#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KRT2	3849	hgsc.bcm.edu	37	12	53045601	53045603	+	In_Frame_Del	DEL	CTG	CTG	-	rs369691469		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	CTG	CTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr12:53045601_53045603delCTG	ENST00000309680.3	-	1	345_347	c.324_326delCAG	c.(322-327)ttcagt>ttt	p.S109del		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	109	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		accaccaccactgaagccgctgc	0.635																																					p.109_109del		Atlas-Indel	.											.	KRT2	94	.	0			c.325_327del						PASS	.			45,4193		0,45,2074						-3.5	0.4		dbSNP_126	33	375,7857		0,375,3741	no	coding	KRT2	NM_000423.2		0,420,5815	A1A1,A1R,RR		4.5554,1.0618,3.3681				420,12050				SO:0001651	inframe_deletion	3849	exon1			.		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.324_326delCAG	12.37:g.53045601_53045603delCTG	ENSP00000310861:p.Ser109del	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	120	17	0.141667	NM_000423	Q4VAQ2	In_Frame_Del	DEL	ENST00000309680.3	37	CCDS8835.1																																																																																			.	.	weak		0.635	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
KRT2	3849	hgsc.bcm.edu	37	12	53045651	53045653	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr12:53045651_53045653delTCT	ENST00000309680.3	-	1	295_297	c.274_276delAGA	c.(274-276)agadel	p.R92del		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	92	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		aaccacctcctctgccaccaaat	0.611																																					p.92_93del		Atlas-Indel	.											.	KRT2	94	.	0			c.275_277del						PASS	.																																			SO:0001651	inframe_deletion	3849	exon1			.		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.274_276delAGA	12.37:g.53045651_53045653delTCT	ENSP00000310861:p.Arg92del	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	97	10	0.103093	NM_000423	Q4VAQ2	In_Frame_Del	DEL	ENST00000309680.3	37	CCDS8835.1																																																																																			.	.	none		0.611	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
TPRX1	284355	hgsc.bcm.edu	37	19	48305613	48305624	+	In_Frame_Del	DEL	TTGGGCCTGAGA	TTGGGCCTGAGA	-	rs201007421		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	TTGGGCCTGAGA	TTGGGCCTGAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:48305613_48305624delTTGGGCCTGAGA	ENST00000322175.3	-	2	799_810	c.644_655delTCTCAGGCCCAA	c.(643-657)atctcaggcccaaac>aac	p.ISGP215del	TPRX1_ENST00000535759.1_In_Frame_Del_p.ISGP312del|TPRX1_ENST00000543508.1_In_Frame_Del_p.ISGP205del	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	215	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		gggcctgggtttgggcctgagattgggcctga	0.67																																					p.215_219del	Esophageal Squamous(123;175 2281 3051 32395)	Atlas-Indel	.											TPRX1,NS,carcinoma,0,1	TPRX1	46	1	0			c.645_656del						PASS	.																																			SO:0001651	inframe_deletion	284355	exon2			.		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.644_655delTCTCAGGCCCAA	19.37:g.48305613_48305624delTTGGGCCTGAGA	ENSP00000323455:p.Ile215_Pro218del	Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	32	11	0.34375	NM_198479	A5D8Y3|B2RPL5	In_Frame_Del	DEL	ENST00000322175.3	37	CCDS33066.1																																																																																			.	.	none		0.670	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
PLIN4	729359	hgsc.bcm.edu	37	19	4511540	4511737	+	In_Frame_Del	DEL	TTGGCCACATTCGCAGCACCGGTCACCCCACTGCACACAGCATCCTTGGTACCAGTTAACACAGTCTTGGTGGTGTCCATGCCGGTCTGGACAGTCCCTTTGGCCAACTTCACAGCCCCTGTGAGCCCAGTGGACACAGCATCTTTAGTGCCAGTCAGGACAGACTTTGTAGTGTCCAGGCCCCCTTGGATGGCCCCT	TTGGCCACATTCGCAGCACCGGTCACCCCACTGCACACAGCATCCTTGGTACCAGTTAACACAGTCTTGGTGGTGTCCATGCCGGTCTGGACAGTCCCTTTGGCCAACTTCACAGCCCCTGTGAGCCCAGTGGACACAGCATCTTTAGTGCCAGTCAGGACAGACTTTGTAGTGTCCAGGCCCCCTTGGATGGCCCCT	-	rs7256387|rs368903378|rs202212610|rs555549345|rs201329270|rs201141051|rs78467378|rs75876308|rs200355083|rs199877521|rs577186284|rs75029810|rs115045260|rs113780287|rs370832479|rs368212787|rs577122808|rs538065591|rs373392114|rs77044499|rs62115187|rs62115186|rs386806135|rs386806134|rs62115189|rs62115188|rs546272975|rs201668625|rs386806136|rs62115185|rs556468881|rs113633295|rs548397251|rs113361848|rs78884463|rs560157750|rs539807788|rs542057395|rs555134306|rs539973505|rs560697989|rs76022477|rs377284048|rs28546567|rs62115190|rs562810671|rs534038291|rs374575535|rs57610751|rs77582974|rs73920825|rs201218860|rs372120790|rs200701465|rs369867902|rs112673009|rs545793182	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	TTGGCCACATTCGCAGCACCGGTCACCCCACTGCACACAGCATCCTTGGTACCAGTTAACACAGTCTTGGTGGTGTCCATGCCGGTCTGGACAGTCCCTTTGGCCAACTTCACAGCCCCTGTGAGCCCAGTGGACACAGCATCTTTAGTGCCAGTCAGGACAGACTTTGTAGTGTCCAGGCCCCCTTGGATGGCCCCT	TTGGCCACATTCGCAGCACCGGTCACCCCACTGCACACAGCATCCTTGGTACCAGTTAACACAGTCTTGGTGGTGTCCATGCCGGTCTGGACAGTCCCTTTGGCCAACTTCACAGCCCCTGTGAGCCCAGTGGACACAGCATCTTTAGTGCCAGTCAGGACAGACTTTGTAGTGTCCAGGCCCCCTTGGATGGCCCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:4511540_4511737delTTGGCCACATTCGCAGCACCGGTCACCCCACTGCACACAGCATCCTTGGTACCAGTTAACACAGTCTTGGTGGTGTCCATGCCGGTCTGGACAGTCCCTTTGGCCAACTTCACAGCCCCTGTGAGCCCAGTGGACACAGCATCTTTAGTGCCAGTCAGGACAGACTTTGTAGTGTCCAGGCCCCCTTGGATGGCCCCT	ENST00000301286.3	-	3	2192_2389	c.2193_2390delAGGGGCCATCCAAGGGGGCCTGGACACTACAAAGTCTGTCCTGACTGGCACTAAAGATGCTGTGTCCACTGGGCTCACAGGGGCTGTGAAGTTGGCCAAAGGGACTGTCCAGACCGGCATGGACACCACCAAGACTGTGTTAACTGGTACCAAGGATGCTGTGTGCAGTGGGGTGACCGGTGCTGCGAATGTGGCCAA	c.(2191-2391)aaaggggccatccaagggggcctggacactacaaagtctgtcctgactggcactaaagatgctgtgtccactgggctcacaggggctgtgaagttggccaaagggactgtccagaccggcatggacaccaccaagactgtgttaactggtaccaaggatgctgtgtgcagtggggtgaccggtgctgcgaatgtggccaag>aag	p.731_797KGAIQGGLDTTKSVLTGTKDAVSTGLTGAVKLAKGTVQTGMDTTKTVLTGTKDAVCSGVTGAANVAK>K		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	731	27 X 33 AA approximate tandem repeat.		K -> N (in dbSNP:rs7256387). {ECO:0000269|PubMed:11572484}.	I -> V (in Ref. 2; BAB67774). {ECO:0000305}.		cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GACGGCCCCCTTGGCCACATTCGCAGCACCGGTCACCCCACTGCACACAGCATCCTTGGTACCAGTTAACACAGTCTTGGTGGTGTCCATGCCGGTCTGGACAGTCCCTTTGGCCAACTTCACAGCCCCTGTGAGCCCAGTGGACACAGCATCTTTAGTGCCAGTCAGGACAGACTTTGTAGTGTCCAGGCCCCCTTGGATGGCCCCTTTGGCCACAT	0.595																																					p.732_797del		Pindel	.											.	PLIN4	191	.	0			c.2194_2391del						PASS	.																																			SO:0001651	inframe_deletion	729359	exon3			.	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2193_2390delAGGGGCCATCCAAGGGGGCCTGGACACTACAAAGTCTGTCCTGACTGGCACTAAAGATGCTGTGTCCACTGGGCTCACAGGGGCTGTGAAGTTGGCCAAAGGGACTGTCCAGACCGGCATGGACACCACCAAGACTGTGTTAACTGGTACCAAGGATGCTGTGTGCAGTGGGGTGACCGGTGCTGCGAATGTGGCCAA	19.37:g.4511540_4511737delTTGGCCACATTCGCAGCACCGGTCACCCCACTGCACACAGCATCCTTGGTACCAGTTAACACAGTCTTGGTGGTGTCCATGCCGGTCTGGACAGTCCCTTTGGCCAACTTCACAGCCCCTGTGAGCCCAGTGGACACAGCATCTTTAGTGCCAGTCAGGACAGACTTTGTAGTGTCCAGGCCCCCTTGGATGGCCCCT	ENSP00000301286:p.Lys731_Ala796del	Somatic	78	.	.		WXS	Illumina HiSeq	Phase_I	94	17	0.181	NM_001080400	A6NEI2	In_Frame_Del	DEL	ENST00000301286.3	37	CCDS45927.1																																																																																			.	.	none		0.595	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
AR	367	hgsc.bcm.edu	37	X	66765158	66765158	+	Missense_Mutation	SNP	T	T	A	rs78686797|rs3032358|rs4045402		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chrX:66765158T>A	ENST00000374690.3	+	1	694	c.170T>A	c.(169-171)cTg>cAg	p.L57Q	AR_ENST00000396044.3_Missense_Mutation_p.L57Q|AR_ENST00000504326.1_Missense_Mutation_p.L57Q|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	57	Modulating.|Poly-Leu.		L -> Q (in prostate cancer).		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L57Q(3)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	TTGCTGCTGCTgcagcagcag	0.667									Androgen Insensitivity Syndrome																												p.L57Q		Atlas-SNP	.											.	AR	249	.	3	Substitution - Missense(3)	lung(1)|endometrium(1)|central_nervous_system(1)	c.T170A						PASS	.						9.0	12.0	11.0					X																	66765158		2134	4208	6342	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	TGCTGCTGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.170T>A	X.37:g.66765158T>A	ENSP00000363822:p.Leu57Gln	Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	100	8	0.08	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	37	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	N	0.020	-1.439011	0.01098	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	D;D;D	0.83992	-1.79;-1.79;-1.79	.	.	.	.	0.157526	0.30101	N	0.010412	T	0.56441	0.1985	N	0.03608	-0.345	0.09310	N	0.999999	.	.	.	.	.	.	T	0.48927	-0.8991	6	0.20519	T	0.43	.	.	.	.	.	57;57;55	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	Q	57	ENSP00000363822:L57Q;ENSP00000421155:L57Q;ENSP00000379359:L57Q	ENSP00000363822:L57Q	L	+	2	0	AR	66681883	0.999000	0.42202	0.884000	0.34674	0.488000	0.33401	0.326000	0.19646	0.000000	0.14550	0.000000	0.15137	CTG	.	.	weak		0.667	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
HLA-DRB5	3127	hgsc.bcm.edu	37	6	32487265	32487265	+	Missense_Mutation	SNP	C	C	G	rs139485758	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:32487265C>G	ENST00000374975.3	-	3	596	c.534G>C	c.(532-534)caG>caC	p.Q178H		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5									p.Q178H(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						AGTCTCCATTCTGAATCAGGC	0.552													C|||	836	0.166933	0.2224	0.1326	5008	,	,		15097	0.1667		0.1531	False		,,,				2504	0.1309				p.Q178H		Atlas-SNP	.											HLA-DRB5,NS,NS,0,1	HLA-DRB5	31	1	1	Substitution - Missense(1)	NS(1)	c.G534C						scavenged	.						61.0	68.0	65.0					6																	32487265		1933	3889	5822	SO:0001583	missense	3127	exon3			TCCATTCTGAATC		CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.534G>C	6.37:g.32487265C>G	ENSP00000364114:p.Gln178His	Somatic	20	19	0.95		WXS	Illumina HiSeq	Phase_I	14	14	1	NM_002125		Missense_Mutation	SNP	ENST00000374975.3	37	CCDS4751.1	.	.	.	.	.	.	.	.	.	.	.	2.451	-0.326294	0.05350	.	.	ENSG00000198502	ENST00000374975	T	0.14391	2.51	4.6	-9.19	0.00685	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	1.115120	0.06656	N	0.763651	T	0.02193	0.0068	L	0.35487	1.065	0.80722	P	0.0	B;B	0.19445	0.036;0.003	B;B	0.33690	0.168;0.014	T	0.35871	-0.9771	9	0.35671	T	0.21	.	1.7649	0.03000	0.2235:0.402:0.1926:0.1818	.	105;178	Q29973;Q30154	.;DRB5_HUMAN	H	178	ENSP00000364114:Q178H	ENSP00000364114:Q178H	Q	-	3	2	HLA-DRB5	32595243	0.000000	0.05858	0.000000	0.03702	0.495000	0.33615	-4.437000	0.00234	-3.808000	0.00104	-0.273000	0.10243	CAG	A|0.003;C|0.930;G|0.067	0.067	strong		0.552	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
ZSCAN5A	79149	hgsc.bcm.edu	37	19	56736100	56736100	+	Missense_Mutation	SNP	T	T	C	rs200493184		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:56736100T>C	ENST00000587340.1	-	4	1011	c.316A>G	c.(316-318)Atg>Gtg	p.M106V	ZSCAN5A_ENST00000592355.1_Missense_Mutation_p.M106V|ZSCAN5A_ENST00000254165.3_Intron|ZSCAN5A_ENST00000587492.1_Intron|ZSCAN5A_ENST00000391713.1_Missense_Mutation_p.M106V			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	106	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.M106V(2)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						ACACCGTTCATCATGACTAAG	0.547																																					p.M106V		Atlas-SNP	.											ZSCAN5A,trunk,malignant_melanoma,0,2	ZSCAN5A	118	2	2	Substitution - Missense(2)	skin(2)	c.A316G						scavenged	.						19.0	19.0	19.0					19																	56736100		2139	4211	6350	SO:0001583	missense	79149	exon2			CGTTCATCATGAC	AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.316A>G	19.37:g.56736100T>C	ENSP00000467631:p.Met106Val	Somatic	279	1	0.00358423		WXS	Illumina HiSeq	Phase_I	278	4	0.0143885	NM_024303	B4DX98|Q49A73|Q53F04|Q8N7B3	Missense_Mutation	SNP	ENST00000587340.1	37	CCDS12941.1	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.996233	0.00435	.	.	ENSG00000131848	ENST00000391713	T	0.04083	3.71	2.27	0.0345	0.14184	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.02119	0.0066	N	0.04508	-0.205	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.47142	-0.9140	9	0.29301	T	0.29	.	4.2945	0.10895	0.0:0.6121:0.0:0.3879	.	106	Q9BUG6	ZSA5A_HUMAN	V	106	ENSP00000375593:M106V	ENSP00000375593:M106V	M	-	1	0	ZSCAN5A	61427912	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.069000	0.14552	0.068000	0.16574	-0.415000	0.06103	ATG	.	.	weak		0.547	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458110.1	NM_024303	
MUC4	4585	hgsc.bcm.edu	37	3	195507539	195507539	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:195507539G>A	ENST00000463781.3	-	2	11371	c.10912C>T	c.(10912-10914)Ctt>Ttt	p.L3638F	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L3638F	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAAGGCTGGTGACA	0.582																																					p.L3638F		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	0			c.C10912T						scavenged	.						15.0	13.0	14.0					3																	195507539		617	1515	2132	SO:0001583	missense	4585	exon2			AGGAAAGGCTGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10912C>T	3.37:g.195507539G>A	ENSP00000417498:p.Leu3638Phe	Somatic	113	7	0.0619469		WXS	Illumina HiSeq	Phase_I	102	9	0.0882353	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	9.111	1.006664	0.19199	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.36520	1.25;1.49	0.743	-1.49	0.08718	.	.	.	.	.	T	0.13114	0.0318	N	0.08118	0	0.09310	N	1	B	0.26876	0.162	B	0.08055	0.003	T	0.15235	-1.0444	8	.	.	.	.	2.9195	0.05764	0.0:0.3015:0.3959:0.3025	.	3510	E7ESK3	.	F	3638	ENSP00000417498:L3638F;ENSP00000420243:L3638F	.	L	-	1	0	MUC4	196992318	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-3.553000	0.00433	-1.969000	0.01005	-1.982000	0.00454	CTT	.	.	weak		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
HIST1H2BG	8339	hgsc.bcm.edu	37	6	26216764	26216764	+	Silent	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:26216764C>T	ENST00000244601.3	-	1	108	c.108G>A	c.(106-108)gaG>gaA	p.E36E	HIST1H2AE_ENST00000303910.2_5'Flank	NM_003518.3	NP_003509.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	36					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	8		all_hematologic(11;0.196)				CGGAGTAGCTCTCCTTACGAC	0.517																																					p.E36E		Atlas-SNP	.											.	HIST1H2BG	25	.	0			c.G108A						PASS	.						250.0	219.0	229.0					6																	26216764		2203	4300	6503	SO:0001819	synonymous_variant	8339	exon1			GTAGCTCTCCTTA	M60750	CCDS4594.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000187990	ENSG00000273802		"""Histones / Replication-dependent"""	4746	protein-coding gene	gene with protein product		602798	"""H2B histone family, member A"", ""histone 1, H2bg"""	H2BFA		1916825, 12408966	Standard	NM_003518		Approved	H2B/a, H2B.1A	uc003ngz.2	P62807	OTTHUMG00000014446	ENST00000244601.3:c.108G>A	6.37:g.26216764C>T		Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	88	19	0.215909	NM_003518	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	ENST00000244601.3	37	CCDS4594.1																																																																																			.	.	none		0.517	HIST1H2BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040109.2	NM_003518	
HIST1H1D	3007	hgsc.bcm.edu	37	6	26234674	26234674	+	Missense_Mutation	SNP	G	G	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:26234674G>C	ENST00000244534.5	-	1	542	c.488C>G	c.(487-489)gCa>gGa	p.A163G		NM_005320.2	NP_005311.1	P16402	H13_HUMAN	histone cluster 1, H1d	163					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				AGCAGCGGTTGCTGGCTTCTT	0.537																																					p.A163G		Atlas-SNP	.											.	HIST1H1D	40	.	0			c.C488G						PASS	.						95.0	103.0	100.0					6																	26234674		2203	4300	6503	SO:0001583	missense	3007	exon1			GCGGTTGCTGGCT	M60747	CCDS4597.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000124575	ENSG00000124575		"""Histones / Replication-dependent"""	4717	protein-coding gene	gene with protein product		142210	"""H1 histone family, member 3"", ""histone 1, H1d"""	H1F3		1916825, 12408966	Standard	NM_005320		Approved	H1.3, H1d, H1s-2	uc003nhd.3	P16402	OTTHUMG00000014432	ENST00000244534.5:c.488C>G	6.37:g.26234674G>C	ENSP00000244534:p.Ala163Gly	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	74	16	0.216216	NM_005320	B2R751|Q2M2I2	Missense_Mutation	SNP	ENST00000244534.5	37	CCDS4597.1	.	.	.	.	.	.	.	.	.	.	.	9.047	0.991113	0.18966	.	.	ENSG00000124575	ENST00000244534	T	0.25414	1.8	5.22	4.35	0.52113	.	0.316723	0.32444	N	0.006082	T	0.06280	0.0162	N	0.08118	0	0.53005	D	0.999965	B	0.27853	0.191	B	0.28465	0.09	T	0.16453	-1.0402	10	0.33940	T	0.23	-1.7269	13.338	0.60528	0.0768:0.0:0.9232:0.0	.	163	P16402	H13_HUMAN	G	163	ENSP00000244534:A163G	ENSP00000244534:A163G	A	-	2	0	HIST1H1D	26342653	0.437000	0.25593	0.009000	0.14445	0.105000	0.19272	2.513000	0.45494	1.351000	0.45789	0.650000	0.86243	GCA	.	.	none		0.537	HIST1H1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040095.1	NM_005320	
PLXDC2	84898	hgsc.bcm.edu	37	10	20436808	20436808	+	Nonsense_Mutation	SNP	C	C	T	rs372842489		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr10:20436808C>T	ENST00000377252.4	+	6	1601	c.760C>T	c.(760-762)Cga>Tga	p.R254*	PLXDC2_ENST00000377238.2_3'UTR|PLXDC2_ENST00000377242.3_Nonsense_Mutation_p.R205*	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	254					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						CATGGATGGACGAATCATCTT	0.453																																					p.R254X		Atlas-SNP	.											.	PLXDC2	108	.	0			c.C760T						PASS	.						102.0	82.0	88.0					10																	20436808		2203	4300	6503	SO:0001587	stop_gained	84898	exon6			GATGGACGAATCA	AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.760C>T	10.37:g.20436808C>T	ENSP00000366460:p.Arg254*	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	102	14	0.137255	NM_032812	Q96E59|Q96PD9|Q96SU9	Nonsense_Mutation	SNP	ENST00000377252.4	37	CCDS7132.1	.	.	.	.	.	.	.	.	.	.	C	44	11.271397	0.99539	.	.	ENSG00000120594	ENST00000377252;ENST00000377242;ENST00000377238;ENST00000536022	.	.	.	4.83	3.85	0.44370	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1168	0.65159	0.1509:0.8491:0.0:0.0	.	.	.	.	X	254;205;117;240	.	ENSP00000366446:R117X	R	+	1	2	PLXDC2	20476814	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	3.792000	0.55476	2.392000	0.81423	0.557000	0.71058	CGA	.	.	none		0.453	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2	NM_032812	
NBPF10	100132406	hgsc.bcm.edu	37	1	145296373	145296373	+	Missense_Mutation	SNP	G	G	T	rs3969711	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:145296373G>T	ENST00000342960.5	+	3	330	c.295G>T	c.(295-297)Gtt>Ttt	p.V99F	NBPF10_ENST00000369338.1_Intron|RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	99						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.V99F(1)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TAAAGTCCTAGTTCACTCTCA	0.473																																					p.V99F		Atlas-SNP	.											NBPF10,NS,carcinoma,0,3	NBPF10	221	3	1	Substitution - Missense(1)	kidney(1)	c.G295T						scavenged	.																																			SO:0001583	missense	100132406	exon3			GTCCTAGTTCACT	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.295G>T	1.37:g.145296373G>T	ENSP00000345684:p.Val99Phe	Somatic	56	2	0.0357143		WXS	Illumina HiSeq	Phase_I	41	7	0.170732	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	10.07	1.249076	0.22880	.	.	ENSG00000163386	ENST00000369339;ENST00000448873;ENST00000342960	T	0.03889	3.77	1.15	-0.158	0.13383	.	.	.	.	.	T	0.03220	0.0094	M	0.72479	2.2	0.09310	N	1	.	.	.	.	.	.	T	0.38757	-0.9646	7	0.87932	D	0	.	3.0726	0.06236	0.7069:0.0:0.2931:0.0	rs3969711;rs4996270	.	.	.	F	99;24;99	ENSP00000345684:V99F	ENSP00000345684:V99F	V	+	1	0	NBPF10	144007730	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.057000	0.14279	-0.026000	0.13895	0.121000	0.15741	GTT	G|0.700;T|0.300	0.300	strong		0.473	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
MUC4	4585	hgsc.bcm.edu	37	3	195509171	195509171	+	Missense_Mutation	SNP	G	G	A	rs71634716		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:195509171G>A	ENST00000463781.3	-	2	9739	c.9280C>T	c.(9280-9282)Ctt>Ttt	p.L3094F	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L3094F	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.L3094F(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAAGGCTGGTGACA	0.602																																					p.L3094F		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	1	Substitution - Missense(1)	kidney(1)	c.C9280T						scavenged	.						13.0	10.0	11.0					3																	195509171		666	1549	2215	SO:0001583	missense	4585	exon2			AGGAAAGGCTGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9280C>T	3.37:g.195509171G>A	ENSP00000417498:p.Leu3094Phe	Somatic	92	4	0.0434783		WXS	Illumina HiSeq	Phase_I	101	9	0.0891089	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	13.68	2.309979	0.40895	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.36520	1.4;1.25	.	.	.	.	.	.	.	.	T	0.17280	0.0415	N	0.14661	0.345	0.09310	N	0.999996	P	0.47604	0.898	B	0.40165	0.321	T	0.07462	-1.0771	7	.	.	.	.	3.4791	0.07595	1.0E-4:1.0E-4:0.5545:0.4454	.	2966	E7ESK3	.	F	3094	ENSP00000417498:L3094F;ENSP00000420243:L3094F	.	L	-	1	0	MUC4	196993950	.	.	0.015000	0.15790	0.000000	0.00434	.	.	0.497000	0.27926	0.000000	0.15137	CTT	.	.	none		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ADAM21	8747	hgsc.bcm.edu	37	14	70924294	70924294	+	Silent	SNP	C	C	T	rs112060847		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr14:70924294C>T	ENST00000603540.1	+	2	336	c.78C>T	c.(76-78)tcC>tcT	p.S26S	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Silent_p.S26S	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	26					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TGTCTATTTCCGGCTACTGTC	0.542																																					p.S26S		Atlas-SNP	.											ADAM21_ENST00000267499,NS,malignant_melanoma,+1,4	ADAM21	181	4	0			c.C78T						scavenged	.						101.0	110.0	107.0					14																	70924294		2203	4300	6503	SO:0001819	synonymous_variant	8747	exon2			TATTTCCGGCTAC	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.78C>T	14.37:g.70924294C>T		Somatic	82	3	0.0365854		WXS	Illumina HiSeq	Phase_I	88	4	0.0454545	NM_003813	O43507|Q2VPC6|Q32MR0	Silent	SNP	ENST00000603540.1	37	CCDS9804.1																																																																																			C|0.779;T|0.221	0.221	strong		0.542	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3		
CNN2	1265	hgsc.bcm.edu	37	19	1037764	1037764	+	Silent	SNP	C	C	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:1037764C>G	ENST00000263097.4	+	7	1158	c.795C>G	c.(793-795)ggC>ggG	p.G265G	ABCA7_ENST00000263094.6_5'Flank|CNN2_ENST00000562958.2_Silent_p.G286G|AC011558.5_ENST00000585757.1_RNA|CNN2_ENST00000565096.2_Silent_p.G254G|CNN2_ENST00000606983.1_3'UTR|CNN2_ENST00000348419.3_Silent_p.G226G	NM_004368.2	NP_004359.1	Q99439	CNN2_HUMAN	calponin 2	265					actomyosin structure organization (GO:0031032)|cellular response to mechanical stimulus (GO:0071260)|cytoskeleton organization (GO:0007010)|hemopoiesis (GO:0030097)|negative regulation of cell migration (GO:0030336)|negative regulation of phagocytosis (GO:0050765)|positive regulation of gene expression (GO:0010628)|regulation of actin filament-based process (GO:0032970)|regulation of cell proliferation (GO:0042127)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|stress fiber (GO:0001725)	actin binding (GO:0003779)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGGCCTGGGCCGGCAGATAT	0.652																																					p.G265G		Atlas-SNP	.											.	CNN2	26	.	0			c.C795G						PASS	.						70.0	81.0	77.0					19																	1037764		2200	4288	6488	SO:0001819	synonymous_variant	1265	exon7			CCTGGGCCGGCAG	D83735	CCDS12053.1, CCDS12054.1	19p13.3	2011-02-18			ENSG00000064666	ENSG00000064666			2156	protein-coding gene	gene with protein product		602373				8889829	Standard	NM_004368		Approved		uc002lqu.3	Q99439		ENST00000263097.4:c.795C>G	19.37:g.1037764C>G		Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	108	26	0.240741	NM_004368	A5D8U8|A6NFI4|D6W5X9|Q92578	Silent	SNP	ENST00000263097.4	37	CCDS12053.1																																																																																			.	.	none		0.652	CNN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420293.3	NM_004368	
