#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NEFH	4744	hgsc.bcm.edu	37	22	29885581	29885604	+	In_Frame_Del	DEL	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs79235463|rs200984527|rs370803228	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr22:29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENST00000310624.6	+	4	1985_2008	c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	c.(1951-1977)aaggccaagtccccagagaaggaagag>aag	p.AKSPEKEE652del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	658	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCTGAGAAGGCCAAGTCCCCAGAGAAGGAAGAGGCCAAGTC	0.562																																					p.651_658del		Atlas-Indel	.											.	NEFH	178	.	0			c.1951_1974del						PASS	.																																			SO:0001651	inframe_deletion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	22.37:g.29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENSP00000311997:p.Ala652_Glu659del	Somatic	262	0	0		WXS	Illumina HiSeq	Phase_I	198	43	0.217172	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	weak		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
MUC6	4588	hgsc.bcm.edu	37	11	1017440	1017632	+	Frame_Shift_Del	DEL	CGACGTGGTGTGGGCCACAGGGGTTCTGGTGCCTGTACTGGTGTGGTTGGGGGTGATGCTGGTGGTAGAAGTTGAGGTGACTTCAGGATGGTGTGTGGAGGAAGTGTGTGAATGTAGGGATGTAGAGGTTTTGGCCGTGCTAAATGAGCTTCGGGATTGGCTGGTCCCACTGGTGGTCACTGTCATTGGTGGG	CGACGTGGTGTGGGCCACAGGGGTTCTGGTGCCTGTACTGGTGTGGTTGGGGGTGATGCTGGTGGTAGAAGTTGAGGTGACTTCAGGATGGTGTGTGGAGGAAGTGTGTGAATGTAGGGATGTAGAGGTTTTGGCCGTGCTAAATGAGCTTCGGGATTGGCTGGTCCCACTGGTGGTCACTGTCATTGGTGGG	-	rs569940344|rs529918366|rs200644196|rs564856663|rs76886285|rs75533660|rs201522029|rs201325807|rs35868469|rs201812614|rs76707565|rs202040290|rs201376676|rs201054567|rs575890149|rs77815355|rs558521321|rs78729877|rs77216712|rs112313736|rs111641154|rs201198887|rs199592093|rs80266715|rs79986665|rs542420852|rs200995870|rs202206004|rs557325875|rs111594665|rs536994070|rs534774807|rs112553306|rs79037833|rs372353242|rs112874139|rs112510411|rs76222533|rs201997835|rs199869567	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	CGACGTGGTGTGGGCCACAGGGGTTCTGGTGCCTGTACTGGTGTGGTTGGGGGTGATGCTGGTGGTAGAAGTTGAGGTGACTTCAGGATGGTGTGTGGAGGAAGTGTGTGAATGTAGGGATGTAGAGGTTTTGGCCGTGCTAAATGAGCTTCGGGATTGGCTGGTCCCACTGGTGGTCACTGTCATTGGTGGG	CGACGTGGTGTGGGCCACAGGGGTTCTGGTGCCTGTACTGGTGTGGTTGGGGGTGATGCTGGTGGTAGAAGTTGAGGTGACTTCAGGATGGTGTGTGGAGGAAGTGTGTGAATGTAGGGATGTAGAGGTTTTGGCCGTGCTAAATGAGCTTCGGGATTGGCTGGTCCCACTGGTGGTCACTGTCATTGGTGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr11:1017440_1017632delCGACGTGGTGTGGGCCACAGGGGTTCTGGTGCCTGTACTGGTGTGGTTGGGGGTGATGCTGGTGGTAGAAGTTGAGGTGACTTCAGGATGGTGTGTGGAGGAAGTGTGTGAATGTAGGGATGTAGAGGTTTTGGCCGTGCTAAATGAGCTTCGGGATTGGCTGGTCCCACTGGTGGTCACTGTCATTGGTGGG	ENST00000421673.2	-	31	5219_5411	c.5169_5361delCCCACCAATGACAGTGACCACCAGTGGGACCAGCCAATCCCGAAGCTCATTTAGCACGGCCAAAACCTCTACATCCCTACATTCACACACTTCCTCCACACACCATCCTGAAGTCACCTCAACTTCTACCACCAGCATCACCCCCAACCACACCAGTACAGGCACCAGAACCCCTGTGGCCCACACCACGTCG	c.(5167-5361)accccaccaatgacagtgaccaccagtgggaccagccaatcccgaagctcatttagcacggccaaaacctctacatccctacattcacacacttcctccacacaccatcctgaagtcacctcaacttctaccaccagcatcacccccaaccacaccagtacaggcaccagaacccctgtggcccacaccacgtcgfs	p.TPPMTVTTSGTSQSRSSFSTAKTSTSLHSHTSSTHHPEVTSTSTTSITPNHTSTGTRTPVAHTTS1723fs		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1723	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.T1745A(2)|p.T1729T(2)|p.Q1735H(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGCTGGTGGCCGACGTGGTGTGGGCCACAGGGGTTCTGGTGCCTGTACTGGTGTGGTTGGGGGTGATGCTGGTGGTAGAAGTTGAGGTGACTTCAGGATGGTGTGTGGAGGAAGTGTGTGAATGTAGGGATGTAGAGGTTTTGGCCGTGCTAAATGAGCTTCGGGATTGGCTGGTCCCACTGGTGGTCACTGTCATTGGTGGGGTTCCTGTAC	0.562																																					p.1724_1788del		Pindel	.											MUC6_ENST00000421673,NS,carcinoma,0,2	MUC6	408	2	5	Substitution - Missense(3)|Substitution - coding silent(2)	kidney(4)|prostate(1)	c.5170_5362del						PASS	.																																			SO:0001589	frameshift_variant	4588	exon31			.	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5169_5361delCCCACCAATGACAGTGACCACCAGTGGGACCAGCCAATCCCGAAGCTCATTTAGCACGGCCAAAACCTCTACATCCCTACATTCACACACTTCCTCCACACACCATCCTGAAGTCACCTCAACTTCTACCACCAGCATCACCCCCAACCACACCAGTACAGGCACCAGAACCCCTGTGGCCCACACCACGTCG	11.37:g.1017440_1017632delCGACGTGGTGTGGGCCACAGGGGTTCTGGTGCCTGTACTGGTGTGGTTGGGGGTGATGCTGGTGGTAGAAGTTGAGGTGACTTCAGGATGGTGTGTGGAGGAAGTGTGTGAATGTAGGGATGTAGAGGTTTTGGCCGTGCTAAATGAGCTTCGGGATTGGCTGGTCCCACTGGTGGTCACTGTCATTGGTGGG	ENSP00000406861:p.Thr1723fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	11	11	1.000	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Frame_Shift_Del	DEL	ENST00000421673.2	37	CCDS44513.1																																																																																			.	.	none		0.562	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
AKR1C4	1109	hgsc.bcm.edu	37	10	5248268	5248268	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr10:5248268G>A	ENST00000380448.1	+	7	731	c.478G>A	c.(478-480)Gcc>Acc	p.A160T	AKR1C4_ENST00000263126.1_Missense_Mutation_p.A160T			P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4	160					androgen metabolic process (GO:0008209)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|bile acid transmembrane transporter activity (GO:0015125)|chlordecone reductase activity (GO:0047743)|electron carrier activity (GO:0009055)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|retinal dehydrogenase activity (GO:0001758)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	18						TGCAGGATTGGCCAAGTCCAT	0.493																																					p.A160T		Atlas-SNP	.											.	AKR1C4	57	.	0			c.G478A						PASS	.						160.0	140.0	147.0					10																	5248268		2203	4300	6503	SO:0001583	missense	1109	exon5			GGATTGGCCAAGT	M33375	CCDS7064.1	10p15.1	2012-12-04	2012-12-04		ENSG00000198610	ENSG00000198610	1.1.1.225	"""Aldo-keto reductases"""	387	protein-coding gene	gene with protein product	"""chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4"""	600451	"""aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4)"""	CHDR		7789999	Standard	NM_001818		Approved	DD4, HAKRA, C11, 3-alpha-HSD, CDR, MGC22581	uc001ihw.2	P17516	OTTHUMG00000017591	ENST00000380448.1:c.478G>A	10.37:g.5248268G>A	ENSP00000369814:p.Ala160Thr	Somatic	181	0	0		WXS	Illumina HiSeq	Phase_I	143	11	0.0769231	NM_001818	Q5T6A3|Q8WW84|Q9NS54	Missense_Mutation	SNP	ENST00000380448.1	37	CCDS7064.1	.	.	.	.	.	.	.	.	.	.	G	5.716	0.316610	0.10845	.	.	ENSG00000198610	ENST00000380448;ENST00000263126	T;T	0.52754	0.65;0.65	3.16	1.2	0.21068	Aldo/keto reductase, conserved site (1);NADP-dependent oxidoreductase domain (3);	0.432537	0.20662	N	0.088006	T	0.23649	0.0572	N	0.11201	0.11	0.33351	D	0.571106	B	0.12013	0.005	B	0.18263	0.021	T	0.15896	-1.0421	10	0.25106	T	0.35	.	6.7199	0.23325	0.2549:0.0:0.7451:0.0	.	160	P17516	AK1C4_HUMAN	T	160	ENSP00000369814:A160T;ENSP00000263126:A160T	ENSP00000263126:A160T	A	+	1	0	AKR1C4	5238268	0.194000	0.23325	0.735000	0.30896	0.146000	0.21551	0.134000	0.15932	0.019000	0.15079	0.313000	0.20887	GCC	.	.	none		0.493	AKR1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046543.2	NM_001818	
SPATA31A3	727830	hgsc.bcm.edu	37	9	40702760	40702760	+	Missense_Mutation	SNP	T	T	G	rs192661010	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr9:40702760T>G	ENST00000356699.5	+	4	446	c.417T>G	c.(415-417)caT>caG	p.H139Q	SPATA31A3_ENST00000463536.1_3'UTR|RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	139	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGTCCTCTCATGAGCCTATGG	0.597													T|||	514	0.102636	0.0885	0.1009	5008	,	,		20141	0.003		0.2286	False		,,,				2504	0.0961				p.H139Q		Atlas-SNP	.											FAM75A3_ENST00000356699,NS,carcinoma,+2,2	.	.	2	0			c.T417G						scavenged	.	T	GLN/HIS	382,3416		13,356,1530	53.0	63.0	60.0		417	-3.7	0.0	9	dbSNP_134	60	1741,6417		82,1577,2420	no	missense	FAM75A3	NM_001083124.1	24	95,1933,3950	GG,GT,TT		21.341,10.0579,17.7568	possibly-damaging	139/1348	40702760	2123,9833	1899	4079	5978	SO:0001583	missense	727830	exon4			CTCTCATGAGCCT			9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.417T>G	9.37:g.40702760T>G	ENSP00000349132:p.His139Gln	Somatic	437	1	0.00228833		WXS	Illumina HiSeq	Phase_I	296	5	0.0168919	NM_001083124		Missense_Mutation	SNP	ENST00000356699.5	37	CCDS47969.1	.	.	.	.	.	.	.	.	.	.	T	1.786	-0.480697	0.04383	0.100579	0.21341	ENSG00000147926	ENST00000356699	T	0.03889	3.77	1.86	-3.73	0.04398	.	1.943840	0.02631	N	0.104336	T	0.00012	0.0000	N	0.02916	-0.46	0.80722	P	0.0	B	0.12013	0.005	B	0.11329	0.006	T	0.45760	-0.9239	9	0.25106	T	0.35	0.3542	0.1983	0.00142	0.2674:0.2166:0.2878:0.2282	.	139	Q5VYP0	F75A3_HUMAN	Q	139	ENSP00000349132:H139Q	ENSP00000349132:H139Q	H	+	3	2	FAM75A3	40692760	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.285000	0.02791	-1.013000	0.03383	-0.836000	0.03065	CAT	T|0.744;G|0.256	0.256	strong		0.597	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036919.1	NM_001083124	
CHD5	26038	hgsc.bcm.edu	37	1	6196687	6196687	+	Silent	SNP	G	G	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:6196687G>T	ENST00000262450.3	-	17	2685	c.2586C>A	c.(2584-2586)gtC>gtA	p.V862V	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		AGCTGTTTAAGACCCTAAAAA	0.602																																					p.V862V		Atlas-SNP	.											.	CHD5	267	.	0			c.C2586A						PASS	.						43.0	53.0	50.0					1																	6196687		2203	4300	6503	SO:0001819	synonymous_variant	26038	exon17			GTTTAAGACCCTA	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.2586C>A	1.37:g.6196687G>T		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	72	7	0.0972222	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Silent	SNP	ENST00000262450.3	37	CCDS57.1																																																																																			.	.	none		0.602	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
IGSF3	3321	hgsc.bcm.edu	37	1	117142613	117142613	+	Missense_Mutation	SNP	C	C	T	rs76151115	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:117142613C>T	ENST00000369486.3	-	7	2744	c.1979G>A	c.(1978-1980)cGa>cAa	p.R660Q	IGSF3_ENST00000318837.6_Missense_Mutation_p.R680Q|IGSF3_ENST00000369483.1_Missense_Mutation_p.R680Q	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	660	Ig-like C2-type 5.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		CTCCGCCAGTCGCGTCCAGGT	0.612																																					p.R680Q		Atlas-SNP	.											.	IGSF3	294	.	0			c.G2039A						PASS	.						69.0	54.0	59.0					1																	117142613		2203	4300	6503	SO:0001583	missense	3321	exon8			GCCAGTCGCGTCC	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.1979G>A	1.37:g.117142613C>T	ENSP00000358498:p.Arg660Gln	Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	46	10	0.217391	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.979753	0.34942	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.03212	4.01;4.04;4.04	4.56	2.7	0.31948	Immunoglobulin subtype (1);	0.270543	0.31010	N	0.008430	T	0.01353	0.0044	L	0.29908	0.895	0.36040	D	0.840027	D;D;D	0.59767	0.982;0.986;0.986	B;P;P	0.45310	0.345;0.476;0.476	T	0.64071	-0.6493	10	0.22706	T	0.39	-28.9658	8.7768	0.34767	0.0:0.8142:0.0:0.1858	.	680;660;680	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	Q	660;680;680	ENSP00000358498:R660Q;ENSP00000358495:R680Q;ENSP00000321184:R680Q	ENSP00000321184:R680Q	R	-	2	0	IGSF3	116944136	0.789000	0.28775	0.602000	0.28890	0.526000	0.34562	2.194000	0.42668	0.550000	0.28991	-0.384000	0.06662	CGA	C|0.967;T|0.033	0.033	strong		0.612	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
WDR87	83889	hgsc.bcm.edu	37	19	38384696	38384696	+	Silent	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr19:38384696C>T	ENST00000303868.5	-	4	1754	c.1530G>A	c.(1528-1530)cgG>cgA	p.R510R	WDR87_ENST00000447313.2_Silent_p.R549R	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	510										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TGGCGAGAGGCCGCAGTTGTA	0.512																																					p.R510R		Atlas-SNP	.											.	WDR87	191	.	0			c.G1530A						PASS	.						65.0	61.0	62.0					19																	38384696		692	1591	2283	SO:0001819	synonymous_variant	83889	exon4			GAGAGGCCGCAGT	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.1530G>A	19.37:g.38384696C>T		Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	114	8	0.0701754	NM_031951	Q9BWV9	Silent	SNP	ENST00000303868.5	37	CCDS46063.1																																																																																			.	.	none		0.512	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
CD7	924	hgsc.bcm.edu	37	17	80274183	80274183	+	Missense_Mutation	SNP	G	G	C	rs199986856		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:80274183G>C	ENST00000312648.3	-	3	606	c.500C>G	c.(499-501)gCc>gGc	p.A167G	CD7_ENST00000578509.1_Missense_Mutation_p.A67G|CD7_ENST00000583376.1_Missense_Mutation_p.A67G|CD7_ENST00000584284.1_Missense_Mutation_p.A167G	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	167	4 X 9 AA tandem repeats, potential spacer function.				homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			GAGGGCAGAGGCTGTCTGCGG	0.711																																					p.A167G	Pancreas(45;804 1068 19702 28207 28798)	Atlas-SNP	.											CD7,rectum,carcinoma,0,2	CD7	25	2	0			c.C500G						scavenged	.																																			SO:0001583	missense	924	exon3			GCAGAGGCTGTCT	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.500C>G	17.37:g.80274183G>C	ENSP00000312027:p.Ala167Gly	Somatic	87	1	0.0114943		WXS	Illumina HiSeq	Phase_I	50	13	0.26	NM_006137		Missense_Mutation	SNP	ENST00000312648.3	37	CCDS11807.1	.	.	.	.	.	.	.	.	.	.	G	1.766	-0.485462	0.04352	.	.	ENSG00000173762	ENST00000312648	T	0.25912	1.77	0.122	-0.245	0.13027	.	.	.	.	.	T	0.08537	0.0212	N	0.08118	0	0.20926	N	0.999825	P;P	0.38110	0.618;0.618	B;B	0.28638	0.092;0.092	T	0.27088	-1.0084	9	0.21540	T	0.41	.	4.5003	0.11860	0.3195:0.0:0.6805:0.0	.	167;167	Q29VG3;P09564	.;CD7_HUMAN	G	167	ENSP00000312027:A167G	ENSP00000312027:A167G	A	-	2	0	CD7	77867472	0.013000	0.17824	0.007000	0.13788	0.007000	0.05969	0.000000	0.12993	-1.039000	0.03275	-1.031000	0.02408	GCC	G|0.999;A|0.001	.	alt		0.711	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137	
EFHC1	114327	hgsc.bcm.edu	37	6	52344014	52344014	+	Silent	SNP	C	C	G			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr6:52344014C>G	ENST00000371068.5	+	8	1561	c.1458C>G	c.(1456-1458)ggC>ggG	p.G486G	EFHC1_ENST00000538167.1_Silent_p.G467G|EFHC1_ENST00000433625.2_Silent_p.G395G	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	486	DM10 3. {ECO:0000255|PROSITE- ProRule:PRU00665}.					axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					TCTACTATGGCCCCAGTGACT	0.443																																					p.G486G		Atlas-SNP	.											.	EFHC1	68	.	0			c.C1458G						PASS	.						123.0	112.0	115.0					6																	52344014		2203	4300	6503	SO:0001819	synonymous_variant	114327	exon8			CTATGGCCCCAGT	AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.1458C>G	6.37:g.52344014C>G		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	60	5	0.0833333	NM_018100	B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Silent	SNP	ENST00000371068.5	37	CCDS4942.1																																																																																			.	.	none		0.443	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040905.2	NM_018100	
SMARCA2	6595	hgsc.bcm.edu	37	9	2081900	2081900	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr9:2081900G>A	ENST00000382203.1	+	15	2462	c.2253G>A	c.(2251-2253)atG>atA	p.M751I	SMARCA2_ENST00000382194.1_Missense_Mutation_p.M751I|SMARCA2_ENST00000349721.2_Missense_Mutation_p.M751I|SMARCA2_ENST00000357248.2_Missense_Mutation_p.M751I			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	751	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CCGATGAAATGGGGCTTGGAA	0.433																																					p.M751I		Atlas-SNP	.											SMARCA2_ENST00000349721,NS,carcinoma,+2,2	SMARCA2	313	2	0			c.G2253A						PASS	.						217.0	181.0	193.0					9																	2081900		2203	4300	6503	SO:0001583	missense	6595	exon15			TGAAATGGGGCTT	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.2253G>A	9.37:g.2081900G>A	ENSP00000371638:p.Met751Ile	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	92	11	0.119565	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878109	0.72294	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	D;D;D;D	0.94497	-3.44;-3.44;-3.44;-3.44	5.41	5.41	0.78517	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98801	0.9596	H	0.99634	4.67	0.80722	D	1	D;P;P	0.89917	1.0;0.908;0.925	D;D;D	0.91635	0.999;0.922;0.954	D	0.99395	1.0926	10	0.87932	D	0	-33.1543	19.1951	0.93684	0.0:0.0:1.0:0.0	.	352;751;751	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	I	751	ENSP00000265773:M751I;ENSP00000349788:M751I;ENSP00000371638:M751I;ENSP00000371629:M751I	ENSP00000265773:M751I	M	+	3	0	SMARCA2	2071900	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.552000	0.86080	0.591000	0.81541	ATG	.	.	none		0.433	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
MUC4	4585	hgsc.bcm.edu	37	3	195505836	195505836	+	Silent	SNP	G	G	A	rs369326402	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr3:195505836G>A	ENST00000463781.3	-	2	13074	c.12615C>T	c.(12613-12615)caC>caT	p.H4205H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.H4205H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H4205Q(10)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597													.|||	29	0.00579073	0.0129	0.0014	5008	,	,		13455	0.002		0.004	False		,,,				2504	0.0051				p.H4205H		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,19	MUC4	1505	19	10	Substitution - Missense(10)	kidney(4)|prostate(3)|urinary_tract(2)|endometrium(1)	c.C12615T						scavenged	.						15.0	14.0	14.0					3																	195505836		687	1573	2260	SO:0001819	synonymous_variant	4585	exon2			GGTGGCGTGACCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12615C>T	3.37:g.195505836G>A		Somatic	63	1	0.015873		WXS	Illumina HiSeq	Phase_I	71	8	0.112676	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			A|1.000;|0.000	1.000	alt		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CDH23	64072	hgsc.bcm.edu	37	10	73537483	73537483	+	Missense_Mutation	SNP	C	C	T	rs370762269	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr10:73537483C>T	ENST00000224721.6	+	38	4912	c.4907C>T	c.(4906-4908)gCg>gTg	p.A1636V		NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	1631	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						AATGATAACGCGCCCATGTTC	0.587													C|||	5	0.000998403	0.0	0.0	5008	,	,		20989	0.0		0.0	False		,,,				2504	0.0051				p.A1631V		Atlas-SNP	.											.	CDH23	365	.	0			c.C4892T						PASS	.	C	VAL/ALA	0,4192		0,0,2096	52.0	54.0	53.0		4892	5.8	0.0	10		53	3,8429		0,3,4213	no	missense	CDH23	NM_022124.5	64	0,3,6309	TT,TC,CC		0.0356,0.0,0.0238	benign	1631/3355	73537483	3,12621	2096	4216	6312	SO:0001583	missense	64072	exon37			ATAACGCGCCCAT	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.4907C>T	10.37:g.73537483C>T	ENSP00000224721:p.Ala1636Val	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	69	6	0.0869565	NM_022124	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37		.	.	.	.	.	.	.	.	.	.	C	15.30	2.791860	0.50102	0.0	3.56E-4	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721	.	.	.	5.75	5.75	0.90469	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.119943	0.56097	D	0.000029	T	0.66187	0.2764	L	0.58510	1.815	0.80722	D	1	B	0.13145	0.007	B	0.09377	0.004	T	0.59883	-0.7370	9	0.37606	T	0.19	.	19.938	0.97149	0.0:1.0:0.0:0.0	.	1631	Q9H251	CAD23_HUMAN	V	1636;1631;1634	.	ENSP00000224721:A1636V	A	+	2	0	CDH23	73207489	0.989000	0.36119	0.034000	0.17996	0.188000	0.23474	4.843000	0.62838	2.732000	0.93576	0.650000	0.86243	GCG	.	.	none		0.587	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
TBC1D29	26083	hgsc.bcm.edu	37	17	28890361	28890361	+	Missense_Mutation	SNP	G	G	A	rs372824382		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:28890361G>A	ENST00000580161.1	+	6	2868	c.371G>A	c.(370-372)cGg>cAg	p.R124Q	RP11-218M11.1_ENST00000563063.1_lincRNA|TBC1D29_ENST00000579181.1_Missense_Mutation_p.R124Q|TBC1D29_ENST00000584297.1_3'UTR			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	124							Rab GTPase activator activity (GO:0005097)	p.R124Q(1)		breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				GCCTTGAGCCGGGGAGACAAG	0.567																																					p.R124Q		Atlas-SNP	.											TBC1D29,NS,carcinoma,0,3	TBC1D29	19	3	1	Substitution - Missense(1)	prostate(1)	c.G371A						scavenged	.						78.0	68.0	71.0					17																	28890361		2203	4300	6503	SO:0001583	missense	26083	exon5			TGAGCCGGGGAGA	BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.371G>A	17.37:g.28890361G>A	ENSP00000462799:p.Arg124Gln	Somatic	193	0	0		WXS	Illumina HiSeq	Phase_I	153	2	0.0130719	NM_015594		Missense_Mutation	SNP	ENST00000580161.1	37	CCDS32606.1	.	.	.	.	.	.	.	.	.	.	.	2.991	-0.208219	0.06180	.	.	ENSG00000197689	ENST00000329040	.	.	.	.	.	.	.	.	.	.	.	T	0.14399	0.0348	N	0.08118	0	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.14559	-1.0468	7	0.33141	T	0.24	.	3.9265	0.09265	0.6657:0.0:0.3343:0.0	.	124	Q9UFV1	TBC29_HUMAN	Q	124	.	ENSP00000330052:R124Q	R	+	2	0	TBC1D29	25914487	0.090000	0.21635	0.024000	0.17045	0.025000	0.11179	-1.180000	0.03088	-1.657000	0.01492	-1.643000	0.00768	CGG	.	.	alt		0.567	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443632.1	NM_015594	
SIGLEC5	8778	hgsc.bcm.edu	37	19	52132668	52132668	+	Missense_Mutation	SNP	T	T	C	rs34553740		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr19:52132668T>C	ENST00000534261.2	-	4	1042	c.643A>G	c.(643-645)Atg>Gtg	p.M215V	SIGLEC5_ENST00000222107.4_Missense_Mutation_p.M215V|SIGLEC5_ENST00000599649.1_Missense_Mutation_p.M215V|SIGLEC5_ENST00000570106.2_Missense_Mutation_p.M215V|SIGLEC5_ENST00000429354.3_Missense_Mutation_p.M215V			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	215	Ig-like C2-type 1.		M -> V (in dbSNP:rs1807124).		cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.M215V(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		TGGCGTTTCATCTGACAGGTG	0.637																																					p.M215V		Atlas-SNP	.											SIGLEC5,NS,carcinoma,0,1	SIGLEC5	67	1	1	Substitution - Missense(1)	prostate(1)	c.A643G						scavenged	.						122.0	109.0	113.0					19																	52132668		2203	4300	6503	SO:0001583	missense	8778	exon3			GTTTCATCTGACA	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.643A>G	19.37:g.52132668T>C	ENSP00000473238:p.Met215Val	Somatic	388	3	0.00773196		WXS	Illumina HiSeq	Phase_I	343	9	0.0262391	NM_003830		Missense_Mutation	SNP	ENST00000534261.2	37	CCDS33088.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.691237	0.00731	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	T;T	0.02050	4.48;4.48	3.69	2.65	0.31530	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.42682	N	0.000676	T	0.00412	0.0013	N	0.00023	-2.71	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44651	-0.9314	10	0.02654	T	1	.	6.1979	0.20559	0.0:0.7599:0.0:0.2401	rs34553740	215	O15389	SIGL5_HUMAN	V	215	ENSP00000222107:M215V;ENSP00000415200:M215V	ENSP00000222107:M215V	M	-	1	0	SIGLEC5	56824480	0.020000	0.18652	0.004000	0.12327	0.034000	0.12701	1.066000	0.30604	0.367000	0.24454	-0.320000	0.08662	ATG	.	.	weak		0.637	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830	
TNFAIP3	7128	hgsc.bcm.edu	37	6	138200148	138200148	+	Silent	SNP	A	A	G	rs202233466		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr6:138200148A>G	ENST00000237289.4	+	7	1632	c.1566A>G	c.(1564-1566)caA>caG	p.Q522Q		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	522	Interaction with TNIP1. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		GGAAGTGCCAAGCCTGCCTCC	0.572			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																p.Q522Q	GBM(130;153 1739 22295 28918 47987)	Atlas-SNP	.		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	.	TNFAIP3	340	.	25	Whole gene deletion(25)	haematopoietic_and_lymphoid_tissue(25)	c.A1566G						PASS	.						74.0	79.0	77.0					6																	138200148		2203	4300	6503	SO:0001819	synonymous_variant	7128	exon7			GTGCCAAGCCTGC	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1566A>G	6.37:g.138200148A>G		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	61	4	0.0655738	NM_001270507	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Silent	SNP	ENST00000237289.4	37	CCDS5187.1																																																																																			A|0.999;G|0.001	0.001	weak		0.572	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1		
MUC4	4585	hgsc.bcm.edu	37	3	195505822	195505822	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr3:195505822G>T	ENST00000463781.3	-	2	13088	c.12629C>A	c.(12628-12630)cCt>cAt	p.P4210H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P4210H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGAAGAGGGGT	0.592																																					p.P4210H		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	0			c.C12629A						scavenged	.						18.0	16.0	17.0					3																	195505822		688	1572	2260	SO:0001583	missense	4585	exon2			GTGACAGGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12629C>A	3.37:g.195505822G>T	ENSP00000417498:p.Pro4210His	Somatic	69	2	0.0289855		WXS	Illumina HiSeq	Phase_I	69	9	0.130435	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	2.410	-0.335654	0.05278	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.37058	1.22;1.26	.	.	.	.	.	.	.	.	T	0.32912	0.0845	N	0.14661	0.345	0.09310	N	0.999993	D	0.76494	0.999	D	0.72338	0.977	T	0.14117	-1.0484	7	.	.	.	.	2.6645	0.05037	0.4931:0.0:0.5069:0.0	.	4082	E7ESK3	.	H	4210	ENSP00000417498:P4210H;ENSP00000420243:P4210H	.	P	-	2	0	MUC4	196990601	.	.	0.023000	0.16930	0.027000	0.11550	.	.	0.088000	0.17205	0.089000	0.15464	CCT	.	.	none		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ALPK2	115701	hgsc.bcm.edu	37	18	56171335	56171335	+	Silent	SNP	C	C	T	rs199833082	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr18:56171335C>T	ENST00000361673.3	-	11	6288	c.6075G>A	c.(6073-6075)ccG>ccA	p.P2025P		NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	2025	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CTGTAGCATACGGGATATTGT	0.458													C|||	2	0.000399361	0.0	0.0	5008	,	,		20784	0.001		0.001	False		,,,				2504	0.0				p.P2025P		Atlas-SNP	.											ALPK2_ENST00000361673,NS,carcinoma,0,2	ALPK2	487	2	0			c.G6075A						PASS	.						151.0	147.0	148.0					18																	56171335		2203	4300	6503	SO:0001819	synonymous_variant	115701	exon11			AGCATACGGGATA	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.6075G>A	18.37:g.56171335C>T		Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	88	7	0.0795455	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	ENST00000361673.3	37	CCDS11966.2																																																																																			C|1.000;T|0.000	0.000	strong		0.458	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
