#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLCB1	23236	hgsc.bcm.edu	37	20	8352099	8352100	+	Splice_Site	INS	-	-	AGGATCCC			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr20:8352099_8352100insAGGATCCC	ENST00000338037.6	+	3	273		c.e3+2		PLCB1_ENST00000378637.2_Splice_Site|PLCB1_ENST00000378641.3_Splice_Site	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)						activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						GCTCCCAAGGTAGGAGGTTGAG	0.446																																					.		Pindel,Atlas-Indel	.											.	PLCB1	394	.	0			c.246+2->AGGATCCC						PASS	.																																			SO:0001630	splice_region_variant	23236	exon3			.	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.246+2->AGGATCCC	20.37:g.8352099_8352100insAGGATCCC		Somatic	71	.	.		WXS	Illumina HiSeq	Phase_I	62	19	0.306	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Splice_Site	INS	ENST00000338037.6	37	CCDS13102.1																																																																																			.	.	none		0.446	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		Intron
SYNE1	23345	hgsc.bcm.edu	37	6	152737628	152737629	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr6:152737628_152737629insT	ENST00000367255.5	-	41	6544_6545	c.5943_5944insA	c.(5941-5946)aaagcafs	p.A1982fs	SYNE1_ENST00000448038.1_Frame_Shift_Ins_p.A1989fs|SYNE1_ENST00000341594.5_Frame_Shift_Ins_p.A2019fs|SYNE1_ENST00000265368.4_Frame_Shift_Ins_p.A1982fs|SYNE1_ENST00000423061.1_Frame_Shift_Ins_p.A1989fs	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1982					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTGGAATGCTTTTTTCAACA	0.495										HNSCC(10;0.0054)																											p.A1989fs		Pindel,Atlas-Indel	.											.	SYNE1	3227	.	0			c.5965_5966insA						PASS	.																																			SO:0001589	frameshift_variant	23345	exon41			.	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.5944dupA	6.37:g.152737634_152737634dupT	ENSP00000356224:p.Ala1982fs	Somatic	255	.	.		WXS	Illumina HiSeq	Phase_I	107	24	0.224	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Frame_Shift_Ins	INS	ENST00000367255.5	37	CCDS5236.2																																																																																			.	.	none		0.495	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
CNPY4	245812	hgsc.bcm.edu	37	7	99720170	99720170	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr7:99720170delT	ENST00000262932.3	+	3	444	c.312delT	c.(310-312)gctfs	p.A104fs	CNPY4_ENST00000480692.1_3'UTR|TAF6_ENST00000437822.2_5'Flank|RP11-506M12.1_ENST00000494221.1_RNA	NM_152755.1	NP_689968.1	Q8N129	CNPY4_HUMAN	canopy FGF signaling regulator 4	104						extracellular region (GO:0005576)				breast(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTGTTCACGCTGAGCGCAAGG	0.522																																					p.A104fs		Atlas-Indel	.											.	CNPY4	18	.	0			c.311delC						PASS	.						101.0	106.0	105.0					7																	99720170		2203	4300	6503	SO:0001589	frameshift_variant	245812	exon3			.	AK075537	CCDS34701.1	7q22.1	2013-07-23	2013-07-23		ENSG00000166997	ENSG00000166997			28631	protein-coding gene	gene with protein product	"""protein associated with TLR4"""	610047	"""canopy 4 homolog (zebrafish)"""			12975309	Standard	NM_152755		Approved	MGC40499, PRAT4B	uc003uto.3	Q8N129	OTTHUMG00000154817	ENST00000262932.3:c.312delT	7.37:g.99720170delT	ENSP00000262932:p.Ala104fs	Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	87	17	0.195402	NM_152755	Q8WUN9	Frame_Shift_Del	DEL	ENST00000262932.3	37	CCDS34701.1																																																																																			.	.	none		0.522	CNPY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337224.4	NM_152755	
SPRR3	6707	hgsc.bcm.edu	37	1	152975659	152975682	+	In_Frame_Del	DEL	GAGCCAGGCTGTACCAAGGTCCCT	GAGCCAGGCTGTACCAAGGTCCCT	-	rs568163793|rs553429466|rs74134624	byFrequency	TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	GAGCCAGGCTGTACCAAGGTCCCT	GAGCCAGGCTGTACCAAGGTCCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:152975659_152975682delGAGCCAGGCTGTACCAAGGTCCCT	ENST00000295367.4	+	2	205_228	c.163_186delGAGCCAGGCTGTACCAAGGTCCCT	c.(163-186)gagccaggctgtaccaaggtccctdel	p.EPGCTKVP95del	SPRR3_ENST00000542696.1_In_Frame_Del_p.EPGCTKVP87del|SPRR3_ENST00000331860.3_In_Frame_Del_p.EPGCTKVP95del	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	95	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAAGATTCCAGAGCCAGGCTGTACCAAGGTCCCTGAGCCAGGCT	0.562																																					p.54_62del		Atlas-Indel	.											SPRR3,colon,carcinoma,+2,1	SPRR3	45	1	0			c.162_185del						PASS	.		,	2036,1952		740,556,698					,	-1.4	0.0		dbSNP_130	70	3135,4775		852,1431,1672	no	coding,coding	SPRR3	NM_005416.2,NM_001097589.1	,	1592,1987,2370	A1A1,A1R,RR		39.6334,48.9468,43.4611	,	,		5171,6727				SO:0001651	inframe_deletion	6707	exon2			.	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.163_186delGAGCCAGGCTGTACCAAGGTCCCT	1.37:g.152975659_152975682delGAGCCAGGCTGTACCAAGGTCCCT	ENSP00000295367:p.Glu95_Pro102del	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	91	41	0.450549	NM_001097589	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	In_Frame_Del	DEL	ENST00000295367.4	37	CCDS1033.1																																																																																			.	.	weak		0.562	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
ENTHD1	150350	hgsc.bcm.edu	37	22	40161596	40161599	+	Frame_Shift_Del	DEL	GAGA	GAGA	-	rs140918120	byFrequency	TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	GAGA	GAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr22:40161596_40161599delGAGA	ENST00000325157.6	-	6	1098_1101	c.848_851delTCTC	c.(847-852)ctctcafs	p.LS283fs		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	283										breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					ACTATTTTCTGAGAGAGTAGGCAC	0.319																																					p.283_284del		Atlas-Indel	.											.	ENTHD1	83	.	0			c.849_852del						PASS	.																																			SO:0001589	frameshift_variant	150350	exon6			.	AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.848_851delTCTC	22.37:g.40161596_40161599delGAGA	ENSP00000317431:p.Leu283fs	Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	92	12	0.130435	NM_152512	B0QYD5|Q5H9F7|Q96LK3	Frame_Shift_Del	DEL	ENST00000325157.6	37	CCDS13998.1																																																																																			.	.	none		0.319	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	NM_152512	
NEFH	4744	hgsc.bcm.edu	37	22	29885567	29885568	+	In_Frame_Ins	INS	-	-	AAGTCCCCTGAGAAGGCC	rs147489453|rs559153194|rs75808076|rs59279731		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr22:29885567_29885568insAAGTCCCCTGAGAAGGCC	ENST00000310624.6	+	4	1971_1972	c.1938_1939insAAGTCCCCTGAGAAGGCC	c.(1939-1941)aag>AAGTCCCCTGAGAAGGCCaag	p.647_647K>KSPEKAK		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	653	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGAGGAAGCAAAGTCCCCTGA	0.569																																					p.A646delinsAKSPEKA		Atlas-Indel	.											NEFH,rectum,carcinoma,0,1	NEFH	178	1	0			c.1938_1939insAAGTCCCCTGAGAAGGCC						PASS	.			2816,1448		937,942,253						-5.3	0.0		dbSNP_134	77	5046,3206		1537,1972,617	no	coding	NEFH	NM_021076.3		2474,2914,870	A1A1,A1R,RR		38.8512,33.9587,37.1844				7862,4654				SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1939_1956dupAAGTCCCCTGAGAAGGCC	22.37:g.29885567_29885568insAAGTCCCCTGAGAAGGCC	Exception_encountered	Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	55	25	0.454545	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	strong		0.569	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
SETX	23064	hgsc.bcm.edu	37	9	135221697	135221698	+	Frame_Shift_Ins	INS	-	-	GGAACTC			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr9:135221697_135221698insGGAACTC	ENST00000224140.5	-	4	520_521	c.338_339insGAGTTCC	c.(337-339)cctfs	p.-113fs	SETX_ENST00000372169.2_Frame_Shift_Ins_p.-113fs|SETX_ENST00000393220.1_Frame_Shift_Ins_p.-113fs	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin						cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TTTCAAGAAGAGGAACTCGAAG	0.342																																					p.P113fs		Pindel,Atlas-Indel	.											SETX,NS,carcinoma,-2,1	SETX	234	1	0			c.339_340insGAGTTCC						PASS	.																																			SO:0001589	frameshift_variant	23064	exon4			.	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.332_338dupGAGTTCC	9.37:g.135221698_135221704dupGGAACTC	ENSP00000224140:p.Pro113fs	Somatic	144	.	.		WXS	Illumina HiSeq	Phase_I	85	27	0.318	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Frame_Shift_Ins	INS	ENST00000224140.5	37	CCDS6947.1																																																																																			.	.	none		0.342	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
SPTBN5	51332	hgsc.bcm.edu	37	15	42172481	42172482	+	Frame_Shift_Ins	INS	-	-	ATGG			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr15:42172481_42172482insATGG	ENST00000320955.6	-	14	2914_2915	c.2687_2688insCCAT	c.(2686-2688)atgfs	p.M896fs		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	896					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CGAACAGGGCCATGGCCTCCTC	0.668																																					p.M861fs		Pindel,Atlas-Indel	.											.	SPTBN5	171	.	0			c.2583_2584insCCAT						PASS	.																																			SO:0001589	frameshift_variant	51332	exon14			.	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.2684_2687dupCCAT	15.37:g.42172482_42172485dupATGG	ENSP00000317790:p.Met896fs	Somatic	111	.	.		WXS	Illumina HiSeq	Phase_I	69	18	0.261	NM_016642		Frame_Shift_Ins	INS	ENST00000320955.6	37																																																																																				.	.	none		0.668	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346595	39346596	+	In_Frame_Ins	INS	-	-	GCTGTGGGTCCAGCTGCTGCCAGCCTA	rs33927480|rs377187211|rs148036927|rs11283848	byFrequency	TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr17:39346595_39346596insGCTGTGGGTCCAGCTGCTGCCAGCCTA	ENST00000398470.1	+	1	457_458	c.457_458insGCTGTGGGTCCAGCTGCTGCCAGCCTA	c.(457-459)tgc>tGCTGTGGGTCCAGCTGCTGCCAGCCTAgc	p.153_154insCGSSCCQPS	KRTAP9-1_ENST00000318329.5_In_Frame_Ins_p.70_71insCGSSCCQPS|KRTAP9-1_ENST00000377723.3_Intron	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	153	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)		p.T152_C153>S(2)		breast(1)|lung(3)	4						CCAGCCCACCTGCTGTGGGTCC	0.584														4543	0.907149	0.9402	0.889	5008	,	,		27695	0.8512		0.8698	False		,,,				2504	0.9714				p.C153delinsCCGSSCCQPS		Atlas-Indel	.											KRTAP9-1_ENST00000398470,rectum,carcinoma,0,2	KRTAP9-1	34	2	2	Complex - deletion inframe(2)	breast(2)	c.457_458insGCTGTGGGTCCAGCTGCTGCCAGCCTA						PASS	.																																			SO:0001652	inframe_insertion	728318	exon1			.	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	Exception_encountered	17.37:g.39346595_39346596insGCTGTGGGTCCAGCTGCTGCCAGCCTA	ENSP00000381488:p.Cys153_Cys154insCysGlySerSerCysCysGlnProSer	Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	102	46	0.45098	NM_001190460		In_Frame_Ins	INS	ENST00000398470.1	37	CCDS56029.1																																																																																			.	.	none		0.584	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
TCHH	7062	hgsc.bcm.edu	37	1	152084202	152084203	+	In_Frame_Ins	INS	-	-	CGCCTCTCCTGCTGCTCG			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:152084202_152084203insCGCCTCTCCTGCTGCTCG	ENST00000368804.1	-	2	1489_1490	c.1490_1491insCGAGCAGCAGGAGAGGCG	c.(1489-1491)cgc>cgCGAGCAGCAGGAGAGGCGc	p.497_497R>REQQERR		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	497	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGCTGCTCGCGCCTCTCCTC	0.668																																					p.R497delinsREQQERR		Atlas-Indel	.											.	TCHH	275	.	0			c.1491_1492insCGAGCAGCAGGAGAGGCG						PASS	.																																			SO:0001652	inframe_insertion	7062	exon3			.	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1473_1490dupCGAGCAGCAGGAGAGGCG	1.37:g.152084202_152084203insCGCCTCTCCTGCTGCTCG	Exception_encountered	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	94	11	0.117021	NM_007113	Q5VUI3	In_Frame_Ins	INS	ENST00000368804.1	37	CCDS41396.1																																																																																			.	.	none		0.668	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
FLG	2312	hgsc.bcm.edu	37	1	152285878	152285878	+	Missense_Mutation	SNP	G	G	A	rs139321371		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:152285878G>A	ENST00000368799.1	-	3	1519	c.1484C>T	c.(1483-1485)tCg>tTg	p.S495L	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	495	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCGTGGTGCGATCCTTGTCT	0.607									Ichthyosis																												p.S495L		Atlas-SNP	.											FLG,NS,carcinoma,0,1	FLG	900	1	0			c.C1484T						PASS	.	G	LEU/SER	0,4406		0,0,2203	278.0	260.0	266.0		1484	-2.5	0.0	1	dbSNP_134	266	1,8599		0,1,4299	no	missense	FLG	NM_002016.1	145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	495/4062	152285878	1,13005	2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TGGTGCGATCCTT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1484C>T	1.37:g.152285878G>A	ENSP00000357789:p.Ser495Leu	Somatic	233	0	0		WXS	Illumina HiSeq	Phase_I	180	21	0.116667	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	10.99	1.506078	0.26949	0.0	1.16E-4	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.03745	3.82	2.94	-2.49	0.06403	.	.	.	.	.	T	0.05364	0.0142	M	0.80028	2.48	0.09310	N	1	D	0.71674	0.998	D	0.79108	0.992	T	0.12528	-1.0544	9	0.31617	T	0.26	.	5.7028	0.17891	0.0:0.3484:0.2968:0.3548	.	495	P20930	FILA_HUMAN	L	495;27	ENSP00000357789:S495L	ENSP00000357789:S495L	S	-	2	0	FLG	150552502	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.842000	0.00737	-0.654000	0.05394	0.505000	0.49811	TCG	G|1.000;A|0.000	0.000	weak		0.607	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
MRPL49	740	hgsc.bcm.edu	37	11	64889115	64889115	+	5'Flank	SNP	G	G	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr11:64889115G>C	ENST00000279242.2	+	0	0				MRPL49_ENST00000534078.1_5'Flank|FAU_ENST00000531743.1_Splice_Site_p.A26G|MRPL49_ENST00000531705.1_5'Flank|MRPL49_ENST00000526171.1_5'Flank|FAU_ENST00000434372.2_Splice_Site_p.A26G|FAU_ENST00000529639.1_Splice_Site_p.A26G|FAU_ENST00000525297.1_Intron|FAU_ENST00000279259.3_Splice_Site_p.A26G|FAU_ENST00000527548.1_Splice_Site_p.A26G|FAU_ENST00000529259.1_Splice_Site_p.A26G	NM_004927.3	NP_004918.1	Q13405	RM49_HUMAN	mitochondrial ribosomal protein L49						translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			endometrium(1)|ovary(1)	2						GGCTACATGAGCCTACAGGGA	0.612																																					p.A26G		Atlas-SNP	.											.	FAU	17	.	0			c.C77G						PASS	.						59.0	52.0	54.0					11																	64889115		2201	4297	6498	SO:0001631	upstream_gene_variant	2197	exon3			ACATGAGCCTACA		CCDS8096.1	11q13.1	2012-11-14	2001-10-16	2001-10-19	ENSG00000149792	ENSG00000149792		"""Mitochondrial ribosomal proteins / large subunits"""	1176	protein-coding gene	gene with protein product	"""neighbor of FAU"", ""next to FAU"""	606866	"""chromosome 11 open reading frame 4"""	C11orf4		8786148	Standard	NM_004927		Approved	NOF, NOF1, L49mt	uc001oda.2	Q13405	OTTHUMG00000165608		11.37:g.64889115G>C	Exception_encountered	Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	76	14	0.184211	NM_001997	B2R4G6	Missense_Mutation	SNP	ENST00000279242.2	37	CCDS8096.1	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452215	0.43531	.	.	ENSG00000149806	ENST00000529639;ENST00000531743;ENST00000527548;ENST00000279259;ENST00000529259;ENST00000526555;ENST00000434372	T;T;T;T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85	6.17	3.2	0.36748	Ubiquitin supergroup (1);Ubiquitin conserved site (1);Ubiquitin (2);	0.257041	0.44688	D	0.000439	T	0.78214	0.4248	M	0.78637	2.42	0.29175	N	0.876885	B;P	0.40000	0.015;0.698	B;P	0.46975	0.075;0.533	T	0.74372	-0.3687	10	0.72032	D	0.01	.	9.7529	0.40485	0.0:0.1301:0.4671:0.4028	.	26;26	E9PMS9;P35544	.;UBIM_HUMAN	G	26	ENSP00000435370:A26G;ENSP00000431822:A26G;ENSP00000434440:A26G;ENSP00000279259:A26G;ENSP00000434680:A26G;ENSP00000433139:A26G;ENSP00000413848:A26G	ENSP00000279259:A26G	A	-	2	0	FAU	64645691	1.000000	0.71417	0.997000	0.53966	0.191000	0.23601	3.507000	0.53371	0.425000	0.26087	-0.169000	0.13324	GCT	.	.	none		0.612	MRPL49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385293.1	NM_004927	
HELZ2	85441	hgsc.bcm.edu	37	20	62194351	62194351	+	Missense_Mutation	SNP	C	C	G	rs148162381		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr20:62194351C>G	ENST00000467148.1	-	8	5893	c.5824G>C	c.(5824-5826)Gcc>Ccc	p.A1942P	HELZ2_ENST00000427522.2_Missense_Mutation_p.A1373P	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1942					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CACACGCAGGCGTACTCATCC	0.667																																					p.A1942P		Atlas-SNP	.											.	.	.	.	0			c.G5824C						PASS	.						13.0	11.0	12.0					20																	62194351		2161	4264	6425	SO:0001583	missense	85441	exon9			CGCAGGCGTACTC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.5824G>C	20.37:g.62194351C>G	ENSP00000417401:p.Ala1942Pro	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	79	21	0.265823	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	C	4.849	0.157913	0.09236	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	T;T	0.80033	-1.33;-1.23	4.75	-9.5	0.00584	.	1.864240	0.02078	N	0.052103	T	0.66896	0.2836	N	0.22421	0.69	0.09310	N	1	P;P	0.46020	0.797;0.871	B;P	0.45406	0.286;0.479	T	0.70676	-0.4806	10	0.33141	T	0.24	-1.2872	4.4847	0.11783	0.1009:0.3812:0.1031:0.4149	.	1942;1373	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	P	1373;1942	ENSP00000393257:A1373P;ENSP00000417401:A1942P	ENSP00000393257:A1373P	A	-	1	0	RP4-697K14.7	61664795	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.460000	0.02368	-4.162000	0.00068	-1.185000	0.01705	GCC	C|1.000;T|0.000	.	alt		0.667	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
B3GALNT2	148789	hgsc.bcm.edu	37	1	235647809	235647809	+	Silent	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:235647809C>T	ENST00000366600.3	-	4	612	c.384G>A	c.(382-384)gcG>gcA	p.A128A	B3GALNT2_ENST00000494378.1_5'UTR|B3GALNT2_ENST00000313984.3_Silent_p.A169A	NM_152490.2	NP_689703.1	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2	128					protein glycosylation (GO:0006486)|protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|acetylglucosaminyltransferase activity (GO:0008375)|galactosyltransferase activity (GO:0008378)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			ACAGACTGAACGCTTCAATTT	0.423																																					p.A128A		Atlas-SNP	.											.	B3GALNT2	36	.	0			c.G384A						PASS	.						138.0	137.0	138.0					1																	235647809		2203	4300	6503	SO:0001819	synonymous_variant	148789	exon4			ACTGAACGCTTCA	BC029564	CCDS1606.1, CCDS60453.1	1q42.3	2013-02-19	2006-06-14		ENSG00000162885	ENSG00000162885		"""Beta 3-glycosyltransferases"""	28596	protein-coding gene	gene with protein product		610194	"""UDP-GalNAc:betaGlcNAc beta-1,3-galactosaminyltransferase, polypeptide 2"""			14724282	Standard	NM_001277155		Approved	MGC39558	uc001hxc.3	Q8NCR0	OTTHUMG00000040468	ENST00000366600.3:c.384G>A	1.37:g.235647809C>T		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	61	14	0.229508	NM_152490	Q59GR3|Q5TCI3|Q96AL7	Silent	SNP	ENST00000366600.3	37	CCDS1606.1																																																																																			.	.	none		0.423	B3GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097376.1	NM_152490	
HLA-C	3107	hgsc.bcm.edu	37	6	31238009	31238009	+	Silent	SNP	T	T	C	rs1131014	byFrequency	TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr6:31238009T>C	ENST00000376228.5	-	4	887	c.873A>G	c.(871-873)caA>caG	p.Q291Q	HLA-C_ENST00000383329.3_Silent_p.Q291Q	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	291	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						TGAGGGGCTCTTGCAGCCCCT	0.592													C|||	2561	0.511382	0.6172	0.549	5008	,	,		13431	0.5744		0.4404	False		,,,				2504	0.3497				p.Q291Q		Atlas-SNP	.											HLA-C_ENST00000383329,colon,carcinoma,0,2	HLA-C	92	2	0			c.A873G						scavenged	.						23.0	30.0	28.0					6																	31238009		2121	4194	6315	SO:0001819	synonymous_variant	3107	exon4			GGGCTCTTGCAGC	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.873A>G	6.37:g.31238009T>C		Somatic	41	16	0.390244		WXS	Illumina HiSeq	Phase_I	64	46	0.71875	NM_002117	O02864|O02958|Q29643|Q9MY30	Silent	SNP	ENST00000376228.5	37	CCDS34393.1	872	0.3992673992673993	230	0.46747967479674796	148	0.4088397790055249	255	0.4458041958041958	239	0.3153034300791557	.	0.019	-1.465537	0.01053	.	.	ENSG00000204525	ENST00000415537	.	.	.	2.67	-5.33	0.02713	.	.	.	.	.	T	0.06005	0.0156	.	.	.	0.53005	P	3.799999999998249E-5	.	.	.	.	.	.	T	0.24154	-1.0168	3	.	.	.	.	2.6503	0.04996	0.1827:0.239:0.4507:0.1277	rs41551714	.	.	.	R	255	.	.	K	-	2	0	HLA-C	31345988	0.000000	0.05858	0.108000	0.21378	0.013000	0.08279	-3.876000	0.00344	-1.974000	0.00998	-0.711000	0.03637	AAG	T|0.651;C|0.349	0.349	strong		0.592	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