ROBO1	6091	hgsc.bcm.edu	37	3	78795978	78795978	+	Missense_Mutation	SNP	C	C	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:78795978C>A	ENST00000464233.1	-	5	685	c.572G>T	c.(571-573)tGc>tTc	p.C191F	ROBO1_ENST00000436010.2_Missense_Mutation_p.C152F|ROBO1_ENST00000467549.1_Missense_Mutation_p.C152F|ROBO1_ENST00000495273.1_Missense_Mutation_p.C152F	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	191	Ig-like C2-type 2.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TGGAGGTTGGCATTCCATTAC	0.433																																					p.C191F		Atlas-SNP	.											.	ROBO1	833	.	0			c.G572T						PASS	.						124.0	123.0	123.0					3																	78795978		1923	4132	6055	SO:0001583	missense	6091	exon5			GGTTGGCATTCCA	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.572G>T	3.37:g.78795978C>A	ENSP00000420321:p.Cys191Phe	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	108	14	0.12963	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.664509	0.67700	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.83	5.83	0.93111	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	D	0.90038	0.6889	H	0.96175	3.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.92395	0.5924	9	.	.	.	.	20.1133	0.97917	0.0:1.0:0.0:0.0	.	191;152;152;152	Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	ROBO1_HUMAN;.;.;.	F	152;152;191;152;152;191	ENSP00000406043:C152F;ENSP00000420321:C191F;ENSP00000420637:C152F;ENSP00000417992:C152F	.	C	-	2	0	ROBO1	78878668	1.000000	0.71417	1.000000	0.80357	0.188000	0.23474	7.818000	0.86416	2.762000	0.94881	0.591000	0.81541	TGC	.	.	none		0.433	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
OR52I2	143502	hgsc.bcm.edu	37	11	4608393	4608393	+	Silent	SNP	A	A	G	rs56002758	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr11:4608393A>G	ENST00000312614.4	+	1	373	c.351A>G	c.(349-351)tcA>tcG	p.S117S		NM_001005170.2	NP_001005170.1	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I, member 2	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|pancreas(1)|skin(1)	19		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCTTCTGCTCAGGAGACAGCT	0.512													A|||	138	0.0275559	0.0915	0.0029	5008	,	,		24334	0.0109		0.0	False		,,,				2504	0.0041				p.S117S		Atlas-SNP	.											OR52I2,NS,carcinoma,0,1	OR52I2	50	1	0			c.A351G						scavenged	.						202.0	191.0	195.0					11																	4608393		2201	4298	6499	SO:0001819	synonymous_variant	143502	exon1			CTGCTCAGGAGAC	BK004264	CCDS31355.1	11p15.4	2012-08-09			ENSG00000226288	ENSG00000226288		"""GPCR / Class A : Olfactory receptors"""	15221	protein-coding gene	gene with protein product							Standard	NM_001005170		Approved		uc010qyh.2	Q8NH67	OTTHUMG00000165721	ENST00000312614.4:c.351A>G	11.37:g.4608393A>G		Somatic	97	3	0.0309278		WXS	Illumina HiSeq	Phase_I	98	6	0.0612245	NM_001005170	B2RNJ5|B9EKV8|Q6IFJ8	Silent	SNP	ENST00000312614.4	37	CCDS31355.1																																																																																			A|0.972;G|0.028	0.028	strong		0.512	OR52I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385946.1	NM_001005170	
ZSCAN5A	79149	hgsc.bcm.edu	37	19	56736102	56736102	+	Missense_Mutation	SNP	A	A	T	rs201600248		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:56736102A>T	ENST00000587340.1	-	4	1009	c.314T>A	c.(313-315)aTg>aAg	p.M105K	ZSCAN5A_ENST00000592355.1_Missense_Mutation_p.M105K|ZSCAN5A_ENST00000254165.3_Intron|ZSCAN5A_ENST00000587492.1_Intron|ZSCAN5A_ENST00000391713.1_Missense_Mutation_p.M105K			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	105	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.M105K(2)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						ACCGTTCATCATGACTAAGAC	0.552																																					p.M105K		Atlas-SNP	.											ZSCAN5A,trunk,malignant_melanoma,0,2	ZSCAN5A	118	2	2	Substitution - Missense(2)	skin(2)	c.T314A						scavenged	.						19.0	19.0	19.0					19																	56736102		2141	4214	6355	SO:0001583	missense	79149	exon2			TTCATCATGACTA	AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.314T>A	19.37:g.56736102A>T	ENSP00000467631:p.Met105Lys	Somatic	280	1	0.00357143		WXS	Illumina HiSeq	Phase_I	279	4	0.0143369	NM_024303	B4DX98|Q49A73|Q53F04|Q8N7B3	Missense_Mutation	SNP	ENST00000587340.1	37	CCDS12941.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.262023	0.00262	.	.	ENSG00000131848	ENST00000391713	T	0.03745	3.82	2.27	-1.24	0.09435	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.00637	0.0021	N	0.00086	-2.195	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.44817	-0.9303	9	0.02654	T	1	.	2.254	0.04051	0.2591:0.3296:0.0:0.4112	.	105	Q9BUG6	ZSA5A_HUMAN	K	105	ENSP00000375593:M105K	ENSP00000375593:M105K	M	-	2	0	ZSCAN5A	61427914	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-2.751000	0.00792	-0.413000	0.07507	-0.669000	0.03829	ATG	.	.	weak		0.552	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458110.1	NM_024303	
NBPF3	84224	hgsc.bcm.edu	37	1	21795388	21795388	+	Missense_Mutation	SNP	A	A	G	rs1827293	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:21795388A>G	ENST00000318249.5	+	3	691	c.341A>G	c.(340-342)tAc>tGc	p.Y114C	NBPF3_ENST00000454000.2_Intron|NBPF3_ENST00000342104.5_Missense_Mutation_p.Y114C|NBPF3_ENST00000318220.6_Missense_Mutation_p.Y58C	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	114			Y -> C (in dbSNP:rs1827293). {ECO:0000269|PubMed:15489334}.			cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CAAAATAATTACGGTAAGTTC	0.448											OREG0013205	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	.|||	2123	0.423922	0.1445	0.4755	5008	,	,		19838	0.5804		0.5417	False		,,,				2504	0.4826				p.A114G		Atlas-SNP	.											NBPF3,NS,carcinoma,0,1	NBPF3	55	1	0			c.C341G						scavenged	.	A	CYS/TYR	970,3436		104,762,1337	48.0	53.0	51.0		341	-2.2	0.0	1	dbSNP_92	51	4756,3844		1332,2092,876	yes	missense	NBPF3	NM_032264.2	194	1436,2854,2213	GG,GA,AA		44.6977,22.0154,44.0258	probably-damaging	114/634	21795388	5726,7280	2203	4300	6503	SO:0001583	missense	84224	exon3			ATAATTACGGTAA	BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.341A>G	1.37:g.21795388A>G	ENSP00000316782:p.Tyr114Cys	Somatic	253	0	0	751	WXS	Illumina HiSeq	Phase_I	220	4	0.0181818	NM_001256416	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	37	CCDS216.1	999	0.4574175824175824	88	0.17886178861788618	187	0.5165745856353591	318	0.5559440559440559	406	0.5356200527704486	.	10.34	1.323132	0.24080	0.220154	0.553023	ENSG00000142794	ENST00000318220;ENST00000318249;ENST00000417552;ENST00000342104;ENST00000434838	T;T;T;T	0.04970	3.69;3.52;3.55;3.69	1.08	-2.16	0.07080	.	.	.	.	.	T	0.00012	0.0000	M	0.72353	2.195	0.80722	P	0.0	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.979	T	0.48547	-0.9026	8	0.87932	D	0	.	1.9892	0.03442	0.3991:0.302:0.0:0.2989	rs1827293;rs3738102;rs17420230;rs17856707;rs52824093;rs58179675;rs1827293	114;114	Q9H094-3;Q9H094	.;NBPF3_HUMAN	C	58;114;58;114;58	ENSP00000316739:Y58C;ENSP00000316782:Y114C;ENSP00000340336:Y114C;ENSP00000391865:Y58C	ENSP00000316739:Y58C	Y	+	2	0	NBPF3	21667975	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	-0.056000	0.11787	-0.776000	0.04578	0.327000	0.21459	TAC	A|0.554;G|0.446	0.446	strong		0.448	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032264	
PPP2R5A	5525	hgsc.bcm.edu	37	1	212532087	212532087	+	Missense_Mutation	SNP	T	T	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:212532087T>G	ENST00000261461.2	+	12	1860	c.1286T>G	c.(1285-1287)cTt>cGt	p.L429R	RP11-384C4.2_ENST00000447949.1_RNA|PPP2R5A_ENST00000537030.3_Missense_Mutation_p.L372R	NM_006243.3	NP_006234.1	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B', alpha	429					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of lipid kinase activity (GO:0090219)|positive regulation of protein dephosphorylation (GO:0035307)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|M band (GO:0031430)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)|Z disc (GO:0030018)	kinase binding (GO:0019900)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		AATGGCAAGCTTTTCGATGAC	0.343																																					p.L429R		Atlas-SNP	.											.	PPP2R5A	48	.	0			c.T1286G						PASS	.						94.0	89.0	91.0					1																	212532087		2203	4300	6503	SO:0001583	missense	5525	exon12			GCAAGCTTTTCGA	BC022474	CCDS1503.1, CCDS55686.1	1q32.2-q32.3	2010-06-18	2010-04-14		ENSG00000066027	ENSG00000066027		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9309	protein-coding gene	gene with protein product		601643	"""protein phosphatase 2, regulatory subunit B (B56), alpha isoform"", ""protein phosphatase 2, regulatory subunit B', alpha isoform"""			7592815	Standard	NM_006243		Approved	PR61A, B56A	uc001hjb.3	Q15172	OTTHUMG00000036750	ENST00000261461.2:c.1286T>G	1.37:g.212532087T>G	ENSP00000261461:p.Leu429Arg	Somatic	269	0	0		WXS	Illumina HiSeq	Phase_I	318	47	0.147799	NM_006243	B2R6D2|B7Z7L2|D3DT99|Q2NL72|Q5VVB2|Q8TBI9	Missense_Mutation	SNP	ENST00000261461.2	37	CCDS1503.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.736868	0.89482	.	.	ENSG00000066027	ENST00000542178;ENST00000261461;ENST00000537030	.	.	.	6.06	6.06	0.98353	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.87653	0.6231	H	0.97103	3.94	0.80722	D	1	D;D	0.57257	0.979;0.979	D;D	0.66084	0.941;0.941	D	0.91502	0.5220	9	0.72032	D	0.01	-16.7161	16.6154	0.84909	0.0:0.0:0.0:1.0	.	372;429	B7Z7L2;Q15172	.;2A5A_HUMAN	R	429;429;372	.	ENSP00000261461:L429R	L	+	2	0	PPP2R5A	210598710	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	7.678000	0.84035	2.315000	0.78130	0.533000	0.62120	CTT	.	.	none		0.343	PPP2R5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089302.1	NM_006243	
RELL1	768211	hgsc.bcm.edu	37	4	37650923	37650923	+	Silent	SNP	G	G	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr4:37650923G>T	ENST00000454158.2	-	2	376	c.288C>A	c.(286-288)atC>atA	p.I96I	RELL1_ENST00000314117.4_Silent_p.I96I	NM_001085400.1	NP_001078869.1	Q8IUW5	RELL1_HUMAN	RELT-like 1	96						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)		p.I96I(1)		endometrium(1)|large_intestine(3)|lung(1)|skin(1)	6						TTTCCTCTTCGATATCTTGCT	0.408																																					p.I96I		Atlas-SNP	.											RELL1,rectum,carcinoma,0,1	RELL1	16	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C288A						scavenged	.						161.0	167.0	165.0					4																	37650923		1895	4114	6009	SO:0001819	synonymous_variant	768211	exon2			CTCTTCGATATCT	AK025431	CCDS43221.1	4p14	2011-10-11				ENSG00000181826			27379	protein-coding gene	gene with protein product		611212				16389068	Standard	NM_001085399		Approved		uc003gsz.2	Q8IUW5		ENST00000454158.2:c.288C>A	4.37:g.37650923G>T		Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	125	3	0.024	NM_001085399	Q8NBK1	Silent	SNP	ENST00000454158.2	37	CCDS43221.1																																																																																			.	.	none		0.408	RELL1-002	KNOWN	alternative_3_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360485.1	NM_001085400	
OR10G4	390264	hgsc.bcm.edu	37	11	123887184	123887184	+	Silent	SNP	T	T	G	rs4936882	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr11:123887184T>G	ENST00000320891.4	+	1	903	c.903T>G	c.(901-903)ctT>ctG	p.L301L		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L301L(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TGTTGAAACTTAGAGACAAAG	0.373													t|||	3314	0.661741	0.5166	0.804	5008	,	,		21245	0.7173		0.7266	False		,,,				2504	0.6329				p.L301L		Atlas-SNP	.											OR10G4,NS,carcinoma,0,1	OR10G4	77	1	1	Substitution - coding silent(1)	stomach(1)	c.T903G						scavenged	.	G		2514,1888	627.3+/-394.9	720,1074,407	66.0	63.0	64.0		903	-6.8	0.0	11	dbSNP_111	64	6560,2038	719.1+/-406.2	2504,1552,243	no	coding-synonymous	OR10G4	NM_001004462.1		3224,2626,650	GG,GT,TT		23.7032,42.8896,30.2		301/312	123887184	9074,3926	2201	4299	6500	SO:0001819	synonymous_variant	390264	exon1			GAAACTTAGAGAC	AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.903T>G	11.37:g.123887184T>G		Somatic	79	1	0.0126582		WXS	Illumina HiSeq	Phase_I	59	2	0.0338983	NM_001004462	Q6IEW0	Silent	SNP	ENST00000320891.4	37	CCDS31702.1																																																																																			T|0.297;G|0.703	0.703	strong		0.373	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462	
MUC4	4585	hgsc.bcm.edu	37	3	195506982	195506982	+	Silent	SNP	G	G	C	rs562381906	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:195506982G>C	ENST00000463781.3	-	2	11928	c.11469C>G	c.(11467-11469)acC>acG	p.T3823T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.T3823T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGGAAGAGGGGTGGTGTCAC	0.592													.|||	152	0.0303514	0.112	0.0029	5008	,	,		9549	0.0		0.002	False		,,,				2504	0.0				p.T3823T		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	0			c.C11469G						scavenged	.						5.0	5.0	5.0					3																	195506982		422	1223	1645	SO:0001819	synonymous_variant	4585	exon2			AAGAGGGGTGGTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11469C>G	3.37:g.195506982G>C		Somatic	40	4	0.1		WXS	Illumina HiSeq	Phase_I	38	4	0.105263	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	none		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CNOT1	23019	hgsc.bcm.edu	37	16	58577327	58577327	+	Intron	SNP	A	A	C	rs556592424		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr16:58577327A>C	ENST00000317147.5	-	31	4767				CNOT1_ENST00000441024.2_Missense_Mutation_p.F1540V|CNOT1_ENST00000245138.4_Intron|CNOT1_ENST00000569240.1_Intron	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		aaaaaaaaaaaacacacagac	0.299													A|||	1	0.000199681	0.0	0.0	5008	,	,		18548	0.0		0.001	False		,,,				2504	0.0				p.F1540V		Atlas-SNP	.											CNOT1_ENST00000441024,caecum,carcinoma,0,1	CNOT1	359	1	0			c.T4618G						scavenged	.						20.0	20.0	20.0					16																	58577327		1013	2122	3135	SO:0001627	intron_variant	23019	exon31			AAAAAAAACACAC	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4434+183T>G	16.37:g.58577327A>C		Somatic	215	2	0.00930233		WXS	Illumina HiSeq	Phase_I	188	8	0.0425532	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	A	4.645	0.119968	0.08881	.	.	ENSG00000125107	ENST00000441024	T	0.44482	0.92	1.6	-3.2	0.05156	.	.	.	.	.	T	0.28499	0.0705	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12400	-1.0549	8	0.87932	D	0	.	5.872	0.18809	0.2548:0.5872:0.158:0.0	.	1540	A5YKK6-4	.	V	1540	ENSP00000413113:F1540V	ENSP00000413113:F1540V	F	-	1	0	CNOT1	57134828	0.004000	0.15560	0.000000	0.03702	0.000000	0.00434	0.507000	0.22675	-2.105000	0.00842	-1.344000	0.01245	TTT	.	.	none		0.299	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
THOC1	9984	hgsc.bcm.edu	37	18	246400	246400	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr18:246400G>T	ENST00000261600.6	-	11	849	c.842C>A	c.(841-843)gCc>gAc	p.A281D	THOC1_ENST00000582313.1_5'UTR	NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1	281					apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				TTTTCTTGAGGCCTGAGTATC	0.264																																					p.A281D		Atlas-SNP	.											THOC1,colon,carcinoma,-1,1	THOC1	43	1	0			c.C842A						scavenged	.						47.0	47.0	47.0					18																	246400		1786	4047	5833	SO:0001583	missense	9984	exon11			CTTGAGGCCTGAG	AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9		ENST00000261600.6:c.842C>A	18.37:g.246400G>T	ENSP00000261600:p.Ala281Asp	Somatic	568	1	0.00176056		WXS	Illumina HiSeq	Phase_I	639	9	0.0140845	NM_005131	B2RBP6|Q15219|Q64I72|Q64I73	Missense_Mutation	SNP	ENST00000261600.6	37	CCDS45820.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.303538	0.81136	.	.	ENSG00000079134	ENST00000261600	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.78407	0.4278	M	0.73962	2.25	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.67382	0.918;0.951	T	0.73007	-0.4118	9	0.23302	T	0.38	-6.4058	20.0784	0.97758	0.0:0.0:1.0:0.0	.	281;281	Q96FV9-2;Q96FV9	.;THOC1_HUMAN	D	281	.	ENSP00000261600:A281D	A	-	2	0	THOC1	236400	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.450000	0.97607	2.736000	0.93811	0.655000	0.94253	GCC	.	.	none		0.264	THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440348.5	NM_005131	
NHSL1	57224	hgsc.bcm.edu	37	6	138751531	138751531	+	Splice_Site	SNP	T	T	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:138751531T>C	ENST00000427025.2	-	5	4591	c.3963A>G	c.(3961-3963)gcA>gcG	p.A1321A	NHSL1_ENST00000343505.5_Splice_Site_p.A1317A	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	1321										breast(2)|endometrium(4)|kidney(1)	7						CAGACTCACCTGCTCCGTCCT	0.587																																					p.A1321A		Atlas-SNP	.											.	NHSL1	99	.	0			c.A3963G						PASS	.						12.0	14.0	13.0					6																	138751531		692	1591	2283	SO:0001630	splice_region_variant	57224	exon5			CTCACCTGCTCCG	AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.3964+1A>G	6.37:g.138751531T>C		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	89	27	0.303371	NM_020464	Q3ZCS5|Q5SYE8|Q9P2J0	Silent	SNP	ENST00000427025.2	37	CCDS55063.1																																																																																			.	.	none		0.587	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043700.2	XM_050421	Silent
FRG1	2483	hgsc.bcm.edu	37	4	190878625	190878625	+	Missense_Mutation	SNP	A	A	G	rs373840195		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr4:190878625A>G	ENST00000226798.4	+	6	727	c.505A>G	c.(505-507)Agt>Ggt	p.S169G	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	169					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.S169G(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AGAAGCAAAAAGTAAAACAGC	0.363																																					p.S169G		Atlas-SNP	.											FRG1,NS,carcinoma,0,3	FRG1	76	3	1	Substitution - Missense(1)	lung(1)	c.A505G						scavenged	.						49.0	46.0	47.0					4																	190878625		2183	4281	6464	SO:0001583	missense	2483	exon6			GCAAAAAGTAAAA	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.505A>G	4.37:g.190878625A>G	ENSP00000226798:p.Ser169Gly	Somatic	641	5	0.00780031		WXS	Illumina HiSeq	Phase_I	607	10	0.0164745	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	21.2	4.112843	0.77210	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.49139	1.86;0.79	4.19	4.19	0.49359	Actin cross-linking (1);	0.160510	0.64402	D	0.000002	T	0.58750	0.2144	M	0.77103	2.36	0.49915	D	0.999832	D	0.55800	0.973	P	0.53102	0.718	T	0.61426	-0.7065	10	0.39692	T	0.17	0.1847	11.5749	0.50856	1.0:0.0:0.0:0.0	.	169	Q14331	FRG1_HUMAN	G	169;41;106	ENSP00000226798:S169G;ENSP00000435943:S106G	ENSP00000226798:S169G	S	+	1	0	FRG1	191115619	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.044000	0.93805	1.677000	0.50941	0.373000	0.22412	AGT	.	.	weak		0.363	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
MUC4	4585	hgsc.bcm.edu	37	3	195509650	195509650	+	Missense_Mutation	SNP	A	A	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:195509650A>G	ENST00000463781.3	-	2	9260	c.8801T>C	c.(8800-8802)cTt>cCt	p.L2934P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L2934P	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAAGGCTGGTGAC	0.577																																					p.L2934P		Atlas-SNP	.											MUC4_ENST00000463781,trunk,malignant_melanoma,-1,2	MUC4	1505	2	0			c.T8801C						scavenged	.						9.0	8.0	8.0					3																	195509650		664	1511	2175	SO:0001583	missense	4585	exon2			GAGGAAAGGCTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8801T>C	3.37:g.195509650A>G	ENSP00000417498:p.Leu2934Pro	Somatic	99	2	0.020202		WXS	Illumina HiSeq	Phase_I	102	3	0.0294118	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.742	-0.775893	0.02951	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35421	1.35;1.31	.	.	.	.	.	.	.	.	T	0.25901	0.0631	N	0.14661	0.345	0.09310	N	0.99999	D	0.57257	0.979	P	0.51487	0.671	T	0.15665	-1.0429	6	.	.	.	.	.	.	.	.	2806	E7ESK3	.	P	2934	ENSP00000417498:L2934P;ENSP00000420243:L2934P	.	L	-	2	0	MUC4	196994429	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.713000	0.05007	-0.000000	0.14550	0.000000	0.15137	CTT	.	.	none		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PRAMEF11	440560	hgsc.bcm.edu	37	1	12888397	12888397	+	Missense_Mutation	SNP	C	C	T	rs202156326	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:12888397C>T	ENST00000535591.1	-	2	322	c.127G>A	c.(127-129)Gat>Aat	p.D43N		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	43					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.D43N(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						TCAAGCCCATCGAGCACAGCT	0.627													.|||	63	0.0125799	0.0454	0.0043	5008	,	,		16628	0.0		0.0	False		,,,				2504	0.0				p.D43N		Atlas-SNP	.											PRAMEF11,NS,other,0,1	PRAMEF11	72	1	1	Substitution - Missense(1)	pancreas(1)	c.G127A						scavenged	.																																			SO:0001583	missense	440560	exon2			GCCCATCGAGCAC	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.127G>A	1.37:g.12888397C>T	ENSP00000439551:p.Asp43Asn	Somatic	283	42	0.14841		WXS	Illumina HiSeq	Phase_I	273	62	0.227106	NM_001146344		Missense_Mutation	SNP	ENST00000535591.1	37	CCDS53268.1	.	.	.	.	.	.	.	.	.	.	.	13.12	2.143414	0.37825	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.05996	3.36;3.36	1.45	1.45	0.22620	.	0.744226	0.12606	N	0.454302	T	0.10766	0.0263	M	0.77712	2.385	0.09310	N	1	D	0.53745	0.962	P	0.44921	0.464	T	0.18366	-1.0339	10	0.87932	D	0	.	6.4008	0.21638	0.0:1.0:0.0:0.0	.	43	O60813	PRA11_HUMAN	N	43;84;43	ENSP00000439551:D43N;ENSP00000391839:D43N	ENSP00000328783:D84N	D	-	1	0	PRAMEF11	12810984	0.004000	0.15560	0.007000	0.13788	0.013000	0.08279	0.287000	0.18920	1.122000	0.41944	0.380000	0.24917	GAT	C|0.250;T|0.750	0.750	weak		0.627	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341	
DNMT3L	29947	hgsc.bcm.edu	37	21	45675970	45675970	+	Missense_Mutation	SNP	A	A	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr21:45675970A>G	ENST00000418993.1	-	7	1067	c.584T>C	c.(583-585)cTt>cCt	p.L195P	DNMT3L_ENST00000270172.3_Missense_Mutation_p.L195P	NM_175867.2	NP_787063.1	Q9UJW3	DNM3L_HUMAN	DNA (cytosine-5-)-methyltransferase 3-like	195					chorionic trophoblast cell differentiation (GO:0060718)|DNA methylation (GO:0006306)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|placenta development (GO:0001890)|positive regulation of catalytic activity (GO:0043085)|regulation of gene expression by genetic imprinting (GO:0006349)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	11				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		GTCTTCAAAAAGGGACAGCAC	0.502																																					p.L195P		Atlas-SNP	.											DNMT3L,NS,carcinoma,-1,1	DNMT3L	33	1	0			c.T584C						scavenged	.						106.0	107.0	107.0					21																	45675970		2203	4300	6503	SO:0001583	missense	29947	exon7			TCAAAAAGGGACA	AF194032	CCDS13705.1	21q22.3	2008-07-31			ENSG00000142182	ENSG00000142182			2980	protein-coding gene	gene with protein product	"""cytosine-5-methyltransferase 3-like protein"", ""human cytosine-5-methyltransferase 3-like protein"""	606588				10857753	Standard	NM_013369		Approved	MGC1090	uc002zeh.2	Q9UJW3	OTTHUMG00000086914	ENST00000418993.1:c.584T>C	21.37:g.45675970A>G	ENSP00000412862:p.Leu195Pro	Somatic	305	0	0		WXS	Illumina HiSeq	Phase_I	276	3	0.0108696	NM_013369	E9PB42|Q9BUJ4	Missense_Mutation	SNP	ENST00000418993.1	37	CCDS46650.1	.	.	.	.	.	.	.	.	.	.	A	10.83	1.462111	0.26248	.	.	ENSG00000142182	ENST00000270172;ENST00000418993;ENST00000431166	T;T;T	0.79554	-1.28;-1.28;-1.28	3.44	3.44	0.39384	.	0.000000	0.64402	D	0.000001	D	0.88651	0.6494	M	0.86268	2.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88955	0.3389	10	0.87932	D	0	-16.8446	8.4862	0.33074	1.0:0.0:0.0:0.0	.	195;195	Q9UJW3-2;Q9UJW3	.;DNM3L_HUMAN	P	195;195;180	ENSP00000270172:L195P;ENSP00000412862:L195P;ENSP00000400242:L180P	ENSP00000270172:L195P	L	-	2	0	DNMT3L	44500398	0.998000	0.40836	0.109000	0.21407	0.005000	0.04900	5.328000	0.65887	1.588000	0.49971	0.379000	0.24179	CTT	.	.	none		0.502	DNMT3L-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000195820.1	NM_013369	