NOTCH2	4853	hgsc.bcm.edu	37	1	120539668	120539668	+	Missense_Mutation	SNP	T	T	A	rs200464440		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:120539668T>A	ENST00000256646.2	-	4	922	c.703A>T	c.(703-705)Acc>Tcc	p.T235S	NOTCH2_ENST00000602566.1_Missense_Mutation_p.T196S	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	235	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCCGACAGGTGCCTCCATTG	0.572			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.T235S		Atlas-SNP	.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	NOTCH2_ENST00000369342,NS,carcinoma,0,2	NOTCH2	348	2	0			c.A703T						scavenged	.						50.0	40.0	43.0					1																	120539668		2203	4299	6502	SO:0001583	missense	4853	exon4	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GACAGGTGCCTCC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.703A>T	1.37:g.120539668T>A	ENSP00000256646:p.Thr235Ser	Somatic	276	5	0.0181159		WXS	Illumina HiSeq	Phase_I	228	6	0.0263158	NM_001200001	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.508758	0.85282	.	.	ENSG00000134250	ENST00000256646;ENST00000539617;ENST00000401649;ENST00000369342	T	0.33438	1.41	5.83	5.83	0.93111	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.38897	U	0.001527	T	0.42471	0.1204	L	0.58510	1.815	0.80722	D	1	P;D;D	0.71674	0.924;0.998;0.965	P;D;P	0.77004	0.585;0.989;0.834	T	0.25082	-1.0142	10	0.41790	T	0.15	.	15.3661	0.74523	0.0:0.0:0.0:1.0	.	196;235;235	D2WEZ3;Q6IQ50;Q04721	.;.;NOTC2_HUMAN	S	235;196;208;196	ENSP00000256646:T235S	ENSP00000256646:T235S	T	-	1	0	NOTCH2	120341191	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.185000	0.72013	2.216000	0.71823	0.477000	0.44152	ACC	.	.	weak		0.572	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
SDHC	6391	hgsc.bcm.edu	37	1	161326591	161326591	+	Silent	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:161326591C>T	ENST00000367975.2	+	5	515	c.366C>T	c.(364-366)ttC>ttT	p.F122F	SDHC_ENST00000342751.4_Intron|SDHC_ENST00000392169.2_Silent_p.F69F|SDHC_ENST00000513009.1_Intron|SDHC_ENST00000470743.3_3'UTR|SDHC_ENST00000432287.2_Silent_p.F88F	NM_003001.3	NP_002992.1	Q99643	C560_HUMAN	succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa	122					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)|respiratory chain complex II (GO:0045273)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|succinate dehydrogenase activity (GO:0000104)			urinary_tract(1)	1	all_cancers(52;6.96e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Succinic acid(DB00139)	CACTTGTCTTCCCTCTCATGT	0.483			"""Mis, N, F"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Carney-Stratakis syndrome																												p.F122F		Atlas-SNP	.	yes	Rec		Familial paraganglioma	1	1q21	6391	"""succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa"""		O	.	SDHC	19	.	0			c.C366T						PASS	.						170.0	158.0	162.0					1																	161326591		2203	4300	6503	SO:0001819	synonymous_variant	6391	exon5	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	TGTCTTCCCTCTC	D49737	CCDS1230.1, CCDS41431.1, CCDS41432.1, CCDS44263.1, CCDS60330.1	1q23.3	2014-09-17	2002-08-29		ENSG00000143252	ENSG00000143252		"""Mitochondrial respiratory chain complex / Complex II"""	10682	protein-coding gene	gene with protein product		602413	"""succinate dehydrogenase complex, subunit C, integral membrane protein, 15kD"""	PGL3		9533030, 12658451	Standard	NM_001278172		Approved		uc001gag.3	Q99643	OTTHUMG00000034468	ENST00000367975.2:c.366C>T	1.37:g.161326591C>T		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	83	6	0.0722892	NM_003001	O75609|Q3C259|Q3C2D8|Q3C2H4|Q5VTH3	Silent	SNP	ENST00000367975.2	37	CCDS1230.1																																																																																			.	.	none		0.483	SDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083316.2	NM_003001	
SLX4	84464	hgsc.bcm.edu	37	16	3633415	3633415	+	Missense_Mutation	SNP	G	G	T	rs140844106	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr16:3633415G>T	ENST00000294008.3	-	14	5476	c.4836C>A	c.(4834-4836)gaC>gaA	p.D1612E	RP11-461A8.1_ENST00000573982.1_lincRNA	NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	1612	Interaction with MUS81.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						ACTGGCTCTCGTCCTCGGAGT	0.602								Direct reversal of damage																													p.D1612E		Atlas-SNP	.											.	SLX4	173	.	0			c.C4836A						PASS	.						89.0	85.0	86.0					16																	3633415		2197	4300	6497	SO:0001583	missense	84464	exon14			GCTCTCGTCCTCG	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.4836C>A	16.37:g.3633415G>T	ENSP00000294008:p.Asp1612Glu	Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	99	4	0.040404	NM_032444	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	37	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	G	14.49	2.550284	0.45383	.	.	ENSG00000188827	ENST00000294008	T	0.01279	5.06	5.64	-11.3	0.00108	.	0.338393	0.30830	N	0.008795	T	0.00754	0.0025	L	0.33245	0.995	0.21064	N	0.999799	P	0.38020	0.615	B	0.28638	0.092	T	0.35624	-0.9781	10	0.30078	T	0.28	.	9.2116	0.37322	0.5432:0.2303:0.2265:0.0	.	1612	Q8IY92	SLX4_HUMAN	E	1612	ENSP00000294008:D1612E	ENSP00000294008:D1612E	D	-	3	2	SLX4	3573416	0.000000	0.05858	0.004000	0.12327	0.552000	0.35366	-2.093000	0.01353	-1.628000	0.01548	-0.238000	0.12139	GAC	G|1.000;A|0.000	.	alt		0.602	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
DLX6	1750	hgsc.bcm.edu	37	7	96635385	96635385	+	Splice_Site	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr7:96635385G>A	ENST00000007660.5	+	1	95		c.e1+1		DLX6-AS1_ENST00000430404.2_RNA|DLX6-AS1_ENST00000458352.2_RNA|DLX6_ENST00000555308.1_5'Flank|DLX6-AS2_ENST00000606174.1_RNA|DLX6-AS1_ENST00000437541.1_RNA|DLX6-AS1_ENST00000431497.2_RNA|DLX6_ENST00000518156.2_Silent_p.Q32Q|DLX6-AS1_ENST00000452769.2_RNA|DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS1_ENST00000437331.2_RNA	NM_005222.3	NP_005213.3	P56179	DLX6_HUMAN	distal-less homeobox 6						anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					agcagcagcagcaacagcagc	0.657																																					p.Q32Q		Atlas-SNP	.											DLX6,right_lower_lobe,carcinoma,0,1	DLX6	37	1	0			c.G96A						PASS	.						5.0	7.0	6.0					7																	96635385		1971	3959	5930	SO:0001630	splice_region_variant	1750	exon1			GCAGCAGCAACAG		CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000007660.5:c.95+1G>A	7.37:g.96635385G>A		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	18	4	0.222222	NM_005222	A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	Silent	SNP	ENST00000007660.5	37																																																																																				.	.	none		0.657	DLX6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_005222	Intron
CCDC144A	9720	hgsc.bcm.edu	37	17	16610846	16610846	+	Missense_Mutation	SNP	A	A	G			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:16610846A>G	ENST00000360524.8	+	4	804	c.728A>G	c.(727-729)aAg>aGg	p.K243R	CCDC144A_ENST00000443444.2_Missense_Mutation_p.K243R|CCDC144A_ENST00000399273.1_Missense_Mutation_p.K243R|RN7SL620P_ENST00000580704.1_RNA|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.K243R|CCDC144A_ENST00000340621.5_Missense_Mutation_p.K242R|CCDC144A_ENST00000456009.1_Missense_Mutation_p.K243R|CCDC144A_ENST00000436374.1_3'UTR	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	243																	TGCGAAAATAAGCAGCCACAG	0.348																																					p.K243R		Atlas-SNP	.											CCDC144B,NS,carcinoma,0,2	CCDC144A	53	2	0			c.A728G						scavenged	.						35.0	37.0	36.0					17																	16610846		1818	4077	5895	SO:0001583	missense	9720	exon4			AAAATAAGCAGCC	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.728A>G	17.37:g.16610846A>G	ENSP00000353717:p.Lys243Arg	Somatic	685	0	0		WXS	Illumina HiSeq	Phase_I	447	5	0.0111857	NM_014695	O60311|Q6ZU57	Missense_Mutation	SNP	ENST00000360524.8	37	CCDS45621.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	9.643|9.643	1.139396|1.139396	0.21205|0.21205	.|.	.|.	ENSG00000170160|ENSG00000170160	ENST00000420937;ENST00000340621;ENST00000399273;ENST00000436374;ENST00000443444;ENST00000448331;ENST00000360524;ENST00000456009;ENST00000360495|ENST00000328495	T;T;T;T;T;T;T|.	0.27104|.	1.69;1.69;1.69;1.69;1.69;1.69;1.69|.	1.72|1.72	0.553|0.553	0.17235|0.17235	.|.	.|.	.|.	.|.	.|.	T|T	0.20861|0.20861	0.0502|0.0502	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B|.	0.09022|.	0.002|.	B|.	0.04013|.	0.001|.	T|T	0.23797|0.23797	-1.0178|-1.0178	9|5	0.17832|.	T|.	0.49|.	.|.	3.4046|3.4046	0.07336|0.07336	0.7569:0.0:0.2431:0.0|0.7569:0.0:0.2431:0.0	.|.	243|.	A2RUR9|.	C144A_HUMAN|.	R|G	243;242;243;243;243;243;243;243;243|7	ENSP00000344740:K242R;ENSP00000382215:K243R;ENSP00000439262:K243R;ENSP00000440655:K243R;ENSP00000353717:K243R;ENSP00000394201:K243R;ENSP00000353685:K243R|.	ENSP00000344740:K242R|.	K|S	+|+	2|1	0|0	CCDC144A|CCDC144A	16551571|16551571	0.008000|0.008000	0.16893|0.16893	0.014000|0.014000	0.15608|0.15608	0.140000|0.140000	0.21249|0.21249	0.121000|0.121000	0.15667|0.15667	-0.016000|-0.016000	0.14127|0.14127	0.147000|0.147000	0.16070|0.16070	AAG|AGC	.	.	none		0.348	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1		
FAM186A	121006	hgsc.bcm.edu	37	12	50746158	50746158	+	Missense_Mutation	SNP	G	G	T	rs71459097		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr12:50746158G>T	ENST00000327337.5	-	4	4456	c.4457C>A	c.(4456-4458)cCg>cAg	p.P1486Q	FAM186A_ENST00000543111.1_Missense_Mutation_p.P1486Q|FAM186A_ENST00000543096.1_5'Flank	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1486								p.P1486Q(1)									CTGAGCCTGCGGAGGGATGAG	0.647																																					p.P1486Q	NSCLC(138;1796 1887 12511 19463 37884)	Atlas-SNP	.											FAM186A_ENST00000327337,extremity,malignant_melanoma,0,2	FAM186A	181	2	1	Substitution - Missense(1)	skin(1)	c.C4457A						scavenged	.						18.0	18.0	18.0					12																	50746158		692	1591	2283	SO:0001583	missense	121006	exon4			GCCTGCGGAGGGA		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4457C>A	12.37:g.50746158G>T	ENSP00000329995:p.Pro1486Gln	Somatic	259	1	0.003861		WXS	Illumina HiSeq	Phase_I	219	6	0.0273973	NM_001145475		Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	-	3.047	-0.196295	0.06259	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.04049	3.72;3.72	4.53	-1.5	0.08691	.	.	.	.	.	T	0.02012	0.0063	N	0.04203	-0.255	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.49351	-0.8949	9	0.13853	T	0.58	.	7.1242	0.25463	0.0:0.1707:0.524:0.3053	.	1486;1486	F5GYN0;A6NE01	.;F186A_HUMAN	Q	1486	ENSP00000441337:P1486Q;ENSP00000329995:P1486Q	ENSP00000329995:P1486Q	P	-	2	0	FAM186A	49032425	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.921000	0.04008	-0.386000	0.07821	-0.446000	0.05623	CCG	.	.	none		0.647	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
MSH3	4437	hgsc.bcm.edu	37	5	79950715	79950715	+	Missense_Mutation	SNP	G	G	C	rs144776112|rs201874762		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr5:79950715G>C	ENST00000265081.6	+	1	249	c.169G>C	c.(169-171)Gcc>Ccc	p.A57P	DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000504396.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	57	Poly-Ala.		Missing. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8942985}.		ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ggctgcagcggccgcagcggc	0.692								Mismatch excision repair (MMR)																													p.A57P	Melanoma(88;1010 1399 13793 26548 36275)	Atlas-SNP	.											MSH3_ENST00000265081,NS,carcinoma,0,1	MSH3	129	1	0			c.G169C						PASS	.						7.0	7.0	7.0					5																	79950715		2089	4077	6166	SO:0001583	missense	4437	exon1			GCAGCGGCCGCAG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.169G>C	5.37:g.79950715G>C	ENSP00000265081:p.Ala57Pro	Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	47	17	0.361702	NM_002439	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	362	0.16575091575091574	115	0.23373983739837398	67	0.1850828729281768	32	0.055944055944055944	148	0.19525065963060687	-	0.222	-1.028222	0.02045	.	.	ENSG00000113318	ENST00000265081	D	0.87256	-2.23	.	.	.	.	.	.	.	.	T	0.00039	0.0001	N	0.03608	-0.345	0.80722	P	0.0	.	.	.	.	.	.	T	0.02983	-1.1086	3	.	.	.	.	.	.	.	.	57	P20585	MSH3_HUMAN	P	57	ENSP00000265081:A57P	.	A	+	1	0	MSH3	79986471	0.041000	0.20044	0.049000	0.19019	0.152000	0.21847	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	GCC	G|0.835;C|0.165	0.165	strong		0.692	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
PIK3C2G	5288	hgsc.bcm.edu	37	12	18443868	18443868	+	Missense_Mutation	SNP	C	C	G			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr12:18443868C>G	ENST00000266497.5	+	3	879	c.841C>G	c.(841-843)Cag>Gag	p.Q281E	PIK3C2G_ENST00000536967.1_3'UTR|RERGL_ENST00000541632.1_Intron|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.Q281E|PIK3C2G_ENST00000535651.1_Missense_Mutation_p.Q281E|PIK3C2G_ENST00000433979.1_Missense_Mutation_p.Q281E			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	281					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				ATTTCCGTATCAGCTCTTTTC	0.333																																					p.Q281E		Atlas-SNP	.											.	PIK3C2G	315	.	0			c.C841G						PASS	.						70.0	65.0	67.0					12																	18443868		1831	4080	5911	SO:0001583	missense	5288	exon4			CCGTATCAGCTCT	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.841C>G	12.37:g.18443868C>G	ENSP00000266497:p.Gln281Glu	Somatic	270	0	0		WXS	Illumina HiSeq	Phase_I	187	23	0.122995	NM_004570	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	C	3.777	-0.046403	0.07407	.	.	ENSG00000139144	ENST00000535651;ENST00000433979;ENST00000266497;ENST00000538779	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	4.07	3.17	0.36434	Phosphoinositide 3-kinase, ras-binding (1);	1.575750	0.03477	N	0.214491	T	0.33411	0.0862	L	0.36672	1.1	0.09310	N	1	B;B;B	0.20164	0.042;0.034;0.012	B;B;B	0.25506	0.061;0.036;0.037	T	0.30794	-0.9966	10	0.02654	T	1	-0.5465	9.0175	0.36179	0.2401:0.7599:0.0:0.0	.	280;281;281	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	E	281	ENSP00000443850:Q281E;ENSP00000404845:Q281E;ENSP00000266497:Q281E;ENSP00000445381:Q281E	ENSP00000266497:Q281E	Q	+	1	0	PIK3C2G	18335135	0.097000	0.21791	0.040000	0.18447	0.115000	0.19883	0.564000	0.23563	1.294000	0.44707	0.644000	0.83932	CAG	.	.	none		0.333	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
SMPD1	6609	hgsc.bcm.edu	37	11	6412880	6412880	+	Silent	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr11:6412880C>T	ENST00000342245.4	+	2	753	c.585C>T	c.(583-585)gcC>gcT	p.A195A	SMPD1_ENST00000356761.2_Silent_p.A195A|SMPD1_ENST00000299397.3_Silent_p.A195A|SMPD1_ENST00000533196.1_Intron|SMPD1_ENST00000527275.1_Silent_p.A194A	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	193					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	GCCCCCCAGCCCCAGGTGCCC	0.617																																					p.A195A		Atlas-SNP	.											.	SMPD1	108	.	0			c.C585T						PASS	.						6.0	6.0	6.0					11																	6412880		2114	4096	6210	SO:0001819	synonymous_variant	6609	exon2			CCCAGCCCCAGGT	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.585C>T	11.37:g.6412880C>T		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	36	13	0.361111	NM_000543	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Silent	SNP	ENST00000342245.4	37	CCDS44531.1																																																																																			.	.	none		0.617	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
MST1L	11223	hgsc.bcm.edu	37	1	17085872	17085872	+	RNA	SNP	A	A	G	rs1806514		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:17085872A>G	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.W307R(1)|p.W317R(1)									TCGAGGTTCCAGCAGAAGTTC	0.662																																					p.W317R		Atlas-SNP	.											Q13209_HUMAN,right_upper_lobe,carcinoma,0,9	.	.	9	2	Substitution - Missense(2)	prostate(2)	c.T949C						scavenged	.																																					11223	exon8			GGTTCCAGCAGAA	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085872A>G		Somatic	79	4	0.0506329		WXS	Illumina HiSeq	Phase_I	95	8	0.0842105	NM_001271733	B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	37		.	.	.	.	.	.	.	.	.	.	.	0.008	-1.910101	0.00508	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	.	0.000000	0.37857	N	0.001920	T	0.10809	0.0264	.	.	.	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.28073	-1.0055	6	0.02654	T	1	.	2.1243	0.03734	0.4998:2.0E-4:2.0E-4:0.4998	rs1806514;rs2021016;rs2761537;rs3982178;rs61595267	317	Q2TV78-2	.	R	307;317;317	.	ENSP00000439273:W317R	W	-	1	0	MST1P9	16958459	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	1.935000	0.40173	-0.000000	0.14550	0.000000	0.15137	TGG	A|0.750;G|0.250	0.250	weak		0.662	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733	
CPZ	8532	hgsc.bcm.edu	37	4	8608504	8608504	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr4:8608504C>T	ENST00000360986.4	+	6	1121	c.947C>T	c.(946-948)gCg>gTg	p.A316V	CPZ_ENST00000429646.2_5'UTR|CPZ_ENST00000382480.2_Missense_Mutation_p.A179V|CPZ_ENST00000315782.6_Missense_Mutation_p.A305V	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	316					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						AGGCAGAACGCGCAGAACCTG	0.657																																					p.A316V		Atlas-SNP	.											CPZ,rectum,carcinoma,+1,1	CPZ	95	1	0			c.C947T						PASS	.						70.0	69.0	69.0					4																	8608504		2203	4300	6503	SO:0001583	missense	8532	exon6			AGAACGCGCAGAA	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.947C>T	4.37:g.8608504C>T	ENSP00000354255:p.Ala316Val	Somatic	208	0	0		WXS	Illumina HiSeq	Phase_I	157	15	0.0955414	NM_001014447	O00520|Q96MX2	Missense_Mutation	SNP	ENST00000360986.4	37	CCDS33953.1	.	.	.	.	.	.	.	.	.	.	c	17.32	3.359187	0.61403	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782	T;T;T	0.03920	3.76;3.76;3.76	3.31	3.31	0.37934	Peptidase M14, carboxypeptidase A (2);	0.202783	0.41605	N	0.000853	T	0.08044	0.0201	M	0.85197	2.74	0.80722	D	1	P;B	0.37207	0.587;0.17	B;B	0.23574	0.047;0.013	T	0.14531	-1.0469	10	0.49607	T	0.09	-20.6085	12.9837	0.58579	0.0:1.0:0.0:0.0	.	305;316	Q66K79-2;Q66K79	.;CBPZ_HUMAN	V	316;179;305	ENSP00000354255:A316V;ENSP00000371920:A179V;ENSP00000315074:A305V	ENSP00000315074:A305V	A	+	2	0	CPZ	8659404	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	5.155000	0.64900	1.672000	0.50884	0.450000	0.29827	GCG	.	.	none		0.657	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
MAML3	55534	hgsc.bcm.edu	37	4	140811125	140811125	+	Missense_Mutation	SNP	G	G	T	rs62344940		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr4:140811125G>T	ENST00000509479.2	-	2	2321	c.1465C>A	c.(1465-1467)Caa>Aaa	p.Q489K	MAML3_ENST00000327122.5_Missense_Mutation_p.Q333K|MAML3_ENST00000398940.1_Missense_Mutation_p.Q28K	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					tgctgctgttgctgttgctgt	0.552																																					p.Q489K		Atlas-SNP	.											MAML3_ENST00000509479,colon,carcinoma,+2,2	MAML3	192	2	0			c.C1465A						scavenged	.						17.0	20.0	19.0					4																	140811125		2194	4294	6488	SO:0001583	missense	55534	exon2			GCTGTTGCTGTTG	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1465C>A	4.37:g.140811125G>T	ENSP00000421180:p.Gln489Lys	Somatic	57	5	0.0877193		WXS	Illumina HiSeq	Phase_I	35	3	0.0857143	NM_018717		Missense_Mutation	SNP	ENST00000509479.2	37	CCDS54805.1	.	.	.	.	.	.	.	.	.	.	G	3.000	-0.206260	0.06180	.	.	ENSG00000196782	ENST00000509479;ENST00000327122;ENST00000398940	T;T	0.76448	0.83;-1.02	2.61	2.61	0.31194	.	0.000000	0.64402	D	0.000001	T	0.66607	0.2806	N	0.08118	0	0.31344	N	0.683255	P	0.43392	0.805	P	0.59424	0.857	T	0.64106	-0.6485	10	0.05436	T	0.98	.	8.8799	0.35367	0.0:0.0:1.0:0.0	rs62344940	489	Q96JK9	MAML3_HUMAN	K	489;333;28	ENSP00000421180:Q489K;ENSP00000313316:Q333K	ENSP00000313316:Q333K	Q	-	1	0	MAML3	141030575	1.000000	0.71417	1.000000	0.80357	0.631000	0.37964	3.291000	0.51764	1.788000	0.52465	0.484000	0.47621	CAA	.	.	weak		0.552	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
MSN	4478	hgsc.bcm.edu	37	X	64951012	64951012	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chrX:64951012C>T	ENST00000360270.5	+	5	683	c.511C>T	c.(511-513)Cgg>Tgg	p.R171W		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	171	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						GTGGGAGGAGCGGATCCAGGT	0.532			T	ALK	ALCL																																p.R171W		Atlas-SNP	.		Dom	yes		X	Xq11.2-q12	4478	moesin		L	.	MSN	89	.	0			c.C511T						PASS	.						110.0	67.0	82.0					X																	64951012		2202	4300	6502	SO:0001583	missense	4478	exon5			GAGGAGCGGATCC	M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.511C>T	X.37:g.64951012C>T	ENSP00000353408:p.Arg171Trp	Somatic	330	0	0		WXS	Illumina HiSeq	Phase_I	270	24	0.0888889	NM_002444		Missense_Mutation	SNP	ENST00000360270.5	37	CCDS14382.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.223212	0.79464	.	.	ENSG00000147065	ENST00000360270	D	0.81739	-1.53	5.8	2.74	0.32292	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.92319	0.7563	H	0.97051	3.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93176	0.6570	10	0.87932	D	0	.	12.3315	0.55041	0.6829:0.3171:0.0:0.0	.	171	P26038	MOES_HUMAN	W	171	ENSP00000353408:R171W	ENSP00000353408:R171W	R	+	1	2	MSN	64867737	0.997000	0.39634	0.910000	0.35882	0.974000	0.67602	2.491000	0.45303	0.571000	0.29365	0.600000	0.82982	CGG	.	.	none		0.532	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444	
KIAA1109	84162	hgsc.bcm.edu	37	4	123192383	123192383	+	Silent	SNP	T	T	C	rs45574236	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr4:123192383T>C	ENST00000264501.4	+	47	8077	c.7704T>C	c.(7702-7704)gaT>gaC	p.D2568D	KIAA1109_ENST00000455637.1_Silent_p.D2568D|KIAA1109_ENST00000388738.3_Silent_p.D2568D			Q2LD37	K1109_HUMAN	KIAA1109	2568					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.D2568D(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AGCATGTAGATATGGCTTTGG	0.393													T|||	1369	0.273363	0.0333	0.3026	5008	,	,		20839	0.3611		0.2913	False		,,,				2504	0.4683				p.D2568D		Atlas-SNP	.											KIAA1109,NS,carcinoma,0,1	KIAA1109	424	1	1	Substitution - coding silent(1)	prostate(1)	c.T7704C						scavenged	.	T		307,3525		14,279,1623	193.0	184.0	187.0		7704	0.6	1.0	4	dbSNP_127	187	2507,5751		375,1757,1997	no	coding-synonymous	KIAA1109	NM_015312.3		389,2036,3620	CC,CT,TT		30.3584,8.0115,23.2754		2568/5006	123192383	2814,9276	1916	4129	6045	SO:0001819	synonymous_variant	84162	exon45			TGTAGATATGGCT	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.7704T>C	4.37:g.123192383T>C		Somatic	161	0	0		WXS	Illumina HiSeq	Phase_I	146	2	0.0136986	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	37	CCDS43267.1	557|557	0.25503663003663|0.25503663003663	22|22	0.044715447154471545|0.044715447154471545	107|107	0.2955801104972376|0.2955801104972376	199|199	0.3479020979020979|0.3479020979020979	229|229	0.3021108179419525|0.3021108179419525	T|T	7.365|7.365	0.625574|0.625574	0.14257|0.14257	0.080115|0.080115	0.303584|0.303584	ENSG00000138688|ENSG00000138688	ENST00000446180|ENST00000419325	.|.	.|.	.|.	5.82|5.82	0.618|0.618	0.17624|0.17624	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	.|.	.|.	.|.	0.09310|0.09310	P|P	1.0|1.0	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.35992|0.35992	-0.9766|-0.9766	3|3	.|.	.|.	.|.	.|.	10.8498|10.8498	0.46763|0.46763	0.0:0.5064:0.0:0.4936|0.0:0.5064:0.0:0.4936	rs45574236|rs45574236	.|.	.|.	.|.	T|H	1141|526	.|.	.|.	I|Y	+|+	2|1	0|0	KIAA1109|KIAA1109	123411833|123411833	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.996000|0.996000	0.88848|0.88848	1.125000|1.125000	0.31332|0.31332	0.109000|0.109000	0.17891|0.17891	0.383000|0.383000	0.25322|0.25322	ATA|TAT	T|0.716;C|0.284	0.284	strong		0.393	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
PPM1E	22843	hgsc.bcm.edu	37	17	56833491	56833491	+	Missense_Mutation	SNP	T	T	C	rs58091258	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:56833491T>C	ENST00000308249.2	+	1	262	c.133T>C	c.(133-135)Tcc>Ccc	p.S45P		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			cgaacccgagtccgagcccga	0.706													T|||	35	0.00698882	0.0129	0.0029	5008	,	,		8544	0.0069		0.001	False		,,,				2504	0.0082				p.S45P		Atlas-SNP	.											PPM1E,rectum,carcinoma,0,2	PPM1E	97	2	0			c.T133C						scavenged	.																																			SO:0001583	missense	22843	exon1			CCCGAGTCCGAGC	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.133T>C	17.37:g.56833491T>C	ENSP00000312411:p.Ser45Pro	Somatic	227	3	0.0132159		WXS	Illumina HiSeq	Phase_I	203	31	0.152709	NM_014906	Q8N8J9|Q96DB8	Missense_Mutation	SNP	ENST00000308249.2	37	CCDS11613.1	.	.	.	.	.	.	.	.	.	.	T	0.181	-1.062190	0.01950	.	.	ENSG00000175175	ENST00000308249	T	0.22945	1.93	4.15	-1.34	0.09143	.	.	.	.	.	T	0.10551	0.0258	N	0.14661	0.345	0.52099	P	5.100000000002325E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.45920	-0.9228	8	0.02654	T	1	1.5526	8.0241	0.30427	0.0:0.5961:0.0:0.4039	rs58091258;rs62648074	45	Q8WY54-2	.	P	45	ENSP00000312411:S45P	ENSP00000312411:S45P	S	+	1	0	PPM1E	54188490	0.903000	0.30736	0.954000	0.39281	0.160000	0.22226	0.122000	0.15687	-0.124000	0.11724	-1.425000	0.01104	TCC	T|0.667;C|0.333	0.333	strong		0.706	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
BCAR3	8412	hgsc.bcm.edu	37	1	94032925	94032925	+	Missense_Mutation	SNP	C	C	G			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:94032925C>G	ENST00000370244.1	-	13	2498	c.2210G>C	c.(2209-2211)tGt>tCt	p.C737S	BCAR3_ENST00000370247.3_Missense_Mutation_p.C646S|BCAR3_ENST00000539242.1_Missense_Mutation_p.C413S|BCAR3_ENST00000370243.1_Missense_Mutation_p.C737S|BCAR3_ENST00000260502.6_Missense_Mutation_p.C737S	NM_001261408.1	NP_001248337.1	O75815	BCAR3_HUMAN	breast cancer anti-estrogen resistance 3	737	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				lens morphogenesis in camera-type eye (GO:0002089)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	25		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		CATGATTTCACAGCTCTGGTC	0.517																																					p.C737S		Atlas-SNP	.											.	BCAR3	62	.	0			c.G2210C						PASS	.						168.0	143.0	152.0					1																	94032925		2203	4300	6503	SO:0001583	missense	8412	exon11			ATTTCACAGCTCT	U92715	CCDS745.1, CCDS58010.1	1p22.1	2013-02-14			ENSG00000137936	ENSG00000137936		"""SH2 domain containing"""	973	protein-coding gene	gene with protein product		604704				9582273	Standard	NM_001261408		Approved	NSP2, SH2D3B	uc001dpz.4	O75815	OTTHUMG00000010301	ENST00000370244.1:c.2210G>C	1.37:g.94032925C>G	ENSP00000359264:p.Cys737Ser	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	97	4	0.0412371	NM_001261409	D3DT43|Q5TEW3|Q6UW40|Q9BR50	Missense_Mutation	SNP	ENST00000370244.1	37	CCDS745.1	.	.	.	.	.	.	.	.	.	.	C	34	5.336461	0.95758	.	.	ENSG00000137936	ENST00000370247;ENST00000260502;ENST00000370244;ENST00000370243;ENST00000539242	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	5.85	5.85	0.93711	Guanine-nucleotide dissociation stimulator CDC25 (2);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.46946	0.1419	M	0.64404	1.975	0.80722	D	1	P;D	0.69078	0.769;0.997	P;D	0.64877	0.456;0.93	T	0.35126	-0.9801	10	0.56958	D	0.05	-21.5128	20.1577	0.98120	0.0:1.0:0.0:0.0	.	737;646	O75815;Q5TEW3	BCAR3_HUMAN;.	S	646;737;737;737;413	ENSP00000359267:C646S;ENSP00000260502:C737S;ENSP00000359264:C737S;ENSP00000359263:C737S;ENSP00000441343:C413S	ENSP00000260502:C737S	C	-	2	0	BCAR3	93805513	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.461000	0.80834	2.767000	0.95098	0.655000	0.94253	TGT	.	.	none		0.517	BCAR3-003	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028420.1		
ABHD17A	81926	hgsc.bcm.edu	37	19	1881395	1881395	+	Silent	SNP	T	T	C	rs199929215	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr19:1881395T>C	ENST00000292577.7	-	2	604	c.171A>G	c.(169-171)agA>agG	p.R57R	ABHD17A_ENST00000250974.9_Silent_p.R57R|ABHD17A_ENST00000590661.1_Silent_p.R57R	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	57						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.R57R(1)									CCGAGGAGGCTCTCAGGGTCC	0.726																																					p.R57R		Atlas-SNP	.											FAM108A1,NS,carcinoma,0,3	FAM108A1	29	3	1	Substitution - coding silent(1)	prostate(1)	c.A171G						scavenged	.						7.0	10.0	9.0					19																	1881395		1880	3957	5837	SO:0001819	synonymous_variant	81926	exon2			GGAGGCTCTCAGG	BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.171A>G	19.37:g.1881395T>C		Somatic	46	2	0.0434783		WXS	Illumina HiSeq	Phase_I	53	8	0.150943	NM_031213	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Silent	SNP	ENST00000292577.7	37	CCDS45902.1																																																																																			T|0.991;C|0.010	0.010	strong		0.726	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415556.2	NM_031213	
