#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EPB41L4A	64097	hgsc.bcm.edu	37	5	111500816	111500817	+	Splice_Site	INS	-	-	TAAAA	rs145708081|rs369027426		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr5:111500816_111500817insTAAAA	ENST00000261486.5	-	23	2209		c.e23-1		EPB41L4A-AS1_ENST00000413221.2_lincRNA|EPB41L4A_ENST00000507810.1_Intron	NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		CATTTCTTCTCTAAAATATATT	0.317																																					.		Atlas-Indel	.											.	EPB41L4A	130	.	0			c.1933-1->TTTTA						PASS	.			3408,36		1689,30,3						5.3	1.0		dbSNP_134	59	7446,316		3600,246,35	no	splice-3	EPB41L4A	NM_022140.3		5289,276,38	A1A1,A1R,RR		4.0711,1.0453,3.1412				10854,352				SO:0001630	splice_region_variant	64097	exon24			.	AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.1933-1->TTTTA	5.37:g.111500817_111500821dupTAAAA		Somatic	253	0	0		WXS	Illumina HiSeq	Phase_I	232	25	0.107759	NM_022140	A4FUI6	Splice_Site	INS	ENST00000261486.5	37	CCDS43350.1																																																																																			-|0.025;TAAAA|0.975	0.975	strong		0.317	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370969.1		Intron
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346593	39346595	+	In_Frame_Del	DEL	CCT	CCT	-	rs377187211|rs148036927|rs11283848	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	CCT	CCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr17:39346593_39346595delCCT	ENST00000398470.1	+	1	455_457	c.455_457delCCT	c.(454-459)acctgc>agc	p.152_153TC>S	KRTAP9-1_ENST00000377723.3_Intron|KRTAP9-1_ENST00000318329.5_In_Frame_Del_p.69_70TC>S	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	152	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)		p.T152_C153>S(2)		breast(1)|lung(3)	4						TGCCAGCCCACCTGCTGTGGGTC	0.581																																					p.152_152del		Atlas-Indel	.											KRTAP9-1_ENST00000398470,colon,carcinoma,0,2	KRTAP9-1	34	2	2	Complex - deletion inframe(2)	breast(2)	c.454_456del						PASS	.																																			SO:0001651	inframe_deletion	728318	exon1			.	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	ENST00000398470.1:c.455_457delCCT	17.37:g.39346593_39346595delCCT	ENSP00000381488:p.Thr152_Cys153delinsSer	Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	81	30	0.37037	NM_001190460		In_Frame_Del	DEL	ENST00000398470.1	37	CCDS56029.1																																																																																			.	.	weak		0.581	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
ZC3H18	124245	hgsc.bcm.edu	37	16	88675458	88675461	+	Splice_Site	DEL	GAGT	GAGT	-			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	GAGT	GAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr16:88675458_88675461delGAGT	ENST00000301011.5	+	7	1405_1406	c.1205_1206delGAGT	c.(1204-1206)cga>c	p.R402fs	ZC3H18_ENST00000452588.2_Splice_Site_p.R426fs	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	402						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		CATAATTACCGAGTAAGTATGACT	0.363																																					p.402_402del	Ovarian(121;375 2276 20373 38669)	Atlas-Indel	.											.	ZC3H18	90	.	0			c.1204_1206del						PASS	.																																			SO:0001630	splice_region_variant	124245	exon7			.	BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.1206+1GAGT>-	16.37:g.88675458_88675461delGAGT		Somatic	167	0	0		WXS	Illumina HiSeq	Phase_I	131	13	0.0992366	NM_144604	Q96DG4|Q96MP7	In_Frame_Del	DEL	ENST00000301011.5	37	CCDS10967.1																																																																																			.	.	none		0.363	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1	NM_144604	Frame_Shift_Del
C14orf23	387978	hgsc.bcm.edu	37	14	29261305	29261306	+	In_Frame_Ins	INS	-	-	AAC	rs202195469|rs200251419|rs565026588	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr14:29261305_29261306insAAC	ENST00000399387.4	+	3	446_447	c.342_343insAAC	c.(343-345)aaa>AACaaa	p.114_115insN	C14orf23_ENST00000548213.1_Intron|C14orf23_ENST00000550266.1_Intron					chromosome 14 open reading frame 23											central_nervous_system(1)	1						CTTCAGCACTAAAAAAAACAAA	0.376																																					.		Atlas-Indel	.											.	C14orf23	5	.	0			.						PASS	.																																			SO:0001652	inframe_insertion	387978	.			.			14q11.2	2013-01-15			ENSG00000186960	ENSG00000186960			19828	other	unknown							Standard	NR_026731		Approved		uc001wqf.3	Q86U37	OTTHUMG00000029410	Exception_encountered	14.37:g.29261305_29261306insAAC	ENSP00000382318:p.Leu114_Lys115insAsn	Somatic	164	0	0		WXS	Illumina HiSeq	Phase_I	112	14	0.125	.		RNA	INS	ENST00000399387.4	37																																																																																				-|0.668;AAC|0.332	0.332	strong		0.376	C14orf23-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000134019.2	NR_026731	
VTN	7448	hgsc.bcm.edu	37	17	26699199	26699200	+	5'Flank	INS	-	-	C	rs71135830|rs112387743	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr17:26699199_26699200insC	ENST00000226218.4	-	0	0				TMEM199_ENST00000509083.1_Intron|VTN_ENST00000536498.1_5'Flank|SARM1_ENST00000379061.4_Intron|SARM1_ENST00000457710.3_Frame_Shift_Ins_p.A16fs|CTB-96E2.3_ENST00000591482.1_RNA	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin						cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	GGTGGCCCGGGCCCGCGAAAGT	0.777													CCCC|CCC|CCCC|deletion	4982	0.994808	0.9887	1.0	5008	,	,		9313	1.0		0.9891	False		,,,				2504	1.0				p.G49fs		Atlas-Indel	.											.	SARM1	40	.	0			c.146_147insC						PASS	.			606,4		303,0,2						-0.0	1.0		dbSNP_130	1	1168,14		582,4,5	no	frameshift	SARM1	NM_015077.2		885,4,7	A1A1,A1R,RR		1.1844,0.6557,1.0045				1774,18				SO:0001631	upstream_gene_variant	23098	exon1			.	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500		17.37:g.26699202_26699202dupC	Exception_encountered	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	12	10	0.833333	NM_015077	B2R7G0|P01141|Q9BSH7	Frame_Shift_Ins	INS	ENST00000226218.4	37	CCDS11229.1																																																																																			C|1.000;|0.000	1.000	strong		0.777	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
VTN	7448	hgsc.bcm.edu	37	17	26699195	26699196	+	5'Flank	INS	-	-	G	rs67356455|rs200078932|rs11437592		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr17:26699195_26699196insG	ENST00000226218.4	-	0	0				TMEM199_ENST00000509083.1_Intron|VTN_ENST00000536498.1_5'Flank|SARM1_ENST00000379061.4_Intron|SARM1_ENST00000457710.3_Frame_Shift_Ins_p.R15fs|CTB-96E2.3_ENST00000591482.1_RNA	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin						cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	TGCGGGTGGCCCGGGCCCGCGA	0.767													G|-|G|deletion	5008	1.0	1.0	1.0	5008	,	,		9018	1.0		1.0	False		,,,				2504	1.0				p.P48fs		Atlas-Indel	.											.	SARM1	40	.	0			c.142_143insG						PASS	.			901,19		450,1,9						3.8	1.0		dbSNP_130	1	1901,43		949,3,20	no	frameshift	SARM1	NM_015077.2		1399,4,29	A1A1,A1R,RR		2.2119,2.0652,2.1648				2802,62				SO:0001631	upstream_gene_variant	23098	exon1			.	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500		17.37:g.26699195_26699196insG	Exception_encountered	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	12	11	0.916667	NM_015077	B2R7G0|P01141|Q9BSH7	Frame_Shift_Ins	INS	ENST00000226218.4	37	CCDS11229.1																																																																																			-|0.010;G|0.990	0.990	strong		0.767	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346595	39346596	+	In_Frame_Ins	INS	-	-	GCTGTGGGTCCAGCTGCTGCCAGCCTA	rs33927480|rs377187211|rs148036927|rs11283848	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr17:39346595_39346596insGCTGTGGGTCCAGCTGCTGCCAGCCTA	ENST00000398470.1	+	1	457_458	c.457_458insGCTGTGGGTCCAGCTGCTGCCAGCCTA	c.(457-459)tgc>tGCTGTGGGTCCAGCTGCTGCCAGCCTAgc	p.153_154insCGSSCCQPS	KRTAP9-1_ENST00000377723.3_Intron|KRTAP9-1_ENST00000318329.5_In_Frame_Ins_p.70_71insCGSSCCQPS	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	153	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)		p.T152_C153>S(2)		breast(1)|lung(3)	4						CCAGCCCACCTGCTGTGGGTCC	0.584														4543	0.907149	0.9402	0.889	5008	,	,		27695	0.8512		0.8698	False		,,,				2504	0.9714				p.C153delinsCCGSSCCQPS		Pindel	.											KRTAP9-1_ENST00000398470,rectum,carcinoma,0,2	KRTAP9-1	34	2	2	Complex - deletion inframe(2)	breast(2)	c.457_458insGCTGTGGGTCCAGCTGCTGCCAGCCTA						PASS	.																																			SO:0001652	inframe_insertion	728318	exon1			.	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	Exception_encountered	17.37:g.39346595_39346596insGCTGTGGGTCCAGCTGCTGCCAGCCTA	ENSP00000381488:p.Cys153_Cys154insCysGlySerSerCysCysGlnProSer	Somatic	77	.	.		WXS	Illumina HiSeq	Phase_I	85	19	0.224	NM_001190460		In_Frame_Ins	INS	ENST00000398470.1	37	CCDS56029.1																																																																																			.	.	none		0.584	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