INSR	3643	hgsc.bcm.edu	37	19	7174667	7174667	+	Silent	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:7174667C>T	ENST00000302850.5	-	4	1192	c.1050G>A	c.(1048-1050)tcG>tcA	p.S350S	INSR_ENST00000341500.5_Silent_p.S350S	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	350			S -> L (in RMS and LEPRCH). {ECO:0000269|PubMed:12970295, ECO:0000269|PubMed:8314008}.		activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CAGACGTCACCGAGTCGATGG	0.602																																					p.S350S		Atlas-SNP	.											.	INSR	265	.	0			c.G1050A						PASS	.						109.0	80.0	90.0					19																	7174667		2203	4300	6503	SO:0001819	synonymous_variant	3643	exon4			CGTCACCGAGTCG	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.1050G>A	19.37:g.7174667C>T		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	75	13	0.173333	NM_000208	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Silent	SNP	ENST00000302850.5	37	CCDS12176.1																																																																																			.	.	none		0.602	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1		
TMEM44	93109	hgsc.bcm.edu	37	3	194338424	194338424	+	Missense_Mutation	SNP	G	G	C	rs58679389|rs386669926	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:194338424G>C	ENST00000392432.2	-	6	899	c.694C>G	c.(694-696)Cgt>Ggt	p.R232G	TMEM44_ENST00000273580.7_Intron|TMEM44_ENST00000473092.1_Intron|TMEM44_ENST00000381975.3_Intron|TMEM44_ENST00000347147.4_Intron	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44	232			R -> H (in dbSNP:rs12695036). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		ctgggagaacgTGAGGGAGAC	0.627													G|||	932	0.186102	0.1399	0.2003	5008	,	,		16153	0.3036		0.0666	False		,,,				2504	0.2403				p.R232G		Atlas-SNP	.											.	TMEM44	42	.	0			c.C694G						PASS	.						62.0	71.0	68.0					3																	194338424		692	1591	2283	SO:0001583	missense	93109	exon6			GAGAACGTGAGGG	AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.694C>G	3.37:g.194338424G>C	ENSP00000376227:p.Arg232Gly	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_001166305	A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	Missense_Mutation	SNP	ENST00000392432.2	37	CCDS54699.1	304	0.1391941391941392	64	0.13008130081300814	59	0.16298342541436464	148	0.25874125874125875	33	0.04353562005277045	G	3.222	-0.159324	0.06544	.	.	ENSG00000145014	ENST00000392432	T	0.23552	1.9	2.03	-2.52	0.06346	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.45101	-0.9284	6	0.30078	T	0.28	.	6.5849	0.22614	0.6181:0.0:0.3819:0.0	rs58679389	.	.	.	G	232	ENSP00000376227:R232G	ENSP00000376227:R232G	R	-	1	0	TMEM44	195819713	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-2.396000	0.01052	-0.762000	0.04664	-0.464000	0.05259	CGT	C|0.130;G|0.870	0.130	strong		0.627	TMEM44-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000342750.1	NM_138399	
OR2L2	26246	hgsc.bcm.edu	37	1	248201673	248201673	+	Missense_Mutation	SNP	T	T	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:248201673T>C	ENST00000366479.2	+	1	200	c.104T>C	c.(103-105)cTa>cCa	p.L35P	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	35						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CTCATTTTCCTAATGGCTCTA	0.373																																					p.L35P		Atlas-SNP	.											OR2L2,NS,carcinoma,-1,1	OR2L2	115	1	0			c.T104C						scavenged	.						204.0	197.0	200.0					1																	248201673		2202	4300	6502	SO:0001583	missense	26246	exon1			TTTTCCTAATGGC	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.104T>C	1.37:g.248201673T>C	ENSP00000355435:p.Leu35Pro	Somatic	217	0	0		WXS	Illumina HiSeq	Phase_I	187	2	0.0106952	NM_001004686	Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	37	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	9.276	1.046946	0.19748	.	.	ENSG00000203663	ENST00000366479	T	0.17691	2.26	1.76	1.76	0.24704	.	.	.	.	.	T	0.22704	0.0548	M	0.80616	2.505	0.19300	N	0.99998	B	0.18166	0.026	B	0.20767	0.031	T	0.22695	-1.0209	9	0.66056	D	0.02	.	8.3759	0.32442	0.0:0.0:0.0:1.0	.	35	Q8NH16	OR2L2_HUMAN	P	35	ENSP00000355435:L35P	ENSP00000355435:L35P	L	+	2	0	OR2L2	246268296	0.002000	0.14202	0.154000	0.22540	0.347000	0.29111	1.111000	0.31159	0.842000	0.35045	0.163000	0.16589	CTA	.	.	none		0.373	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686	
SIRPG	55423	hgsc.bcm.edu	37	20	1629906	1629906	+	Silent	SNP	C	C	T	rs6079967	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr20:1629906C>T	ENST00000303415.3	-	2	286	c.222G>A	c.(220-222)cgG>cgA	p.R74R	RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000381580.1_Silent_p.R41R|SIRPG_ENST00000216927.4_Silent_p.R74R|SIRPG_ENST00000344103.4_Silent_p.R74R|SIRPG_ENST00000381583.2_Silent_p.R74R	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	74	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R74R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						AGATTAATTCCCGGCCTGGTC	0.507													t|||	1761	0.351637	0.3064	0.5058	5008	,	,		19787	0.2708		0.4394	False		,,,				2504	0.2965				p.R74R		Atlas-SNP	.											SIRPG,right_upper_lobe,carcinoma,-1,2	SIRPG	61	2	1	Substitution - coding silent(1)	stomach(1)	c.G222A						scavenged	.	T	,,	1457,2949		248,961,994	182.0	165.0	171.0		222,222,222	-0.1	0.0	20	dbSNP_114	171	3939,4661		906,2127,1267	no	coding-synonymous,coding-synonymous,coding-synonymous	SIRPG	NM_001039508.1,NM_018556.3,NM_080816.2	,,	1154,3088,2261	TT,TC,CC		45.8023,33.0685,41.4885	,,	74/277,74/388,74/171	1629906	5396,7610	2203	4300	6503	SO:0001819	synonymous_variant	55423	exon2			TAATTCCCGGCCT	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.222G>A	20.37:g.1629906C>T		Somatic	190	1	0.00526316		WXS	Illumina HiSeq	Phase_I	182	5	0.0274725	NM_001039508	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Silent	SNP	ENST00000303415.3	37	CCDS13020.2																																																																																			C|0.593;T|0.407	0.407	strong		0.507	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556	
CASR	846	hgsc.bcm.edu	37	3	122002948	122002948	+	Missense_Mutation	SNP	G	G	A	rs201670662		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:122002948G>A	ENST00000490131.1	+	7	2519	c.2147G>A	c.(2146-2148)cGc>cAc	p.R716H	CASR_ENST00000498619.1_Missense_Mutation_p.R726H|CASR_ENST00000296154.5_Missense_Mutation_p.R716H|AC068754.1_ENST00000408547.1_RNA	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	716					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	AGCTTCCACCGCAAGTGGTGG	0.567																																					p.R726H		Atlas-SNP	.											.	CASR	190	.	0			c.G2177A						PASS	.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	55.0	51.0	52.0		2147,2177	6.0	1.0	3		52	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CASR	NM_000388.3,NM_001178065.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	716/1079,726/1089	122002948	1,13005	2203	4300	6503	SO:0001583	missense	846	exon7			TCCACCGCAAGTG	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2147G>A	3.37:g.122002948G>A	ENSP00000418685:p.Arg716His	Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	29	7	0.241379	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.668983	0.67814	0.0	1.16E-4	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.87729	-2.29;-2.29;-2.29	6.04	6.04	0.98038	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.93304	0.7866	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.98	D	0.92406	0.5933	10	0.51188	T	0.08	.	19.5674	0.95401	0.0:0.0:1.0:0.0	.	726;716	E7ENE0;P41180	.;CASR_HUMAN	H	716;726;716	ENSP00000418685:R716H;ENSP00000420194:R726H;ENSP00000296154:R716H	ENSP00000296154:R716H	R	+	2	0	CASR	123485638	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.928000	0.87587	2.873000	0.98535	0.561000	0.74099	CGC	.	.	weak		0.567	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
TRPM2	7226	hgsc.bcm.edu	37	21	45825049	45825049	+	Missense_Mutation	SNP	G	G	A	rs144022462		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr21:45825049G>A	ENST00000397928.1	+	17	3008	c.2563G>A	c.(2563-2565)Ggg>Agg	p.G855R	TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000397932.2_Missense_Mutation_p.G855R|TRPM2_ENST00000300482.5_Missense_Mutation_p.G855R|TRPM2_ENST00000300481.9_Missense_Mutation_p.G835R	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	855					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						TGACGAGTGCGGGCTGATGAA	0.537																																					p.G855R		Atlas-SNP	.											.	TRPM2	196	.	0			c.G2563A						PASS	.						200.0	156.0	171.0					21																	45825049		2202	4299	6501	SO:0001583	missense	7226	exon17			GAGTGCGGGCTGA	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2563G>A	21.37:g.45825049G>A	ENSP00000381023:p.Gly855Arg	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	55	12	0.218182	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	g	13.30	2.195886	0.38806	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.62232	0.04;0.04;0.04;0.04	4.55	1.57	0.23409	Ion transport (1);	0.225132	0.36740	N	0.002438	T	0.52901	0.1763	M	0.70903	2.155	0.34092	D	0.660838	P;P;P	0.47106	0.731;0.89;0.604	B;B;B	0.39562	0.235;0.303;0.235	T	0.59182	-0.7502	10	0.33141	T	0.24	-18.79	6.0001	0.19515	0.0754:0.1359:0.6479:0.1408	.	855;641;855	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	R	855;855;835;855	ENSP00000300482:G855R;ENSP00000381023:G855R;ENSP00000300481:G835R;ENSP00000381026:G855R	ENSP00000300481:G835R	G	+	1	0	TRPM2	44649477	1.000000	0.71417	0.005000	0.12908	0.850000	0.48378	4.013000	0.57138	0.096000	0.17463	0.465000	0.42564	GGG	G|1.000;T|0.000	.	alt		0.537	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
BPTF	2186	hgsc.bcm.edu	37	17	65955758	65955758	+	Silent	SNP	T	T	C	rs139709271|rs202116659		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr17:65955758T>C	ENST00000321892.4	+	26	8467	c.8406T>C	c.(8404-8406)gcT>gcC	p.A2802A	BPTF_ENST00000335221.5_Silent_p.A2659A|BPTF_ENST00000424123.3_Silent_p.A2520A|BPTF_ENST00000306378.6_Silent_p.A2676A			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2802	Pro-rich.			AP -> VL (in Ref. 1; BAA89208). {ECO:0000305}.	anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A2676A(1)|p.A2659A(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TGACAccagctcctccagccc	0.582																																					p.A2676A		Atlas-SNP	.											BPTF_ENST00000335221,rectum,carcinoma,0,2	BPTF	415	2	2	Substitution - coding silent(2)	large_intestine(2)	c.T8028C						scavenged	.						40.0	33.0	36.0					17																	65955758		2203	4300	6503	SO:0001819	synonymous_variant	2186	exon24			ACCAGCTCCTCCA	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.8406T>C	17.37:g.65955758T>C		Somatic	92	2	0.0217391		WXS	Illumina HiSeq	Phase_I	108	18	0.166667	NM_182641	Q6NX67|Q7Z7D6|Q9UIG2	Silent	SNP	ENST00000321892.4	37																																																																																				.	.	weak		0.582	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
LRFN5	145581	hgsc.bcm.edu	37	14	42356300	42356300	+	Missense_Mutation	SNP	A	A	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr14:42356300A>C	ENST00000298119.4	+	3	1661	c.472A>C	c.(472-474)Aat>Cat	p.N158H	LRFN5_ENST00000554171.1_Missense_Mutation_p.N158H|LRFN5_ENST00000554120.1_Missense_Mutation_p.N158H	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	158						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GTCCTATAATAATCTAGAAAC	0.398										HNSCC(30;0.082)																											p.N158H		Atlas-SNP	.											LRFN5,NS,carcinoma,0,1	LRFN5	269	1	0			c.A472C						scavenged	.						83.0	72.0	76.0					14																	42356300		2203	4300	6503	SO:0001583	missense	145581	exon3			TATAATAATCTAG	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.472A>C	14.37:g.42356300A>C	ENSP00000298119:p.Asn158His	Somatic	67	1	0.0149254		WXS	Illumina HiSeq	Phase_I	55	15	0.272727	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	A	17.04	3.288566	0.59976	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	D;D;D	0.92249	-3.0;-3.0;-3.0	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000010	D	0.92251	0.7542	N	0.17800	0.525	0.58432	D	0.999995	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.993	D	0.92871	0.6314	10	0.51188	T	0.08	.	13.6661	0.62396	1.0:0.0:0.0:0.0	.	158;158	G3V364;Q96NI6	.;LRFN5_HUMAN	H	158	ENSP00000298119:N158H;ENSP00000451897:N158H;ENSP00000451067:N158H	ENSP00000298119:N158H	N	+	1	0	LRFN5	41426050	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.098000	0.63641	0.528000	0.53228	AAT	.	.	none		0.398	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
FN1	2335	hgsc.bcm.edu	37	2	216257886	216257886	+	Intron	SNP	G	G	T	rs61732520	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr2:216257886G>T	ENST00000359671.1	-	25	4062				FN1_ENST00000336916.4_Intron|FN1_ENST00000346544.3_Intron|FN1_ENST00000421182.1_Intron|FN1_ENST00000345488.5_Intron|FN1_ENST00000357867.4_Intron|FN1_ENST00000446046.1_Intron|FN1_ENST00000356005.4_Intron|FN1_ENST00000354785.4_Silent_p.T1279T|FN1_ENST00000323926.6_Silent_p.T1279T|FN1_ENST00000432072.2_Silent_p.T1279T|FN1_ENST00000443816.1_Intron|FN1_ENST00000357009.2_Intron			P02751	FINC_HUMAN	fibronectin 1						acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	TGCTTGAATCGGTTATATCAA	0.473																																					p.T1279T		Atlas-SNP	.											.	FN1	521	.	0			c.C3837A						PASS	.						79.0	78.0	78.0					2																	216257886		1867	4095	5962	SO:0001627	intron_variant	2335	exon25			TGAATCGGTTATA		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3797-1349C>A	2.37:g.216257886G>T		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	100	4	0.04	NM_212482	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	ENST00000359671.1	37																																																																																				G|0.994;A|0.006	.	alt		0.473	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
LILRB1	10859	hgsc.bcm.edu	37	19	55148031	55148031	+	Silent	SNP	T	T	C	rs41308746	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:55148031T>C	ENST00000396331.1	+	15	2091	c.1734T>C	c.(1732-1734)ccT>ccC	p.P578P	LILRB1_ENST00000427581.2_Silent_p.P629P|LILRB1_ENST00000324602.7_Silent_p.P580P|AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000396321.2_Silent_p.P578P|LILRB1_ENST00000396317.1_Silent_p.P562P|LILRB1_ENST00000418536.2_Silent_p.P562P|LILRB1_ENST00000396332.4_Silent_p.P579P|LILRB1_ENST00000396315.1_Silent_p.P580P|LILRB1_ENST00000434867.2_Silent_p.P578P|LILRB1_ENST00000448689.1_3'UTR|LILRB1_ENST00000396327.3_Silent_p.P579P|LILRB1_ENST00000462628.1_3'UTR	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	578					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CCTCTCCTCCTTCCCCACTGT	0.582										HNSCC(37;0.09)			t|||	554	0.110623	0.1785	0.0893	5008	,	,		16680	0.0139		0.1491	False		,,,				2504	0.0941				p.P580P		Atlas-SNP	.											LILRB1,NS,carcinoma,+2,1	LILRB1	140	1	0			c.T1740C						scavenged	.						111.0	95.0	100.0					19																	55148031		2200	4295	6495	SO:0001819	synonymous_variant	10859	exon14			TCCTCCTTCCCCA	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1734T>C	19.37:g.55148031T>C		Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	188	4	0.0212766	NM_001081637	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Silent	SNP	ENST00000396331.1	37	CCDS42617.1																																																																																			.	.	weak		0.582	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
KRT2	3849	hgsc.bcm.edu	37	12	53045642	53045642	+	Silent	SNP	A	A	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr12:53045642A>G	ENST00000309680.3	-	1	306	c.285T>C	c.(283-285)ggT>ggC	p.G95G		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	95	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		cgcctccaaaaccacctcctc	0.617																																					p.G95G		Atlas-SNP	.											KRT2,rectum,carcinoma,0,1	KRT2	94	1	0			c.T285C						PASS	.						53.0	34.0	40.0					12																	53045642		2198	4298	6496	SO:0001819	synonymous_variant	3849	exon1			TCCAAAACCACCT		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.285T>C	12.37:g.53045642A>G		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	108	29	0.268519	NM_000423	Q4VAQ2	Silent	SNP	ENST00000309680.3	37	CCDS8835.1																																																																																			.	.	none		0.617	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
CCDC74A	90557	hgsc.bcm.edu	37	2	132290242	132290242	+	Missense_Mutation	SNP	G	G	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr2:132290242G>C	ENST00000295171.6	+	5	902	c.764G>C	c.(763-765)gGg>gCg	p.G255A	CCDC74A_ENST00000409856.3_Missense_Mutation_p.G189A|CCDC74A_ENST00000467992.2_3'UTR	NM_001258304.1|NM_001258305.1|NM_138770.2	NP_001245233.1|NP_001245234.1|NP_620125.1	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	255								p.G255A(1)		endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						ATGGGGGCGGGGGCACACCCC	0.597																																					p.G255A		Atlas-SNP	.											CCDC74A,NS,carcinoma,0,1	CCDC74A	44	1	1	Substitution - Missense(1)	endometrium(1)	c.G764C						scavenged	.						109.0	113.0	111.0					2																	132290242		2203	4300	6503	SO:0001583	missense	90557	exon5			GGGCGGGGGCACA		CCDS2167.1, CCDS58732.1, CCDS74578.1	2q21.1	2008-02-05		2006-02-16	ENSG00000163040	ENSG00000163040			25197	protein-coding gene	gene with protein product						12477932	Standard	NM_138770		Approved	FLJ40345	uc002ttb.4	Q96AQ1	OTTHUMG00000131667	ENST00000295171.6:c.764G>C	2.37:g.132290242G>C	ENSP00000295171:p.Gly255Ala	Somatic	268	5	0.0186567		WXS	Illumina HiSeq	Phase_I	256	5	0.0195312	NM_138770	Q6P4I5	Missense_Mutation	SNP	ENST00000295171.6	37	CCDS2167.1	.	.	.	.	.	.	.	.	.	.	.	11.11	1.541194	0.27563	.	.	ENSG00000163040	ENST00000295171;ENST00000409856	T;T	0.32272	1.52;1.46	2.34	1.42	0.22433	.	0.261145	0.19502	U	0.112715	T	0.30978	0.0782	L	0.59436	1.845	0.19300	N	0.999975	P;D	0.57899	0.928;0.981	P;B	0.51487	0.671;0.403	T	0.18681	-1.0329	10	0.13108	T	0.6	.	5.2496	0.15515	0.191:0.0:0.809:0.0	.	189;255	Q96AQ1-2;Q96AQ1	.;CC74A_HUMAN	A	255;189	ENSP00000295171:G255A;ENSP00000387009:G189A	ENSP00000295171:G255A	G	+	2	0	CCDC74A	132006712	0.489000	0.26004	0.005000	0.12908	0.013000	0.08279	1.420000	0.34804	0.092000	0.17331	0.194000	0.17425	GGG	.	.	weak		0.597	CCDC74A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254570.2	NM_138770	
LINS	55180	hgsc.bcm.edu	37	15	101113950	101113950	+	Silent	SNP	A	A	G	rs12592868	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr15:101113950A>G	ENST00000314742.8	-	5	1350	c.1128T>C	c.(1126-1128)agT>agC	p.S376S	LINS_ENST00000561308.1_Silent_p.S376S|LINS_ENST00000559149.1_5'UTR|LINS_ENST00000560133.1_Silent_p.S257S	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	376								p.S376S(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						CATGATCTGGACTAGTGATAA	0.353													A|||	1640	0.327476	0.2973	0.2507	5008	,	,		20927	0.246		0.4513	False		,,,				2504	0.3793				p.S376S		Atlas-SNP	.											LINS,NS,carcinoma,0,1	LINS	62	1	1	Substitution - coding silent(1)	stomach(1)	c.T1128C						scavenged	.	A		1415,2991	461.3+/-352.9	206,1003,994	94.0	88.0	90.0		1128	-0.9	0.8	15	dbSNP_120	90	4040,4560	556.5+/-386.9	961,2118,1221	no	coding-synonymous	LINS	NM_001040616.2		1167,3121,2215	GG,GA,AA		46.9767,32.1153,41.9422		376/758	101113950	5455,7551	2203	4300	6503	SO:0001819	synonymous_variant	55180	exon5			ATCTGGACTAGTG	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.1128T>C	15.37:g.101113950A>G		Somatic	181	1	0.00552486		WXS	Illumina HiSeq	Phase_I	143	3	0.020979	NM_001040616	Q96FW2|Q9NVQ3	Silent	SNP	ENST00000314742.8	37	CCDS10385.1																																																																																			A|0.609;G|0.391	0.391	strong		0.353	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1	NM_018148	
HIST1H2BK	85236	hgsc.bcm.edu	37	6	27114569	27114569	+	Silent	SNP	T	T	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:27114569T>C	ENST00000356950.1	-	1	8	c.9A>G	c.(7-9)gaA>gaG	p.E3E	HIST1H2BK_ENST00000396891.4_Silent_p.E3E|HIST1H2AH_ENST00000377459.1_5'Flank|MIR3143_ENST00000584253.1_RNA			O60814	H2B1K_HUMAN	histone cluster 1, H2bk	3					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						ACTTCGCTGGTTCCGGCATGT	0.562																																					p.E3E		Atlas-SNP	.											HIST1H2BK_ENST00000396891,NS,carcinoma,-2,2	HIST1H2BK	68	2	0			c.A9G						scavenged	.						51.0	51.0	51.0					6																	27114569		2203	4300	6503	SO:0001819	synonymous_variant	85236	exon1			CGCTGGTTCCGGC	AJ223352	CCDS4621.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000197903	ENSG00000197903		"""Histones / Replication-dependent"""	13954	protein-coding gene	gene with protein product		615045	"""H2B histone family, member T"", ""histone 1, H2bk"""	H2BFT		12408966	Standard	NM_080593		Approved	H2BFAiii	uc003nix.2	O60814	OTTHUMG00000014473	ENST00000356950.1:c.9A>G	6.37:g.27114569T>C		Somatic	111	4	0.036036		WXS	Illumina HiSeq	Phase_I	113	6	0.0530973	NM_080593	A8K7P7|Q2VPI7	Silent	SNP	ENST00000356950.1	37	CCDS4621.1																																																																																			.	.	none		0.562	HIST1H2BK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040141.1	NM_080593	
FCGR3A	2214	hgsc.bcm.edu	37	1	161518286	161518286	+	Missense_Mutation	SNP	C	C	T	rs200727785		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:161518286C>T	ENST00000436743.1	-	4	398	c.244G>A	c.(244-246)Gac>Aac	p.D82N	FCGR3A_ENST00000367969.3_Missense_Mutation_p.D118N|FCGR3A_ENST00000443193.1_Missense_Mutation_p.D117N|RP11-25K21.6_ENST00000537821.2_RNA|FCGR3A_ENST00000540048.1_Missense_Mutation_p.D82N|FCGR3A_ENST00000476031.1_5'UTR	NM_001127593.1|NM_001127595.1|NM_001127596.1	NP_001121065.1|NP_001121067.1|NP_001121068.1	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)	82	Ig-like C2-type 1.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCACTGTCGTCGACTGTGGCA	0.547																																					p.D118N		Atlas-SNP	.											FCGR3A,colon,carcinoma,+2,1	FCGR3A	38	1	0			c.G352A						scavenged	.						282.0	257.0	266.0					1																	161518286		2203	4300	6503	SO:0001583	missense	2214	exon3			TGTCGTCGACTGT	BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000436743.1:c.244G>A	1.37:g.161518286C>T	ENSP00000416607:p.Asp82Asn	Somatic	369	18	0.0487805		WXS	Illumina HiSeq	Phase_I	356	19	0.0533708	NM_000569	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	ENST00000436743.1	37	CCDS44266.1	.	.	.	.	.	.	.	.	.	.	T	0.254	-1.004529	0.02112	.	.	ENSG00000203747	ENST00000367969;ENST00000443193;ENST00000436743;ENST00000367967;ENST00000540048;ENST00000442336	T;T;T;T;T;T	0.12255	2.7;2.7;2.7;2.7;2.7;2.7	4.42	-8.84	0.00803	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.472120	0.04313	N	0.349334	T	0.01061	0.0035	N	0.11756	0.17	0.09310	A	2.22055e-13	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30937	-0.9961	9	0.02654	T	1	.	6.7583	0.23526	0.0842:0.2147:0.084:0.6171	.	82;117	P08637;E9PG94	FCG3A_HUMAN;.	N	118;117;82;82;82;81	ENSP00000356946:D118N;ENSP00000392047:D117N;ENSP00000416607:D82N;ENSP00000356944:D82N;ENSP00000444971:D82N;ENSP00000396567:D81N	ENSP00000356944:D82N	D	-	1	0	FCGR3A	159784910	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.472000	0.00459	-3.122000	0.00238	-3.646000	0.00026	GAC	C|0.667;T|0.333	0.333	strong		0.547	FCGR3A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102169.2	NM_000569	
CBWD3	445571	hgsc.bcm.edu	37	9	70871836	70871836	+	Splice_Site	SNP	C	C	G	rs376362566		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr9:70871836C>G	ENST00000360171.6	+	5	981		c.e5-1		CBWD3_ENST00000377342.5_Intron	NM_201453.2	NP_958861.2	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3								ATP binding (GO:0005524)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		TATATTTTCACGTGCAGTGGC	0.289																																					.		Atlas-SNP	.											CBWD3,rectum,carcinoma,-1,1	CBWD3	10	1	0			c.431-1C>G						scavenged	.						25.0	31.0	29.0					9																	70871836		2190	4250	6440	SO:0001630	splice_region_variant	445571	exon5			TTTTCACGTGCAG	BC069006	CCDS35038.1, CCDS35038.2	9q13	2014-05-06			ENSG00000196873	ENSG00000196873			18519	protein-coding gene	gene with protein product		611080				15233989, 12421752	Standard	XM_005277637		Approved	bA561O23.1	uc004aga.4	Q5JTY5	OTTHUMG00000184383	ENST00000360171.6:c.431-1C>G	9.37:g.70871836C>G		Somatic	784	9	0.0114796		WXS	Illumina HiSeq	Phase_I	723	14	0.0193638	NM_201453	B4DNG9|Q6VB91	Splice_Site	SNP	ENST00000360171.6	37	CCDS35038.1	.	.	.	.	.	.	.	.	.	.	c	14.78	2.637800	0.47049	.	.	ENSG00000196873	ENST00000360171;ENST00000447896;ENST00000455061;ENST00000455820;ENST00000377344	.	.	.	3.38	3.38	0.38709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.714	0.51641	0.0:0.1812:0.8188:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CBWD3	70061656	1.000000	0.71417	0.991000	0.47740	0.802000	0.45316	7.061000	0.76699	0.543000	0.28864	-0.676000	0.03789	.	C|0.500;G|0.500	0.500	weak		0.289	CBWD3-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052526.1	NM_201453	Intron