PALM2	114299	hgsc.bcm.edu	37	9	112642863	112642863	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr9:112642863G>T	ENST00000374531.2	+	4	239	c.165G>T	c.(163-165)caG>caT	p.Q55H	PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.Q53H|PALM2_ENST00000483909.1_Missense_Mutation_p.Q53H|PALM2_ENST00000314527.4_Missense_Mutation_p.Q53H|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.Q53H|AKAP2_ENST00000510514.5_Missense_Mutation_p.Q53H|PALM2_ENST00000448454.2_Missense_Mutation_p.Q55H|AKAP2_ENST00000555236.1_Missense_Mutation_p.Q53H	NM_001037293.2	NP_001032370.1	Q8IXS6	PALM2_HUMAN	paralemmin 2	55					regulation of cell shape (GO:0008360)	plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	18						GGCTGCTGCAGGGCATACCCG	0.517																																					p.Q55H		Atlas-SNP	.											.	PALM2	51	.	0			c.G165T						PASS	.						97.0	84.0	89.0					9																	112642863		2203	4300	6503	SO:0001583	missense	114299	exon4			GCTGCAGGGCATA	AJ312216	CCDS35099.1, CCDS48002.1, CCDS48002.2	9q31.3	2009-10-16			ENSG00000243444	ENSG00000243444			15845	protein-coding gene	gene with protein product						11478809	Standard	NM_001037293		Approved			Q8IXS6	OTTHUMG00000020479	ENST00000374531.2:c.165G>T	9.37:g.112642863G>T	ENSP00000363656:p.Gln55His	Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	75	4	0.0533333	NM_001037293	A9Z1X9|Q8N9D5|Q96DU1	Missense_Mutation	SNP	ENST00000374531.2	37	CCDS35099.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.674599	0.67928	.	.	ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000157654;ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978	ENST00000374531;ENST00000448454;ENST00000483909;ENST00000314527;ENST00000497711;ENST00000374530;ENST00000413420;ENST00000302798;ENST00000555236;ENST00000510514	T;T;T;T;T;T;T;T;T;T	0.32515	1.82;1.84;1.81;1.84;1.45;2.09;1.81;2.09;2.09;2.09	5.36	3.09	0.35607	.	0.639479	0.14359	N	0.324569	T	0.43122	0.1233	L	0.40543	1.245	0.30980	N	0.722632	D;D;D;D	0.89917	0.997;0.997;0.995;1.0	D;D;D;D	0.83275	0.995;0.995;0.99;0.996	T	0.41822	-0.9487	10	0.87932	D	0	-11.3524	8.4766	0.33016	0.2302:0.0:0.7698:0.0	.	53;53;55;55	Q9Y2D5-6;Q9Y2D5-4;Q8IXS6;D3YTA4	.;.;PALM2_HUMAN;.	H	55;55;53;53;39;53;53;53;53;53	ENSP00000363656:Q55H;ENSP00000400206:Q55H;ENSP00000417525:Q53H;ENSP00000323805:Q53H;ENSP00000419747:Q39H;ENSP00000363654:Q53H;ENSP00000397839:Q53H;ENSP00000305861:Q53H;ENSP00000451476:Q53H;ENSP00000421522:Q53H	ENSP00000305861:Q53H	Q	+	3	2	PALM2-AKAP2;PALM2;AKAP2	111682684	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.503000	0.22610	1.390000	0.46547	0.650000	0.86243	CAG	.	.	none		0.517	PALM2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053604.1	NM_001037293	
PEX5	5830	hgsc.bcm.edu	37	12	7343151	7343151	+	Intron	SNP	G	G	C			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr12:7343151G>C	ENST00000455147.2	+	3	727				RP11-273B20.3_ENST00000543061.1_RNA|PEX5_ENST00000266564.3_Intron|PEX5_ENST00000266563.5_Intron|RP11-273B20.3_ENST00000545794.1_RNA|PEX5_ENST00000434354.2_Missense_Mutation_p.A60P|PEX5_ENST00000412720.2_Intron|PEX5_ENST00000420616.2_Intron|PEX5_ENST00000545220.1_Intron	NM_001131026.1	NP_001124498.1	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5						cell development (GO:0048468)|cerebral cortex cell migration (GO:0021795)|cerebral cortex neuron differentiation (GO:0021895)|endoplasmic reticulum organization (GO:0007029)|fatty acid beta-oxidation (GO:0006635)|mitochondrial membrane organization (GO:0007006)|negative regulation of protein homotetramerization (GO:1901094)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|positive regulation of multicellular organism growth (GO:0040018)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|protein import into peroxisome matrix, translocation (GO:0016561)|protein import into peroxisome membrane (GO:0045046)|protein targeting to peroxisome (GO:0006625)|protein tetramerization (GO:0051262)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|small GTPase binding (GO:0031267)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)	21						AAGCCCAGGTGCAGCCTCTGA	0.632																																					p.A60P		Atlas-SNP	.											PEX5_ENST00000434354,colon,carcinoma,-2,3	PEX5	63	3	0			c.G178C						scavenged	.						10.0	12.0	12.0					12																	7343151		2163	4228	6391	SO:0001627	intron_variant	5830	exon2			CCAGGTGCAGCCT	U19721	CCDS8576.1, CCDS44822.1, CCDS44823.1, CCDS44824.1, CCDS73433.1	12p	2013-01-10	2004-03-17	2004-03-19		ENSG00000139197		"""Tetratricopeptide (TTC) repeat domain containing"""	9719	protein-coding gene	gene with protein product		600414	"""peroxisome receptor 1"""	PXR1			Standard	NM_000319		Approved	PTS1R	uc010sgc.2	P50542		ENST00000455147.2:c.147+31G>C	12.37:g.7343151G>C		Somatic	37	2	0.0540541		WXS	Illumina HiSeq	Phase_I	43	9	0.209302	NM_001131023	A8K891|B4DZ45|B7ZAD5|D3DUT8|Q15115|Q15266|Q96FN7	Missense_Mutation	SNP	ENST00000455147.2	37	CCDS44823.1	.	.	.	.	.	.	.	.	.	.	G	4.863	0.160424	0.09287	.	.	ENSG00000139197	ENST00000434354;ENST00000396637	D;D	0.87650	-2.28;-2.1	.	.	.	.	.	.	.	.	T	0.73024	0.3534	.	.	.	0.09310	N	0.999999	P	0.42993	0.797	B	0.31191	0.125	T	0.61525	-0.7045	5	.	.	.	.	.	.	.	.	60	B4DZ45	.	P	60	ENSP00000407401:A60P;ENSP00000379877:A60P	.	A	+	1	0	PEX5	7234418	0.000000	0.05858	0.005000	0.12908	0.094000	0.18550	0.032000	0.13732	0.502000	0.28037	0.000000	0.15137	GCA	.	.	none		0.632	PEX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398611.1	NM_000319	
NOTCH2	4853	hgsc.bcm.edu	37	1	120612006	120612006	+	Silent	SNP	G	G	A	rs4021006	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:120612006G>A	ENST00000256646.2	-	1	234	c.15C>T	c.(13-15)cgC>cgT	p.R5R		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	5					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAGAGCGGGGCGCAGGGCGG	0.761			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome				g|||	1973	0.39397	0.2632	0.4049	5008	,	,		21911	0.4315		0.4423	False		,,,				2504	0.4744				p.R5R		Atlas-SNP	.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	NOTCH2,NS,carcinoma,0,1	NOTCH2	348	1	0			c.C15T						scavenged	.						6.0	8.0	8.0					1																	120612006		1838	3882	5720	SO:0001819	synonymous_variant	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AGCGGGGCGCAGG	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.15C>T	1.37:g.120612006G>A		Somatic	5	1	0.2		WXS	Illumina HiSeq	Phase_I	10	7	0.7	NM_001200001	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	G	9.758	1.169358	0.21621	.	.	ENSG00000134250	ENST00000538680	.	.	.	2.9	1.95	0.26073	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.0819	0.14661	0.1818:0.0:0.8182:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH2	120413529	0.988000	0.35896	0.959000	0.39883	0.588000	0.36517	1.074000	0.30703	0.543000	0.28864	0.184000	0.17185	.	.	.	none		0.761	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
OR2T4	127074	hgsc.bcm.edu	37	1	248525427	248525427	+	Missense_Mutation	SNP	T	T	C			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:248525427T>C	ENST00000366475.1	+	1	545	c.545T>C	c.(544-546)tTc>tCc	p.F182S		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F182S(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGCTGCTGGTTCCTGGGCTCA	0.542																																					p.F182S		Atlas-SNP	.											OR2T4,rectum,carcinoma,-1,2	OR2T4	126	2	1	Substitution - Missense(1)	large_intestine(1)	c.T545C						scavenged	.						262.0	228.0	240.0					1																	248525427		2203	4300	6503	SO:0001583	missense	127074	exon1			GCTGGTTCCTGGG	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.545T>C	1.37:g.248525427T>C	ENSP00000355431:p.Phe182Ser	Somatic	402	3	0.00746269		WXS	Illumina HiSeq	Phase_I	267	3	0.011236	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	T	10.25	1.297316	0.23650	.	.	ENSG00000196944	ENST00000366475	T	0.37584	1.19	3.61	2.44	0.29823	GPCR, rhodopsin-like superfamily (1);	0.441477	0.19272	N	0.118381	T	0.23492	0.0568	N	0.26042	0.785	0.09310	N	1	B	0.33477	0.413	B	0.35899	0.213	T	0.12915	-1.0529	10	0.54805	T	0.06	.	5.522	0.16938	0.0:0.1104:0.336:0.5537	.	182	Q8NH00	OR2T4_HUMAN	S	182	ENSP00000355431:F182S	ENSP00000355431:F182S	F	+	2	0	OR2T4	246592050	0.001000	0.12720	0.769000	0.31535	0.383000	0.30230	0.454000	0.21827	1.264000	0.44198	0.477000	0.44152	TTC	.	.	none		0.542	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
OR9Q2	219957	hgsc.bcm.edu	37	11	57958226	57958226	+	Silent	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr11:57958226C>T	ENST00000311591.3	+	1	321	c.264C>T	c.(262-264)caC>caT	p.H88H		NM_001005283.2	NP_001005283.1	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q, member 2	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(3)|lung(24)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41		Breast(21;0.0589)				TGTGGGAGCACGGCACAACCA	0.567																																					p.H88H		Atlas-SNP	.											OR9Q2,NS,carcinoma,+2,1	OR9Q2	78	1	0			c.C264T						scavenged	.						182.0	132.0	149.0					11																	57958226		2201	4296	6497	SO:0001819	synonymous_variant	219957	exon1			GGAGCACGGCACA	AB065859	CCDS31544.1	11q12.1	2012-08-09		2004-03-10	ENSG00000186513	ENSG00000186513		"""GPCR / Class A : Olfactory receptors"""	15328	protein-coding gene	gene with protein product				OR9Q2P			Standard	NM_001005283		Approved		uc010rka.2	Q8NGE9	OTTHUMG00000167414	ENST00000311591.3:c.264C>T	11.37:g.57958226C>T		Somatic	58	1	0.0172414		WXS	Illumina HiSeq	Phase_I	52	12	0.230769	NM_001005283		Silent	SNP	ENST00000311591.3	37	CCDS31544.1																																																																																			.	.	none		0.567	OR9Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394540.1	NM_001005283	
EXOG	9941	hgsc.bcm.edu	37	3	38565705	38565705	+	Missense_Mutation	SNP	G	G	T	rs570781004		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr3:38565705G>T	ENST00000287675.5	+	6	1055	c.959G>T	c.(958-960)cGa>cTa	p.R320L	EXOG_ENST00000422077.2_Missense_Mutation_p.R270L|EXOG_ENST00000358249.2_Intron	NM_005107.3	NP_005098.2	Q9Y2C4	EXOG_HUMAN	endo/exonuclease (5'-3'), endonuclease G-like	320					DNA catabolic process, endonucleolytic (GO:0000737)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			central_nervous_system(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	17						GAAGGAGCCCGATCAGTGCTC	0.423																																					p.R320L		Atlas-SNP	.											EXOG,bladder,carcinoma,+1,2	EXOG	29	2	0			c.G959T						scavenged	.						89.0	95.0	93.0					3																	38565705		2203	4300	6503	SO:0001583	missense	9941	exon6			GAGCCCGATCAGT	AB020523	CCDS2680.1, CCDS46795.1	3p21.3	2010-05-07	2009-01-08	2009-01-08	ENSG00000157036	ENSG00000157036	3.1.30.-		3347	protein-coding gene	gene with protein product		604051	"""endonuclease G-like 1"", ""endonuclease G-like 2"""	ENDOGL1, ENDOGL2		10231028, 18187503	Standard	NM_005107		Approved	ENGL-a, ENGL, ENGL-b	uc003cih.2	Q9Y2C4	OTTHUMG00000131295	ENST00000287675.5:c.959G>T	3.37:g.38565705G>T	ENSP00000287675:p.Arg320Leu	Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	93	2	0.0215054	NM_005107	A8K242|B4DVG2|Q3SXM9|Q9Y2C8	Missense_Mutation	SNP	ENST00000287675.5	37	CCDS2680.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930555	0.52866	.	.	ENSG00000157036	ENST00000287675;ENST00000422077	T;T	0.47869	0.83;0.86	5.54	3.75	0.43078	.	0.437392	0.22739	N	0.056222	T	0.45094	0.1325	M	0.63843	1.955	0.80722	D	1	B;B	0.24186	0.099;0.075	B;B	0.25140	0.058;0.04	T	0.39840	-0.9594	10	0.49607	T	0.09	-0.6957	10.8252	0.46627	0.0718:0.1457:0.7824:0.0	.	270;320	Q9Y2C4-4;Q9Y2C4	.;EXOG_HUMAN	L	320;270	ENSP00000287675:R320L;ENSP00000404305:R270L	ENSP00000287675:R320L	R	+	2	0	EXOG	38540709	0.882000	0.30256	0.657000	0.29651	0.995000	0.86356	2.256000	0.43231	0.885000	0.36088	0.655000	0.94253	CGA	.	.	none		0.423	EXOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254063.2	NM_005107	
CSGALNACT2	55454	hgsc.bcm.edu	37	10	43659372	43659372	+	Nonsense_Mutation	SNP	C	C	T	rs76607193	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr10:43659372C>T	ENST00000374466.3	+	5	1374	c.1039C>T	c.(1039-1041)Cga>Tga	p.R347*		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	347					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.R347*(1)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TAATCGTGGACGAGGACTAAA	0.408																																					p.R347X		Atlas-SNP	.											CSGALNACT2,trunk,malignant_melanoma,0,1	CSGALNACT2	67	1	1	Substitution - Nonsense(1)	skin(1)	c.C1039T						scavenged	.						191.0	181.0	184.0					10																	43659372		2203	4300	6503	SO:0001587	stop_gained	55454	exon5			CGTGGACGAGGAC	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1039C>T	10.37:g.43659372C>T	ENSP00000363590:p.Arg347*	Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	146	5	0.0342466	NM_018590	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Nonsense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	C	41	8.712957	0.98925	.	.	ENSG00000169826	ENST00000374466	.	.	.	6.08	4.19	0.49359	.	0.110120	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-3.2438	15.5126	0.75795	0.253:0.747:0.0:0.0	.	.	.	.	X	347	.	ENSP00000363590:R347X	R	+	1	2	CSGALNACT2	42979378	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	1.226000	0.32563	0.852000	0.35287	0.591000	0.81541	CGA	C|0.997;T|0.003	0.003	strong		0.408	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
ABHD17A	81926	hgsc.bcm.edu	37	19	1881397	1881397	+	Silent	SNP	T	T	G	rs200867680	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr19:1881397T>G	ENST00000292577.7	-	2	602	c.169A>C	c.(169-171)Aga>Cga	p.R57R	ABHD17A_ENST00000250974.9_Silent_p.R57R|ABHD17A_ENST00000590661.1_Silent_p.R57R	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	57						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										GAGGAGGCTCTCAGGGTCCCC	0.726																																					p.R57R		Atlas-SNP	.											FAM108A1,NS,carcinoma,+2,3	FAM108A1	29	3	0			c.A169C						scavenged	.						7.0	10.0	9.0					19																	1881397		1877	3941	5818	SO:0001819	synonymous_variant	81926	exon2			AGGCTCTCAGGGT	BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.169A>C	19.37:g.1881397T>G		Somatic	45	1	0.0222222		WXS	Illumina HiSeq	Phase_I	54	9	0.166667	NM_031213	A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Silent	SNP	ENST00000292577.7	37	CCDS45902.1																																																																																			T|0.983;G|0.016	0.016	strong		0.726	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415556.2	NM_031213	
DAO	1610	hgsc.bcm.edu	37	12	109278847	109278847	+	Missense_Mutation	SNP	G	G	A	rs200257378		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr12:109278847G>A	ENST00000228476.3	+	2	269	c.65G>A	c.(64-66)cGc>cAc	p.R22H	DAO_ENST00000551281.1_Missense_Mutation_p.R22H	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase	22					cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	ATCCATGAGCGCTACCACTCA	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		17707	0.001		0.0	False		,,,				2504	0.0				p.R22H		Atlas-SNP	.											DAO,colon,carcinoma,0,1	DAO	58	1	0			c.G65A						PASS	.						121.0	97.0	105.0					12																	109278847		2203	4300	6503	SO:0001583	missense	1610	exon2			ATGAGCGCTACCA	D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360	ENST00000228476.3:c.65G>A	12.37:g.109278847G>A	ENSP00000228476:p.Arg22His	Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	56	8	0.142857	NM_001917	B2R7I5|Q16758|Q8N6R2	Missense_Mutation	SNP	ENST00000228476.3	37	CCDS9122.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	11.86	1.763654	0.31228	.	.	ENSG00000110887	ENST00000551281;ENST00000228476;ENST00000547166	T;T;T	0.48836	0.8;0.8;0.87	5.44	-0.879	0.10613	FAD dependent oxidoreductase (1);NAD(P)-binding domain (1);	0.534143	0.23139	N	0.051487	T	0.23806	0.0576	N	0.20357	0.565	0.32875	D	0.509703	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.15925	-1.0420	10	0.17832	T	0.49	.	5.3692	0.16131	0.4709:0.0:0.3964:0.1328	.	22;22	P14920;Q7Z312	OXDA_HUMAN;.	H	22	ENSP00000446853:R22H;ENSP00000228476:R22H;ENSP00000447104:R22H	ENSP00000228476:R22H	R	+	2	0	DAO	107802976	0.210000	0.23517	0.459000	0.27081	0.960000	0.62799	0.606000	0.24194	-0.056000	0.13221	-0.218000	0.12543	CGC	G|1.000;A|0.000	0.000	strong		0.622	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403682.1		
TRPM3	80036	hgsc.bcm.edu	37	9	73461394	73461394	+	Silent	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr9:73461394G>A	ENST00000377111.2	-	4	819	c.576C>T	c.(574-576)aaC>aaT	p.N192N	TRPM3_ENST00000361823.5_Silent_p.N39N|TRPM3_ENST00000396285.1_Silent_p.N39N|TRPM3_ENST00000396283.1_Silent_p.N39N|TRPM3_ENST00000360823.2_Silent_p.N39N|TRPM3_ENST00000357533.2_Silent_p.N194N|TRPM3_ENST00000377105.1_Silent_p.N39N|TRPM3_ENST00000377097.3_Silent_p.N39N|TRPM3_ENST00000423814.3_Silent_p.N194N|TRPM3_ENST00000377106.1_Silent_p.N39N|TRPM3_ENST00000396292.4_Silent_p.N39N|TRPM3_ENST00000377101.1_Silent_p.N39N|TRPM3_ENST00000408909.2_Silent_p.N39N|TRPM3_ENST00000396280.5_Silent_p.N39N|TRPM3_ENST00000377110.3_Silent_p.N192N|TRPM3_ENST00000358082.3_Silent_p.N39N	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	192					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GGAGTTCAAAGTTCTGCAGGC	0.483																																					p.N192N		Atlas-SNP	.											.	TRPM3	700	.	0			c.C576T						PASS	.						148.0	151.0	150.0					9																	73461394		2203	4300	6503	SO:0001819	synonymous_variant	80036	exon4			TTCAAAGTTCTGC	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.576C>T	9.37:g.73461394G>A		Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	128	14	0.109375	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	ENST00000377111.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.226|9.226	1.034597|1.034597	0.19590|0.19590	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000396280|ENST00000377097	.|.	.|.	.|.	6.01|6.01	3.19|3.19	0.36642|0.36642	.|.	.|.	.|.	.|.	.|.	T|T	0.57829|0.57829	0.2080|0.2080	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.52983|0.52983	-0.8502|-0.8502	4|4	.|.	.|.	.|.	-20.7118|-20.7118	8.1451|8.1451	0.31106|0.31106	0.4047:0.0:0.5953:0.0|0.4047:0.0:0.5953:0.0	.|.	.|.	.|.	.|.	F|I	39|82	.|.	.|.	L|T	-|-	1|2	0|0	TRPM3|TRPM3	72651214|72651214	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.447000|1.447000	0.35101|0.35101	0.899000|0.899000	0.36444|0.36444	0.650000|0.650000	0.86243|0.86243	CTT|ACT	.	.	none		0.483	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
APEH	327	hgsc.bcm.edu	37	3	49721622	49721622	+	IGR	SNP	C	C	T	rs200268600		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr3:49721622C>T	ENST00000296456.5	+	0	3220				MST1_ENST00000494828.2_5'Flank|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000449682.2_Splice_Site_p.G673S	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCGTAGTCACCCTGGCAGGTA	0.567																																					p.G673S		Atlas-SNP	.											MST1,NS,carcinoma,0,2	MST1	84	2	0			c.G2017A						scavenged	.						19.0	19.0	19.0					3																	49721622		2202	4294	6496	SO:0001628	intergenic_variant	4485	exon18			AGTCACCCTGGCA	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49721622C>T		Somatic	380	7	0.0184211		WXS	Illumina HiSeq	Phase_I	270	17	0.062963	NM_020998	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.4|26.4	4.733873|4.733873	0.89482|0.89482	.|.	.|.	ENSG00000173531|ENSG00000173531	ENST00000448220|ENST00000449682	.|D	.|0.97924	.|-4.61	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	0.000000|0.000000	0.43260|0.43260	D|D	0.000594|0.000594	D|D	0.98893|0.98893	0.9625|0.9625	M|M	0.86573|0.86573	2.825|2.825	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.77004	.|0.989	D|D	0.99593|0.99593	1.0976|1.0976	6|10	.|0.66056	.|D	.|0.02	.|.	19.5863|19.5863	0.95490|0.95490	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|673	.|G3XAK1	.|.	E|S	142|673	.|ENSP00000414287:G673S	.|ENSP00000414287:G673S	G|G	-|-	2|1	0|0	MST1|MST1	49696626|49696626	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	4.520000|4.520000	0.60524|0.60524	2.621000|2.621000	0.88768|0.88768	0.655000|0.655000	0.94253|0.94253	GGG|GGT	C|0.999;T|0.001	0.001	weak		0.567	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
CDC42BPA	8476	hgsc.bcm.edu	37	1	227279603	227279603	+	Missense_Mutation	SNP	G	G	A	rs56119119		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:227279603G>A	ENST00000366769.3	-	16	3630	c.2339C>T	c.(2338-2340)aCg>aTg	p.T780M	CDC42BPA_ENST00000535525.1_Missense_Mutation_p.T780M|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.T780M|CDC42BPA_ENST00000366767.3_Missense_Mutation_p.T699M|CDC42BPA_ENST00000366764.2_Missense_Mutation_p.T780M|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.T780M|CDC42BPA_ENST00000366766.2_Missense_Mutation_p.T780M	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				AAGTTCACTCGTCAGCTTTTT	0.313																																					p.T780M		Atlas-SNP	.											CDC42BPA_ENST00000366769,NS,carcinoma,0,3	CDC42BPA	528	3	0			c.C2339T						PASS	.	G	MET/THR,MET/THR	0,4402		0,0,2201	182.0	173.0	176.0		2339,2096	5.1	1.0	1	dbSNP_129	176	4,8588	3.7+/-12.6	0,4,4292	yes	missense,missense	CDC42BPA	NM_003607.3,NM_014826.4	81,81	0,4,6493	AA,AG,GG		0.0466,0.0,0.0308	benign,benign	780/1720,699/1639	227279603	4,12990	2201	4296	6497	SO:0001583	missense	8476	exon16			TCACTCGTCAGCT	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.2339C>T	1.37:g.227279603G>A	ENSP00000355731:p.Thr780Met	Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	83	5	0.060241	NM_003607		Missense_Mutation	SNP	ENST00000366769.3	37	CCDS1558.1	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665839	0.67700	0.0	4.66E-4	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000366762;ENST00000535525;ENST00000366765	T;T;T;T;T;T;T	0.66460	-0.21;0.96;-0.21;-0.19;0.96;-0.19;-0.21	5.09	5.09	0.68999	.	0.054763	0.85682	D	0.000000	T	0.71426	0.3338	N	0.25485	0.75	0.31652	N	0.646716	D;B;D;B;B	0.58620	0.983;0.055;0.976;0.121;0.26	P;B;D;B;B	0.63033	0.73;0.02;0.91;0.065;0.095	T	0.72915	-0.4147	10	0.40728	T	0.16	.	18.855	0.92247	0.0:0.0:1.0:0.0	rs56119119	780;780;699;780;780	F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5;Q5VT25-2	.;.;.;.;.	M	780;699;780;780;780;44;780;780	ENSP00000355731:T780M;ENSP00000355729:T699M;ENSP00000335341:T780M;ENSP00000355728:T780M;ENSP00000355726:T780M;ENSP00000443275:T780M;ENSP00000355727:T780M	ENSP00000335341:T780M	T	-	2	0	CDC42BPA	225346226	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.769000	0.91742	2.537000	0.85549	0.557000	0.71058	ACG	G|1.000;A|0.000	0.000	weak		0.313	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	
FOLH1	2346	hgsc.bcm.edu	37	11	49175427	49175427	+	Silent	SNP	A	A	G	rs199517010		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr11:49175427A>G	ENST00000256999.2	-	17	2201	c.1941T>C	c.(1939-1941)agT>agC	p.S647S	FOLH1_ENST00000356696.3_Silent_p.S647S|FOLH1_ENST00000340334.7_Silent_p.S632S|FOLH1_ENST00000343844.4_Silent_p.S339S|FOLH1_ENST00000533034.1_Silent_p.S632S	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	647					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.S647S(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GGAGTCTCTCACTGAACTTGG	0.294																																					p.S647S		Atlas-SNP	.											FOLH1,mouth,carcinoma,0,1	FOLH1	141	1	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.T1941C						scavenged	.						83.0	85.0	84.0					11																	49175427		2201	4296	6497	SO:0001819	synonymous_variant	2346	exon17			TCTCTCACTGAAC	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1941T>C	11.37:g.49175427A>G		Somatic	465	11	0.0236559		WXS	Illumina HiSeq	Phase_I	404	10	0.0247525	NM_004476	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	ENST00000256999.2	37	CCDS7946.1																																																																																			A|0.999;G|0.001	0.001	weak		0.294	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
PRR21	643905	hgsc.bcm.edu	37	2	240982129	240982129	+	Missense_Mutation	SNP	G	G	C	rs112308001	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr2:240982129G>C	ENST00000408934.1	-	1	270	c.271C>G	c.(271-273)Cct>Gct	p.P91A		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	91	Pro-rich.							p.S86fs*291(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GGGTGAAGAGGCATGGATGAA	0.622													-|||	793	0.158347	0.1536	0.1182	5008	,	,		14823	0.3155		0.1034	False		,,,				2504	0.0879				p.P91A		Atlas-SNP	.											PRR21,NS,carcinoma,0,2	PRR21	53	2	2	Deletion - Frameshift(2)	upper_aerodigestive_tract(2)	c.C271G						scavenged	.	G	ALA/PRO	143,4029		12,119,1955	141.0	135.0	137.0		271	-3.6	0.0	2	dbSNP_132	137	180,8138		5,170,3984	yes	missense	PRR21	NM_001080835.1	27	17,289,5939	CC,CG,GG		2.164,3.4276,2.5861	benign	91/390	240982129	323,12167	2086	4159	6245	SO:0001583	missense	643905	exon1			GAAGAGGCATGGA	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.271C>G	2.37:g.240982129G>C	ENSP00000386166:p.Pro91Ala	Somatic	73	10	0.136986		WXS	Illumina HiSeq	Phase_I	58	8	0.137931	NM_001080835		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	.	.	.	.	.	.	.	.	.	.	-	0.001	-3.857866	0.00003	0.034276	0.02164	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.13196	2.61;2.61	1.79	-3.59	0.04583	.	.	.	.	.	T	0.01387	0.0045	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.18777	-1.0326	9	0.13108	T	0.6	.	1.5465	0.02566	0.2218:0.1637:0.4043:0.2103	.	91	Q8WXC7	PRR21_HUMAN	A	91	ENSP00000386166:P91A;ENSP00000418240:P91A	ENSP00000386166:P91A	P	-	1	0	PRR21	240630802	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-8.648000	0.00018	-5.464000	0.00014	-4.758000	0.00003	CCT	G|0.996;C|0.004	0.004	strong		0.622	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
AMOT	154796	hgsc.bcm.edu	37	X	112035109	112035109	+	Missense_Mutation	SNP	C	C	T	rs150900068		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chrX:112035109C>T	ENST00000524145.1	-	7	1951	c.1877G>A	c.(1876-1878)cGt>cAt	p.R626H	AMOT_ENST00000371958.1_Missense_Mutation_p.R394H|AMOT_ENST00000304758.1_Missense_Mutation_p.R217H|AMOT_ENST00000371962.1_Missense_Mutation_p.R394H|AMOT_ENST00000371959.3_Missense_Mutation_p.R626H			Q4VCS5	AMOT_HUMAN	angiomotin	626					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						TGTCCGGAGACGGTGCTCTAG	0.473																																					p.R626H		Atlas-SNP	.											.	AMOT	204	.	0			c.G1877A						PASS	.	C	HIS/ARG,HIS/ARG	0,3835		0,0,1632,571	154.0	132.0	140.0		1877,650	5.8	1.0	X	dbSNP_134	140	1,6727		0,1,2427,1872	no	missense,missense	AMOT	NM_001113490.1,NM_133265.2	29,29	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging,probably-damaging	626/1085,217/676	112035109	1,10562	2203	4300	6503	SO:0001583	missense	154796	exon6			CGGAGACGGTGCT	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1877G>A	X.37:g.112035109C>T	ENSP00000429013:p.Arg626His	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	83	8	0.0963855	NM_001113490	Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	ENST00000524145.1	37	CCDS48154.1	.	.	.	.	.	.	.	.	.	.	C	35	5.460507	0.96240	0.0	1.49E-4	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000371958	T;T;T;T;T	0.35421	1.99;1.57;1.81;1.57;1.31	5.79	5.79	0.91817	Angiomotin, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.63522	0.2518	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66598	-0.5883	10	0.66056	D	0.02	-9.5449	17.8504	0.88746	0.0:1.0:0.0:0.0	.	626	Q4VCS5	AMOT_HUMAN	H	217;626;394;626;394	ENSP00000305557:R217H;ENSP00000361027:R626H;ENSP00000361030:R394H;ENSP00000429013:R626H;ENSP00000361026:R394H	ENSP00000305557:R217H	R	-	2	0	AMOT	111921765	1.000000	0.71417	0.987000	0.45799	0.926000	0.56050	7.818000	0.86416	2.435000	0.82474	0.600000	0.82982	CGT	C|1.000;T|0.000	0.000	weak		0.473	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	NM_133265	