HIST1H1D	3007	hgsc.bcm.edu	37	6	26234939	26234939	+	Missense_Mutation	SNP	C	C	T	rs2050949	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr6:26234939C>T	ENST00000244534.5	-	1	277	c.223G>A	c.(223-225)Gaa>Aaa	p.E75K		NM_005320.2	NP_005311.1	P16402	H13_HUMAN	histone cluster 1, H1d	75	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.		E -> K (in dbSNP:rs2050949).		nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				TTGTTTTTTTCTACATCGTAG	0.532													C|||	439	0.0876597	0.0348	0.1037	5008	,	,		15763	0.2113		0.1004	False		,,,				2504	0.0072				p.E75K		Atlas-SNP	.											HIST1H1D,colon,carcinoma,+2,1	HIST1H1D	40	1	0			c.G223A						scavenged	.						71.0	80.0	77.0					6																	26234939		2203	4300	6503	SO:0001583	missense	3007	exon1			TTTTTTCTACATC	M60747	CCDS4597.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000124575	ENSG00000124575		"""Histones / Replication-dependent"""	4717	protein-coding gene	gene with protein product		142210	"""H1 histone family, member 3"", ""histone 1, H1d"""	H1F3		1916825, 12408966	Standard	NM_005320		Approved	H1.3, H1d, H1s-2	uc003nhd.3	P16402	OTTHUMG00000014432	ENST00000244534.5:c.223G>A	6.37:g.26234939C>T	ENSP00000244534:p.Glu75Lys	Somatic	201	1	0.00497512		WXS	Illumina HiSeq	Phase_I	195	10	0.0512821	NM_005320	B2R751|Q2M2I2	Missense_Mutation	SNP	ENST00000244534.5	37	CCDS4597.1	.	.	.	.	.	.	.	.	.	.	.	22.3	4.269948	0.80469	.	.	ENSG00000124575	ENST00000244534	T	0.09255	3.0	5.23	5.23	0.72850	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.262738	0.43110	D	0.000603	T	0.17066	0.0410	L	0.54908	1.71	0.80722	D	1	B	0.29188	0.236	P	0.48304	0.573	T	0.02966	-1.1088	10	0.59425	D	0.04	-77.8298	18.1633	0.89717	0.0:1.0:0.0:0.0	rs2050949;rs2050949	75	P16402	H13_HUMAN	K	75	ENSP00000244534:E75K	ENSP00000244534:E75K	E	-	1	0	HIST1H1D	26342918	1.000000	0.71417	1.000000	0.80357	0.153000	0.21895	4.012000	0.57131	2.623000	0.88846	0.655000	0.94253	GAA	C|0.998;T|0.002	0.002	strong		0.532	HIST1H1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040095.1	NM_005320	
TBC1D8B	54885	hgsc.bcm.edu	37	X	106116883	106116883	+	Silent	SNP	T	T	A	rs140391999	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:106116883T>A	ENST00000357242.5	+	21	3225	c.3051T>A	c.(3049-3051)gcT>gcA	p.A1017A	TBC1D8B_ENST00000276175.3_Silent_p.A1011A	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	1017							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AAGCCATTGCTGTTGTAACCA	0.403																																					p.A1017A		Atlas-SNP	.											.	TBC1D8B	181	.	0			c.T3051A						PASS	.						126.0	122.0	123.0					X																	106116883		2203	4300	6503	SO:0001819	synonymous_variant	54885	exon21			CATTGCTGTTGTA	AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.3051T>A	X.37:g.106116883T>A		Somatic	232	0	0		WXS	Illumina HiSeq	Phase_I	236	20	0.0847458	NM_017752	B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Silent	SNP	ENST00000357242.5	37	CCDS14522.1																																																																																			T|0.999;C|0.001	.	alt		0.403	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057807.2	NM_017752	
IST1	9798	hgsc.bcm.edu	37	16	71956517	71956517	+	Silent	SNP	C	C	A	rs549750934|rs372825060	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr16:71956517C>A	ENST00000378799.6	+	7	1049	c.693C>A	c.(691-693)ccC>ccA	p.P231P	IST1_ENST00000535424.1_Silent_p.P244P|IST1_ENST00000329908.8_Silent_p.P231P|IST1_ENST00000544564.1_Silent_p.P231P|IST1_ENST00000541571.2_Silent_p.P231P|RP11-498D10.5_ENST00000567146.1_RNA|IST1_ENST00000606369.1_Silent_p.P83P|IST1_ENST00000538565.1_3'UTR|IST1_ENST00000378798.5_Silent_p.P231P|IST1_ENST00000538850.1_Silent_p.P83P			P53990	IST1_HUMAN	increased sodium tolerance 1 homolog (yeast)	229	Interaction with VPS37B.|Interaction with VTA1.				abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of proteolysis (GO:0045862)|protein localization (GO:0008104)|viral capsid secondary envelopment (GO:0046745)|viral release from host cell (GO:0019076)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|midbody (GO:0030496)	MIT domain binding (GO:0090541)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)										tgccaatgcccatgcccatgc	0.498																																					p.P244P		Atlas-SNP	.											KIAA0174,rectum,carcinoma,0,1	.	.	1	0			c.C732A						scavenged	.						102.0	70.0	81.0					16																	71956517		2198	4300	6498	SO:0001819	synonymous_variant	9798	exon8			AATGCCCATGCCC	BC004359	CCDS10905.1, CCDS59271.1, CCDS59272.1, CCDS59273.1, CCDS59274.1	16q22.2	2011-08-18	2011-08-18	2011-08-18	ENSG00000182149	ENSG00000182149			28977	protein-coding gene	gene with protein product			"""KIAA0174"""	KIAA0174		8724849, 19129480	Standard	NM_001270975		Approved		uc002fbm.2	P53990	OTTHUMG00000137597	ENST00000378799.6:c.693C>A	16.37:g.71956517C>A		Somatic	69	2	0.0289855		WXS	Illumina HiSeq	Phase_I	64	8	0.125	NM_001270976	A8KAH5|J3QLU7|Q3SYM4|Q9BQ81|Q9BWN2	Silent	SNP	ENST00000378799.6	37	CCDS59272.1	.	.	.	.	.	.	.	.	.	.	C	7.943	0.743115	0.15642	.	.	ENSG00000182149	ENST00000541848	.	.	.	5.54	-4.88	0.03113	.	0.046113	0.85682	D	0.000000	T	0.58750	0.2144	.	.	.	0.58432	D	0.999993	.	.	.	.	.	.	T	0.60454	-0.7260	6	0.62326	D	0.03	-2.7071	8.7497	0.34609	0.1145:0.2195:0.0:0.666	.	.	.	.	Q	118	.	ENSP00000437499:P118Q	P	+	2	0	KIAA0174	70514018	0.000000	0.05858	0.488000	0.27440	0.917000	0.54804	-3.886000	0.00342	-0.979000	0.03529	-0.122000	0.15005	CCA	.	.	none		0.498	IST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269005.2	NM_014761	
DCAF8L2	347442	hgsc.bcm.edu	37	X	27766417	27766417	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:27766417A>G	ENST00000451261.2	+	5	1804	c.1405A>G	c.(1405-1407)Aat>Gat	p.N469D		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	469										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						ACACAGAAATAATACCACAGT	0.443																																					p.N469D		Atlas-SNP	.											.	DCAF8L2	79	.	0			c.A1405G						PASS	.						84.0	56.0	65.0					X																	27766417		692	1591	2283	SO:0001583	missense	347442	exon1			AGAAATAATACCA		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.1405A>G	X.37:g.27766417A>G	ENSP00000462745:p.Asn469Asp	Somatic	265	0	0		WXS	Illumina HiSeq	Phase_I	227	14	0.061674	NM_001136533	B2RXH9|J3KT06	Missense_Mutation	SNP	ENST00000451261.2	37	CCDS59162.1																																																																																			.	.	none		0.443	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354	