HS6ST1	9394	hgsc.bcm.edu	37	2	129075797	129075797	+	Missense_Mutation	SNP	A	A	C	rs199993343		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr2:129075797A>C	ENST00000259241.6	-	1	354	c.341T>G	c.(340-342)gTg>gGg	p.V114G	HS6ST1_ENST00000494089.1_5'UTR	NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	114					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)	p.V114G(1)		endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		GTCGCACGGCACCTCGAGGCG	0.662																																					p.V114G		Atlas-SNP	.											HS6ST1,NS,carcinoma,0,1	HS6ST1	31	1	1	Substitution - Missense(1)	liver(1)	c.T341G						scavenged	.						2.0	4.0	3.0					2																	129075797		1196	3527	4723	SO:0001583	missense	9394	exon1			CACGGCACCTCGA	AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.341T>G	2.37:g.129075797A>C	ENSP00000259241:p.Val114Gly	Somatic	82	16	0.195122		WXS	Illumina HiSeq	Phase_I	62	16	0.258065	NM_004807	B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	ENST00000259241.6	37	CCDS42748.1	.	.	.	.	.	.	.	.	.	.	a	15.67	2.902312	0.52227	.	.	ENSG00000136720	ENST00000259241	D	0.82526	-1.62	3.69	3.69	0.42338	.	0.000000	0.85682	U	0.000000	T	0.77452	0.4132	N	0.22421	0.69	0.80722	D	1	D	0.53462	0.96	P	0.51777	0.679	T	0.74592	-0.3614	9	.	.	.	.	10.2637	0.43443	1.0:0.0:0.0:0.0	.	114	O60243	H6ST1_HUMAN	G	114	ENSP00000259241:V114G	.	V	-	2	0	HS6ST1	128792267	0.855000	0.29742	1.000000	0.80357	0.942000	0.58702	0.276000	0.18716	1.308000	0.44962	0.260000	0.18958	GTG	A|0.862;C|0.138	0.138	strong		0.662	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331572.1	NM_004807	
POTEF	728378	hgsc.bcm.edu	37	2	130872871	130872871	+	Silent	SNP	C	C	T	rs199770435		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr2:130872871C>T	ENST00000409914.2	-	4	951	c.552G>A	c.(550-552)ggG>ggA	p.G184G	POTEF_ENST00000357462.5_Silent_p.G184G|POTEF_ENST00000360967.5_Silent_p.G184G|POTEF_ENST00000361163.4_Silent_p.G184G	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	184					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.G184G(2)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CTTCTGAATTCCCATTGGCAG	0.423																																					p.G184G		Atlas-SNP	.											POTEF,NS,carcinoma,0,5	POTEF	140	5	2	Substitution - coding silent(2)	prostate(2)	c.G552A						scavenged	.						45.0	53.0	50.0					2																	130872871		2105	4041	6146	SO:0001819	synonymous_variant	728378	exon4			TGAATTCCCATTG	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.552G>A	2.37:g.130872871C>T		Somatic	670	14	0.0208955		WXS	Illumina HiSeq	Phase_I	630	17	0.0269841	NM_001099771	A6NC34	Silent	SNP	ENST00000409914.2	37	CCDS46409.1																																																																																			C|0.998;T|0.002	0.002	weak		0.423	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771	
TTN	7273	hgsc.bcm.edu	37	2	179605902	179605902	+	Missense_Mutation	SNP	A	A	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr2:179605902A>T	ENST00000591111.1	-	46	11331	c.11107T>A	c.(11107-11109)Tcc>Acc	p.S3703T	TTN_ENST00000589042.1_Missense_Mutation_p.S4020T|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.S3657T|TTN_ENST00000342175.6_Missense_Mutation_p.S3849T|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S3782T			Q8WZ42	TITIN_HUMAN	titin	14005	Ig-like 22.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCACAGGTGGACTCACCCAAC	0.488																																					p.S4020T		Atlas-SNP	.											.	TTN	18412	.	0			c.T12058A						PASS	.						79.0	80.0	80.0					2																	179605902		1920	4138	6058	SO:0001583	missense	7273	exon48			AGGTGGACTCACC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.11107T>A	2.37:g.179605902A>T	ENSP00000465570:p.Ser3703Thr	Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	29	11	0.37931	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	9.788	1.177085	0.21787	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.67345	-0.26;-0.26;-0.26	5.87	2.01	0.26516	.	.	.	.	.	T	0.51635	0.1686	N	0.21373	0.66	0.20638	N	0.99987	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.002;0.002;0.003	T	0.46247	-0.9205	9	0.87932	D	0	.	10.1952	0.43049	0.3712:0.524:0.0:0.1048	.	3657;3782;3849	D3DPF9;E7EQE6;E7ET18	.;.;.	T	3657;3849;3782;3657	ENSP00000434586:S3657T;ENSP00000340554:S3849T;ENSP00000352154:S3782T	ENSP00000340554:S3849T	S	-	1	0	TTN	179314147	1.000000	0.71417	0.717000	0.30585	0.415000	0.31203	1.705000	0.37867	0.157000	0.19338	-0.313000	0.08912	TCC	.	.	none		0.488	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UPF3A	65110	hgsc.bcm.edu	37	13	115047496	115047496	+	Splice_Site	SNP	G	G	C	rs76186578		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr13:115047496G>C	ENST00000375299.3	+	2	264	c.208G>C	c.(208-210)Gtg>Ctg	p.V70L	UPF3A_ENST00000351487.5_Splice_Site_p.V70L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	70	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.V70L(4)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		CTCCCCGCAGGTGGTCATCCG	0.731																																					p.V70L		Atlas-SNP	.											UPF3A,extremity,malignant_melanoma,0,3	UPF3A	47	3	4	Substitution - Missense(4)	skin(2)|upper_aerodigestive_tract(1)|lung(1)	c.G208C						scavenged	.						3.0	3.0	3.0					13																	115047496		1806	3727	5533	SO:0001630	splice_region_variant	65110	exon2			CCGCAGGTGGTCA	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.208-1G>C	13.37:g.115047496G>C		Somatic	18	2	0.111111		WXS	Illumina HiSeq	Phase_I	19	3	0.157895	NM_080687	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Missense_Mutation	SNP	ENST00000375299.3	37	CCDS9543.1	.	.	.	.	.	.	.	.	.	.	g	24.7	4.562889	0.86335	.	.	ENSG00000169062	ENST00000375299;ENST00000351487	T;T	0.69806	-0.43;-0.43	4.77	4.77	0.60923	Regulator of nonsense-mediated decay, UPF3 (1);Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.79167	0.4400	L	0.58354	1.805	0.80722	D	1	D;D;D	0.89917	0.988;1.0;0.997	D;D;D	0.80764	0.951;0.994;0.991	T	0.78492	-0.2183	9	.	.	.	-20.8011	18.2246	0.89913	0.0:0.0:1.0:0.0	.	70;70;70	B4DGE0;Q9H1J1-2;Q9H1J1	.;.;REN3A_HUMAN	L	70	ENSP00000364448:V70L;ENSP00000329592:V70L	.	V	+	1	0	UPF3A	114065598	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	6.880000	0.75578	2.371000	0.80710	0.473000	0.43528	GTG	.	.	weak		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		Missense_Mutation
OR2L3	391192	hgsc.bcm.edu	37	1	248224739	248224739	+	Silent	SNP	A	A	G	rs113420317	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:248224739A>G	ENST00000359959.3	+	1	756	c.756A>G	c.(754-756)gcA>gcG	p.A252A	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	252						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TCTACTATGCACCTTTTGTCT	0.498													a|||	40	0.00798722	0.0287	0.0029	5008	,	,		20949	0.0		0.0	False		,,,				2504	0.0				p.A252A		Atlas-SNP	.											OR2L3,NS,carcinoma,0,2	OR2L3	97	2	0			c.A756G						scavenged	.	A	,	90,4316	73.1+/-111.1	2,86,2115	131.0	124.0	126.0		756,	-4.0	0.0	1	dbSNP_132	126	20,8576	3.0+/-9.4	0,20,4278	no	coding-synonymous,intron	OR2L13,OR2L3	NM_001004687.1,NM_175911.2	,	2,106,6393	GG,GA,AA		0.2327,2.0427,0.846	,	252/313,	248224739	110,12892	2203	4298	6501	SO:0001819	synonymous_variant	391192	exon1			CTATGCACCTTTT	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.756A>G	1.37:g.248224739A>G		Somatic	115	1	0.00869565		WXS	Illumina HiSeq	Phase_I	60	4	0.0666667	NM_001004687	B9EH44	Silent	SNP	ENST00000359959.3	37	CCDS31104.1																																																																																			.	.	weak		0.498	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
OR51B2	79345	hgsc.bcm.edu	37	11	5345486	5345486	+	Silent	SNP	G	G	A	rs4910750	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr11:5345486G>A	ENST00000328813.2	-	1	96	c.42C>T	c.(40-42)ggC>ggT	p.G14G	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron	NM_033180.4	NP_149420.4	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B, member 2	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|biliary_tract(1)|central_nervous_system(1)|large_intestine(6)|lung(21)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCCCTGGAAAGCCAGTCAGCA	0.493											OREG0003719	type=REGULATORY REGION|Gene=OR51B2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	A|||	3784	0.755591	0.7844	0.7651	5008	,	,		19902	0.5397		0.9085	False		,,,				2504	0.7751				p.G14G		Atlas-SNP	.											OR51B2,NS,carcinoma,-2,1	OR51B2	69	1	0			c.C42T						scavenged	.	A		3560,842	328.3+/-300.5	1437,686,78	49.0	47.0	48.0		42	-8.8	0.3	11	dbSNP_111	48	7846,748	174.5+/-224.7	3580,686,31	no	coding-synonymous	OR51B2	NM_033180.4		5017,1372,109	AA,AG,GG		8.7037,19.1277,12.2345		14/313	5345486	11406,1590	2201	4297	6498	SO:0001819	synonymous_variant	79345	exon1			TGGAAAGCCAGTC	AF399503	CCDS31377.1	11p15.4	2012-08-09			ENSG00000184881	ENSG00000184881		"""GPCR / Class A : Olfactory receptors"""	14703	protein-coding gene	gene with protein product				OR51B1P			Standard	NM_033180		Approved		uc001mao.1	Q9Y5P1	OTTHUMG00000066682	ENST00000328813.2:c.42C>T	11.37:g.5345486G>A		Somatic	274	1	0.00364964	625	WXS	Illumina HiSeq	Phase_I	264	4	0.0151515	NM_033180	Q96RD4	Silent	SNP	ENST00000328813.2	37	CCDS31377.1																																																																																			G|0.181;A|0.819	0.819	strong		0.493	OR51B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142983.1	NM_033180	
UBC	7316	hgsc.bcm.edu	37	12	125397358	125397358	+	Silent	SNP	T	T	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr12:125397358T>C	ENST00000536769.1	-	1	2536	c.960A>G	c.(958-960)gaA>gaG	p.E320E	UBC_ENST00000546120.1_Silent_p.E244E|UBC_ENST00000339647.5_Silent_p.E320E|UBC_ENST00000538617.1_Intron|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000536661.1_5'Flank			P0CG48	UBC_HUMAN	ubiquitin C	320	Ubiquitin-like 5. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)	p.E320E(1)		breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		TCGGCTCCACTTCGAGAGTGA	0.522																																					p.E320E		Atlas-SNP	.											UBC,NS,carcinoma,0,2	UBC	79	2	1	Substitution - coding silent(1)	prostate(1)	c.A960G						scavenged	.						92.0	81.0	85.0					12																	125397358		2202	4282	6484	SO:0001819	synonymous_variant	7316	exon2			CTCCACTTCGAGA		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000536769.1:c.960A>G	12.37:g.125397358T>C		Somatic	245	3	0.0122449		WXS	Illumina HiSeq	Phase_I	234	7	0.0299145	NM_021009	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	ENST00000536769.1	37	CCDS9260.1																																																																																			.	.	none		0.522	UBC-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400177.1	NM_021009	
LRCOL1	100507055	hgsc.bcm.edu	37	12	133181399	133181399	+	lincRNA	SNP	T	T	C	rs11146963	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr12:133181399T>C	ENST00000545517.1	-	0	323							A6NCL2	LRCL1_HUMAN	leucine rich colipase-like 1						digestion (GO:0007586)|lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	enzyme activator activity (GO:0008047)										TCGTGTCTCCTGCATGGCTCC	0.622													C|||	3614	0.721645	0.885	0.7594	5008	,	,		19537	0.7808		0.5497	False		,,,				2504	0.59				p.R42G		Atlas-SNP	.											.	.	.	.	0			c.A124G						PASS	.																																					100507055	exon3			GTCTCCTGCATGG		CCDS73547.1	12q24.33	2012-07-02			ENSG00000204583	ENSG00000204583			44160	protein-coding gene	gene with protein product							Standard	NM_001195520		Approved		uc021rgr.1	A6NCL2	OTTHUMG00000168043		12.37:g.133181399T>C		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_001195520	H9BFB1	Missense_Mutation	SNP	ENST00000545517.1	37																																																																																				T|0.274;C|0.726	0.726	strong		0.622	LRCOL1-003	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000397683.1	NM_001195520	
ZIC4	84107	hgsc.bcm.edu	37	3	147108785	147108785	+	Missense_Mutation	SNP	A	A	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:147108785A>G	ENST00000383075.3	-	4	1449	c.937T>C	c.(937-939)Tgc>Cgc	p.C313R	ZIC4_ENST00000484399.1_Missense_Mutation_p.C313R|ZIC4_ENST00000525172.2_Missense_Mutation_p.C363R|ZIC4_ENST00000425731.3_Missense_Mutation_p.C351R|ZIC4_ENST00000491672.1_Missense_Mutation_p.C107R|ZIC4_ENST00000472749.2_5'UTR|ZIC4_ENST00000473123.1_Missense_Mutation_p.C313R	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	313						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						TTGTGGCCGCAGTCCGACGAG	0.692																																					p.C363R		Atlas-SNP	.											ZIC4,brain,primitive_neuroectodermal_tumour-medulloblastoma,+2,1	ZIC4	174	1	0			c.T1087C						scavenged	.						23.0	29.0	27.0					3																	147108785		2112	4250	6362	SO:0001583	missense	84107	exon4			GGCCGCAGTCCGA	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.937T>C	3.37:g.147108785A>G	ENSP00000372553:p.Cys313Arg	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	52	2	0.0384615	NM_001168378	A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	ENST00000383075.3	37	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	A	8.390	0.839548	0.16891	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000491672	T;T;T;T;T;T	0.10573	2.94;2.88;2.86;2.94;2.94;2.92	5.05	1.26	0.21427	.	0.979536	0.08337	N	0.961371	T	0.06600	0.0169	N	0.22421	0.69	0.23483	N	0.997583	B;B	0.16166	0.016;0.003	B;B	0.15484	0.013;0.008	T	0.44787	-0.9305	9	0.15952	T	0.53	.	4.9773	0.14148	0.707:0.0:0.1528:0.1402	.	363;313	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	R	313;351;363;313;313;107	ENSP00000372553:C313R;ENSP00000397695:C351R;ENSP00000435509:C363R;ENSP00000417855:C313R;ENSP00000420775:C313R;ENSP00000418277:C107R	ENSP00000372553:C313R	C	-	1	0	ZIC4	148591475	0.999000	0.42202	0.997000	0.53966	0.460000	0.32559	1.311000	0.33562	0.231000	0.21079	0.379000	0.24179	TGC	.	.	none		0.692	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1		
RNF123	63891	hgsc.bcm.edu	37	3	49724172	49724172	+	5'Flank	SNP	C	C	T	rs41291698		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:49724172C>T	ENST00000327697.6	+	0	0				MST1_ENST00000449682.2_Nonsense_Mutation_p.W264*|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000383728.3_Nonsense_Mutation_p.W189*|MST1_ENST00000494828.2_5'Flank|RNF123_ENST00000432042.1_5'Flank|MST1_ENST00000545762.1_3'UTR	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.W250*(1)		NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		TAGTGTAGCACCATGGCCGCT	0.642																																					p.W264X		Atlas-SNP	.											MST1,NS,carcinoma,0,1	MST1	84	1	1	Substitution - Nonsense(1)	endometrium(1)	c.G792A						scavenged	.						6.0	7.0	7.0					3																	49724172		2129	4208	6337	SO:0001631	upstream_gene_variant	4485	exon7			GTAGCACCATGGC	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49724172C>T	Exception_encountered	Somatic	270	12	0.0444444		WXS	Illumina HiSeq	Phase_I	249	27	0.108434	NM_020998	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Nonsense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	C	39	7.839035	0.98519	.	.	ENSG00000173531	ENST00000449682;ENST00000383728	.	.	.	5.75	5.75	0.90469	.	0.265808	0.20896	N	0.083726	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.9522	0.97203	0.0:1.0:0.0:0.0	rs41291698	.	.	.	X	264;189	.	ENSP00000373234:W189X	W	-	3	0	MST1	49699176	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.550000	0.82173	2.725000	0.93324	0.655000	0.94253	TGG	C|0.500;T|0.500	0.500	strong		0.642	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
PLD1	5337	hgsc.bcm.edu	37	3	171455820	171455820	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:171455820G>A	ENST00000351298.4	-	2	148	c.22C>T	c.(22-24)Cgg>Tgg	p.R8W	PLD1_ENST00000356327.5_Missense_Mutation_p.R8W|PLD1_ENST00000340989.4_Missense_Mutation_p.R8W|PLD1_ENST00000342215.6_Missense_Mutation_p.R8W	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	8					chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)	p.R8W(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	GTATTTACCCGTGGCTCGTTT	0.418																																					p.R8W	NSCLC(149;2174 3517 34058)	Atlas-SNP	.											PLD1,NS,carcinoma,0,2	PLD1	134	2	1	Substitution - Missense(1)	endometrium(1)	c.C22T						scavenged	.						80.0	75.0	77.0					3																	171455820		2203	4300	6503	SO:0001583	missense	5337	exon2			TTACCCGTGGCTC	U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.22C>T	3.37:g.171455820G>A	ENSP00000342793:p.Arg8Trp	Somatic	130	1	0.00769231		WXS	Illumina HiSeq	Phase_I	172	27	0.156977	NM_002662		Missense_Mutation	SNP	ENST00000351298.4	37	CCDS3216.1	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772291	0.31411	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000342215;ENST00000340989;ENST00000418087	T;T;T;T;T	0.46063	3.34;3.35;1.44;3.21;0.88	5.51	-5.02	0.02982	.	0.379407	0.22897	N	0.054316	T	0.29126	0.0724	L	0.29908	0.895	0.09310	N	1	D;D	0.69078	0.997;0.994	B;B	0.43783	0.409;0.431	T	0.48234	-0.9053	10	0.72032	D	0.01	-6.2871	14.8852	0.70564	0.0768:0.0:0.6076:0.3156	.	31;8	Q59EA4;Q13393	.;PLD1_HUMAN	W	8	ENSP00000348681:R8W;ENSP00000342793:R8W;ENSP00000339936:R8W;ENSP00000340326:R8W;ENSP00000400639:R8W	ENSP00000340326:R8W	R	-	1	2	PLD1	172938514	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.421000	0.07053	-0.550000	0.06183	-0.262000	0.10625	CGG	.	.	none		0.418	PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662	
MAGEF1	64110	hgsc.bcm.edu	37	3	184429559	184429559	+	Silent	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:184429559C>T	ENST00000317897.3	-	1	277	c.51G>A	c.(49-51)ggG>ggA	p.G17G		NM_022149.4	NP_071432.2	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1	17						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			CATCCTTCTCCCCCTCGGCCT	0.721																																					p.G17G		Atlas-SNP	.											.	MAGEF1	27	.	0			c.G51A						PASS	.						8.0	10.0	9.0					3																	184429559		2097	4121	6218	SO:0001819	synonymous_variant	64110	exon1			CTTCTCCCCCTCG	AF295378	CCDS3269.1	3q13	2008-02-05			ENSG00000177383	ENSG00000177383			29639	protein-coding gene	gene with protein product		609267				11313144	Standard	NM_022149		Approved		uc003fpa.3	Q9HAY2	OTTHUMG00000156712	ENST00000317897.3:c.51G>A	3.37:g.184429559C>T		Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	111	17	0.153153	NM_022149	Q9H215	Silent	SNP	ENST00000317897.3	37	CCDS3269.1																																																																																			.	.	none		0.721	MAGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345417.1	NM_022149	
MUC4	4585	hgsc.bcm.edu	37	3	195505851	195505851	+	Silent	SNP	T	T	C	rs200522168		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:195505851T>C	ENST00000463781.3	-	2	13059	c.12600A>G	c.(12598-12600)tcA>tcG	p.S4200S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.S4200S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGTGGATGCTGAGGAAGTGT	0.592																																					p.S4200S		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	0			c.A12600G						scavenged	.						18.0	14.0	15.0					3																	195505851		689	1574	2263	SO:0001819	synonymous_variant	4585	exon2			GGATGCTGAGGAA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12600A>G	3.37:g.195505851T>C		Somatic	55	9	0.163636		WXS	Illumina HiSeq	Phase_I	59	10	0.169492	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	weak		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CRYGN	155051	hgsc.bcm.edu	37	7	151135158	151135158	+	Missense_Mutation	SNP	T	T	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr7:151135158T>G	ENST00000337323.2	-	2	320	c.194A>C	c.(193-195)gAg>gCg	p.E65A	CRYGN_ENST00000491928.1_Missense_Mutation_p.E65A|RP4-555L14.4_ENST00000465549.1_RNA|CRYGN_ENST00000476631.1_5'UTR	NM_144727.1	NP_653328.1	Q8WXF5	CRGN_HUMAN	crystallin, gamma N	65	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.									central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(1)|lung(4)	8			OV - Ovarian serous cystadenocarcinoma(82;0.00358)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTCGCCGTGCTCCAAGATGAA	0.617																																					p.E65A		Atlas-SNP	.											.	CRYGN	15	.	0			c.A194C						PASS	.						62.0	61.0	61.0					7																	151135158		2203	4300	6503	SO:0001583	missense	155051	exon2			CCGTGCTCCAAGA	AF445455	CCDS5926.1	7q36.1	2003-02-25			ENSG00000127377	ENSG00000127377			20458	protein-coding gene	gene with protein product		609603					Standard	NM_144727		Approved		uc003wke.3	Q8WXF5	OTTHUMG00000157353	ENST00000337323.2:c.194A>C	7.37:g.151135158T>G	ENSP00000338613:p.Glu65Ala	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	58	11	0.189655	NM_144727	Q496G6	Missense_Mutation	SNP	ENST00000337323.2	37	CCDS5926.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.655167	0.88056	.	.	ENSG00000127377	ENST00000337323	T	0.78364	-1.17	5.05	5.05	0.67936	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.000000	0.85682	D	0.000000	D	0.90810	0.7114	H	0.94345	3.525	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	D	0.92787	0.6245	10	0.56958	D	0.05	.	13.9762	0.64275	0.0:0.0:0.0:1.0	.	65;65	Q8WXF5-2;Q8WXF5	.;CRGN_HUMAN	A	65	ENSP00000338613:E65A	ENSP00000338613:E65A	E	-	2	0	CRYGN	150766091	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.602000	0.82796	1.894000	0.54839	0.379000	0.24179	GAG	.	.	none		0.617	CRYGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348553.1		
SVEP1	79987	hgsc.bcm.edu	37	9	113208155	113208155	+	Missense_Mutation	SNP	G	G	T	rs140985683	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr9:113208155G>T	ENST00000401783.2	-	26	4761	c.4425C>A	c.(4423-4425)aaC>aaA	p.N1475K	SVEP1_ENST00000302728.8_Missense_Mutation_p.N1475K|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.N1452K	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	1475	Pentaxin.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.N1475N(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TGTCGCTGCCGTTATCAACTG	0.453																																					p.N1475K		Atlas-SNP	.											SVEP1,NS,carcinoma,0,1	SVEP1	326	1	1	Substitution - coding silent(1)	stomach(1)	c.C4425A						scavenged	.						170.0	164.0	166.0					9																	113208155		1956	4159	6115	SO:0001583	missense	79987	exon26			GCTGCCGTTATCA	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.4425C>A	9.37:g.113208155G>T	ENSP00000384917:p.Asn1475Lys	Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	93	2	0.0215054	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	A	6.962	0.547428	0.13312	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728	T;T;T	0.73152	3.43;3.43;-0.72	5.5	1.71	0.24356	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.219729	0.39210	N	0.001427	T	0.61502	0.2352	L	0.58810	1.83	0.25789	N	0.984648	B;B	0.14438	0.01;0.004	B;B	0.15052	0.012;0.012	T	0.53236	-0.8467	10	0.48119	T	0.1	.	6.5316	0.22330	0.5546:0.122:0.3234:0.0	.	1475;1475	E9PBN8;Q4LDE5	.;SVEP1_HUMAN	K	1475;1452;1475	ENSP00000384917:N1475K;ENSP00000363593:N1452K;ENSP00000304118:N1475K	ENSP00000304118:N1475K	N	-	3	2	SVEP1	112247976	0.952000	0.32445	0.834000	0.33040	0.037000	0.13140	0.081000	0.14823	-0.126000	0.11682	-1.061000	0.02294	AAC	G|0.999;A|0.001	.	alt		0.453	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