KRT4	3851	hgsc.bcm.edu	37	12	53207603	53207603	+	Silent	SNP	A	A	G	rs7135148		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr12:53207603A>G	ENST00000551956.1	-	1	732	c.240T>C	c.(238-240)ttT>ttC	p.F80F	KRT4_ENST00000293774.4_Silent_p.F154F|KRT4_ENST00000458244.2_Silent_p.F60F			P19013	K2C4_HUMAN	keratin 4	80	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CACCAGTGCCAAAGCCTCCAG	0.602																																					p.F80F	Pancreas(190;284 2995 41444 45903)	Atlas-SNP	.											KRT4,rectum,carcinoma,0,1	KRT4	110	1	0			c.T240C						PASS	.						82.0	99.0	94.0					12																	53207603		2119	4253	6372	SO:0001819	synonymous_variant	3851	exon1			AGTGCCAAAGCCT		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.240T>C	12.37:g.53207603A>G		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	74	8	0.108108	NM_002272	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	ENST00000551956.1	37	CCDS41787.2																																																																																			A|1.000;|0.000	.	weak		0.602	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
PPP1R36	145376	hgsc.bcm.edu	37	14	65054033	65054033	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr14:65054033G>T	ENST00000298705.1	+	10	929	c.833G>T	c.(832-834)aGg>aTg	p.R278M	RP11-973N13.3_ENST00000554454.1_RNA|RP11-973N13.3_ENST00000556634.1_RNA	NM_172365.1	NP_758953.1	Q96LQ0	PPR36_HUMAN	protein phosphatase 1, regulatory subunit 36	278					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										CCTCGCAGGAGGCGTGAAGAT	0.438																																					p.R278M		Atlas-SNP	.											.	.	.	.	0			c.G833T						PASS	.						118.0	117.0	117.0					14																	65054033		2203	4300	6503	SO:0001583	missense	145376	exon10			GCAGGAGGCGTGA		CCDS9767.1	14q23.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000165807	ENSG00000165807		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20097	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 50"""	C14orf50			Standard	NM_172365		Approved		uc001xhl.1	Q96LQ0	OTTHUMG00000141316	ENST00000298705.1:c.833G>T	14.37:g.65054033G>T	ENSP00000298705:p.Arg278Met	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	95	4	0.0421053	NM_172365	Q6NTH6	Missense_Mutation	SNP	ENST00000298705.1	37	CCDS9767.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.049283	0.55218	.	.	ENSG00000165807	ENST00000298705	T	0.33438	1.41	5.55	1.56	0.23342	.	0.366248	0.26227	N	0.025588	T	0.23688	0.0573	L	0.36672	1.1	0.24361	N	0.994873	P	0.48230	0.907	B	0.44163	0.443	T	0.09357	-1.0678	10	0.62326	D	0.03	-18.651	7.233	0.26053	0.6839:0.0:0.3161:0.0	.	278	Q96LQ0	PPR36_HUMAN	M	278	ENSP00000298705:R278M	ENSP00000298705:R278M	R	+	2	0	C14orf50	64123786	0.167000	0.22975	0.989000	0.46669	0.940000	0.58332	0.403000	0.20982	0.404000	0.25506	-0.302000	0.09304	AGG	.	.	none		0.438	PPP1R36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280667.1	NM_172365	
POLR2E	5434	hgsc.bcm.edu	37	19	1089905	1089905	+	Missense_Mutation	SNP	T	T	C			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr19:1089905T>C	ENST00000215587.7	-	6	828	c.545A>G	c.(544-546)tAc>tGc	p.Y182C	POLR2E_ENST00000586746.1_Missense_Mutation_p.Y182C|POLR2E_ENST00000585838.1_5'UTR			P19388	RPAB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide E, 25kDa	182					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|skin(2)	11		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TATCCCAAAGTAGCGCGCCAC	0.657																																					p.Y182C		Atlas-SNP	.											.	POLR2E	22	.	0			c.A545G						PASS	.						25.0	30.0	28.0					19																	1089905		2203	4299	6502	SO:0001583	missense	5434	exon6			CCAAAGTAGCGCG		CCDS12056.1	19p13.3	2013-01-21	2002-08-29			ENSG00000099817		"""RNA polymerase subunits"""	9192	protein-coding gene	gene with protein product	"""DNA directed RNA polymerase II 23 kda polypeptide"""	180664	"""polymerase (RNA) II (DNA directed) polypeptide E (25kD)"""			8034326	Standard	NM_002695		Approved	RPB5, RPABC1, XAP4, hRPB25, hsRPB5	uc002lre.4	P19388		ENST00000215587.7:c.545A>G	19.37:g.1089905T>C	ENSP00000215587:p.Tyr182Cys	Somatic	185	0	0		WXS	Illumina HiSeq	Phase_I	185	21	0.113514	NM_002695	B2R6L4|D6W5Y1|O43380|Q6PIH5|Q9BT06	Missense_Mutation	SNP	ENST00000215587.7	37	CCDS12056.1	.	.	.	.	.	.	.	.	.	.	T	17.53	3.412695	0.62511	.	.	ENSG00000099817	ENST00000215587	T	0.55052	0.54	3.95	3.95	0.45737	RNA polymerase, subunit H/Rpb5 C-terminal (4);	0.000000	0.85682	D	0.000000	T	0.81019	0.4736	H	0.98089	4.145	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.86577	0.1851	10	0.87932	D	0	0.1586	11.664	0.51363	0.0:0.0:0.0:1.0	.	182	P19388	RPAB1_HUMAN	C	182	ENSP00000215587:Y182C	ENSP00000215587:Y182C	Y	-	2	0	POLR2E	1040905	1.000000	0.71417	0.885000	0.34714	0.637000	0.38172	7.212000	0.77941	1.440000	0.47531	0.402000	0.26972	TAC	.	.	none		0.657	POLR2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458044.1	NM_002695	
MEF2A	4205	hgsc.bcm.edu	37	15	100211761	100211761	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr15:100211761C>T	ENST00000354410.5	+	5	924	c.295C>T	c.(295-297)Cca>Tca	p.P99S	MEF2A_ENST00000449277.2_Intron|MEF2A_ENST00000338042.6_Intron|MEF2A_ENST00000557942.1_Intron|MEF2A_ENST00000557785.1_Intron|MEF2A_ENST00000558812.1_Intron|MEF2A_ENST00000453228.2_Intron	NM_005587.2	NP_005578.2	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	99					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)	p.P99S(3)		endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			GTGCGACAGCCCAGACCCTGA	0.333																																					p.P99S		Atlas-SNP	.											MEF2A_ENST00000354410,NS,carcinoma,0,3	MEF2A	138	3	3	Substitution - Missense(3)	lung(1)|kidney(1)|central_nervous_system(1)	c.C295T						scavenged	.						82.0	69.0	73.0					15																	100211761		1843	4079	5922	SO:0001583	missense	4205	exon5			GACAGCCCAGACC		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000354410.5:c.295C>T	15.37:g.100211761C>T	ENSP00000346389:p.Pro99Ser	Somatic	106	2	0.0188679		WXS	Illumina HiSeq	Phase_I	90	6	0.0666667	NM_005587	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000354410.5	37	CCDS45362.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.814941	0.90790	.	.	ENSG00000068305	ENST00000354410	T	0.63255	-0.03	5.42	5.42	0.78866	Holliday junction regulator protein family C-terminal repeat (1);	0.000000	0.85682	D	0.000000	D	0.82866	0.5130	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.85220	0.1026	10	0.72032	D	0.01	-16.5447	19.5673	0.95398	0.0:1.0:0.0:0.0	.	99;99	Q02078;Q02078-5	MEF2A_HUMAN;.	S	99	ENSP00000346389:P99S	ENSP00000346389:P99S	P	+	1	0	MEF2A	98029284	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.445000	0.80570	2.706000	0.92434	0.462000	0.41574	CCA	.	.	none		0.333	MEF2A-001	KNOWN	overlapping_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000415980.1		
KRT4	3851	hgsc.bcm.edu	37	12	53207606	53207606	+	Silent	SNP	G	G	A	rs79164931		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr12:53207606G>A	ENST00000551956.1	-	1	729	c.237C>T	c.(235-237)ggC>ggT	p.G79G	KRT4_ENST00000293774.4_Silent_p.G153G|KRT4_ENST00000458244.2_Silent_p.G59G			P19013	K2C4_HUMAN	keratin 4	79	Gly-rich.|Head.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						CAGTGCCAAAGCCTCCAGCAC	0.597																																					p.G79G	Pancreas(190;284 2995 41444 45903)	Atlas-SNP	.											KRT4,rectum,carcinoma,0,3	KRT4	110	3	0			c.C237T						scavenged	.						85.0	102.0	96.0					12																	53207606		2113	4248	6361	SO:0001819	synonymous_variant	3851	exon1			GCCAAAGCCTCCA		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.237C>T	12.37:g.53207606G>A		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	73	7	0.0958904	NM_002272	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	ENST00000551956.1	37	CCDS41787.2																																																																																			.	.	strong		0.597	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
PHLDB1	23187	hgsc.bcm.edu	37	11	118526582	118526582	+	Missense_Mutation	SNP	C	C	T	rs149980232		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr11:118526582C>T	ENST00000361417.2	+	23	4384	c.3973C>T	c.(3973-3975)Cgc>Tgc	p.R1325C	PHLDB1_ENST00000527898.1_Intron|PHLDB1_ENST00000524713.1_Intron|PHLDB1_ENST00000534672.1_Intron|PHLDB1_ENST00000356063.5_Intron	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1325	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.									breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GAGGTTTTTCCGCTTCACTAT	0.542													C|||	1	0.000199681	0.0	0.0	5008	,	,		18829	0.001		0.0	False		,,,				2504	0.0				p.R1325C		Atlas-SNP	.											.	PHLDB1	103	.	0			c.C3973T						PASS	.						189.0	178.0	182.0					11																	118526582		2200	4295	6495	SO:0001583	missense	23187	exon22			TTTTTCCGCTTCA		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3973C>T	11.37:g.118526582C>T	ENSP00000354498:p.Arg1325Cys	Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	38	10	0.263158	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	37	CCDS8401.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	12.88	2.070482	0.36566	.	.	ENSG00000019144	ENST00000361417	T	0.31510	1.49	5.25	1.91	0.25777	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.745951	0.12817	N	0.436765	T	0.14960	0.0361	N	0.02916	-0.46	0.80722	D	1	B	0.31968	0.349	B	0.32022	0.139	T	0.10337	-1.0634	10	0.54805	T	0.06	1.0934	12.4647	0.55751	0.5992:0.4008:0.0:0.0	.	1325	Q86UU1	PHLB1_HUMAN	C	1325	ENSP00000354498:R1325C	ENSP00000354498:R1325C	R	+	1	0	PHLDB1	118031792	0.944000	0.32072	0.991000	0.47740	0.999000	0.98932	0.095000	0.15127	0.211000	0.20683	0.650000	0.86243	CGC	C|1.000;T|0.000	0.000	strong		0.542	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
PHF10	55274	hgsc.bcm.edu	37	6	170115902	170115902	+	Missense_Mutation	SNP	A	A	C	rs562092150		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr6:170115902A>C	ENST00000339209.4	-	6	718	c.595T>G	c.(595-597)Tat>Gat	p.Y199D	PHF10_ENST00000366780.4_Missense_Mutation_p.Y197D|PHF10_ENST00000464779.1_5'Flank	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	199	SAY.				nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)	p.Y111D(2)|p.Y199D(1)		endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		TTCTTAATATACTCAGGCACT	0.353																																					p.Y199D		Atlas-SNP	.											PHF10_ENST00000339209,NS,carcinoma,0,3	PHF10	76	3	3	Substitution - Missense(3)	lung(2)|prostate(1)	c.T595G						scavenged	.						81.0	83.0	82.0					6																	170115902		2202	4299	6501	SO:0001583	missense	55274	exon6			TAATATACTCAGG	AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.595T>G	6.37:g.170115902A>C	ENSP00000341805:p.Tyr199Asp	Somatic	230	2	0.00869565		WXS	Illumina HiSeq	Phase_I	146	4	0.0273973	NM_018288	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Missense_Mutation	SNP	ENST00000339209.4	37	CCDS5308.2	.	.	.	.	.	.	.	.	.	.	A	26.0	4.691335	0.88735	.	.	ENSG00000130024	ENST00000366780;ENST00000339209	T;T	0.29917	1.55;1.55	6.06	6.06	0.98353	.	0.107337	0.64402	D	0.000003	T	0.47266	0.1436	M	0.65975	2.015	0.80722	D	1	P;D;D	0.89917	0.955;1.0;0.995	P;D;P	0.85130	0.78;0.997;0.741	T	0.50759	-0.8790	10	0.87932	D	0	-18.8351	15.7905	0.78357	1.0:0.0:0.0:0.0	.	111;197;199	Q5T069;Q8WUB8-2;Q8WUB8	.;.;PHF10_HUMAN	D	197;199	ENSP00000355743:Y197D;ENSP00000341805:Y199D	ENSP00000341805:Y199D	Y	-	1	0	PHF10	169857827	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.676000	0.91199	2.324000	0.78689	0.533000	0.62120	TAT	.	.	none		0.353	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346732.1	NM_018288	
YTHDC2	64848	hgsc.bcm.edu	37	5	112889370	112889370	+	Missense_Mutation	SNP	G	G	C	rs75714066	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr5:112889370G>C	ENST00000161863.4	+	14	2164	c.1951G>C	c.(1951-1953)Gac>Cac	p.D651H	YTHDC2_ENST00000515883.1_Missense_Mutation_p.D651H	NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	651	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		GCGGTTTGCTGACAGTACACA	0.398													G|||	276	0.0551118	0.0023	0.0331	5008	,	,		15883	0.1002		0.0696	False		,,,				2504	0.0808				p.D651H		Atlas-SNP	.											.	YTHDC2	118	.	0			c.G1951C						PASS	.	G	HIS/ASP	51,4353	50.9+/-86.3	1,49,2152	141.0	141.0	141.0		1951	5.4	1.0	5	dbSNP_131	141	625,7975	161.9+/-214.7	27,571,3702	yes	missense	YTHDC2	NM_022828.3	81	28,620,5854	CC,CG,GG		7.2674,1.158,5.1984	probably-damaging	651/1431	112889370	676,12328	2202	4300	6502	SO:0001583	missense	64848	exon14			TTTGCTGACAGTA	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.1951G>C	5.37:g.112889370G>C	ENSP00000161863:p.Asp651His	Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	80	4	0.05	NM_022828	B2RP66	Missense_Mutation	SNP	ENST00000161863.4	37	CCDS4113.1	121	0.0554029304029304	2	0.0040650406504065045	15	0.04143646408839779	51	0.08916083916083917	53	0.06992084432717678	G	16.04	3.008921	0.54361	0.01158	0.072674	ENSG00000047188	ENST00000161863;ENST00000515883;ENST00000511372	T;T	0.08193	4.09;3.12	5.38	5.38	0.77491	Helicase, C-terminal (2);	0.438726	0.25453	N	0.030576	T	0.00412	0.0013	N	0.22421	0.69	0.58432	D	0.999992	B	0.26483	0.15	B	0.38296	0.27	T	0.45542	-0.9254	10	0.49607	T	0.09	.	19.1064	0.93296	0.0:0.0:1.0:0.0	.	651	Q9H6S0	YTDC2_HUMAN	H	651;651;561	ENSP00000161863:D651H;ENSP00000423101:D651H	ENSP00000161863:D651H	D	+	1	0	YTHDC2	112917269	1.000000	0.71417	0.997000	0.53966	0.875000	0.50365	7.088000	0.76901	2.495000	0.84180	0.650000	0.86243	GAC	G|0.944;C|0.056	0.056	strong		0.398	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828	
CKB	1152	hgsc.bcm.edu	37	14	103988180	103988180	+	Silent	SNP	G	G	T	rs1136165	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr14:103988180G>T	ENST00000348956.2	-	4	813	c.456C>A	c.(454-456)cgC>cgA	p.R152R		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	152	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	TCTCGATGGCGCGGCGCTCCC	0.756													G|||	3294	0.657748	0.5416	0.7349	5008	,	,		7060	0.8264		0.6233	False		,,,				2504	0.6217				p.R152R	Esophageal Squamous(186;2492 2823 49929 50127)	Atlas-SNP	.											.	CKB	9	.	0			c.C456A						PASS	.	G		1738,1164		574,590,287	3.0	4.0	3.0		456	-0.0	1.0	14	dbSNP_86	3	4002,2154		1387,1228,463	no	coding-synonymous	CKB	NM_001823.3		1961,1818,750	TT,TG,GG		34.9903,40.1103,36.6306		152/382	103988180	5740,3318	1451	3078	4529	SO:0001819	synonymous_variant	1152	exon4			GATGGCGCGGCGC		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.456C>A	14.37:g.103988180G>T		Somatic	1	0	0		WXS	Illumina HiSeq	Phase_I	7	4	0.571429	NM_001823	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	ENST00000348956.2	37	CCDS9981.1	1462	0.6694139194139194	285	0.5792682926829268	250	0.6906077348066298	460	0.8041958041958042	467	0.6160949868073878	G	13.11	2.138272	0.37728	0.598897	0.650097	ENSG00000166165	ENST00000428256	.	.	.	4.64	-0.0349	0.13894	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999624	.	.	.	.	.	.	T	0.17592	-1.0364	5	0.41790	T	0.15	-18.9304	4.9837	0.14180	0.3841:0.2745:0.3414:0.0	rs1136165;rs2227867;rs2765044;rs3179077;rs3199393;rs17366340;rs17423634;rs17849441;rs17850309;rs17850603;rs17851735;rs17851741;rs17857802	.	.	.	S	118	.	ENSP00000395515:R118S	R	-	1	0	CKB	103057933	0.001000	0.12720	0.999000	0.59377	0.996000	0.88848	-2.081000	0.01367	0.066000	0.16515	0.449000	0.29647	CGC	G|0.327;T|0.673	0.673	strong		0.756	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
DGKZ	8525	hgsc.bcm.edu	37	11	46387868	46387868	+	Missense_Mutation	SNP	A	A	G	rs1317826	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr11:46387868A>G	ENST00000454345.1	+	2	187	c.62A>G	c.(61-63)cAg>cGg	p.Q21R	DGKZ_ENST00000456247.2_Intron|DGKZ_ENST00000527911.1_Intron|DGKZ_ENST00000528615.1_Intron|DGKZ_ENST00000318201.8_Intron|DGKZ_ENST00000543978.1_Intron|DGKZ_ENST00000532868.2_Intron|DGKZ_ENST00000525434.1_3'UTR|DGKZ_ENST00000421244.2_Intron|DGKZ_ENST00000343674.6_Intron|DGKZ_ENST00000395574.3_Intron	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	21			Q -> R (in dbSNP:rs1317826). {ECO:0000269|PubMed:9159104}.		blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		GAGGGGCAGCAGCGGCCCAGC	0.701													G|||	2181	0.435503	0.9107	0.2493	5008	,	,		13838	0.1458		0.3111	False		,,,				2504	0.3517				p.Q21R		Atlas-SNP	.											.	DGKZ	199	.	0			c.A62G						PASS	.	G	ARG/GLN,,,,,,	2682,930		1027,628,151	8.0	9.0	9.0		62,,,,,,	4.5	1.0	11	dbSNP_88	9	2229,5713		386,1457,2128	yes	missense,intron,intron,intron,intron,intron,intron	DGKZ	NM_001105540.1,NM_001199266.1,NM_001199267.1,NM_001199268.1,NM_003646.3,NM_201532.2,NM_201533.3	43,,,,,,	1413,2085,2279	GG,GA,AA		28.066,25.7475,42.5048	benign,,,,,,	21/1118,,,,,,	46387868	4911,6643	1806	3971	5777	SO:0001583	missense	8525	exon2			GGCAGCAGCGGCC	U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.62A>G	11.37:g.46387868A>G	ENSP00000412178:p.Gln21Arg	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	17	7	0.411765	NM_001105540	B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Missense_Mutation	SNP	ENST00000454345.1	37	CCDS41640.1	872	0.3992673992673993	446	0.9065040650406504	95	0.26243093922651933	97	0.16958041958041958	234	0.3087071240105541	G	2.360	-0.346808	0.05208	0.742525	0.28066	ENSG00000149091	ENST00000454345	T	0.64260	-0.09	4.53	4.53	0.55603	.	0.291635	0.22594	N	0.058046	T	0.00012	0.0000	N	0.02916	-0.46	0.09310	P	1.0	B	0.02656	0.0	B	0.01281	0.0	T	0.40961	-0.9535	9	0.02654	T	1	.	13.0604	0.59003	0.0784:0.0:0.9216:0.0	rs1317826	21	Q13574	DGKZ_HUMAN	R	21	ENSP00000412178:Q21R	ENSP00000412178:Q21R	Q	+	2	0	DGKZ	46344444	1.000000	0.71417	0.991000	0.47740	0.097000	0.18754	3.832000	0.55783	1.049000	0.40321	-0.213000	0.12676	CAG	A|0.609;G|0.391	0.391	strong		0.701	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389772.1	NM_001105540	
ZNF578	147660	hgsc.bcm.edu	37	19	53014878	53014878	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr19:53014878C>T	ENST00000421239.2	+	6	1488	c.1244C>T	c.(1243-1245)tCa>tTa	p.S415L	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	415					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		TCACACCTTTCACGTCATCAT	0.378																																					p.S415L		Atlas-SNP	.											.	.	.	.	0			c.C1244T						PASS	.						88.0	91.0	90.0					19																	53014878		2203	4300	6503	SO:0001583	missense	147660	exon6			ACCTTTCACGTCA	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.1244C>T	19.37:g.53014878C>T	ENSP00000459216:p.Ser415Leu	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	49	5	0.102041	NM_001099694	B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	37	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	-	5.135	0.210440	0.09757	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.48	-2.25	0.06888	.	.	.	.	.	T	0.17408	0.0418	N	0.17764	0.52	0.09310	N	1	B	0.12013	0.005	B	0.13407	0.009	T	0.24621	-1.0155	7	.	.	.	.	3.2313	0.06750	0.0:0.3277:0.2196:0.4527	.	415	G3V4F6	.	L	415	.	.	S	+	2	0	ZNF578	57706690	0.117000	0.22190	0.000000	0.03702	0.002000	0.02628	-0.265000	0.08644	-0.620000	0.05641	-0.734000	0.03567	TCA	.	.	none		0.378	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472	
CD7	924	hgsc.bcm.edu	37	17	80274179	80274179	+	Silent	SNP	A	A	G	rs560319694		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:80274179A>G	ENST00000312648.3	-	3	610	c.504T>C	c.(502-504)tcT>tcC	p.S168S	CD7_ENST00000578509.1_Silent_p.S68S|CD7_ENST00000583376.1_Silent_p.S68S|CD7_ENST00000584284.1_Silent_p.S168S	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	168	4 X 9 AA tandem repeats, potential spacer function.				homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			CAGGGAGGGCAGAGGCTGTCT	0.716																																					p.S168S	Pancreas(45;804 1068 19702 28207 28798)	Atlas-SNP	.											CD7,rectum,carcinoma,0,1	CD7	25	1	0			c.T504C						scavenged	.						14.0	17.0	16.0					17																	80274179		2168	4265	6433	SO:0001819	synonymous_variant	924	exon3			GAGGGCAGAGGCT	X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.504T>C	17.37:g.80274179A>G		Somatic	85	1	0.0117647		WXS	Illumina HiSeq	Phase_I	48	13	0.270833	NM_006137		Silent	SNP	ENST00000312648.3	37	CCDS11807.1																																																																																			.	.	none		0.716	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442826.1	NM_006137	
HLA-DMB	3109	hgsc.bcm.edu	37	6	32905038	32905038	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr6:32905038G>A	ENST00000418107.2	-	3	795	c.533C>T	c.(532-534)tCc>tTc	p.S178F	HLA-DMB_ENST00000416244.2_Missense_Mutation_p.S178F|AL645941.1_ENST00000390777.1_RNA	NM_002118.4	NP_002109.2	P28068	DMB_HUMAN	major histocompatibility complex, class II, DM beta	178	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|MHC class II protein complex assembly (GO:0002399)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001190)|positive regulation of T cell proliferation (GO:0042102)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)			breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						GGCTAAATGGGAGAGGGTCTG	0.557																																					p.S178F		Atlas-SNP	.											.	HLA-DMB	38	.	0			c.C533T						PASS	.						146.0	111.0	123.0					6																	32905038		2203	4300	6503	SO:0001583	missense	3109	exon3			AAATGGGAGAGGG		CCDS4760.1	6p21.3	2014-05-16			ENSG00000242574	ENSG00000242574		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4935	protein-coding gene	gene with protein product		142856				1922365	Standard	NM_002118		Approved	D6S221E, RING7	uc003ocl.2	P28068	OTTHUMG00000031176	ENST00000418107.2:c.533C>T	6.37:g.32905038G>A	ENSP00000398890:p.Ser178Phe	Somatic	187	0	0		WXS	Illumina HiSeq	Phase_I	166	11	0.0662651	NM_002118	O77936|Q13012|Q29751|Q58ZE2|Q5SNZ8|Q5STC4|Q9XRX2	Missense_Mutation	SNP	ENST00000418107.2	37	CCDS4760.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.151635	0.38021	.	.	ENSG00000242574	ENST00000438510;ENST00000446948;ENST00000418107;ENST00000416244	T;T;T	0.04234	3.67;5.59;5.59	4.56	4.56	0.56223	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.240788	0.29892	N	0.010929	T	0.16041	0.0386	M	0.89287	3.02	0.28561	N	0.911108	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0	D;D;D;D;D	0.97110	0.983;1.0;0.969;0.994;1.0	T	0.01460	-1.1349	10	0.87932	D	0	.	13.0126	0.58739	0.0:0.0:1.0:0.0	.	178;178;60;67;178	E9PD01;A2AAT3;B0V061;B0V062;P28068	.;.;.;.;DMB_HUMAN	F	60;178;178;178	ENSP00000390848:S60F;ENSP00000398890:S178F;ENSP00000391010:S178F	ENSP00000391010:S178F	S	-	2	0	HLA-DMB	33013016	0.107000	0.21998	0.515000	0.27774	0.121000	0.20230	2.070000	0.41491	2.524000	0.85096	0.494000	0.49563	TCC	.	.	none		0.557	HLA-DMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076340.2	NM_002118	
OR2T33	391195	hgsc.bcm.edu	37	1	248436840	248436840	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:248436840C>T	ENST00000318021.2	-	1	298	c.277G>A	c.(277-279)Gct>Act	p.A93T		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CCACAGCCAGCGCGGGAGATG	0.577																																					p.A93T		Atlas-SNP	.											OR2T33,bladder,carcinoma,0,1	OR2T33	133	1	0			c.G277A						scavenged	.																																			SO:0001583	missense	391195	exon1			AGCCAGCGCGGGA		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.277G>A	1.37:g.248436840C>T	ENSP00000324687:p.Ala93Thr	Somatic	616	5	0.00811688		WXS	Illumina HiSeq	Phase_I	496	8	0.016129	NM_001004695	B2RNN0	Missense_Mutation	SNP	ENST00000318021.2	37	CCDS31109.1	.	.	.	.	.	.	.	.	.	.	-	0.985	-0.695697	0.03279	.	.	ENSG00000177212	ENST00000318021	T	0.00397	7.57	2.7	0.338	0.15974	GPCR, rhodopsin-like superfamily (1);	0.230385	0.21954	U	0.066696	T	0.00178	0.0005	L	0.35854	1.095	0.09310	N	1	P	0.39250	0.665	B	0.28139	0.086	T	0.43556	-0.9384	10	0.31617	T	0.26	.	2.9908	0.05982	0.0:0.3022:0.2351:0.4627	.	93	Q8NG76	O2T33_HUMAN	T	93	ENSP00000324687:A93T	ENSP00000324687:A93T	A	-	1	0	OR2T33	246503463	0.000000	0.05858	0.014000	0.15608	0.002000	0.02628	-2.218000	0.01219	0.399000	0.25367	0.494000	0.49563	GCT	.	.	none		0.577	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695	
SERPINB13	5275	hgsc.bcm.edu	37	18	61255917	61255917	+	Missense_Mutation	SNP	G	G	A	rs191405968	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr18:61255917G>A	ENST00000344731.5	+	2	118	c.16G>A	c.(16-18)Gcc>Acc	p.A6T	SERPINB13_ENST00000269489.5_Missense_Mutation_p.A6T	NM_012397.3	NP_036529.1	Q9UIV8	SPB13_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 13	6					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						TTCACTTGGCGCCGTCAGCAC	0.423													G|||	2	0.000399361	0.0	0.0029	5008	,	,		19904	0.0		0.0	False		,,,				2504	0.0				p.A6T		Atlas-SNP	.											.	SERPINB13	51	.	0			c.G16A						PASS	.						92.0	89.0	90.0					18																	61255917		2203	4300	6503	SO:0001583	missense	5275	exon2			CTTGGCGCCGTCA	AF169949, BC101821	CCDS11985.1	18q21.33	2014-02-18	2005-08-18		ENSG00000197641	ENSG00000197641		"""Serine (or cysteine) peptidase inhibitors"""	8944	protein-coding gene	gene with protein product		604445	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13"""	PI13		9297979, 10512713, 24172014	Standard	NM_012397		Approved	HUR7, hurpin, headpin	uc002ljc.3	Q9UIV8	OTTHUMG00000060406	ENST00000344731.5:c.16G>A	18.37:g.61255917G>A	ENSP00000341584:p.Ala6Thr	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	88	6	0.0681818	NM_012397	A8K2Q8|Q3MII2|Q9HCX1|Q9UBW1|Q9UKG0	Missense_Mutation	SNP	ENST00000344731.5	37	CCDS11985.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	7.201	0.593433	0.13875	.	.	ENSG00000197641	ENST00000431153;ENST00000269489;ENST00000539341;ENST00000344731	T;T;D	0.82984	-0.88;2.75;-1.67	4.89	-0.0729	0.13737	Serpin domain (1);	0.665922	0.13840	N	0.359130	T	0.59878	0.2226	N	0.11313	0.125	0.09310	N	1	B;B	0.25105	0.118;0.004	B;B	0.21917	0.037;0.007	T	0.46062	-0.9218	10	0.11485	T	0.65	.	5.043	0.14469	0.4092:0.1437:0.4471:0.0	.	6;6	B7ZKV6;Q9UIV8	.;SPB13_HUMAN	T	36;6;6;6	ENSP00000388300:A36T;ENSP00000269489:A6T;ENSP00000341584:A6T	ENSP00000269489:A6T	A	+	1	0	SERPINB13	59406897	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.999000	0.03697	-0.219000	0.10003	-0.258000	0.10820	GCC	G|1.000;A|0.000	0.000	strong		0.423	SERPINB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133798.1	NM_012397	