CHEK2	11200	hgsc.bcm.edu	37	22	29091840	29091840	+	Missense_Mutation	SNP	T	T	C	rs142470496	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr22:29091840T>C	ENST00000405598.1	-	12	1308	c.1117A>G	c.(1117-1119)Aag>Gag	p.K373E	CHEK2_ENST00000382580.2_Missense_Mutation_p.K416E|CHEK2_ENST00000382578.1_Missense_Mutation_p.K282E|CHEK2_ENST00000544772.1_Missense_Mutation_p.K152E|CHEK2_ENST00000464581.1_5'Flank|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000403642.1_Missense_Mutation_p.K282E|CHEK2_ENST00000404276.1_Missense_Mutation_p.K373E|CHEK2_ENST00000382566.1_3'UTR|CHEK2_ENST00000328354.6_Missense_Mutation_p.K373E|CHEK2_ENST00000402731.1_Missense_Mutation_p.K344E|CHEK2_ENST00000348295.3_Missense_Mutation_p.K344E			O96017	CHK2_HUMAN	checkpoint kinase 2	373	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|T-loop/activation segment.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.K373E(9)		central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CCCAAAATCTTGGAGTGCCCA	0.418			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																													p.K416E		Atlas-SNP	.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	CHEK2,NS,carcinoma,0,36	CHEK2	438	36	9	Substitution - Missense(9)	kidney(4)|prostate(2)|endometrium(1)|stomach(1)|central_nervous_system(1)	c.A1246G						scavenged	.																																			SO:0001583	missense	11200	exon12			AAATCTTGGAGTG	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1117A>G	22.37:g.29091840T>C	ENSP00000386087:p.Lys373Glu	Somatic	103	2	0.0194175		WXS	Illumina HiSeq	Phase_I	122	4	0.0327869	NM_001005735	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	ENST00000405598.1	37	CCDS13843.1	.	.	.	.	.	.	.	.	.	.	T	19.06	3.754336	0.69648	.	.	ENSG00000183765	ENST00000348295;ENST00000382578;ENST00000544772;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000402731	T;T;T;T;T;T;T;T;T	0.54071	0.9;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.9	5.89	5.89	0.94794	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.043710	0.85682	D	0.000000	T	0.56292	0.1975	N	0.11756	0.17	0.80722	D	1	D;D;D;D;D;D	0.76494	0.996;0.999;0.998;0.998;0.993;0.991	P;D;D;D;D;P	0.74674	0.905;0.984;0.943;0.969;0.923;0.896	T	0.64769	-0.6329	10	0.87932	D	0	-1.7726	15.4726	0.75453	0.0:0.0:0.0:1.0	.	282;152;373;344;373;416	O96017-4;Q9HBS5;A8JZZ5;O96017-12;O96017;O96017-9	.;.;.;.;CHK2_HUMAN;.	E	344;282;152;373;373;373;416;282;344	ENSP00000329012:K344E;ENSP00000372021:K282E;ENSP00000442458:K152E;ENSP00000329178:K373E;ENSP00000385747:K373E;ENSP00000386087:K373E;ENSP00000372023:K416E;ENSP00000384919:K282E;ENSP00000384835:K344E	ENSP00000329178:K373E	K	-	1	0	CHEK2	27421840	1.000000	0.71417	1.000000	0.80357	0.479000	0.33129	4.270000	0.58896	2.248000	0.74166	0.528000	0.53228	AAG	.	.	weak		0.418	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
OR4C3	256144	hgsc.bcm.edu	37	11	48346855	48346855	+	Silent	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr11:48346855C>T	ENST00000319856.4	+	1	384	c.363C>T	c.(361-363)tgC>tgT	p.C121C		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						CTTATGAGTGCTGCATGGCTC	0.458																																					p.C121C		Atlas-SNP	.											OR4C3,NS,carcinoma,0,1	OR4C3	75	1	0			c.C363T						scavenged	.						264.0	251.0	256.0					11																	48346855		2201	4298	6499	SO:0001819	synonymous_variant	256144	exon1			TGAGTGCTGCATG	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.363C>T	11.37:g.48346855C>T		Somatic	330	1	0.0030303		WXS	Illumina HiSeq	Phase_I	349	7	0.0200573	NM_001004702	B2RNF2|Q6IFB3	Silent	SNP	ENST00000319856.4	37	CCDS31489.1																																																																																			.	.	none		0.458	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390557.1	NM_001004702	
FLG	2312	hgsc.bcm.edu	37	1	152284823	152284823	+	Missense_Mutation	SNP	A	A	G	rs74129459	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr1:152284823A>G	ENST00000368799.1	-	3	2574	c.2539T>C	c.(2539-2541)Tca>Cca	p.S847P	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	847	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTCTGCTTGACCCCGGGTGT	0.582									Ichthyosis																												p.S847P		Atlas-SNP	.											FLG,NS,carcinoma,0,1	FLG	900	1	0			c.T2539C						scavenged	.						322.0	322.0	322.0					1																	152284823		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TGCTTGACCCCGG	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2539T>C	1.37:g.152284823A>G	ENSP00000357789:p.Ser847Pro	Somatic	213	2	0.00938967		WXS	Illumina HiSeq	Phase_I	166	4	0.0240964	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	7.279	0.608792	0.14066	.	.	ENSG00000143631	ENST00000368799	T	0.03772	3.81	3.63	2.44	0.29823	.	.	.	.	.	T	0.05731	0.0150	L	0.58428	1.81	0.09310	N	1	D	0.76494	0.999	D	0.68765	0.96	T	0.31530	-0.9940	9	0.34782	T	0.22	.	6.6957	0.23197	0.7566:0.2434:0.0:0.0	.	847	P20930	FILA_HUMAN	P	847	ENSP00000357789:S847P	ENSP00000357789:S847P	S	-	1	0	FLG	150551447	0.001000	0.12720	0.003000	0.11579	0.020000	0.10135	0.252000	0.18278	0.443000	0.26582	0.392000	0.25879	TCA	A|0.984;T|0.016	.	alt		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
AMER1	139285	hgsc.bcm.edu	37	X	63412763	63412763	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:63412763C>A	ENST00000330258.3	-	2	676	c.404G>T	c.(403-405)gGg>gTg	p.G135V	AMER1_ENST00000403336.1_Missense_Mutation_p.G135V|AMER1_ENST00000374869.3_Missense_Mutation_p.G135V	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	135					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									CTCCAAAGCCCCATGGGCACT	0.547																																					p.G135V		Atlas-SNP	.											.	.	.	.	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.G404T						PASS	.						52.0	48.0	49.0					X																	63412763		2203	4300	6503	SO:0001583	missense	139285	exon2			AAAGCCCCATGGG	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.404G>T	X.37:g.63412763C>A	ENSP00000329117:p.Gly135Val	Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	125	10	0.08	NM_152424	A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	C	9.805	1.181715	0.21787	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.18338	2.22;2.22;2.22	4.59	2.79	0.32731	.	0.360426	0.27807	N	0.017766	T	0.10637	0.0260	L	0.43152	1.355	0.20703	N	0.999866	B	0.23854	0.092	B	0.23574	0.047	T	0.26467	-1.0102	10	0.17369	T	0.5	-4.6723	1.1464	0.01776	0.1844:0.4399:0.1755:0.2003	.	135	Q5JTC6	F123B_HUMAN	V	135	ENSP00000364003:G135V;ENSP00000329117:G135V;ENSP00000384722:G135V	ENSP00000329117:G135V	G	-	2	0	FAM123B	63329488	0.000000	0.05858	0.010000	0.14722	0.766000	0.43426	0.351000	0.20096	0.641000	0.30601	0.600000	0.82982	GGG	.	.	none		0.547	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
ADRM1	11047	hgsc.bcm.edu	37	20	60878686	60878686	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr20:60878686A>G	ENST00000253003.2	+	2	108	c.62A>G	c.(61-63)aAg>aGg	p.K21R	RP11-157P1.4_ENST00000414042.1_RNA|ADRM1_ENST00000462554.1_3'UTR	NM_007002.2|NM_175573.1	NP_008933.2|NP_783163.1	Q16186	ADRM1_HUMAN	adhesion regulating molecule 1	21	Interaction with PSMD1.				positive regulation of endopeptidase activity (GO:0010950)|proteasome assembly (GO:0043248)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|protease binding (GO:0002020)|proteasome binding (GO:0070628)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|urinary_tract(1)	5	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)			GCCTCCAACAAGTACTTGGTG	0.622																																					p.K21R		Atlas-SNP	.											.	ADRM1	28	.	0			c.A62G						PASS	.						78.0	86.0	83.0					20																	60878686		2203	4299	6502	SO:0001583	missense	11047	exon2			CCAACAAGTACTT	D64154	CCDS13496.1, CCDS74747.1	20q13.33	2008-05-22			ENSG00000130706	ENSG00000130706			15759	protein-coding gene	gene with protein product		610650				8033103	Standard	NM_007002		Approved	GP110, Rpn13, ARM1	uc002yco.3	Q16186	OTTHUMG00000032904	ENST00000253003.2:c.62A>G	20.37:g.60878686A>G	ENSP00000253003:p.Lys21Arg	Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	35	6	0.171429	NM_175573	A0PKB1|Q96FJ7|Q9H1P2	Missense_Mutation	SNP	ENST00000253003.2	37	CCDS13496.1	.	.	.	.	.	.	.	.	.	.	A	19.48	3.834980	0.71373	.	.	ENSG00000130706	ENST00000370744;ENST00000253003	.	.	.	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.65637	0.2710	L	0.41632	1.29	0.80722	D	1	B;P	0.48350	0.018;0.909	B;D	0.63957	0.046;0.92	T	0.64622	-0.6364	9	0.39692	T	0.17	-25.6551	13.6872	0.62524	1.0:0.0:0.0:0.0	.	21;21	B4DMP7;Q16186	.;ADRM1_HUMAN	R	21	.	ENSP00000253003:K21R	K	+	2	0	ADRM1	60312081	1.000000	0.71417	0.998000	0.56505	0.767000	0.43475	7.101000	0.76997	1.707000	0.51288	0.459000	0.35465	AAG	.	.	none		0.622	ADRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080007.1		