TPTE2	93492	hgsc.bcm.edu	37	13	20056679	20056679	+	Missense_Mutation	SNP	T	T	G	rs200244531		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr13:20056679T>G	ENST00000400230.2	-	4	172	c.128A>C	c.(127-129)gAa>gCa	p.E43A	TPTE2_ENST00000382975.4_Missense_Mutation_p.E43A|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000382977.4_Missense_Mutation_p.E43A|TPTE2_ENST00000382978.1_Missense_Mutation_p.E43A|TPTE2_ENST00000457266.2_Missense_Mutation_p.E43A|TPTE2_ENST00000400103.2_Missense_Mutation_p.E43A			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	43					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.E43A(1)		NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		GGAAAGTCGTTCTAACATACT	0.313																																					p.E43A		Atlas-SNP	.											TPTE2_ENST00000400230,NS,carcinoma,0,1	TPTE2	225	1	1	Substitution - Missense(1)	kidney(1)	c.A128C						scavenged	.						52.0	51.0	51.0					13																	20056679		2201	4299	6500	SO:0001583	missense	93492	exon5			AGTCGTTCTAACA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.128A>C	13.37:g.20056679T>G	ENSP00000383089:p.Glu43Ala	Somatic	755	9	0.0119205		WXS	Illumina HiSeq	Phase_I	629	12	0.0190779	NM_199254	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	T	2.387	-0.340821	0.05243	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.94931	-3.56;-3.53;-3.47;-3.47;-3.56;-3.53	2.06	0.858	0.19030	.	0.878504	0.09602	U	0.780065	D	0.86159	0.5866	N	0.21448	0.665	0.09310	N	1	B;B	0.28850	0.225;0.0	B;B	0.19946	0.027;0.0	T	0.74598	-0.3612	9	.	.	.	-0.5937	3.8365	0.08896	0.0:0.192:0.0:0.808	.	43;43	A8MX64;Q6XPS3	.;TPTE2_HUMAN	A	43	ENSP00000372438:E43A;ENSP00000382974:E43A;ENSP00000383089:E43A;ENSP00000372437:E43A;ENSP00000372435:E43A;ENSP00000442218:E43A	.	E	-	2	0	TPTE2	18954679	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.422000	0.21296	0.241000	0.21283	0.383000	0.25322	GAA	.	.	weak		0.313	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
MYH1	4619	hgsc.bcm.edu	37	17	10399327	10399327	+	Silent	SNP	C	C	T	rs149731873	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr17:10399327C>T	ENST00000226207.5	-	35	5203	c.5109G>A	c.(5107-5109)agG>agA	p.R1703R	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1703					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R1703R(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CTGCGATTTTCCTGCTCCTCT	0.542													C|||	5	0.000998403	0.0008	0.0	5008	,	,		16305	0.002		0.002	False		,,,				2504	0.0				p.R1703R		Atlas-SNP	.											MYH1,NS,carcinoma,0,1	MYH1	403	1	1	Substitution - coding silent(1)	kidney(1)	c.G5109A						scavenged	.						102.0	92.0	96.0					17																	10399327		2203	4300	6503	SO:0001819	synonymous_variant	4619	exon35			GATTTTCCTGCTC		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.5109G>A	17.37:g.10399327C>T		Somatic	73	1	0.0136986		WXS	Illumina HiSeq	Phase_I	60	4	0.0666667	NM_005963	Q14CA4|Q9Y622	Silent	SNP	ENST00000226207.5	37	CCDS11155.1																																																																																			C|0.999;T|0.001	0.001	strong		0.542	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
MT-ND6	4541	hgsc.bcm.edu	37	M	14364	14364	+	Silent	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chrM:14364G>A	ENST00000361681.2	-	1	309	c.310C>T	c.(310-312)Ctg>Ttg	p.L104L	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	104					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						TTTCACCCACAGCACCAATCC	0.493																																					p.L104L		Atlas-SNP	.											.	.	.	.	0			c.C310T						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			CCCACAGCACCAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.310C>T	M.37:g.14364G>A		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	7	7	1	ENST00000361681	Q34774|Q8HG30	Silent	SNP	ENST00000361681.2	37																																																																																				.	.	none		0.493	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
KLHL6	89857	hgsc.bcm.edu	37	3	183212058	183212058	+	Missense_Mutation	SNP	T	T	C	rs372112529		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:183212058T>C	ENST00000341319.3	-	5	1194	c.1159A>G	c.(1159-1161)Aca>Gca	p.T387A		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	387					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			TCATGCTGTGTTTCTTTGCCA	0.408																																					p.T387A		Atlas-SNP	.											.	KLHL6	100	.	0			c.A1159G						PASS	.						106.0	106.0	106.0					3																	183212058		2203	4300	6503	SO:0001583	missense	89857	exon5			GCTGTGTTTCTTT	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1159A>G	3.37:g.183212058T>C	ENSP00000341342:p.Thr387Ala	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	78	19	0.24359	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	T	18.48	3.633258	0.67015	.	.	ENSG00000172578	ENST00000341319	T	0.65549	-0.16	5.96	5.96	0.96718	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.65186	0.2667	M	0.64997	1.995	0.58432	D	0.999997	P	0.51449	0.945	P	0.44732	0.459	T	0.69558	-0.5113	10	0.59425	D	0.04	.	16.4338	0.83864	0.0:0.0:0.0:1.0	.	387	Q8WZ60	KLHL6_HUMAN	A	387	ENSP00000341342:T387A	ENSP00000341342:T387A	T	-	1	0	KLHL6	184694752	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.036000	0.88901	2.270000	0.75569	0.533000	0.62120	ACA	.	.	alt		0.408	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
KRTAP4-3	85290	hgsc.bcm.edu	37	17	39324104	39324104	+	Silent	SNP	A	A	G	rs368619075		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr17:39324104A>G	ENST00000391356.2	-	1	320	c.321T>C	c.(319-321)tcT>tcC	p.S107S		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	107	29 X 5 AA repeats of C-C-[GIKRQVH]-[SPT]- [STA].		Missing (in allele KAP3-v2). {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.S107S(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			TGCAGCAACTAGAAATGCAGC	0.597																																					p.S107S		Atlas-SNP	.											KRTAP4-3,colon,carcinoma,0,1	KRTAP4-3	40	1	1	Substitution - coding silent(1)	large_intestine(1)	c.T321C						scavenged	.						18.0	23.0	21.0					17																	39324104		2109	4252	6361	SO:0001819	synonymous_variant	85290	exon1			GCAACTAGAAATG	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.321T>C	17.37:g.39324104A>G		Somatic	178	4	0.0224719		WXS	Illumina HiSeq	Phase_I	188	8	0.0425532	NM_033187		Silent	SNP	ENST00000391356.2	37	CCDS42331.1																																																																																			.	.	weak		0.597	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
PRAMEF11	440560	hgsc.bcm.edu	37	1	12888371	12888371	+	Missense_Mutation	SNP	T	T	G	rs200394590	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:12888371T>G	ENST00000535591.1	-	2	348	c.153A>C	c.(151-153)caA>caC	p.Q51H		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	51					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.Q51H(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						GACGAACCCCTTGGGTAAGCA	0.622																																					p.Q51H		Atlas-SNP	.											PRAMEF11,NS,other,0,1	PRAMEF11	72	1	1	Substitution - Missense(1)	pancreas(1)	c.A153C						scavenged	.																																			SO:0001583	missense	440560	exon2			AACCCCTTGGGTA	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.153A>C	1.37:g.12888371T>G	ENSP00000439551:p.Gln51His	Somatic	311	50	0.160772		WXS	Illumina HiSeq	Phase_I	310	67	0.216129	NM_001146344		Missense_Mutation	SNP	ENST00000535591.1	37	CCDS53268.1	.	.	.	.	.	.	.	.	.	.	.	4.508	0.094264	0.08632	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.17213	2.29;2.29	1.48	-0.613	0.11594	.	0.588261	0.17002	N	0.190871	T	0.18173	0.0436	M	0.79343	2.45	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.21109	-1.0255	10	0.54805	T	0.06	.	5.3835	0.16204	0.0:0.52:0.0:0.48	.	51	O60813	PRA11_HUMAN	H	51;92;51	ENSP00000439551:Q51H;ENSP00000391839:Q51H	ENSP00000328783:Q92H	Q	-	3	2	PRAMEF11	12810958	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.096000	0.11059	-0.635000	0.05531	-2.221000	0.00296	CAA	T|0.250;G|0.750	0.750	weak		0.622	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341	
COL24A1	255631	hgsc.bcm.edu	37	1	86249233	86249233	+	Missense_Mutation	SNP	T	T	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:86249233T>G	ENST00000370571.2	-	51	4596	c.4230A>C	c.(4228-4230)gaA>gaC	p.E1410D	COL24A1_ENST00000436319.1_Missense_Mutation_p.E1410D	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	1410	Collagen-like 16.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.E1410D(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		CAGCATCCCCTTCAGGACCCT	0.353																																					p.E1410D		Atlas-SNP	.											COL24A1,colon,carcinoma,0,1	COL24A1	202	1	1	Substitution - Missense(1)	large_intestine(1)	c.A4230C						PASS	.						122.0	115.0	117.0					1																	86249233		1840	4085	5925	SO:0001583	missense	255631	exon51			ATCCCCTTCAGGA	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.4230A>C	1.37:g.86249233T>G	ENSP00000359603:p.Glu1410Asp	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	156	35	0.224359	NM_152890	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	ENST00000370571.2	37	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.872250	0.33069	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.93307	-3.2;-3.1	5.48	-3.93	0.04143	.	0.000000	0.39083	N	0.001464	T	0.65943	0.2740	N	0.11201	0.11	0.26770	N	0.969815	P;P	0.34977	0.478;0.458	B;B	0.38880	0.148;0.284	T	0.73672	-0.3909	10	0.13853	T	0.58	.	3.6705	0.08272	0.5974:0.1259:0.0997:0.177	.	1410;1410	Q17RW2;Q17RW2-2	COOA1_HUMAN;.	D	1410	ENSP00000359603:E1410D;ENSP00000392531:E1410D	ENSP00000359603:E1410D	E	-	3	2	COL24A1	86021821	0.021000	0.18746	0.961000	0.40146	0.883000	0.51084	-1.096000	0.03353	-0.281000	0.09141	-0.242000	0.12053	GAA	.	.	none		0.353	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890	
FCRL3	115352	hgsc.bcm.edu	37	1	157670256	157670256	+	Silent	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:157670256C>T	ENST00000368184.3	-	2	315	c.24G>A	c.(22-24)ctG>ctA	p.L8L	FCRL3_ENST00000368186.5_Silent_p.L8L|FCRL3_ENST00000473231.1_5'Flank	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	8						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					CACTCAGGATCAGCAGCAGCA	0.547																																					p.L8L		Atlas-SNP	.											.	FCRL3	163	.	0			c.G24A						PASS	.						47.0	49.0	49.0					1																	157670256		2203	4300	6503	SO:0001819	synonymous_variant	115352	exon2			CAGGATCAGCAGC	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.24G>A	1.37:g.157670256C>T		Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	160	39	0.24375	NM_052939	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	ENST00000368184.3	37	CCDS1167.1																																																																																			.	.	none		0.547	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939	
FRG1	2483	hgsc.bcm.edu	37	4	190878551	190878551	+	Splice_Site	SNP	A	A	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr4:190878551A>G	ENST00000226798.4	+	6	654		c.e6-1		FRG1_ENST00000514482.1_Splice_Site	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1						mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.?(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TGTTTCACTTAGGGGAAAATG	0.358																																					.		Atlas-SNP	.											FRG1,NS,malignant_melanoma,0,1	FRG1	76	1	1	Unknown(1)	NS(1)	c.433-2A>G						scavenged	.						10.0	16.0	14.0					4																	190878551		2077	4234	6311	SO:0001630	splice_region_variant	2483	exon6			TCACTTAGGGGAA	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.433-1A>G	4.37:g.190878551A>G		Somatic	274	4	0.0145985		WXS	Illumina HiSeq	Phase_I	227	5	0.0220264	NM_004477	A8K775	Splice_Site	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	N	13.17	2.156273	0.38021	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	.	.	.	3.8	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8823	0.46946	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1	191115545	1.000000	0.71417	1.000000	0.80357	0.407000	0.30961	9.035000	0.93752	1.517000	0.48917	0.373000	0.22412	.	.	.	none		0.358	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	Intron
FAM72B	653820	hgsc.bcm.edu	37	1	120846059	120846059	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:120846059G>A	ENST00000369390.3	+	3	1124	c.295G>A	c.(295-297)Gga>Aga	p.G99R	FAM72B_ENST00000355228.4_Missense_Mutation_p.G59R|FAM72B_ENST00000471903.2_3'UTR	NM_001100910.1	NP_001094380.1	Q86X60	FA72B_HUMAN	family with sequence similarity 72, member B	99										large_intestine(1)|lung(2)	3	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)		CTGCAACAACGGACACTTCTG	0.388																																					p.G99R		Atlas-SNP	.											FAM72B,NS,carcinoma,0,1	FAM72B	10	1	0			c.G295A						scavenged	.						345.0	316.0	325.0					1																	120846059		1870	4114	5984	SO:0001583	missense	653820	exon3			AACAACGGACACT	AL357493	CCDS72848.1	1p12	2014-05-06			ENSG00000188610	ENSG00000188610			24805	protein-coding gene	gene with protein product		614711					Standard	NM_001100910		Approved	RP11-439A17.6	uc009whp.3	Q86X60	OTTHUMG00000185025	ENST00000369390.3:c.295G>A	1.37:g.120846059G>A	ENSP00000358397:p.Gly99Arg	Somatic	766	6	0.0078329		WXS	Illumina HiSeq	Phase_I	529	11	0.020794	NM_001100910	B2RPQ5|Q5QP15	Missense_Mutation	SNP	ENST00000369390.3	37	CCDS41374.1	.	.	.	.	.	.	.	.	.	.	g	18.03	3.532588	0.64972	.	.	ENSG00000188610	ENST00000369392;ENST00000369390;ENST00000452190;ENST00000355228	T;T;T	0.38401	1.14;1.14;1.14	2.54	2.54	0.30619	.	0.000000	0.85682	U	0.000000	T	0.36166	0.0957	M	0.83603	2.65	0.54753	D	0.999989	D;B	0.63880	0.993;0.295	P;B	0.49361	0.608;0.056	T	0.42548	-0.9445	10	0.54805	T	0.06	.	10.8119	0.46551	0.0:0.0:1.0:0.0	.	99;59	Q86X60;Q86X60-2	FA72B_HUMAN;.	R	70;99;70;59	ENSP00000358397:G99R;ENSP00000392882:G70R;ENSP00000347368:G59R	ENSP00000347368:G59R	G	+	1	0	FAM72B	120647582	1.000000	0.71417	0.995000	0.50966	0.956000	0.61745	7.236000	0.78154	1.431000	0.47355	0.398000	0.26397	GGA	.	.	weak		0.388	FAM72B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098437.1		
SETD8	387893	hgsc.bcm.edu	37	12	123875311	123875311	+	Silent	SNP	C	C	T	rs74356260		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr12:123875311C>T	ENST00000402868.3	+	3	693	c.267C>T	c.(265-267)gcC>gcT	p.A89A	SETD8_ENST00000478781.2_3'UTR|SETD8_ENST00000330479.4_Silent_p.A89A			Q9NQR1	SETD8_HUMAN	SET domain containing (lysine methyltransferase) 8	130					histone lysine methylation (GO:0034968)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|transcription corepressor activity (GO:0003714)	p.A89A(4)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|urinary_tract(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)		AACCATTAGCCGGAATCTACA	0.498																																					p.A89A		Atlas-SNP	.											SETD8,NS,carcinoma,0,6	SETD8	35	6	4	Substitution - coding silent(4)	prostate(3)|central_nervous_system(1)	c.C267T						scavenged	.						105.0	100.0	101.0					12																	123875311		2203	4300	6503	SO:0001819	synonymous_variant	387893	exon3			ATTAGCCGGAATC	AY102937	CCDS9247.1	12q24.31	2011-07-01			ENSG00000183955	ENSG00000183955		"""Chromatin-modifying enzymes / K-methyltransferases"""	29489	protein-coding gene	gene with protein product		607240				15933070, 12086618, 12121615	Standard	NM_020382		Approved	SET8, SET07, PR-Set7, KMT5A	uc001uew.3	Q9NQR1	OTTHUMG00000150477	ENST00000402868.3:c.267C>T	12.37:g.123875311C>T		Somatic	138	1	0.00724638		WXS	Illumina HiSeq	Phase_I	147	6	0.0408163	NM_020382	A8K9D0|Q86W83|Q8TD09	Silent	SNP	ENST00000402868.3	37	CCDS9247.1																																																																																			.	.	weak		0.498	SETD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318263.1	NM_020382	
APOBEC3F	200316	hgsc.bcm.edu	37	22	39441197	39441197	+	Silent	SNP	G	G	A	rs200983508	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr22:39441197G>A	ENST00000308521.5	+	3	780	c.423G>A	c.(421-423)ggG>ggA	p.G141G	APOBEC3F_ENST00000491387.1_3'UTR|APOBEC3G_ENST00000452957.2_Intron	NM_145298.5	NP_660341.2	Q8IUX4	ABC3F_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F	141					base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|DNA demethylation (GO:0080111)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.G141G(2)		breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|skin(2)	16	Melanoma(58;0.04)					GTCAGGCAGGGGCCCGCGTGA	0.592																																					p.G141G		Atlas-SNP	.											APOBEC3F,NS,carcinoma,0,1	APOBEC3F	37	1	2	Substitution - coding silent(2)	lung(1)|endometrium(1)	c.G423A						scavenged	.						47.0	49.0	48.0					22																	39441197		2203	4300	6503	SO:0001819	synonymous_variant	200316	exon3			GGCAGGGGCCCGC	BC038808	CCDS33648.1, CCDS33649.1	22q13.1-q13.2	2008-05-15			ENSG00000128394	ENSG00000128394		"""Apolipoprotein B mRNA editing enzymes"""	17356	protein-coding gene	gene with protein product		608993				11863358, 17121840	Standard	NM_145298		Approved	ARP8, BK150C2.4.MRNA, KA6	uc003aww.3	Q8IUX4	OTTHUMG00000151080	ENST00000308521.5:c.423G>A	22.37:g.39441197G>A		Somatic	93	8	0.0860215		WXS	Illumina HiSeq	Phase_I	71	2	0.028169	NM_145298	B0QYD4|Q45F03|Q6ICH3|Q7Z2N2|Q7Z2N5	Silent	SNP	ENST00000308521.5	37	CCDS33648.1																																																																																			G|0.998;A|0.002	0.002	strong		0.592	APOBEC3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321216.1	NM_145298	
CNTRL	11064	hgsc.bcm.edu	37	9	123937296	123937296	+	Splice_Site	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr9:123937296G>A	ENST00000373855.1	+	43	7008	c.6748G>A	c.(6748-6750)Gcc>Acc	p.A2250T	CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000373850.1_Splice_Site_p.A1698T|CNTRL_ENST00000238341.5_Splice_Site_p.A2250T			Q7Z7A1	CNTRL_HUMAN	centriolin	2250	Sufficient for interaction with HOOK2.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						CACTTTTCAGGCCCAACTCCG	0.438																																					p.A2250T		Atlas-SNP	.											.	CNTRL	161	.	0			c.G6748A						PASS	.						115.0	122.0	120.0					9																	123937296		2203	4300	6503	SO:0001630	splice_region_variant	11064	exon41			TTTCAGGCCCAAC	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.6748-1G>A	9.37:g.123937296G>A		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	81	21	0.259259	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	G	33	5.277169	0.95459	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000394368;ENST00000373850;ENST00000373845	T;T;T	0.35421	1.48;1.48;1.31	5.59	5.59	0.84812	.	.	.	.	.	T	0.59169	0.2174	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.55108	-0.8192	8	.	.	.	.	18.5881	0.91197	0.0:0.0:1.0:0.0	.	2250	Q7Z7A1	CNTRL_HUMAN	T	2250;2250;2250;407;1698;932	ENSP00000362962:A2250T;ENSP00000238341:A2250T;ENSP00000362956:A1698T	.	A	+	1	0	CNTRL	122977117	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.810000	0.86072	2.629000	0.89072	0.555000	0.69702	GCC	.	.	none		0.438	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	Missense_Mutation
PCDHGA3	56112	hgsc.bcm.edu	37	5	140725547	140725547	+	Silent	SNP	C	C	T	rs544633115	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr5:140725547C>T	ENST00000253812.6	+	1	1947	c.1947C>T	c.(1945-1947)caC>caT	p.H649H	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	649	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H649H(1)		breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCAGGACCACGGCCAGCCCC	0.711													.|||	8	0.00159744	0.0053	0.0	5008	,	,		14827	0.0		0.001	False		,,,				2504	0.0				p.H649H		Atlas-SNP	.											PCDHGA3_ENST00000253812,NS,carcinoma,0,1	PCDHGA3	246	1	1	Substitution - coding silent(1)	kidney(1)	c.C1947T						scavenged	.						12.0	19.0	17.0					5																	140725547		2129	4231	6360	SO:0001819	synonymous_variant	56112	exon1			GGACCACGGCCAG	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1947C>T	5.37:g.140725547C>T		Somatic	152	11	0.0723684		WXS	Illumina HiSeq	Phase_I	120	16	0.133333	NM_032011	Q9Y5D4	Silent	SNP	ENST00000253812.6	37	CCDS47290.1																																																																																			.	.	none		0.711	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
ATXN1	6310	hgsc.bcm.edu	37	6	16327891	16327891	+	Missense_Mutation	SNP	C	C	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:16327891C>A	ENST00000244769.4	-	8	1587	c.651G>T	c.(649-651)caG>caT	p.Q217H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q217H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	217	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.Q217H(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgctgctgctgctgct	0.657																																					p.Q217H		Atlas-SNP	.											ATXN1,NS,carcinoma,0,1	ATXN1	117	1	1	Substitution - Missense(1)	lung(1)	c.G651T						PASS	.																																			SO:0001583	missense	6310	exon7			CTGCTGCTGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.651G>T	6.37:g.16327891C>A	ENSP00000244769:p.Gln217His	Somatic	27	0	0		WXS	Illumina HiSeq	Phase_I	40	9	0.225	NM_001128164	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	-	6.133	0.392825	0.11638	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.63913	-0.07;-0.07	0.753	-0.262	0.12958	.	.	.	.	.	T	0.14657	0.0354	N	0.08118	0	0.09310	N	1	B	0.28713	0.22	B	0.17979	0.02	T	0.12344	-1.0551	9	0.54805	T	0.06	.	3.1001	0.06323	0.0:0.6446:0.0:0.3554	.	217	P54253	ATX1_HUMAN	H	217	ENSP00000244769:Q217H;ENSP00000416360:Q217H	ENSP00000244769:Q217H	Q	-	3	2	ATXN1	16435870	0.069000	0.21087	0.004000	0.12327	0.137000	0.21094	0.232000	0.17891	-0.113000	0.11958	0.121000	0.15741	CAG	.	.	none		0.657	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
HNRNPCL1	343069	hgsc.bcm.edu	37	1	12907708	12907708	+	Silent	SNP	A	A	G	rs4026149	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:12907708A>G	ENST00000317869.6	-	2	660	c.435T>C	c.(433-435)cgT>cgC	p.R145R		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	145						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						ATAGACGTTGACGTTTCGAGG	0.483																																					p.R145R		Atlas-SNP	.											HNRNPCL1,NS,carcinoma,-1,1	HNRNPCL1	68	1	0			c.T435C						scavenged	.						120.0	124.0	122.0					1																	12907708		2201	4297	6498	SO:0001819	synonymous_variant	343069	exon2			ACGTTGACGTTTC	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.435T>C	1.37:g.12907708A>G		Somatic	145	20	0.137931		WXS	Illumina HiSeq	Phase_I	127	20	0.15748	NM_001013631	B2RP44	Silent	SNP	ENST00000317869.6	37	CCDS30591.1																																																																																			A|0.667;G|0.333	0.333	strong		0.483	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
JUNB	3726	hgsc.bcm.edu	37	19	12902785	12902785	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:12902785G>A	ENST00000302754.4	+	1	476	c.200G>A	c.(199-201)aGc>aAc	p.S67N		NM_002229.2	NP_002220.1	P17275	JUNB_HUMAN	jun B proto-oncogene	67					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|decidualization (GO:0046697)|embryonic process involved in female pregnancy (GO:0060136)|gene expression (GO:0010467)|labyrinthine layer blood vessel development (GO:0060716)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|osteoclast differentiation (GO:0030316)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|kidney(1)|lung(3)	6						GGTGGCGGCAGCTACTTTTCT	0.672																																					p.S67N		Atlas-SNP	.											.	JUNB	14	.	0			c.G200A						PASS	.						12.0	13.0	13.0					19																	12902785		2200	4293	6493	SO:0001583	missense	3726	exon1			GCGGCAGCTACTT	M29039	CCDS12280.1	19p13.13	2013-01-10				ENSG00000171223		"""basic leucine zipper proteins"""	6205	protein-coding gene	gene with protein product		165161				2513129	Standard	NM_002229		Approved		uc002mvc.3	P17275		ENST00000302754.4:c.200G>A	19.37:g.12902785G>A	ENSP00000303315:p.Ser67Asn	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	69	20	0.289855	NM_002229	Q96GH3	Missense_Mutation	SNP	ENST00000302754.4	37	CCDS12280.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.050854	0.36181	.	.	ENSG00000171223	ENST00000302754	T	0.29655	1.56	4.25	3.1	0.35709	Jun-like transcription factor (1);	.	.	.	.	T	0.20373	0.0490	N	0.25485	0.75	0.33704	D	0.614893	B	0.28820	0.224	B	0.26094	0.066	T	0.17107	-1.0380	9	0.17369	T	0.5	-16.9799	13.1068	0.59252	0.0:0.1633:0.8367:0.0	.	67	P17275	JUNB_HUMAN	N	67	ENSP00000303315:S67N	ENSP00000303315:S67N	S	+	2	0	JUNB	12763785	0.995000	0.38212	1.000000	0.80357	0.967000	0.64934	2.201000	0.42734	2.300000	0.77407	0.549000	0.68633	AGC	.	.	none		0.672	JUNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451015.1	NM_002229	