UBR4	23352	hgsc.bcm.edu	37	1	19491323	19491323	+	Nonsense_Mutation	SNP	A	A	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:19491323A>T	ENST00000375254.3	-	32	4508	c.4481T>A	c.(4480-4482)tTa>tAa	p.L1494*	UBR4_ENST00000375267.2_Nonsense_Mutation_p.L1494*|UBR4_ENST00000375217.2_Nonsense_Mutation_p.L1494*|UBR4_ENST00000375226.2_Nonsense_Mutation_p.L1494*	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1494					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGTGGTCAGTAACTGCAGCAG	0.493																																					p.L1494X		Atlas-SNP	.											.	UBR4	415	.	0			c.T4481A						PASS	.						116.0	114.0	114.0					1																	19491323		2203	4300	6503	SO:0001587	stop_gained	23352	exon32			GTCAGTAACTGCA	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.4481T>A	1.37:g.19491323A>T	ENSP00000364403:p.Leu1494*	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	64	16	0.25	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Nonsense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	A	31	5.095569	0.94197	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	.	.	.	5.99	5.99	0.97316	.	0.081308	0.49916	D	0.000127	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	16.1557	0.81666	1.0:0.0:0.0:0.0	.	.	.	.	X	1494;1494;1494;1494;204;710	.	ENSP00000364365:L1494X	L	-	2	0	UBR4	19363910	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	6.871000	0.75531	2.291000	0.77112	0.533000	0.62120	TTA	.	.	none		0.493	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
KIAA0040	9674	hgsc.bcm.edu	37	1	175129933	175129933	+	Missense_Mutation	SNP	T	T	C	rs150137790		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:175129933T>C	ENST00000423313.1	-	4	753	c.217A>G	c.(217-219)Aag>Gag	p.K73E	KIAA0040_ENST00000444639.1_Missense_Mutation_p.K73E|KIAA0040_ENST00000567124.1_5'Flank|KIAA0040_ENST00000545251.2_Missense_Mutation_p.K73E	NM_001162893.1|NM_001162895.1|NM_014656.2	NP_001156365.1|NP_001156367.1|NP_055471.2	Q15053	K0040_HUMAN	KIAA0040	0																	tccttcttcttcttcttcttc	0.502																																					p.K73E		Atlas-SNP	.											KIAA0040,colon,carcinoma,0,1	KIAA0040	2	1	0			c.A217G						PASS	.						107.0	90.0	95.0					1																	175129933		692	1591	2283	SO:0001583	missense	9674	exon3			TCTTCTTCTTCTT	D25539		1q24-q25	2012-11-29			ENSG00000235750	ENSG00000235750			28950	protein-coding gene	gene with protein product							Standard	NM_014656		Approved		uc001gkn.3	Q15053	OTTHUMG00000034880	ENST00000423313.1:c.217A>G	1.37:g.175129933T>C	ENSP00000462172:p.Lys73Glu	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	93	8	0.0860215	NM_001162895	A8K9H6|Q2NKQ0	Missense_Mutation	SNP	ENST00000423313.1	37																																																																																				.	.	none		0.502	KIAA0040-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000084420.3	NM_014656	
FAM161B	145483	hgsc.bcm.edu	37	14	74411424	74411424	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr14:74411424C>T	ENST00000534936.1	-	3	644	c.539G>A	c.(538-540)cGc>cAc	p.R180H	FAM161B_ENST00000286544.3_Missense_Mutation_p.R243H			Q96MY7	F161B_HUMAN	family with sequence similarity 161, member B	180										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)	21						CCGGGCCTCGCGCAGCGTCAT	0.672																																					p.R243H		Atlas-SNP	.											.	FAM161B	67	.	0			c.G728A						PASS	.						26.0	27.0	26.0					14																	74411424		2203	4300	6503	SO:0001583	missense	145483	exon3			GCCTCGCGCAGCG	AA356453	CCDS9822.1, CCDS9822.2	14q24.2	2008-06-05	2008-06-05	2008-06-05		ENSG00000156050			19854	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 44"""	C14orf44			Standard	NM_152445		Approved	FLJ31697	uc001xpd.3	Q96MY7		ENST00000534936.1:c.539G>A	14.37:g.74411424C>T	ENSP00000445326:p.Arg180His	Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	89	19	0.213483	NM_152445	B7Z882|J3KNA2	Missense_Mutation	SNP	ENST00000534936.1	37		.	.	.	.	.	.	.	.	.	.	C	20.7	4.035056	0.75617	.	.	ENSG00000156050	ENST00000286544;ENST00000534936	T;T	0.76316	-1.01;-1.01	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000002	D	0.89935	0.6859	M	0.87682	2.9	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	D	0.91329	0.5088	10	0.87932	D	0	-7.9894	18.8556	0.92251	0.0:1.0:0.0:0.0	.	180	Q96MY7	F161B_HUMAN	H	243;180	ENSP00000286544:R243H;ENSP00000445326:R180H	ENSP00000286544:R243H	R	-	2	0	FAM161B	73481177	1.000000	0.71417	0.996000	0.52242	0.200000	0.23975	5.085000	0.64468	2.688000	0.91661	0.563000	0.77884	CGC	.	.	none		0.672	FAM161B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_152445	
FOXD4	2298	hgsc.bcm.edu	37	9	117998	117998	+	Missense_Mutation	SNP	G	G	T	rs66612967	byFrequency	TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr9:117998G>T	ENST00000382500.2	-	1	419	c.122C>A	c.(121-123)gCg>gAg	p.A41E		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	41					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A41E(1)		endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CTGGCTCGCCGCCTCCTCCTC	0.682													T|||	111	0.0221645	0.0749	0.013	5008	,	,		13954	0.001		0.002	False		,,,				2504	0.0				p.A41E		Atlas-SNP	.											FOXD4_ENST00000382500,NS,carcinoma,0,3	FOXD4	75	3	1	Substitution - Missense(1)	skin(1)	c.C122A						scavenged	.						38.0	53.0	48.0					9																	117998		2203	4298	6501	SO:0001583	missense	2298	exon1			CTCGCCGCCTCCT	U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.122C>A	9.37:g.117998G>T	ENSP00000371940:p.Ala41Glu	Somatic	282	20	0.070922		WXS	Illumina HiSeq	Phase_I	186	21	0.112903	NM_207305	B2RN05|B9EGL7|Q5VVK1|Q8WXT6	Missense_Mutation	SNP	ENST00000382500.2	37	CCDS34975.1	50	0.022893772893772892	43	0.08739837398373984	4	0.011049723756906077	3	0.005244755244755245	0	0.0	.	0.012	-1.673624	0.00758	.	.	ENSG00000170122	ENST00000382500	D	0.94457	-3.43	1.56	1.56	0.23342	.	.	.	.	.	T	0.13030	0.0316	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.57458	-0.7808	9	0.02654	T	1	.	4.5559	0.12136	0.0:0.0:0.3427:0.6573	.	41	Q12950	FOXD4_HUMAN	E	41	ENSP00000371940:A41E	ENSP00000371940:A41E	A	-	2	0	FOXD4	107998	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	-0.379000	0.07437	0.095000	0.17434	-1.316000	0.01300	GCG	G|0.977;T|0.023	0.023	strong		0.682	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055433.1	NM_207305	
RYR2	6262	hgsc.bcm.edu	37	1	237819151	237819151	+	Missense_Mutation	SNP	C	C	A	rs370333448		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:237819151C>A	ENST00000366574.2	+	53	8313	c.7996C>A	c.(7996-7998)Ctg>Atg	p.L2666M	RYR2_ENST00000542537.1_Missense_Mutation_p.L2650M|RYR2_ENST00000360064.6_Missense_Mutation_p.L2664M	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2666	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAAACTGGCACTGCCTTGCCT	0.408																																					p.L2666M		Atlas-SNP	.											.	RYR2	1273	.	0			c.C7996A						PASS	.						43.0	42.0	42.0					1																	237819151		1837	4092	5929	SO:0001583	missense	6262	exon53			CTGGCACTGCCTT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7996C>A	1.37:g.237819151C>A	ENSP00000355533:p.Leu2666Met	Somatic	198	0	0		WXS	Illumina HiSeq	Phase_I	242	83	0.342975	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	10.59	1.391987	0.25118	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.95069	-3.6;-3.6;-3.6	5.95	4.86	0.63082	.	0.000000	0.47093	D	0.000249	D	0.84995	0.5596	N	0.12527	0.23	0.80722	D	1	B	0.31599	0.33	B	0.28709	0.093	T	0.80443	-0.1380	10	0.32370	T	0.25	-11.7878	5.4522	0.16570	0.2052:0.6592:0.0:0.1356	.	2666	Q92736	RYR2_HUMAN	M	2666;2664;2650	ENSP00000355533:L2666M;ENSP00000353174:L2664M;ENSP00000443798:L2650M	ENSP00000353174:L2664M	L	+	1	2	RYR2	235885774	0.234000	0.23783	1.000000	0.80357	0.998000	0.95712	0.729000	0.26028	2.826000	0.97356	0.563000	0.77884	CTG	.	.	none		0.408	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
MYT1L	23040	hgsc.bcm.edu	37	2	1796099	1796099	+	Silent	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr2:1796099C>T	ENST00000399161.2	-	24	4161	c.3414G>A	c.(3412-3414)ccG>ccA	p.P1138P	MYT1L_ENST00000407844.1_Silent_p.P136P|MYT1L_ENST00000428368.2_Silent_p.P1136P	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1138					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TTACCATGTGCGGCAGCTGGA	0.517																																					p.P1136P		Atlas-SNP	.											MYT1L,trunk,malignant_melanoma,-1,1	MYT1L	241	1	0			c.G3408A						PASS	.						59.0	61.0	61.0					2																	1796099		2086	4227	6313	SO:0001819	synonymous_variant	23040	exon24			CATGTGCGGCAGC	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3414G>A	2.37:g.1796099C>T		Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	83	19	0.228916	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	37																																																																																				.	.	none		0.517	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
EXTL3	2137	hgsc.bcm.edu	37	8	28588800	28588800	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr8:28588800A>T	ENST00000220562.4	+	4	3111	c.2209A>T	c.(2209-2211)Aca>Tca	p.T737S	EXTL3_ENST00000519886.1_Intron|EXTL3_ENST00000523149.1_Missense_Mutation_p.T353S	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	737					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		TGAAATTGAGACAGAGGCCAT	0.433																																					p.T737S		Atlas-SNP	.											.	EXTL3	83	.	0			c.A2209T						PASS	.						133.0	121.0	125.0					8																	28588800		2203	4300	6503	SO:0001583	missense	2137	exon4			ATTGAGACAGAGG	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.2209A>T	8.37:g.28588800A>T	ENSP00000220562:p.Thr737Ser	Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	76	40	0.526316	NM_001440	D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	ENST00000220562.4	37	CCDS6070.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	28.5|28.5	4.928506|4.928506	0.92389|0.92389	.|.	.|.	ENSG00000012232|ENSG00000012232	ENST00000521473|ENST00000523149;ENST00000220562;ENST00000521532	.|D;D;D	.|0.92595	.|-3.07;-3.07;-3.07	5.13|5.13	5.13|5.13	0.70059|0.70059	.|EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96734|0.96734	0.8934|0.8934	M|M	0.91140|0.91140	3.18|3.18	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.97429|0.97429	1.0014|1.0014	5|10	.|0.62326	.|D	.|0.03	-11.0701|-11.0701	15.1147|15.1147	0.72392|0.72392	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|737	.|O43909	.|EXTL3_HUMAN	V|S	70|353;737;35	.|ENSP00000428691:T353S;ENSP00000220562:T737S;ENSP00000431013:T35S	.|ENSP00000220562:T737S	D|T	+|+	2|1	0|0	EXTL3|EXTL3	28644719|28644719	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.922000|0.922000	0.55478|0.55478	8.989000|8.989000	0.93506|0.93506	2.150000|2.150000	0.67090|0.67090	0.477000|0.477000	0.44152|0.44152	GAC|ACA	.	.	none		0.433	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440	
BIRC6	57448	hgsc.bcm.edu	37	2	32773075	32773075	+	Silent	SNP	T	T	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr2:32773075T>C	ENST00000421745.2	+	64	13103	c.12969T>C	c.(12967-12969)ctT>ctC	p.L4323L		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4323					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TTACCTGCCTTCTGCAGGTAT	0.378																																					p.L4323L	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											.	BIRC6	838	.	0			c.T12969C						PASS	.						60.0	57.0	58.0					2																	32773075		2203	4300	6503	SO:0001819	synonymous_variant	57448	exon64			CTGCCTTCTGCAG	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.12969T>C	2.37:g.32773075T>C		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	115	47	0.408696	NM_016252	Q9ULD1	Silent	SNP	ENST00000421745.2	37	CCDS33175.2																																																																																			.	.	none		0.378	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
FKBP10	60681	hgsc.bcm.edu	37	17	39974646	39974646	+	Silent	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr17:39974646C>T	ENST00000321562.4	+	4	698	c.594C>T	c.(592-594)ggC>ggT	p.G198G	FKBP10_ENST00000544340.1_5'Flank	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	198	PPIase FKBP-type 2. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		ACAGTAAGGGCGGCACTTATG	0.607																																					p.G198G		Atlas-SNP	.											FKBP10,NS,carcinoma,+2,1	FKBP10	57	1	0			c.C594T						PASS	.						86.0	76.0	79.0					17																	39974646		2203	4300	6503	SO:0001819	synonymous_variant	60681	exon4			TAAGGGCGGCACT	AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.594C>T	17.37:g.39974646C>T		Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	122	22	0.180328	NM_021939	Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Silent	SNP	ENST00000321562.4	37	CCDS11409.1																																																																																			.	.	none		0.607	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257410.2	NM_021939	
JMJD1C	221037	hgsc.bcm.edu	37	10	64966940	64966940	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr10:64966940T>C	ENST00000399262.2	-	10	4707	c.4489A>G	c.(4489-4491)Agt>Ggt	p.S1497G	JMJD1C_ENST00000542921.1_Missense_Mutation_p.S1315G|JMJD1C_ENST00000402544.1_Missense_Mutation_p.S1278G|JMJD1C_ENST00000399251.1_Missense_Mutation_p.S1278G	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1497					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					CTGGCATTACTACTTTTATAC	0.408																																					p.S1497G		Atlas-SNP	.											.	JMJD1C	347	.	0			c.A4489G						PASS	.						105.0	100.0	102.0					10																	64966940		1886	4113	5999	SO:0001583	missense	221037	exon10			CATTACTACTTTT	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.4489A>G	10.37:g.64966940T>C	ENSP00000382204:p.Ser1497Gly	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	177	27	0.152542	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	T	10.93	1.490177	0.26686	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.56275	0.84;0.47;2.38;0.82	5.75	4.6	0.57074	.	0.145674	0.64402	D	0.000008	T	0.40767	0.1130	L	0.29908	0.895	0.40990	D	0.984842	B;B;B	0.13145	0.007;0.007;0.007	B;B;B	0.11329	0.004;0.006;0.004	T	0.36792	-0.9733	10	0.52906	T	0.07	-16.6876	11.907	0.52717	0.0:0.0691:0.0:0.9309	.	1038;1497;1315	A6PW35;Q15652;A0T124	.;JHD2C_HUMAN;.	G	1497;1278;1278;1315	ENSP00000382204:S1497G;ENSP00000384990:S1278G;ENSP00000382195:S1278G;ENSP00000444682:S1315G	ENSP00000382195:S1278G	S	-	1	0	JMJD1C	64636946	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.239000	0.51360	2.194000	0.70268	0.482000	0.46254	AGT	.	.	none		0.408	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
CYP11B1	1584	hgsc.bcm.edu	37	8	143958274	143958274	+	Missense_Mutation	SNP	C	C	T	rs200559974		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr8:143958274C>T	ENST00000292427.4	-	4	655	c.623G>A	c.(622-624)cGg>cAg	p.R208Q	CYP11B1_ENST00000377675.3_Missense_Mutation_p.R279Q|CYP11B1_ENST00000517471.1_Missense_Mutation_p.R208Q	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	208					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CAGGCCCAGCCGCTCTCCAAA	0.622									Familial Hyperaldosteronism type I				.|||	1	0.000199681	0.0	0.0	5008	,	,		19702	0.001		0.0	False		,,,				2504	0.0				p.R208Q		Atlas-SNP	.											CYP11B1,NS,carcinoma,+1,1	CYP11B1	128	1	0			c.G623A						PASS	.						31.0	33.0	33.0					8																	143958274		2203	4300	6503	SO:0001583	missense	1584	exon4	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	CCCAGCCGCTCTC	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.623G>A	8.37:g.143958274C>T	ENSP00000292427:p.Arg208Gln	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	150	66	0.44	NM_000497	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	26.2	4.714828	0.89112	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.70631	-0.5;2.55;-0.5	4.3	4.3	0.51218	.	0.000000	0.47852	D	0.000205	D	0.85961	0.5819	M	0.90369	3.11	0.50313	D	0.999863	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87885	0.2680	10	0.46703	T	0.11	.	14.6015	0.68445	0.0:1.0:0.0:0.0	.	279;208;208	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	Q	208;208;279	ENSP00000292427:R208Q;ENSP00000428043:R208Q;ENSP00000366903:R279Q	ENSP00000292427:R208Q	R	-	2	0	CYP11B1	143955276	0.993000	0.37304	1.000000	0.80357	0.754000	0.42855	2.707000	0.47143	2.086000	0.62901	0.650000	0.86243	CGG	C|0.999;T|0.001	0.001	weak		0.622	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
DST	667	hgsc.bcm.edu	37	6	56485371	56485371	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr6:56485371T>G	ENST00000370765.6	-	23	3568	c.3461A>C	c.(3460-3462)aAg>aCg	p.K1154T	DST_ENST00000370788.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000312431.6_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	0					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TACTCGGGACTTTTGTTTCTT	0.423																																					p.K1154T		Atlas-SNP	.											.	DST	1427	.	0			c.A3461C						PASS	.						184.0	178.0	180.0					6																	56485371		2203	4300	6503	SO:0001583	missense	667	exon23			CGGGACTTTTGTT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.3461A>C	6.37:g.56485371T>G	ENSP00000359801:p.Lys1154Thr	Somatic	190	0	0		WXS	Illumina HiSeq	Phase_I	226	32	0.141593	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000370765.6	37	CCDS4959.1	.	.	.	.	.	.	.	.	.	.	T	14.77	2.635748	0.47049	.	.	ENSG00000151914	ENST00000370765	T	0.25250	1.81	4.46	4.46	0.54185	.	.	.	.	.	T	0.25644	0.0624	.	.	.	0.09310	N	0.999997	D	0.54964	0.969	P	0.55824	0.785	T	0.03157	-1.1066	7	0.27785	T	0.31	.	13.9147	0.63890	0.0:0.0:0.0:1.0	.	1154	Q03001-3	.	T	1154	ENSP00000359801:K1154T	ENSP00000359801:K1154T	K	-	2	0	DST	56593330	1.000000	0.71417	0.917000	0.36280	0.602000	0.36980	5.260000	0.65490	1.880000	0.54463	0.366000	0.22137	AAG	.	.	none		0.423	DST-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041027.2	NM_001723	
WDR64	128025	hgsc.bcm.edu	37	1	241842832	241842832	+	Nonsense_Mutation	SNP	C	C	T	rs41304038	byFrequency	TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:241842832C>T	ENST00000366552.2	+	5	736	c.529C>T	c.(529-531)Cga>Tga	p.R177*	WDR64_ENST00000437684.2_Nonsense_Mutation_p.R177*|WDR64_ENST00000461971.1_3'UTR	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	177										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			GCAGCTGAAACGAATCGTAGC	0.438													C|||	4	0.000798722	0.0	0.0029	5008	,	,		19694	0.0		0.002	False		,,,				2504	0.0				p.R177X		Atlas-SNP	.											WDR64_ENST00000366552,NS,carcinoma,-1,1	WDR64	234	1	0			c.C529T						PASS	.	C	stop/ARG	0,1384		0,0,692	87.0	78.0	81.0		529	3.7	1.0	1	dbSNP_127	81	2,3180		0,2,1589	yes	stop-gained	WDR64	NM_144625.4		0,2,2281	TT,TC,CC		0.0629,0.0,0.0438		177/1082	241842832	2,4564	692	1591	2283	SO:0001587	stop_gained	128025	exon5			CTGAAACGAATCG	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.529C>T	1.37:g.241842832C>T	ENSP00000355510:p.Arg177*	Somatic	161	0	0		WXS	Illumina HiSeq	Phase_I	164	21	0.128049	NM_144625	B1ANT0|Q7Z573|Q96LY9	Nonsense_Mutation	SNP	ENST00000366552.2	37		1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	38	6.963864	0.97967	0.0	6.29E-4	ENSG00000162843	ENST00000366552;ENST00000437684	.	.	.	5.72	3.72	0.42706	.	0.150508	0.30850	N	0.008744	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.4949	7.5122	0.27579	0.314:0.6081:0.0:0.0779	rs41304038	.	.	.	X	177	.	ENSP00000355510:R177X	R	+	1	2	WDR64	239909455	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.258000	0.32944	1.386000	0.46466	0.655000	0.94253	CGA	C|1.000;T|0.000	0.000	strong		0.438	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625	
KAAG1	353219	hgsc.bcm.edu	37	6	24358062	24358062	+	Silent	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr6:24358062C>T	ENST00000274766.1	+	1	932	c.195C>T	c.(193-195)ggC>ggT	p.G65G	DCDC2_ENST00000378454.3_5'UTR	NM_181337.3	NP_851854.1	Q9UBP8	KAAG1_HUMAN	kidney associated antigen 1	65					immune response (GO:0006955)					central_nervous_system(1)|lung(1)|prostate(1)	3						GCACCCAGGGCGCGGGATCGC	0.667																																					p.G65G		Atlas-SNP	.											.	KAAG1	4	.	0			c.C195T						PASS	.						24.0	28.0	27.0					6																	24358062		2180	4266	6446	SO:0001819	synonymous_variant	353219	exon1			CCAGGGCGCGGGA	AF181722	CCDS4551.1	6p22.1	2010-11-23			ENSG00000146049	ENSG00000146049			21031	protein-coding gene	gene with protein product		608211				10601354	Standard	NM_181337		Approved	RU2, RU2AS	uc003ndz.1	Q9UBP8	OTTHUMG00000014354	ENST00000274766.1:c.195C>T	6.37:g.24358062C>T		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	99	13	0.131313	NM_181337		Silent	SNP	ENST00000274766.1	37	CCDS4551.1																																																																																			.	.	none		0.667	KAAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040001.1		
MUC4	4585	hgsc.bcm.edu	37	3	195507836	195507836	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr3:195507836C>G	ENST00000463781.3	-	2	11074	c.10615G>C	c.(10615-10617)Gtc>Ctc	p.V3539L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V3539L|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V3539L(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGCTGGTGACAGGAAGAGGC	0.617																																					p.V3539L		Atlas-SNP	.											MUC4_ENST00000463781,trunk,malignant_melanoma,0,2	MUC4	1505	2	2	Substitution - Missense(2)	skin(2)	c.G10615C						scavenged	.						27.0	27.0	27.0					3																	195507836		681	1578	2259	SO:0001583	missense	4585	exon2			TGGTGACAGGAAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10615G>C	3.37:g.195507836C>G	ENSP00000417498:p.Val3539Leu	Somatic	230	5	0.0217391		WXS	Illumina HiSeq	Phase_I	488	21	0.0430328	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	3.354	-0.131924	0.06753	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33865	1.4;1.39	0.743	-1.49	0.08718	.	0.000000	0.23275	U	0.049970	T	0.17831	0.0428	N	0.19112	0.55	0.09310	N	1	B	0.33494	0.414	B	0.35899	0.213	T	0.15665	-1.0429	9	.	.	.	.	4.8397	0.13483	0.3414:0.6586:0.0:1.0E-4	.	3411	E7ESK3	.	L	3539	ENSP00000417498:V3539L;ENSP00000420243:V3539L	.	V	-	1	0	MUC4	196992615	0.000000	0.05858	0.015000	0.15790	0.015000	0.08874	-0.219000	0.09228	0.088000	0.17205	0.089000	0.15464	GTC	.	.	none		0.617	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