GNPTAB	79158	hgsc.bcm.edu	37	12	102158979	102158979	+	Silent	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr12:102158979G>A	ENST00000299314.7	-	13	1978	c.1716C>T	c.(1714-1716)gcC>gcT	p.A572A	RNU6-101P_ENST00000410323.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	572					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						CTCCTCTTTTGGCTACTTCTG	0.393																																					p.A572A		Atlas-SNP	.											GNPTAB,NS,carcinoma,-1,1	GNPTAB	120	1	0			c.C1716T						PASS	.						186.0	174.0	178.0					12																	102158979		2203	4300	6503	SO:0001819	synonymous_variant	79158	exon13			TCTTTTGGCTACT	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.1716C>T	12.37:g.102158979G>A		Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	158	11	0.0696203	NM_024312	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Silent	SNP	ENST00000299314.7	37	CCDS9088.1																																																																																			.	.	none		0.393	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1		
GPR82	27197	hgsc.bcm.edu	37	X	41586775	41586775	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:41586775A>G	ENST00000302548.4	+	3	736	c.496A>G	c.(496-498)Ata>Gta	p.I166V	CASK_ENST00000378158.1_Intron|CASK_ENST00000421587.2_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000378154.1_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000442742.2_Intron|CASK_ENST00000378163.1_Intron	NM_080817.4	NP_543007.1	Q96P67	GPR82_HUMAN	G protein-coupled receptor 82	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	10						TGTACTGGGCATAATCATTCC	0.408																																					p.I166V		Atlas-SNP	.											.	GPR82	52	.	0			c.A496G						PASS	.						69.0	67.0	67.0					X																	41586775		2203	4300	6503	SO:0001583	missense	27197	exon3			CTGGGCATAATCA	AF411111	CCDS14259.1	Xp11.4	2012-08-21			ENSG00000171657	ENSG00000171657		"""GPCR / Class A : Orphans"""	4533	protein-coding gene	gene with protein product		300748				11574155	Standard	NM_080817		Approved		uc004dft.3	Q96P67	OTTHUMG00000021373	ENST00000302548.4:c.496A>G	X.37:g.41586775A>G	ENSP00000303549:p.Ile166Val	Somatic	216	0	0		WXS	Illumina HiSeq	Phase_I	192	16	0.0833333	NM_080817	Q5VT13	Missense_Mutation	SNP	ENST00000302548.4	37	CCDS14259.1	.	.	.	.	.	.	.	.	.	.	A	0.372	-0.933289	0.02359	.	.	ENSG00000171657	ENST00000302548	T	0.72051	-0.62	5.62	-6.3	0.02007	GPCR, rhodopsin-like superfamily (1);	0.298098	0.25604	N	0.029527	T	0.35770	0.0943	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46965	-0.9153	10	0.02654	T	1	-6.7524	9.1887	0.37187	0.2148:0.3218:0.4634:0.0	.	166	Q96P67	GPR82_HUMAN	V	166	ENSP00000303549:I166V	ENSP00000303549:I166V	I	+	1	0	GPR82	41471719	0.000000	0.05858	0.015000	0.15790	0.245000	0.25701	-2.276000	0.01161	-1.138000	0.02884	-0.314000	0.08810	ATA	.	.	none		0.408	GPR82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056261.1	NM_080817	
RANBP2	5903	hgsc.bcm.edu	37	2	109381816	109381816	+	Silent	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:109381816G>A	ENST00000283195.6	+	20	4947	c.4821G>A	c.(4819-4821)gaG>gaA	p.E1607E		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1607					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.E1607E(6)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CTAAGAAGGAGGGACAGTGGG	0.433																																					p.E1607E		Atlas-SNP	.											RANBP2_ENST00000283195,NS,carcinoma,0,4	RANBP2	488	4	6	Substitution - coding silent(6)	prostate(6)	c.G4821A						scavenged	.						75.0	75.0	75.0					2																	109381816		2172	4252	6424	SO:0001819	synonymous_variant	5903	exon20			GAAGGAGGGACAG	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.4821G>A	2.37:g.109381816G>A		Somatic	320	1	0.003125		WXS	Illumina HiSeq	Phase_I	313	4	0.0127796	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Silent	SNP	ENST00000283195.6	37	CCDS2079.1																																																																																			.	.	none		0.433	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
IRF5	3663	hgsc.bcm.edu	37	7	128587381	128587381	+	Silent	SNP	T	T	C	rs199508964|rs79724471|rs60344245	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr7:128587381T>C	ENST00000402030.2	+	6	603	c.531T>C	c.(529-531)ccT>ccC	p.P177P	IRF5_ENST00000477535.1_Intron|IRF5_ENST00000473745.1_Silent_p.P177P|IRF5_ENST00000357234.5_Silent_p.P193P|IRF5_ENST00000249375.4_Silent_p.P177P	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	177					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						TGCGGCCGCCTACTCTGCAGC	0.657																																					p.P193P		Atlas-SNP	.											.	IRF5	40	.	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.T579C						PASS	.	T	,,,,	881,2925		144,593,1166	5.0	7.0	6.0		531,579,531,,531		0.1	7	dbSNP_131	6	1628,6000		358,912,2544	no	coding-synonymous,coding-synonymous,coding-synonymous,intron,coding-synonymous	IRF5	NM_001098627.2,NM_001098629.1,NM_001098630.1,NM_001242452.1,NM_032643.3	,,,,	502,1505,3710	CC,CT,TT		21.3424,23.1477,21.9433	,,,,	177/499,193/515,177/499,,177/499	128587381	2509,8925	1903	3814	5717	SO:0001819	synonymous_variant	3663	exon6			GCCGCCTACTCTG		CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.531T>C	7.37:g.128587381T>C		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	70	14	0.2	NM_001098629	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	Silent	SNP	ENST00000402030.2	37	CCDS5808.1	740	0.33882783882783885	191	0.3882113821138211	85	0.23480662983425415	170	0.2972027972027972	294	0.38786279683377306	T	2.949	-0.217149	0.06101	0.231477	0.213424	ENSG00000128604	ENST00000430204	.	.	.	.	.	.	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	2.9999999999752447E-6	.	.	.	.	.	.	T	0.44667	-0.9313	1	.	.	.	.	.	.	.	.	166	E9PC81	.	P	166	.	.	L	+	2	0	IRF5	128374617	0.027000	0.19231	0.110000	0.21437	0.055000	0.15305	0.056000	0.14256	0.056000	0.16144	0.055000	0.15244	CTA	T|0.661;C|0.339	0.339	strong		0.657	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350934.1	NM_001098627	
ERGIC2	51290	hgsc.bcm.edu	37	12	29514613	29514613	+	Silent	SNP	T	T	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr12:29514613T>C	ENST00000360150.4	-	6	414	c.339A>G	c.(337-339)gtA>gtG	p.V113V		NM_016570.2	NP_057654.2	Q96RQ1	ERGI2_HUMAN	ERGIC and golgi 2	113					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)				endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)|urinary_tract(1)	10	Lung NSC(12;2.02e-08)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)|Lung SC(9;0.184)					AAAGATCAAATACTGTCTGAA	0.308																																					p.V113V		Atlas-SNP	.											ERGIC2,NS,carcinoma,-2,1	ERGIC2	29	1	0			c.A339G						PASS	.						146.0	146.0	146.0					12																	29514613		1833	4083	5916	SO:0001819	synonymous_variant	51290	exon6			ATCAAATACTGTC	AF216751	CCDS41765.1	12p11.22	2006-02-08							30208	protein-coding gene	gene with protein product		612236				11445006, 12932305	Standard	NM_016570		Approved	PTX1, Erv41	uc001riv.3	Q96RQ1		ENST00000360150.4:c.339A>G	12.37:g.29514613T>C		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	143	8	0.0559441	NM_016570	A6NHH6|Q53GY2|Q8N2Q9|Q9BVV9|Q9NZA3	Silent	SNP	ENST00000360150.4	37	CCDS41765.1																																																																																			.	.	none		0.308	ERGIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403489.1	NM_016570	