DDIT4L	115265	hgsc.bcm.edu	37	4	101109161	101109161	+	Silent	SNP	G	G	C	rs3749604	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr4:101109161G>C	ENST00000273990.2	-	3	469	c.255C>G	c.(253-255)acC>acG	p.T85T	RP11-15B17.1_ENST00000515026.1_RNA|RP11-588P8.1_ENST00000515782.1_RNA	NM_145244.3	NP_660287.1	Q96D03	DDT4L_HUMAN	DNA-damage-inducible transcript 4-like	85					negative regulation of signal transduction (GO:0009968)	cytoplasm (GO:0005737)				breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(2)	12				OV - Ovarian serous cystadenocarcinoma(123;5.75e-09)		CAATTCTCTGGGTCAGTTTCT	0.453													G|||	631	0.125998	0.1626	0.1254	5008	,	,		19326	0.006		0.2316	False		,,,				2504	0.092				p.T85T		Atlas-SNP	.											DDIT4L,NS,carcinoma,-1,1	DDIT4L	33	1	0			c.C255G						scavenged	.	G		785,3621	316.1+/-294.4	60,665,1478	139.0	133.0	135.0		255	2.9	1.0	4	dbSNP_107	135	1940,6660	342.1+/-324.3	215,1510,2575	no	coding-synonymous	DDIT4L	NM_145244.3		275,2175,4053	CC,CG,GG		22.5581,17.8166,20.9519		85/194	101109161	2725,10281	2203	4300	6503	SO:0001819	synonymous_variant	115265	exon3			TCTCTGGGTCAGT	BC013592	CCDS34036.1	4q23	2008-02-05				ENSG00000145358			30555	protein-coding gene	gene with protein product	"""regulated in development and DNA damage response 2"", "" similar to Smhs1 protein"""	607730				12477932	Standard	NM_145244		Approved	REDD2, Rtp801L	uc003hvq.3	Q96D03		ENST00000273990.2:c.255C>G	4.37:g.101109161G>C		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	82	2	0.0243902	NM_145244	B2R7C3	Silent	SNP	ENST00000273990.2	37	CCDS34036.1																																																																																			G|0.813;C|0.187	0.187	strong		0.453	DDIT4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363423.1	NM_145244	
PLIN5	440503	hgsc.bcm.edu	37	19	4529195	4529195	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:4529195C>T	ENST00000381848.3	-	5	490	c.410G>A	c.(409-411)cGg>cAg	p.R137Q	CTB-50L17.14_ENST00000586020.1_3'UTR	NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	137	Essential for lipid droplet targeting. {ECO:0000250}.				lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)		p.R137Q(1)		endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						GCTCCAGCGCCGGCCCCTCCG	0.642																																					p.R137Q		Atlas-SNP	.											PLIN5,NS,carcinoma,0,1	PLIN5	27	1	1	Substitution - Missense(1)	endometrium(1)	c.G410A						scavenged	.						62.0	71.0	68.0					19																	4529195		2059	4196	6255	SO:0001583	missense	440503	exon5			CAGCGCCGGCCCC	DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.410G>A	19.37:g.4529195C>T	ENSP00000371272:p.Arg137Gln	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	109	3	0.0275229	NM_001013706	A2RRC1|Q6ZS68	Missense_Mutation	SNP	ENST00000381848.3	37	CCDS42473.1	.	.	.	.	.	.	.	.	.	.	.	24.5	4.537006	0.85812	.	.	ENSG00000214456	ENST00000381848	T	0.05649	3.41	4.83	4.83	0.62350	.	1.606760	0.04872	U	0.446127	T	0.24967	0.0606	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00013	-1.2413	10	0.62326	D	0.03	-29.6221	13.401	0.60883	0.0:1.0:0.0:0.0	.	137	Q00G26	PLIN5_HUMAN	Q	137	ENSP00000371272:R137Q	ENSP00000371272:R137Q	R	-	2	0	PLIN5	4480195	0.984000	0.35163	1.000000	0.80357	0.908000	0.53690	1.885000	0.39678	2.252000	0.74401	0.561000	0.74099	CGG	.	.	none		0.642	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458647.1	NM_001013706	
PRKCSH	5589	hgsc.bcm.edu	37	19	11558370	11558370	+	Silent	SNP	G	G	A	rs77563879		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:11558370G>A	ENST00000589838.1	+	10	966	c.966G>A	c.(964-966)gaG>gaA	p.E322E	PRKCSH_ENST00000591462.1_Silent_p.E322E|PRKCSH_ENST00000252455.2_Silent_p.E322E|PRKCSH_ENST00000412601.1_Silent_p.E322E|PRKCSH_ENST00000587327.1_Silent_p.E322E|PRKCSH_ENST00000592741.1_Silent_p.E322E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	322	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaagaagagg	0.632																																					p.E322E		Atlas-SNP	.											PRKCSH,caecum,carcinoma,0,1	PRKCSH	55	1	1	Deletion - In frame(1)	central_nervous_system(1)	c.G966A						PASS	.						27.0	27.0	27.0					19																	11558370		2200	4298	6498	SO:0001819	synonymous_variant	5589	exon11			GGAGGAGGAAGAA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.966G>A	19.37:g.11558370G>A		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	71	5	0.0704225	NM_001001329	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	37	CCDS32911.1																																																																																			.	.	weak		0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
PCDHA3	56145	hgsc.bcm.edu	37	5	140180941	140180941	+	Silent	SNP	G	G	A	rs201478898	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr5:140180941G>A	ENST00000522353.2	+	1	159	c.159G>A	c.(157-159)ggG>ggA	p.G53G	PCDHA3_ENST00000532566.2_Silent_p.G53G|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	53	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGACCTGGGGCTGGAGCTGG	0.637																																					p.G53G		Atlas-SNP	.											PCDHA3_ENST00000522353,NS,haematopoietic_neoplasm,0,2	PCDHA3	396	2	0			c.G159A						scavenged	.																																			SO:0001819	synonymous_variant	56145	exon1			CCTGGGGCTGGAG	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.159G>A	5.37:g.140180941G>A		Somatic	41	5	0.121951		WXS	Illumina HiSeq	Phase_I	33	8	0.242424	NM_031497	O75286	Silent	SNP	ENST00000522353.2	37	CCDS54915.1																																																																																			G|0.926;A|0.074	0.074	strong		0.637	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
FLG	2312	hgsc.bcm.edu	37	1	152286156	152286156	+	Silent	SNP	G	G	A	rs140941956		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:152286156G>A	ENST00000368799.1	-	3	1241	c.1206C>T	c.(1204-1206)cgC>cgT	p.R402R	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	402	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R402R(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAGCTTGCCCGCGCCCAGTGG	0.562									Ichthyosis																												p.R402R		Atlas-SNP	.											FLG,NS,carcinoma,0,3	FLG	900	3	1	Substitution - coding silent(1)	endometrium(1)	c.C1206T						scavenged	.	G		0,4406		0,0,2203	238.0	243.0	241.0		1206	-8.3	0.0	1	dbSNP_134	241	2,8598		0,2,4298	no	coding-synonymous	FLG	NM_002016.1		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		402/4062	152286156	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TTGCCCGCGCCCA	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1206C>T	1.37:g.152286156G>A		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	67	2	0.0298507	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																			G|1.000;A|0.000	0.000	weak		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
OTOP1	133060	hgsc.bcm.edu	37	4	4228479	4228479	+	Missense_Mutation	SNP	G	G	C	rs199890951		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr4:4228479G>C	ENST00000296358.4	-	1	137	c.113C>G	c.(112-114)tCc>tGc	p.S38C		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	38					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ggATTCCGGGGACCTCGGGGC	0.746																																					p.S38C		Atlas-SNP	.											OTOP1,NS,carcinoma,0,1	OTOP1	118	1	0			c.C113G						scavenged	.						3.0	3.0	3.0					4																	4228479		1773	3481	5254	SO:0001583	missense	133060	exon1			TCCGGGGACCTCG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.113C>G	4.37:g.4228479G>C	ENSP00000296358:p.Ser38Cys	Somatic	38	2	0.0526316		WXS	Illumina HiSeq	Phase_I	7	2	0.285714	NM_177998	A1L476	Missense_Mutation	SNP	ENST00000296358.4	37	CCDS3372.1	.	.	.	.	.	.	.	.	.	.	G	7.656	0.683978	0.14907	.	.	ENSG00000163982	ENST00000296358	T	0.08896	3.04	2.01	0.00709	0.14069	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	0.09310	N	1	P	0.52463	0.953	B	0.31390	0.129	T	0.44559	-0.9320	9	0.49607	T	0.09	-0.0197	7.5462	0.27768	0.0:0.5332:0.4668:0.0	.	38	Q7RTM1	OTOP1_HUMAN	C	38	ENSP00000296358:S38C	ENSP00000296358:S38C	S	-	2	0	OTOP1	4279380	0.001000	0.12720	0.002000	0.10522	0.057000	0.15508	0.411000	0.21115	-0.016000	0.14127	-0.472000	0.04984	TCC	.	.	weak		0.746	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
VWF	7450	hgsc.bcm.edu	37	12	6085324	6085324	+	Missense_Mutation	SNP	G	G	A	rs61751286		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr12:6085324G>A	ENST00000261405.5	-	43	7644	c.7390C>T	c.(7390-7392)Cgc>Tgc	p.R2464C		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2464	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TGGGCCACGCGGAGGCCCATC	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		17555	0.0		0.001	False		,,,				2504	0.0				p.R2464C		Atlas-SNP	.											VWF,NS,lymphoid_neoplasm,+1,1	VWF	338	1	0			c.C7390T	GRCh37	CM070317	VWF	M	rs61751286	scavenged	.						70.0	63.0	65.0					12																	6085324		2203	4300	6503	SO:0001583	missense	7450	exon43			CCACGCGGAGGCC		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7390C>T	12.37:g.6085324G>A	ENSP00000261405:p.Arg2464Cys	Somatic	99	1	0.010101		WXS	Illumina HiSeq	Phase_I	68	16	0.235294	NM_000552	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	22.3	4.268417	0.80469	.	.	ENSG00000110799	ENST00000261405	T	0.65916	-0.18	5.19	5.19	0.71726	von Willebrand factor, type C (4);	0.185059	0.26631	N	0.023302	T	0.71779	0.3380	L	0.51422	1.61	0.80722	D	1	D	0.76494	0.999	P	0.60609	0.877	T	0.73563	-0.3943	10	0.56958	D	0.05	.	15.8551	0.78972	0.0:0.0:1.0:0.0	rs61751286	2464	P04275	VWF_HUMAN	C	2464	ENSP00000261405:R2464C	ENSP00000261405:R2464C	R	-	1	0	VWF	5955585	1.000000	0.71417	0.987000	0.45799	0.734000	0.41952	5.369000	0.66138	2.412000	0.81896	0.591000	0.81541	CGC	G|1.000;A|0.000	0.000	strong		0.642	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
EP300	2033	hgsc.bcm.edu	37	22	41572795	41572795	+	Missense_Mutation	SNP	A	A	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr22:41572795A>G	ENST00000263253.7	+	31	6299	c.5080A>G	c.(5080-5082)Acc>Gcc	p.T1694A	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1694	Binding region for E1A adenovirus.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CTTGTGTATCACCTGCTATAA	0.423			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.T1694A		Atlas-SNP	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.A5080G						PASS	.						131.0	125.0	127.0					22																	41572795		2203	4300	6503	SO:0001583	missense	2033	exon31	Familial Cancer Database	Broad Thumb-Hallux syndrome	TGTATCACCTGCT	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.5080A>G	22.37:g.41572795A>G	ENSP00000263253:p.Thr1694Ala	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	93	25	0.268817	NM_001429	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	37	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	A	13.71	2.319613	0.41096	.	.	ENSG00000100393	ENST00000263253	D	0.91124	-2.79	5.45	5.45	0.79879	Zinc finger, ZZ-type (4);	0.000000	0.49916	D	0.000129	T	0.80727	0.4678	N	0.04655	-0.195	0.43032	D	0.994605	P	0.36616	0.561	B	0.40285	0.325	T	0.80016	-0.1559	10	0.08381	T	0.77	-9.5504	15.8114	0.78568	1.0:0.0:0.0:0.0	.	1694	Q09472	EP300_HUMAN	A	1694	ENSP00000263253:T1694A	ENSP00000263253:T1694A	T	+	1	0	EP300	39902741	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.576000	0.82467	2.191000	0.70037	0.528000	0.53228	ACC	.	.	none		0.423	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
TMEM44	93109	hgsc.bcm.edu	37	3	194338423	194338423	+	Missense_Mutation	SNP	C	C	T	rs12695036|rs386669926	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:194338423C>T	ENST00000392432.2	-	6	900	c.695G>A	c.(694-696)cGt>cAt	p.R232H	TMEM44_ENST00000273580.7_Intron|TMEM44_ENST00000473092.1_Intron|TMEM44_ENST00000381975.3_Intron|TMEM44_ENST00000347147.4_Intron	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44	232			R -> H (in dbSNP:rs12695036). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		gctgggagaacgTGAGGGAGA	0.622													C|||	2410	0.48123	0.3517	0.5331	5008	,	,		16125	0.75		0.2942	False		,,,				2504	0.5348				p.R232H		Atlas-SNP	.											.	TMEM44	42	.	0			c.G695A						PASS	.	C	,HIS/ARG,,	361,1023		75,211,406	60.0	69.0	66.0		,695,,	-2.8	0.0	3	dbSNP_121	66	912,2270		173,566,852	yes	intron,missense,intron,intron	TMEM44	NM_001011655.2,NM_001166305.1,NM_001166306.1,NM_138399.4	,29,,	248,777,1258	TT,TC,CC		28.6612,26.0838,27.88	,,,	,232/476,,	194338423	1273,3293	692	1591	2283	SO:0001583	missense	93109	exon6			GGAGAACGTGAGG	AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.695G>A	3.37:g.194338423C>T	ENSP00000376227:p.Arg232His	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_001166305	A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	Missense_Mutation	SNP	ENST00000392432.2	37	CCDS54699.1	1016	0.4652014652014652	176	0.35772357723577236	195	0.5386740331491713	431	0.7534965034965035	214	0.28232189973614774	C	6.123	0.390972	0.11581	0.260838	0.286612	ENSG00000145014	ENST00000392432	T	0.23950	1.88	2.03	-2.85	0.05734	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.32428	-0.9907	6	0.23302	T	0.38	.	0.4159	0.00448	0.1788:0.2613:0.2601:0.2998	rs12695036;rs59789853;rs12695036	.	.	.	H	232	ENSP00000376227:R232H	ENSP00000376227:R232H	R	-	2	0	TMEM44	195819712	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-1.678000	0.01942	-0.836000	0.04229	-1.270000	0.01421	CGT	C|0.567;T|0.433	0.433	strong		0.622	TMEM44-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000342750.1	NM_138399	
MUC4	4585	hgsc.bcm.edu	37	3	195505772	195505772	+	Missense_Mutation	SNP	C	C	G	rs556354486		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:195505772C>G	ENST00000463781.3	-	2	13138	c.12679G>C	c.(12679-12681)Gtc>Ctc	p.V4227L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V4227L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	984					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V4227L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGCTGGTGACAGGAAGAGGG	0.582													.|||	1	0.000199681	0.0	0.0	5008	,	,		15508	0.0		0.001	False		,,,				2504	0.0				p.V4227L		Atlas-SNP	.											MUC4_ENST00000463781,bladder,carcinoma,0,4	MUC4	1505	4	1	Substitution - Missense(1)	lung(1)	c.G12679C						scavenged	.																																			SO:0001583	missense	4585	exon2			TGGTGACAGGAAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12679G>C	3.37:g.195505772C>G	ENSP00000417498:p.Val4227Leu	Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	86	2	0.0232558	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	5.247	0.230981	0.09969	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.56;1.6	1.57	0.566	0.17317	.	.	.	.	.	T	0.14227	0.0344	N	0.14661	0.345	0.19300	N	0.999978	B	0.27765	0.188	B	0.22601	0.04	T	0.27640	-1.0068	8	.	.	.	.	5.595	0.17321	0.0:0.6491:0.3509:0.0	.	4099	E7ESK3	.	L	4227	ENSP00000417498:V4227L;ENSP00000420243:V4227L	.	V	-	1	0	MUC4	196990551	0.000000	0.05858	0.020000	0.16555	0.011000	0.07611	-0.070000	0.11523	0.201000	0.20466	0.484000	0.47621	GTC	.	.	none		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PAPPA2	60676	hgsc.bcm.edu	37	1	176671860	176671860	+	Silent	SNP	G	G	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:176671860G>C	ENST00000367662.3	+	9	4518	c.3354G>C	c.(3352-3354)ggG>ggC	p.G1118G		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1118					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GTGGAGATGGGAAGGTGTCAG	0.502																																					p.G1118G		Atlas-SNP	.											.	PAPPA2	665	.	0			c.G3354C						PASS	.						85.0	81.0	82.0					1																	176671860		1978	4164	6142	SO:0001819	synonymous_variant	60676	exon9			AGATGGGAAGGTG	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.3354G>C	1.37:g.176671860G>C		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	30	4	0.133333	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	ENST00000367662.3	37	CCDS41438.1																																																																																			.	.	none		0.502	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
NFKBIE	4794	hgsc.bcm.edu	37	6	44227895	44227895	+	Missense_Mutation	SNP	A	A	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:44227895A>G	ENST00000275015.5	-	5	1321	c.1322T>C	c.(1321-1323)cTg>cCg	p.L441P	SLC35B2_ENST00000393812.3_5'Flank|SLC35B2_ENST00000495706.1_5'Flank|SLC35B2_ENST00000393810.1_5'Flank|SLC35B2_ENST00000538577.1_5'Flank|SLC35B2_ENST00000537814.1_5'Flank	NM_004556.2	NP_004547.2	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon	441					cytoplasmic sequestering of transcription factor (GO:0042994)|D-serine transport (GO:0042942)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TGCCAGGTGCAGGGGTGTGCA	0.647																																					p.L441P		Atlas-SNP	.											.	NFKBIE	31	.	0			c.T1322C						PASS	.						49.0	51.0	50.0					6																	44227895		2203	4300	6503	SO:0001583	missense	4794	exon5			AGGTGCAGGGGTG	U91616	CCDS34463.1	6p21.1	2013-01-10			ENSG00000146232	ENSG00000146232		"""Ankyrin repeat domain containing"""	7799	protein-coding gene	gene with protein product		604548				9135156	Standard	NM_004556		Approved	IKBE	uc003oxe.1	O00221	OTTHUMG00000014762	ENST00000275015.5:c.1322T>C	6.37:g.44227895A>G	ENSP00000275015:p.Leu441Pro	Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	45	17	0.377778	NM_004556	Q5T9V9	Missense_Mutation	SNP	ENST00000275015.5	37	CCDS34463.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.421610	0.83559	.	.	ENSG00000146232	ENST00000275015;ENST00000443607	D	0.82255	-1.59	5.05	5.05	0.67936	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000007	D	0.94238	0.8150	H	0.98818	4.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96517	0.9383	10	0.87932	D	0	-42.6353	14.814	0.70017	1.0:0.0:0.0:0.0	.	441	O00221	IKBE_HUMAN	P	441;42	ENSP00000275015:L441P	ENSP00000275015:L441P	L	-	2	0	NFKBIE	44335873	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.297000	0.96120	1.895000	0.54865	0.533000	0.62120	CTG	.	.	none		0.647	NFKBIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040733.2		
PTPRK	5796	hgsc.bcm.edu	37	6	128505735	128505735	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:128505735C>T	ENST00000368215.3	-	7	1003	c.1004G>A	c.(1003-1005)gGa>gAa	p.G335E	PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000368227.3_Missense_Mutation_p.G335E|PTPRK_ENST00000532331.1_Missense_Mutation_p.G335E|PTPRK_ENST00000368207.3_Missense_Mutation_p.G335E|PTPRK_ENST00000368213.5_Missense_Mutation_p.G335E|PTPRK_ENST00000368226.4_Missense_Mutation_p.G335E|PTPRK_ENST00000368210.3_Missense_Mutation_p.G335E			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	335	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TGTCCAGGATCCTGATGTCAT	0.433																																					p.G335E		Atlas-SNP	.											PTPRK_ENST00000368213,mucosal,malignant_melanoma,-1,2	PTPRK	330	2	0			c.G1004A						PASS	.						219.0	202.0	208.0					6																	128505735		2203	4300	6503	SO:0001583	missense	5796	exon7			CAGGATCCTGATG	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.1004G>A	6.37:g.128505735C>T	ENSP00000357198:p.Gly335Glu	Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	127	10	0.0787402	NM_001135648	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	ENST00000368215.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.174795|5.174795	0.94807|0.94807	.|.	.|.	ENSG00000152894|ENSG00000152894	ENST00000490332|ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207;ENST00000427676	.|T;T;T;T;T;T;T	.|0.80480	.|-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38	5.49|5.49	5.49|5.49	0.81192|0.81192	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85031|0.85031	0.5604|0.5604	L|L	0.48986|0.48986	1.54|1.54	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;0.995;0.993;0.988;1.0;1.0	.|D;D;P;P;D;D	.|0.91635	.|0.999;0.932;0.888;0.838;0.999;0.998	T|T	0.82764|0.82764	-0.0296|-0.0296	5|10	.|0.36615	.|T	.|0.2	.|.	19.3758|19.3758	0.94508|0.94508	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|335;335;335;192;335;335	.|B4DHC3;B7ZMG0;Q15262-3;F5GWP2;Q15262;Q15262-2	.|.;.;.;.;PTPRK_HUMAN;.	N|E	152|335;335;335;335;335;335;335;192	.|ENSP00000357209:G335E;ENSP00000357210:G335E;ENSP00000432973:G335E;ENSP00000357196:G335E;ENSP00000357193:G335E;ENSP00000357198:G335E;ENSP00000357190:G335E	.|ENSP00000357190:G335E	D|G	-|-	1|2	0|0	PTPRK|PTPRK	128547428|128547428	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.944000|0.944000	0.59088|0.59088	7.818000|7.818000	0.86416|0.86416	2.577000|2.577000	0.86979|0.86979	0.655000|0.655000	0.94253|0.94253	GAT|GGA	.	.	none		0.433	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
ANKRD11	29123	hgsc.bcm.edu	37	16	89347228	89347228	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr16:89347228G>A	ENST00000301030.4	-	9	6182	c.5722C>T	c.(5722-5724)Ccc>Tcc	p.P1908S	ANKRD11_ENST00000378330.2_Missense_Mutation_p.P1908S	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1908	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		AGGTCCGGGGGAAGGGCCCCT	0.662																																					p.P1908S		Atlas-SNP	.											.	ANKRD11	195	.	0			c.C5722T						PASS	.						30.0	36.0	34.0					16																	89347228		2196	4296	6492	SO:0001583	missense	29123	exon9			CCGGGGGAAGGGC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.5722C>T	16.37:g.89347228G>A	ENSP00000301030:p.Pro1908Ser	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	82	24	0.292683	NM_001256183	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	g	16.17	3.048706	0.55110	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.43688	0.94;0.94	4.78	2.7	0.31948	.	0.169886	0.38111	N	0.001806	T	0.32224	0.0822	L	0.36672	1.1	0.80722	D	1	P	0.50066	0.931	B	0.41374	0.355	T	0.02743	-1.1116	10	0.24483	T	0.36	.	14.1122	0.65129	0.0:0.288:0.7119:0.0	.	1908	Q6UB99	ANR11_HUMAN	S	1908	ENSP00000301030:P1908S;ENSP00000367581:P1908S	ENSP00000301030:P1908S	P	-	1	0	ANKRD11	87874729	1.000000	0.71417	0.926000	0.36857	0.821000	0.46438	5.071000	0.64382	0.377000	0.24735	0.450000	0.29827	CCC	.	.	none		0.662	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
HIST1H2BG	8339	hgsc.bcm.edu	37	6	26216827	26216827	+	Silent	SNP	G	G	A	rs143774290		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:26216827G>A	ENST00000244601.3	-	1	45	c.45C>T	c.(43-45)tcC>tcT	p.S15S	HIST1H2AE_ENST00000303910.2_5'Flank	NM_003518.3	NP_003509.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	15					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	8		all_hematologic(11;0.196)				CAGCCTTCTTGGAACCCTTCT	0.493																																					p.S15S		Atlas-SNP	.											.	HIST1H2BG	25	.	0			c.C45T						PASS	.	G		0,4406		0,0,2203	138.0	125.0	129.0		45	2.2	1.0	6	dbSNP_134	129	2,8598		0,2,4298	no	coding-synonymous	HIST1H2BG	NM_003518.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		15/127	26216827	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	8339	exon1			CTTCTTGGAACCC	M60750	CCDS4594.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000187990	ENSG00000273802		"""Histones / Replication-dependent"""	4746	protein-coding gene	gene with protein product		602798	"""H2B histone family, member A"", ""histone 1, H2bg"""	H2BFA		1916825, 12408966	Standard	NM_003518		Approved	H2B/a, H2B.1A	uc003ngz.2	P62807	OTTHUMG00000014446	ENST00000244601.3:c.45C>T	6.37:g.26216827G>A		Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	74	16	0.216216	NM_003518	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	ENST00000244601.3	37	CCDS4594.1																																																																																			G|1.000;A|0.000	0.000	weak		0.493	HIST1H2BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040109.2	NM_003518	
CCAR1	55749	hgsc.bcm.edu	37	10	70520826	70520826	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr10:70520826G>T	ENST00000265872.6	+	16	2102	c.1983G>T	c.(1981-1983)caG>caT	p.Q661H	CCAR1_ENST00000543719.1_Missense_Mutation_p.Q646H|MIR1254-1_ENST00000408257.1_RNA|CCAR1_ENST00000535016.1_Missense_Mutation_p.Q646H	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	661	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						TAAAATCCCAGTTAATAGCCC	0.353																																					p.Q661H		Atlas-SNP	.											CCAR1,NS,carcinoma,0,1	CCAR1	118	1	0			c.G1983T						scavenged	.						70.0	73.0	72.0					10																	70520826		2203	4299	6502	SO:0001583	missense	55749	exon16			ATCCCAGTTAATA	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.1983G>T	10.37:g.70520826G>T	ENSP00000265872:p.Gln661His	Somatic	189	0	0		WXS	Illumina HiSeq	Phase_I	188	4	0.0212766	NM_018237	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	ENST00000265872.6	37	CCDS7282.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.51|15.51	2.854631|2.854631	0.51376|0.51376	.|.	.|.	ENSG00000060339|ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000536012|ENST00000543706	T;T;T;T;T;T|.	0.29917|.	1.55;1.72;1.72;1.72;1.77;1.75|.	5.43|5.43	4.53|4.53	0.55603|0.55603	DNA-binding SAP (4);|.	0.060025|.	0.64402|.	D|.	0.000002|.	T|T	0.64757|0.64757	0.2627|0.2627	M|M	0.66939|0.66939	2.045|2.045	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.71674|.	0.988;0.996;0.998|.	D;D;D|.	0.81914|.	0.984;0.995;0.955|.	T|T	0.63730|0.63730	-0.6571|-0.6571	10|5	0.72032|.	D|.	0.01|.	-8.4663|-8.4663	10.399|10.399	0.44218|0.44218	0.1489:0.0:0.8511:0.0|0.1489:0.0:0.8511:0.0	.|.	646;661;635|.	Q8IX12-2;Q8IX12;F5H2E6|.	.;CCAR1_HUMAN;.|.	H|F	661;646;646;646;635;466|31	ENSP00000265872:Q661H;ENSP00000441820:Q646H;ENSP00000445254:Q646H;ENSP00000439252:Q646H;ENSP00000438610:Q635H;ENSP00000439642:Q466H|.	ENSP00000265872:Q661H|.	Q|V	+|+	3|1	2|0	CCAR1|CCAR1	70190832|70190832	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.959000|0.959000	0.62525|0.62525	4.424000|4.424000	0.59868|0.59868	1.299000|1.299000	0.44798|0.44798	0.655000|0.655000	0.94253|0.94253	CAG|GTT	.	.	none		0.353	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237	
