:V142M	V	+	1	0	C11orf84	63342149	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-1.225000	0.02956	-0.942000	0.03695	-0.254000	0.11334	GTG	.	.	weak		0.587	C11orf84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396084.1	NM_138471	
MPP7	143098	hgsc.bcm.edu	37	10	28420542	28420542	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr10:28420542C>T	ENST00000375732.1	-	6	653	c.394G>A	c.(394-396)Gat>Aat	p.D132N	MPP7_ENST00000375719.3_Missense_Mutation_p.D132N|MPP7_ENST00000337532.5_Missense_Mutation_p.D132N|MPP7_ENST00000481244.1_5'UTR|MPP7_ENST00000445954.2_Missense_Mutation_p.D7N|MPP7_ENST00000540098.1_Missense_Mutation_p.D132N			Q5T2T1	MPP7_HUMAN	membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)	132					establishment of cell polarity (GO:0030010)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of signal transduction (GO:0009967)|protein localization to adherens junction (GO:0071896)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cell junction (GO:0030054)|mitochondrion (GO:0005739)|MPP7-DLG1-LIN7 complex (GO:0097025)|tight junction (GO:0005923)	protein complex scaffold (GO:0032947)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|signaling adaptor activity (GO:0035591)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	22						TCTTCCTCATCGTCAATATCT	0.413																																					p.D132N		Atlas-SNP	.											.	MPP7	60	.	0			c.G394A						PASS	.						132.0	119.0	123.0					10																	28420542		2203	4300	6503	SO:0001583	missense	143098	exon8			CCTCATCGTCAAT	BC038105	CCDS7158.1	10p12.1	2004-01-15			ENSG00000150054	ENSG00000150054			26542	protein-coding gene	gene with protein product		610973				14719143	Standard	NM_173496		Approved	FLJ32798	uc001iua.1	Q5T2T1	OTTHUMG00000017868	ENST00000375732.1:c.394G>A	10.37:g.28420542C>T	ENSP00000364884:p.Asp132Asn	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	97	24	0.247423	NM_173496	B2RCC9|B4DWL9|B5MDZ3|D3DRW3|Q5T2T0|Q8IY28	Missense_Mutation	SNP	ENST00000375732.1	37	CCDS7158.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.939983	0.73557	.	.	ENSG00000150054	ENST00000375732;ENST00000337532;ENST00000540098;ENST00000375719;ENST00000445954	T;T;T;T;T	0.23147	2.72;2.72;2.72;2.72;1.92	5.74	4.84	0.62591	PDZ/DHR/GLGF (1);	0.221823	0.52532	N	0.000062	T	0.22513	0.0543	L	0.39633	1.23	0.80722	D	1	B	0.23854	0.092	B	0.18871	0.023	T	0.02404	-1.1164	10	0.33141	T	0.24	.	14.4397	0.67306	0.0:0.9287:0.0:0.0713	.	132	Q5T2T1	MPP7_HUMAN	N	132;132;132;132;7	ENSP00000364884:D132N;ENSP00000337907:D132N;ENSP00000438693:D132N;ENSP00000364871:D132N;ENSP00000405397:D7N	ENSP00000337907:D132N	D	-	1	0	MPP7	28460548	1.000000	0.71417	0.883000	0.34634	0.991000	0.79684	4.814000	0.62627	1.442000	0.47568	0.561000	0.74099	GAT	.	.	none		0.413	MPP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047345.1	NM_173496	
CDC27	996	hgsc.bcm.edu	37	17	45234300	45234300	+	Missense_Mutation	SNP	G	G	T	rs199588670		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr17:45234300G>T	ENST00000066544.3	-	7	914	c.821C>A	c.(820-822)gCt>gAt	p.A274D	CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000446365.2_Missense_Mutation_p.A213D|CDC27_ENST00000531206.1_Missense_Mutation_p.A274D|CDC27_ENST00000527547.1_Missense_Mutation_p.A274D	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	274					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.A274D(11)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGGACTAAGAGCTGCTGGTCC	0.363																																					p.A274D		Atlas-SNP	.											CDC27_ENST00000531206,NS,carcinoma,0,10	CDC27	337	10	11	Substitution - Missense(11)	prostate(9)|skin(2)	c.C821A						scavenged	.						61.0	65.0	63.0					17																	45234300		2201	4292	6493	SO:0001583	missense	996	exon7			CTAAGAGCTGCTG	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.821C>A	17.37:g.45234300G>T	ENSP00000066544:p.Ala274Asp	Somatic	86	2	0.0232558		WXS	Illumina HiSeq	Phase_I	72	6	0.0833333	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604295	0.66445	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.69175	-0.38;-0.38;-0.13;-0.38;0.68	5.64	5.64	0.86602	.	