DNAJC11	55735	hgsc.bcm.edu	37	1	6700045	6700045	+	Silent	SNP	G	G	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:6700045G>A	ENST00000377577.5	-	11	1293	c.1170C>T	c.(1168-1170)ttC>ttT	p.F390F	DNAJC11_ENST00000349363.6_Intron|DNAJC11_ENST00000294401.7_Intron|DNAJC11_ENST00000542246.1_Silent_p.F352F|DNAJC11_ENST00000377573.5_Silent_p.F300F|DNAJC11_ENST00000465508.1_5'UTR	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	390						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CGGTGGCATAGAACATGGCGC	0.483																																					p.F390F		Atlas-SNP	.											.	DNAJC11	93	.	0			c.C1170T						PASS	.						79.0	74.0	76.0					1																	6700045		2203	4300	6503	SO:0001819	synonymous_variant	55735	exon11			GGCATAGAACATG	AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.1170C>T	1.37:g.6700045G>A		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	47	19	0.404255	NM_018198	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Silent	SNP	ENST00000377577.5	37	CCDS87.1																																																																																			.	.	none		0.483	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004216.3	NM_018198	
INPP5F	22876	hgsc.bcm.edu	37	10	121556996	121556996	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr10:121556996G>A	ENST00000361976.2	+	8	1058	c.892G>A	c.(892-894)Gtg>Atg	p.V298M	INPP5F_ENST00000369083.3_Missense_Mutation_p.V298M	NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	0	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		ACGAAGAGGAGTGGATAAAAA	0.353																																					p.V298M		Atlas-SNP	.											.	INPP5F	112	.	0			c.G892A						PASS	.						89.0	80.0	83.0					10																	121556996		2203	4300	6503	SO:0001583	missense	22876	exon8			AGAGGAGTGGATA	AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.892G>A	10.37:g.121556996G>A	ENSP00000354519:p.Val298Met	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	174	26	0.149425	NM_014937	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000361976.2	37	CCDS7616.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.767250	0.90020	.	.	ENSG00000198825	ENST00000361976;ENST00000369083	T;T	0.60171	0.21;0.21	5.65	5.65	0.86999	Synaptojanin, N-terminal (2);	0.061078	0.64402	D	0.000003	T	0.79834	0.4514	M	0.85859	2.78	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.81996	-0.0676	10	0.87932	D	0	-20.0928	20.0781	0.97751	0.0:0.0:1.0:0.0	.	298	Q9Y2H2	SAC2_HUMAN	M	298	ENSP00000354519:V298M;ENSP00000358079:V298M	ENSP00000354519:V298M	V	+	1	0	INPP5F	121546986	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.172000	0.77604	2.817000	0.96982	0.563000	0.77884	GTG	.	.	none		0.353	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1	NM_014937	
MIA3	375056	hgsc.bcm.edu	37	1	222805652	222805652	+	Silent	SNP	G	G	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:222805652G>A	ENST00000344922.5	+	5	3340	c.3315G>A	c.(3313-3315)gaG>gaA	p.E1105E	MIA3_ENST00000344441.6_Silent_p.E1105E|MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000344507.1_Intron	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1105					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		CAAATACTGAGAAAGACCTGG	0.453																																					p.E1105E		Atlas-SNP	.											.	MIA3	167	.	0			c.G3315A						PASS	.						90.0	86.0	87.0					1																	222805652		1864	4082	5946	SO:0001819	synonymous_variant	375056	exon5			TACTGAGAAAGAC		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.3315G>A	1.37:g.222805652G>A		Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	108	20	0.185185	NM_198551	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Silent	SNP	ENST00000344922.5	37	CCDS41470.1	.	.	.	.	.	.	.	.	.	.	G	3.427	-0.116990	0.06838	.	.	ENSG00000154305	ENST00000354906	T	0.19250	2.16	3.81	2.89	0.33648	.	.	.	.	.	T	0.21881	0.0527	.	.	.	0.22305	N	0.999213	.	.	.	.	.	.	T	0.13150	-1.0520	6	0.41790	T	0.15	.	8.8823	0.35382	0.0:0.0:0.7777:0.2223	.	.	.	.	K	688	ENSP00000355062:E688K	ENSP00000355062:E688K	E	+	1	0	MIA3	220872275	0.016000	0.18221	0.038000	0.18304	0.226000	0.24999	1.531000	0.36018	1.166000	0.42689	0.557000	0.71058	GAA	.	.	none		0.453	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551	
PRKD1	5587	hgsc.bcm.edu	37	14	30046638	30046638	+	Silent	SNP	G	G	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr14:30046638G>T	ENST00000331968.5	-	18	2774	c.2545C>A	c.(2545-2547)Cga>Aga	p.R849R	PRKD1_ENST00000415220.2_Silent_p.R857R	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	849					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TCCAGCTCTCGCAAATCTAAC	0.453																																					p.R849R		Atlas-SNP	.											PRKD1_ENST00000331968,NS,carcinoma,0,2	PRKD1	316	2	0			c.C2545A						PASS	.						99.0	93.0	95.0					14																	30046638		2203	4300	6503	SO:0001819	synonymous_variant	5587	exon18			GCTCTCGCAAATC		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2545C>A	14.37:g.30046638G>T		Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	114	30	0.263158	NM_002742	A6NL64|B2RAF6	Silent	SNP	ENST00000331968.5	37	CCDS9637.1																																																																																			.	.	none		0.453	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
ADCY2	108	hgsc.bcm.edu	37	5	7766914	7766914	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr5:7766914C>T	ENST00000338316.4	+	17	2298	c.2209C>T	c.(2209-2211)Ctc>Ttc	p.L737F	ADCY2_ENST00000537121.1_Missense_Mutation_p.L557F	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	737					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TTTATTTTTCCTCCCGGTAAG	0.428																																					p.L737F		Atlas-SNP	.											.	ADCY2	337	.	0			c.C2209T						PASS	.						188.0	194.0	192.0					5																	7766914		2203	4300	6503	SO:0001583	missense	108	exon17			TTTTTCCTCCCGG	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2209C>T	5.37:g.7766914C>T	ENSP00000342952:p.Leu737Phe	Somatic	216	0	0		WXS	Illumina HiSeq	Phase_I	137	27	0.19708	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	C	12.67	2.008322	0.35415	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;D	0.81908	-1.08;-1.55	5.46	5.46	0.80206	.	0.068532	0.64402	N	0.000019	T	0.81064	0.4745	L	0.60455	1.87	0.49582	D	0.999802	B;B	0.14805	0.005;0.011	B;B	0.17979	0.019;0.02	T	0.76250	-0.3028	10	0.38643	T	0.18	.	16.0386	0.80648	0.0:1.0:0.0:0.0	.	557;737	B7Z2C1;Q08462	.;ADCY2_HUMAN	F	737;570;557	ENSP00000342952:L737F;ENSP00000444803:L557F	ENSP00000342952:L737F	L	+	1	0	ADCY2	7819914	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	3.754000	0.55189	2.559000	0.86315	0.655000	0.94253	CTC	.	.	none		0.428	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
ZNF236	7776	hgsc.bcm.edu	37	18	74611013	74611013	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr18:74611013T>A	ENST00000253159.8	+	11	1921	c.1723T>A	c.(1723-1725)Ttt>Att	p.F575I	ZNF236_ENST00000320610.9_Missense_Mutation_p.F577I	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	575					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		TGACAAAAAATTTCGAACCTC	0.383																																					p.F575I		Atlas-SNP	.											.	ZNF236	325	.	0			c.T1723A						PASS	.						117.0	107.0	110.0					18																	74611013		1849	4096	5945	SO:0001583	missense	7776	exon11			AAAAAATTTCGAA	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.1723T>A	18.37:g.74611013T>A	ENSP00000253159:p.Phe575Ile	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	74	22	0.297297	NM_007345	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	37	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	T	32	5.149273	0.94645	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.47528	0.84;0.84	5.09	5.09	0.68999	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.77698	0.4169	H	0.95611	3.695	0.58432	D	0.999991	D	0.89917	1.0	D	0.87578	0.998	D	0.85094	0.0953	10	0.87932	D	0	.	14.8972	0.70651	0.0:0.0:0.0:1.0	.	575	Q9UL36	ZN236_HUMAN	I	575	ENSP00000253159:F575I;ENSP00000444524:F575I	ENSP00000253159:F575I	F	+	1	0	ZNF236	72740001	1.000000	0.71417	0.849000	0.33467	0.989000	0.77384	7.751000	0.85126	1.928000	0.55862	0.482000	0.46254	TTT	.	.	none		0.383	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
SPTB	6710	hgsc.bcm.edu	37	14	65253667	65253667	+	Missense_Mutation	SNP	C	C	T	rs151112486	byFrequency	TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr14:65253667C>T	ENST00000389721.5	-	15	3048	c.3016G>A	c.(3016-3018)Gcc>Acc	p.A1006T	SPTB_ENST00000556626.1_Missense_Mutation_p.A1006T|SPTB_ENST00000389722.3_Missense_Mutation_p.A1006T|SPTB_ENST00000389720.3_Missense_Mutation_p.A1006T|SPTB_ENST00000542895.1_Missense_Mutation_p.A1006T	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1006					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GCCTGGATGGCGGCCACGTCA	0.592																																					p.A1006T		Atlas-SNP	.											.	SPTB	378	.	0			c.G3016A						PASS	.		THR/ALA,THR/ALA	4,4402	8.1+/-20.4	0,4,2199	85.0	79.0	81.0		3016,3016	4.9	0.9	14	dbSNP_134	81	11,8589	8.4+/-32.0	0,11,4289	yes	missense,missense	SPTB	NM_000347.5,NM_001024858.2	58,58	0,15,6488	TT,TC,CC		0.1279,0.0908,0.1153	probably-damaging,probably-damaging	1006/2138,1006/2329	65253667	15,12991	2203	4300	6503	SO:0001583	missense	6710	exon15			GGATGGCGGCCAC		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3016G>A	14.37:g.65253667C>T	ENSP00000374371:p.Ala1006Thr	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	38	16	0.421053	NM_001024858	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079450	0.94050	9.08E-4	0.001279	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.78059	0.4224	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.988	D	0.83450	0.0048	10	0.87932	D	0	.	17.1796	0.86851	0.0:1.0:0.0:0.0	.	1006;1010	P11277;Q59FP5	SPTB1_HUMAN;.	T	1010;1006;1006;1006;1006;1006	ENSP00000374372:A1006T;ENSP00000451752:A1006T;ENSP00000374371:A1006T;ENSP00000443882:A1006T;ENSP00000374370:A1006T	ENSP00000374370:A1006T	A	-	1	0	SPTB	64323420	1.000000	0.71417	0.946000	0.38457	0.843000	0.47879	6.078000	0.71282	2.430000	0.82344	0.549000	0.68633	GCC	C|0.999;T|0.001	0.001	strong		0.592	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
TRIM51	84767	hgsc.bcm.edu	37	11	55655597	55655597	+	Silent	SNP	A	A	G			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr11:55655597A>G	ENST00000449290.2	+	4	689	c.597A>G	c.(595-597)gaA>gaG	p.E199E	TRIM51_ENST00000244891.3_Silent_p.E56E	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	199						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										ATCACTTGGAAAGGCTGCGAA	0.433																																					p.E199E		Atlas-SNP	.											SPRYD5_ENST00000327733,NS,carcinoma,+2,2	.	.	2	0			c.A597G						scavenged	.						61.0	58.0	59.0					11																	55655597		2201	4296	6497	SO:0001819	synonymous_variant	84767	exon4			CTTGGAAAGGCTG	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.597A>G	11.37:g.55655597A>G		Somatic	410	17	0.0414634		WXS	Illumina HiSeq	Phase_I	373	22	0.0589812	NM_032681	A6NMG2	Silent	SNP	ENST00000449290.2	37																																																																																				.	.	none		0.433	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	
MUC4	4585	hgsc.bcm.edu	37	3	195506982	195506982	+	Silent	SNP	G	G	C	rs562381906	byFrequency	TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr3:195506982G>C	ENST00000463781.3	-	2	11928	c.11469C>G	c.(11467-11469)acC>acG	p.T3823T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.T3823T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGGAAGAGGGGTGGTGTCAC	0.592													.|||	152	0.0303514	0.112	0.0029	5008	,	,		9549	0.0		0.002	False		,,,				2504	0.0				p.T3823T		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	0			c.C11469G						scavenged	.						5.0	5.0	5.0					3																	195506982		422	1223	1645	SO:0001819	synonymous_variant	4585	exon2			AAGAGGGGTGGTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11469C>G	3.37:g.195506982G>C		Somatic	75	4	0.0533333		WXS	Illumina HiSeq	Phase_I	118	14	0.118644	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	none		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
AOC1	26	hgsc.bcm.edu	37	7	150557673	150557673	+	Silent	SNP	C	C	T	rs375543270		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr7:150557673C>T	ENST00000493429.1	+	6	2525	c.1941C>T	c.(1939-1941)ccC>ccT	p.P647P	AOC1_ENST00000416793.2_Silent_p.P666P|AOC1_ENST00000480582.1_3'UTR|AOC1_ENST00000360937.4_Silent_p.P647P|AOC1_ENST00000467291.1_Silent_p.P647P			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	647					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)									Amiloride(DB00594)	GGCACCCGCCCGTGGTCTTTG	0.617																																					p.P666P		Atlas-SNP	.											.	ABP1	92	.	0			c.C1998T						PASS	.						101.0	116.0	111.0					7																	150557673		2085	4217	6302	SO:0001819	synonymous_variant	26	exon4			CCCGCCCGTGGTC	AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.1941C>T	7.37:g.150557673C>T		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	23	9	0.391304	NM_001272072	C9J690|Q16683|Q16684|Q56II4|Q6GU42	Silent	SNP	ENST00000493429.1	37	CCDS43679.1	.	.	.	.	.	.	.	.	.	.	C	5.686	0.311190	0.10789	.	.	ENSG00000002726	ENST00000487631	.	.	.	5.05	-3.73	0.04398	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.2137	0.25947	0.1403:0.5182:0.0:0.3415	.	.	.	.	.	-1	.	.	.	+	.	.	ABP1	150188606	0.000000	0.05858	0.964000	0.40570	0.466000	0.32739	-3.706000	0.00388	-0.720000	0.04935	-0.339000	0.08088	.	.	.	weak		0.617	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350628.1	NM_001091	
BCL2	596	hgsc.bcm.edu	37	18	60985514	60985514	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr18:60985514C>T	ENST00000398117.1	-	1	1847	c.386G>A	c.(385-387)cGc>cAc	p.R129H	BCL2_ENST00000444484.1_Missense_Mutation_p.R129H|BCL2_ENST00000333681.4_Missense_Mutation_p.R129H|BCL2_ENST00000589955.1_Missense_Mutation_p.R129H	NM_000633.2	NP_000624.2	P10415	BCL2_HUMAN	B-cell CLL/lymphoma 2	129				R -> C (in Ref. 4; CAA29778). {ECO:0000305}.	actin filament organization (GO:0007015)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|axonogenesis (GO:0007409)|B cell homeostasis (GO:0001782)|B cell lineage commitment (GO:0002326)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|behavioral fear response (GO:0001662)|branching involved in ureteric bud morphogenesis (GO:0001658)|CD8-positive, alpha-beta T cell lineage commitment (GO:0043375)|cell aging (GO:0007569)|cell growth (GO:0016049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to organic substance (GO:0071310)|cochlear nucleus development (GO:0021747)|defense response to virus (GO:0051607)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|ear development (GO:0043583)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|female pregnancy (GO:0007565)|focal adhesion assembly (GO:0048041)|gland morphogenesis (GO:0022612)|glomerulus development (GO:0032835)|hair follicle morphogenesis (GO:0031069)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|melanin metabolic process (GO:0006582)|melanocyte differentiation (GO:0030318)|mesenchymal cell development (GO:0014031)|metanephros development (GO:0001656)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of autophagy (GO:0010507)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cellular pH reduction (GO:0032848)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of retinal cell programmed cell death (GO:0046671)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|oocyte development (GO:0048599)|organ growth (GO:0035265)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pigment granule organization (GO:0048753)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell growth (GO:0030307)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron maturation (GO:0014042)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smooth muscle cell migration (GO:0014911)|post-embryonic development (GO:0009791)|protein dephosphorylation (GO:0006470)|protein polyubiquitination (GO:0000209)|reactive oxygen species metabolic process (GO:0072593)|regulation of calcium ion transport (GO:0051924)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glycoprotein biosynthetic process (GO:0010559)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|regulation of protein stability (GO:0031647)|regulation of transmembrane transporter activity (GO:0022898)|regulation of viral genome replication (GO:0045069)|release of cytochrome c from mitochondria (GO:0001836)|renal system process (GO:0003014)|response to acid chemical (GO:0001101)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to iron ion (GO:0010039)|response to ischemia (GO:0002931)|response to nicotine (GO:0035094)|response to radiation (GO:0009314)|response to toxic substance (GO:0009636)|response to UV-B (GO:0010224)|single organismal cell-cell adhesion (GO:0016337)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|channel inhibitor activity (GO:0016248)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin protein ligase binding (GO:0031625)	p.R129H(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(106)|kidney(1)|large_intestine(1)|lung(3)	113		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Ibuprofen(DB01050)|Paclitaxel(DB01229)|Rasagiline(DB01367)	CGTGGCAAAGCGTCCCCGCGC	0.667			T	IGH@	"""NHL, CLL"""																																p.R129H		Atlas-SNP	.		Dom	yes		18	18q21.3	596	B-cell CLL/lymphoma 2		L	BCL2,NS,lymphoid_neoplasm,0,1	BCL2	272	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G386A						PASS	.						100.0	116.0	111.0					18																	60985514		2203	4300	6503	SO:0001583	missense	596	exon2			GCAAAGCGTCCCC	M14745	CCDS11981.1, CCDS45882.1	18q21.3	2014-03-07			ENSG00000171791	ENSG00000171791		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	990	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 50"""	151430					Standard	XM_006722523		Approved	Bcl-2, PPP1R50	uc002lit.1	P10415	OTTHUMG00000132791	ENST00000398117.1:c.386G>A	18.37:g.60985514C>T	ENSP00000381185:p.Arg129His	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	73	16	0.219178	NM_000633	C9JHD5|P10416|Q13842|Q16197	Missense_Mutation	SNP	ENST00000398117.1	37	CCDS11981.1	.	.	.	.	.	.	.	.	.	.	C	16.99	3.275064	0.59649	.	.	ENSG00000171791	ENST00000398117;ENST00000333681;ENST00000444484	T;T;T	0.11385	2.78;2.78;2.78	4.63	3.72	0.42706	Apoptosis regulator, Bcl2-like (1);Apoptosis regulator, Bcl-2, BH (2);	0.062950	0.64402	D	0.000003	T	0.27967	0.0689	L	0.55481	1.735	0.54753	D	0.999987	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.01966	-1.1238	10	0.72032	D	0.01	-20.1356	14.4183	0.67165	0.0:0.8513:0.1487:0.0	.	129;129	C9JHD5;P10415	.;BCL2_HUMAN	H	129	ENSP00000381185:R129H;ENSP00000329623:R129H;ENSP00000404214:R129H	ENSP00000329623:R129H	R	-	2	0	BCL2	59136494	1.000000	0.71417	0.959000	0.39883	0.138000	0.21146	5.728000	0.68531	1.092000	0.41356	0.655000	0.94253	CGC	.	.	none		0.667	BCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256199.1	NM_000633, NM_000657	
LARP1B	55132	hgsc.bcm.edu	37	4	129035899	129035899	+	Splice_Site	SNP	T	T	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr4:129035899T>C	ENST00000326639.6	+	10	1372		c.e10+2		LARP1B_ENST00000441387.1_Splice_Site|LARP1B_ENST00000264584.5_Splice_Site|LARP1B_ENST00000512292.1_Splice_Site|LARP1B_ENST00000427266.1_Splice_Site|LARP1B_ENST00000354456.3_Splice_Site	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B							nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						AAATTGAGGGTAAGTTGTTAC	0.408																																					.		Atlas-SNP	.											.	LARP1B	120	.	0			c.1161+2T>C						PASS	.						86.0	85.0	85.0					4																	129035899		2203	4300	6503	SO:0001630	splice_region_variant	55132	exon10			TGAGGGTAAGTTG		CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.1161+2T>C	4.37:g.129035899T>C		Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	68	17	0.25	NM_018078	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Splice_Site	SNP	ENST00000326639.6	37	CCDS3738.1	.	.	.	.	.	.	.	.	.	.	T	15.70	2.910818	0.52439	.	.	ENSG00000138709	ENST00000326639;ENST00000512292;ENST00000508819;ENST00000264584;ENST00000441387;ENST00000427266;ENST00000507377	.	.	.	4.42	4.42	0.53409	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.84	0.63432	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	LARP1B	129255349	1.000000	0.71417	0.986000	0.45419	0.668000	0.39293	5.211000	0.65219	1.840000	0.53500	0.482000	0.46254	.	.	.	none		0.408	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257173.2	NM_018078	Intron