PLIN4	729359	hgsc.bcm.edu	37	19	4512840	4512840	+	Missense_Mutation	SNP	C	C	T	rs183706868	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr19:4512840C>T	ENST00000301286.3	-	3	1089	c.1090G>A	c.(1090-1092)Gtg>Atg	p.V364M		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	364	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GCCAAGTTCACGGCACCGGTC	0.582													C|||	118	0.0235623	0.084	0.0014	5008	,	,		18712	0.0		0.005	False		,,,				2504	0.001				p.V364M		Atlas-SNP	.											PLIN4_ENST00000301286,colon,carcinoma,0,4	PLIN4	191	4	0			c.G1090A						scavenged	.	C	MET/VAL	222,3242		8,206,1518	39.0	64.0	56.0		1090	-8.7	0.0	19		56	27,8209		0,27,4091	yes	missense	PLIN4	NM_001080400.1	21	8,233,5609	TT,TC,CC		0.3278,6.4088,2.1282	benign	364/1358	4512840	249,11451	1732	4118	5850	SO:0001583	missense	729359	exon3			AGTTCACGGCACC	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.1090G>A	19.37:g.4512840C>T	ENSP00000301286:p.Val364Met	Somatic	157	1	0.00636943		WXS	Illumina HiSeq	Phase_I	96	3	0.03125	NM_001080400	A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	37	CCDS45927.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	3.523	-0.097275	0.07010	0.064088	0.003278	ENSG00000167676	ENST00000301286	T	0.11712	2.75	4.36	-8.72	0.00845	.	0.735978	0.11783	N	0.529974	T	0.00356	0.0011	N	0.01771	-0.73	0.09310	N	1	B	0.26602	0.154	B	0.11329	0.006	T	0.33904	-0.9850	10	0.11485	T	0.65	-2.9034	14.7504	0.69522	0.0:0.39:0.0:0.61	.	364	Q96Q06	PLIN4_HUMAN	M	364	ENSP00000301286:V364M	ENSP00000301286:V364M	V	-	1	0	PLIN4	4463840	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-7.548000	0.00034	-2.883000	0.00318	-2.648000	0.00150	GTG	C|1.000;T|0.000	0.000	strong		0.582	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
TIGD2	166815	hgsc.bcm.edu	37	4	90034738	90034738	+	Missense_Mutation	SNP	A	A	G			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr4:90034738A>G	ENST00000317005.2	+	1	771	c.613A>G	c.(613-615)Agc>Ggc	p.S205G	FAM13A_ENST00000502459.1_5'Flank|RP11-84C13.1_ENST00000603357.1_lincRNA	NM_145715.2	NP_663761.1	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	205	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	14		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		GTGTAGGTCAAGCAGAGAGAG	0.413																																					p.S205G		Atlas-SNP	.											.	TIGD2	36	.	0			c.A613G						PASS	.						74.0	77.0	76.0					4																	90034738		2203	4299	6502	SO:0001583	missense	166815	exon1			AGGTCAAGCAGAG	AK027653	CCDS3633.1	4q21.3	2013-02-21			ENSG00000180346	ENSG00000180346			18333	protein-coding gene	gene with protein product		612973					Standard	NM_145715		Approved		uc003hsk.3	Q4W5G0	OTTHUMG00000130946	ENST00000317005.2:c.613A>G	4.37:g.90034738A>G	ENSP00000317170:p.Ser205Gly	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	97	7	0.0721649	NM_145715		Missense_Mutation	SNP	ENST00000317005.2	37	CCDS3633.1	.	.	.	.	.	.	.	.	.	.	a	4.701	0.130320	0.08981	.	.	ENSG00000180346	ENST00000317005	T	0.41065	1.01	3.97	3.97	0.46021	.	0.000000	0.39083	U	0.001480	T	0.32852	0.0843	L	0.53671	1.685	0.26228	N	0.979052	B	0.16166	0.016	B	0.15052	0.012	T	0.14839	-1.0458	10	0.17832	T	0.49	-3.6072	7.4637	0.27310	0.7792:0.2208:0.0:0.0	.	205	Q4W5G0	TIGD2_HUMAN	G	205	ENSP00000317170:S205G	ENSP00000317170:S205G	S	+	1	0	TIGD2	90253761	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	4.010000	0.57117	1.682000	0.51000	0.446000	0.29264	AGC	.	.	none		0.413	TIGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253545.2	NM_145715	
KRT38	8687	hgsc.bcm.edu	37	17	39595539	39595539	+	Silent	SNP	A	A	G	rs117668654	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:39595539A>G	ENST00000246646.3	-	3	647	c.648T>C	c.(646-648)gaT>gaC	p.D216D		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	216	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				CCAGGGTCGCATCATCCAGGA	0.632													G|||	58	0.0115815	0.0008	0.0043	5008	,	,		17656	0.0278		0.0089	False		,,,				2504	0.0174				p.D216D		Atlas-SNP	.											KRT38,rectum,carcinoma,0,1	KRT38	63	1	0			c.T648C						scavenged	.						85.0	77.0	79.0					17																	39595539		2203	4300	6503	SO:0001819	synonymous_variant	8687	exon3			GGTCGCATCATCC	Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.648T>C	17.37:g.39595539A>G		Somatic	50	3	0.06		WXS	Illumina HiSeq	Phase_I	59	3	0.0508475	NM_006771	A2RRM5|Q6A164	Silent	SNP	ENST00000246646.3	37	CCDS11392.1																																																																																			A|0.999;G|0.001	0.001	weak		0.632	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257307.2	NM_006771	
MKL1	57591	hgsc.bcm.edu	37	22	40816901	40816901	+	Missense_Mutation	SNP	C	C	G			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr22:40816901C>G	ENST00000355630.3	-	10	1421	c.831G>C	c.(829-831)caG>caC	p.Q277H	MKL1_ENST00000407029.1_Missense_Mutation_p.Q277H|MKL1_ENST00000396617.3_Missense_Mutation_p.Q277H|MKL1_ENST00000402042.1_Missense_Mutation_p.Q227H	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	277	Gln-rich.				negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GCTGCTGCTGCTGGTTGAGGA	0.657			T	RBM15	acute megakaryocytic leukemia																																p.Q277H		Atlas-SNP	.		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	MKL1	69	.	0			c.G831C						PASS	.						62.0	63.0	62.0					22																	40816901		2203	4300	6503	SO:0001583	missense	57591	exon10			CTGCTGCTGGTTG	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.831G>C	22.37:g.40816901C>G	ENSP00000347847:p.Gln277His	Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	67	4	0.0597015	NM_020831	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	37	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.766193	0.69878	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029	T;T;T;T	0.61859	0.16;0.11;0.07;0.16	5.26	4.24	0.50183	.	0.000000	0.85682	D	0.000000	T	0.73353	0.3576	M	0.77616	2.38	0.48696	D	0.999692	P;D;P	0.67145	0.787;0.996;0.787	B;D;B	0.75484	0.294;0.986;0.294	T	0.75385	-0.3336	10	0.66056	D	0.02	-15.2355	9.9937	0.41887	0.0:0.8449:0.0:0.1551	.	227;277;277	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	H	277;277;227;277	ENSP00000347847:Q277H;ENSP00000379861:Q277H;ENSP00000385584:Q227H;ENSP00000385835:Q277H	ENSP00000347847:Q277H	Q	-	3	2	MKL1	39146847	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.270000	0.51600	1.210000	0.43336	0.462000	0.41574	CAG	.	.	none		0.657	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
DNTTIP2	30836	hgsc.bcm.edu	37	1	94341909	94341909	+	Missense_Mutation	SNP	T	T	C			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:94341909T>C	ENST00000436063.2	-	2	1639	c.1582A>G	c.(1582-1584)Agt>Ggt	p.S528G	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	528					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S528G(1)		NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		tcttcttcacttttttcatcc	0.368																																					p.S528G		Atlas-SNP	.											DNTTIP2,lymph_node,lymphoid_neoplasm,0,1	DNTTIP2	59	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.A1582G						PASS	.						137.0	120.0	125.0					1																	94341909		1856	4045	5901	SO:0001583	missense	30836	exon2			CTTCACTTTTTTC	AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.1582A>G	1.37:g.94341909T>C	ENSP00000411010:p.Ser528Gly	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	90	7	0.0777778	NM_014597	Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Missense_Mutation	SNP	ENST00000436063.2	37	CCDS44174.1	.	.	.	.	.	.	.	.	.	.	T	10.41	1.341819	0.24339	.	.	ENSG00000067334	ENST00000436063	T	0.17528	2.27	4.36	3.22	0.36961	.	2.882460	0.00834	N	0.001686	T	0.07098	0.0180	L	0.56769	1.78	0.28783	N	0.899718	B	0.29716	0.255	B	0.24394	0.053	T	0.17776	-1.0358	10	0.39692	T	0.17	.	5.0473	0.14490	0.0:0.3543:0.0:0.6457	.	528	Q5QJE6	TDIF2_HUMAN	G	528	ENSP00000411010:S528G	ENSP00000352137:S528G	S	-	1	0	DNTTIP2	94114497	0.172000	0.23043	0.804000	0.32291	0.784000	0.44337	0.933000	0.28897	0.992000	0.38840	0.533000	0.62120	AGT	.	.	none		0.368	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597	
SLFN12L	100506736	hgsc.bcm.edu	37	17	33805150	33805150	+	Missense_Mutation	SNP	T	T	C	rs2304968	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:33805150T>C	ENST00000260908.7	-	3	1265	c.1148A>G	c.(1147-1149)tAt>tGt	p.Y383C	SLFN12L_ENST00000361112.4_Missense_Mutation_p.Y412C|RP11-686D22.9_ENST00000587076.1_RNA|SLFN12L_ENST00000449046.1_Missense_Mutation_p.Y414C	NM_001195790.1	NP_001182719.1	Q6IEE8	SN12L_HUMAN	schlafen family member 12-like	383						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)	p.Y414C(2)|p.Y412C(1)		breast(1)|endometrium(4)|kidney(5)|large_intestine(2)|lung(3)|ovary(1)	16						ACGAAGAGGATAACTCTGGGA	0.398													C|||	3780	0.754792	0.9168	0.6383	5008	,	,		20128	0.6587		0.6829	False		,,,				2504	0.7914				p.Y383C		Atlas-SNP	.											SLFN12L_ENST00000449046,NS,carcinoma,0,6	SLFN12L	140	6	3	Substitution - Missense(3)	kidney(3)	c.A1148G						scavenged	.	C	CYS/TYR	1227,157		546,135,11	135.0	121.0	125.0		1148	-1.2	0.0	17	dbSNP_100	125	2115,1067		707,701,183	yes	missense	SLFN12L	NM_001195790.1	194	1253,836,194	CC,CT,TT		33.5324,11.3439,26.8068	benign	383/589	33805150	3342,1224	692	1591	2283	SO:0001583	missense	100506736	exon3			AGAGGATAACTCT	AK172761	CCDS56026.1	17q12	2011-05-24				ENSG00000205045			33920	protein-coding gene	gene with protein product		614956				9846487	Standard	NM_001195790		Approved		uc021tuy.1	Q6IEE8		ENST00000260908.7:c.1148A>G	17.37:g.33805150T>C	ENSP00000437635:p.Tyr383Cys	Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	108	2	0.0185185	NM_001195790	F5H6G3	Missense_Mutation	SNP	ENST00000260908.7	37	CCDS56026.1	1593	0.7293956043956044	449	0.9126016260162602	254	0.7016574585635359	397	0.6940559440559441	493	0.6503957783641161	C	1.330	-0.597078	0.03771	0.886561	0.664676	ENSG00000205045	ENST00000260908;ENST00000361112;ENST00000449046	T;T;T	0.03689	3.85;3.95;3.84	1.27	-1.22	0.09494	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.04153	-1.0973	8	0.42905	T	0.14	.	5.2941	0.15743	0.0:0.4062:0.0:0.5938	rs2304968;rs17249618;rs52812194;rs56785656;rs2304968	412	Q6IEE8-2	.	C	383;412;414	ENSP00000437635:Y383C;ENSP00000354412:Y412C;ENSP00000389348:Y414C	ENSP00000437635:Y383C	Y	-	2	0	SLFN12L	30829263	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.731000	0.01853	-0.909000	0.03852	-0.971000	0.02607	TAT	T|0.242;C|0.758	0.758	strong		0.398	SLFN12L-004	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395748.2	XM_496206	
TAS2R30	259293	hgsc.bcm.edu	37	12	11286736	11286736	+	Silent	SNP	G	G	C	rs112605675		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr12:11286736G>C	ENST00000539585.1	-	1	507	c.108C>G	c.(106-108)gtC>gtG	p.V36V	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	36					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.V36V(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						TTTGTCTCTTGACCCACTCAA	0.388																																					p.V36V		Atlas-SNP	.											TAS2R30,NS,carcinoma,0,1	TAS2R30	28	1	1	Substitution - coding silent(1)	lung(1)	c.C108G						scavenged	.						67.0	66.0	66.0					12																	11286736		2014	4225	6239	SO:0001819	synonymous_variant	259293	exon1			TCTCTTGACCCAC	AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.108C>G	12.37:g.11286736G>C		Somatic	295	2	0.00677966		WXS	Illumina HiSeq	Phase_I	261	7	0.0268199	NM_001097643	Q645X7	Silent	SNP	ENST00000539585.1	37	CCDS53750.1																																																																																			G|0.500;C|0.500	0.500	weak		0.388	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
FMN2	56776	hgsc.bcm.edu	37	1	240371283	240371283	+	Silent	SNP	T	T	A	rs201761863	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:240371283T>A	ENST00000319653.9	+	5	3401	c.3171T>A	c.(3169-3171)ccT>ccA	p.P1057P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1057	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CTCCTCCCCCTCTTCCCGGAG	0.736																																					p.P1057P		Atlas-SNP	.											FMN2,NS,carcinoma,0,1	FMN2	451	1	0			c.T3171A						scavenged	.						1.0	1.0	1.0					1																	240371283		602	1396	1998	SO:0001819	synonymous_variant	56776	exon5			TCCCCCTCTTCCC	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3171T>A	1.37:g.240371283T>A		Somatic	75	11	0.146667		WXS	Illumina HiSeq	Phase_I	66	8	0.121212	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			T|0.957;A|0.043	0.043	strong		0.736	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
ACAN	176	hgsc.bcm.edu	37	15	89400106	89400106	+	Silent	SNP	T	T	C	rs78806382	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr15:89400106T>C	ENST00000561243.1	+	11	4290	c.4290T>C	c.(4288-4290)agT>agC	p.S1430S	ACAN_ENST00000559004.1_Silent_p.S1430S|ACAN_ENST00000439576.2_Silent_p.S1430S|ACAN_ENST00000352105.7_Silent_p.S1430S			P16112	PGCA_HUMAN	aggrecan	1431	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			ATGAGATCAGTGGGCTTCCTT	0.527													-|||	119	0.023762	0.0083	0.0144	5008	,	,		17508	0.0129		0.0398	False		,,,				2504	0.046				p.S1430S		Atlas-SNP	.											AGC1,NS,haematopoietic_neoplasm,0,2	ACAN	220	2	0			c.T4290C						scavenged	.	T	,	36,3654		0,36,1809	147.0	146.0	147.0		4290,4290	-1.8	0.0	15	dbSNP_131	147	209,7961		4,201,3880	no	coding-synonymous,coding-synonymous	ACAN	NM_001135.3,NM_013227.3	,	4,237,5689	CC,CT,TT		2.5581,0.9756,2.0658	,	1430/2432,1430/2531	89400106	245,11615	1845	4085	5930	SO:0001819	synonymous_variant	176	exon12			GATCAGTGGGCTT	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.4290T>C	15.37:g.89400106T>C		Somatic	130	2	0.0153846		WXS	Illumina HiSeq	Phase_I	104	4	0.0384615	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	37	CCDS53970.1																																																																																			T|0.949;C|0.051	0.051	strong		0.527	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
KDR	3791	hgsc.bcm.edu	37	4	55968617	55968617	+	Missense_Mutation	SNP	T	T	G			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr4:55968617T>G	ENST00000263923.4	-	14	2341	c.2046A>C	c.(2044-2046)gaA>gaC	p.E682D		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	682	Ig-like C2-type 7.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTTCGATGCTTTCCCCAATAC	0.438			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.E682D		Atlas-SNP	.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	KDR	307	.	0			c.A2046C						PASS	.						191.0	160.0	171.0					4																	55968617		2203	4300	6503	SO:0001583	missense	3791	exon14			GATGCTTTCCCCA	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2046A>C	4.37:g.55968617T>G	ENSP00000263923:p.Glu682Asp	Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	111	6	0.0540541	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	T	4.280	0.051088	0.08243	.	.	ENSG00000128052	ENST00000263923	D	0.82344	-1.6	6.02	0.114	0.14639	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.105014	0.64402	D	0.000004	T	0.65616	0.2708	N	0.11364	0.135	0.39576	D	0.969365	B	0.27140	0.169	B	0.36030	0.216	T	0.48833	-0.9000	10	0.09590	T	0.72	.	9.6807	0.40067	0.0:0.3153:0.0:0.6847	.	682	P35968	VGFR2_HUMAN	D	682	ENSP00000263923:E682D	ENSP00000263923:E682D	E	-	3	2	KDR	55663374	1.000000	0.71417	0.988000	0.46212	0.095000	0.18619	0.945000	0.29056	-0.165000	0.10908	0.533000	0.62120	GAA	.	.	none		0.438	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
FCGBP	8857	hgsc.bcm.edu	37	19	40373950	40373950	+	Missense_Mutation	SNP	G	G	T	rs200958848	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr19:40373950G>T	ENST00000221347.6	-	26	12135	c.12128C>A	c.(12127-12129)aCc>aAc	p.T4043N	FCGBP_ENST00000595713.1_5'Flank	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4043	Cys-rich.			T -> N (in Ref. 1; BAA19526). {ECO:0000305}.		extracellular vesicular exosome (GO:0070062)		p.T4043N(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			agcACCTTTGGTGACGCAGCT	0.637													g|||	355	0.0708866	0.0242	0.0159	5008	,	,		20309	0.244		0.0239	False		,,,				2504	0.0429				p.T4043N		Atlas-SNP	.											FCGBP,NS,carcinoma,0,1	FCGBP	416	1	1	Substitution - Missense(1)	lung(1)	c.C12128A						scavenged	.						41.0	42.0	41.0					19																	40373950		2124	4117	6241	SO:0001583	missense	8857	exon26			CCTTTGGTGACGC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12128C>A	19.37:g.40373950G>T	ENSP00000221347:p.Thr4043Asn	Somatic	227	8	0.0352423		WXS	Illumina HiSeq	Phase_I	229	20	0.0873362	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	g	0.780	-0.762570	0.02996	.	.	ENSG00000090920	ENST00000221347	T	0.19532	2.14	2.82	-4.06	0.03986	von Willebrand factor, type C (1);	.	.	.	.	T	0.12433	0.0302	L	0.31664	0.95	0.80722	P	0.0	B	0.06786	0.001	B	0.04013	0.001	T	0.41680	-0.9495	8	0.16896	T	0.51	.	10.7073	0.45962	0.0:0.0:0.3532:0.6468	.	4043	Q9Y6R7	FCGBP_HUMAN	N	4043	ENSP00000221347:T4043N	ENSP00000221347:T4043N	T	-	2	0	FCGBP	45065790	0.051000	0.20477	0.021000	0.16686	0.010000	0.07245	-0.835000	0.04386	-0.764000	0.04651	-0.677000	0.03784	ACC	G|0.750;T|0.250	0.250	weak		0.637	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
PTPRG	5793	hgsc.bcm.edu	37	3	62189308	62189308	+	Silent	SNP	C	C	T	rs150936656		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr3:62189308C>T	ENST00000474889.1	+	12	2216	c.1839C>T	c.(1837-1839)caC>caT	p.H613H	PTPRG_ENST00000295874.10_Silent_p.H613H	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	613					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		GGGTGACCCACGCTGCCGAGG	0.602																																					p.H613H		Atlas-SNP	.											.	PTPRG	153	.	0			c.C1839T						PASS	.	C		0,4346		0,0,2173	87.0	56.0	66.0		1839	-0.8	0.0	3	dbSNP_134	66	1,8519		0,1,4259	no	coding-synonymous	PTPRG	NM_002841.3		0,1,6432	TT,TC,CC		0.0117,0.0,0.0078		613/1446	62189308	1,12865	2173	4260	6433	SO:0001819	synonymous_variant	5793	exon12			GACCCACGCTGCC	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.1839C>T	3.37:g.62189308C>T		Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	125	16	0.128	NM_002841	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Silent	SNP	ENST00000474889.1	37	CCDS2895.1																																																																																			C|1.000;T|0.000	0.000	weak		0.602	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
ADSSL1	122622	hgsc.bcm.edu	37	14	105204722	105204722	+	Missense_Mutation	SNP	T	T	C			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr14:105204722T>C	ENST00000330877.2	+	3	390	c.305T>C	c.(304-306)gTg>gCg	p.V102A	ADSSL1_ENST00000332972.5_Missense_Mutation_p.V145A	NM_152328.3	NP_689541.1			adenylosuccinate synthase like 1											central_nervous_system(1)|cervix(1)|kidney(1)|lung(5)|ovary(2)|prostate(1)	11		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)		GGCAACGGGGTGGTCATCCAC	0.527																																					p.V145A		Atlas-SNP	.											ADSSL1,NS,carcinoma,-1,1	ADSSL1	37	1	0			c.T434C						scavenged	.						108.0	93.0	98.0					14																	105204722		2203	4300	6503	SO:0001583	missense	122622	exon3			ACGGGGTGGTCAT	AK095921	CCDS9990.1, CCDS9991.1	14q32.33	2010-08-05			ENSG00000185100	ENSG00000185100			20093	protein-coding gene	gene with protein product		612498					Standard	NM_199165		Approved	FLJ38602	uc001ype.3	Q8N142		ENST00000330877.2:c.305T>C	14.37:g.105204722T>C	ENSP00000331260:p.Val102Ala	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	50	3	0.06	NM_199165		Missense_Mutation	SNP	ENST00000330877.2	37	CCDS9990.1	.	.	.	.	.	.	.	.	.	.	T	18.43	3.623044	0.66901	.	.	ENSG00000185100	ENST00000330877;ENST00000332972	T;T	0.54479	0.57;0.57	3.64	3.64	0.41730	.	0.000000	0.85682	D	0.000000	T	0.71333	0.3327	M	0.81682	2.555	0.80722	D	1	D;D	0.64830	0.993;0.994	D;D	0.72338	0.973;0.977	T	0.75822	-0.3182	10	0.87932	D	0	-3.9478	12.2559	0.54623	0.0:0.0:0.0:1.0	.	145;102	Q8N142-2;Q8N142	.;PURA1_HUMAN	A	102;145	ENSP00000331260:V102A;ENSP00000333019:V145A	ENSP00000331260:V102A	V	+	2	0	ADSSL1	104275767	1.000000	0.71417	0.806000	0.32338	0.630000	0.37929	7.699000	0.84547	1.297000	0.44761	0.402000	0.26972	GTG	.	.	none		0.527	ADSSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410529.1		
FAM25A	643161	hgsc.bcm.edu	37	10	88782084	88782084	+	Silent	SNP	A	A	G	rs3802666	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr10:88782084A>G	ENST00000343959.4	+	2	106	c.87A>G	c.(85-87)gaA>gaG	p.E29E	RP11-96C23.14_ENST00000444180.3_RNA	NM_001146157.2	NP_001139629.1	B3EWG3	FM25A_HUMAN	family with sequence similarity 25, member A	29								p.E29E(1)		stomach(1)	1						ATGCCGTGGAAGAAGTGGTGA	0.622													.|||	2472	0.49361	0.5	0.3098	5008	,	,		20458	0.7173		0.4493	False		,,,				2504	0.4305				p.E29E		Atlas-SNP	.											FAM25A,NS,carcinoma,0,1	FAM25A	4	1	1	Substitution - coding silent(1)	stomach(1)	c.A87G						scavenged	.						42.0	39.0	40.0					10																	88782084		691	1591	2282	SO:0001819	synonymous_variant	643161	exon2			CGTGGAAGAAGTG		CCDS44451.1	10q23.2	2008-08-13			ENSG00000188100	ENSG00000188100			23436	protein-coding gene	gene with protein product							Standard	NM_001146157		Approved	bA96C23.5	uc010qmo.2	B3EWG3	OTTHUMG00000018664	ENST00000343959.4:c.87A>G	10.37:g.88782084A>G		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	18	10	0.555556	NM_001146157	B2RV02|Q5VTM1	Silent	SNP	ENST00000343959.4	37	CCDS44451.1	902	0.413003663003663	166	0.33739837398373984	101	0.27900552486187846	367	0.6416083916083916	268	0.35356200527704484	G	6.788	0.514316	0.12944	.	.	ENSG00000188100	ENST00000343959	.	.	.	3.93	0.895	0.19247	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.35480	P	0.20192299999999996	.	.	.	.	.	.	T	0.43621	-0.9380	3	.	.	.	-16.1847	7.6603	0.28400	0.3778:0.0:0.6222:0.0	rs3802666;rs7097990;rs12784638	.	.	.	G	36	.	.	R	+	1	2	FAM25A	88772064	0.520000	0.26250	0.513000	0.27749	0.255000	0.26057	-0.446000	0.06837	-0.130000	0.11599	-0.349000	0.07799	AGA	A|0.562;G|0.438	0.438	strong		0.622	FAM25A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049182.2		
CAPN12	147968	hgsc.bcm.edu	37	19	39227194	39227194	+	Missense_Mutation	SNP	C	C	G			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr19:39227194C>G	ENST00000328867.4	-	11	1680	c.1372G>C	c.(1372-1374)Gag>Cag	p.E458Q	CTD-2540F13.2_ENST00000602255.1_RNA|CAPN12_ENST00000601953.1_Missense_Mutation_p.E309Q	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	458	Domain III.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			AGACTCACCTCCTCTGGAATC	0.652																																					p.E458Q		Atlas-SNP	.											.	CAPN12	43	.	0			c.G1372C						PASS	.						22.0	24.0	23.0					19																	39227194		2198	4296	6494	SO:0001583	missense	147968	exon11			TCACCTCCTCTGG	BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.1372G>C	19.37:g.39227194C>G	ENSP00000331636:p.Glu458Gln	Somatic	337	0	0		WXS	Illumina HiSeq	Phase_I	313	25	0.0798722	NM_144691		Missense_Mutation	SNP	ENST00000328867.4	37	CCDS12519.1	.	.	.	.	.	.	.	.	.	.	c	13.68	2.308766	0.40895	.	.	ENSG00000182472	ENST00000328867	D	0.87809	-2.3	2.66	2.66	0.31614	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.845148	0.10500	N	0.667358	T	0.81692	0.4876	L	0.45228	1.405	0.32007	N	0.602555	B	0.06786	0.001	B	0.16722	0.016	T	0.78494	-0.2182	10	0.38643	T	0.18	.	8.9436	0.35745	0.0:1.0:0.0:0.0	.	458	Q6ZSI9	CAN12_HUMAN	Q	458	ENSP00000331636:E458Q	ENSP00000331636:E458Q	E	-	1	0	CAPN12	43919034	1.000000	0.71417	1.000000	0.80357	0.520000	0.34377	2.215000	0.42862	1.798000	0.52647	0.298000	0.19748	GAG	.	.	none		0.652	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462151.1		
CTSE	1510	hgsc.bcm.edu	37	1	206329027	206329027	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:206329027C>T	ENST00000360218.2	+	7	955	c.851C>T	c.(850-852)cCt>cTt	p.P284L	CTSE_ENST00000358184.2_Silent_p.P331P|CTSE_ENST00000432969.2_Missense_Mutation_p.P209L|CTSE_ENST00000361052.3_Silent_p.P336P	NM_148964.2	NP_683865.1	P14091	CATE_HUMAN	cathepsin E	0					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			ACGGAGTCCCCTATACCCTCA	0.527																																					p.P284L		Atlas-SNP	.											.	CTSE	72	.	0			c.C851T						PASS	.						166.0	135.0	146.0					1																	206329027		2203	4300	6503	SO:0001583	missense	1510	exon7			AGTCCCCTATACC	BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000360218.2:c.851C>T	1.37:g.206329027C>T	ENSP00000353350:p.Pro284Leu	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	113	9	0.079646	NM_148964	Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Missense_Mutation	SNP	ENST00000360218.2	37	CCDS1461.1	.	.	.	.	.	.	.	.	.	.	c	12.35	1.910655	0.33721	.	.	ENSG00000196188	ENST00000360218;ENST00000432969	T;T	0.62788	0.67;0.0	5.3	2.21	0.28008	.	0.643045	0.15132	N	0.278775	T	0.44973	0.1319	.	.	.	0.24200	N	0.995516	B;B	0.14438	0.006;0.01	B;B	0.13407	0.004;0.009	T	0.41360	-0.9513	9	0.87932	D	0	.	2.459	0.04537	0.1543:0.4224:0.2816:0.1417	.	209;284	B4DNU8;P14091-2	.;.	L	284;209	ENSP00000353350:P284L;ENSP00000394607:P209L	ENSP00000353350:P284L	P	+	2	0	CTSE	204495650	0.000000	0.05858	0.775000	0.31657	0.173000	0.22820	-0.176000	0.09811	0.717000	0.32145	0.637000	0.83480	CCT	.	.	none		0.527	CTSE-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000087999.1	NM_001910	
DGKI	9162	hgsc.bcm.edu	37	7	137206621	137206621	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr7:137206621G>A	ENST00000288490.5	-	21	2239	c.2239C>T	c.(2239-2241)Cga>Tga	p.R747*	DGKI_ENST00000424189.2_Nonsense_Mutation_p.R768*|DGKI_ENST00000453654.2_Nonsense_Mutation_p.R447*|DGKI_ENST00000446122.1_Nonsense_Mutation_p.R747*	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	747					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CAAGCTTCTCGGAGTTTCTCC	0.443																																					p.R747X		Atlas-SNP	.											.	DGKI	335	.	0			c.C2239T						PASS	.						115.0	98.0	104.0					7																	137206621		2203	4300	6503	SO:0001587	stop_gained	9162	exon21			CTTCTCGGAGTTT	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2239C>T	7.37:g.137206621G>A	ENSP00000288490:p.Arg747*	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	86	4	0.0465116	NM_004717	A4D1Q9|Q9NZ49	Nonsense_Mutation	SNP	ENST00000288490.5	37	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	G	43	9.936638	0.99299	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	.	.	.	5.77	5.77	0.91146	.	0.060212	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	19.9576	0.97228	0.0:0.0:1.0:0.0	.	.	.	.	X	447;695;768;747;747	.	ENSP00000288490:R747X	R	-	1	2	DGKI	136857161	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.753000	0.62183	2.885000	0.99019	0.655000	0.94253	CGA	.	.	none		0.443	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
FMN2	56776	hgsc.bcm.edu	37	1	240371141	240371141	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:240371141C>T	ENST00000319653.9	+	5	3259	c.3029C>T	c.(3028-3030)cCt>cTt	p.P1010L		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1010	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGCATACCCCCTCCTCCCCCT	0.731																																					p.P1010L		Atlas-SNP	.											FMN2,colon,carcinoma,0,2	FMN2	451	2	0			c.C3029T						scavenged	.						2.0	3.0	3.0					1																	240371141		1609	3382	4991	SO:0001583	missense	56776	exon5			TACCCCCTCCTCC	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3029C>T	1.37:g.240371141C>T	ENSP00000318884:p.Pro1010Leu	Somatic	91	2	0.021978		WXS	Illumina HiSeq	Phase_I	83	3	0.0361446	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	C	9.791	1.177981	0.21787	.	.	ENSG00000155816	ENST00000319653	T	0.65549	-0.16	3.48	2.52	0.30459	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (2);	0.346446	0.24843	N	0.035156	T	0.68888	0.3050	M	0.63843	1.955	0.44117	D	0.99689	D	0.63046	0.992	P	0.58172	0.834	T	0.67550	-0.5642	9	.	.	.	.	10.5456	0.45058	0.1936:0.8064:0.0:0.0	.	1010	Q9NZ56	FMN2_HUMAN	L	1010	ENSP00000318884:P1010L	.	P	+	2	0	FMN2	238437764	0.000000	0.05858	0.003000	0.11579	0.031000	0.12232	0.259000	0.18405	0.763000	0.33175	0.479000	0.44913	CCT	.	.	none		0.731	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