0.058237	0.64402	D	0.000002	T	0.64735	0.2625	N	0.24115	0.695	0.58432	D	0.999999	P;P;P;B	0.51351	0.704;0.886;0.944;0.363	B;P;P;B	0.51615	0.216;0.495;0.675;0.143	T	0.64685	-0.6349	10	0.40728	T	0.16	-20.3108	17.2083	0.86924	0.0:0.0:1.0:0.0	.	213;274;274;274	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	D	274;274;213;274;274	ENSP00000066544:A274D;ENSP00000434614:A274D;ENSP00000392802:A213D;ENSP00000437339:A274D;ENSP00000432105:A274D	ENSP00000066544:A274D	A	-	2	0	CDC27	42589299	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.260000	0.95568	2.665000	0.90641	0.460000	0.39030	GCT	.	.	weak		0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
MUC4	4585	hgsc.bcm.edu	37	3	195505858	195505858	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr3:195505858G>A	ENST00000463781.3	-	2	13052	c.12593C>T	c.(12592-12594)aCt>aTt	p.T4198I	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T4198I	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAAGTGTCGGTGAC	0.602																																					p.T4198I		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-1,3	MUC4	1505	3	0			c.C12593T						scavenged	.						19.0	15.0	16.0					3																	195505858		689	1576	2265	SO:0001583	missense	4585	exon2			GAGGAAGTGTCGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12593C>T	3.37:g.195505858G>A	ENSP00000417498:p.Thr4198Ile	Somatic	120	1	0.00833333		WXS	Illumina HiSeq	Phase_I	127	4	0.0314961	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	4.623	0.115726	0.08831	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35605	1.38;1.3	.	.	.	.	.	.	.	.	T	0.19485	0.0468	N	0.14661	0.345	0.21105	N	0.999787	P	0.44090	0.826	B	0.40782	0.34	T	0.09975	-1.0650	7	.	.	.	.	6.6097	0.22745	2.0E-4:0.0:0.9998:0.0	.	4070	E7ESK3	.	I	4198	ENSP00000417498:T4198I;ENSP00000420243:T4198I	.	T	-	2	0	MUC4	196990637	0.000000	0.05858	0.017000	0.16124	0.032000	0.12392	0.289000	0.18957	0.452000	0.26830	0.074000	0.15403	ACT	.	.	none		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TUBA3C	7278	hgsc.bcm.edu	37	13	19751301	19751301	+	Silent	SNP	C	C	T	rs140548354		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr13:19751301C>T	ENST00000400113.3	-	4	926	c.822G>A	c.(820-822)ccG>ccA	p.P274P		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	274					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CTGAGATGACCGGGGCGTAGG	0.607																																					p.P274P		Atlas-SNP	.											TUBA3C,bladder,carcinoma,-2,1	TUBA3C	166	1	0			c.G822A						scavenged	.						123.0	114.0	117.0					13																	19751301		2203	4300	6503	SO:0001819	synonymous_variant	7278	exon4			GATGACCGGGGCG	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.822G>A	13.37:g.19751301C>T		Somatic	133	5	0.037594		WXS	Illumina HiSeq	Phase_I	92	8	0.0869565	NM_006001	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																			C|0.999;T|0.001	0.001	weak		0.607	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
SLC9A3	6550	hgsc.bcm.edu	37	5	480029	480029	+	Silent	SNP	C	C	T	rs147340203	byFrequency	TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr5:480029C>T	ENST00000264938.3	-	10	1578	c.1569G>A	c.(1567-1569)tcG>tcA	p.S523S	CTD-2228K2.7_ENST00000607005.1_RNA|CTD-2228K2.7_ENST00000607286.1_RNA|SLC9A3_ENST00000514375.1_Silent_p.S514S|CTD-2228K2.7_ENST00000606288.1_RNA	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	523					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			ACTTCTGGGCCGACCGTCTCA	0.592													C|||	5	0.000998403	0.0038	0.0	5008	,	,		17863	0.0		0.0	False		,,,				2504	0.0				p.S523S		Atlas-SNP	.											.	SLC9A3	89	.	0			c.G1569A						PASS	.	C		2,4404	4.2+/-10.8	0,2,2201	117.0	114.0	115.0		1569	-9.9	0.0	5	dbSNP_134	115	0,8600		0,0,4300	no	coding-synonymous	SLC9A3	NM_004174.2		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		523/835	480029	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	6550	exon10			CTGGGCCGACCGT		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.1569G>A	5.37:g.480029C>T		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	35	7	0.2	NM_004174	B7ZKR2|E9PF67|Q3MIW3	Silent	SNP	ENST00000264938.3	37	CCDS3855.1																																																																																			C|1.000;T|0.000	0.000	strong		0.592	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