IL6ST	3572	hgsc.bcm.edu	37	5	55237383	55237383	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr5:55237383C>T	ENST00000381298.2	-	17	2596	c.2284G>A	c.(2284-2286)Gtg>Atg	p.V762M	IL6ST_ENST00000536319.1_3'UTR|IL6ST_ENST00000381294.3_Missense_Mutation_p.V701M|IL6ST_ENST00000381287.4_3'UTR|IL6ST_ENST00000502326.3_Missense_Mutation_p.V762M|IL6ST_ENST00000336909.5_Missense_Mutation_p.V762M|CTD-2031P19.5_ENST00000576302.1_RNA	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	762					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				CTGTGTACCACGGTAGAATAC	0.483			O		hepatocellular ca																																p.V762M		Atlas-SNP	.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	IL6ST	75	.	0			c.G2284A						PASS	.						145.0	144.0	144.0					5																	55237383		2203	4300	6503	SO:0001583	missense	3572	exon17			GTACCACGGTAGA	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.2284G>A	5.37:g.55237383C>T	ENSP00000370698:p.Val762Met	Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	147	34	0.231293	NM_002184	A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	ENST00000381298.2	37	CCDS3971.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.376368	0.82682	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294	T;T;T	0.63580	0.3;0.3;-0.05	5.4	5.4	0.78164	.	0.000000	0.44688	D	0.000433	T	0.73481	0.3592	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.75616	-0.3256	10	0.87932	D	0	.	19.5543	0.95335	0.0:1.0:0.0:0.0	.	762;701;762	Q17RA0;Q5FC04;P40189	.;.;IL6RB_HUMAN	M	762;762;701	ENSP00000370698:V762M;ENSP00000338799:V762M;ENSP00000370694:V701M	ENSP00000338799:V762M	V	-	1	0	IL6ST	55273140	1.000000	0.71417	0.961000	0.40146	0.713000	0.41058	5.413000	0.66399	2.687000	0.91594	0.557000	0.71058	GTG	.	.	none		0.483	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
FAT1	2195	hgsc.bcm.edu	37	4	187549438	187549438	+	Silent	SNP	C	C	T	rs370954148		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr4:187549438C>T	ENST00000441802.2	-	9	4889	c.4680G>A	c.(4678-4680)ccG>ccA	p.P1560P		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1560	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CGGTGAACCACGGGGCGTGGT	0.498										HNSCC(5;0.00058)																											p.P1560P	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											FAT1,NS,carcinoma,0,2	FAT1	500	2	0			c.G4680A						PASS	.	C		0,4196		0,0,2098	54.0	57.0	56.0		4680	-1.7	1.0	4		56	1,8461		0,1,4230	no	coding-synonymous	FAT1	NM_005245.3		0,1,6328	TT,TC,CC		0.0118,0.0,0.0079		1560/4589	187549438	1,12657	2098	4231	6329	SO:0001819	synonymous_variant	2195	exon9			GAACCACGGGGCG	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.4680G>A	4.37:g.187549438C>T		Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	82	21	0.256098	NM_005245		Silent	SNP	ENST00000441802.2	37	CCDS47177.1																																																																																			.	.	weak		0.498	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
FFAR4	338557	hgsc.bcm.edu	37	10	95335856	95335856	+	Silent	SNP	G	G	T	rs377477484		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr10:95335856G>T	ENST00000371483.4	+	2	632	c.576G>T	c.(574-576)tcG>tcT	p.S192S	FFAR4_ENST00000604414.1_Silent_p.S192S|FFAR4_ENST00000371481.4_Silent_p.S192S	NM_181745.3	NP_859529.2	Q5NUL3	FFAR4_HUMAN	free fatty acid receptor 4	192					hormone secretion (GO:0046879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of inflammatory response (GO:0050728)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of glucose transport (GO:0010827)	endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fatty acid binding (GO:0005504)|taste receptor activity (GO:0008527)										AGGAAATTTCGATTTGCACAC	0.433																																					p.S192S		Atlas-SNP	.											O3FAR1,NS,malignant_melanoma,+1,2	.	.	2	0			c.G576T						PASS	.						259.0	227.0	238.0					10																	95335856		2203	4300	6503	SO:0001819	synonymous_variant	338557	exon2			AATTTCGATTTGC		CCDS31248.1, CCDS55720.1	10q23.33	2012-11-16	2012-11-16	2012-11-16	ENSG00000186188	ENSG00000186188		"""GPCR / Class A : Fatty acid receptors"""	19061	protein-coding gene	gene with protein product		609044	"""G protein-coupled receptor 129"", ""G protein-coupled receptor 120"", ""omega-3 fatty acid receptor 1"""	GPR129, GPR120, O3FAR1		20471368, 19723586, 15619630, 20813258	Standard	NM_181745		Approved	PGR4	uc010qnt.2	Q5NUL3	OTTHUMG00000034409	ENST00000371483.4:c.576G>T	10.37:g.95335856G>T		Somatic	320	0	0		WXS	Illumina HiSeq	Phase_I	353	42	0.11898	NM_001195755	Q495H1|Q5VY25|Q5VY26|Q7Z605|Q86SM7	Silent	SNP	ENST00000371483.4	37	CCDS31248.1																																																																																			.	.	none		0.433	FFAR4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000083179.1	NM_181745	
DSP	1832	hgsc.bcm.edu	37	6	7584954	7584954	+	Silent	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr6:7584954C>T	ENST00000379802.3	+	24	7800	c.7459C>T	c.(7459-7461)Cta>Tta	p.L2487L	DSP_ENST00000418664.2_Silent_p.L1888L	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2487	Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CAAGAAGGGCCTAATTGATTA	0.458																																					p.L2487L		Atlas-SNP	.											.	DSP	306	.	0			c.C7459T						PASS	.						105.0	111.0	109.0					6																	7584954		2203	4300	6503	SO:0001819	synonymous_variant	1832	exon24			AAGGGCCTAATTG	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.7459C>T	6.37:g.7584954C>T		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	90	66	0.733333	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	37	CCDS4501.1																																																																																			.	.	none		0.458	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
TBX18	9096	hgsc.bcm.edu	37	6	85446869	85446869	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr6:85446869C>T	ENST00000369663.5	-	8	1695	c.1358G>A	c.(1357-1359)aGg>aAg	p.R453K	TBX18_ENST00000606784.1_Intron	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	453					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.R453K(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		GGAGGGAGTCCTGGGCGGGGC	0.602																																					p.R453K		Atlas-SNP	.											TBX18,NS,carcinoma,0,1	TBX18	131	1	1	Substitution - Missense(1)	lung(1)	c.G1358A						PASS	.						98.0	89.0	92.0					6																	85446869		2203	4300	6503	SO:0001583	missense	9096	exon8			GGAGTCCTGGGCG	AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.1358G>A	6.37:g.85446869C>T	ENSP00000358677:p.Arg453Lys	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	46	23	0.5	NM_001080508	A2RU13|Q7Z6U4|Q9UJI6	Missense_Mutation	SNP	ENST00000369663.5	37	CCDS34495.1	.	.	.	.	.	.	.	.	.	.	C	19.50	3.839155	0.71373	.	.	ENSG00000112837	ENST00000369663	D	0.87334	-2.24	5.48	4.59	0.56863	.	0.071026	0.64402	D	0.000017	D	0.86049	0.5840	L	0.32530	0.975	0.58432	D	0.999997	D	0.67145	0.996	D	0.75484	0.986	D	0.84996	0.0897	10	0.27082	T	0.32	.	16.1361	0.81490	0.0:0.866:0.134:0.0	.	453	O95935	TBX18_HUMAN	K	453	ENSP00000358677:R453K	ENSP00000358677:R453K	R	-	2	0	TBX18	85503588	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	6.367000	0.73099	1.277000	0.44412	0.585000	0.79938	AGG	.	.	none		0.602	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508	
PCDHA5	56143	hgsc.bcm.edu	37	5	140201632	140201632	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr5:140201632G>A	ENST00000529859.1	+	1	272	c.272G>A	c.(271-273)cGg>cAg	p.R91Q	PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.R91Q|PCDHA5_ENST00000529619.1_Missense_Mutation_p.R91Q|PCDHA4_ENST00000512229.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	91	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGATCGACCGGGAGGAGCTG	0.622																																					p.R91Q		Atlas-SNP	.											PCDHA5_ENST00000529859,NS,carcinoma,-1,2	PCDHA5	361	2	0			c.G272A						PASS	.						91.0	106.0	101.0					5																	140201632		2202	4300	6502	SO:0001583	missense	56143	exon1			TCGACCGGGAGGA	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.272G>A	5.37:g.140201632G>A	ENSP00000436557:p.Arg91Gln	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	90	14	0.155556	NM_018908	O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765070	0.90020	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.53206	0.63;0.63;0.63	3.97	3.97	0.46021	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.82185	0.4982	H	0.99565	4.63	0.37098	D	0.899752	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.992;0.989;0.989	D	0.92497	0.6005	9	0.87932	D	0	.	16.4728	0.84119	0.0:0.0:1.0:0.0	.	91;91;91	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	Q	91	ENSP00000433416:R91Q;ENSP00000436557:R91Q;ENSP00000367366:R91Q	ENSP00000367366:R91Q	R	+	2	0	PCDHA5	140181816	1.000000	0.71417	0.998000	0.56505	0.911000	0.54048	9.861000	0.99562	1.937000	0.56155	0.580000	0.79431	CGG	.	.	none		0.622	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908	
FANCD2	2177	hgsc.bcm.edu	37	3	10094085	10094085	+	Nonsense_Mutation	SNP	T	T	G			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr3:10094085T>G	ENST00000419585.1	+	18	1721	c.1560T>G	c.(1558-1560)taT>taG	p.Y520*	FANCD2_ENST00000383807.1_Nonsense_Mutation_p.Y520*|FANCD2_ENST00000287647.3_Nonsense_Mutation_p.Y520*|FANCD2_ENST00000383806.1_Nonsense_Mutation_p.Y520*			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	520					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TTTTAGATTATCTGGATAACA	0.378			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.Y520X		Atlas-SNP	.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2	253	.	0			c.T1560G						PASS	.						69.0	66.0	67.0					3																	10094085		2203	4300	6503	SO:0001587	stop_gained	2177	exon18	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AGATTATCTGGAT	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.1560T>G	3.37:g.10094085T>G	ENSP00000398754:p.Tyr520*	Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	80	25	0.3125	NM_001018115	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Nonsense_Mutation	SNP	ENST00000419585.1	37	CCDS33696.1	.	.	.	.	.	.	.	.	.	.	T	39	7.513557	0.98329	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	.	.	.	5.55	-2.27	0.06846	.	0.196116	0.45606	D	0.000343	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.8243	0.52259	0.0:0.5994:0.0:0.4006	.	.	.	.	X	520	.	ENSP00000287647:Y520X	Y	+	3	2	FANCD2	10069085	0.995000	0.38212	0.991000	0.47740	0.970000	0.65996	0.342000	0.19926	-0.131000	0.11578	-0.440000	0.05779	TAT	.	.	none		0.378	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
SKIDA1	387640	hgsc.bcm.edu	37	10	21805466	21805466	+	Missense_Mutation	SNP	C	C	T	rs112207161	byFrequency	TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr10:21805466C>T	ENST00000449193.2	-	4	3538	c.1286G>A	c.(1285-1287)gGg>gAg	p.G429E	SKIDA1_ENST00000444772.3_Missense_Mutation_p.G350E|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	348						nucleus (GO:0005634)		p.E428_G429insEE(2)									CCCGCTGCccccctcctcctc	0.617																																					p.G429E		Atlas-SNP	.											C10orf140_ENST00000449193,caecum,carcinoma,0,4	.	.	4	2	Insertion - In frame(2)	soft_tissue(2)	c.G1286A						scavenged	.						6.0	7.0	7.0					10																	21805466		2039	4149	6188	SO:0001583	missense	387640	exon4			CTGCCCCCCTCCT	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1286G>A	10.37:g.21805466C>T	ENSP00000410041:p.Gly429Glu	Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	29	7	0.241379	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Missense_Mutation	SNP	ENST00000449193.2	37	CCDS44363.1	.	.	.	.	.	.	.	.	.	.	C	0.229	-1.022679	0.02061	.	.	ENSG00000180592	ENST00000449193;ENST00000444772	.	.	.	5.09	2.96	0.34315	.	0.390130	0.25726	N	0.028719	T	0.17280	0.0415	N	0.04508	-0.205	0.37355	D	0.910986	B	0.02656	0.0	B	0.06405	0.002	T	0.20974	-1.0259	9	0.02654	T	1	-16.453	4.5892	0.12299	0.0:0.6264:0.0:0.3736	.	429	E9PAX1	.	E	429;350	.	ENSP00000442432:G350E	G	-	2	0	C10orf140	21845472	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.404000	0.34623	1.143000	0.42306	0.555000	0.69702	GGG	.	.	none		0.617	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
FBXW12	285231	hgsc.bcm.edu	37	3	48420937	48420937	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr3:48420937A>C	ENST00000296438.5	+	7	849	c.663A>C	c.(661-663)ttA>ttC	p.L221F	FBXW12_ENST00000445170.1_Missense_Mutation_p.L202F|RN7SL321P_ENST00000581742.1_RNA|FBXW12_ENST00000436231.1_Missense_Mutation_p.L64F|FBXW12_ENST00000415155.1_Missense_Mutation_p.L151F	NM_207102.2	NP_996985.2	Q6X9E4	FBW12_HUMAN	F-box and WD repeat domain containing 12	221										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGCCTGGGTTAAGAGATGTTT	0.413																																					p.L221F		Atlas-SNP	.											.	FBXW12	44	.	0			c.A663C						PASS	.						318.0	285.0	296.0					3																	48420937		2203	4300	6503	SO:0001583	missense	285231	exon7			TGGGTTAAGAGAT	AK097594, AY247969	CCDS2764.1, CCDS54577.1, CCDS54578.1	3p21.31	2011-07-01	2007-02-08	2004-07-21	ENSG00000164049	ENSG00000164049		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	20729	protein-coding gene	gene with protein product		609075	"""F-box only protein 35"", ""F-box and WD-40 domain protein 12"""	FBXO35		15040455	Standard	NM_207102		Approved	Fbw12	uc010hjv.3	Q6X9E4	OTTHUMG00000133530	ENST00000296438.5:c.663A>C	3.37:g.48420937A>C	ENSP00000296438:p.Leu221Phe	Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	156	40	0.25641	NM_207102	E9PG36|Q494Y9|Q494Z0	Missense_Mutation	SNP	ENST00000296438.5	37	CCDS2764.1	.	.	.	.	.	.	.	.	.	.	A	14.39	2.522619	0.44866	.	.	ENSG00000164049	ENST00000458736;ENST00000296438;ENST00000436231;ENST00000445170;ENST00000415155	T;T;T;T	0.63913	1.53;-0.07;1.53;3.4	3.64	-0.456	0.12190	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);	0.000000	0.64402	D	0.000012	T	0.69097	0.3073	M	0.67397	2.05	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.992;0.998;0.988;0.995	T	0.58070	-0.7701	10	0.66056	D	0.02	-0.3675	3.6866	0.08331	0.5915:0.1914:0.2171:0.0	.	120;202;151;221	E9PCA2;E9PG36;Q494Z0;Q6X9E4	.;.;.;FBW12_HUMAN	F	120;221;64;202;151	ENSP00000296438:L221F;ENSP00000413866:L64F;ENSP00000406139:L202F;ENSP00000414683:L151F	ENSP00000296438:L221F	L	+	3	2	FBXW12	48395941	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	0.092000	0.15066	-0.074000	0.12820	0.533000	0.62120	TTA	.	.	none		0.413	FBXW12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257505.1	NM_207102	
C4A	720	hgsc.bcm.edu	37	6	31963866	31963866	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr6:31963866C>T	ENST00000428956.2	+	26	3449	c.3365C>T	c.(3364-3366)cCa>cTa	p.P1122L	C4A_ENST00000498271.1_Missense_Mutation_p.P1122L	NM_007293.2	NP_009224.2	P0C0L4	CO4A_HUMAN	complement component 4A (Rodgers blood group)	1122					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement component C1q binding (GO:0001849)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	GACCCCTGTCCAGTGTTAGAC	0.622																																					p.P1122L		Atlas-SNP	.											.	C4A	15	.	0			c.C3365T						PASS	.						79.0	79.0	79.0					6																	31963866		1565	3532	5097	SO:0001583	missense	720	exon26			CCTGTCCAGTGTT	L26261, M14823, X77491, AY224378	CCDS47404.1, CCDS59005.1	6p21.3	2014-09-17	2006-01-19		ENSG00000244731	ENSG00000244731		"""Blood group antigens"", ""Complement system"""	1323	protein-coding gene	gene with protein product		120810	"""complement component 4A"""				Standard	NM_001252204		Approved	CPAMD2, C4S, CO4, C4, C4A3, C4A2, C4A4, C4A6, C4B, RG		P0C0L4	OTTHUMG00000031186	ENST00000428956.2:c.3365C>T	6.37:g.31963866C>T	ENSP00000396688:p.Pro1122Leu	Somatic	694	0	0		WXS	Illumina HiSeq	Phase_I	896	76	0.0848214	NM_007293	A6H8M8|A6NHJ5|A7E2V2|B0QZR6|B0V2C8|B2RUT6|B7ZVZ6|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q4LE82|Q5JNX2|Q5JQM8|Q6P4R1|Q6U2E5|Q6U2E8|Q6U2F0|Q6U2F3|Q6U2F4|Q6U2F6|Q6U2F8|Q6U2G0|Q96EG2|Q96SA8|Q9NPK5|Q9UIP5	Missense_Mutation	SNP	ENST00000428956.2	37	CCDS47404.1	.	.	.	.	.	.	.	.	.	.	C	11.67	1.707361	0.30322	.	.	ENSG00000244731	ENST00000428956;ENST00000498271	T;T	0.39056	1.1;1.1	3.35	3.35	0.38373	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	.	.	.	.	T	0.59321	0.2185	M	0.88640	2.97	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.79108	0.992;0.969	T	0.66586	-0.5886	9	0.72032	D	0.01	.	10.5084	0.44847	0.0:1.0:0.0:0.0	.	1122;1122	A6H8M8;P0C0L4	.;CO4A_HUMAN	L	1122	ENSP00000396688:P1122L;ENSP00000420212:P1122L	ENSP00000396688:P1122L	P	+	2	0	C4A	.	0.670000	0.27512	0.078000	0.20375	0.040000	0.13550	4.610000	0.61155	1.901000	0.55032	0.413000	0.27773	CCA	.	.	none		0.622	C4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076364.3	NM_007293	
C17orf102	400591	hgsc.bcm.edu	37	17	32905908	32905908	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr17:32905908C>A	ENST00000357754.1	-	1	480	c.392G>T	c.(391-393)gGg>gTg	p.G131V	TMEM132E_ENST00000321639.5_5'Flank	NM_207454.2	NP_997337.2	A2RUQ5	CQ102_HUMAN	chromosome 17 open reading frame 102	131										central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(3)|ovary(1)	9						AAGCACTGTCCCCTCCTCTTC	0.587																																					p.G131V		Atlas-SNP	.											.	C17orf102	24	.	0			c.G392T						PASS	.						175.0	185.0	182.0					17																	32905908		1946	4145	6091	SO:0001583	missense	400591	exon1			ACTGTCCCCTCCT		CCDS42297.1	17q12	2009-02-11			ENSG00000197322	ENSG00000197322			34412	protein-coding gene	gene with protein product							Standard	NM_207454		Approved	FLJ44815	uc002hie.1	A2RUQ5	OTTHUMG00000156883	ENST00000357754.1:c.392G>T	17.37:g.32905908C>A	ENSP00000350392:p.Gly131Val	Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	93	22	0.236559	NM_207454	A5PKX0|Q6ZTB3	Missense_Mutation	SNP	ENST00000357754.1	37	CCDS42297.1	.	.	.	.	.	.	.	.	.	.	C	13.56	2.274858	0.40194	.	.	ENSG00000197322	ENST00000357754	T	0.46819	0.86	4.15	-0.222	0.13122	.	0.267652	0.20576	N	0.089625	T	0.33381	0.0861	N	0.19112	0.55	0.09310	N	1	P	0.49090	0.919	P	0.50082	0.63	T	0.17930	-1.0353	10	0.87932	D	0	.	2.7364	0.05241	0.2062:0.4407:0.0:0.3531	.	131	A2RUQ5	CQ102_HUMAN	V	131	ENSP00000350392:G131V	ENSP00000350392:G131V	G	-	2	0	C17orf102	29930021	0.000000	0.05858	0.000000	0.03702	0.653000	0.38743	-0.002000	0.12924	0.124000	0.18369	0.655000	0.94253	GGG	.	.	none		0.587	C17orf102-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346435.1	NM_207454	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230400	23230400	+	Missense_Mutation	SNP	T	T	C	rs189360394		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr22:23230400T>C	ENST00000526893.1	+	1	441	c.167T>C	c.(166-168)gTt>gCt	p.V56A	IGLL5_ENST00000531372.1_Missense_Mutation_p.V56A|IGLL5_ENST00000532223.2_Missense_Mutation_p.V56A|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	56						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GGAGCCTCAGTTGGAAGCAGC	0.667													T|||	1	0.000199681	0.0	0.0014	5008	,	,		10673	0.0		0.0	False		,,,				2504	0.0				p.V56A		Atlas-SNP	.											.	IGLL5	26	.	0			c.T167C						PASS	.																																			SO:0001583	missense	100423062	exon1			CCTCAGTTGGAAG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.167T>C	22.37:g.23230400T>C	ENSP00000431254:p.Val56Ala	Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	112	21	0.1875	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	T	0.035	-1.312432	0.01331	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00571	6.5;6.5	3.92	-3.93	0.04143	.	.	.	.	.	T	0.00356	0.0011	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.45071	-0.9286	9	0.54805	T	0.06	.	0.8497	0.01169	0.1514:0.2511:0.2977:0.2998	.	56	B9A064	IGLL5_HUMAN	A	56	ENSP00000436353:V56A;ENSP00000431254:V56A	ENSP00000431254:V56A	V	+	2	0	IGLL5	21560400	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.389000	0.02530	-0.629000	0.05575	-1.272000	0.01410	GTT	T|1.000;C|0.000	0.000	strong		0.667	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
EGR1	1958	hgsc.bcm.edu	37	5	137801591	137801591	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr5:137801591G>C	ENST00000239938.4	+	1	413	c.141G>C	c.(139-141)caG>caC	p.Q47H		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	47					BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GGGCTCCCCAGTTCCTCGGCG	0.677																																					p.Q47H		Atlas-SNP	.											.	EGR1	52	.	0			c.G141C						PASS	.						52.0	49.0	50.0					5																	137801591		2203	4300	6503	SO:0001583	missense	1958	exon1			TCCCCAGTTCCTC	M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.141G>C	5.37:g.137801591G>C	ENSP00000239938:p.Gln47His	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	83	22	0.26506	NM_001964		Missense_Mutation	SNP	ENST00000239938.4	37	CCDS4206.1	.	.	.	.	.	.	.	.	.	.	G	9.531	1.110797	0.20714	.	.	ENSG00000120738	ENST00000535792;ENST00000411801;ENST00000239938	T	0.09163	3.01	5.07	3.26	0.37387	.	0.120124	0.64402	D	0.000020	T	0.11410	0.0278	L	0.48642	1.525	0.36348	D	0.859902	B;B	0.21753	0.06;0.004	B;B	0.23275	0.045;0.002	T	0.07809	-1.0753	10	0.66056	D	0.02	-0.6163	11.2363	0.48942	0.0:0.2576:0.609:0.1334	.	47;47	B4DNX4;P18146	.;EGR1_HUMAN	H	47	ENSP00000239938:Q47H	ENSP00000239938:Q47H	Q	+	3	2	EGR1	137829490	1.000000	0.71417	1.000000	0.80357	0.389000	0.30415	1.087000	0.30865	0.700000	0.31782	-0.500000	0.04577	CAG	.	.	none		0.677	EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251274.1	NM_001964	