APOB	338	hgsc.bcm.edu	37	2	21239442	21239442	+	Silent	SNP	C	C	T	rs200281277	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr2:21239442C>T	ENST00000233242.1	-	21	3328	c.3201G>A	c.(3199-3201)ccG>ccA	p.P1067P		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1067					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATCAAAATCCGGAATTTGGA	0.433													C|||	2	0.000399361	0.0	0.0	5008	,	,		18827	0.002		0.0	False		,,,				2504	0.0				p.P1067P		Atlas-SNP	.											.	APOB	761	.	0			c.G3201A						PASS	.						139.0	124.0	129.0					2																	21239442		2203	4300	6503	SO:0001819	synonymous_variant	338	exon21			AAAATCCGGAATT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3201G>A	2.37:g.21239442C>T		Somatic	202	0	0		WXS	Illumina HiSeq	Phase_I	136	12	0.0882353	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																			C|1.000;T|0.000	0.000	strong		0.433	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
CDC27	996	hgsc.bcm.edu	37	17	45216113	45216113	+	Missense_Mutation	SNP	A	A	G			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:45216113A>G	ENST00000066544.3	-	13	1789	c.1696T>C	c.(1696-1698)Tcg>Ccg	p.S566P	CDC27_ENST00000446365.2_Missense_Mutation_p.S505P|CDC27_ENST00000527547.1_Missense_Mutation_p.S565P|CDC27_ENST00000531206.1_Missense_Mutation_p.S572P	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	566					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						ACCTCTGGCGAATTTTTATCC	0.353																																					p.S572P		Atlas-SNP	.											CDC27_ENST00000531206,caecum,carcinoma,+1,6	CDC27	337	6	0			c.T1714C						scavenged	.						50.0	55.0	53.0					17																	45216113		2201	4299	6500	SO:0001583	missense	996	exon13			CTGGCGAATTTTT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1696T>C	17.37:g.45216113A>G	ENSP00000066544:p.Ser566Pro	Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	48	2	0.0416667	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.623261	0.87460	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	5.62	5.62	0.85841	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.058252	0.64402	D	0.000001	T	0.71417	0.3337	M	0.92367	3.3	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;0.998	D;D;D;D	0.73380	0.98;0.961;0.975;0.924	T	0.79176	-0.1911	10	0.87932	D	0	-9.281	13.77	0.63019	1.0:0.0:0.0:0.0	.	505;565;572;566	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	P	566;572;505;565	ENSP00000066544:S566P;ENSP00000434614:S572P;ENSP00000392802:S505P;ENSP00000437339:S565P	ENSP00000066544:S566P	S	-	1	0	CDC27	42571112	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	8.962000	0.93254	2.141000	0.66446	0.528000	0.53228	TCG	.	.	none		0.353	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
ADRA2B	151	hgsc.bcm.edu	37	2	96781704	96781704	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr2:96781704G>A	ENST00000409345.3	-	1	280	c.185C>T	c.(184-186)gCc>gTc	p.A62V		NM_000682.5	NP_000673	P18089	ADA2B_HUMAN	adrenoceptor alpha 2B	62					activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|MAPK cascade (GO:0000165)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of vascular smooth muscle contraction (GO:0003056)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)			endometrium(2)|large_intestine(2)|lung(9)|ovary(3)	16					Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Etomidate(DB00292)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GATGAGCGTGGCCACCAGGAT	0.657																																					p.A62V		Atlas-SNP	.											.	ADRA2B	115	.	0			c.C185T						PASS	.						45.0	51.0	49.0					2																	96781704		2202	4300	6502	SO:0001583	missense	151	exon1			AGCGTGGCCACCA	M34041	CCDS56129.1	2q11.1	2014-05-06	2012-05-09		ENSG00000222040	ENSG00000274286		"""GPCR / Class A : Adrenoceptors : alpha"""	282	protein-coding gene	gene with protein product		104260	"""adrenergic, alpha-2B-, receptor"""	ADRA2L1, ADRA2RL1		2164221	Standard	NM_000682		Approved	ADRARL1	uc021vlh.1	P18089	OTTHUMG00000188276	ENST00000409345.3:c.185C>T	2.37:g.96781704G>A	ENSP00000387281:p.Ala62Val	Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	117	9	0.0769231	NM_000682	Q4TUH9|Q53RF2|Q9BZK0	Missense_Mutation	SNP	ENST00000409345.3	37	CCDS56129.1	.	.	.	.	.	.	.	.	.	.	g	29.4	5.000455	0.93227	.	.	ENSG00000222040	ENST00000409345	T	0.13538	2.58	4.48	4.48	0.54585	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.48537	0.1505	H	0.95950	3.745	0.54753	D	0.999982	D	0.69078	0.997	D	0.65323	0.934	T	0.66408	-0.5931	9	0.87932	D	0	.	14.755	0.69557	0.0:0.0:1.0:0.0	.	62	P18089	ADA2B_HUMAN	V	62	ENSP00000387281:A62V	ENSP00000387281:A62V	A	-	2	0	ADRA2B	96145431	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.654000	0.98509	2.334000	0.79466	0.450000	0.29827	GCC	.	.	none		0.657	ADRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334990.1		
NEFH	4744	hgsc.bcm.edu	37	22	29885567	29885567	+	Silent	SNP	A	A	C	rs147489453|rs75808076|rs59279731		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr22:29885567A>C	ENST00000310624.6	+	4	1971	c.1938A>C	c.(1936-1938)gcA>gcC	p.A646A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	652	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGAGGAAGCAAAGTCCCCTG	0.567																																					p.A646A		Atlas-SNP	.											NEFH,rectum,carcinoma,0,1	NEFH	178	1	0			c.A1938C						PASS	.						78.0	77.0	77.0					22																	29885567		2133	4127	6260	SO:0001819	synonymous_variant	4744	exon4			GGAAGCAAAGTCC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1938A>C	22.37:g.29885567A>C		Somatic	198	0	0		WXS	Illumina HiSeq	Phase_I	159	17	0.106918	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	weak		0.567	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
CRIPAK	285464	hgsc.bcm.edu	37	4	1389063	1389063	+	Missense_Mutation	SNP	G	G	C	rs148588369	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr4:1389063G>C	ENST00000324803.4	+	1	3724	c.764G>C	c.(763-765)cGa>cCa	p.R255P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	255					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R255P(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CTCACGTGCCGATGTGGAGTG	0.682													g|||	168	0.0335463	0.087	0.013	5008	,	,		12257	0.0169		0.007	False		,,,				2504	0.0204				p.R255P		Atlas-SNP	.											CRIPAK,NS,carcinoma,0,1	CRIPAK	185	1	1	Substitution - Missense(1)	prostate(1)	c.G764C						scavenged	.	C	PRO/ARG	237,4167		9,219,1974	160.0	142.0	148.0		764	-0.2	0.0	4	dbSNP_134	148	16,8582		2,12,4285	no	missense	CRIPAK	NM_175918.3	103	11,231,6259	CC,CG,GG		0.1861,5.3815,1.9459	probably-damaging	255/447	1389063	253,12749	2202	4299	6501	SO:0001583	missense	285464	exon1			CGTGCCGATGTGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.764G>C	4.37:g.1389063G>C	ENSP00000323978:p.Arg255Pro	Somatic	48	1	0.0208333		WXS	Illumina HiSeq	Phase_I	43	4	0.0930233	NM_175918	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	0.914	-0.718231	0.03182	0.053815	0.001861	ENSG00000179979	ENST00000324803;ENST00000382944	T	0.22743	1.94	0.815	-0.148	0.13424	Post-SET domain (1);	.	.	.	.	T	0.01061	0.0035	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.34675	-0.9819	9	0.07482	T	0.82	.	4.0747	0.09899	0.0:0.5464:0.2553:0.1983	.	255	Q8N1N5	CRPAK_HUMAN	P	255;197	ENSP00000323978:R255P	ENSP00000323978:R255P	R	+	2	0	CRIPAK	1379063	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.274000	0.01163	-1.652000	0.01502	-2.723000	0.00131	CGA	G|0.982;C|0.018	0.018	strong		0.682	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
PCDHA12	56137	hgsc.bcm.edu	37	5	140257190	140257190	+	Silent	SNP	G	G	C			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr5:140257190G>C	ENST00000398631.2	+	1	2133	c.2133G>C	c.(2131-2133)ctG>ctC	p.L711L	PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA11_ENST00000398640.2_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	711					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGCCTGCTGGTGCTCACGC	0.677																																					p.L711L	Pancreas(113;759 1672 13322 24104 50104)	Atlas-SNP	.											.	PCDHA12	196	.	0			c.G2133C						PASS	.						40.0	39.0	40.0					5																	140257190		2203	4300	6503	SO:0001819	synonymous_variant	56137	exon1			CCTGCTGGTGCTC	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.2133G>C	5.37:g.140257190G>C		Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	95	15	0.157895	NM_018903	O75278|Q2M1N8	Silent	SNP	ENST00000398631.2	37	CCDS47285.1																																																																																			.	.	none		0.677	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
POTEE	445582	hgsc.bcm.edu	37	2	132021766	132021766	+	Missense_Mutation	SNP	A	A	C			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr2:132021766A>C	ENST00000356920.5	+	15	2832	c.2738A>C	c.(2737-2739)aAa>aCa	p.K913T	POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	913	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.K913T(1)									CGTGACATCAAAGAGAAGCTG	0.602																																					p.K913T		Atlas-SNP	.											ENSG00000188219,rectum,NS,0,1	.	.	1	1	Substitution - Missense(1)	large_intestine(1)	c.A2738C						scavenged	.						73.0	77.0	75.0					2																	132021766		1926	3862	5788	SO:0001583	missense	445582	exon15			ACATCAAAGAGAA	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2738A>C	2.37:g.132021766A>C	ENSP00000439189:p.Lys913Thr	Somatic	177	3	0.0169492		WXS	Illumina HiSeq	Phase_I	147	8	0.0544218	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	15.85	2.956333	0.53293	.	.	ENSG00000188219	ENST00000356920	D	0.97850	-4.57	.	.	.	.	.	.	.	.	D	0.99177	0.9715	H	0.99884	4.89	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96111	0.9077	8	0.87932	D	0	.	4.5487	0.12098	0.9994:0.0:6.0E-4:0.0	.	913	Q6S8J3	POTEE_HUMAN	T	913	ENSP00000439189:K913T	ENSP00000439189:K913T	K	+	2	0	AC131180.1	131738236	1.000000	0.71417	0.327000	0.25402	0.329000	0.28539	6.177000	0.71961	0.103000	0.17682	0.102000	0.15555	AAA	.	.	none		0.602	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
DCLK1	9201	hgsc.bcm.edu	37	13	36686046	36686046	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr13:36686046G>T	ENST00000360631.3	-	3	894	c.683C>A	c.(682-684)tCg>tAg	p.S228*	DCLK1_ENST00000255448.4_Nonsense_Mutation_p.S228*|DCLK1_ENST00000379892.4_Nonsense_Mutation_p.S228*			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	228	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		CACCACTCCCGAGTCCAGCTT	0.502																																					p.S228X		Atlas-SNP	.											DCLK1_ENST00000255448,colon,carcinoma,0,2	DCLK1	350	2	0			c.C683A						scavenged	.						135.0	114.0	121.0					13																	36686046		2203	4300	6503	SO:0001587	stop_gained	9201	exon3			ACTCCCGAGTCCA	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.683C>A	13.37:g.36686046G>T	ENSP00000353846:p.Ser228*	Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	59	2	0.0338983	NM_004734	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Nonsense_Mutation	SNP	ENST00000360631.3	37		.	.	.	.	.	.	.	.	.	.	G	41	8.630846	0.98892	.	.	ENSG00000133083	ENST00000255448;ENST00000360631;ENST00000539451;ENST00000379892	.	.	.	5.55	5.55	0.83447	.	0.063259	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8703	0.96847	0.0:0.0:1.0:0.0	.	.	.	.	X	228	.	ENSP00000255448:S228X	S	-	2	0	DCLK1	35584046	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.592000	0.98245	2.770000	0.95276	0.650000	0.86243	TCG	.	.	none		0.502	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
RAB36	9609	hgsc.bcm.edu	37	22	23495232	23495232	+	Missense_Mutation	SNP	T	T	G			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr22:23495232T>G	ENST00000263116.2	+	5	478	c.438T>G	c.(436-438)aaT>aaG	p.N146K	RAB36_ENST00000341989.4_Missense_Mutation_p.N124K	NM_004914.2	NP_004905.2	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family	146					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		TTTGCAAGAATGTTTTTGATC	0.478																																					p.N146K		Atlas-SNP	.											.	RAB36	26	.	0			c.T438G						PASS	.						183.0	174.0	177.0					22																	23495232		2203	4300	6503	SO:0001583	missense	9609	exon5			CAAGAATGTTTTT	AB023061	CCDS13805.1	22q11.22	2008-06-11			ENSG00000100228	ENSG00000100228		"""RAB, member RAS oncogene"""	9775	protein-coding gene	gene with protein product		605662				9920784, 10591208	Standard	NM_004914		Approved		uc002zwv.1	O95755	OTTHUMG00000150601	ENST00000263116.2:c.438T>G	22.37:g.23495232T>G	ENSP00000263116:p.Asn146Lys	Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	52	9	0.173077	NM_004914	Q2M390|Q7Z4A9|Q9UHP5	Missense_Mutation	SNP	ENST00000263116.2	37	CCDS13805.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.35|16.35	3.098812|3.098812	0.56183|0.56183	.|.	.|.	ENSG00000100228|ENSG00000100228	ENST00000420895|ENST00000263116;ENST00000341989	.|T;T	.|0.80214	.|-1.35;-1.35	5.53|5.53	-1.43|-1.43	0.08884|0.08884	.|Small GTP-binding protein domain (1);	.|0.059264	.|0.64402	.|D	.|0.000005	T|T	0.77505|0.77505	0.4140|0.4140	L|L	0.39514|0.39514	1.22|1.22	0.29904|0.29904	N|N	0.824138|0.824138	.|D;B	.|0.55605	.|0.972;0.118	.|P;B	.|0.53360	.|0.724;0.101	T|T	0.75665|0.75665	-0.3239|-0.3239	5|10	.|0.44086	.|T	.|0.13	-26.0893|-26.0893	11.9159|11.9159	0.52765|0.52765	0.0:0.4297:0.0:0.5703|0.0:0.4297:0.0:0.5703	.|.	.|124;146	.|O95755-2;O95755	.|.;RAB36_HUMAN	G|K	41|146;124	.|ENSP00000263116:N146K;ENSP00000343494:N124K	.|ENSP00000263116:N146K	C|N	+|+	1|3	0|2	RAB36|RAB36	21825232|21825232	0.355000|0.355000	0.24921|0.24921	0.226000|0.226000	0.23910|0.23910	0.816000|0.816000	0.46133|0.46133	0.251000|0.251000	0.18257|0.18257	-0.429000|-0.429000	0.07329|0.07329	-1.139000|-1.139000	0.01908|0.01908	TGT|AAT	.	.	none		0.478	RAB36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319046.1	NM_004914	
TLN1	7094	hgsc.bcm.edu	37	9	35724043	35724043	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr9:35724043C>T	ENST00000314888.9	-	7	1041	c.688G>A	c.(688-690)Gtc>Atc	p.V230I	TLN1_ENST00000540444.1_Missense_Mutation_p.V230I	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	230	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TCAAAGGAGACAGGGTGGGAG	0.562																																					p.V230I		Atlas-SNP	.											.	TLN1	185	.	0			c.G688A						PASS	.						157.0	138.0	145.0					9																	35724043		2203	4300	6503	SO:0001583	missense	7094	exon7			AGGAGACAGGGTG	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.688G>A	9.37:g.35724043C>T	ENSP00000316029:p.Val230Ile	Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	72	8	0.111111	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380291	0.61845	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.79033	-1.23;-1.23	5.48	5.48	0.80851	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.064498	0.64402	D	0.000009	T	0.76104	0.3941	L	0.50919	1.6	0.80722	D	1	B;B	0.26445	0.149;0.005	B;B	0.28709	0.093;0.086	T	0.73052	-0.4104	10	0.49607	T	0.09	-29.9777	19.387	0.94560	0.0:1.0:0.0:0.0	.	230;230	Q5TCU5;Q9Y490	.;TLN1_HUMAN	I	230	ENSP00000316029:V230I;ENSP00000442981:V230I	ENSP00000316029:V230I	V	-	1	0	TLN1	35714043	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.056000	0.71111	2.572000	0.86782	0.655000	0.94253	GTC	.	.	none		0.562	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
MUC21	394263	hgsc.bcm.edu	37	6	30954709	30954709	+	Missense_Mutation	SNP	G	G	A	rs11756238	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr6:30954709G>A	ENST00000376296.3	+	2	998	c.757G>A	c.(757-759)Ggc>Agc	p.G253S	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	253	28 X 15 AA approximate tandem repeats.|Ser-rich.		G -> S (in dbSNP:rs41288655). {ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:14574404}.		cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G253S(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CAGTGGGGCCGGCACAGCCAC	0.637													A|||	193	0.0385383	0.0356	0.062	5008	,	,		20371	0.0208		0.0467	False		,,,				2504	0.0358				p.G253S		Atlas-SNP	.											MUC21,colon,carcinoma,-1,2	MUC21	98	2	1	Substitution - Missense(1)	central_nervous_system(1)	c.G757A						scavenged	.						135.0	138.0	137.0					6																	30954709		2203	4300	6503	SO:0001583	missense	394263	exon2			GGGGCCGGCACAG	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.757G>A	6.37:g.30954709G>A	ENSP00000365473:p.Gly253Ser	Somatic	111	4	0.036036		WXS	Illumina HiSeq	Phase_I	106	10	0.0943396	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	A	1.863	-0.462214	0.04508	.	.	ENSG00000204544	ENST00000376296	T	0.01265	5.08	4.3	1.82	0.25136	.	.	.	.	.	T	0.00210	0.0006	N	0.01576	-0.805	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.18366	-1.0339	8	.	.	.	.	7.3667	0.26776	0.6106:0.0:0.3894:0.0	rs41288655	253	Q5SSG8	MUC21_HUMAN	S	253	ENSP00000365473:G253S	.	G	+	1	0	MUC21	31062688	0.000000	0.05858	0.003000	0.11579	0.041000	0.13682	-0.706000	0.05047	-0.001000	0.14495	-0.490000	0.04691	GGC	G|0.989;A|0.011	0.011	strong		0.637	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
FAM21A	387680	hgsc.bcm.edu	37	10	51863831	51863831	+	Missense_Mutation	SNP	G	G	C	rs201489423	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr10:51863831G>C	ENST00000282633.5	+	18	1710	c.1665G>C	c.(1663-1665)aaG>aaC	p.K555N	FAM21A_ENST00000314664.7_Missense_Mutation_p.K555N|FAM21A_ENST00000399339.2_Missense_Mutation_p.K467N|FAM21A_ENST00000351071.6_Missense_Mutation_p.K555N	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	555					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)		p.K555N(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						GTGCGAGTAAGTTAAAAGGTG	0.373																																					p.K555N		Atlas-SNP	.											FAM21A,NS,carcinoma,0,1	FAM21A	32	1	1	Substitution - Missense(1)	prostate(1)	c.G1665C						scavenged	.																																			SO:0001583	missense	387680	exon18			GAGTAAGTTAAAA	BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.1665G>C	10.37:g.51863831G>C	ENSP00000282633:p.Lys555Asn	Somatic	500	10	0.02		WXS	Illumina HiSeq	Phase_I	384	13	0.0338542	NM_001005751	A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	ENST00000282633.5	37	CCDS41527.1	.	.	.	.	.	.	.	.	.	.	C	6.739	0.505070	0.12822	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633;ENST00000399339	.	.	.	3.2	3.2	0.36748	.	0.179758	0.47455	D	0.000237	T	0.75766	0.3894	M	0.77616	2.38	0.38837	D	0.955976	B;B;D;B;B	0.69078	0.008;0.01;0.997;0.049;0.028	B;B;D;B;B	0.80764	0.016;0.019;0.994;0.079;0.017	T	0.78021	-0.2367	9	0.48119	T	0.1	-3.197	10.2638	0.43443	0.0:0.0:1.0:0.0	.	555;555;467;555;449	E7ESD2;Q641Q2-2;F8W7U3;Q641Q2;Q5T1D7	.;.;.;FA21A_HUMAN;.	N	555;555;449;555;467	.	ENSP00000282633:K555N	K	+	3	2	FAM21A	51533837	0.997000	0.39634	0.828000	0.32881	0.253000	0.25986	3.117000	0.50407	1.510000	0.48803	0.184000	0.17185	AAG	.	.	weak		0.373	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276917.2	NM_001005751	
NCAPG	64151	hgsc.bcm.edu	37	4	17829990	17829990	+	Missense_Mutation	SNP	G	G	C	rs3795243	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr4:17829990G>C	ENST00000251496.2	+	12	1919	c.1743G>C	c.(1741-1743)atG>atC	p.M581I		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	581			M -> I (in dbSNP:rs3795243). {ECO:0000269|PubMed:10910072}.		mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		GTGCAACCATGAATGGAATCA	0.343													G|||	707	0.141174	0.0877	0.1167	5008	,	,		16434	0.1617		0.0905	False		,,,				2504	0.2618				p.M581I		Atlas-SNP	.											.	NCAPG	76	.	0			c.G1743C						PASS	.	G	ILE/MET	389,4017	196.4+/-220.7	17,355,1831	152.0	143.0	146.0		1743	5.0	1.0	4	dbSNP_107	146	1138,7462	234.7+/-267.5	74,990,3236	yes	missense	NCAPG	NM_022346.3	10	91,1345,5067	CC,CG,GG		13.2326,8.8289,11.7407	benign	581/1016	17829990	1527,11479	2203	4300	6503	SO:0001583	missense	64151	exon12			AACCATGAATGGA	AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.1743G>C	4.37:g.17829990G>C	ENSP00000251496:p.Met581Ile	Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	76	4	0.0526316	NM_022346	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	ENST00000251496.2	37	CCDS3424.1	228	0.1043956043956044	46	0.09349593495934959	43	0.11878453038674033	70	0.12237762237762238	69	0.09102902374670185	G	1.362	-0.588596	0.03799	0.088289	0.132326	ENSG00000109805	ENST00000251496;ENST00000510063	T;T	0.37411	1.2;1.2	5.01	5.01	0.66863	Armadillo-type fold (1);	0.095044	0.85682	D	0.000000	T	0.00210	0.0006	N	0.21097	0.63	0.27727	P	0.944946	B	0.15930	0.015	B	0.17979	0.02	T	0.12941	-1.0528	9	0.10377	T	0.69	-20.967	7.9431	0.29969	0.0836:0.0:0.7449:0.1715	rs3795243;rs52790962	581	Q9BPX3	CND3_HUMAN	I	581;146	ENSP00000251496:M581I;ENSP00000425625:M146I	ENSP00000251496:M581I	M	+	3	0	NCAPG	17439088	1.000000	0.71417	1.000000	0.80357	0.327000	0.28475	3.187000	0.50950	2.309000	0.77851	0.585000	0.79938	ATG	G|0.884;C|0.116	0.116	strong		0.343	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250375.1	NM_022346	
NOMO1	23420	hgsc.bcm.edu	37	16	14969025	14969025	+	Silent	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr16:14969025C>T	ENST00000287667.7	+	19	2358	c.2187C>T	c.(2185-2187)ggC>ggT	p.G729G		NM_014287.3	NP_055102.3	Q15155	NOMO1_HUMAN	NODAL modulator 1	729						integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)	p.G729G(1)		endometrium(6)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|skin(2)	30						ATGAGGAAGGCGAAGAAAGAA	0.562																																					p.G729G		Atlas-SNP	.											NOMO1,NS,carcinoma,0,1	NOMO1	60	1	1	Substitution - coding silent(1)	endometrium(1)	c.C2187T						scavenged	.						262.0	267.0	266.0					16																	14969025		2197	4299	6496	SO:0001819	synonymous_variant	23420	exon19			GGAAGGCGAAGAA	X57398	CCDS10556.1	16p13.11	2008-02-05			ENSG00000103512	ENSG00000103512			30060	protein-coding gene	gene with protein product		609157				1310294, 15257293	Standard	NM_014287		Approved	PM5	uc002dcv.3	Q15155	OTTHUMG00000090541	ENST00000287667.7:c.2187C>T	16.37:g.14969025C>T		Somatic	455	1	0.0021978		WXS	Illumina HiSeq	Phase_I	405	4	0.00987654	NM_014287	P78421|Q8IW21|Q96DG0	Silent	SNP	ENST00000287667.7	37	CCDS10556.1																																																																																			.	.	weak		0.562	NOMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207065.1		
FRG1	2483	hgsc.bcm.edu	37	4	190873379	190873379	+	Missense_Mutation	SNP	A	A	G	rs112612436		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr4:190873379A>G	ENST00000226798.4	+	3	418	c.196A>G	c.(196-198)Aag>Gag	p.K66E	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	66			K -> E (in dbSNP:rs17406826).		mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K66E(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TGAAATGGATAAGGGAACCTA	0.383																																					p.K66E		Atlas-SNP	.											FRG1,arm,malignant_melanoma,0,1	FRG1	76	1	1	Substitution - Missense(1)	skin(1)	c.A196G						scavenged	.						101.0	115.0	110.0					4																	190873379		2203	4298	6501	SO:0001583	missense	2483	exon3			ATGGATAAGGGAA	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.196A>G	4.37:g.190873379A>G	ENSP00000226798:p.Lys66Glu	Somatic	289	22	0.0761246		WXS	Illumina HiSeq	Phase_I	222	28	0.126126	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	11.33	1.608104	0.28623	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.44083	2.07;0.93	3.47	2.23	0.28157	Actin cross-linking (1);	0.148940	0.64402	D	0.000013	T	0.29288	0.0729	L	0.52011	1.625	0.42341	D	0.992332	B	0.02656	0.0	B	0.04013	0.001	T	0.10314	-1.0635	10	0.06757	T	0.87	-8.6418	8.2577	0.31766	0.7983:0.2017:0.0:0.0	rs17406826	66	Q14331	FRG1_HUMAN	E	66;3	ENSP00000226798:K66E;ENSP00000435943:K3E	ENSP00000226798:K66E	K	+	1	0	FRG1	191110373	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.931000	0.48932	0.668000	0.31126	0.441000	0.28932	AAG	.	.	weak		0.383	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
PPM1E	22843	hgsc.bcm.edu	37	17	56833457	56833457	+	Silent	SNP	G	G	C	rs3834568|rs201186780|rs74256772	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:56833457G>C	ENST00000308249.2	+	1	228	c.99G>C	c.(97-99)ccG>ccC	p.P33P		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			agccggagccggaacccgaac	0.672																																					p.P33P		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	1	0			c.G99C						PASS	.						14.0	20.0	18.0					17																	56833457		2188	4284	6472	SO:0001819	synonymous_variant	22843	exon1			GGAGCCGGAACCC	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.99G>C	17.37:g.56833457G>C		Somatic	226	0	0		WXS	Illumina HiSeq	Phase_I	195	11	0.0564103	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	37	CCDS11613.1																																																																																			.	.	weak		0.672	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
HIST1H2AC	8334	hgsc.bcm.edu	37	6	26124712	26124712	+	Silent	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr6:26124712G>A	ENST00000602637.1	+	1	282	c.252G>A	c.(250-252)ttG>ttA	p.L84L	HIST1H2BC_ENST00000314332.5_5'Flank|HIST1H2BC_ENST00000396984.1_5'Flank|HIST1H2AC_ENST00000377791.2_Silent_p.L84L			Q93077	H2A1C_HUMAN	histone cluster 1, H2ac	84						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(5)	12						CGCGCCACTTGCAGCTGGCCA	0.632																																					p.L84L		Atlas-SNP	.											.	HIST1H2AC	29	.	0			c.G252A						PASS	.						107.0	103.0	105.0					6																	26124712		2203	4300	6503	SO:0001819	synonymous_variant	8334	exon1			CCACTTGCAGCTG	Z80778	CCDS4585.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000180573	ENSG00000180573		"""Histones / Replication-dependent"""	4733	protein-coding gene	gene with protein product		602794	"""H2A histone family, member L"", ""histone 1, H2ac"""	H2AFL		9119399, 12408966	Standard	NM_003512		Approved		uc003ngm.3	Q93077	OTTHUMG00000014428	ENST00000602637.1:c.252G>A	6.37:g.26124712G>A		Somatic	195	0	0		WXS	Illumina HiSeq	Phase_I	183	12	0.0655738	NM_003512	B2R4F7|O00775|O00776|O00777|O00778|Q540R1	Silent	SNP	ENST00000602637.1	37	CCDS4585.1																																																																																			.	.	none		0.632	HIST1H2AC-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468023.1	NM_003512	
LTA	4049	hgsc.bcm.edu	37	6	31541106	31541106	+	Missense_Mutation	SNP	G	G	A	rs148093456		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr6:31541106G>A	ENST00000454783.1	+	4	512	c.254G>A	c.(253-255)cGt>cAt	p.R85H	TNF_ENST00000449264.2_5'Flank|LTA_ENST00000418386.2_Missense_Mutation_p.R85H	NM_001159740.2	NP_001153212.1	P01374	TNFB_HUMAN	lymphotoxin alpha	85					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|defense response to Gram-positive bacterium (GO:0050830)|humoral immune response (GO:0006959)|lymph node development (GO:0048535)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of growth of symbiont in host (GO:0044130)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of interferon-gamma production (GO:0032729)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|membrane (GO:0016020)	receptor binding (GO:0005102)			endometrium(2)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9					Etanercept(DB00005)	AACACGGACCGTGCCTTCCTC	0.562																																					p.R85H		Atlas-SNP	.											.	LTA	18	.	0			c.G254A						PASS	.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	98.0	83.0	88.0		254,254	2.1	0.0	6	dbSNP_134	88	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LTA	NM_000595.2,NM_001159740.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	85/206,85/206	31541106	1,13005	2203	4300	6503	SO:0001583	missense	4049	exon4			CGGACCGTGCCTT	X01393	CCDS4701.1	6p21.3	2013-05-22	2013-05-22		ENSG00000226979	ENSG00000226979		"""Tumor necrosis factor (ligand) superfamily"""	6709	protein-coding gene	gene with protein product	"""TNF superfamily member 1"""	153440	"""lymphotoxin alpha (TNF superfamily, member 1)"""	TNFB		2995927, 3001529	Standard	NM_001159740		Approved	TNFSF1, LT	uc011dnu.2	P01374	OTTHUMG00000031135	ENST00000454783.1:c.254G>A	6.37:g.31541106G>A	ENSP00000403495:p.Arg85His	Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	68	4	0.0588235	NM_001159740	Q8N4C3|Q9UKS8	Missense_Mutation	SNP	ENST00000454783.1	37	CCDS4701.1	.	.	.	.	.	.	.	.	.	.	G	1.401	-0.578112	0.03854	0.0	1.16E-4	ENSG00000226979	ENST00000454783;ENST00000418386;ENST00000436827	D;D	0.94613	-3.47;-3.47	5.16	2.13	0.27403	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.498096	0.22853	N	0.054821	T	0.68375	0.2994	N	0.04203	-0.255	0.09310	N	1	B;B;B	0.33198	0.022;0.401;0.007	B;B;B	0.23150	0.007;0.044;0.004	T	0.66114	-0.6004	10	0.38643	T	0.18	-22.6602	5.1779	0.15145	0.514:0.0:0.486:0.0	.	85;85;85	E7ET53;F8WB56;P01374	.;.;TNFB_HUMAN	H	85	ENSP00000403495:R85H;ENSP00000413450:R85H	ENSP00000413450:R85H	R	+	2	0	LTA	31649085	0.000000	0.05858	0.001000	0.08648	0.036000	0.12997	0.082000	0.14847	0.269000	0.21961	-0.140000	0.14226	CGT	G|1.000;A|0.000	0.000	weak		0.562	LTA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259097.1		