LEPR	3953	hgsc.bcm.edu	37	1	66036295	66036295	+	Silent	SNP	G	G	T	rs376850470		TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr1:66036295G>T	ENST00000349533.6	+	4	365	c.180G>T	c.(178-180)tcG>tcT	p.S60S	LEPR_ENST00000406510.3_5'UTR|LEPR_ENST00000462765.1_3'UTR|LEPR_ENST00000371059.3_Silent_p.S60S|LEPR_ENST00000371060.3_Silent_p.S60S|snoU13_ENST00000459362.1_RNA|LEPR_ENST00000344610.8_Silent_p.S60S|LEPR_ENST00000371058.1_Silent_p.S60S	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		CTTCAAATTCGAATGGACATT	0.383																																					p.S60S		Atlas-SNP	.											LEPR_ENST00000349533,NS,carcinoma,0,6	LEPR	284	6	0			c.G180T						scavenged	.						124.0	122.0	123.0					1																	66036295		2203	4300	6503	SO:0001819	synonymous_variant	3953	exon4			AAATTCGAATGGA	U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.180G>T	1.37:g.66036295G>T		Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	118	3	0.0254237	NM_002303	Q6FHL5	Silent	SNP	ENST00000349533.6	37	CCDS631.1																																																																																			.	.	none		0.383	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303	
CSK	1445	hgsc.bcm.edu	37	15	75093927	75093927	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CW-01A-11D-A382-10	TCGA-FF-A7CW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	422d5ebf-9d30-4c11-b1fe-c437822f0143	22d154b9-2ceb-409b-94d1-8f44d359d3a3	g.chr15:75093927A>G	ENST00000220003.9	+	10	1607	c.878A>G	c.(877-879)aAg>aGg	p.K293R	CSK_ENST00000567571.1_Missense_Mutation_p.K293R|CSK_ENST00000309470.9_Missense_Mutation_p.K293R|CSK_ENST00000439220.2_Missense_Mutation_p.K293R	NM_004383.2	NP_004374.1	P41240	CSK_HUMAN	c-src tyrosine kinase	293	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adherens junction organization (GO:0034332)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cellular response to peptide hormone stimulus (GO:0071375)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of kinase activity (GO:0033673)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of phagocytosis (GO:0050765)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein C-terminus binding (GO:0008022)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|lung(2)	3						TGTCTCCTCAAGTTCTCGCTG	0.627																																					p.K293R		Atlas-SNP	.											.	CSK	43	.	0			c.A878G						PASS	.						106.0	86.0	93.0					15																	75093927		2197	4296	6493	SO:0001583	missense	1445	exon11			TCCTCAAGTTCTC		CCDS10269.1	15q24.1	2013-02-14			ENSG00000103653	ENSG00000103653	2.7.10.1	"""SH2 domain containing"""	2444	protein-coding gene	gene with protein product		124095				1377109	Standard	NM_004383		Approved		uc010bka.3	P41240	OTTHUMG00000142814	ENST00000220003.9:c.878A>G	15.37:g.75093927A>G	ENSP00000220003:p.Lys293Arg	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	69	8	0.115942	NM_001127190	Q2M3N2|Q6FGZ6	Missense_Mutation	SNP	ENST00000220003.9	37	CCDS10269.1	.	.	.	.	.	.	.	.	.	.	a	13.88	2.368850	0.42003	.	.	ENSG00000103653	ENST00000220003;ENST00000439220;ENST00000451345;ENST00000309470	D;D;D	0.82984	-1.67;-1.67;-1.67	5.27	5.27	0.74061	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.207772	0.48767	D	0.000163	T	0.64193	0.2576	N	0.02111	-0.68	0.42521	D	0.993006	B	0.33280	0.405	B	0.32928	0.155	T	0.72228	-0.4354	10	0.87932	D	0	-24.1195	14.1618	0.65452	1.0:0.0:0.0:0.0	.	293	P41240	CSK_HUMAN	R	293;293;242;293	ENSP00000220003:K293R;ENSP00000414764:K293R;ENSP00000438808:K293R	ENSP00000220003:K293R	K	+	2	0	CSK	72880980	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.845000	0.69437	1.990000	0.58119	0.529000	0.55759	AAG	.	.	none		0.627	CSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286398.2	NM_004383	