HIST1H1E	3008	hgsc.bcm.edu	37	6	26156745	26156745	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr6:26156745C>G	ENST00000304218.3	+	1	187	c.127C>G	c.(127-129)Ctc>Gtc	p.L43V	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	43	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						GGTGTCCGAGCTCATTACTAA	0.632																																					p.L43V		Atlas-SNP	.											.	HIST1H1E	69	.	0			c.C127G						PASS	.						21.0	27.0	25.0					6																	26156745		2203	4299	6502	SO:0001583	missense	3008	exon1			TCCGAGCTCATTA	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.127C>G	6.37:g.26156745C>G	ENSP00000307705:p.Leu43Val	Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	70	14	0.2	NM_005321	Q4VB25	Missense_Mutation	SNP	ENST00000304218.3	37	CCDS4586.1	.	.	.	.	.	.	.	.	.	.	.	14.84	2.656485	0.47467	.	.	ENSG00000168298	ENST00000304218	T	0.26957	1.7	5.49	4.61	0.57282	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.065201	0.64402	D	0.000006	T	0.36880	0.0983	M	0.82433	2.59	0.58432	D	0.999999	P	0.37500	0.597	P	0.49953	0.627	T	0.38929	-0.9638	10	0.87932	D	0	-5.0498	15.0173	0.71597	0.1436:0.8564:0.0:0.0	.	43	P10412	H14_HUMAN	V	43	ENSP00000307705:L43V	ENSP00000307705:L43V	L	+	1	0	HIST1H1E	26264724	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	5.964000	0.70379	1.423000	0.47198	-0.181000	0.13052	CTC	.	.	none		0.632	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
ENTPD5	957	hgsc.bcm.edu	37	14	74449761	74449761	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr14:74449761C>T	ENST00000334696.6	-	6	720	c.401G>A	c.(400-402)cGc>cAc	p.R134H	ENTPD5_ENST00000557325.1_Missense_Mutation_p.R134H	NM_001249.2	NP_001240.1	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5	134					'de novo' posttranslational protein folding (GO:0051084)|ATP metabolic process (GO:0046034)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|positive regulation of glycolytic process (GO:0045821)|protein N-linked glycosylation (GO:0006487)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	guanosine-diphosphatase activity (GO:0004382)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(234;0.00394)		TGGCAGTAAGCGTAGTCCTGC	0.473																																					p.R134H		Atlas-SNP	.											.	ENTPD5	26	.	0			c.G401A						PASS	.						237.0	220.0	226.0					14																	74449761		2203	4300	6503	SO:0001583	missense	957	exon6			AGTAAGCGTAGTC	AF039918	CCDS9825.1	14q24	2003-10-03	2003-10-03			ENSG00000187097			3367	protein-coding gene	gene with protein product		603162	"""proto-oncogene CPH"""	CD39L4, PCPH		9271669, 9676430	Standard	NM_001249		Approved	NTPDase-5	uc010tuo.2	O75356		ENST00000334696.6:c.401G>A	14.37:g.74449761C>T	ENSP00000335246:p.Arg134His	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	99	20	0.20202	NM_001249	A1L4C5|Q96RX0	Missense_Mutation	SNP	ENST00000334696.6	37	CCDS9825.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621905	0.87460	.	.	ENSG00000187097	ENST00000557325;ENST00000334696;ENST00000553284	T;T;T	0.41065	1.01;1.01;1.01	4.99	4.99	0.66335	.	0.055041	0.85682	D	0.000000	T	0.77725	0.4173	H	0.97962	4.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.86237	0.1641	10	0.87932	D	0	-9.958	16.2422	0.82418	0.0:1.0:0.0:0.0	.	134;134	O75356;G3V4I0	ENTP5_HUMAN;.	H	134	ENSP00000451810:R134H;ENSP00000335246:R134H;ENSP00000451591:R134H	ENSP00000335246:R134H	R	-	2	0	ENTPD5	73519514	1.000000	0.71417	0.999000	0.59377	0.686000	0.39977	6.469000	0.73555	2.593000	0.87608	0.655000	0.94253	CGC	.	.	none		0.473	ENTPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412637.1	NM_001249	
PDCD11	22984	hgsc.bcm.edu	37	10	105184917	105184917	+	Silent	SNP	C	C	G			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr10:105184917C>G	ENST00000369797.3	+	20	3034	c.2940C>G	c.(2938-2940)ctC>ctG	p.L980L		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	980					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CCCTAACCCTCAAGACCACAG	0.587																																					p.L980L		Atlas-SNP	.											.	PDCD11	160	.	0			c.C2940G						PASS	.						86.0	75.0	79.0					10																	105184917		2203	4300	6503	SO:0001819	synonymous_variant	22984	exon20			AACCCTCAAGACC	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.2940C>G	10.37:g.105184917C>G		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	94	18	0.191489	NM_014976	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Silent	SNP	ENST00000369797.3	37	CCDS31276.1																																																																																			.	.	none		0.587	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
ZNF385D	79750	hgsc.bcm.edu	37	3	21478509	21478509	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr3:21478509C>A	ENST00000281523.2	-	5	1144	c.626G>T	c.(625-627)tGc>tTc	p.C209F	ZNF385D_ENST00000494118.1_5'UTR	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	209						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						AGCAACCTTGCATAGCGAACA	0.478																																					p.C209F		Atlas-SNP	.											.	ZNF385D	93	.	0			c.G626T						PASS	.						170.0	140.0	150.0					3																	21478509		2203	4300	6503	SO:0001583	missense	79750	exon5			ACCTTGCATAGCG	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.626G>T	3.37:g.21478509C>A	ENSP00000281523:p.Cys209Phe	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	85	21	0.247059	NM_024697		Missense_Mutation	SNP	ENST00000281523.2	37	CCDS2636.1	.	.	.	.	.	.	.	.	.	.	C	32	5.105674	0.94292	.	.	ENSG00000151789	ENST00000281523	D	0.99964	-9.97	6.09	6.09	0.99107	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	D	0.99971	0.9990	M	0.81802	2.56	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.95511	0.8586	10	0.72032	D	0.01	-16.5546	20.6789	0.99705	0.0:1.0:0.0:0.0	.	209	Q9H6B1	Z385D_HUMAN	F	209	ENSP00000281523:C209F	ENSP00000281523:C209F	C	-	2	0	ZNF385D	21453513	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.742000	0.85008	2.891000	0.99171	0.655000	0.94253	TGC	.	.	none		0.478	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697	
KRT3	3850	hgsc.bcm.edu	37	12	53183951	53183951	+	Missense_Mutation	SNP	C	C	T	rs570613061|rs60125653	byFrequency	TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr12:53183951C>T	ENST00000417996.2	-	9	1836	c.1762G>A	c.(1762-1764)Ggc>Agc	p.G588S	KRT3_ENST00000309505.3_Missense_Mutation_p.G589S	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	588	Gly-rich.|Tail.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						GAGCCAAAgccgctgccaccg	0.697																																					p.G588S		Atlas-SNP	.											KRT3,rectum,carcinoma,0,1	KRT3	65	1	0			c.G1762A						PASS	.						14.0	31.0	25.0					12																	53183951		1574	3123	4697	SO:0001583	missense	3850	exon9			CAAAGCCGCTGCC		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.1762G>A	12.37:g.53183951C>T	ENSP00000413479:p.Gly588Ser	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	42	8	0.190476	NM_057088	A6NIS2|Q701L8	Missense_Mutation	SNP	ENST00000417996.2	37	CCDS44895.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.307617	0.40795	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	D;D	0.91351	-2.83;-2.83	3.4	-1.34	0.09143	.	0.507655	0.14827	N	0.296110	T	0.80149	0.4570	N	0.22421	0.69	0.09310	N	1	B	0.18166	0.026	B	0.08055	0.003	T	0.65302	-0.6201	10	0.34782	T	0.22	.	7.4497	0.27231	0.0:0.4872:0.0:0.5128	.	588	P12035	K2C3_HUMAN	S	588;589	ENSP00000413479:G588S;ENSP00000312206:G589S	ENSP00000312206:G589S	G	-	1	0	KRT3	51470218	0.000000	0.05858	0.005000	0.12908	0.008000	0.06430	-1.682000	0.01935	-0.284000	0.09102	-0.258000	0.10820	GGC	.	.	none		0.697	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
CDH18	1016	hgsc.bcm.edu	37	5	19571926	19571926	+	Nonsense_Mutation	SNP	T	T	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr5:19571926T>A	ENST00000507958.1	-	10	2005	c.1015A>T	c.(1015-1017)Aaa>Taa	p.K339*	CDH18_ENST00000502796.1_Nonsense_Mutation_p.K339*|CDH18_ENST00000382275.1_Nonsense_Mutation_p.K339*|CDH18_ENST00000511273.1_Nonsense_Mutation_p.K339*|CDH18_ENST00000506372.1_Nonsense_Mutation_p.K339*|CDH18_ENST00000274170.4_Nonsense_Mutation_p.K339*			Q13634	CAD18_HUMAN	cadherin 18, type 2	339	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GACTTCTTTTTCTCATAGTTC	0.303																																					p.K339X		Atlas-SNP	.											.	CDH18	561	.	0			c.A1015T						PASS	.						62.0	65.0	64.0					5																	19571926		2203	4300	6503	SO:0001587	stop_gained	1016	exon8			TCTTTTTCTCATA	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1015A>T	5.37:g.19571926T>A	ENSP00000425093:p.Lys339*	Somatic	338	0	0		WXS	Illumina HiSeq	Phase_I	261	61	0.233716	NM_001167667	A8K0I2|B4DHG6|Q8N5Z2	Nonsense_Mutation	SNP	ENST00000507958.1	37	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	T	47	13.320112	0.99734	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	.	.	.	5.17	5.17	0.71159	.	0.048931	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.131	0.65253	0.0:0.0:0.0:1.0	.	.	.	.	X	339;339;339;339;339;339;285;339	.	.	K	-	1	0	CDH18	19607683	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.806000	0.69150	2.095000	0.63458	0.533000	0.62120	AAA	.	.	none		0.303	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
RGL3	57139	hgsc.bcm.edu	37	19	11507932	11507932	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr19:11507932G>A	ENST00000380456.3	-	18	2065	c.2002C>T	c.(2002-2004)Cct>Tct	p.P668S	RGL3_ENST00000568628.1_5'UTR|RGL3_ENST00000393423.3_Missense_Mutation_p.P674S	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	668	Interaction with HRAS, MRAS and RIT1. {ECO:0000250}.|Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						CGGTCCCCAGGAAGGACTTGA	0.637																																					p.P674S	GBM(174;751 2067 17998 27979 33959)	Atlas-SNP	.											.	RGL3	100	.	0			c.C2020T						PASS	.						79.0	81.0	80.0					19																	11507932		2203	4300	6503	SO:0001583	missense	57139	exon18			CCCCAGGAAGGAC	BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.2002C>T	19.37:g.11507932G>A	ENSP00000369823:p.Pro668Ser	Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	33	13	0.393939	NM_001161616	B5ME84|B7ZL22|Q0P6G0	Missense_Mutation	SNP	ENST00000380456.3	37	CCDS32910.1	.	.	.	.	.	.	.	.	.	.	G	3.931	-0.016219	0.07681	.	.	ENSG00000205517	ENST00000342684;ENST00000393423;ENST00000380456	T;T	0.54479	0.57;0.57	4.7	2.56	0.30785	Ras-association (3);	0.301362	0.36374	N	0.002635	T	0.46151	0.1378	L	0.35723	1.085	0.42444	D	0.992721	B;B;B;D	0.57571	0.033;0.015;0.019;0.98	B;B;B;P	0.57244	0.084;0.023;0.012;0.816	T	0.54397	-0.8300	10	0.02654	T	1	.	6.4223	0.21750	0.2994:0.0:0.7005:0.0	.	668;674;674;465	Q3MIN7;B5ME84;B7ZL22;Q8TEP0	RGL3_HUMAN;.;.;.	S	465;674;668	ENSP00000377075:P674S;ENSP00000369823:P668S	ENSP00000344665:P465S	P	-	1	0	RGL3	11368932	0.980000	0.34600	0.991000	0.47740	0.984000	0.73092	1.078000	0.30754	0.694000	0.31654	0.555000	0.69702	CCT	.	.	none		0.637	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421208.3	XM_290867	
BTK	695	hgsc.bcm.edu	37	X	100613634	100613634	+	Nonsense_Mutation	SNP	A	A	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chrX:100613634A>C	ENST00000308731.7	-	11	1108	c.945T>G	c.(943-945)taT>taG	p.Y315*	BTK_ENST00000372880.1_Nonsense_Mutation_p.Y315*	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	315	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						CAGACACTGTATATTTGCCAG	0.478									Agammaglobulinemia, X-linked																												p.Y315X		Atlas-SNP	.											.	BTK	87	.	0			c.T945G	GRCh37	CM980271	BTK	M		PASS	.						247.0	217.0	227.0					X																	100613634		2203	4300	6503	SO:0001587	stop_gained	695	exon11	Familial Cancer Database	Bruton Type Agammaglobulinemia	CACTGTATATTTG	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.945T>G	X.37:g.100613634A>C	ENSP00000308176:p.Tyr315*	Somatic	304	0	0		WXS	Illumina HiSeq	Phase_I	134	34	0.253731	NM_000061	B2RAW1|Q32ML5	Nonsense_Mutation	SNP	ENST00000308731.7	37	CCDS14482.1	.	.	.	.	.	.	.	.	.	.	A	40	8.164449	0.98686	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	.	.	.	5.88	-0.277	0.12898	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0824	0.64932	0.2624:0.0:0.7376:0.0	.	.	.	.	X	315	.	ENSP00000308176:Y315X	Y	-	3	2	BTK	100500290	1.000000	0.71417	0.985000	0.45067	0.988000	0.76386	1.439000	0.35013	-0.260000	0.09418	0.486000	0.48141	TAT	.	.	none		0.478	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057532.2	NM_000061	
TRANK1	9881	hgsc.bcm.edu	37	3	36898455	36898455	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr3:36898455C>A	ENST00000429976.2	-	12	2873	c.2626G>T	c.(2626-2628)Gcc>Tcc	p.A876S	TRANK1_ENST00000428977.2_Missense_Mutation_p.A326S|TRANK1_ENST00000301807.6_Missense_Mutation_p.A326S	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	876							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						TGCTCCGTGGCAATGATCTTC	0.532																																					p.A876S		Atlas-SNP	.											.	TRANK1	398	.	0			c.G2626T						PASS	.						55.0	50.0	52.0					3																	36898455		1990	4175	6165	SO:0001583	missense	9881	exon12			CCGTGGCAATGAT	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.2626G>T	3.37:g.36898455C>A	ENSP00000416168:p.Ala876Ser	Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	70	21	0.3	NM_014831	Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	C	0.157	-1.085744	0.01873	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.29655	1.56;1.97;1.56	5.49	0.111	0.14619	.	0.642324	0.15186	N	0.275836	T	0.15305	0.0369	N	0.19112	0.55	0.09310	N	1	B	0.20887	0.049	B	0.22386	0.039	T	0.29058	-1.0024	10	0.17832	T	0.49	.	5.6844	0.17794	0.124:0.5867:0.0:0.2893	.	876	O15050	TRNK1_HUMAN	S	326;876;326	ENSP00000416826:A326S;ENSP00000416168:A876S;ENSP00000301807:A326S	ENSP00000301807:A326S	A	-	1	0	TRANK1	36873459	0.021000	0.18746	0.000000	0.03702	0.002000	0.02628	0.424000	0.21330	0.072000	0.16694	-0.275000	0.10095	GCC	.	.	none		0.532	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
OR2T2	401992	hgsc.bcm.edu	37	1	248616329	248616329	+	Silent	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:248616329C>T	ENST00000342927.3	+	1	253	c.231C>T	c.(229-231)atC>atT	p.I77I		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACATCTGTATCACTGTCCCCA	0.522																																					p.I77I		Atlas-SNP	.											.	OR2T2	73	.	0			c.C231T						PASS	.						130.0	147.0	141.0					1																	248616329		2203	4297	6500	SO:0001819	synonymous_variant	401992	exon1			CTGTATCACTGTC	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.231C>T	1.37:g.248616329C>T		Somatic	674	0	0		WXS	Illumina HiSeq	Phase_I	689	44	0.0638607	NM_001004136	B2RNM1|B9EH01	Silent	SNP	ENST00000342927.3	37	CCDS31116.1																																																																																			.	.	none		0.522	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136	
BCKDHA	593	hgsc.bcm.edu	37	19	41932430	41932430	+	IGR	SNP	C	C	G			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr19:41932430C>G	ENST00000269980.2	+	0	2103				B3GNT8_ENST00000321702.2_Missense_Mutation_p.S85T|CTC-435M10.6_ENST00000598887.1_RNA|B3GNT8_ENST00000601379.1_Intron	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						GCTGTCCCCACTGGGCAGGGA	0.692																																					p.S85T		Atlas-SNP	.											.	B3GNT8	20	.	0			c.G254C						PASS	.						11.0	11.0	11.0					19																	41932430		2174	4270	6444	SO:0001628	intergenic_variant	374907	exon3			TCCCCACTGGGCA	J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128		19.37:g.41932430C>G		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	89	18	0.202247	NM_198540	B4DP47|E7EW46|Q16034|Q16472	Missense_Mutation	SNP	ENST00000269980.2	37	CCDS12581.1	.	.	.	.	.	.	.	.	.	.	C	10.21	1.288472	0.23478	.	.	ENSG00000177191	ENST00000321702	T	0.34859	1.34	4.21	1.79	0.24919	.	0.546871	0.16746	N	0.201230	T	0.21841	0.0526	N	0.25144	0.715	0.34090	D	0.660626	B	0.06786	0.001	B	0.04013	0.001	T	0.24333	-1.0163	10	0.14656	T	0.56	.	11.6491	0.51277	0.0:0.6581:0.3419:0.0	.	85	Q7Z7M8	B3GN8_HUMAN	T	85	ENSP00000312700:S85T	ENSP00000312700:S85T	S	-	2	0	B3GNT8	46624270	0.000000	0.05858	0.712000	0.30502	0.902000	0.53008	0.004000	0.13106	1.075000	0.40932	0.462000	0.41574	AGT	.	.	none		0.692	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398313.3	NM_000709	
TFAP2B	7021	hgsc.bcm.edu	37	6	50803938	50803938	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr6:50803938C>T	ENST00000393655.3	+	4	935	c.766C>T	c.(766-768)Cgg>Tgg	p.R256W	TFAP2B_ENST00000263046.4_Missense_Mutation_p.R265W	NM_003221.3	NP_003212.2	Q92481	AP2B_HUMAN	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	256					aorta morphogenesis (GO:0035909)|calcium ion homeostasis (GO:0055074)|cellular ammonia homeostasis (GO:0097275)|cellular creatinine homeostasis (GO:0097276)|cellular urea homeostasis (GO:0097277)|collecting duct development (GO:0072044)|distal tubule development (GO:0072017)|ductus arteriosus closure (GO:0097070)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hindlimb morphogenesis (GO:0035137)|kidney development (GO:0001822)|magnesium ion homeostasis (GO:0010960)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphate ion homeostasis (GO:0055062)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|potassium ion homeostasis (GO:0055075)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell differentiation (GO:0045595)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|renal water homeostasis (GO:0003091)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|retina layer formation (GO:0010842)|skin development (GO:0043588)|sodium ion homeostasis (GO:0055078)|sympathetic nervous system development (GO:0048485)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.R256G(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)	40	Lung NSC(77;0.156)					AGTTCAGAGACGGCTGTCGCC	0.498																																					p.R256W	Pancreas(116;1373 2332 5475 10752)	Atlas-SNP	.											TFAP2B,NS,carcinoma,0,1	TFAP2B	91	1	1	Substitution - Missense(1)	lung(1)	c.C766T						PASS	.						57.0	54.0	55.0					6																	50803938		2203	4300	6503	SO:0001583	missense	7021	exon4			CAGAGACGGCTGT	X95694	CCDS4934.2	6p12	2008-02-05	2001-11-28		ENSG00000008196	ENSG00000008196			11743	protein-coding gene	gene with protein product		601601	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)"""			7555706, 8661133	Standard	NM_003221		Approved	AP2-B	uc003pag.3	Q92481	OTTHUMG00000014836	ENST00000393655.3:c.766C>T	6.37:g.50803938C>T	ENSP00000377265:p.Arg256Trp	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	67	10	0.149254	NM_003221	Q5JYX6|Q9NQ63|Q9NU99|Q9UJI7|Q9Y214|Q9Y3K3	Missense_Mutation	SNP	ENST00000393655.3	37	CCDS4934.2	.	.	.	.	.	.	.	.	.	.	C	15.72	2.917242	0.52546	.	.	ENSG00000008196	ENST00000393655;ENST00000263046	D;D	0.99051	-5.37;-5.37	5.44	3.61	0.41365	Transcription factor AP-2, C-terminal (1);	0.109437	0.64402	D	0.000016	D	0.99174	0.9714	M	0.92604	3.325	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	D	0.99690	1.1001	10	0.87932	D	0	-12.5531	8.0974	0.30837	0.2894:0.6377:0.0:0.0729	.	256	Q92481	AP2B_HUMAN	W	256;265	ENSP00000377265:R256W;ENSP00000263046:R265W	ENSP00000263046:R265W	R	+	1	2	TFAP2B	50911897	1.000000	0.71417	0.998000	0.56505	0.338000	0.28826	2.714000	0.47202	0.625000	0.30304	-0.157000	0.13467	CGG	.	.	none		0.498	TFAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040886.3	NM_003221	
MYO9A	4649	hgsc.bcm.edu	37	15	72122636	72122636	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr15:72122636C>T	ENST00000356056.5	-	40	7326	c.6854G>A	c.(6853-6855)cGt>cAt	p.R2285H	MYO9A_ENST00000564571.1_Missense_Mutation_p.R2285H|MYO9A_ENST00000424560.1_Missense_Mutation_p.R2356H|MYO9A_ENST00000444904.1_Missense_Mutation_p.R2266H	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	2285	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GTTTCCTCGACGAATACGCCC	0.443																																					p.R2285H		Atlas-SNP	.											MYO9A,colon,carcinoma,-1,2	MYO9A	203	2	0			c.G6854A						scavenged	.						92.0	92.0	92.0					15																	72122636		2199	4297	6496	SO:0001583	missense	4649	exon40			CCTCGACGAATAC	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.6854G>A	15.37:g.72122636C>T	ENSP00000348349:p.Arg2285His	Somatic	83	1	0.0120482		WXS	Illumina HiSeq	Phase_I	58	17	0.293103	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.779952	0.31502	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.84730	-1.89;-1.89;-1.88	4.73	1.83	0.25207	.	.	.	.	.	T	0.73837	0.3638	N	0.25144	0.715	0.28282	N	0.923939	B;B	0.14012	0.009;0.0	B;B	0.04013	0.001;0.001	T	0.60372	-0.7276	9	0.30078	T	0.28	.	9.8686	0.41160	0.0:0.7822:0.0:0.2178	.	2285;2049	B2RTY4;B2RTY4-5	MYO9A_HUMAN;.	H	2285;2356;2266	ENSP00000348349:R2285H;ENSP00000399162:R2356H;ENSP00000398250:R2266H	ENSP00000348349:R2285H	R	-	2	0	MYO9A	69909690	0.020000	0.18652	0.797000	0.32132	0.997000	0.91878	0.416000	0.21198	0.319000	0.23209	0.655000	0.94253	CGT	.	.	none		0.443	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
ANO1	55107	hgsc.bcm.edu	37	11	70009435	70009435	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr11:70009435C>T	ENST00000355303.5	+	19	2244	c.1939C>T	c.(1939-1941)Cga>Tga	p.R647*	ANO1_ENST00000530676.1_Nonsense_Mutation_p.R501*|ANO1_ENST00000398543.2_Nonsense_Mutation_p.R501*|ANO1_ENST00000316296.5_Nonsense_Mutation_p.R589*|ANO1_ENST00000531349.1_Nonsense_Mutation_p.R356*|ANO1_ENST00000538023.1_Nonsense_Mutation_p.R647*	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	647					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	CCGTTCCTTCCGAATGGAAGA	0.517																																					p.R647X		Atlas-SNP	.											ANO1_ENST00000355303,NS,carcinoma,-1,2	ANO1	156	2	0			c.C1939T						PASS	.						65.0	68.0	67.0					11																	70009435		1947	4128	6075	SO:0001587	stop_gained	55107	exon19			TCCTTCCGAATGG	BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.1939C>T	11.37:g.70009435C>T	ENSP00000347454:p.Arg647*	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	100	17	0.17	NM_018043	A8KAM3|Q8IYY8|Q8N7V3	Nonsense_Mutation	SNP	ENST00000355303.5	37	CCDS44663.1	.	.	.	.	.	.	.	.	.	.	C	34	5.291684	0.95546	.	.	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000316296;ENST00000530676;ENST00000531349	.	.	.	5.08	5.08	0.68730	.	0.137550	0.48767	D	0.000162	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8074	0.63240	0.1531:0.8469:0.0:0.0	.	.	.	.	X	647;647;501;405;589;501;356	.	.	R	+	1	2	ANO1	69687083	1.000000	0.71417	0.999000	0.59377	0.440000	0.31957	2.470000	0.45119	2.535000	0.85469	0.655000	0.94253	CGA	.	.	none		0.517	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	NM_018043	