RPS6KA1	6195	hgsc.bcm.edu	37	1	26856462	26856462	+	Silent	SNP	T	T	G	rs11800553	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:26856462T>G	ENST00000374168.2	+	1	205	c.51T>G	c.(49-51)ccT>ccG	p.P17P	RPS6KA1_ENST00000374162.2_5'Flank|RPS6KA1_ENST00000374166.4_Silent_p.P17P|RPS6KA1_ENST00000526792.1_5'Flank	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	17					axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		AGCTAGTGCCTCTGGACCCGG	0.786													G|||	4691	0.936701	0.9259	0.9179	5008	,	,		6031	0.9583		0.9553	False		,,,				2504	0.9233				p.P17P		Atlas-SNP	.											.	RPS6KA1	65	.	0			c.T51G						PASS	.						2.0	2.0	2.0					1																	26856462		1084	2070	3154	SO:0001819	synonymous_variant	6195	exon1			AGTGCCTCTGGAC	BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.51T>G	1.37:g.26856462T>G		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	7	7	1	NM_002953	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Silent	SNP	ENST00000374168.2	37	CCDS284.1																																																																																			T|0.065;G|0.935	0.935	strong		0.786	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953	
PAPPA	5069	hgsc.bcm.edu	37	9	118989774	118989774	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr9:118989774G>A	ENST00000328252.3	+	6	2545	c.2176G>A	c.(2176-2178)Gct>Act	p.A726T	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	726					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TGCTTCCAACGCTTCCTCCCC	0.542																																					p.A726T		Atlas-SNP	.											PAPPA,NS,carcinoma,-2,1	PAPPA	243	1	0			c.G2176A						PASS	.						152.0	131.0	138.0					9																	118989774		2203	4300	6503	SO:0001583	missense	5069	exon6			TCCAACGCTTCCT		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.2176G>A	9.37:g.118989774G>A	ENSP00000330658:p.Ala726Thr	Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	41	7	0.170732	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	G	33	5.254603	0.95336	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.03004	4.08	5.85	5.85	0.93711	.	0.047663	0.85682	D	0.000000	T	0.18341	0.0440	M	0.75615	2.305	0.80722	D	1	D;D	0.76494	0.999;0.994	P;P	0.62089	0.898;0.592	T	0.00015	-1.2398	10	0.87932	D	0	-25.4983	20.1624	0.98139	0.0:0.0:1.0:0.0	.	170;726	E7EMD3;Q13219	.;PAPP1_HUMAN	T	726;170	ENSP00000330658:A726T	ENSP00000330658:A726T	A	+	1	0	PAPPA	118029595	1.000000	0.71417	0.985000	0.45067	0.987000	0.75469	7.400000	0.79949	2.764000	0.94973	0.591000	0.81541	GCT	.	.	none		0.542	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
PCDHGA6	56109	hgsc.bcm.edu	37	5	140755640	140755640	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr5:140755640G>A	ENST00000517434.1	+	1	1990	c.1990G>A	c.(1990-1992)Gtg>Atg	p.V664M	PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	664	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACCGTGGCCGTGGCCGACAG	0.682																																					p.V664M		Atlas-SNP	.											.	PCDHGA6	219	.	0			c.G1990A						PASS	.						22.0	29.0	27.0					5																	140755640		2192	4276	6468	SO:0001583	missense	56109	exon1			GTGGCCGTGGCCG	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1990G>A	5.37:g.140755640G>A	ENSP00000429601:p.Val664Met	Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	150	11	0.0733333	NM_018919	A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	ENST00000517434.1	37	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	10.61	1.399613	0.25291	.	.	ENSG00000253731	ENST00000517434	T	0.68181	-0.31	5.02	2.93	0.34026	Cadherin (4);Cadherin-like (1);	0.311695	0.16920	N	0.194119	T	0.78027	0.4219	H	0.94698	3.57	0.21147	N	0.999772	D;D	0.65815	0.982;0.995	P;P	0.53146	0.597;0.719	T	0.70992	-0.4721	10	0.72032	D	0.01	.	2.9236	0.05777	0.1869:0.1835:0.5086:0.121	.	664;664	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	M	664	ENSP00000429601:V664M	ENSP00000429601:V664M	V	+	1	0	PCDHGA6	140735824	0.513000	0.26194	0.153000	0.22517	0.120000	0.20174	0.792000	0.26929	0.603000	0.29913	0.563000	0.77884	GTG	.	.	none		0.682	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919	
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274214	39274214	+	Missense_Mutation	SNP	G	G	C			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:39274214G>C	ENST00000391413.2	-	1	392	c.354C>G	c.(352-354)agC>agG	p.S118R		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	118	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			gtctgcagcagctggacacac	0.652																																					p.S118R		Atlas-SNP	.											KRTAP4-11,right_upper_lobe,carcinoma,-1,2	KRTAP4-11	94	2	0			c.C354G						scavenged	.						4.0	8.0	7.0					17																	39274214		642	1521	2163	SO:0001583	missense	653240	exon1			GCAGCAGCTGGAC	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.354C>G	17.37:g.39274214G>C	ENSP00000375232:p.Ser118Arg	Somatic	35	3	0.0857143		WXS	Illumina HiSeq	Phase_I	51	6	0.117647	NM_033059	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	11.65	1.702454	0.30232	.	.	ENSG00000212721	ENST00000391413	T	0.01963	4.53	3.63	2.63	0.31362	.	.	.	.	.	T	0.05914	0.0154	M	0.92691	3.335	0.25757	N	0.984995	B	0.18166	0.026	B	0.19391	0.025	T	0.23013	-1.0200	9	0.37606	T	0.19	.	5.3088	0.15819	0.1185:0.2126:0.6689:0.0	.	118	Q9BYQ6	KR411_HUMAN	R	118	ENSP00000375232:S118R	ENSP00000375232:S118R	S	-	3	2	KRTAP4-11	36527740	0.000000	0.05858	0.722000	0.30670	0.015000	0.08874	0.147000	0.16202	0.630000	0.30394	-0.413000	0.06143	AGC	.	.	none		0.652	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
CDC27	996	hgsc.bcm.edu	37	17	45234727	45234727	+	Missense_Mutation	SNP	T	T	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:45234727T>A	ENST00000066544.3	-	6	592	c.499A>T	c.(499-501)Aca>Tca	p.T167S	CDC27_ENST00000446365.2_Missense_Mutation_p.T106S|CDC27_ENST00000527547.1_Missense_Mutation_p.T167S|CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000531206.1_Missense_Mutation_p.T167S	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	167					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AATTTAAATGTTTGGTCAGGA	0.368																																					p.T167S		Atlas-SNP	.											CDC27_ENST00000531206,NS,carcinoma,+2,10	CDC27	337	10	0			c.A499T						scavenged	.						73.0	73.0	73.0					17																	45234727		2203	4300	6503	SO:0001583	missense	996	exon6			TAAATGTTTGGTC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.499A>T	17.37:g.45234727T>A	ENSP00000066544:p.Thr167Ser	Somatic	206	2	0.00970874		WXS	Illumina HiSeq	Phase_I	160	5	0.03125	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	14.73	2.623232	0.46840	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67171	-0.25;-0.25;0.04;-0.25;0.89	5.39	5.39	0.77823	.	0.119985	0.64402	D	0.000020	T	0.47192	0.1432	N	0.08118	0	0.39122	D	0.961682	P;P;P;B	0.38677	0.475;0.528;0.642;0.211	B;B;B;B	0.36092	0.049;0.217;0.204;0.067	T	0.59762	-0.7393	10	0.72032	D	0.01	-19.1215	13.3763	0.60741	0.0:0.0:0.0:1.0	.	106;167;167;167	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	S	167;167;106;167;167	ENSP00000066544:T167S;ENSP00000434614:T167S;ENSP00000392802:T106S;ENSP00000437339:T167S;ENSP00000432105:T167S	ENSP00000066544:T167S	T	-	1	0	CDC27	42589726	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.374000	0.66167	2.053000	0.61076	0.528000	0.53228	ACA	.	.	none		0.368	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
CXXC1	30827	hgsc.bcm.edu	37	18	47812268	47812268	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr18:47812268G>A	ENST00000285106.6	-	5	1204	c.490C>T	c.(490-492)Cgg>Tgg	p.R164W	CXXC1_ENST00000589940.1_Missense_Mutation_p.R164W|CXXC1_ENST00000412036.2_Missense_Mutation_p.R164W|CXXC1_ENST00000587396.1_5'Flank	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	164					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						CGGGCTGACCGTTTGATctgc	0.577																																					p.R164W		Atlas-SNP	.											.	CXXC1	50	.	0			c.C490T						PASS	.						54.0	47.0	49.0					18																	47812268		2203	4300	6503	SO:0001583	missense	30827	exon5			CTGACCGTTTGAT	BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.490C>T	18.37:g.47812268G>A	ENSP00000285106:p.Arg164Trp	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	65	5	0.0769231	NM_001101654	B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	ENST00000285106.6	37	CCDS11945.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395324	0.62066	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.30182	1.54;1.56	3.99	3.08	0.35506	Zinc finger, CXXC-type (2);	0.062520	0.64402	D	0.000005	T	0.51363	0.1670	M	0.73217	2.22	0.54753	D	0.999989	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.999;0.996;0.988;0.993;0.993	T	0.52548	-0.8561	10	0.72032	D	0.01	.	10.7306	0.46093	0.0:0.0:0.8078:0.1922	.	164;164;164;164;31	B4DGL1;B2RC03;Q9P0U4-2;Q9P0U4;Q59EC8	.;.;.;CXXC1_HUMAN;.	W	164	ENSP00000285106:R164W;ENSP00000390475:R164W	ENSP00000285106:R164W	R	-	1	2	CXXC1	46066266	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.810000	0.47979	0.772000	0.33382	0.542000	0.68232	CGG	.	.	none		0.577	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255927.2	NM_014593	
CXCR4	7852	hgsc.bcm.edu	37	2	136875620	136875620	+	Missense_Mutation	SNP	A	A	C			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr2:136875620A>C	ENST00000241393.3	-	1	115	c.11T>G	c.(10-12)aTc>aGc	p.I4S	CXCR4_ENST00000409817.1_5'Flank|CXCR4_ENST00000466288.1_5'Flank	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	4	Important for chemokine binding, signaling and HIV-1 coreceptor activity.				activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	ACTTACACTGATCCCCTCCAT	0.557																																					p.I4S		Atlas-SNP	.											.	CXCR4	51	.	0			c.T11G						PASS	.						55.0	61.0	59.0					2																	136875620		1947	4140	6087	SO:0001583	missense	7852	exon1			ACACTGATCCCCT	AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.11T>G	2.37:g.136875620A>C	ENSP00000241393:p.Ile4Ser	Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	56	5	0.0892857	NM_003467	B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Missense_Mutation	SNP	ENST00000241393.3	37	CCDS46420.1	.	.	.	.	.	.	.	.	.	.	A	14.24	2.476334	0.44044	.	.	ENSG00000121966	ENST00000241393	T	0.60548	0.18	4.14	4.14	0.48551	.	.	.	.	.	T	0.38931	0.1059	N	0.14661	0.345	0.24453	N	0.994476	B	0.14012	0.009	B	0.15484	0.013	T	0.15235	-1.0444	9	0.30854	T	0.27	.	9.8281	0.40925	1.0:0.0:0.0:0.0	.	4	P61073	CXCR4_HUMAN	S	4	ENSP00000241393:I4S	ENSP00000241393:I4S	I	-	2	0	CXCR4	136592090	0.206000	0.23470	0.143000	0.22291	0.767000	0.43475	2.871000	0.48459	2.091000	0.63221	0.455000	0.32223	ATC	.	.	none		0.557	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1		
NEFH	4744	hgsc.bcm.edu	37	22	29885562	29885562	+	Missense_Mutation	SNP	G	G	A	rs370929798		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr22:29885562G>A	ENST00000310624.6	+	4	1966	c.1933G>A	c.(1933-1935)Gaa>Aaa	p.E645K		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	645	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AACGAAGGAGGAAGCAAAGTC	0.562																																					p.E645K		Atlas-SNP	.											NEFH,rectum,carcinoma,-2,1	NEFH	178	1	0			c.G1933A						PASS	.						82.0	88.0	86.0					22																	29885562		2203	4300	6503	SO:0001583	missense	4744	exon4			AAGGAGGAAGCAA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1933G>A	22.37:g.29885562G>A	ENSP00000311997:p.Glu645Lys	Somatic	205	0	0		WXS	Illumina HiSeq	Phase_I	153	11	0.0718954	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	G	9.212	1.031217	0.19590	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.83914	-1.78	4.97	4.97	0.65823	.	0.115504	0.38778	N	0.001569	D	0.87783	0.6264	L	0.61218	1.895	0.29104	N	0.881289	P	0.36712	0.566	P	0.52267	0.694	D	0.83526	0.0088	10	0.44086	T	0.13	.	16.1111	0.81263	0.0:0.0:1.0:0.0	.	645	P12036	NFH_HUMAN	K	645	ENSP00000311997:E645K	ENSP00000311997:E645K	E	+	1	0	NEFH	28215562	0.001000	0.12720	0.367000	0.25926	0.091000	0.18340	0.923000	0.28757	2.745000	0.94114	0.491000	0.48974	GAA	.	.	weak		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
TNFRSF10C	8794	hgsc.bcm.edu	37	8	22974315	22974315	+	Missense_Mutation	SNP	A	A	C	rs61736405		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr8:22974315A>C	ENST00000356864.3	+	5	1083	c.551A>C	c.(550-552)aAc>aCc	p.N184T	TNFRSF10C_ENST00000540813.1_Missense_Mutation_p.N82T	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain	184					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.N184T(1)		endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		GAGACAATGAACACCAGCCCG	0.602																																					p.N184T		Atlas-SNP	.											TNFRSF10C,trunk,malignant_melanoma,0,1	TNFRSF10C	30	1	1	Substitution - Missense(1)	skin(1)	c.A551C						scavenged	.						68.0	80.0	76.0					8																	22974315		2203	4297	6500	SO:0001583	missense	8794	exon5			CAATGAACACCAG	AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.551A>C	8.37:g.22974315A>C	ENSP00000349324:p.Asn184Thr	Somatic	124	2	0.016129		WXS	Illumina HiSeq	Phase_I	107	7	0.0654206	NM_003841	O14755|Q08AS6|Q6FH98|Q6UXM5	Missense_Mutation	SNP	ENST00000356864.3	37	CCDS6037.1	.	.	.	.	.	.	.	.	.	.	A	1.881	-0.457883	0.04508	.	.	ENSG00000173535	ENST00000356864;ENST00000540813;ENST00000544885	T;T	0.62788	0.0;1.25	.	.	.	.	0.568776	0.17737	U	0.163718	T	0.28400	0.0702	N	0.03608	-0.345	0.22213	N	0.999289	P	0.38110	0.618	B	0.33690	0.168	T	0.14924	-1.0455	9	0.37606	T	0.19	.	2.8413	0.05530	0.5024:0.497:2.0E-4:3.0E-4	rs61736405	184	O14798	TR10C_HUMAN	T	184;82;184	ENSP00000349324:N184T;ENSP00000437612:N82T	ENSP00000349324:N184T	N	+	2	0	TNFRSF10C	23030260	0.001000	0.12720	0.054000	0.19295	0.104000	0.19210	0.918000	0.28678	0.077000	0.16863	0.076000	0.15429	AAC	A|0.013;C|0.987	0.987	weak		0.602	TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215134.3		
NACC1	112939	hgsc.bcm.edu	37	19	13246155	13246155	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr19:13246155G>T	ENST00000292431.4	+	2	260	c.134G>T	c.(133-135)cGg>cTg	p.R45L	AC005546.2_ENST00000591837.1_lincRNA	NM_052876.3	NP_443108.1	Q96RE7	NACC1_HUMAN	nucleus accumbens associated 1, BEN and BTB (POZ) domain containing	45	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear body (GO:0016604)|nucleus (GO:0005634)				endometrium(3)|large_intestine(2)|lung(3)|skin(1)	9						AAGGCCCACCGGGCCGTGCTT	0.637																																					p.R45L		Atlas-SNP	.											NACC1,colon,carcinoma,0,1	NACC1	30	1	0			c.G134T						scavenged	.						55.0	55.0	55.0					19																	13246155		2203	4300	6503	SO:0001583	missense	112939	exon2			CCCACCGGGCCGT	AF395817	CCDS12294.1	19p13.13	2013-01-09	2008-10-03	2008-10-03		ENSG00000160877		"""BEN domain containing"", ""BTB/POZ domain containing"""	20967	protein-coding gene	gene with protein product	"""nucleus accumbens associated 1"", ""BEN domain containing 8"""	610672	"""BTB (POZ) domain containing 14B"""	BTBD14B		12477932	Standard	NM_052876		Approved	NAC1, NAC-1, BEND8, BTBD30	uc002mwm.4	Q96RE7		ENST00000292431.4:c.134G>T	19.37:g.13246155G>T	ENSP00000292431:p.Arg45Leu	Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	87	2	0.0229885	NM_052876		Missense_Mutation	SNP	ENST00000292431.4	37	CCDS12294.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.644427	0.87859	.	.	ENSG00000160877	ENST00000292431	T	0.29917	1.55	5.05	5.05	0.67936	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.69984	0.3172	H	0.97540	4.025	0.58432	D	0.999996	D	0.89917	1.0	D	0.81914	0.995	T	0.82065	-0.0642	10	0.87932	D	0	.	15.9789	0.80091	0.0:0.0:1.0:0.0	.	45	Q96RE7	NACC1_HUMAN	L	45	ENSP00000292431:R45L	ENSP00000292431:R45L	R	+	2	0	NACC1	13107155	1.000000	0.71417	0.990000	0.47175	0.914000	0.54420	9.770000	0.98971	2.359000	0.80004	0.650000	0.86243	CGG	.	.	none		0.637	NACC1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452879.1	NM_052876	
MUC17	140453	hgsc.bcm.edu	37	7	100680438	100680438	+	Missense_Mutation	SNP	G	G	C	rs112926140		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr7:100680438G>C	ENST00000306151.4	+	3	5805	c.5741G>C	c.(5740-5742)aGc>aCc	p.S1914T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1914	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCTGACGGTAGCAGCATGCCA	0.493																																					p.S1914T		Atlas-SNP	.											MUC17,right_upper_lobe,carcinoma,+1,1	MUC17	804	1	0			c.G5741C						scavenged	.						249.0	250.0	250.0					7																	100680438		2203	4300	6503	SO:0001583	missense	140453	exon3			ACGGTAGCAGCAT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5741G>C	7.37:g.100680438G>C	ENSP00000302716:p.Ser1914Thr	Somatic	71	2	0.028169		WXS	Illumina HiSeq	Phase_I	52	2	0.0384615	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	N	0.074	-1.195664	0.01594	.	.	ENSG00000169876	ENST00000306151	T	0.02498	4.27	1.18	-2.36	0.06663	.	.	.	.	.	T	0.00998	0.0033	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41610	-0.9499	9	0.02654	T	1	.	1.2251	0.01932	0.1506:0.3181:0.2997:0.2316	.	1914	Q685J3	MUC17_HUMAN	T	1914	ENSP00000302716:S1914T	ENSP00000302716:S1914T	S	+	2	0	MUC17	100467158	0.001000	0.12720	0.000000	0.03702	0.013000	0.08279	-0.876000	0.04201	-3.962000	0.00087	-1.848000	0.00571	AGC	A|0.001;G|0.999	.	strong		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
CSMD3	114788	hgsc.bcm.edu	37	8	113267635	113267635	+	Missense_Mutation	SNP	C	C	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr8:113267635C>A	ENST00000297405.5	-	62	10128	c.9884G>T	c.(9883-9885)gGt>gTt	p.G3295V	CSMD3_ENST00000352409.3_Missense_Mutation_p.G3225V|CSMD3_ENST00000455883.2_Missense_Mutation_p.G3126V|CSMD3_ENST00000343508.3_Missense_Mutation_p.G3255V	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3295	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GGCAGGTATACCAGGGTCACC	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.G3295V		Atlas-SNP	.											CSMD3_ENST00000343508,caecum,carcinoma,-1,4	CSMD3	2325	4	0			c.G9884T						PASS	.						98.0	92.0	94.0					8																	113267635		2203	4300	6503	SO:0001583	missense	114788	exon62			GGTATACCAGGGT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9884G>T	8.37:g.113267635C>A	ENSP00000297405:p.Gly3295Val	Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	91	6	0.0659341	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.337760	0.81911	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11	4.99	4.99	0.66335	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.80757	0.4684	M	0.84156	2.68	0.80722	D	1	D;D;B	0.89917	1.0;1.0;0.355	D;D;B	0.97110	1.0;1.0;0.359	T	0.79895	-0.1610	10	0.34782	T	0.22	.	18.485	0.90825	0.0:1.0:0.0:0.0	.	3126;3295;3255	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	V	3255;3295;2565;3126;3225	ENSP00000345799:G3255V;ENSP00000297405:G3295V;ENSP00000341558:G2565V;ENSP00000412263:G3126V;ENSP00000343124:G3225V	ENSP00000297405:G3295V	G	-	2	0	CSMD3	113336811	1.000000	0.71417	0.991000	0.47740	0.841000	0.47740	7.581000	0.82535	2.601000	0.87937	0.650000	0.86243	GGT	.	.	none		0.388	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
MUC5B	727897	hgsc.bcm.edu	37	11	1264581	1264581	+	Silent	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr11:1264581C>T	ENST00000529681.1	+	31	6529	c.6471C>T	c.(6469-6471)ccC>ccT	p.P2157P	MUC5B_ENST00000447027.1_Silent_p.P2160P|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2157	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ggacaactcccatccccccag	0.647																																					p.P2157P		Atlas-SNP	.											MUC5B,NS,carcinoma,+1,2	MUC5B	473	2	0			c.C6471T						scavenged	.						105.0	136.0	126.0					11																	1264581		2094	4146	6240	SO:0001819	synonymous_variant	727897	exon31			AACTCCCATCCCC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.6471C>T	11.37:g.1264581C>T		Somatic	428	2	0.0046729		WXS	Illumina HiSeq	Phase_I	463	8	0.0172786	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.	.	none		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
GGT1	2678	hgsc.bcm.edu	37	22	25023419	25023419	+	Silent	SNP	C	C	T	rs202087650	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr22:25023419C>T	ENST00000400382.1	+	12	1796	c.1041C>T	c.(1039-1041)tcC>tcT	p.S347S	GGT1_ENST00000404920.1_Silent_p.S3S|GGT1_ENST00000404532.1_Silent_p.S3S|GGT1_ENST00000466310.1_3'UTR|GGT1_ENST00000403838.1_Silent_p.S3S|GGT1_ENST00000248923.4_Silent_p.S347S|GGT1_ENST00000406383.2_Silent_p.S347S|GGT1_ENST00000400380.1_Silent_p.S347S|GGT1_ENST00000400383.1_Silent_p.S347S|GGT1_ENST00000401885.1_Silent_p.S3S|GGT1_ENST00000404223.1_Silent_p.S3S			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	347					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	ACATGACCTCCGAGTTCTTCG	0.647																																					p.S347S		Atlas-SNP	.											GGT1,NS,carcinoma,0,2	GGT1	68	2	0			c.C1041T						scavenged	.						53.0	54.0	54.0					22																	25023419		2201	4297	6498	SO:0001819	synonymous_variant	2678	exon12			GACCTCCGAGTTC	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.1041C>T	22.37:g.25023419C>T		Somatic	367	12	0.0326975		WXS	Illumina HiSeq	Phase_I	314	19	0.0605096	NM_013430	Q08247|Q14404|Q8TBS1|Q9UMK1	Silent	SNP	ENST00000400382.1	37	CCDS42992.1																																																																																			C|0.989;T|0.011	0.011	strong		0.647	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1	NM_013430	
NEFH	4744	hgsc.bcm.edu	37	22	29885564	29885564	+	Silent	SNP	A	A	G	rs202065964|rs371230849		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr22:29885564A>G	ENST00000310624.6	+	4	1968	c.1935A>G	c.(1933-1935)gaA>gaG	p.E645E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	645	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CGAAGGAGGAAGCAAAGTCCC	0.562																																					p.E645E		Atlas-SNP	.											NEFH,rectum,carcinoma,0,1	NEFH	178	1	0			c.A1935G						PASS	.						83.0	89.0	87.0					22																	29885564		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GGAGGAAGCAAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1935A>G	22.37:g.29885564A>G		Somatic	202	0	0		WXS	Illumina HiSeq	Phase_I	152	14	0.0921053	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	weak		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
MUC4	4585	hgsc.bcm.edu	37	3	195505814	195505814	+	Missense_Mutation	SNP	C	C	T	rs199819876	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr3:195505814C>T	ENST00000463781.3	-	2	13096	c.12637G>A	c.(12637-12639)Gac>Aac	p.D4213N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D4213N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.D4213N(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.597													.|||	95	0.0189696	0.0151	0.0187	5008	,	,		14244	0.0169		0.0308	False		,,,				2504	0.0143				p.D4213N		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,+1,5	MUC4	1505	5	1	Substitution - Missense(1)	endometrium(1)	c.G12637A						scavenged	.						24.0	21.0	22.0					3																	195505814		690	1577	2267	SO:0001583	missense	4585	exon2			AAGTGTCGGTGAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12637G>A	3.37:g.195505814C>T	ENSP00000417498:p.Asp4213Asn	Somatic	69	1	0.0144928		WXS	Illumina HiSeq	Phase_I	70	10	0.142857	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.070	-1.204716	0.01568	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32023	1.47;1.49	.	.	.	.	.	.	.	.	T	0.12860	0.0312	N	0.14661	0.345	0.09310	N	1	B	0.17268	0.021	B	0.06405	0.002	T	0.24083	-1.0170	7	.	.	.	.	4.5334	0.12017	0.0:0.668:0.0:0.332	.	4085	E7ESK3	.	N	4213	ENSP00000417498:D4213N;ENSP00000420243:D4213N	.	D	-	1	0	MUC4	196990593	.	.	0.001000	0.08648	0.001000	0.01503	.	.	-1.791000	0.01261	-1.780000	0.00649	GAC	.	.	weak		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PPM1E	22843	hgsc.bcm.edu	37	17	56833497	56833497	+	Missense_Mutation	SNP	C	C	T	rs61052860		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:56833497C>T	ENST00000308249.2	+	1	268	c.139C>T	c.(139-141)Ccc>Tcc	p.P47S		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			cgagtccgagcccgagcccga	0.701																																					p.P47S		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	1	0			c.C139T						PASS	.						15.0	17.0	16.0					17																	56833497		2188	4270	6458	SO:0001583	missense	22843	exon1			TCCGAGCCCGAGC	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.139C>T	17.37:g.56833497C>T	ENSP00000312411:p.Pro47Ser	Somatic	232	0	0		WXS	Illumina HiSeq	Phase_I	202	20	0.0990099	NM_014906	Q8N8J9|Q96DB8	Missense_Mutation	SNP	ENST00000308249.2	37	CCDS11613.1	.	.	.	.	.	.	.	.	.	.	C	9.492	1.100828	0.20552	.	.	ENSG00000175175	ENST00000308249	T	0.22336	1.96	4.15	3.1	0.35709	.	.	.	.	.	T	0.09202	0.0227	N	0.14661	0.345	0.23192	N	0.998149	P	0.36909	0.573	B	0.32342	0.144	T	0.08452	-1.0721	9	0.02654	T	1	1.9125	10.3339	0.43839	0.0:0.7991:0.2009:0.0	rs61052860	47	Q8WY54-2	.	S	47	ENSP00000312411:P47S	ENSP00000312411:P47S	P	+	1	0	PPM1E	54188496	0.741000	0.28217	1.000000	0.80357	0.229000	0.25112	1.208000	0.32345	2.017000	0.59298	0.462000	0.41574	CCC	C|0.900;T|0.100	0.100	weak		0.701	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
MT-CO3	4514	hgsc.bcm.edu	37	M	9368	9368	+	Missense_Mutation	SNP	A	A	G			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chrM:9368A>G	ENST00000362079.2	+	1	162	c.162A>G	c.(160-162)atA>atG	p.I54M	MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TL2_ENST00000387456.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	54					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						ACACTAACCATATACCAATGG	0.493																																					p.M54M		Atlas-SNP	.											.	.	.	.	0			c.A162G						PASS	.																																			SO:0001583	missense	5742	exon1			AACCATATACCAA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.162A>G	M.37:g.9368A>G	ENSP00000354982:p.Ile54Met	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	5	5	1	ENST00000362079	Q14Y83	Silent	SNP	ENST00000362079.2	37																																																																																				.	.	none		0.493	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
KCNC2	3747	hgsc.bcm.edu	37	12	75601404	75601404	+	Silent	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr12:75601404G>A	ENST00000549446.1	-	2	1040	c.360C>T	c.(358-360)acC>acT	p.T120T	KCNC2_ENST00000393288.2_Silent_p.T120T|KCNC2_ENST00000341669.3_Silent_p.T120T|KCNC2_ENST00000550433.1_Silent_p.T120T|KCNC2_ENST00000548513.1_Silent_p.T120T|KCNC2_ENST00000350228.2_Silent_p.T120T|KCNC2_ENST00000540018.1_Silent_p.T120T|KCNC2_ENST00000298972.1_Silent_p.T120T	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	120					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.T120T(2)		breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	GCAGCTTGCCGGTGCGGTAGT	0.692																																					p.T120T		Atlas-SNP	.											KCNC2_ENST00000549446,colon,carcinoma,0,2	KCNC2	239	2	2	Substitution - coding silent(2)	large_intestine(2)	c.C360T						PASS	.						28.0	32.0	31.0					12																	75601404		2203	4298	6501	SO:0001819	synonymous_variant	3747	exon2			CTTGCCGGTGCGG	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.360C>T	12.37:g.75601404G>A		Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	158	12	0.0759494	NM_139137	B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Silent	SNP	ENST00000549446.1	37	CCDS9007.1																																																																																			.	.	none		0.692	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748	