SIM2	6493	hgsc.bcm.edu	37	21	38072069	38072069	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr21:38072069C>T	ENST00000290399.6	+	1	636	c.23C>T	c.(22-24)gCg>gTg	p.A8V	AP000697.6_ENST00000430607.1_RNA|SIM2_ENST00000460783.1_3'UTR|SIM2_ENST00000430056.3_Missense_Mutation_p.A8V	NM_005069.3	NP_005060.1	Q14190	SIM2_HUMAN	single-minded family bHLH transcription factor 2	8	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell differentiation (GO:0030154)|embryonic pattern specification (GO:0009880)|lung development (GO:0030324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(2)	16						TCCAAGAATGCGGCCAAGACC	0.657																																					p.A8V		Atlas-SNP	.											.	SIM2	55	.	0			c.C23T						PASS	.						120.0	94.0	103.0					21																	38072069		2202	4300	6502	SO:0001583	missense	6493	exon1			AGAATGCGGCCAA		CCDS13646.1	21q22.2	2013-10-17	2013-10-17		ENSG00000159263	ENSG00000159263		"""Basic helix-loop-helix proteins"""	10883	protein-coding gene	gene with protein product	"""transcription factor SIM2"""	600892	"""single-minded (Drosophila) homolog 2"", ""single-minded homolog 2 (Drosophila)"""	SIM		7485157	Standard	NM_009586		Approved	MGC119447, bHLHe15	uc002yvr.2	Q14190	OTTHUMG00000086637	ENST00000290399.6:c.23C>T	21.37:g.38072069C>T	ENSP00000290399:p.Ala8Val	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	92	5	0.0543478	NM_005069	O60766|Q15470|Q15471|Q15472|Q15473|Q16532|Q2TBD8	Missense_Mutation	SNP	ENST00000290399.6	37	CCDS13646.1	.	.	.	.	.	.	.	.	.	.	C	33	5.244806	0.95272	.	.	ENSG00000159263	ENST00000290399;ENST00000430056	T;D	0.97850	2.88;-4.57	4.41	3.52	0.40303	Helix-loop-helix DNA-binding (4);	0.056007	0.64402	N	0.000001	D	0.98836	0.9607	M	0.92367	3.3	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.99449	1.0940	10	0.87932	D	0	.	12.3321	0.55046	0.0:0.9181:0.0:0.0819	.	8;8	Q14190;Q14190-2	SIM2_HUMAN;.	V	8	ENSP00000290399:A8V;ENSP00000404176:A8V	ENSP00000290399:A8V	A	+	2	0	SIM2	36993939	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.443000	0.80521	1.084000	0.41184	0.563000	0.77884	GCG	.	.	none		0.657	SIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194692.1	NM_009586	
SH3PXD2A	9644	hgsc.bcm.edu	37	10	105362350	105362350	+	Silent	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr10:105362350G>A	ENST00000369774.4	-	15	2901	c.2625C>T	c.(2623-2625)agC>agT	p.S875S	SH3PXD2A_ENST00000538130.1_Silent_p.S710S|SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000427662.2_Intron|SH3PXD2A_ENST00000355946.2_Silent_p.S847S|SH3PXD2A_ENST00000540321.1_Silent_p.S742S			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	875	SH3 4. {ECO:0000255|PROSITE- ProRule:PRU00192}.				superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		ACCACCACCCGCTCTCCTGCT	0.617																																					p.S847S		Atlas-SNP	.											.	SH3PXD2A	90	.	0			c.C2541T						PASS	.						50.0	51.0	51.0					10																	105362350		2203	4300	6503	SO:0001819	synonymous_variant	9644	exon14			CCACCCGCTCTCC	AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.2625C>T	10.37:g.105362350G>A		Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	104	5	0.0480769	NM_014631	D3DR98|O43302|Q5TCZ2|Q5TDQ8	Silent	SNP	ENST00000369774.4	37		.	.	.	.	.	.	.	.	.	.	G	0.409	-0.914168	0.02415	.	.	ENSG00000107957	ENST00000420222	.	.	.	4.59	-2.81	0.05805	.	.	.	.	.	T	0.57169	0.2035	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55976	-0.8055	4	.	.	.	-16.5179	11.8174	0.52218	0.728:0.0:0.272:0.0	.	.	.	.	W	802	.	.	R	-	1	2	SH3PXD2A	105352340	0.038000	0.19896	0.854000	0.33618	0.429000	0.31625	-0.502000	0.06390	-0.468000	0.06922	-0.258000	0.10820	CGG	.	.	none		0.617	SH3PXD2A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050178.1	NM_014631	
CCDC88C	440193	hgsc.bcm.edu	37	14	91883122	91883122	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr14:91883122A>C	ENST00000389857.6	-	2	207	c.121T>G	c.(121-123)Tta>Gta	p.L41V	CCDC88C_ENST00000389856.5_Missense_Mutation_p.L33V|CCDC88C_ENST00000554165.1_5'UTR|CCDC88C_ENST00000553403.1_Missense_Mutation_p.L41V|RP11-895M11.3_ENST00000557524.1_lincRNA	NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	41					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CCGTCCACTAAATCCATGTAC	0.473																																					p.L41V		Atlas-SNP	.											.	CCDC88C	192	.	0			c.T121G						PASS	.						56.0	54.0	54.0					14																	91883122		1952	4139	6091	SO:0001583	missense	440193	exon2			CCACTAAATCCAT		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.121T>G	14.37:g.91883122A>C	ENSP00000374507:p.Leu41Val	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	88	6	0.0681818	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	37	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	A	19.24	3.789352	0.70337	.	.	ENSG00000015133	ENST00000389857;ENST00000541408;ENST00000389856;ENST00000553403	T;T;T	0.65732	-0.17;-0.17;-0.17	5.18	1.39	0.22231	.	0.000000	0.30329	U	0.009879	T	0.73845	0.3639	M	0.86864	2.845	0.80722	D	1	D;D	0.65815	0.971;0.995	D;P	0.64506	0.926;0.894	T	0.70781	-0.4779	10	0.87932	D	0	-4.4737	2.9797	0.05949	0.4867:0.0:0.3289:0.1844	.	41;41	Q9P219;G3V3S0	DAPLE_HUMAN;.	V	41;5;33;41	ENSP00000374507:L41V;ENSP00000374506:L33V;ENSP00000451392:L41V	ENSP00000374506:L33V	L	-	1	2	CCDC88C	90952875	0.997000	0.39634	1.000000	0.80357	0.995000	0.86356	1.407000	0.34657	0.333000	0.23563	0.379000	0.24179	TTA	.	.	none		0.473	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
PCMTD1	115294	hgsc.bcm.edu	37	8	52733227	52733227	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr8:52733227C>T	ENST00000360540.5	-	7	1164	c.758G>A	c.(757-759)cGc>cAc	p.R253H	PCMTD1_ENST00000522514.1_Missense_Mutation_p.R253H|PCMTD1_ENST00000544451.1_Missense_Mutation_p.R177H|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	253						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)	p.R253H(3)		NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				TCTAAGTGTGCGTCGAATGTA	0.378																																					p.R253H		Atlas-SNP	.											PCMTD1,trunk,malignant_melanoma,0,3	PCMTD1	73	3	3	Substitution - Missense(3)	skin(3)	c.G758A						scavenged	.						66.0	68.0	67.0					8																	52733227		2203	4300	6503	SO:0001583	missense	115294	exon6			AGTGTGCGTCGAA		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.758G>A	8.37:g.52733227C>T	ENSP00000353739:p.Arg253His	Somatic	231	4	0.017316		WXS	Illumina HiSeq	Phase_I	215	7	0.0325581	NM_052937	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387497	0.61956	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.44083	1.52;0.93;1.52	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.56031	0.1958	L	0.42245	1.32	0.80722	D	1	P;D;B	0.89917	0.653;1.0;0.051	B;D;B	0.66196	0.059;0.942;0.02	T	0.39623	-0.9605	10	0.20046	T	0.44	-15.7151	19.9832	0.97338	0.0:1.0:0.0:0.0	.	123;177;253	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	H	253;177;253	ENSP00000353739:R253H;ENSP00000444026:R177H;ENSP00000428099:R253H	ENSP00000353739:R253H	R	-	2	0	PCMTD1	52895780	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	7.046000	0.76592	2.722000	0.93159	0.655000	0.94253	CGC	.	.	none		0.378	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
ZNF217	7764	hgsc.bcm.edu	37	20	52198348	52198348	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr20:52198348T>A	ENST00000371471.2	-	2	1443	c.1018A>T	c.(1018-1020)Agt>Tgt	p.S340C	ZNF217_ENST00000540425.1_5'Flank|ZNF217_ENST00000302342.3_Missense_Mutation_p.S340C			O75362	ZN217_HUMAN	zinc finger protein 217	340					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			CCTGCACAACTGCCCTTATTT	0.542																																					p.S340C		Atlas-SNP	.											.	ZNF217	227	.	0			c.A1018T						PASS	.						126.0	128.0	128.0					20																	52198348		2203	4300	6503	SO:0001583	missense	7764	exon1			CACAACTGCCCTT	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.1018A>T	20.37:g.52198348T>A	ENSP00000360526:p.Ser340Cys	Somatic	221	0	0		WXS	Illumina HiSeq	Phase_I	259	24	0.0926641	NM_006526	E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	37	CCDS13443.1	.	.	.	.	.	.	.	.	.	.	T	8.872	0.949551	0.18356	.	.	ENSG00000171940	ENST00000371471;ENST00000302342	T;T	0.10099	2.91;2.91	5.7	0.987	0.19790	.	0.778438	0.12010	N	0.507981	T	0.09686	0.0238	L	0.40543	1.245	0.09310	N	1	P	0.47106	0.89	B	0.40101	0.319	T	0.18935	-1.0321	10	0.66056	D	0.02	-9.5155	9.5173	0.39113	0.0:0.5469:0.0:0.4531	.	340	O75362	ZN217_HUMAN	C	340	ENSP00000360526:S340C;ENSP00000304308:S340C	ENSP00000304308:S340C	S	-	1	0	ZNF217	51631755	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	0.015000	0.13355	-0.056000	0.13221	-0.376000	0.06991	AGT	.	.	none		0.542	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526	