FRG1	2483	hgsc.bcm.edu	37	4	190878658	190878658	+	Splice_Site	SNP	G	G	A	rs76810924		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr4:190878658G>A	ENST00000226798.4	+	6	759		c.e6+1		FRG1_ENST00000514482.1_Splice_Site	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1						mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AATGATCAAGGTAATGATGAC	0.348																																					.		Atlas-SNP	.											FRG1,right_upper_lobe,carcinoma,0,1	FRG1	76	1	0			c.537+1G>A						scavenged	.						47.0	43.0	44.0					4																	190878658		2169	4247	6416	SO:0001630	splice_region_variant	2483	exon6			ATCAAGGTAATGA	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.537+1G>A	4.37:g.190878658G>A		Somatic	525	3	0.00571429		WXS	Illumina HiSeq	Phase_I	511	10	0.0195695	NM_004477	A8K775	Splice_Site	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	N	15.05	2.718286	0.48622	.	.	ENSG00000109536	ENST00000226798;ENST00000524583	.	.	.	3.8	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6226	0.62146	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1	191115652	1.000000	0.71417	1.000000	0.80357	0.557000	0.35523	9.554000	0.98121	1.860000	0.53959	0.454000	0.30748	.	G|0.875;A|0.125	0.125	weak		0.348	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	Intron
MUC4	4585	hgsc.bcm.edu	37	3	195513470	195513470	+	Missense_Mutation	SNP	G	G	C	rs577584155	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:195513470G>C	ENST00000463781.3	-	2	5440	c.4981C>G	c.(4981-4983)Cac>Gac	p.H1661D	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H1661D	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGCGTGACCTGTGGAT	0.587													.|||	6	0.00119808	0.0	0.0	5008	,	,		20843	0.004		0.001	False		,,,				2504	0.001				p.H1661D		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,+2,2	MUC4	1505	2	0			c.C4981G						scavenged	.						26.0	31.0	30.0					3																	195513470		688	1578	2266	SO:0001583	missense	4585	exon2			TGGCGTGACCTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4981C>G	3.37:g.195513470G>C	ENSP00000417498:p.His1661Asp	Somatic	105	10	0.0952381		WXS	Illumina HiSeq	Phase_I	128	12	0.09375	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	1.588	-0.529937	0.04112	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31247	1.57;1.5	0.595	-0.659	0.11424	.	.	.	.	.	T	0.16685	0.0401	N	0.08118	0	0.09310	N	1	P	0.44006	0.824	P	0.46208	0.507	T	0.17077	-1.0381	7	.	.	.	.	.	.	.	.	1661	E7ESK3	.	D	1661	ENSP00000417498:H1661D;ENSP00000420243:H1661D	.	H	-	1	0	MUC4	196997865	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	-4.994000	0.00162	-0.175000	0.10725	-1.880000	0.00545	CAC	.	.	none		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
BIRC7	79444	hgsc.bcm.edu	37	20	61870941	61870941	+	Missense_Mutation	SNP	G	G	A	rs142521563		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr20:61870941G>A	ENST00000217169.3	+	6	1095	c.881G>A	c.(880-882)cGc>cAc	p.R294H	BIRC7_ENST00000342412.6_Missense_Mutation_p.R276H|BIRC7_ENST00000395306.1_Missense_Mutation_p.R189H|MIR3196_ENST00000579556.1_RNA|NKAIN4_ENST00000466885.1_5'Flank	NM_139317.1	NP_647478.1	Q96CA5	BIRC7_HUMAN	baculoviral IAP repeat containing 7	294					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of natural killer cell apoptotic process (GO:0070247)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(9)|ovary(1)	12	all_cancers(38;2.72e-09)					AGCCGCGTGCGCACCTTCCTG	0.721																																					p.R294H		Atlas-SNP	.											BIRC7,colon,carcinoma,0,1	BIRC7	25	1	0			c.G881A						PASS	.	G	HIS/ARG,HIS/ARG	1,4385		0,1,2192	29.0	26.0	27.0		827,881	3.9	1.0	20	dbSNP_134	27	0,8582		0,0,4291	no	missense,missense	BIRC7	NM_022161.2,NM_139317.1	29,29	0,1,6483	AA,AG,GG		0.0,0.0228,0.0077	probably-damaging,probably-damaging	276/281,294/299	61870941	1,12967	2193	4291	6484	SO:0001583	missense	79444	exon6			GCGTGCGCACCTT	AF301009	CCDS13512.1, CCDS13513.1	20q13.3	2011-01-25	2011-01-25		ENSG00000101197	ENSG00000101197		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	13702	protein-coding gene	gene with protein product	"""melanoma inhibitor of apoptosis protein"", ""kidney inhibitor of apoptosis protein"", ""livin inhibitor-of-apoptosis"", ""livin"""	605737	"""baculoviral IAP repeat-containing 7"""			11024045, 11162435	Standard	NM_139317		Approved	mliap, ML-IAP, KIAP, RNF50	uc002yej.3	Q96CA5	OTTHUMG00000032957	ENST00000217169.3:c.881G>A	20.37:g.61870941G>A	ENSP00000217169:p.Arg294His	Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	32	11	0.34375	NM_139317	Q9BQV0|Q9H2A8|Q9HAP7	Missense_Mutation	SNP	ENST00000217169.3	37	CCDS13513.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.923510	0.52653	2.28E-4	0.0	ENSG00000101197	ENST00000342412;ENST00000217169;ENST00000395306	T;T;T	0.56776	0.64;0.44;1.65	4.89	3.94	0.45596	.	0.000000	0.40728	N	0.001031	T	0.51669	0.1688	M	0.70275	2.135	0.58432	D	0.999999	P;P	0.52842	0.943;0.956	B;B	0.42386	0.209;0.386	T	0.58188	-0.7680	10	0.87932	D	0	.	10.498	0.44789	0.162:0.0:0.838:0.0	.	294;276	Q96CA5;Q96CA5-2	BIRC7_HUMAN;.	H	276;294;189	ENSP00000345213:R276H;ENSP00000217169:R294H;ENSP00000378717:R189H	ENSP00000217169:R294H	R	+	2	0	BIRC7	61341386	1.000000	0.71417	0.998000	0.56505	0.136000	0.21042	4.069000	0.57541	1.038000	0.40049	0.467000	0.42956	CGC	G|1.000;A|0.000	0.000	weak		0.721	BIRC7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080114.2	NM_139317	
ZKSCAN1	7586	hgsc.bcm.edu	37	7	99631550	99631550	+	Silent	SNP	G	G	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr7:99631550G>T	ENST00000324306.6	+	6	1656	c.1422G>T	c.(1420-1422)tcG>tcT	p.S474S	ZKSCAN1_ENST00000426572.1_Silent_p.S438S|ZKSCAN1_ENST00000535170.1_Silent_p.S261S	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	474					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			GCCAGAGCTCGGACCTCACCA	0.483																																					p.S474S		Atlas-SNP	.											.	ZKSCAN1	59	.	0			c.G1422T						PASS	.						99.0	106.0	104.0					7																	99631550		2203	4300	6503	SO:0001819	synonymous_variant	7586	exon6			GAGCTCGGACCTC	X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.1422G>T	7.37:g.99631550G>T		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	91	4	0.043956	NM_003439	A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Silent	SNP	ENST00000324306.6	37	CCDS34698.1																																																																																			.	.	none		0.483	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344550.2	NM_003439	
KDM2B	84678	hgsc.bcm.edu	37	12	121891060	121891060	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr12:121891060G>A	ENST00000377071.4	-	13	1894	c.1822C>T	c.(1822-1824)Cgg>Tgg	p.R608W	KDM2B_ENST00000377069.4_Missense_Mutation_p.R577W|KDM2B_ENST00000542973.1_5'UTR|KDM2B_ENST00000536437.1_Missense_Mutation_p.R491W	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	608					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						GTCCGGCGCCGCCGAGCTCCT	0.706																																					p.R608W		Atlas-SNP	.											.	KDM2B	218	.	0			c.C1822T						PASS	.						10.0	13.0	12.0					12																	121891060		1945	4112	6057	SO:0001583	missense	84678	exon13			GGCGCCGCCGAGC	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.1822C>T	12.37:g.121891060G>A	ENSP00000366271:p.Arg608Trp	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	44	11	0.25	NM_032590	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900662	0.72754	.	.	ENSG00000089094	ENST00000397480;ENST00000377069;ENST00000377071;ENST00000536437;ENST00000397478;ENST00000540043;ENST00000261824	T;T;T	0.54675	1.97;1.38;0.56	5.18	0.934	0.19477	Zinc finger, CXXC-type (2);	0.000000	0.47852	D	0.000201	T	0.71134	0.3304	M	0.87547	2.89	0.47245	D	0.999366	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.971;0.999;0.971;0.999	T	0.72001	-0.4422	10	0.87932	D	0	-18.2694	9.0059	0.36111	0.0676:0.0:0.5518:0.3806	.	48;491;608;577;48	B7ZB05;Q1RLM7;Q8NHM5;A8MRS1;B4DSN4	.;.;KDM2B_HUMAN;.;.	W	608;577;608;491;608;48;608	ENSP00000366269:R577W;ENSP00000366271:R608W;ENSP00000445196:R491W	ENSP00000261824:R608W	R	-	1	2	KDM2B	120375443	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	1.788000	0.38714	0.298000	0.22638	-0.266000	0.10368	CGG	.	.	none		0.706	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
RARB	5915	hgsc.bcm.edu	37	3	25611289	25611289	+	Silent	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:25611289G>A	ENST00000404969.1	+	4	510	c.510G>A	c.(508-510)tcG>tcA	p.S170S	RARB_ENST00000462272.1_3'UTR|RARB_ENST00000458646.1_Silent_p.S51S|RARB_ENST00000437042.2_Silent_p.S51S|RARB_ENST00000330688.4_Silent_p.S163S			P10826	RARB_HUMAN	retinoic acid receptor, beta	170	Hinge.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	AGGAGACTTCGAAGCAAGAAT	0.507																																					p.S163S		Atlas-SNP	.											RARB_ENST00000404969,rectum,carcinoma,+1,2	RARB	123	2	0			c.G489A						scavenged	.						118.0	114.0	115.0					3																	25611289		2203	4300	6503	SO:0001819	synonymous_variant	5915	exon4			GACTTCGAAGCAA	Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.510G>A	3.37:g.25611289G>A		Somatic	102	1	0.00980392		WXS	Illumina HiSeq	Phase_I	82	20	0.243902	NM_000965	P12891|Q00989|Q15298|Q9UN48	Silent	SNP	ENST00000404969.1	37																																																																																				.	.	none		0.507	RARB-201	KNOWN	basic	protein_coding	protein_coding		NM_000965, NM_016152	
ATP6V1A	523	hgsc.bcm.edu	37	3	113505224	113505224	+	Missense_Mutation	SNP	T	T	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:113505224T>C	ENST00000273398.3	+	6	818	c.710T>C	c.(709-711)cTt>cCt	p.L237P	ATP6V1A_ENST00000538620.1_Missense_Mutation_p.L204P	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	237					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	CTTGATGCCCTTTTTCCGTAA	0.423																																					p.L237P		Atlas-SNP	.											ATP6V1A,NS,malignant_melanoma,0,1	ATP6V1A	71	1	0			c.T710C						scavenged	.						219.0	201.0	207.0					3																	113505224		2203	4300	6503	SO:0001583	missense	523	exon6			ATGCCCTTTTTCC	L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.710T>C	3.37:g.113505224T>C	ENSP00000273398:p.Leu237Pro	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	121	3	0.0247934	NM_001690	B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Missense_Mutation	SNP	ENST00000273398.3	37	CCDS2976.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.972517	0.74246	.	.	ENSG00000114573	ENST00000273398;ENST00000538620	D;D	0.84223	-1.82;-1.82	5.33	4.17	0.49024	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.94062	0.8097	H	0.96208	3.785	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	D	0.94260	0.7501	10	0.87932	D	0	-16.1423	10.9912	0.47551	0.0:0.0737:0.0:0.9263	.	237	P38606	VATA_HUMAN	P	237;204	ENSP00000273398:L237P;ENSP00000439874:L204P	ENSP00000273398:L237P	L	+	2	0	ATP6V1A	114987914	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.484000	0.81180	0.873000	0.35799	-0.353000	0.07706	CTT	.	.	none		0.423	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354457.1	NM_001690	
OR4D6	219983	hgsc.bcm.edu	37	11	59225155	59225155	+	Missense_Mutation	SNP	C	C	T	rs376910045	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr11:59225155C>T	ENST00000300127.2	+	1	745	c.722C>T	c.(721-723)aCg>aTg	p.T241M		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						TCCACGTGCACGTCCCACATG	0.562													C|||	2	0.000399361	0.0	0.0	5008	,	,		20259	0.0		0.0	False		,,,				2504	0.002				p.T241M		Atlas-SNP	.											OR4D6,colon,carcinoma,-1,1	OR4D6	65	1	0			c.C722T						PASS	.	C	MET/THR	0,4402		0,0,2201	120.0	107.0	112.0		722	5.1	1.0	11		112	1,8589	1.2+/-3.3	0,1,4294	no	missense	OR4D6	NM_001004708.1	81	0,1,6495	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	241/315	59225155	1,12991	2201	4295	6496	SO:0001583	missense	219983	exon1			CGTGCACGTCCCA	AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.722C>T	11.37:g.59225155C>T	ENSP00000300127:p.Thr241Met	Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	55	9	0.163636	NM_001004708	B2RNP7|Q6IFF5|Q96R74	Missense_Mutation	SNP	ENST00000300127.2	37	CCDS31562.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.281877	0.40394	0.0	1.16E-4	ENSG00000166884	ENST00000300127	T	0.40756	1.02	6.01	5.09	0.68999	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000039	T	0.65575	0.2704	M	0.77486	2.375	0.23831	N	0.996728	D	0.89917	1.0	D	0.77004	0.989	T	0.62581	-0.6824	10	0.62326	D	0.03	-21.1448	15.3738	0.74587	0.1406:0.8594:0.0:0.0	.	241	Q8NGJ1	OR4D6_HUMAN	M	241	ENSP00000300127:T241M	ENSP00000300127:T241M	T	+	2	0	OR4D6	58981731	0.000000	0.05858	0.983000	0.44433	0.227000	0.25037	0.628000	0.24522	1.516000	0.48900	0.655000	0.94253	ACG	.	.	weak		0.562	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394234.1	NM_001004708	
ATAD5	79915	hgsc.bcm.edu	37	17	29167653	29167653	+	Missense_Mutation	SNP	A	A	C	rs3764421	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr17:29167653A>C	ENST00000321990.4	+	4	2473	c.2095A>C	c.(2095-2097)Aac>Cac	p.N699H	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	699			N -> H (in dbSNP:rs3764421).		cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				TACTTCAAAAAACATATCAAA	0.284													A|||	722	0.144169	0.0711	0.1859	5008	,	,		15768	0.1359		0.1074	False		,,,				2504	0.2597				p.N699H		Atlas-SNP	.											ATAD5,NS,carcinoma,0,1	ATAD5	150	1	0			c.A2095C						scavenged	.	A	HIS/ASN	320,4086	147.6+/-182.1	15,290,1898	79.0	85.0	83.0		2095	5.9	1.0	17	dbSNP_107	83	890,7710	175.5+/-225.5	37,816,3447	yes	missense	ATAD5	NM_024857.3	68	52,1106,5345	CC,CA,AA		10.3488,7.2628,9.3034	possibly-damaging	699/1845	29167653	1210,11796	2203	4300	6503	SO:0001583	missense	79915	exon4			TCAAAAAACATAT		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.2095A>C	17.37:g.29167653A>C	ENSP00000313171:p.Asn699His	Somatic	387	2	0.00516796		WXS	Illumina HiSeq	Phase_I	360	5	0.0138889	NM_024857	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	CCDS11260.1	274	0.12545787545787546	45	0.09146341463414634	65	0.17955801104972377	92	0.16083916083916083	72	0.09498680738786279	A	12.78	2.039141	0.35989	0.072628	0.103488	ENSG00000176208	ENST00000321990	T	0.09817	2.94	5.9	5.9	0.94986	.	0.925252	0.09360	N	0.812877	T	0.00073	0.0002	M	0.61703	1.905	0.28364	P	0.9203312	D;D	0.71674	0.996;0.998	D;D	0.65874	0.939;0.915	T	0.01795	-1.1272	9	0.72032	D	0.01	.	16.3155	0.82918	1.0:0.0:0.0:0.0	rs3764421;rs52792999;rs59938755;rs3764421	699;699	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	H	699	ENSP00000313171:N699H	ENSP00000313171:N699H	N	+	1	0	ATAD5	26191779	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.491000	0.60326	2.260000	0.74910	0.528000	0.53228	AAC	A|0.885;C|0.115	0.115	strong		0.284	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
MLLT3	4300	hgsc.bcm.edu	37	9	20414373	20414373	+	Silent	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr9:20414373G>A	ENST00000380338.4	-	5	757	c.471C>T	c.(469-471)agC>agT	p.S157S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S154S|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	157	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S157S(5)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.527			T	MLL	ALL																																p.S157S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,NS,carcinoma,0,4	MLLT3	125	4	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)	c.C471T						scavenged	.						9.0	14.0	12.0					9																	20414373		1757	3647	5404	SO:0001819	synonymous_variant	4300	exon5			GCTGCTGCTACTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.471C>T	9.37:g.20414373G>A		Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	21	4	0.190476	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.	.	none		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
TSC22D2	9819	hgsc.bcm.edu	37	3	150176367	150176367	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:150176367G>T	ENST00000361875.3	+	4	3303	c.2287G>T	c.(2287-2289)Gca>Tca	p.A763S	TSC22D2_ENST00000361136.2_Missense_Mutation_p.A739S	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	763					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A763T(1)		cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AGCAGTGATAGCACAGCCTCC	0.443																																					p.A763S		Atlas-SNP	.											TSC22D2,NS,carcinoma,0,1	TSC22D2	42	1	1	Substitution - Missense(1)	kidney(1)	c.G2287T						scavenged	.						96.0	94.0	95.0					3																	150176367		2203	4300	6503	SO:0001583	missense	9819	exon4			GTGATAGCACAGC	AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.2287G>T	3.37:g.150176367G>T	ENSP00000354543:p.Ala763Ser	Somatic	284	1	0.00352113		WXS	Illumina HiSeq	Phase_I	335	4	0.0119403	NM_014779	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	ENST00000361875.3	37	CCDS3149.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.60|11.60	1.686679|1.686679	0.29962|0.29962	.|.	.|.	ENSG00000196428|ENSG00000196428	ENST00000543241;ENST00000361875;ENST00000361136|ENST00000466814	T;T|.	0.33216|.	1.42;1.46|.	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	0.112900|.	0.37809|.	N|.	0.001926|.	T|T	0.43590|0.43590	0.1254|0.1254	N|N	0.12182|0.12182	0.205|0.205	0.34511|0.34511	D|D	0.707131|0.707131	D;D|.	0.76494|.	0.999;0.994|.	D;D|.	0.80764|.	0.994;0.97|.	T|T	0.51521|0.51521	-0.8695|-0.8695	10|5	0.05721|.	T|.	0.95|.	.|.	17.2681|17.2681	0.87093|0.87093	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	739;763|.	O75157-2;O75157|.	.;T22D2_HUMAN|.	S|I	212;763;739|186	ENSP00000354543:A763S;ENSP00000354893:A739S|.	ENSP00000354893:A739S|.	A|S	+|+	1|2	0|0	TSC22D2|TSC22D2	151659057|151659057	1.000000|1.000000	0.71417|0.71417	0.843000|0.843000	0.33291|0.33291	0.627000|0.627000	0.37826|0.37826	4.492000|4.492000	0.60334|0.60334	2.693000|2.693000	0.91896|0.91896	0.655000|0.655000	0.94253|0.94253	GCA|AGC	.	.	none		0.443	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357123.2	NM_014779	
C16orf93	90835	hgsc.bcm.edu	37	16	30770512	30770512	+	Silent	SNP	T	T	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr16:30770512T>C	ENST00000543610.1	-	7	1675	c.714A>G	c.(712-714)ccA>ccG	p.P238P	PHKG2_ENST00000563588.1_3'UTR|PHKG2_ENST00000424889.3_Intron|RNF40_ENST00000324685.6_5'Flank|C16orf93_ENST00000541260.1_Silent_p.P303P	NM_001014979.2	NP_001014979.2	A1A4V9	CP093_HUMAN	chromosome 16 open reading frame 93	238										breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)	11						TCTCACTCTCTGGCCACAGTT	0.597																																					p.P238P		Atlas-SNP	.											.	C16orf93	33	.	0			c.A714G						PASS	.						68.0	70.0	70.0					16																	30770512		2197	4300	6497	SO:0001819	synonymous_variant	90835	exon7			ACTCTCTGGCCAC	BC042548	CCDS32434.1, CCDS32434.2, CCDS55993.1	16p11.2	2012-10-10			ENSG00000196118	ENSG00000196118			28078	protein-coding gene	gene with protein product							Standard	NM_001195620		Approved	MGC104706	uc002dzm.3	A1A4V9	OTTHUMG00000167926	ENST00000543610.1:c.714A>G	16.37:g.30770512T>C		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	51	12	0.235294	NM_001014979	A1A4V8|F5GX13|Q569G2	Silent	SNP	ENST00000543610.1	37	CCDS32434.2	.	.	.	.	.	.	.	.	.	.	T	5.075	0.199509	0.09652	.	.	ENSG00000196118	ENST00000535476	.	.	.	5.12	2.78	0.32641	.	.	.	.	.	T	0.51686	0.1689	.	.	.	0.51482	D	0.999921	.	.	.	.	.	.	T	0.39563	-0.9608	4	.	.	.	-0.303	4.4208	0.11479	0.1727:0.094:0.0:0.7333	.	.	.	.	R	135	.	.	Q	-	2	0	C16orf93	30678013	0.438000	0.25602	0.578000	0.28575	0.575000	0.36095	0.133000	0.15912	0.327000	0.23409	0.533000	0.62120	CAG	.	.	none		0.597	C16orf93-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397089.1	NM_001014979	
SLCO1B1	10599	hgsc.bcm.edu	37	12	21331570	21331570	+	Missense_Mutation	SNP	G	G	T	rs142101690		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr12:21331570G>T	ENST00000256958.2	+	6	638	c.542G>T	c.(541-543)cGt>cTt	p.R181L		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	181					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	AATATGCTTCGTGGAATAGGG	0.348																																					p.R181L		Atlas-SNP	.											SLCO1B1,scalp,carcinoma,+1,1	SLCO1B1	151	1	0			c.G542T						scavenged	.						144.0	133.0	137.0					12																	21331570		2203	4300	6503	SO:0001583	missense	10599	exon6			TGCTTCGTGGAAT		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.542G>T	12.37:g.21331570G>T	ENSP00000256958:p.Arg181Leu	Somatic	314	0	0		WXS	Illumina HiSeq	Phase_I	291	5	0.0171821	NM_006446	B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	ENST00000256958.2	37	CCDS8685.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.917223	0.52546	.	.	ENSG00000134538	ENST00000256958	T	0.54866	0.55	3.62	3.62	0.41486	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.63733	0.2536	L	0.41961	1.31	0.58432	D	0.999999	D	0.71674	0.998	D	0.76071	0.987	T	0.63440	-0.6637	10	0.36615	T	0.2	.	15.813	0.78578	0.0:0.0:1.0:0.0	.	181	Q9Y6L6	SO1B1_HUMAN	L	181	ENSP00000256958:R181L	ENSP00000256958:R181L	R	+	2	0	SLCO1B1	21222837	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	7.198000	0.77823	2.018000	0.59344	0.313000	0.20887	CGT	G|1.000;A|0.000	.	alt		0.348	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446	
PTPRD	5789	hgsc.bcm.edu	37	9	8518055	8518055	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr9:8518055C>A	ENST00000381196.4	-	18	1879	c.1336G>T	c.(1336-1338)Gga>Tga	p.G446*	PTPRD_ENST00000397606.3_Nonsense_Mutation_p.G436*|PTPRD_ENST00000355233.5_Nonsense_Mutation_p.G446*|PTPRD_ENST00000397611.3_Nonsense_Mutation_p.G443*|PTPRD_ENST00000397617.3_Nonsense_Mutation_p.G436*|PTPRD_ENST00000358503.5_Nonsense_Mutation_p.G433*|PTPRD_ENST00000537002.1_Nonsense_Mutation_p.G443*|PTPRD_ENST00000356435.5_Nonsense_Mutation_p.G446*|PTPRD_ENST00000360074.4_Nonsense_Mutation_p.G433*|PTPRD_ENST00000540109.1_Nonsense_Mutation_p.G446*|PTPRD_ENST00000486161.1_Nonsense_Mutation_p.G446*	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	446	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TGGATCTGTCCATTTGGCTCT	0.458										TSP Lung(15;0.13)																											p.G446X		Atlas-SNP	.											PTPRD,scalp,malignant_melanoma,+1,1	PTPRD	1348	1	0			c.G1336T						scavenged	.						279.0	252.0	261.0					9																	8518055		2203	4300	6503	SO:0001587	stop_gained	5789	exon10			TCTGTCCATTTGG	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1336G>T	9.37:g.8518055C>A	ENSP00000370593:p.Gly446*	Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	140	3	0.0214286	NM_130392	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Nonsense_Mutation	SNP	ENST00000381196.4	37	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.990614	0.93106	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9787	0.92747	0.0:1.0:0.0:0.0	.	.	.	.	X	446;446;433;433;446;436;443;443;446;446;446;436	.	.	G	-	1	0	PTPRD	8508055	1.000000	0.71417	1.000000	0.80357	0.025000	0.11179	7.770000	0.85390	2.484000	0.83849	0.467000	0.42956	GGA	.	.	none		0.458	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