STAB2	55576	hgsc.bcm.edu	37	12	104031890	104031890	+	Missense_Mutation	SNP	G	G	A	rs374968745		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr12:104031890G>A	ENST00000388887.2	+	8	1010	c.806G>A	c.(805-807)cGt>cAt	p.R269H		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GAAGGCTACCGTGGGGATGGC	0.498																																					p.R269H		Atlas-SNP	.											STAB2,rectum,carcinoma,0,1	STAB2	370	1	0			c.G806A						PASS	.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	177.0	151.0	160.0		806	-10.7	0.0	12		160	1,8599		0,1,4299	no	missense	STAB2	NM_017564.9	29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	269/2552	104031890	2,13004	2203	4300	6503	SO:0001583	missense	55576	exon8			GCTACCGTGGGGA	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.806G>A	12.37:g.104031890G>A	ENSP00000373539:p.Arg269His	Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	93	7	0.0752688	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	G	0.287	-0.982590	0.02180	2.27E-4	1.16E-4	ENSG00000136011	ENST00000388887	T	0.04970	3.52	5.34	-10.7	0.00240	EGF domain, merozoite surface protein 1-like (1);Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.796511	0.11661	N	0.541825	T	0.03348	0.0097	N	0.20986	0.625	0.09310	N	0.999999	B	0.14438	0.01	B	0.09377	0.004	T	0.32508	-0.9904	10	0.26408	T	0.33	.	12.2094	0.54371	0.3687:0.0:0.539:0.0924	.	269	Q8WWQ8	STAB2_HUMAN	H	269	ENSP00000373539:R269H	ENSP00000373539:R269H	R	+	2	0	STAB2	102556020	0.000000	0.05858	0.000000	0.03702	0.453000	0.32348	-1.459000	0.02370	-2.678000	0.00410	-1.036000	0.02392	CGT	.	.	weak		0.498	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
PRR21	643905	hgsc.bcm.edu	37	2	240982131	240982131	+	Missense_Mutation	SNP	A	A	G	rs79839275	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr2:240982131A>G	ENST00000408934.1	-	1	268	c.269T>C	c.(268-270)aTg>aCg	p.M90T		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	90	Pro-rich.							p.S86fs*291(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GTGAAGAGGCATGGATGAAGG	0.617													-|||	1342	0.267971	0.3094	0.2378	5008	,	,		13820	0.3591		0.2167	False		,,,				2504	0.1922				p.M90T		Atlas-SNP	.											PRR21,NS,carcinoma,0,2	PRR21	53	2	2	Deletion - Frameshift(2)	upper_aerodigestive_tract(2)	c.T269C						scavenged	.	A	THR/MET	623,3545		160,303,1621	145.0	139.0	141.0		269	-3.6	0.0	2	dbSNP_131	141	921,7389		239,443,3473	no	missense	PRR21	NM_001080835.1	81	399,746,5094	GG,GA,AA		11.083,14.9472,12.3738	benign	90/390	240982131	1544,10934	2084	4155	6239	SO:0001583	missense	643905	exon1			AGAGGCATGGATG	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.269T>C	2.37:g.240982131A>G	ENSP00000386166:p.Met90Thr	Somatic	73	11	0.150685		WXS	Illumina HiSeq	Phase_I	60	7	0.116667	NM_001080835		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	573	0.2623626373626374	126	0.25609756097560976	81	0.22375690607734808	202	0.3531468531468531	164	0.21635883905013192	-	0.001	-3.069052	0.00036	0.149472	0.11083	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.13196	2.61;2.61	1.79	-3.59	0.04583	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.10296	0.003	B	0.10450	0.005	T	0.48103	-0.9064	8	0.21014	T	0.42	.	6.6332	0.22869	0.1723:0.4441:0.3836:0.0	.	90	Q8WXC7	PRR21_HUMAN	T	90	ENSP00000386166:M90T;ENSP00000418240:M90T	ENSP00000386166:M90T	M	-	2	0	PRR21	240630804	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.360000	0.20250	-2.294000	0.00663	-0.489000	0.04712	ATG	A|0.737;G|0.263	0.263	strong		0.617	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
DCAF4L2	138009	hgsc.bcm.edu	37	8	88886183	88886183	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr8:88886183G>T	ENST00000319675.3	-	1	113	c.17C>A	c.(16-18)cCg>cAg	p.P6Q		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	6										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GAGCAGTCGCGGTCTTTTGCT	0.512																																					p.P6Q		Atlas-SNP	.											DCAF4L2,NS,carcinoma,0,1	DCAF4L2	187	1	0			c.C17A						scavenged	.						44.0	44.0	44.0					8																	88886183		2203	4300	6503	SO:0001583	missense	138009	exon1			AGTCGCGGTCTTT	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.17C>A	8.37:g.88886183G>T	ENSP00000316496:p.Pro6Gln	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	88	3	0.0340909	NM_152418		Missense_Mutation	SNP	ENST00000319675.3	37	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	G	3.954	-0.011626	0.07727	.	.	ENSG00000176566	ENST00000319675	T	0.60299	0.2	1.39	-2.79	0.05841	.	0.486110	0.21957	N	0.066645	T	0.26122	0.0637	N	0.11427	0.14	0.09310	N	1	B	0.18863	0.031	B	0.15870	0.014	T	0.07309	-1.0779	10	0.24483	T	0.36	.	2.2198	0.03970	0.5561:0.0:0.2011:0.2428	.	6	Q8NA75	DC4L2_HUMAN	Q	6	ENSP00000316496:P6Q	ENSP00000316496:P6Q	P	-	2	0	DCAF4L2	88955299	0.879000	0.30193	0.001000	0.08648	0.014000	0.08584	0.238000	0.18004	-1.064000	0.03172	-0.518000	0.04402	CCG	.	.	none		0.512	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
STRADB	55437	hgsc.bcm.edu	37	2	202344861	202344861	+	Missense_Mutation	SNP	A	A	G	rs139900078		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr2:202344861A>G	ENST00000194530.3	+	12	1585	c.1220A>G	c.(1219-1221)gAt>gGt	p.D407G	STRADB_ENST00000392249.2_3'UTR	NM_001206864.1|NM_018571.5	NP_001193793.1|NP_061041.2	Q9C0K7	STRAB_HUMAN	STE20-related kinase adaptor beta	407					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cell morphogenesis (GO:0000902)|insulin receptor signaling pathway (GO:0008286)|JNK cascade (GO:0007254)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.D407G(1)		breast(1)|large_intestine(2)|lung(5)|prostate(1)|skin(3)|stomach(1)	13						CCAGAATGTGATTTTCCTGAT	0.403																																					p.D407G		Atlas-SNP	.											STRADB,hand,malignant_melanoma,0,1	STRADB	33	1	1	Substitution - Missense(1)	skin(1)	c.A1220G						scavenged	.						140.0	138.0	139.0					2																	202344861		2203	4300	6503	SO:0001583	missense	55437	exon12			AATGTGATTTTCC	AB038950	CCDS2348.1, CCDS56161.1	2q33.1	2010-09-30	2008-09-15	2008-09-15	ENSG00000082146	ENSG00000082146			13205	protein-coding gene	gene with protein product		607333	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2"""	ALS2CR2		11161814, 14511394	Standard	NM_018571		Approved	CALS-21, PAPK, ILPIPA, ILPIP	uc002uyd.4	Q9C0K7	OTTHUMG00000132831	ENST00000194530.3:c.1220A>G	2.37:g.202344861A>G	ENSP00000194530:p.Asp407Gly	Somatic	210	2	0.00952381		WXS	Illumina HiSeq	Phase_I	166	4	0.0240964	NM_018571	Q5BKY7|Q9P1L0	Missense_Mutation	SNP	ENST00000194530.3	37	CCDS2348.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.737|4.737	0.137134|0.137134	0.09032|0.09032	.|.	.|.	ENSG00000082146|ENSG00000082146	ENST00000194530;ENST00000539670;ENST00000392866|ENST00000415688	T|.	0.61510|.	0.1|.	5.55|5.55	-1.4|-1.4	0.08968|0.08968	.|.	1.281530|.	0.04747|.	N|.	0.423931|.	T|.	0.17959|.	0.0431|.	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|.	0.24512|.	-1.0158|.	10|.	0.21014|.	T|.	0.42|.	.|.	1.8647|1.8647	0.03195|0.03195	0.3817:0.2818:0.075:0.2616|0.3817:0.2818:0.075:0.2616	.|.	407|.	Q9C0K7|.	STRAB_HUMAN|.	G|W	407;407;269|77	ENSP00000194530:D407G|.	ENSP00000194530:D407G|.	D|X	+|+	2|3	0|0	STRADB|STRADB	202053106|202053106	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.245000|0.245000	0.25701|0.25701	-0.132000|-0.132000	0.10467|0.10467	0.023000|0.023000	0.15187|0.15187	0.533000|0.533000	0.62120|0.62120	GAT|TGA	.	.	weak		0.403	STRADB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256297.1	NM_018571	
NBPF15	284565	hgsc.bcm.edu	37	1	148579636	148579636	+	Missense_Mutation	SNP	T	T	C	rs200012164	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:148579636T>C	ENST00000369187.3	+	6	695	c.206T>C	c.(205-207)tTt>tCt	p.F69S	NBPF15_ENST00000442702.2_Missense_Mutation_p.F69S|NBPF15_ENST00000464336.2_3'UTR	NM_173638.3	NP_775909.2	Q8N660	NBPFF_HUMAN	neuroblastoma breakpoint family, member 15	69						cytoplasm (GO:0005737)				NS(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12	all_hematologic(923;0.032)					CTCATAAAATTTATGCTGAGG	0.527																																					p.F69S		Atlas-SNP	.											NBPF15,NS,carcinoma,0,2	NBPF15	20	2	0			c.T206C						scavenged	.						12.0	18.0	17.0					1																	148579636		884	2001	2885	SO:0001583	missense	284565	exon6			TAAAATTTATGCT	BC023087	CCDS72852.1	1q21.1	2014-01-16			ENSG00000243452	ENSG00000266338		"""neuroblastoma breakpoint family"""	28791	protein-coding gene	gene with protein product		610414, 614005	"""neuroblastoma breakpoint family, member 16"""	NBPF16		16079250	Standard	NM_173638		Approved	MGC8902	uc001esc.2	Q8N660	OTTHUMG00000013634	ENST00000369187.3:c.206T>C	1.37:g.148579636T>C	ENSP00000358188:p.Phe69Ser	Somatic	26	9	0.346154		WXS	Illumina HiSeq	Phase_I	22	10	0.454545	NM_173638	Q3BBV9|Q8IX77	Missense_Mutation	SNP	ENST00000369187.3	37	CCDS932.1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.454233	0.00173	.	.	ENSG00000243452	ENST00000442702;ENST00000369187	T;T	0.02050	4.48;4.48	0.566	0.566	0.17317	.	.	.	.	.	T	0.00144	0.0004	N	0.00170	-1.935	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34750	-0.9816	8	0.02654	T	1	.	.	.	.	.	69	Q8N660	NBPFF_HUMAN	S	69	ENSP00000416864:F69S;ENSP00000358188:F69S	ENSP00000358188:F69S	F	+	2	0	NBPF15	146846260	0.001000	0.12720	0.007000	0.13788	0.014000	0.08584	0.004000	0.13106	-0.220000	0.09988	-1.160000	0.01791	TTT	T|0.167;C|0.833	0.833	weak		0.527	NBPF15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038609.3	NM_173638	
PPM1E	22843	hgsc.bcm.edu	37	17	56833454	56833454	+	Silent	SNP	G	G	A	rs77856248		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:56833454G>A	ENST00000308249.2	+	1	225	c.96G>A	c.(94-96)gaG>gaA	p.E32E		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			Gcgagccggagccggaacccg	0.667																																					p.E32E		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	1	0			c.G96A						scavenged	.						14.0	20.0	18.0					17																	56833454		2185	4284	6469	SO:0001819	synonymous_variant	22843	exon1			GCCGGAGCCGGAA	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.96G>A	17.37:g.56833454G>A		Somatic	235	1	0.00425532		WXS	Illumina HiSeq	Phase_I	200	9	0.045	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	37	CCDS11613.1																																																																																			.	.	weak		0.667	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
PPM1E	22843	hgsc.bcm.edu	37	17	56833490	56833490	+	Silent	SNP	G	G	A	rs59676153		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr17:56833490G>A	ENST00000308249.2	+	1	261	c.132G>A	c.(130-132)gaG>gaA	p.E44E		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			ccgaacccgagtccgagcccg	0.706																																					p.E44E		Atlas-SNP	.											PPM1E,colon,carcinoma,0,1	PPM1E	97	1	0			c.G132A						scavenged	.																																			SO:0001819	synonymous_variant	22843	exon1			ACCCGAGTCCGAG	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.132G>A	17.37:g.56833490G>A		Somatic	231	1	0.004329		WXS	Illumina HiSeq	Phase_I	203	31	0.152709	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	37	CCDS11613.1																																																																																			.	.	weak		0.706	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
NRXN1	9378	hgsc.bcm.edu	37	2	50765586	50765586	+	Missense_Mutation	SNP	C	C	T	rs202137841		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr2:50765586C>T	ENST00000406316.2	-	10	3424	c.1948G>A	c.(1948-1950)Gat>Aat	p.D650N	NRXN1_ENST00000402717.3_Missense_Mutation_p.D642N|NRXN1_ENST00000404971.1_Missense_Mutation_p.D690N|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000406859.3_Missense_Mutation_p.D650N|NRXN1_ENST00000405472.3_Missense_Mutation_p.D642N|NRXN1_ENST00000401669.2_Missense_Mutation_p.D650N	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	650	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTTTGGCCATCGATGAACAAA	0.512																																					p.D690N		Atlas-SNP	.											.	NRXN1	1118	.	0			c.G2068A						PASS	.						207.0	221.0	216.0					2																	50765586		2198	4299	6497	SO:0001583	missense	9378	exon11			GGCCATCGATGAA	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.1948G>A	2.37:g.50765586C>T	ENSP00000384311:p.Asp650Asn	Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	110	12	0.109091	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.849430	0.91277	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.71187	0.3310	L	0.38175	1.15	0.50632	D	0.999885	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.991	T	0.65265	-0.6210	10	0.22706	T	0.39	.	18.8479	0.92215	0.0:1.0:0.0:0.0	.	690;650;642	Q9ULB1-3;F8WB18;A7E294	.;.;.	N	690;650;642;650;691;642;650	ENSP00000385142:D690N;ENSP00000384311:D650N;ENSP00000434015:D642N;ENSP00000385017:D650N;ENSP00000385434:D642N;ENSP00000385681:D650N	ENSP00000385017:D650N	D	-	1	0	NRXN1	50619090	1.000000	0.71417	0.636000	0.29352	0.971000	0.66376	7.651000	0.83577	2.682000	0.91365	0.585000	0.79938	GAT	.	.	alt		0.512	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
IFI44	10561	hgsc.bcm.edu	37	1	79116328	79116328	+	Silent	SNP	C	C	A	rs556294601		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr1:79116328C>A	ENST00000370747.4	+	2	533	c.448C>A	c.(448-450)Cga>Aga	p.R150R	IFI44_ENST00000495254.1_Intron|IFI44_ENST00000545124.1_Intron	NM_006417.4	NP_006408.3	Q8TCB0	IFI44_HUMAN	interferon-induced protein 44	150					response to virus (GO:0009615)	cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21						TGAAGTTTTTCGATGCGAAGG	0.333																																					p.R150R		Atlas-SNP	.											IFI44,caecum,carcinoma,0,2	IFI44	55	2	0			c.C448A						scavenged	.						42.0	44.0	43.0					1																	79116328		2201	4291	6492	SO:0001819	synonymous_variant	10561	exon2			GTTTTTCGATGCG	D28915	CCDS688.1	1p31.1	2013-03-14			ENSG00000137965	ENSG00000137965			16938	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 5"""	610468				7925411	Standard	NM_006417		Approved	MTAP44, p44, TLDC5	uc001dip.4	Q8TCB0	OTTHUMG00000009723	ENST00000370747.4:c.448C>A	1.37:g.79116328C>A		Somatic	285	0	0		WXS	Illumina HiSeq	Phase_I	217	3	0.0138249	NM_006417	B7ZAG3|D3DQ80|Q14496	Silent	SNP	ENST00000370747.4	37	CCDS688.1																																																																																			.	.	none		0.333	IFI44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026825.1	NM_006417	
TCTN1	79600	hgsc.bcm.edu	37	12	111066588	111066588	+	Silent	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr12:111066588C>T	ENST00000551590.1	+	4	645	c.489C>T	c.(487-489)tcC>tcT	p.S163S	TCTN1_ENST00000397655.3_Silent_p.S163S|TCTN1_ENST00000551555.2_3'UTR|TCTN1_ENST00000377654.3_5'UTR|TCTN1_ENST00000550703.2_Silent_p.S163S|HVCN1_ENST00000548312.1_Intron|RN7SL387P_ENST00000581015.1_RNA|TCTN1_ENST00000397659.4_Silent_p.S163S			Q2MV58	TECT1_HUMAN	tectonic family member 1	163					central nervous system interneuron axonogenesis (GO:0021956)|cilium morphogenesis (GO:0060271)|dorsal/ventral neural tube patterning (GO:0021904)|in utero embryonic development (GO:0001701)|neural tube formation (GO:0001841)|regulation of smoothened signaling pathway (GO:0008589)|somatic motor neuron differentiation (GO:0021523)|telencephalon development (GO:0021537)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|urinary_tract(1)	15						CTGCATTATCCTTTATTAATC	0.259																																					p.S163S		Atlas-SNP	.											.	TCTN1	37	.	0			c.C489T						PASS	.						89.0	83.0	85.0					12																	111066588		1796	4060	5856	SO:0001819	synonymous_variant	79600	exon4			ATTATCCTTTATT	AK055891	CCDS41833.1, CCDS41834.1, CCDS41835.1	12q24.11	2011-09-07			ENSG00000204852	ENSG00000204852		"""Tectonic proteins"""	26113	protein-coding gene	gene with protein product		609863				16357211	Standard	NM_001082537		Approved	FLJ21127, TECT1, JBTS13	uc001trn.4	Q2MV58	OTTHUMG00000150051	ENST00000551590.1:c.489C>T	12.37:g.111066588C>T		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	57	5	0.0877193	NM_024549	A8MX11|Q49A60|Q6P5X1|Q6UXW2|Q8NAE9|Q96N72|Q9H798	Silent	SNP	ENST00000551590.1	37	CCDS41835.1																																																																																			.	.	none		0.259	TCTN1-001	KNOWN	non_canonical_TEC|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316016.2	NM_024549	
AHRR	57491	hgsc.bcm.edu	37	5	428050	428050	+	Silent	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr5:428050G>A	ENST00000505113.1	+	8	893	c.849G>A	c.(847-849)gcG>gcA	p.A283A	AHRR_ENST00000506456.1_Silent_p.A139A|AHRR_ENST00000316418.5_Silent_p.A301A|AHRR_ENST00000512529.1_Silent_p.A129A	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	283					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			CCTCCGCAGCGGAGATGAAAA	0.617																																					p.A301A		Atlas-SNP	.											AHRR,colon,carcinoma,+1,2	AHRR	67	2	0			c.G903A						scavenged	.						26.0	31.0	29.0					5																	428050		1998	4160	6158	SO:0001819	synonymous_variant	57491	exon9			CGCAGCGGAGATG	AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.849G>A	5.37:g.428050G>A		Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	75	2	0.0266667	NM_020731	A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Silent	SNP	ENST00000505113.1	37	CCDS56355.1																																																																																			.	.	none		0.617	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367720.1	NM_020731	
TMEM30A	55754	hgsc.bcm.edu	37	6	75969072	75969072	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr6:75969072G>A	ENST00000230461.6	-	5	1005	c.676C>T	c.(676-678)Cga>Tga	p.R226*	TMEM30A_ENST00000370050.5_Nonsense_Mutation_p.R107*|TMEM30A_ENST00000475111.2_Nonsense_Mutation_p.R190*	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	226					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R226*(1)		NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCTTTAAATCGTTCTTCCAGG	0.308																																					p.R226X		Atlas-SNP	.											TMEM30A,caecum,carcinoma,0,2	TMEM30A	40	2	1	Substitution - Nonsense(1)	lung(1)	c.C676T						PASS	.						74.0	79.0	77.0					6																	75969072		2203	4298	6501	SO:0001587	stop_gained	55754	exon5			TAAATCGTTCTTC	AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.676C>T	6.37:g.75969072G>A	ENSP00000230461:p.Arg226*	Somatic	392	0	0		WXS	Illumina HiSeq	Phase_I	271	15	0.0553506	NM_018247	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Nonsense_Mutation	SNP	ENST00000230461.6	37	CCDS4983.1	.	.	.	.	.	.	.	.	.	.	G	39	7.311733	0.98203	.	.	ENSG00000112697	ENST00000230461;ENST00000545449;ENST00000370050;ENST00000475111	.	.	.	5.51	2.43	0.29744	.	0.572479	0.17857	N	0.159668	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	10.4926	0.44760	0.0:0.1178:0.5054:0.3768	.	.	.	.	X	226;210;107;190	.	ENSP00000230461:R226X	R	-	1	2	TMEM30A	76025792	0.004000	0.15560	1.000000	0.80357	0.933000	0.57130	0.839000	0.27586	0.724000	0.32296	0.655000	0.94253	CGA	.	.	none		0.308	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041248.2	NM_018247	
ZNF699	374879	hgsc.bcm.edu	37	19	9407194	9407194	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr19:9407194C>A	ENST00000591998.1	-	6	1114	c.886G>T	c.(886-888)Gaa>Taa	p.E296*	ZNF699_ENST00000308650.3_Nonsense_Mutation_p.E296*|CTC-325H20.4_ENST00000591336.1_RNA			Q32M78	ZN699_HUMAN	zinc finger protein 699	296					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTTTTGTGTTCTGTGAGCGAT	0.393																																					p.E296X		Atlas-SNP	.											.	ZNF699	67	.	0			c.G886T						PASS	.						108.0	108.0	108.0					19																	9407194		2155	4272	6427	SO:0001587	stop_gained	374879	exon5			TGTGTTCTGTGAG	BC109268	CCDS42495.1	19p13.2	2013-01-08				ENSG00000196110		"""Zinc fingers, C2H2-type"", ""-"""	24750	protein-coding gene	gene with protein product	hangover homolog (Drosophila)	609571				16940975	Standard	NM_198535		Approved	FLJ38144, hang	uc002mlc.1	Q32M78		ENST00000591998.1:c.886G>T	19.37:g.9407194C>A	ENSP00000467723:p.Glu296*	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	69	6	0.0869565	NM_198535	Q8N9A1	Nonsense_Mutation	SNP	ENST00000591998.1	37	CCDS42495.1	.	.	.	.	.	.	.	.	.	.	c	13.38	2.220238	0.39201	.	.	ENSG00000196110	ENST00000308650	.	.	.	3.28	-2.43	0.06522	.	0.000000	0.36972	N	0.002303	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	0.656	0.00834	0.1756:0.2514:0.173:0.4	.	.	.	.	X	296	.	ENSP00000311596:E296X	E	-	1	0	ZNF699	9268194	0.382000	0.25148	0.000000	0.03702	0.002000	0.02628	0.028000	0.13644	-0.346000	0.08312	-0.273000	0.10243	GAA	.	.	none		0.393	ZNF699-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449010.1	NM_198535	
CSGALNACT2	55454	hgsc.bcm.edu	37	10	43659419	43659419	+	Missense_Mutation	SNP	G	G	T	rs79064394		TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr10:43659419G>T	ENST00000374466.3	+	5	1421	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	362					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.L362F(5)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAGAGGTCTTGATGTTTTTCT	0.433																																					p.L362F		Atlas-SNP	.											CSGALNACT2,NS,carcinoma,0,5	CSGALNACT2	67	5	5	Substitution - Missense(5)	endometrium(4)|kidney(1)	c.G1086T						scavenged	.						223.0	221.0	222.0					10																	43659419		2203	4300	6503	SO:0001583	missense	55454	exon5			GGTCTTGATGTTT	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1086G>T	10.37:g.43659419G>T	ENSP00000363590:p.Leu362Phe	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	156	4	0.025641	NM_018590	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499782	0.85176	.	.	ENSG00000169826	ENST00000374466	T	0.27256	1.68	6.08	5.17	0.71159	.	0.064535	0.64402	D	0.000004	T	0.57359	0.2048	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63721	-0.6573	10	0.87932	D	0	-11.7375	14.8306	0.70146	0.0683:0.0:0.9317:0.0	.	362	Q8N6G5	CGAT2_HUMAN	F	362	ENSP00000363590:L362F	ENSP00000363590:L362F	L	+	3	2	CSGALNACT2	42979425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.683000	0.37638	2.894000	0.99253	0.591000	0.81541	TTG	.	.	weak		0.433	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
POTEH	23784	hgsc.bcm.edu	37	22	16277852	16277852	+	Silent	SNP	C	C	T	rs11489067	byFrequency	TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr22:16277852C>T	ENST00000343518.6	-	5	1113	c.1062G>A	c.(1060-1062)tcG>tcA	p.S354S	POTEH-AS1_ENST00000422014.1_RNA|RNU6-816P_ENST00000390914.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	354										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CTATACTTGCCGATCCACAAC	0.363																																					p.S354S		Atlas-SNP	.											POTEH,NS,carcinoma,0,1	POTEH	114	1	0			c.G1062A						scavenged	.						2.0	2.0	2.0					22																	16277852		390	826	1216	SO:0001819	synonymous_variant	23784	exon5			ACTTGCCGATCCA	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1062G>A	22.37:g.16277852C>T		Somatic	562	115	0.204626		WXS	Illumina HiSeq	Phase_I	429	99	0.230769	NM_001136213	A2CEK4|A6NCI1|A9Z1W0	Silent	SNP	ENST00000343518.6	37	CCDS46658.1																																																																																			C|0.816;T|0.184	0.184	strong		0.363	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
SLMO1	10650	hgsc.bcm.edu	37	18	12420448	12420448	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr18:12420448C>T	ENST00000440960.1	+	2	237	c.157C>T	c.(157-159)Cgc>Tgc	p.R53C	SLMO1_ENST00000587735.1_5'Flank|SLMO1_ENST00000592149.1_Missense_Mutation_p.R32C|SLMO1_ENST00000336990.4_Missense_Mutation_p.R53C|SLMO1_ENST00000590956.1_Intron	NM_001142405.1	NP_001135877.1	Q96N28	SLMO1_HUMAN	slowmo homolog 1 (Drosophila)	53	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(1)	1						GCACAGCTTGCGCCTGCTCAG	0.746																																					p.R53C		Atlas-SNP	.											.	SLMO1	11	.	0			c.C157T						PASS	.						8.0	9.0	9.0					18																	12420448		2149	4232	6381	SO:0001583	missense	10650	exon2			AGCTTGCGCCTGC	AK056046	CCDS11860.1	18p11.21	2007-02-20	2007-02-06	2007-02-06	ENSG00000141391	ENSG00000141391			24639	protein-coding gene	gene with protein product	"""erythroid differentiation and denucleation factor 1"""		"""chromosome 18 open reading frame 43"""	C18orf43			Standard	NM_006553		Approved	HFL-EDDG1, FLJ31484, PRELID3A	uc010wzu.2	Q96N28	OTTHUMG00000131694	ENST00000440960.1:c.157C>T	18.37:g.12420448C>T	ENSP00000404700:p.Arg53Cys	Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	68	6	0.0882353	NM_001142405	B0YJ10|B4E0C9|D3DUJ1|Q6AHX2	Missense_Mutation	SNP	ENST00000440960.1	37	CCDS11860.1	.	.	.	.	.	.	.	.	.	.	c	15.85	2.955021	0.53293	.	.	ENSG00000141391	ENST00000440960;ENST00000336990	T;T	0.37915	1.17;1.17	4.8	3.92	0.45320	PRELI/MSF1 (2);	0.000000	0.85682	D	0.000000	T	0.71719	0.3373	H	0.97340	3.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80686	-0.1272	10	0.87932	D	0	-6.8006	12.3369	0.55073	0.3069:0.693:0.0:0.0	.	53	Q96N28	SLMO1_HUMAN	C	53	ENSP00000404700:R53C;ENSP00000338988:R53C	ENSP00000338988:R53C	R	+	1	0	SLMO1	12410448	1.000000	0.71417	0.970000	0.41538	0.180000	0.23129	2.059000	0.41384	0.981000	0.38548	-0.329000	0.08387	CGC	.	.	none		0.746	SLMO1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254602.2	NM_006553	
PCDHA4	56144	hgsc.bcm.edu	37	5	140186810	140186810	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D5-01A-11D-A31X-10	TCGA-GR-A4D5-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90533f5d-0761-4b4a-a1ee-91e10e9ba2c4	433ab22f-7d7f-4e86-86f3-0ab50681046c	g.chr5:140186810G>A	ENST00000530339.1	+	1	38	c.38G>A	c.(37-39)cGt>cAt	p.R13H	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.R13H|PCDHA4_ENST00000356878.4_Missense_Mutation_p.R13H|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	13					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAATCCCGGCGTCTGCTGCTC	0.522																																					p.R13H		Atlas-SNP	.											.	PCDHA4	419	.	0			c.G38A						PASS	.						77.0	86.0	83.0					5																	140186810		2203	4300	6503	SO:0001583	missense	56144	exon1			CCCGGCGTCTGCT	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.38G>A	5.37:g.140186810G>A	ENSP00000435300:p.Arg13His	Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	80	6	0.075	NM_031500	O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	g	9.674	1.147430	0.21288	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.52526	0.71;0.66;0.68	4.55	2.63	0.31362	.	0.435566	0.16599	U	0.207426	T	0.37100	0.0991	L	0.60455	1.87	0.09310	N	1	B;B;B	0.17268	0.021;0.007;0.007	B;B;B	0.10450	0.005;0.004;0.002	T	0.22906	-1.0203	10	0.13470	T	0.59	.	6.4619	0.21960	0.1637:0.1655:0.6708:0.0	.	13;13;13	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	H	13	ENSP00000423470:R13H;ENSP00000349344:R13H;ENSP00000435300:R13H	ENSP00000349344:R13H	R	+	2	0	PCDHA4	140166994	0.056000	0.20664	0.746000	0.31095	0.800000	0.45204	1.920000	0.40025	0.980000	0.38523	0.467000	0.42956	CGT	.	.	none		0.522	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907	