UACA	55075	hgsc.bcm.edu	37	15	70976724	70976724	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr15:70976724T>C	ENST00000322954.6	-	8	849	c.664A>G	c.(664-666)Aat>Gat	p.N222D	UACA_ENST00000539319.1_Intron|UACA_ENST00000560441.1_Missense_Mutation_p.N209D|UACA_ENST00000379983.2_Missense_Mutation_p.N209D|UACA_ENST00000559183.1_5'Flank	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	222					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TCAGCACCATTTTTAATTAAG	0.403																																					p.N222D		Atlas-SNP	.											UACA_ENST00000322954,colon,carcinoma,+1,2	UACA	235	2	0			c.A664G						PASS	.						180.0	172.0	175.0					15																	70976724		2199	4297	6496	SO:0001583	missense	55075	exon8			CACCATTTTTAAT	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.664A>G	15.37:g.70976724T>C	ENSP00000314556:p.Asn222Asp	Somatic	182	0	0		WXS	Illumina HiSeq	Phase_I	140	7	0.05	NM_018003	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	ENST00000322954.6	37	CCDS10235.1	.	.	.	.	.	.	.	.	.	.	T	19.67	3.870855	0.72065	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000395362	T;T	0.64618	-0.11;-0.11	5.4	5.4	0.78164	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000015	T	0.68604	0.3019	L	0.42744	1.35	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.976;0.976;0.997	T	0.65356	-0.6188	10	0.25751	T	0.34	-31.1748	9.4231	0.38563	0.0:0.0794:0.0:0.9206	.	222;222;209	B7ZKM6;Q9BZF9;G3XAG2	.;UACA_HUMAN;.	D	222;209;209	ENSP00000314556:N222D;ENSP00000369319:N209D	ENSP00000314556:N222D	N	-	1	0	UACA	68763778	1.000000	0.71417	0.973000	0.42090	0.995000	0.86356	3.516000	0.53436	2.176000	0.68965	0.379000	0.24179	AAT	.	.	none		0.403	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2		
CRIPAK	285464	hgsc.bcm.edu	37	4	1388974	1388974	+	Silent	SNP	T	T	C	rs71614969	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr4:1388974T>C	ENST00000324803.4	+	1	3635	c.675T>C	c.(673-675)gaT>gaC	p.D225D		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	225					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCGATGCGGAGTGCC	0.667													N|||	706	0.140974	0.087	0.1888	5008	,	,		14021	0.0268		0.2326	False		,,,				2504	0.2035				p.D225D		Atlas-SNP	.											CRIPAK,rectum,carcinoma,0,1	CRIPAK	185	1	0			c.T675C						scavenged	.						177.0	128.0	145.0					4																	1388974		2168	4272	6440	SO:0001819	synonymous_variant	285464	exon1			TGCCGATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.675T>C	4.37:g.1388974T>C		Somatic	47	8	0.170213		WXS	Illumina HiSeq	Phase_I	42	8	0.190476	NM_175918	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			C|1.000;|0.000	1.000	weak		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
PRB4	5545	hgsc.bcm.edu	37	12	11461566	11461566	+	Silent	SNP	T	T	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr12:11461566T>C	ENST00000535904.1	-	3	384	c.351A>G	c.(349-351)ccA>ccG	p.P117P	PRB4_ENST00000279575.1_Silent_p.P117P|PRB4_ENST00000445719.2_Intron			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	138	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		Missing (in allele M and allele S).			extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						CTGGCTTTCCTGGAGGAGGTG	0.602										HNSCC(22;0.051)																											p.P117P		Atlas-SNP	.											PRB4,caecum,carcinoma,-1,2	PRB4	59	2	0			c.A351G						scavenged	.						146.0	162.0	157.0					12																	11461566		2203	4300	6503	SO:0001819	synonymous_variant	5545	exon3			CTTTCCTGGAGGA		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.351A>G	12.37:g.11461566T>C		Somatic	235	2	0.00851064		WXS	Illumina HiSeq	Phase_I	190	4	0.0210526	NM_002723	A1L439|O00600|P02813|P10161|P10162|P81489	Silent	SNP	ENST00000535904.1	37	CCDS8641.1																																																																																			.	.	none		0.602	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
ZNF676	163223	hgsc.bcm.edu	37	19	22363610	22363610	+	Silent	SNP	A	A	G	rs201622264	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr19:22363610A>G	ENST00000397121.2	-	3	1226	c.909T>C	c.(907-909)caT>caC	p.H303H		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TCTCTCCAGTATGAATTCTCT	0.443																																					p.H303H		Atlas-SNP	.											ZNF676,rectum,carcinoma,0,2	ZNF676	146	2	0			c.T909C						scavenged	.						81.0	83.0	83.0					19																	22363610		2112	4258	6370	SO:0001819	synonymous_variant	163223	exon3			TCCAGTATGAATT	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.909T>C	19.37:g.22363610A>G		Somatic	75	10	0.133333		WXS	Illumina HiSeq	Phase_I	52	11	0.211538	NM_001001411	A8MVX5	Silent	SNP	ENST00000397121.2	37	CCDS42539.1																																																																																			A|0.793;G|0.207	0.207	strong		0.443	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
UNC13B	10497	hgsc.bcm.edu	37	9	35399645	35399645	+	Splice_Site	SNP	G	G	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr9:35399645G>T	ENST00000378495.3	+	35	4230		c.e35-1		UNC13B_ENST00000378496.4_Splice_Site|UNC13B_ENST00000396787.1_Splice_Site	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)						apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			TCTCTGAACAGGATCACATGG	0.532																																					.		Atlas-SNP	.											.	UNC13B	153	.	0			c.4009-1G>T						PASS	.						249.0	228.0	235.0					9																	35399645		2203	4300	6503	SO:0001630	splice_region_variant	10497	exon35			TGAACAGGATCAC	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.4009-1G>T	9.37:g.35399645G>T		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	61	6	0.0983607	NM_006377	Q5VYM8	Splice_Site	SNP	ENST00000378495.3	37	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611073	0.87258	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4471	0.94852	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC13B	35389645	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	9.267000	0.95665	2.824000	0.97209	0.655000	0.94253	.	.	.	none		0.532	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377	Intron
AGAP6	414189	hgsc.bcm.edu	37	10	51768543	51768543	+	Missense_Mutation	SNP	T	T	C	rs368970869		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr10:51768543T>C	ENST00000374056.4	+	7	987	c.589T>C	c.(589-591)Tcg>Ccg	p.S197P	AGAP6_ENST00000412531.3_Missense_Mutation_p.S220P			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	197					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.S220P(3)		NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						CTCCATTCCATCGACTCCCAG	0.532																																					p.S220P		Atlas-SNP	.											AGAP6,NS,carcinoma,0,3	AGAP6	53	3	3	Substitution - Missense(3)	endometrium(2)|NS(1)	c.T658C						scavenged	.																																			SO:0001583	missense	414189	exon8			ATTCCATCGACTC		CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.589T>C	10.37:g.51768543T>C	ENSP00000363168:p.Ser197Pro	Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	116	3	0.0258621	NM_001077665		Missense_Mutation	SNP	ENST00000374056.4	37		.	.	.	.	.	.	.	.	.	.	.	7.332	0.619129	0.14129	.	.	ENSG00000204149	ENST00000374056;ENST00000412531	T	0.56776	0.44	0.0465	0.0465	0.14256	.	0.149774	0.46145	D	0.000318	T	0.42314	0.1197	M	0.65498	2.005	0.37828	D	0.92861	B	0.14012	0.009	B	0.13407	0.009	T	0.20140	-1.0284	10	0.31617	T	0.26	.	4.565	0.12180	0.0:6.0E-4:0.0:0.9994	.	220	C9IYN2	.	P	220;197	ENSP00000400972:S197P	ENSP00000363168:S220P	S	+	1	0	AGAP6	51438549	1.000000	0.71417	0.059000	0.19551	0.060000	0.15804	3.691000	0.54720	0.115000	0.18071	0.113000	0.15668	TCG	T|0.500;C|0.500	0.500	weak		0.532	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_001077665	