MUC4	4585	hgsc.bcm.edu	37	3	195506983	195506983	+	Missense_Mutation	SNP	G	G	A	rs541438739	byFrequency	TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr3:195506983G>A	ENST00000463781.3	-	2	11927	c.11468C>T	c.(11467-11469)aCc>aTc	p.T3823I	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3823I|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3823I(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGAGGGGTGGTGTCACC	0.587													.|||	248	0.0495208	0.1399	0.0317	5008	,	,		9423	0.002		0.0358	False		,,,				2504	0.0031				p.T3823I		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,+1,2	MUC4	1505	2	1	Substitution - Missense(1)	kidney(1)	c.C11468T						scavenged	.						5.0	5.0	5.0					3																	195506983		440	1246	1686	SO:0001583	missense	4585	exon2			AGAGGGGTGGTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11468C>T	3.37:g.195506983G>A	ENSP00000417498:p.Thr3823Ile	Somatic	77	3	0.038961		WXS	Illumina HiSeq	Phase_I	118	11	0.0932203	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	6.889	0.533565	0.13188	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33216	1.42;1.55	.	.	.	.	.	.	.	.	T	0.13200	0.0320	N	0.14661	0.345	0.09310	N	1	P	0.47604	0.898	B	0.36885	0.235	T	0.15838	-1.0423	7	.	.	.	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	3695	E7ESK3	.	I	3823	ENSP00000417498:T3823I;ENSP00000420243:T3823I	.	T	-	2	0	MUC4	196991762	0.000000	0.05858	0.110000	0.21437	0.111000	0.19643	-0.374000	0.07484	0.064000	0.16427	0.064000	0.15345	ACC	.	.	none		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SOGA1	140710	hgsc.bcm.edu	37	20	35433301	35433301	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr20:35433301T>C	ENST00000357779.3	-	10	2536	c.2210A>G	c.(2209-2211)aAt>aGt	p.N737S	SOGA1_ENST00000456801.2_Missense_Mutation_p.N578S|SOGA1_ENST00000279034.6_Missense_Mutation_p.N737S|SOGA1_ENST00000237536.4_Missense_Mutation_p.N975S			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	737					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						GATGTACTCATTGGGCTGCAG	0.577																																					p.N975S		Atlas-SNP	.											SOGA1_ENST00000237536,NS,carcinoma,+1,4	SOGA1	136	4	0			c.A2924G						PASS	.						72.0	75.0	74.0					20																	35433301		2094	4240	6334	SO:0001583	missense	140710	exon10			TACTCATTGGGCT	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.2210A>G	20.37:g.35433301T>C	ENSP00000350424:p.Asn737Ser	Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	38	10	0.263158	NM_080627	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		.	.	.	.	.	.	.	.	.	.	T	10.46	1.355804	0.24598	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.16897	2.31;2.31;2.32;2.32	4.79	3.69	0.42338	.	0.175827	0.49916	D	0.000122	T	0.09468	0.0233	N	0.22421	0.69	0.28792	N	0.899245	B	0.30236	0.274	B	0.31751	0.135	T	0.28396	-1.0045	10	0.08599	T	0.76	-18.6184	7.0441	0.25037	0.0:0.1806:0.0:0.8194	.	737	O94964-4	.	S	975;737;578;737	ENSP00000237536:N975S;ENSP00000279034:N737S;ENSP00000413886:N578S;ENSP00000350424:N737S	ENSP00000237536:N975S	N	-	2	0	KIAA0889	34866715	0.998000	0.40836	0.901000	0.35422	0.935000	0.57460	3.290000	0.51755	0.858000	0.35431	0.455000	0.32223	AAT	.	.	none		0.577	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230440	23230440	+	Splice_Site	SNP	G	G	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr22:23230440G>C	ENST00000526893.1	+	1	480		c.e1+1		IGLL5_ENST00000531372.1_Splice_Site|IGLL5_ENST00000532223.2_Splice_Site|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5							extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						TGTGGGGCAGGTAAGGGGCAA	0.627																																					.		Atlas-SNP	.											.	IGLL5	26	.	0			c.100+1G>C						PASS	.																																			SO:0001630	splice_region_variant	100423062	exon1			GGGCAGGTAAGGG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.206+1G>C	22.37:g.23230440G>C		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	69	12	0.173913	NM_001256296		Splice_Site	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	9.687	1.150929	0.21371	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	.	.	.	3.92	3.92	0.45320	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.74	0.51788	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IGLL5	21560440	1.000000	0.71417	1.000000	0.80357	0.199000	0.23934	1.700000	0.37815	2.481000	0.83766	0.643000	0.83706	.	.	.	none		0.627	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	Intron
OR5R1	219479	hgsc.bcm.edu	37	11	56184896	56184896	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr11:56184896G>T	ENST00000312253.1	-	1	812	c.813C>A	c.(811-813)gaC>gaA	p.D271E		NM_001004744.1	NP_001004744.1	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R, member 1	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(17)|ovary(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(21;0.00448)					AAGCCATCTTGTCTGTGTCCA	0.423																																					p.D271E		Atlas-SNP	.											.	OR5R1	83	.	0			c.C813A						PASS	.						177.0	166.0	170.0					11																	56184896		2201	4296	6497	SO:0001583	missense	219479	exon1			CATCTTGTCTGTG	AB065504	CCDS31530.1	11q11	2012-08-09		2004-03-10	ENSG00000174942	ENSG00000174942		"""GPCR / Class A : Olfactory receptors"""	14841	protein-coding gene	gene with protein product				OR5R1P			Standard	NM_001004744		Approved		uc010rji.2	Q8NH85	OTTHUMG00000154219	ENST00000312253.1:c.813C>A	11.37:g.56184896G>T	ENSP00000308595:p.Asp271Glu	Somatic	178	0	0		WXS	Illumina HiSeq	Phase_I	165	36	0.218182	NM_001004744		Missense_Mutation	SNP	ENST00000312253.1	37	CCDS31530.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813840	0.32053	.	.	ENSG00000174942	ENST00000312253	T	0.00227	8.5	5.62	-2.82	0.05787	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34507	U	0.003901	T	0.00300	0.0009	L	0.59912	1.85	0.09310	N	1	D	0.76494	0.999	D	0.75484	0.986	T	0.53549	-0.8423	10	0.51188	T	0.08	-16.7854	2.7811	0.05361	0.3173:0.1061:0.4679:0.1086	.	271	Q8NH85	OR5R1_HUMAN	E	271	ENSP00000308595:D271E	ENSP00000308595:D271E	D	-	3	2	OR5R1	55941472	0.792000	0.28813	0.480000	0.27341	0.008000	0.06430	-0.321000	0.08018	-0.445000	0.07159	-0.925000	0.02716	GAC	.	.	none		0.423	OR5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334444.1	NM_001004744	
FANCA	2175	hgsc.bcm.edu	37	16	89880941	89880941	+	Silent	SNP	A	A	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr16:89880941A>T	ENST00000389301.3	-	3	300	c.270T>A	c.(268-270)tcT>tcA	p.S90S	FANCA_ENST00000389302.3_Silent_p.S90S|FANCA_ENST00000543736.1_Silent_p.S90S|FANCA_ENST00000568369.1_Silent_p.S90S|FANCA_ENST00000534992.1_Silent_p.S90S|FANCA_ENST00000563673.1_Silent_p.S90S	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	90					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		TAAATGAACTAGAATGATTAG	0.328			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.S90S		Atlas-SNP	.	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	FANCA	99	.	0			c.T270A						PASS	.						90.0	88.0	89.0					16																	89880941		2198	4300	6498	SO:0001819	synonymous_variant	2175	exon3	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TGAACTAGAATGA	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.270T>A	16.37:g.89880941A>T		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	83	18	0.216867	NM_000135	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Silent	SNP	ENST00000389301.3	37	CCDS32515.1																																																																																			.	.	none		0.328	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
SPG11	80208	hgsc.bcm.edu	37	15	44914054	44914054	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr15:44914054T>A	ENST00000261866.7	-	14	2539	c.2523A>T	c.(2521-2523)gaA>gaT	p.E841D	SPG11_ENST00000535302.2_Missense_Mutation_p.E841D|SPG11_ENST00000558319.1_Missense_Mutation_p.E841D|SPG11_ENST00000427534.2_Missense_Mutation_p.E841D	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	841					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		GTTTGTTAAATTCATCTTTAC	0.363																																					p.E841D		Atlas-SNP	.											.	SPG11	207	.	0			c.A2523T						PASS	.						98.0	88.0	91.0					15																	44914054		2198	4298	6496	SO:0001583	missense	80208	exon14			GTTAAATTCATCT		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.2523A>T	15.37:g.44914054T>A	ENSP00000261866:p.Glu841Asp	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	126	30	0.238095	NM_025137	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	ENST00000261866.7	37	CCDS10112.1	.	.	.	.	.	.	.	.	.	.	T	15.83	2.950200	0.53186	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	T;T;T	0.78595	-1.19;-0.94;-0.93	5.76	3.48	0.39840	.	0.413681	0.26432	N	0.024404	T	0.64472	0.2601	L	0.36672	1.1	0.47441	D	0.999429	B;B;B	0.20988	0.005;0.05;0.005	B;B;B	0.17722	0.008;0.019;0.008	T	0.52859	-0.8519	10	0.23302	T	0.38	.	7.7834	0.29078	0.0:0.1583:0.0:0.8417	.	841;841;841	C4B7M2;F5H3N6;Q96JI7	.;.;SPTCS_HUMAN	D	841	ENSP00000261866:E841D;ENSP00000445278:E841D;ENSP00000396110:E841D	ENSP00000261866:E841D	E	-	3	2	SPG11	42701346	0.022000	0.18835	0.992000	0.48379	0.993000	0.82548	0.240000	0.18042	0.472000	0.27344	0.533000	0.62120	GAA	.	.	none		0.363	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
SPO11	23626	hgsc.bcm.edu	37	20	55910492	55910492	+	Silent	SNP	G	G	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr20:55910492G>A	ENST00000371263.3	+	7	724	c.615G>A	c.(613-615)tcG>tcA	p.S205S	SPO11_ENST00000345868.4_Silent_p.S167S|SPO11_ENST00000371260.4_Silent_p.S167S	NM_012444.2	NP_036576.1	Q9Y5K1	SPO11_HUMAN	SPO11 meiotic protein covalently bound to DSB	205					DNA catabolic process, endonucleolytic (GO:0000737)|female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|ovarian follicle development (GO:0001541)|protein localization to chromosome (GO:0034502)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|hydrolase activity (GO:0016787)			autonomic_ganglia(1)|breast(3)|large_intestine(4)|lung(8)|skin(2)	18	Lung NSC(12;0.0066)|all_lung(29;0.0188)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.73e-14)|Epithelial(14;9.02e-10)|all cancers(14;9.31e-09)			CTGTGCCATCGAATATTCAAG	0.303								Editing and processing nucleases																													p.S205S		Atlas-SNP	.											.	SPO11	43	.	0			c.G615A						PASS	.						61.0	58.0	59.0					20																	55910492		2202	4300	6502	SO:0001819	synonymous_variant	23626	exon7			GCCATCGAATATT	AF169385	CCDS13456.1, CCDS13457.1	20q13.31	2013-06-05	2013-06-05		ENSG00000054796	ENSG00000054796			11250	protein-coding gene	gene with protein product	"""cancer/testis antigen 35"", ""spermatogenesis associated 43"""	605114	"""SPO11, meiotic protein covalently bound to DSB (S. cerevisiae)-like"", ""SPO11 meiotic protein covalently bound to DSB-like (S. cerevisiae)"", ""SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)"""			10534401	Standard	NM_012444		Approved	CT35, SPATA43, TOPVIA	uc002xye.3	Q9Y5K1	OTTHUMG00000032817	ENST00000371263.3:c.615G>A	20.37:g.55910492G>A		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	90	16	0.177778	NM_012444	Q5TCI1|Q8N4V0|Q9NQM7|Q9NQM8	Silent	SNP	ENST00000371263.3	37	CCDS13456.1																																																																																			.	.	none		0.303	SPO11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079836.2	NM_012444	
KIAA0754	643314	hgsc.bcm.edu	37	1	39877011	39877011	+	Silent	SNP	A	A	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:39877011A>C	ENST00000530275.1	+	1	861	c.666A>C	c.(664-666)gcA>gcC	p.A222A	MACF1_ENST00000564288.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000539005.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	222										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACAGCCTGGCAGATATTTTTG	0.473											OREG0013393	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A358A		Atlas-SNP	.											.	KIAA0754	93	.	0			c.A1074C						PASS	.						123.0	126.0	125.0					1																	39877011		1964	4158	6122	SO:0001819	synonymous_variant	643314	exon1			CCTGGCAGATATT			1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.666A>C	1.37:g.39877011A>C		Somatic	190	0	0	889	WXS	Illumina HiSeq	Phase_I	161	36	0.223602	NM_015038	E9PMC2|Q6ZSB2	Silent	SNP	ENST00000530275.1	37																																																																																				.	.	none		0.473	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1	NM_015038	
KCNN1	3780	hgsc.bcm.edu	37	19	18108988	18108988	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr19:18108988T>C	ENST00000222249.9	+	11	1724	c.1405T>C	c.(1405-1407)Tcg>Ccg	p.S469P	ARRDC2_ENST00000379656.3_5'Flank	NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	469					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	CGACCTTGTATCGGAGCTGCA	0.642																																					p.S469P		Atlas-SNP	.											.	KCNN1	74	.	0			c.T1405C						PASS	.						14.0	17.0	16.0					19																	18108988		2163	4270	6433	SO:0001583	missense	3780	exon11			CTTGTATCGGAGC	U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.1405T>C	19.37:g.18108988T>C	ENSP00000476519:p.Ser469Pro	Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	44	13	0.295455	NM_002248	Q5KR10|Q6DJU4	Missense_Mutation	SNP	ENST00000222249.9	37		.	.	.	.	.	.	.	.	.	.	T	13.69	2.313548	0.40996	.	.	ENSG00000105642	ENST00000222249	.	.	.	4.19	1.79	0.24919	.	0.206931	0.42964	D	0.000639	T	0.45377	0.1339	L	0.55213	1.73	0.80722	D	1	P	0.44877	0.845	B	0.44044	0.439	T	0.32375	-0.9909	9	0.49607	T	0.09	-12.4163	5.103	0.14770	0.1427:0.0:0.2672:0.5901	.	469	Q92952	KCNN1_HUMAN	P	486	.	ENSP00000222249:S486P	S	+	1	0	KCNN1	17969988	0.961000	0.32948	0.965000	0.40720	0.134000	0.20937	0.750000	0.26334	0.486000	0.27676	0.397000	0.26171	TCG	.	.	none		0.642	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248	
PSG6	5675	hgsc.bcm.edu	37	19	43420486	43420486	+	Missense_Mutation	SNP	G	G	A	rs140974685|rs386809478	byFrequency	TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr19:43420486G>A	ENST00000292125.2	-	2	262	c.218C>T	c.(217-219)aCg>aTg	p.T73M	PSG6_ENST00000187910.2_Missense_Mutation_p.T73M|PSG6_ENST00000402603.4_Missense_Mutation_p.T73M|PSG6_ENST00000601833.1_Missense_Mutation_p.T2M	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	73	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				GTAGAGGTCCGTCATTTGCCC	0.453																																					p.T73M		Atlas-SNP	.											.	PSG6	89	.	0			c.C218T						PASS	.						243.0	238.0	239.0					19																	43420486		2202	4299	6501	SO:0001583	missense	5675	exon2			AGGTCCGTCATTT		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.218C>T	19.37:g.43420486G>A	ENSP00000292125:p.Thr73Met	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	124	20	0.16129	NM_001031850	O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	37	CCDS12613.1	.	.	.	.	.	.	.	.	.	.	N	0.006	-2.086760	0.00367	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125;ENST00000402456	T;T;T	0.65916	-0.18;-0.18;-0.18	1.47	-2.95	0.05564	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.32882	0.0844	N	0.04724	-0.175	0.09310	N	1	B;B;B	0.22746	0.01;0.009;0.074	B;B;B	0.25987	0.028;0.01;0.065	T	0.15122	-1.0448	9	0.33141	T	0.24	.	1.1353	0.01754	0.2697:0.2892:0.2973:0.1438	.	73;73;73	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	M	73	ENSP00000187910:T73M;ENSP00000385736:T73M;ENSP00000292125:T73M	ENSP00000187910:T73M	T	-	2	0	PSG6	48112326	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.550000	0.02180	-5.346000	0.00016	-4.576000	0.00004	ACG	G|0.969;C|0.031	.	alt		0.453	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	NM_002782	
KRTAP4-3	85290	hgsc.bcm.edu	37	17	39324333	39324333	+	Missense_Mutation	SNP	T	T	A	rs12953139	byFrequency	TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr17:39324333T>A	ENST00000391356.2	-	1	91	c.92A>T	c.(91-93)cAg>cTg	p.Q31L		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	31					aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCAGGTGGTCTGGCAGCAGCT	0.637																																					p.Q31L		Atlas-SNP	.											KRTAP4-3,NS,carcinoma,0,1	KRTAP4-3	40	1	0			c.A92T						PASS	.						29.0	32.0	31.0					17																	39324333		2195	4293	6488	SO:0001583	missense	85290	exon1			GTGGTCTGGCAGC	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.92A>T	17.37:g.39324333T>A	ENSP00000375151:p.Gln31Leu	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	122	33	0.270492	NM_033187		Missense_Mutation	SNP	ENST00000391356.2	37	CCDS42331.1	.	.	.	.	.	.	.	.	.	.	.	8.661	0.900435	0.17686	.	.	ENSG00000196156	ENST00000391356	T	0.01629	4.72	5.15	0.112	0.14623	.	.	.	.	.	T	0.03608	0.0103	M	0.85373	2.75	0.80722	P	0.0	B	0.34181	0.44	B	0.38378	0.272	T	0.11131	-1.0600	8	0.35671	T	0.21	.	3.821	0.08836	0.1588:0.2591:0.0:0.5822	.	31	Q9BYR4	KRA43_HUMAN	L	31	ENSP00000375151:Q31L	ENSP00000375151:Q31L	Q	-	2	0	KRTAP4-3	36577859	0.006000	0.16342	0.208000	0.23602	0.204000	0.24138	0.129000	0.15830	0.020000	0.15106	0.533000	0.62120	CAG	A|0.046;T|0.954	0.046	strong		0.637	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
BCL7A	605	hgsc.bcm.edu	37	12	122460029	122460029	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr12:122460029G>C	ENST00000261822.4	+	1	238	c.32G>C	c.(31-33)aGg>aCg	p.R11T	BCL7A_ENST00000538010.1_Missense_Mutation_p.R11T|RP11-87C12.5_ENST00000538710.1_lincRNA	NM_001024808.1	NP_001019979.1	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A	11					negative regulation of transcription, DNA-templated (GO:0045892)					haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		GCCGAGACGAGGAGCCGGGCC	0.721			T	MYC	BNHL																																p.R11T	GBM(17;197 467 16477 23242 44349)	Atlas-SNP	.		Dom	yes		12	12q24.1	605	B-cell CLL/lymphoma 7A		L	BCL7A,NS,lymphoid_neoplasm,+1,2	BCL7A	31	2	0			c.G32C						scavenged	.						22.0	22.0	22.0					12																	122460029		2199	4296	6495	SO:0001583	missense	605	exon1			AGACGAGGAGCCG	X89984	CCDS9226.1, CCDS53841.1	12q24.1	2008-07-03			ENSG00000110987	ENSG00000110987			1004	protein-coding gene	gene with protein product		601406		BCL7		8605326, 9931421	Standard	NM_020993		Approved		uc001ubo.3	Q4VC05	OTTHUMG00000168951	ENST00000261822.4:c.32G>C	12.37:g.122460029G>C	ENSP00000261822:p.Arg11Thr	Somatic	45	1	0.0222222		WXS	Illumina HiSeq	Phase_I	44	26	0.590909	NM_020993	B4DJN6|B7ZB21|Q13843|Q14CT7	Missense_Mutation	SNP	ENST00000261822.4	37	CCDS53841.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.179630	0.57800	.	.	ENSG00000110987	ENST00000538010;ENST00000261822	T;T	0.79653	-1.29;-1.14	4.24	2.39	0.29439	.	0.000000	0.85682	U	0.000000	D	0.87549	0.6205	M	0.79926	2.475	0.58432	D	0.999999	B;D	0.61080	0.322;0.989	B;D	0.75020	0.192;0.985	D	0.85773	0.1356	10	0.87932	D	0	.	8.2255	0.31566	0.1964:0.0:0.8036:0.0	.	11;11	Q4VC05;Q4VC05-2	BCL7A_HUMAN;.	T	11	ENSP00000445868:R11T;ENSP00000261822:R11T	ENSP00000261822:R11T	R	+	2	0	BCL7A	120944412	1.000000	0.71417	1.000000	0.80357	0.300000	0.27592	7.291000	0.78721	0.271000	0.22005	0.460000	0.39030	AGG	.	.	none		0.721	BCL7A-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000401712.1		
LPHN2	23266	hgsc.bcm.edu	37	1	82421682	82421682	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:82421682C>A	ENST00000370728.1	+	13	2588	c.1943C>A	c.(1942-1944)gCt>gAt	p.A648D	LPHN2_ENST00000370713.1_Missense_Mutation_p.A635D|LPHN2_ENST00000359929.3_Missense_Mutation_p.A635D|LPHN2_ENST00000370727.1_Missense_Mutation_p.A648D|LPHN2_ENST00000370721.1_Missense_Mutation_p.A573D|LPHN2_ENST00000370717.2_Missense_Mutation_p.A648D|LPHN2_ENST00000271029.4_Missense_Mutation_p.A648D|LPHN2_ENST00000394879.1_Missense_Mutation_p.A635D|LPHN2_ENST00000370715.1_Missense_Mutation_p.A635D|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370725.1_Missense_Mutation_p.A648D|LPHN2_ENST00000370723.1_Missense_Mutation_p.A635D|LPHN2_ENST00000370730.1_Missense_Mutation_p.A648D|LPHN2_ENST00000335786.5_Missense_Mutation_p.A648D|LPHN2_ENST00000319517.6_Missense_Mutation_p.A635D			O95490	LPHN2_HUMAN	latrophilin 2	648					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GAAGAAGGAGCTTTTGTCCTA	0.378																																					p.A635D		Atlas-SNP	.											.	LPHN2	464	.	0			c.C1904A						PASS	.						114.0	106.0	109.0					1																	82421682		2203	4300	6503	SO:0001583	missense	23266	exon9			AAGGAGCTTTTGT	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.1943C>A	1.37:g.82421682C>A	ENSP00000359763:p.Ala648Asp	Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	114	25	0.219298	NM_012302	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.6|28.6	4.936727|4.936727	0.92458|0.92458	.|.	.|.	ENSG00000117114|ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786|ENST00000449420	T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.14766|.	2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48|.	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79493|0.79493	0.4455|0.4455	M|M	0.83953|0.83953	2.67|2.67	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.997;0.999;1.0|.	T|T	0.80214|0.80214	-0.1475|-0.1475	10|5	0.87932|.	D|.	0|.	.|.	19.3323|19.3323	0.94295|0.94295	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	635;635;635|.	O95490-3;O95490-4;O95490-2|.	.;.;.|.	D|I	573;648;648;648;648;635;635;635;635;635;648;635;648;648|516	ENSP00000359756:A573D;ENSP00000359763:A648D;ENSP00000359765:A648D;ENSP00000359762:A648D;ENSP00000359760:A648D;ENSP00000359758:A635D;ENSP00000353006:A635D;ENSP00000359750:A635D;ENSP00000359748:A635D;ENSP00000322270:A635D;ENSP00000359752:A648D;ENSP00000378344:A635D;ENSP00000271029:A648D;ENSP00000337306:A648D|.	ENSP00000271029:A648D|.	A|L	+|+	2|1	0|0	LPHN2|LPHN2	82194270|82194270	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.487000|7.487000	0.81328|0.81328	2.568000|2.568000	0.86640|0.86640	0.467000|0.467000	0.42956|0.42956	GCT|CTT	.	.	none		0.378	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302	