TET1	80312	hgsc.bcm.edu	37	10	70332320	70332320	+	Silent	SNP	A	A	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr10:70332320A>G	ENST00000373644.4	+	2	434	c.225A>G	c.(223-225)acA>acG	p.T75T		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	75					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GCCTTCTGACAAGAGCTGGAG	0.428																																					p.T75T		Atlas-SNP	.											TET1_ENST00000373644,NS,carcinoma,+1,1	TET1	255	1	0			c.A225G						scavenged	.						69.0	75.0	73.0					10																	70332320		2203	4300	6503	SO:0001819	synonymous_variant	80312	exon2			TCTGACAAGAGCT	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.225A>G	10.37:g.70332320A>G		Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	162	2	0.0123457	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Silent	SNP	ENST00000373644.4	37	CCDS7281.1																																																																																			.	.	none		0.428	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
CCDC12	151903	hgsc.bcm.edu	37	3	46965118	46965118	+	Silent	SNP	G	G	T	rs369626562		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:46965118G>T	ENST00000546280.1	-	4	332	c.285C>A	c.(283-285)ccC>ccA	p.P95P	CCDC12_ENST00000425441.1_Silent_p.P108P|CCDC12_ENST00000292314.2_Silent_p.P108P|CCDC12_ENST00000605358.1_5'UTR	NM_144716.3	NP_653317.2	Q8WUD4	CCD12_HUMAN	coiled-coil domain containing 12	95										endometrium(1)|large_intestine(1)|urinary_tract(1)	3		Prostate(884;0.0143)|Ovarian(412;0.0448)|Acute lymphoblastic leukemia(5;0.143)		OV - Ovarian serous cystadenocarcinoma(275;2.2e-56)|BRCA - Breast invasive adenocarcinoma(193;0.00136)|KIRC - Kidney renal clear cell carcinoma(197;0.00703)|Kidney(197;0.00809)		TGACGGGCTCGGGCTTGGCGG	0.607											OREG0015545	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R108R		Atlas-SNP	.											CCDC12,NS,carcinoma,-2,1	CCDC12	9	1	0			c.G324A						scavenged	.						61.0	50.0	54.0					3																	46965118		2203	4300	6503	SO:0001819	synonymous_variant	151903	exon5			GGGCTCGGGCTTG	BC020830	CCDS2748.1, CCDS2748.2, CCDS2748.3, CCDS63612.1	3p21.31	2006-10-24			ENSG00000160799	ENSG00000160799			28332	protein-coding gene	gene with protein product						12477932	Standard	NM_001277074		Approved	MGC23918	uc003cqo.3	Q8WUD4	OTTHUMG00000133513	ENST00000546280.1:c.285C>A	3.37:g.46965118G>T		Somatic	121	0	0	943	WXS	Illumina HiSeq	Phase_I	125	2	0.016	NM_144716	Q8N8I4	Silent	SNP	ENST00000546280.1	37																																																																																				.	.	alt		0.607	CCDC12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144716	
MYO18B	84700	hgsc.bcm.edu	37	22	26242205	26242205	+	Silent	SNP	C	C	T	rs375428629		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr22:26242205C>T	ENST00000407587.2	+	19	3679	c.3510C>T	c.(3508-3510)gcC>gcT	p.A1170A	MYO18B_ENST00000536101.1_Silent_p.A1169A|MYO18B_ENST00000335473.7_Silent_p.A1169A			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1169	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GCAGCCTTGCCGCGGTGAGGA	0.652																																					p.A1169A		Atlas-SNP	.											.	MYO18B	322	.	0			c.C3507T						PASS	.	C		1,4315		0,1,2157	71.0	84.0	80.0		3507	-8.6	0.0	22		80	0,8484		0,0,4242	no	coding-synonymous	MYO18B	NM_032608.5		0,1,6399	TT,TC,CC		0.0,0.0232,0.0078		1169/2568	26242205	1,12799	2158	4242	6400	SO:0001819	synonymous_variant	84700	exon19			CCTTGCCGCGGTG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.3510C>T	22.37:g.26242205C>T		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	48	11	0.229167	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	37																																																																																				.	.	weak		0.652	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
PODN	127435	hgsc.bcm.edu	37	1	53544260	53544260	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:53544260C>T	ENST00000312553.5	+	8	1229	c.1222C>T	c.(1222-1224)Cgg>Tgg	p.R408W	PODN_ENST00000395871.2_Missense_Mutation_p.R266W|PODN_ENST00000371500.3_Missense_Mutation_p.R389W|RP11-334A14.5_ENST00000447867.1_RNA	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	360					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GGGCCTCAAGCGGTTGCACAC	0.652																																					p.R408W		Atlas-SNP	.											.	PODN	86	.	0			c.C1222T						PASS	.						57.0	54.0	55.0					1																	53544260		2203	4300	6503	SO:0001583	missense	127435	exon8			CTCAAGCGGTTGC	AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.1222C>T	1.37:g.53544260C>T	ENSP00000308315:p.Arg408Trp	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	84	24	0.285714	NM_153703	B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Missense_Mutation	SNP	ENST00000312553.5	37	CCDS573.1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536732	0.65085	.	.	ENSG00000174348	ENST00000371500;ENST00000395871;ENST00000312553	T;T;T	0.58940	0.3;0.3;0.3	4.81	1.05	0.20165	.	0.456979	0.21202	N	0.078445	T	0.72630	0.3484	M	0.74467	2.265	0.32794	N	0.500809	D;D;D	0.76494	0.999;0.999;0.994	D;D;P	0.67103	0.949;0.946;0.877	T	0.80204	-0.1479	10	0.72032	D	0.01	.	14.7344	0.69406	0.8156:0.1844:0.0:0.0	.	266;389;408	Q7Z5L7-4;Q7Z5L7-2;Q7Z5L7-3	.;.;.	W	389;266;408	ENSP00000360555:R389W;ENSP00000379212:R266W;ENSP00000308315:R408W	ENSP00000308315:R408W	R	+	1	2	PODN	53316848	1.000000	0.71417	0.989000	0.46669	0.994000	0.84299	1.866000	0.39489	0.051000	0.15978	0.555000	0.69702	CGG	.	.	none		0.652	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024735.1	NM_153703	
KRTAP4-3	85290	hgsc.bcm.edu	37	17	39324333	39324333	+	Missense_Mutation	SNP	T	T	A	rs12953139	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr17:39324333T>A	ENST00000391356.2	-	1	91	c.92A>T	c.(91-93)cAg>cTg	p.Q31L		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	31					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCAGGTGGTCTGGCAGCAGCT	0.637																																					p.Q31L		Atlas-SNP	.											KRTAP4-3,NS,carcinoma,0,1	KRTAP4-3	40	1	0			c.A92T						scavenged	.						29.0	32.0	31.0					17																	39324333		2195	4293	6488	SO:0001583	missense	85290	exon1			GTGGTCTGGCAGC	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.92A>T	17.37:g.39324333T>A	ENSP00000375151:p.Gln31Leu	Somatic	112	9	0.0803571		WXS	Illumina HiSeq	Phase_I	155	46	0.296774	NM_033187		Missense_Mutation	SNP	ENST00000391356.2	37	CCDS42331.1	.	.	.	.	.	.	.	.	.	.	.	8.661	0.900435	0.17686	.	.	ENSG00000196156	ENST00000391356	T	0.01629	4.72	5.15	0.112	0.14623	.	.	.	.	.	T	0.03608	0.0103	M	0.85373	2.75	0.80722	P	0.0	B	0.34181	0.44	B	0.38378	0.272	T	0.11131	-1.0600	8	0.35671	T	0.21	.	3.821	0.08836	0.1588:0.2591:0.0:0.5822	.	31	Q9BYR4	KRA43_HUMAN	L	31	ENSP00000375151:Q31L	ENSP00000375151:Q31L	Q	-	2	0	KRTAP4-3	36577859	0.006000	0.16342	0.208000	0.23602	0.204000	0.24138	0.129000	0.15830	0.020000	0.15106	0.533000	0.62120	CAG	A|0.046;T|0.954	0.046	strong		0.637	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
MTHFD1	4522	hgsc.bcm.edu	37	14	64882380	64882380	+	Missense_Mutation	SNP	A	A	G	rs1950902	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr14:64882380A>G	ENST00000545908.1	+	6	798	c.569A>G	c.(568-570)aAa>aGa	p.K190R	MTHFD1_ENST00000216605.8_Missense_Mutation_p.K134R			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	134	Methylenetetrahydrofolate dehydrogenase and cyclohydrolase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	aatgctgggaaacttgctaga	0.363													A|||	4124	0.823482	0.8616	0.9107	5008	,	,		22898	0.6448		0.7962	False		,,,				2504	0.9223				p.K134R	Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	Atlas-SNP	.											MTHFD1,tonsil,carcinoma,0,1	MTHFD1	61	1	0			c.A401G	GRCh37	CM065321	MTHFD1	M	rs1950902	scavenged	.	A	ARG/LYS	3728,678	763.1+/-413.2	1567,594,42	80.0	73.0	75.0		401	5.1	1.0	14	dbSNP_92	75	7087,1513	747.6+/-407.3	2928,1231,141	yes	missense	MTHFD1	NM_005956.3	26	4495,1825,183	GG,GA,AA		17.593,15.3881,16.8461	benign	134/936	64882380	10815,2191	2203	4300	6503	SO:0001583	missense	4522	exon6			CTGGGAAACTTGC	J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.569A>G	14.37:g.64882380A>G	ENSP00000438588:p.Lys190Arg	Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	117	3	0.025641	NM_005956	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	ENST00000545908.1	37		1768	0.8095238095238095	420	0.8536585365853658	326	0.9005524861878453	416	0.7272727272727273	606	0.7994722955145118	A	12.12	1.841279	0.32513	0.846119	0.82407	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605;ENST00000555252	T;T;T;T	0.56103	0.48;0.48;0.48;0.48	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	.	.	.	0.09310	P	0.999999360405	B;B	0.14012	0.003;0.009	B;B	0.17098	0.009;0.017	T	0.28396	-1.0045	8	0.08599	T	0.76	-21.4612	15.1283	0.72500	1.0:0.0:0.0:0.0	rs1950902;rs2070262;rs17854633;rs17858060;rs52808281;rs57359350;rs1950902	190;134	F5H2F4;G3V2B8	.;.	R	190;134;190;114	ENSP00000438588:K190R;ENSP00000450560:K134R;ENSP00000216605:K190R;ENSP00000451309:K114R	ENSP00000216605:K134R	K	+	2	0	MTHFD1	63952133	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	8.820000	0.92003	2.032000	0.59987	0.374000	0.22700	AAA	G|0.827;N|0.000	0.827	strong		0.363	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000412167.1		
MUC6	4588	hgsc.bcm.edu	37	11	1017483	1017483	+	Missense_Mutation	SNP	T	T	G	rs79986665		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr11:1017483T>G	ENST00000421673.2	-	31	5368	c.5318A>C	c.(5317-5319)cAc>cCc	p.H1773P		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1773	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGTACTGGTGTGGTTGGGGGT	0.577																																					p.H1773P		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,0,2	MUC6	408	2	0			c.A5318C						scavenged	.						544.0	541.0	542.0					11																	1017483		2199	4294	6493	SO:0001583	missense	4588	exon31			CTGGTGTGGTTGG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5318A>C	11.37:g.1017483T>G	ENSP00000406861:p.His1773Pro	Somatic	285	43	0.150877		WXS	Illumina HiSeq	Phase_I	261	47	0.180077	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	T	4.174	0.030796	0.08101	.	.	ENSG00000184956	ENST00000421673	T	0.17528	2.27	2.91	0.844	0.18943	.	.	.	.	.	T	0.04907	0.0132	N	0.01109	-1.01	0.09310	N	1	B	0.15930	0.015	B	0.14023	0.01	T	0.43065	-0.9414	9	0.22706	T	0.39	.	6.6218	0.22808	0.0:0.1732:0.4682:0.3586	.	1773	Q6W4X9	MUC6_HUMAN	P	1773	ENSP00000406861:H1773P	ENSP00000406861:H1773P	H	-	2	0	MUC6	1007483	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.094000	0.11094	0.066000	0.16515	-0.743000	0.03520	CAC	T|0.500;G|0.500	0.500	weak		0.577	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
SYNRG	11276	hgsc.bcm.edu	37	17	35913676	35913676	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr17:35913676C>T	ENST00000339208.6	-	14	2289	c.2149G>A	c.(2149-2151)Gag>Aag	p.E717K	SYNRG_ENST00000588194.1_5'UTR|SYNRG_ENST00000591288.1_Missense_Mutation_p.E556K|SYNRG_ENST00000585472.1_Missense_Mutation_p.E638K|SYNRG_ENST00000502449.2_Missense_Mutation_p.E639K|SYNRG_ENST00000394378.2_Missense_Mutation_p.E639K|SYNRG_ENST00000346661.4_Missense_Mutation_p.E717K|SYNRG_ENST00000345615.4_Missense_Mutation_p.E639K	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	717	Interaction with A1P1G1 and A1P1G2.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CTGGCTTCCTCTTTAAGGGCA	0.473																																					p.E717K		Atlas-SNP	.											.	SYNRG	101	.	0			c.G2149A						PASS	.						54.0	55.0	54.0					17																	35913676		2203	4300	6503	SO:0001583	missense	11276	exon14			CTTCCTCTTTAAG	AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.2149G>A	17.37:g.35913676C>T	ENSP00000343610:p.Glu717Lys	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	73	7	0.0958904	NM_007247	A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	ENST00000339208.6	37	CCDS11321.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.603368	0.66445	.	.	ENSG00000006114	ENST00000346661;ENST00000339208;ENST00000345615;ENST00000502449;ENST00000394378	T;T;T;T;T	0.50548	1.48;1.15;0.74;0.9;0.9	6.17	6.17	0.99709	.	0.196730	0.53938	D	0.000058	T	0.38585	0.1046	L	0.54323	1.7	0.39716	D	0.971399	P;B;B;B;P;P	0.47762	0.57;0.317;0.317;0.317;0.9;0.9	B;B;B;B;B;B	0.39258	0.255;0.228;0.228;0.228;0.295;0.295	T	0.22591	-1.0212	10	0.16420	T	0.52	-12.6231	10.2468	0.43345	0.0:0.7921:0.1368:0.071	.	556;639;639;639;717;717	B7ZKZ2;Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;.;SYNRG_HUMAN	K	717;556;717;639;639	ENSP00000005279:E717K;ENSP00000343610:E556K;ENSP00000315722:E717K;ENSP00000424893:E639K;ENSP00000377903:E639K	ENSP00000343610:E556K	E	-	1	0	SYNRG	32987789	0.729000	0.28090	0.990000	0.47175	0.951000	0.60555	1.279000	0.33191	2.941000	0.99782	0.655000	0.94253	GAG	.	.	none		0.473	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256811.2	NM_007247	
POLR2B	5431	hgsc.bcm.edu	37	4	57881715	57881715	+	Silent	SNP	G	G	A	rs1713982	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr4:57881715G>A	ENST00000381227.1	+	15	2261	c.1848G>A	c.(1846-1848)acG>acA	p.T616T	POLR2B_ENST00000314595.5_Silent_p.T616T|POLR2B_ENST00000510355.1_3'UTR|POLR2B_ENST00000431623.2_Silent_p.T541T|POLR2B_ENST00000441246.2_Silent_p.T609T			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	616					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					GGATCTATACGGATGCAGGCC	0.333													A|||	1934	0.386182	0.4342	0.2954	5008	,	,		10572	0.2986		0.3469	False		,,,				2504	0.5164				p.T616T		Atlas-SNP	.											POLR2B,colon,carcinoma,0,1	POLR2B	108	1	0			c.G1848A						scavenged	.	A		1882,2524	629.0+/-395.2	403,1076,724	119.0	125.0	123.0		1848	-2.7	1.0	4	dbSNP_89	123	2939,5661	667.8+/-402.5	487,1965,1848	no	coding-synonymous	POLR2B	NM_000938.1		890,3041,2572	AA,AG,GG		34.1744,42.7145,37.0675		616/1175	57881715	4821,8185	2203	4300	6503	SO:0001819	synonymous_variant	5431	exon14			CTATACGGATGCA		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.1848G>A	4.37:g.57881715G>A		Somatic	179	1	0.00558659		WXS	Illumina HiSeq	Phase_I	158	2	0.0126582	NM_000938	A8K1A8|Q8IZ61	Silent	SNP	ENST00000381227.1	37	CCDS3511.1																																																																																			G|0.634;A|0.366	0.366	strong		0.333	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
MUC6	4588	hgsc.bcm.edu	37	11	1017575	1017575	+	Silent	SNP	C	C	T	rs76222533		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr11:1017575C>T	ENST00000421673.2	-	31	5276	c.5226G>A	c.(5224-5226)acG>acA	p.T1742T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1742	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGGTTTTGGCCGTGCTAAATG	0.537													-|||	1	0.000199681	0.0	0.0014	5008	,	,		39036	0.0		0.0	False		,,,				2504	0.0				p.T1742T		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,0,2	MUC6	408	2	0			c.G5226A						scavenged	.						697.0	677.0	684.0					11																	1017575		2190	4282	6472	SO:0001819	synonymous_variant	4588	exon31			TTTGGCCGTGCTA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5226G>A	11.37:g.1017575C>T		Somatic	247	31	0.125506		WXS	Illumina HiSeq	Phase_I	258	22	0.0852713	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																			C|0.500;T|0.500	0.500	strong		0.537	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
CERS6	253782	hgsc.bcm.edu	37	2	169417787	169417787	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr2:169417787G>A	ENST00000305747.6	+	3	949	c.362G>A	c.(361-363)cGc>cAc	p.R121H	CERS6_ENST00000392687.4_Missense_Mutation_p.R121H	NM_203463.2	NP_982288.1	Q6ZMG9	CERS6_HUMAN	ceramide synthase 6	121					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										CGACAAAGACGCAATCAGGAG	0.458																																					p.R121H		Atlas-SNP	.											LASS6,colon,carcinoma,+1,1	.	.	1	0			c.G362A						PASS	.						151.0	143.0	145.0					2																	169417787		2203	4300	6503	SO:0001583	missense	253782	exon3			AAAGACGCAATCA	BX393696	CCDS2228.1, CCDS58734.1	2q31	2011-07-11	2011-07-08	2011-07-08	ENSG00000172292	ENSG00000172292		"""Homeoboxes / CERS class"""	23826	protein-coding gene	gene with protein product		615336	"""LAG1 longevity assurance homolog 6 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 6"""	LASS6			Standard	NM_203463		Approved		uc002uec.2	Q6ZMG9	OTTHUMG00000132183	ENST00000305747.6:c.362G>A	2.37:g.169417787G>A	ENSP00000306579:p.Arg121His	Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	73	20	0.273973	NM_001256126	Q32M63|Q8N617	Missense_Mutation	SNP	ENST00000305747.6	37	CCDS2228.1	.	.	.	.	.	.	.	.	.	.	G	34	5.405789	0.96051	.	.	ENSG00000172292	ENST00000305747;ENST00000392687	D;D	0.99158	-5.5;-5.5	5.31	5.31	0.75309	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.045720	0.85682	D	0.000000	D	0.99518	0.9828	H	0.94423	3.535	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.995;0.998	D	0.98417	1.0575	10	0.52906	T	0.07	-28.4318	19.3447	0.94358	0.0:0.0:1.0:0.0	.	121;121	Q32M63;Q6ZMG9	.;CERS6_HUMAN	H	121	ENSP00000306579:R121H;ENSP00000376453:R121H	ENSP00000306579:R121H	R	+	2	0	CERS6	169126033	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	9.813000	0.99286	2.641000	0.89580	0.650000	0.86243	CGC	.	.	none		0.458	CERS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255235.2	NM_203463	
GPR32	2854	hgsc.bcm.edu	37	19	51274851	51274851	+	Missense_Mutation	SNP	A	A	C	rs201404376		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:51274851A>C	ENST00000270590.4	+	1	1131	c.994A>C	c.(994-996)Act>Cct	p.T332P		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	332					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CCAGTCTTTGACTTCTGCCCT	0.552																																					p.T332P	Esophageal Squamous(113;152 1581 5732 15840 44398)	Atlas-SNP	.											GPR32,NS,carcinoma,0,5	GPR32	68	5	0			c.A994C						scavenged	.						66.0	71.0	69.0					19																	51274851		2203	4298	6501	SO:0001583	missense	2854	exon1			TCTTTGACTTCTG	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.994A>C	19.37:g.51274851A>C	ENSP00000270590:p.Thr332Pro	Somatic	64	3	0.046875		WXS	Illumina HiSeq	Phase_I	58	7	0.12069	NM_001506	Q502U7|Q6NWS5	Missense_Mutation	SNP	ENST00000270590.4	37	CCDS12801.1	.	.	.	.	.	.	.	.	.	.	a	0.006	-2.066505	0.00382	.	.	ENSG00000142511	ENST00000270590	T	0.36699	1.24	2.71	-0.781	0.10965	.	.	.	.	.	T	0.12518	0.0304	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31138	-0.9954	9	0.02654	T	1	.	3.6506	0.08202	0.205:0.5623:0.0:0.2327	.	332	O75388	GPR32_HUMAN	P	332	ENSP00000270590:T332P	ENSP00000270590:T332P	T	+	1	0	GPR32	55966663	0.000000	0.05858	0.025000	0.17156	0.653000	0.38743	0.089000	0.15002	-0.262000	0.09392	-0.755000	0.03482	ACT	.	.	weak		0.552	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1		
FAM120B	84498	hgsc.bcm.edu	37	6	170627883	170627883	+	Missense_Mutation	SNP	T	T	G	rs143059540	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:170627883T>G	ENST00000476287.1	+	2	1513	c.1405T>G	c.(1405-1407)Tcc>Gcc	p.S469A	FAM120B_ENST00000540480.1_Missense_Mutation_p.S481A|FAM120B_ENST00000537664.1_Missense_Mutation_p.S492A|FAM120B_ENST00000252510.9_Intron	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	469					cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		AGGCCCTGAATCCAGGCAAGA	0.468																																					p.S469A		Atlas-SNP	.											FAM120B,NS,carcinoma,0,2	FAM120B	108	2	0			c.T1405G						scavenged	.						150.0	161.0	157.0					6																	170627883		2203	4300	6503	SO:0001583	missense	84498	exon2			CCTGAATCCAGGC	AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.1405T>G	6.37:g.170627883T>G	ENSP00000417970:p.Ser469Ala	Somatic	152	3	0.0197368		WXS	Illumina HiSeq	Phase_I	155	6	0.0387097	NM_032448	B4DL34|Q86V68|Q96JI9	Missense_Mutation	SNP	ENST00000476287.1	37	CCDS5314.1	.	.	.	.	.	.	.	.	.	.	T	0.006	-2.023375	0.00414	.	.	ENSG00000112584	ENST00000540480;ENST00000537664;ENST00000476287	T;T;T	0.08370	3.13;3.1;3.13	1.31	-2.63	0.06133	.	1.867690	0.03051	N	0.154568	T	0.01287	0.0042	L	0.58101	1.795	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.53599	-0.8416	10	0.07644	T	0.81	.	2.1106	0.03702	0.1737:0.1223:0.1139:0.5901	.	469;469	Q96EK7;F2Z2E1	F120B_HUMAN;.	A	481;492;469	ENSP00000444125:S481A;ENSP00000440125:S492A;ENSP00000417970:S469A	ENSP00000436640:S469A	S	+	1	0	FAM120B	170469808	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-4.559000	0.00216	-6.111000	0.00006	-3.860000	0.00018	TCC	T|1.000;C|0.000	.	alt		0.468	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000043259.2	NM_032448	
HSPD1	3329	hgsc.bcm.edu	37	2	198363534	198363534	+	Silent	SNP	C	C	T	rs565153254		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr2:198363534C>T	ENST00000388968.3	-	2	306	c.39G>A	c.(37-39)ccG>ccA	p.P13P	HSPE1_ENST00000409468.1_5'Flank|HSPD1_ENST00000544407.1_Silent_p.P13P|HSPE1_ENST00000233893.5_5'Flank|HSPD1_ENST00000345042.2_Silent_p.P13P|HSPE1_ENST00000409729.1_5'Flank|HSPE1-MOB4_ENST00000604458.1_5'Flank	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)	13					'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)	p.P13P(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			CCCTGGACACCGGTCTCATCT	0.502																																					p.P13P		Atlas-SNP	.											HSPD1_ENST00000426480,NS,haematopoietic_neoplasm,0,3	HSPD1	68	3	1	Substitution - coding silent(1)	breast(1)	c.G39A						scavenged	.						52.0	49.0	50.0					2																	198363534		2203	4300	6503	SO:0001819	synonymous_variant	3329	exon2			GGACACCGGTCTC	M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.39G>A	2.37:g.198363534C>T		Somatic	393	3	0.00763359		WXS	Illumina HiSeq	Phase_I	377	4	0.0106101	NM_002156	B2R5M6|B7Z712|Q38L19|Q9UCR6	Silent	SNP	ENST00000388968.3	37	CCDS33357.1																																																																																			.	.	none		0.502	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335324.2	NM_002156	
EP400	57634	hgsc.bcm.edu	37	12	132547093	132547093	+	Silent	SNP	A	A	G	rs10902490|rs528214697	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr12:132547093A>G	ENST00000333577.4	+	48	8398	c.8289A>G	c.(8287-8289)caA>caG	p.Q2763Q	EP400_ENST00000330386.6_Silent_p.Q2646Q|EP400_ENST00000389562.2_Silent_p.Q2726Q|EP400_ENST00000332482.4_Silent_p.Q2690Q|EP400_ENST00000389561.2_Silent_p.Q2727Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2763	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2726Q(9)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacaacagcagcagc	0.567																																					p.Q2727Q		Atlas-SNP	.											EP400,NS,carcinoma,0,15	EP400	370	15	9	Substitution - coding silent(9)	lung(3)|kidney(2)|endometrium(2)|central_nervous_system(2)	c.A8181G						scavenged	.						25.0	29.0	28.0					12																	132547093		2173	4217	6390	SO:0001819	synonymous_variant	57634	exon47			GCAACAACAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8289A>G	12.37:g.132547093A>G		Somatic	56	1	0.0178571		WXS	Illumina HiSeq	Phase_I	75	3	0.04	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				A|0.500;G|0.500	0.500	weak		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
FAM120B	84498	hgsc.bcm.edu	37	6	170627869	170627869	+	Missense_Mutation	SNP	A	A	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:170627869A>G	ENST00000476287.1	+	2	1499	c.1391A>G	c.(1390-1392)tAt>tGt	p.Y464C	FAM120B_ENST00000540480.1_Missense_Mutation_p.Y476C|FAM120B_ENST00000537664.1_Missense_Mutation_p.Y487C|FAM120B_ENST00000252510.9_Intron	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	464					cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		GTTCCCATGTATACAGGCCCT	0.473																																					p.Y464C		Atlas-SNP	.											FAM120B,NS,carcinoma,+1,1	FAM120B	108	1	0			c.A1391G						scavenged	.						158.0	171.0	167.0					6																	170627869		2203	4300	6503	SO:0001583	missense	84498	exon2			CCATGTATACAGG	AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.1391A>G	6.37:g.170627869A>G	ENSP00000417970:p.Tyr464Cys	Somatic	149	4	0.0268456		WXS	Illumina HiSeq	Phase_I	153	9	0.0588235	NM_032448	B4DL34|Q86V68|Q96JI9	Missense_Mutation	SNP	ENST00000476287.1	37	CCDS5314.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.569559	0.00895	.	.	ENSG00000112584	ENST00000540480;ENST00000537664;ENST00000476287	T;T;T	0.07688	3.17;3.17;3.17	2.33	-4.67	0.03319	.	2.051180	0.02593	N	0.100141	T	0.00724	0.0024	N	0.02315	-0.6	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.41574	-0.9501	10	0.36615	T	0.2	.	5.1008	0.14759	0.2586:0.0:0.3377:0.4037	.	464;464	Q96EK7;F2Z2E1	F120B_HUMAN;.	C	476;487;464	ENSP00000444125:Y476C;ENSP00000440125:Y487C;ENSP00000417970:Y464C	ENSP00000436640:Y464C	Y	+	2	0	FAM120B	170469794	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.507000	0.00448	-4.063000	0.00077	-1.462000	0.01023	TAT	.	.	none		0.473	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000043259.2	NM_032448	