FLG	2312	hgsc.bcm.edu	37	1	152280084	152280084	+	Silent	SNP	G	G	A	rs200015722		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr1:152280084G>A	ENST00000368799.1	-	3	7313	c.7278C>T	c.(7276-7278)tcC>tcT	p.S2426S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2426	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCCATGGGCGGACTCAGACT	0.602									Ichthyosis																												p.S2426S		Atlas-SNP	.											.	FLG	900	.	0			c.C7278T						PASS	.	A		3,4403	825.6+/-416.5	0,3,2200	245.0	231.0	236.0		7278	-9.1	0.0	1		236	3,8597	819.0+/-406.8	0,3,4297	no	coding-synonymous	FLG	NM_002016.1		0,6,6497	AA,AG,GG		0.0349,0.0681,0.0461		2426/4062	152280084	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	ATGGGCGGACTCA	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7278C>T	1.37:g.152280084G>A		Somatic	225	0	0		WXS	Illumina HiSeq	Phase_I	199	15	0.0753769	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																			G|0.999;A|0.001	0.001	weak		0.602	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CD200R1L	344807	hgsc.bcm.edu	37	3	112546302	112546302	+	Silent	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr3:112546302C>T	ENST00000398214.1	-	3	567	c.342G>A	c.(340-342)ccG>ccA	p.P114P	CD200R1L_ENST00000448932.1_Silent_p.P93P|CD200R1L_ENST00000488794.1_Silent_p.P93P	NM_001008784.2	NP_001008784.2	Q6Q8B3	MO2R2_HUMAN	CD200 receptor 1-like	114	Ig-like V-type.					integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(2)	19						TGGTGTCCACCGGACGAATCT	0.458																																					p.P114P		Atlas-SNP	.											CD200R1L,colon,carcinoma,-1,1	CD200R1L	47	1	0			c.G342A						scavenged	.						145.0	140.0	142.0					3																	112546302		2203	4300	6503	SO:0001819	synonymous_variant	344807	exon3			GTCCACCGGACGA	AY284976	CCDS43131.1, CCDS56267.1	3q13.2	2014-05-15	2008-10-08		ENSG00000206531	ENSG00000206531		"""Immunoglobulin superfamily / C2-set domain containing"""	24665	protein-coding gene	gene with protein product	"""CD200 receptor 2"""						Standard	NM_001008784		Approved	CD200RLa, CD200R2	uc003dzi.1	Q6Q8B3	OTTHUMG00000159283	ENST00000398214.1:c.342G>A	3.37:g.112546302C>T		Somatic	360	0	0		WXS	Illumina HiSeq	Phase_I	297	4	0.013468	NM_001008784	Q6WHB7	Silent	SNP	ENST00000398214.1	37	CCDS43131.1																																																																																			.	.	none		0.458	CD200R1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354365.1	NM_001008784	
EIF2B5	8893	hgsc.bcm.edu	37	3	183853228	183853228	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr3:183853228C>T	ENST00000273783.3	+	1	177	c.55C>T	c.(55-57)Cgc>Tgc	p.R19C	RP11-778D9.13_ENST00000609288.1_lincRNA|RP11-778D9.12_ENST00000608232.1_RNA|EIF2B5_ENST00000444495.1_Missense_Mutation_p.R19C|RP11-778D9.12_ENST00000608135.1_RNA|EIF2B5_ENST00000432569.1_Missense_Mutation_p.R19C	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	19					astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GGCTAACAAGCGCAGCGGCGC	0.687											OREG0015363	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R19C		Atlas-SNP	.											.	EIF2B5	62	.	0			c.C55T						PASS	.						6.0	8.0	7.0					3																	183853228		2147	4220	6367	SO:0001583	missense	8893	exon1			AACAAGCGCAGCG	U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.55C>T	3.37:g.183853228C>T	ENSP00000273783:p.Arg19Cys	Somatic	171	0	0	1987	WXS	Illumina HiSeq	Phase_I	151	7	0.0463576	NM_003907	Q541Z1|Q96D04	Missense_Mutation	SNP	ENST00000273783.3	37	CCDS3252.1	.	.	.	.	.	.	.	.	.	.	c	15.18	2.756467	0.49362	.	.	ENSG00000145191	ENST00000273783;ENST00000432569;ENST00000444495	D;D;D	0.98150	-4.74;-4.08;-4.75	4.93	4.93	0.64822	.	0.270105	0.30959	N	0.008529	D	0.94666	0.8280	N	0.08118	0	0.54753	D	0.999983	D	0.76494	0.999	P	0.50754	0.649	D	0.95051	0.8187	10	0.66056	D	0.02	-12.6109	13.4835	0.61351	0.0:0.8436:0.1564:0.0	.	19	Q13144	EI2BE_HUMAN	C	19	ENSP00000273783:R19C;ENSP00000414775:R19C;ENSP00000409142:R19C	ENSP00000273783:R19C	R	+	1	0	EIF2B5	185335922	1.000000	0.71417	0.995000	0.50966	0.168000	0.22595	2.282000	0.43461	2.719000	0.93026	0.650000	0.86243	CGC	.	.	none		0.687	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346168.1		
PRB2	653247	hgsc.bcm.edu	37	12	11546314	11546314	+	Missense_Mutation	SNP	T	T	C	rs34305575	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr12:11546314T>C	ENST00000389362.4	-	3	733	c.698A>G	c.(697-699)cAa>cGa	p.Q233R	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	233	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].		Q -> R (in dbSNP:rs34305575).			extracellular region (GO:0005576)		p.Q233R(1)|p.Q212R(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TCGGGCACTTTGGGACTTGTT	0.602													t|||	1065	0.21266	0.525	0.1513	5008	,	,		19415	0.0942		0.0298	False		,,,				2504	0.1442				p.Q233R		Atlas-SNP	.											PRB2_ENST00000389362,NS,carcinoma,0,2	PRB2	168	2	2	Substitution - Missense(2)	prostate(2)	c.A698G						scavenged	.	C	ARG/GLN	2053,2353		493,1067,643	246.0	269.0	261.0		698	-1.2	0.0	12	dbSNP_126	261	255,8339		12,231,4054	no	missense	PRB2	NM_006248.3	43	505,1298,4697	CC,CT,TT		2.9672,46.5956,17.7538	benign	233/417	11546314	2308,10692	2203	4297	6500	SO:0001583	missense	653247	exon3			GCACTTTGGGACT	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.698A>G	12.37:g.11546314T>C	ENSP00000374013:p.Gln233Arg	Somatic	946	10	0.0105708		WXS	Illumina HiSeq	Phase_I	896	21	0.0234375	NM_006248	O00599|P02811|P04281	Missense_Mutation	SNP	ENST00000389362.4	37	CCDS41757.2	336	0.15384615384615385	207	0.42073170731707316	55	0.15193370165745856	57	0.09965034965034965	17	0.022427440633245383	.	1.619	-0.522010	0.04171	0.465956	0.029672	ENSG00000121335	ENST00000389362	T	0.04083	3.71	1.17	-1.25	0.09405	.	.	.	.	.	T	0.00012	0.0000	L	0.40543	1.245	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41179	-0.9523	8	0.14252	T	0.57	.	5.1581	0.15046	0.0:0.2047:0.0:0.7953	rs34305575	233	P02812	PRB2_HUMAN	R	233	ENSP00000374013:Q233R	ENSP00000374013:Q233R	Q	-	2	0	PRB2	11437581	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-2.671000	0.00843	-0.886000	0.03966	-1.635000	0.00777	CAA	T|0.891;C|0.109	0.109	strong		0.602	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
CDC27	996	hgsc.bcm.edu	37	17	45234727	45234727	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr17:45234727T>A	ENST00000066544.3	-	6	592	c.499A>T	c.(499-501)Aca>Tca	p.T167S	CDC27_ENST00000531206.1_Missense_Mutation_p.T167S|CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000446365.2_Missense_Mutation_p.T106S|CDC27_ENST00000527547.1_Missense_Mutation_p.T167S	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	167					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AATTTAAATGTTTGGTCAGGA	0.368																																					p.T167S		Atlas-SNP	.											CDC27_ENST00000531206,NS,carcinoma,+2,10	CDC27	337	10	0			c.A499T						scavenged	.						73.0	73.0	73.0					17																	45234727		2203	4300	6503	SO:0001583	missense	996	exon6			TAAATGTTTGGTC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.499A>T	17.37:g.45234727T>A	ENSP00000066544:p.Thr167Ser	Somatic	261	4	0.0153257		WXS	Illumina HiSeq	Phase_I	213	9	0.0422535	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	14.73	2.623232	0.46840	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67171	-0.25;-0.25;0.04;-0.25;0.89	5.39	5.39	0.77823	.	0.119985	0.64402	D	0.000020	T	0.47192	0.1432	N	0.08118	0	0.39122	D	0.961682	P;P;P;B	0.38677	0.475;0.528;0.642;0.211	B;B;B;B	0.36092	0.049;0.217;0.204;0.067	T	0.59762	-0.7393	10	0.72032	D	0.01	-19.1215	13.3763	0.60741	0.0:0.0:0.0:1.0	.	106;167;167;167	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	S	167;167;106;167;167	ENSP00000066544:T167S;ENSP00000434614:T167S;ENSP00000392802:T106S;ENSP00000437339:T167S;ENSP00000432105:T167S	ENSP00000066544:T167S	T	-	1	0	CDC27	42589726	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.374000	0.66167	2.053000	0.61076	0.528000	0.53228	ACA	.	.	none		0.368	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