HPSE2	60495	hgsc.bcm.edu	37	10	100995457	100995457	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr10:100995457G>T	ENST00000370552.3	-	1	162	c.103C>A	c.(103-105)Ctc>Atc	p.L35I	HPSE2_ENST00000370546.1_Missense_Mutation_p.L35I|HPSE2_ENST00000404542.1_Missense_Mutation_p.L35I|HPSE2_ENST00000370549.1_Missense_Mutation_p.L35I	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	35					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		GAAAGGGAGAGATGGAGCAAC	0.592																																					p.L35I		Atlas-SNP	.											.	HPSE2	203	.	0			c.C103A						PASS	.						86.0	90.0	88.0					10																	100995457		2203	4300	6503	SO:0001583	missense	60495	exon1			GGGAGAGATGGAG	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.103C>A	10.37:g.100995457G>T	ENSP00000359583:p.Leu35Ile	Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	157	25	0.159236	NM_001166246	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	ENST00000370552.3	37	CCDS7477.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.680987	0.47886	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000370546;ENST00000404542	T;T;T;T	0.00473	7.18;7.18;7.18;7.18	5.8	4.9	0.64082	.	0.447080	0.23696	N	0.045468	T	0.00328	0.0010	L	0.36672	1.1	0.20821	N	0.999848	B;B;B;B	0.26809	0.16;0.16;0.069;0.041	B;B;B;B	0.21917	0.037;0.037;0.037;0.016	T	0.44667	-0.9313	10	0.26408	T	0.33	-10.382	7.4123	0.27023	0.2518:0.0:0.7482:0.0	.	35;35;35;35	Q8WWQ2-4;Q8WWQ2-2;Q8WWQ2-3;Q8WWQ2	.;.;.;HPSE2_HUMAN	I	35	ENSP00000359583:L35I;ENSP00000359580:L35I;ENSP00000359577:L35I;ENSP00000384384:L35I	ENSP00000359577:L35I	L	-	1	0	HPSE2	100985447	0.990000	0.36364	1.000000	0.80357	0.994000	0.84299	1.007000	0.29860	1.474000	0.48178	0.561000	0.74099	CTC	.	.	none		0.592	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828	
MUC4	4585	hgsc.bcm.edu	37	3	195510062	195510062	+	Missense_Mutation	SNP	G	G	C	rs200366897		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr3:195510062G>C	ENST00000463781.3	-	2	8848	c.8389C>G	c.(8389-8391)Cac>Gac	p.H2797D	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H2797D|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H2797D(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGTGTGACCTGTGGAT	0.587																																					p.H2797D		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	1	Substitution - Missense(1)	kidney(1)	c.C8389G						scavenged	.						62.0	36.0	44.0					3																	195510062		687	1519	2206	SO:0001583	missense	4585	exon2			TGGTGTGACCTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8389C>G	3.37:g.195510062G>C	ENSP00000417498:p.His2797Asp	Somatic	176	10	0.0568182		WXS	Illumina HiSeq	Phase_I	302	22	0.0728477	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	2.270	-0.367202	0.05069	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.53;1.53	0.918	0.918	0.19386	.	.	.	.	.	T	0.15609	0.0376	N	0.19112	0.55	0.18873	N	0.999985	P	0.47604	0.898	B	0.37550	0.253	T	0.12218	-1.0556	8	.	.	.	.	7.3741	0.26818	0.0:0.0:1.0:0.0	.	2669	E7ESK3	.	D	2797	ENSP00000417498:H2797D;ENSP00000420243:H2797D	.	H	-	1	0	MUC4	196994841	0.000000	0.05858	0.213000	0.23690	0.036000	0.12997	0.296000	0.19083	0.432000	0.26286	0.074000	0.15403	CAC	.	.	weak		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ATP9A	10079	hgsc.bcm.edu	37	20	50310555	50310555	+	Missense_Mutation	SNP	T	T	C	rs566503519		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr20:50310555T>C	ENST00000338821.5	-	7	898	c.634A>G	c.(634-636)Acg>Gcg	p.T212A	ATP9A_ENST00000402822.1_Intron|ATP9A_ENST00000311637.5_Intron	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	212					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						ACGGCGGCCGTGGGGAGCCTC	0.617																																					p.T212A		Atlas-SNP	.											ATP9A,rectum,carcinoma,+2,2	ATP9A	135	2	0			c.A634G						PASS	.						39.0	43.0	42.0					20																	50310555		2202	4299	6501	SO:0001583	missense	10079	exon7			CGGCCGTGGGGAG	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.634A>G	20.37:g.50310555T>C	ENSP00000342481:p.Thr212Ala	Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	128	22	0.171875	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	37	CCDS33489.1	.	.	.	.	.	.	.	.	.	.	T	11.73	1.726183	0.30593	.	.	ENSG00000054793	ENST00000338821	T	0.78364	-1.17	5.04	5.04	0.67666	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	T	0.60894	0.2304	N	0.11818	0.18	0.80722	D	1	B	0.09022	0.002	B	0.15052	0.012	T	0.56517	-0.7966	10	0.15066	T	0.55	-28.3414	14.7939	0.69863	0.0:0.0:0.0:1.0	.	212	O75110	ATP9A_HUMAN	A	212	ENSP00000342481:T212A	ENSP00000342481:T212A	T	-	1	0	ATP9A	49743962	1.000000	0.71417	0.993000	0.49108	0.791000	0.44710	5.986000	0.70563	1.889000	0.54706	0.533000	0.62120	ACG	.	.	none		0.617	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
ARHGEF11	9826	hgsc.bcm.edu	37	1	156931508	156931508	+	Silent	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:156931508C>T	ENST00000361409.2	-	13	1822	c.1080G>A	c.(1078-1080)ttG>ttA	p.L360L	ARHGEF11_ENST00000368194.3_Silent_p.L400L	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	360	RGSL. {ECO:0000255|PROSITE- ProRule:PRU00171}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TGTCTTTCCCCAAGCTTCGGG	0.443																																					p.L400L		Atlas-SNP	.											.	ARHGEF11	168	.	0			c.G1200A						PASS	.						83.0	90.0	88.0					1																	156931508		2203	4300	6503	SO:0001819	synonymous_variant	9826	exon14			TTTCCCCAAGCTT	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.1080G>A	1.37:g.156931508C>T		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	102	26	0.254902	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	ENST00000361409.2	37	CCDS1162.1																																																																																			.	.	none		0.443	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
PLEKHA6	22874	hgsc.bcm.edu	37	1	204199657	204199657	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:204199657C>T	ENST00000272203.3	-	18	2783	c.2467G>A	c.(2467-2469)Gag>Aag	p.E823K	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.E843K	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	823										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			TCAATCTGCTCCTCCACGCTC	0.647																																					p.E823K		Atlas-SNP	.											.	PLEKHA6	115	.	0			c.G2467A						PASS	.						40.0	33.0	35.0					1																	204199657		2203	4300	6503	SO:0001583	missense	22874	exon18			TCTGCTCCTCCAC	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2467G>A	1.37:g.204199657C>T	ENSP00000272203:p.Glu823Lys	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	123	18	0.146341	NM_014935	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	37	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	C	32	5.119049	0.94385	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.25912	1.77;2.24	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.55529	0.1926	M	0.82323	2.585	0.58432	D	0.999999	D	0.58268	0.982	D	0.67548	0.952	T	0.62229	-0.6898	10	0.87932	D	0	-30.4922	18.4131	0.90559	0.0:1.0:0.0:0.0	.	823	Q9Y2H5	PKHA6_HUMAN	K	823;843	ENSP00000272203:E823K;ENSP00000402046:E843K	ENSP00000272203:E823K	E	-	1	0	PLEKHA6	202466280	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	7.028000	0.76470	2.435000	0.82474	0.462000	0.41574	GAG	.	.	none		0.647	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
C4A	720	hgsc.bcm.edu	37	6	31963559	31963559	+	Missense_Mutation	SNP	A	A	G	rs147162052		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr6:31963559A>G	ENST00000428956.2	+	25	3302	c.3218A>G	c.(3217-3219)gAc>gGc	p.D1073G	C4A_ENST00000498271.1_Missense_Mutation_p.D1073G	NM_007293.2	NP_009224.2	P0C0L4	CO4A_HUMAN	complement component 4A (Rodgers blood group)	1073			D -> G (in allotype C4A1, allotype C4A2; dbSNP:rs147162052). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:3696167, ECO:0000269|Ref.8}.		complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement component C1q binding (GO:0001849)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	TTGTCACGGGACAGCAGCACC	0.612																																					p.G1073G		Atlas-SNP	.											C4B,right_upper_lobe,carcinoma,0,2	C4A	15	2	0			c.G3218G						scavenged	.						101.0	86.0	91.0					6																	31963559		1499	2656	4155	SO:0001583	missense	720	exon25			CACGGGACAGCAG	L26261, M14823, X77491, AY224378	CCDS47404.1, CCDS59005.1	6p21.3	2014-09-17	2006-01-19		ENSG00000244731	ENSG00000244731		"""Blood group antigens"", ""Complement system"""	1323	protein-coding gene	gene with protein product		120810	"""complement component 4A"""				Standard	NM_001252204		Approved	CPAMD2, C4S, CO4, C4, C4A3, C4A2, C4A4, C4A6, C4B, RG		P0C0L4	OTTHUMG00000031186	ENST00000428956.2:c.3218A>G	6.37:g.31963559A>G	ENSP00000396688:p.Asp1073Gly	Somatic	1132	6	0.00530035		WXS	Illumina HiSeq	Phase_I	1081	18	0.0166512	NM_007293	A6H8M8|A6NHJ5|A7E2V2|B0QZR6|B0V2C8|B2RUT6|B7ZVZ6|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q4LE82|Q5JNX2|Q5JQM8|Q6P4R1|Q6U2E5|Q6U2E8|Q6U2F0|Q6U2F3|Q6U2F4|Q6U2F6|Q6U2F8|Q6U2G0|Q96EG2|Q96SA8|Q9NPK5|Q9UIP5	Silent	SNP	ENST00000428956.2	37	CCDS47404.1	.	.	.	.	.	.	.	.	.	.	A	1.712	-0.498842	0.04291	.	.	ENSG00000244731	ENST00000428956;ENST00000498271	T;T	0.37915	1.17;1.17	3.11	1.88	0.25563	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	.	.	.	.	T	0.16642	0.0400	M	0.64170	1.965	0.80722	D	1	B;B	0.19200	0.015;0.034	B;B	0.23150	0.026;0.044	T	0.04885	-1.0920	9	0.46703	T	0.11	.	5.4739	0.16686	0.8606:0.0:0.1394:0.0	.	1073;1073	A6H8M8;P0C0L4	.;CO4A_HUMAN	G	1073	ENSP00000396688:D1073G;ENSP00000420212:D1073G	ENSP00000396688:D1073G	D	+	2	0	C4A	32071538	0.168000	0.22989	0.910000	0.35882	0.043000	0.13939	0.471000	0.22100	0.399000	0.25367	-1.226000	0.01582	GAC	A|0.500;G|0.500	0.500	strong		0.612	C4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076364.3	NM_007293	
FLVCR1	28982	hgsc.bcm.edu	37	1	213061854	213061854	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:213061854C>A	ENST00000366971.4	+	7	1529	c.1331C>A	c.(1330-1332)cCt>cAt	p.P444H	FLVCR1_ENST00000483790.1_3'UTR	NM_014053.3	NP_054772.1	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular receptor 1	444					blood vessel development (GO:0001568)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|head morphogenesis (GO:0060323)|heme export (GO:0097037)|heme transport (GO:0015886)|in utero embryonic development (GO:0001701)|mitochondrial transport (GO:0006839)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|regulation of organ growth (GO:0046620)|spleen development (GO:0048536)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	heme transporter activity (GO:0015232)|transporter activity (GO:0005215)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(2)	12				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		GGTTACCTCCCTTTGGGTTTT	0.393																																					p.P444H	Esophageal Squamous(199;2235 2952 19233 26256)	Atlas-SNP	.											.	FLVCR1	31	.	0			c.C1331A						PASS	.						201.0	185.0	190.0					1																	213061854		2203	4300	6503	SO:0001583	missense	28982	exon7			ACCTCCCTTTGGG	AF118637	CCDS1510.1	1q32.3	2014-05-30			ENSG00000162769	ENSG00000162769		"""Solute carriers"""	24682	protein-coding gene	gene with protein product		609144	"""ataxia, posterior column 1, with retinitis pigmentosa"""	AXPC1		10400745, 10648427, 21070897	Standard	NM_014053		Approved	FLVCR, MFSD7B, PCA	uc001hjt.3	Q9Y5Y0	OTTHUMG00000036924	ENST00000366971.4:c.1331C>A	1.37:g.213061854C>A	ENSP00000355938:p.Pro444His	Somatic	210	0	0		WXS	Illumina HiSeq	Phase_I	248	38	0.153226	NM_014053	Q1HE16|Q86XY9|Q9NVR9	Missense_Mutation	SNP	ENST00000366971.4	37	CCDS1510.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.1|28.1	4.887770|4.887770	0.91814|0.91814	.|.	.|.	ENSG00000162769|ENSG00000162769	ENST00000419102|ENST00000366971	.|T	.|0.61627	.|0.09	5.78|5.78	5.78|5.78	0.91487|0.91487	.|Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.84261|0.84261	0.5433|0.5433	H|H	0.95151|0.95151	3.63|3.63	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.85130	.|0.997	D|D	0.88324|0.88324	0.2964|0.2964	5|10	.|0.87932	.|D	.|0	-24.5348|-24.5348	19.5996|19.5996	0.95554|0.95554	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|444	.|Q9Y5Y0	.|FLVC1_HUMAN	I|H	243|444	.|ENSP00000355938:P444H	.|ENSP00000355938:P444H	L|P	+|+	1|2	0|0	FLVCR1|FLVCR1	211128477|211128477	1.000000|1.000000	0.71417|0.71417	0.966000|0.966000	0.40874|0.40874	0.994000|0.994000	0.84299|0.84299	7.335000|7.335000	0.79234|0.79234	2.729000|2.729000	0.93468|0.93468	0.655000|0.655000	0.94253|0.94253	CTT|CCT	.	.	none		0.393	FLVCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089678.2	NM_014053	
ENAM	10117	hgsc.bcm.edu	37	4	71510318	71510318	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr4:71510318G>A	ENST00000396073.3	+	9	3456	c.3175G>A	c.(3175-3177)Ggc>Agc	p.G1059S	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	1059					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			GCCATGCTTTGGCTCCAAATT	0.458																																					p.G1059S		Atlas-SNP	.											.	ENAM	140	.	0			c.G3175A						PASS	.						107.0	98.0	101.0					4																	71510318		2203	4300	6503	SO:0001583	missense	10117	exon9			TGCTTTGGCTCCA	AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.3175G>A	4.37:g.71510318G>A	ENSP00000379383:p.Gly1059Ser	Somatic	215	0	0		WXS	Illumina HiSeq	Phase_I	139	46	0.330935	NM_031889	Q17RI5|Q9H3D1	Missense_Mutation	SNP	ENST00000396073.3	37	CCDS3544.2	.	.	.	.	.	.	.	.	.	.	G	10.40	1.340890	0.24339	.	.	ENSG00000132464	ENST00000396073	T	0.34072	1.38	5.95	3.18	0.36537	.	0.357246	0.24557	N	0.037508	T	0.36166	0.0957	L	0.50333	1.59	0.29732	N	0.837785	B	0.20459	0.045	B	0.36030	0.216	T	0.40327	-0.9569	10	0.54805	T	0.06	-2.4743	7.769	0.28997	0.1511:0.1474:0.7015:0.0	.	1059	Q9NRM1	ENAM_HUMAN	S	1059	ENSP00000379383:G1059S	ENSP00000379383:G1059S	G	+	1	0	ENAM	71729182	1.000000	0.71417	1.000000	0.80357	0.490000	0.33462	1.006000	0.29847	0.872000	0.35775	-0.794000	0.03295	GGC	.	.	none		0.458	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889	
BCL2	596	hgsc.bcm.edu	37	18	60985870	60985870	+	Silent	SNP	A	A	G			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr18:60985870A>G	ENST00000398117.1	-	1	1491	c.30T>C	c.(28-30)gaT>gaC	p.D10D	BCL2_ENST00000444484.1_Silent_p.D10D|BCL2_ENST00000333681.4_Silent_p.D10D|BCL2_ENST00000589955.1_Silent_p.D10D	NM_000633.2	NP_000624.2	P10415	BCL2_HUMAN	B-cell CLL/lymphoma 2	10					actin filament organization (GO:0007015)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|axonogenesis (GO:0007409)|B cell homeostasis (GO:0001782)|B cell lineage commitment (GO:0002326)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|behavioral fear response (GO:0001662)|branching involved in ureteric bud morphogenesis (GO:0001658)|CD8-positive, alpha-beta T cell lineage commitment (GO:0043375)|cell aging (GO:0007569)|cell growth (GO:0016049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to organic substance (GO:0071310)|cochlear nucleus development (GO:0021747)|defense response to virus (GO:0051607)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|ear development (GO:0043583)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|female pregnancy (GO:0007565)|focal adhesion assembly (GO:0048041)|gland morphogenesis (GO:0022612)|glomerulus development (GO:0032835)|hair follicle morphogenesis (GO:0031069)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|melanin metabolic process (GO:0006582)|melanocyte differentiation (GO:0030318)|mesenchymal cell development (GO:0014031)|metanephros development (GO:0001656)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of autophagy (GO:0010507)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cellular pH reduction (GO:0032848)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of retinal cell programmed cell death (GO:0046671)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|oocyte development (GO:0048599)|organ growth (GO:0035265)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pigment granule organization (GO:0048753)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell growth (GO:0030307)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron maturation (GO:0014042)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smooth muscle cell migration (GO:0014911)|post-embryonic development (GO:0009791)|protein dephosphorylation (GO:0006470)|protein polyubiquitination (GO:0000209)|reactive oxygen species metabolic process (GO:0072593)|regulation of calcium ion transport (GO:0051924)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glycoprotein biosynthetic process (GO:0010559)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|regulation of protein stability (GO:0031647)|regulation of transmembrane transporter activity (GO:0022898)|regulation of viral genome replication (GO:0045069)|release of cytochrome c from mitochondria (GO:0001836)|renal system process (GO:0003014)|response to acid chemical (GO:0001101)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to iron ion (GO:0010039)|response to ischemia (GO:0002931)|response to nicotine (GO:0035094)|response to radiation (GO:0009314)|response to toxic substance (GO:0009636)|response to UV-B (GO:0010224)|single organismal cell-cell adhesion (GO:0016337)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|channel inhibitor activity (GO:0016248)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin protein ligase binding (GO:0031625)	p.D10D(2)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(106)|kidney(1)|large_intestine(1)|lung(3)	113		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Ibuprofen(DB01050)|Paclitaxel(DB01229)|Rasagiline(DB01367)	TCTCCCGGTTATCGTACCCTG	0.657			T	IGH@	"""NHL, CLL"""																																p.D10D		Atlas-SNP	.		Dom	yes		18	18q21.3	596	B-cell CLL/lymphoma 2		L	BCL2_ENST00000398117,NS,lymphoid_neoplasm,0,2	BCL2	272	2	2	Substitution - coding silent(2)	haematopoietic_and_lymphoid_tissue(2)	c.T30C						PASS	.						70.0	77.0	75.0					18																	60985870		1968	4072	6040	SO:0001819	synonymous_variant	596	exon2			CCGGTTATCGTAC	M14745	CCDS11981.1, CCDS45882.1	18q21.3	2014-03-07			ENSG00000171791	ENSG00000171791		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	990	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 50"""	151430					Standard	XM_006722523		Approved	Bcl-2, PPP1R50	uc002lit.1	P10415	OTTHUMG00000132791	ENST00000398117.1:c.30T>C	18.37:g.60985870A>G		Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	80	10	0.125	NM_000633	C9JHD5|P10416|Q13842|Q16197	Silent	SNP	ENST00000398117.1	37	CCDS11981.1																																																																																			.	.	none		0.657	BCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256199.1	NM_000633, NM_000657	
ZNF286A	57335	hgsc.bcm.edu	37	17	15619433	15619433	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr17:15619433A>G	ENST00000464847.2	+	5	948	c.395A>G	c.(394-396)gAa>gGa	p.E132G	ZNF286A_ENST00000413242.2_Missense_Mutation_p.E132G|ZNF286A_ENST00000421016.1_Missense_Mutation_p.E132G|ZNF286A_ENST00000581529.1_3'UTR|ZNF286A_ENST00000583566.1_Missense_Mutation_p.E132G|ZNF286A_ENST00000395894.2_3'UTR|ZNF286A_ENST00000472486.1_3'UTR|ZNF286A_ENST00000585171.1_Intron|ZNF286A_ENST00000593105.1_Missense_Mutation_p.E122G			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A	132					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		TCCAAAGCAGAATCATGCAAA	0.393																																					p.E132G		Atlas-SNP	.											.	ZNF286A	58	.	0			c.A395G						PASS	.						49.0	49.0	49.0					17																	15619433		2201	4284	6485	SO:0001583	missense	57335	exon6			AAGCAGAATCATG	AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000464847.2:c.395A>G	17.37:g.15619433A>G	ENSP00000464218:p.Glu132Gly	Somatic	342	0	0		WXS	Illumina HiSeq	Phase_I	237	51	0.21519	NM_020652	B4DKF9|Q96JF3	Missense_Mutation	SNP	ENST00000464847.2	37	CCDS11172.1	.	.	.	.	.	.	.	.	.	.	a	6.747	0.506566	0.12883	.	.	ENSG00000187607	ENST00000421016;ENST00000412988;ENST00000395894	T;T	0.08896	3.41;3.04	4.38	1.92	0.25849	.	0.867112	0.09338	N	0.815936	T	0.08088	0.0202	L	0.43152	1.355	0.09310	N	1	B	0.23377	0.084	B	0.21360	0.034	T	0.34129	-0.9841	10	0.46703	T	0.11	-2.0712	6.0049	0.19541	0.6718:0.1671:0.0:0.1611	.	132	Q9HBT8	Z286A_HUMAN	G	132;122;132	ENSP00000397163:E132G;ENSP00000408168:E122G	ENSP00000435872:E132G	E	+	2	0	ZNF286A	15560158	0.001000	0.12720	0.090000	0.20809	0.511000	0.34104	0.115000	0.15540	0.676000	0.31285	0.528000	0.53228	GAA	.	.	none		0.393	ZNF286A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130696.4	NM_020652	
MFAP3L	9848	hgsc.bcm.edu	37	4	170926948	170926948	+	Silent	SNP	G	G	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr4:170926948G>A	ENST00000361618.3	-	2	388	c.81C>T	c.(79-81)acC>acT	p.T27T	MFAP3L_ENST00000506110.1_Silent_p.T27T|MFAP3L_ENST00000393704.3_5'Flank|MFAP3L_ENST00000393702.3_Silent_p.T27T	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	27						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		CACTCTTAGCGGTGGCTAGAG	0.453																																					p.T27T		Atlas-SNP	.											.	MFAP3L	59	.	0			c.C81T						PASS	.						103.0	102.0	102.0					4																	170926948		2203	4300	6503	SO:0001819	synonymous_variant	9848	exon2			CTTAGCGGTGGCT	AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.81C>T	4.37:g.170926948G>A		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	69	19	0.275362	NM_021647	A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Silent	SNP	ENST00000361618.3	37	CCDS34103.1																																																																																			.	.	none		0.453	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363043.2	NM_021647	
ITFG1	81533	hgsc.bcm.edu	37	16	47494777	47494777	+	Silent	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr16:47494777C>T	ENST00000320640.6	-	1	408	c.180G>A	c.(178-180)aaG>aaA	p.K60K	PHKB_ENST00000455779.1_5'Flank|PHKB_ENST00000566044.1_5'Flank|ITFG1_ENST00000544001.2_Intron|PHKB_ENST00000299167.8_5'Flank|PHKB_ENST00000323584.5_5'Flank	NM_030790.3	NP_110417.2	Q8TB96	TIP_HUMAN	integrin alpha FG-GAP repeat containing 1	60						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	19		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)				GATCCGTCTGCTTGTCGGAGT	0.672																																					p.K60K		Atlas-SNP	.											.	ITFG1	49	.	0			c.G180A						PASS	.						40.0	31.0	34.0					16																	47494777		2201	4300	6501	SO:0001819	synonymous_variant	81533	exon1			CGTCTGCTTGTCG	AF503339	CCDS10728.1	16q12.1	2008-02-05			ENSG00000129636	ENSG00000129636			30697	protein-coding gene	gene with protein product	"""T cell immunomodulatory protein"""	611803				12598909	Standard	NM_030790		Approved	CDA08, TIP	uc002eet.3	Q8TB96	OTTHUMG00000133103	ENST00000320640.6:c.180G>A	16.37:g.47494777C>T		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	94	23	0.244681	NM_030790	Q96SR4|Q9BRE2|Q9H2V9	Silent	SNP	ENST00000320640.6	37	CCDS10728.1																																																																																			.	.	none		0.672	ITFG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256768.3	NM_030790	
CSN3	1448	hgsc.bcm.edu	37	4	71110559	71110559	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr4:71110559T>C	ENST00000304954.3	+	2	109	c.23T>C	c.(22-24)gTc>gCc	p.V8A		NM_005212.2	NP_005203.2	Q9UNS2	CSN3_HUMAN	casein kappa	0					cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						CTTCTAGTTGTCAATGCCCTG	0.284																																					p.V8A		Atlas-SNP	.											.	CSN3	43	.	0			c.T23C						PASS	.						92.0	88.0	90.0					4																	71110559		2202	4296	6498	SO:0001583	missense	1448	exon2			TAGTTGTCAATGC	U51899	CCDS3538.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000171209	ENSG00000171209			2446	protein-coding gene	gene with protein product		601695	"""casein, kappa"""	CSN10		8863730, 9050925	Standard	NM_005212		Approved		uc003hfe.4	P07498	OTTHUMG00000129399	ENST00000304954.3:c.23T>C	4.37:g.71110559T>C	ENSP00000304822:p.Val8Ala	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	72	22	0.305556	NM_005212	B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	ENST00000304954.3	37	CCDS3538.1	.	.	.	.	.	.	.	.	.	.	T	14.25	2.479333	0.44044	.	.	ENSG00000171209	ENST00000304954	T	0.31247	1.5	4.08	4.08	0.47627	.	0.691470	0.12600	N	0.454752	T	0.41534	0.1163	L	0.59436	1.845	0.27033	N	0.964187	D	0.56968	0.978	P	0.53146	0.719	T	0.24548	-1.0157	10	0.66056	D	0.02	.	9.7345	0.40379	0.0:0.0:0.0:1.0	.	8	P07498	CASK_HUMAN	A	8	ENSP00000304822:V8A	ENSP00000304822:V8A	V	+	2	0	CSN3	71145148	0.978000	0.34361	0.952000	0.39060	0.866000	0.49608	1.903000	0.39858	2.078000	0.62432	0.455000	0.32223	GTC	.	.	none		0.284	CSN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251555.1	NM_005212	
SH3RF1	57630	hgsc.bcm.edu	37	4	170043268	170043268	+	Silent	SNP	C	C	T	rs148721890		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr4:170043268C>T	ENST00000284637.9	-	7	1670	c.1329G>A	c.(1327-1329)ccG>ccA	p.P443P	SH3RF1_ENST00000508685.1_5'UTR	NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	443	Interaction with AKT2. {ECO:0000250}.				negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		GGCGAGTCTGCGGCCGTAAAT	0.552													C|||	1	0.000199681	0.0	0.0	5008	,	,		18539	0.0		0.001	False		,,,				2504	0.0				p.P443P		Atlas-SNP	.											.	SH3RF1	60	.	0			c.G1329A						PASS	.	C		4,4402	8.1+/-20.4	0,4,2199	88.0	78.0	81.0		1329	-10.6	0.8	4	dbSNP_134	81	11,8589	8.4+/-32.0	0,11,4289	no	coding-synonymous	SH3RF1	NM_020870.3		0,15,6488	TT,TC,CC		0.1279,0.0908,0.1153		443/889	170043268	15,12991	2203	4300	6503	SO:0001819	synonymous_variant	57630	exon7			AGTCTGCGGCCGT	BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.1329G>A	4.37:g.170043268C>T		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	70	22	0.314286	NM_020870	Q05BT2|Q8IW46|Q9HAM2|Q9P234	Silent	SNP	ENST00000284637.9	37	CCDS34099.1																																																																																			C|0.999;T|0.001	0.001	strong		0.552	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363382.3	NM_020870	
MUC17	140453	hgsc.bcm.edu	37	7	100682597	100682597	+	Missense_Mutation	SNP	T	T	C	rs137868062		TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr7:100682597T>C	ENST00000306151.4	+	3	7964	c.7900T>C	c.(7900-7902)Tca>Cca	p.S2634P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2634	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGTAAGTACTTCATTAACAAG	0.463																																					p.S2634P		Atlas-SNP	.											MUC17,NS,carcinoma,-1,1	MUC17	804	1	0			c.T7900C						scavenged	.						241.0	244.0	243.0					7																	100682597		2203	4300	6503	SO:0001583	missense	140453	exon3			AGTACTTCATTAA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7900T>C	7.37:g.100682597T>C	ENSP00000302716:p.Ser2634Pro	Somatic	56	9	0.160714		WXS	Illumina HiSeq	Phase_I	35	15	0.428571	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	0.167	-1.075162	0.01903	.	.	ENSG00000169876	ENST00000306151	T	0.02103	4.45	0.522	-0.805	0.10879	.	.	.	.	.	T	0.00845	0.0028	N	0.01576	-0.805	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.46925	-0.9156	9	0.11485	T	0.65	.	5.2426	0.15479	0.0:0.4708:0.0:0.5292	.	2634	Q685J3	MUC17_HUMAN	P	2634	ENSP00000302716:S2634P	ENSP00000302716:S2634P	S	+	1	0	MUC17	100469317	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.716000	0.00385	-1.184000	0.02720	-1.386000	0.01163	TCA	.	.	weak		0.463	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
PPP1R3A	5506	hgsc.bcm.edu	37	7	113518866	113518866	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr7:113518866G>A	ENST00000284601.3	-	4	2349	c.2281C>T	c.(2281-2283)Cga>Tga	p.R761*		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	761					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						CTGTCACTTCGTGCTGTCTCT	0.413																																					p.R761X		Atlas-SNP	.											PPP1R3A,trunk,malignant_melanoma,+1,1	PPP1R3A	317	1	0			c.C2281T						PASS	.						126.0	112.0	117.0					7																	113518866		2203	4299	6502	SO:0001587	stop_gained	5506	exon4			CACTTCGTGCTGT	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2281C>T	7.37:g.113518866G>A	ENSP00000284601:p.Arg761*	Somatic	183	0	0		WXS	Illumina HiSeq	Phase_I	127	37	0.291339	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Nonsense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	G	37	6.149618	0.97324	.	.	ENSG00000154415	ENST00000284601	.	.	.	5.75	3.92	0.45320	.	0.606928	0.14573	N	0.311310	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-7.4711	11.6747	0.51424	0.0:0.2503:0.6199:0.1298	.	.	.	.	X	761	.	ENSP00000284601:R761X	R	-	1	2	PPP1R3A	113306102	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	1.237000	0.32695	0.748000	0.32831	0.650000	0.86243	CGA	.	.	none		0.413	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
RAF1	5894	hgsc.bcm.edu	37	3	12641240	12641240	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr3:12641240G>A	ENST00000251849.4	-	10	1497	c.1058C>T	c.(1057-1059)aCt>aTt	p.T353I	RAF1_ENST00000542177.1_Missense_Mutation_p.T272I|RAF1_ENST00000442415.2_Missense_Mutation_p.T373I|RAF1_ENST00000534997.1_Missense_Mutation_p.T138I	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	353	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	CCCAATCCGAGTGGACAGCAT	0.458			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																												p.T353I		Atlas-SNP	.		Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	.	RAF1	66	.	0			c.C1058T						PASS	.						91.0	88.0	89.0					3																	12641240		2203	4300	6503	SO:0001583	missense	5894	exon10	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	ATCCGAGTGGACA	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.1058C>T	3.37:g.12641240G>A	ENSP00000251849:p.Thr353Ile	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	76	20	0.263158	NM_002880	B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	ENST00000251849.4	37	CCDS2612.1	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665107	0.67700	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	D;D;D;D;D	0.98947	-5.26;-5.26;-5.26;-5.26;-5.26	5.52	5.52	0.82312	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.201811	0.53938	D	0.000054	D	0.97517	0.9187	L	0.41492	1.28	0.52501	D	0.999959	B;B;B	0.23891	0.078;0.045;0.093	B;B;B	0.36534	0.227;0.151;0.214	D	0.95631	0.8689	10	0.49607	T	0.09	.	17.5749	0.87946	0.0:0.0:1.0:0.0	.	272;138;353	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	I	353;373;232;138;272	ENSP00000251849:T353I;ENSP00000401888:T373I;ENSP00000398591:T232I;ENSP00000441186:T138I;ENSP00000443567:T272I	ENSP00000251849:T353I	T	-	2	0	RAF1	12616240	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.301000	0.65727	2.752000	0.94435	0.655000	0.94253	ACT	.	.	none		0.458	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880	
KMT2D	8085	hgsc.bcm.edu	37	12	49420424	49420424	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr12:49420424A>G	ENST00000301067.7	-	48	15324	c.15325T>C	c.(15325-15327)Tgc>Cgc	p.C5109R		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	5109			C -> F (in KABUK1). {ECO:0000269|PubMed:20711175}.		chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										ACATTGGGGCAACGCATGCGA	0.552																																					p.C5109R		Atlas-SNP	.											MLL2_ENST00000301067,NS,carcinoma,+1,2	MLL2	1173	2	0			c.T15325C						PASS	.						66.0	67.0	67.0					12																	49420424		2159	4254	6413	SO:0001583	missense	8085	exon48			TGGGGCAACGCAT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.15325T>C	12.37:g.49420424A>G	ENSP00000301067:p.Cys5109Arg	Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	70	17	0.242857	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	A	11.76	1.735995	0.30774	.	.	ENSG00000167548	ENST00000301067	D	0.94330	-3.4	4.58	4.58	0.56647	Zinc finger, RING-type (1);Zinc finger, PHD-type (1);	0.000000	0.39909	N	0.001227	D	0.97623	0.9221	H	0.96269	3.795	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98595	1.0656	10	0.87932	D	0	.	13.246	0.60024	1.0:0.0:0.0:0.0	.	5109	O14686	MLL2_HUMAN	R	5109	ENSP00000301067:C5109R	ENSP00000301067:C5109R	C	-	1	0	MLL2	47706691	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	1.844000	0.53588	0.459000	0.35465	TGC	.	.	none		0.552	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KMT2D	8085	hgsc.bcm.edu	37	12	49428192	49428192	+	Splice_Site	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr12:49428192C>T	ENST00000301067.7	-	37	10507		c.e37+1		KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D						chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CCCATACTCACTGATCACTCC	0.572																																					.		Atlas-SNP	.											.	MLL2	1173	.	0			c.10507+1G>A						PASS	.						43.0	46.0	45.0					12																	49428192		1961	4160	6121	SO:0001630	splice_region_variant	8085	exon38			TACTCACTGATCA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.10507+1G>A	12.37:g.49428192C>T		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	32	20	0.625	NM_003482	O14687	Splice_Site	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.011341	0.93346	.	.	ENSG00000167548	ENST00000301067	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5761	0.91155	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MLL2	47714459	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.305000	0.78891	2.779000	0.95612	0.655000	0.94253	.	.	.	none		0.572	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		Intron
SNX27	81609	hgsc.bcm.edu	37	1	151630819	151630819	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:151630819C>T	ENST00000458013.2	+	3	772	c.652C>T	c.(652-654)Cga>Tga	p.R218*	SNX27_ENST00000368843.3_Nonsense_Mutation_p.R218*|SNX27_ENST00000368838.1_Nonsense_Mutation_p.R125*			Q96L92	SNX27_HUMAN	sorting nexin family member 27	218	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TACATTTCCTCGACTCCCAGG	0.458																																					p.R218X	Colon(46;291 966 40145 41237 41888)	Atlas-SNP	.											.	SNX27	44	.	0			c.C652T						PASS	.						145.0	141.0	143.0					1																	151630819		2203	4300	6503	SO:0001587	stop_gained	81609	exon3			TTTCCTCGACTCC	AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.652C>T	1.37:g.151630819C>T	ENSP00000400333:p.Arg218*	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	147	24	0.163265	NM_030918	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Nonsense_Mutation	SNP	ENST00000458013.2	37		.	.	.	.	.	.	.	.	.	.	C	37	6.556807	0.97663	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	.	.	.	5.81	5.81	0.92471	.	0.058920	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	18.6433	0.91402	0.0:1.0:0.0:0.0	.	.	.	.	X	218;218;125	.	ENSP00000357831:R125X	R	+	1	2	SNX27	149897443	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.816000	0.62642	2.747000	0.94245	0.650000	0.86243	CGA	.	.	none		0.458	SNX27-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000036624.3	NM_030918	
SPG11	80208	hgsc.bcm.edu	37	15	44914049	44914049	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr15:44914049T>G	ENST00000261866.7	-	14	2544	c.2528A>C	c.(2527-2529)aAc>aCc	p.N843T	SPG11_ENST00000535302.2_Missense_Mutation_p.N843T|SPG11_ENST00000558319.1_Missense_Mutation_p.N843T|SPG11_ENST00000427534.2_Missense_Mutation_p.N843T	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	843					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		GTCCTGTTTGTTAAATTCATC	0.373																																					p.N843T		Atlas-SNP	.											.	SPG11	207	.	0			c.A2528C						PASS	.						101.0	91.0	94.0					15																	44914049		2198	4298	6496	SO:0001583	missense	80208	exon14			TGTTTGTTAAATT		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.2528A>C	15.37:g.44914049T>G	ENSP00000261866:p.Asn843Thr	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	121	31	0.256198	NM_025137	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	ENST00000261866.7	37	CCDS10112.1	.	.	.	.	.	.	.	.	.	.	T	7.050	0.564336	0.13498	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	T;T;T	0.77098	-1.07;-0.81;-0.8	5.76	0.577	0.17385	.	1.017420	0.07812	N	0.958341	T	0.61652	0.2364	L	0.43152	1.355	0.09310	N	1	B;B;B	0.13594	0.005;0.008;0.008	B;B;B	0.09377	0.004;0.004;0.004	T	0.40270	-0.9572	10	0.09084	T	0.74	.	0.8387	0.01145	0.1525:0.2224:0.1583:0.4668	.	843;843;843	C4B7M2;F5H3N6;Q96JI7	.;.;SPTCS_HUMAN	T	843	ENSP00000261866:N843T;ENSP00000445278:N843T;ENSP00000396110:N843T	ENSP00000261866:N843T	N	-	2	0	SPG11	42701341	0.000000	0.05858	0.984000	0.44739	0.994000	0.84299	-0.031000	0.12287	0.422000	0.26005	0.533000	0.62120	AAC	.	.	none		0.373	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
KIF3C	3797	hgsc.bcm.edu	37	2	26204558	26204558	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr2:26204558T>A	ENST00000264712.3	-	1	808	c.229A>T	c.(229-231)Acc>Tcc	p.T77S	KIF3C_ENST00000405914.1_Missense_Mutation_p.T77S	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	77	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.			TVR -> RE (in Ref. 1; AAC05302). {ECO:0000305}.	antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCCTCACGGTTTCGTCATAC	0.627																																					p.T77S		Atlas-SNP	.											.	KIF3C	79	.	0			c.A229T						PASS	.						81.0	79.0	80.0					2																	26204558		2203	4300	6503	SO:0001583	missense	3797	exon1			TCACGGTTTCGTC		CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.229A>T	2.37:g.26204558T>A	ENSP00000264712:p.Thr77Ser	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	75	25	0.333333	NM_002254	O43544|Q4ZG18|Q53SX5|Q562F7	Missense_Mutation	SNP	ENST00000264712.3	37	CCDS1719.1	.	.	.	.	.	.	.	.	.	.	T	13.80	2.344081	0.41498	.	.	ENSG00000084731	ENST00000264712;ENST00000405914	T;T	0.44083	0.93;0.93	5.62	5.62	0.85841	Kinesin, motor domain (4);	0.150477	0.56097	D	0.000029	T	0.34483	0.0899	N	0.11255	0.115	0.50632	D	0.999887	P;B	0.34724	0.465;0.232	P;B	0.45232	0.474;0.145	T	0.32402	-0.9908	10	0.37606	T	0.19	.	13.7774	0.63062	0.0:0.0:0.0:1.0	.	77;77	B7ZM25;O14782	.;KIF3C_HUMAN	S	77	ENSP00000264712:T77S;ENSP00000385030:T77S	ENSP00000264712:T77S	T	-	1	0	KIF3C	26058062	1.000000	0.71417	0.983000	0.44433	0.983000	0.72400	3.312000	0.51927	2.131000	0.65755	0.460000	0.39030	ACC	.	.	none		0.627	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1		
KIF5B	3799	hgsc.bcm.edu	37	10	32307310	32307310	+	Silent	SNP	T	T	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr10:32307310T>C	ENST00000302418.4	-	22	2830	c.2373A>G	c.(2371-2373)aaA>aaG	p.K791K	KIF5B_ENST00000493889.1_Intron	NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	791					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				TCTGAAGTTCTTTTGCCTTGG	0.373			T	"""RET, ALK"""	NSCLC																																p.K791K		Atlas-SNP	.		Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	.	KIF5B	81	.	0			c.A2373G						PASS	.						138.0	135.0	136.0					10																	32307310		2203	4300	6503	SO:0001819	synonymous_variant	3799	exon22			AAGTTCTTTTGCC	X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.2373A>G	10.37:g.32307310T>C		Somatic	187	0	0		WXS	Illumina HiSeq	Phase_I	200	43	0.215	NM_004521	A0AVB2|Q5VZ85	Silent	SNP	ENST00000302418.4	37	CCDS7171.1																																																																																			.	.	none		0.373	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047467.1	NM_004521	
SLC2A5	6518	hgsc.bcm.edu	37	1	9097845	9097845	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr1:9097845C>T	ENST00000377424.4	-	12	1485	c.1306G>A	c.(1306-1308)Ggc>Agc	p.G436S	SLC2A5_ENST00000535586.1_Missense_Mutation_p.G321S|SLC2A5_ENST00000536305.1_Missense_Mutation_p.G377S	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	436					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)			endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GGGCCGAGGCCCTCCTGCGGG	0.617																																					p.G436S		Atlas-SNP	.											.	SLC2A5	77	.	0			c.G1306A						PASS	.						62.0	66.0	65.0					1																	9097845		2203	4300	6503	SO:0001583	missense	6518	exon12			CGAGGCCCTCCTG	BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.1306G>A	1.37:g.9097845C>T	ENSP00000366641:p.Gly436Ser	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	36	11	0.305556	NM_003039	Q14770|Q5T977|Q8IVB3	Missense_Mutation	SNP	ENST00000377424.4	37	CCDS99.1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.926514	0.34002	.	.	ENSG00000142583	ENST00000377424;ENST00000456780;ENST00000536305;ENST00000535586	T;T;T	0.72835	-0.69;-0.69;-0.69	5.35	4.41	0.53225	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.103605	0.64402	D	0.000003	T	0.57989	0.2091	L	0.28014	0.82	0.54753	D	0.999985	B;P;B	0.34815	0.362;0.47;0.399	B;B;B	0.38755	0.11;0.11;0.281	T	0.52056	-0.8626	10	0.14252	T	0.57	.	12.5259	0.56085	0.167:0.833:0.0:0.0	.	392;377;436	B4DG19;B4DU31;P22732	.;.;GTR5_HUMAN	S	436;419;377;321	ENSP00000366641:G436S;ENSP00000440688:G377S;ENSP00000442744:G321S	ENSP00000366641:G436S	G	-	1	0	SLC2A5	9020432	0.001000	0.12720	0.380000	0.26093	0.103000	0.19146	1.019000	0.30014	1.311000	0.45024	0.655000	0.94253	GGC	.	.	none		0.617	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004932.1	NM_003039	
SH3D19	152503	hgsc.bcm.edu	37	4	152069110	152069110	+	Silent	SNP	A	A	C			TCGA-GS-A9TQ-01A-11D-A382-10	TCGA-GS-A9TQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fed06f8b-2c24-4196-a3e5-4a6acea52761	e7763c46-3083-49b4-8739-24cb4ed05f3c	g.chr4:152069110A>C	ENST00000409252.2	-	10	1913	c.1206T>G	c.(1204-1206)cgT>cgG	p.R402R	SH3D19_ENST00000409598.4_Silent_p.R402R|SH3D19_ENST00000424281.1_Silent_p.R366R|SH3D19_ENST00000455740.1_Silent_p.R402R|SH3D19_ENST00000514152.1_Silent_p.R402R|SH3D19_ENST00000427414.2_Silent_p.R366R|SH3D19_ENST00000304527.4_Silent_p.R402R			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	402					cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				CTGGTTTGGGACGAGGGGGTA	0.393																																					p.R402R		Atlas-SNP	.											.	SH3D19	54	.	0			c.T1206G						PASS	.						81.0	88.0	85.0					4																	152069110		2203	4300	6503	SO:0001819	synonymous_variant	152503	exon11			TTTGGGACGAGGG	BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.1206T>G	4.37:g.152069110A>C		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	63	14	0.222222	NM_001128923	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Silent	SNP	ENST00000409252.2	37	CCDS34077.2																																																																																			.	.	none		0.393	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3	NM_001009555	