GPR55	9290	hgsc.bcm.edu	37	2	231774792	231774792	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:231774792G>A	ENST00000392040.1	-	2	1078	c.886C>T	c.(886-888)Cgc>Tgc	p.R296C	GPR55_ENST00000392039.2_Missense_Mutation_p.R296C|AC012507.4_ENST00000454890.1_RNA	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	296					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		ATGTTCATGCGGAATTCTTTG	0.532																																					p.R296C		Atlas-SNP	.											GPR55,colon,carcinoma,+1,1	GPR55	46	1	0			c.C886T						PASS	.						83.0	85.0	84.0					2																	231774792		2203	4300	6503	SO:0001583	missense	9290	exon2			TCATGCGGAATTC	AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.886C>T	2.37:g.231774792G>A	ENSP00000375894:p.Arg296Cys	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	80	4	0.05	NM_005683	Q8N580	Missense_Mutation	SNP	ENST00000392040.1	37	CCDS2480.1	.	.	.	.	.	.	.	.	.	.	G	18.56	3.650184	0.67472	.	.	ENSG00000135898	ENST00000392040;ENST00000392039	T;T	0.58358	0.34;0.34	4.6	3.65	0.41850	.	0.057515	0.64402	D	0.000002	T	0.49029	0.1533	N	0.08118	0	0.48975	D	0.999738	D	0.89917	1.0	D	0.65874	0.939	T	0.57516	-0.7798	10	0.87932	D	0	-42.499	11.8792	0.52564	0.0:0.0:0.8252:0.1748	.	296	Q9Y2T6	GPR55_HUMAN	C	296	ENSP00000375894:R296C;ENSP00000375893:R296C	ENSP00000375893:R296C	R	-	1	0	GPR55	231483036	0.999000	0.42202	0.980000	0.43619	0.953000	0.61014	2.382000	0.44345	2.522000	0.85027	0.561000	0.74099	CGC	.	.	none		0.532	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332618.1	NM_005683	
F8	2157	hgsc.bcm.edu	37	X	154221377	154221377	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:154221377A>T	ENST00000360256.4	-	4	635	c.435T>A	c.(433-435)gaT>gaA	p.D145E		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	145	F5/8 type A 1.|Plastocyanin-like 1.		D -> H (in HEMA; moderate). {ECO:0000269|PubMed:9886318}.		acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.D145D(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GGAAGACTTTATCATCTTCTT	0.423																																					p.D145E		Atlas-SNP	.											.	F8	646	.	2	Substitution - coding silent(2)	endometrium(2)	c.T435A						PASS	.						228.0	210.0	217.0					X																	154221377		2203	4300	6503	SO:0001583	missense	2157	exon4			GACTTTATCATCT	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.435T>A	X.37:g.154221377A>T	ENSP00000353393:p.Asp145Glu	Somatic	320	0	0		WXS	Illumina HiSeq	Phase_I	231	16	0.0692641	NM_000132	Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	A	17.95	3.513344	0.64522	.	.	ENSG00000185010	ENST00000360256;ENST00000423959;ENST00000453950	D;D;D	0.99462	-5.43;-5.43;-5.94	5.35	-1.68	0.08212	Cupredoxin (2);Multicopper oxidase, type 3 (1);	0.145374	0.64402	D	0.000012	D	0.99290	0.9752	M	0.82433	2.59	0.23550	N	0.997433	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99628	1.0985	10	0.87932	D	0	-6.3892	9.7796	0.40640	0.4251:0.0:0.5749:0.0	.	110;145	B1B0G8;P00451	.;FA8_HUMAN	E	145;110;139	ENSP00000353393:D145E;ENSP00000409446:D110E;ENSP00000389153:D139E	ENSP00000353393:D145E	D	-	3	2	F8	153874571	0.337000	0.24766	0.482000	0.27366	0.727000	0.41649	0.869000	0.27996	-0.449000	0.07117	-0.520000	0.04383	GAT	.	.	none		0.423	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
ZNF799	90576	hgsc.bcm.edu	37	19	12501907	12501907	+	Silent	SNP	A	A	G	rs556226523	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr19:12501907A>G	ENST00000430385.3	-	4	1505	c.1305T>C	c.(1303-1305)tcT>tcC	p.S435S	ZNF799_ENST00000419318.1_Silent_p.S403S|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	435					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						GCCTTCGAAGAGAACTGGAAA	0.368													A|||	35	0.00698882	0.0166	0.0	5008	,	,		23529	0.0		0.003	False		,,,				2504	0.0102				p.S435S		Atlas-SNP	.											ZNF799_ENST00000430385,NS,carcinoma,0,2	ZNF799	111	2	0			c.T1305C						scavenged	.						101.0	104.0	103.0					19																	12501907		2203	4300	6503	SO:0001819	synonymous_variant	90576	exon4			TCGAAGAGAACTG	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1305T>C	19.37:g.12501907A>G		Somatic	204	2	0.00980392		WXS	Illumina HiSeq	Phase_I	200	7	0.035	NM_001080821		Silent	SNP	ENST00000430385.3	37	CCDS45989.1																																																																																			.	.	none		0.368	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821	
ADAM21	8747	hgsc.bcm.edu	37	14	70924294	70924294	+	Silent	SNP	C	C	T	rs112060847		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr14:70924294C>T	ENST00000603540.1	+	2	336	c.78C>T	c.(76-78)tcC>tcT	p.S26S	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Silent_p.S26S	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	26					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TGTCTATTTCCGGCTACTGTC	0.542																																					p.S26S		Atlas-SNP	.											ADAM21_ENST00000267499,NS,malignant_melanoma,+1,4	ADAM21	181	4	0			c.C78T						scavenged	.						101.0	110.0	107.0					14																	70924294		2203	4300	6503	SO:0001819	synonymous_variant	8747	exon2			TATTTCCGGCTAC	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.78C>T	14.37:g.70924294C>T		Somatic	255	5	0.0196078		WXS	Illumina HiSeq	Phase_I	239	9	0.0376569	NM_003813	O43507|Q2VPC6|Q32MR0	Silent	SNP	ENST00000603540.1	37	CCDS9804.1																																																																																			C|0.779;T|0.221	0.221	strong		0.542	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3		
MUC4	4585	hgsc.bcm.edu	37	3	195509374	195509374	+	Missense_Mutation	SNP	T	T	G	rs573840119	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr3:195509374T>G	ENST00000463781.3	-	2	9536	c.9077A>C	c.(9076-9078)cAt>cCt	p.H3026P	MUC4_ENST00000475231.1_Missense_Mutation_p.H3026P|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H3026P(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGGTGACATGAAGAGGGGT	0.582													.|||	717	0.143171	0.1808	0.1023	5008	,	,		10228	0.0486		0.2137	False		,,,				2504	0.1462				p.H3026P		Atlas-SNP	.											MUC4_ENST00000463781,extremity,malignant_melanoma,0,1	MUC4	1505	1	1	Substitution - Missense(1)	skin(1)	c.A9077C						scavenged	.						25.0	18.0	20.0					3																	195509374		655	1532	2187	SO:0001583	missense	4585	exon2			GTGACATGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9077A>C	3.37:g.195509374T>G	ENSP00000417498:p.His3026Pro	Somatic	67	13	0.19403		WXS	Illumina HiSeq	Phase_I	65	15	0.230769	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	7.939	0.742287	0.15642	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.28454	1.61;1.61	.	.	.	.	.	.	.	.	T	0.13030	0.0316	N	0.19112	0.55	0.26070	N	0.981239	P	0.42993	0.797	B	0.31337	0.128	T	0.12967	-1.0527	7	.	.	.	.	4.198	0.10452	0.0:0.0:0.0:1.0	.	2898	E7ESK3	.	P	3026	ENSP00000417498:H3026P;ENSP00000420243:H3026P	.	H	-	2	0	MUC4	196994153	0.006000	0.16342	0.030000	0.17652	0.000000	0.00434	-0.139000	0.10358	0.402000	0.25451	0.000000	0.15137	CAT	.	.	weak		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
OR4D10	390197	hgsc.bcm.edu	37	11	59244978	59244978	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr11:59244978G>C	ENST00000530162.1	+	1	133	c.76G>C	c.(76-78)Gtc>Ctc	p.V26L		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						AGTGAGCTTAGTCTTATTTCT	0.433																																					p.V26L		Atlas-SNP	.											.	OR4D10	120	.	0			c.G76C						PASS	.						107.0	110.0	109.0					11																	59244978		2053	4220	6273	SO:0001583	missense	390197	exon1			AGCTTAGTCTTAT	AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.76G>C	11.37:g.59244978G>C	ENSP00000436424:p.Val26Leu	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	175	17	0.0971429	NM_001004705	B2RNH6	Missense_Mutation	SNP	ENST00000530162.1	37	CCDS53636.1	.	.	.	.	.	.	.	.	.	.	G	2.795	-0.250377	0.05867	.	.	ENSG00000254466	ENST00000530162	T	0.00063	8.78	4.2	-8.41	0.00961	.	.	.	.	.	T	0.00073	0.0002	N	0.02286	-0.61	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.18967	-1.0320	9	0.33940	T	0.23	.	8.643	0.33989	0.0831:0.1004:0.6209:0.1956	.	26	Q8NGI6	OR4DA_HUMAN	L	26	ENSP00000436424:V26L	ENSP00000436424:V26L	V	+	1	0	OR4D10	59001554	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.203000	0.00076	-1.731000	0.01360	-1.107000	0.02091	GTC	.	.	none		0.433	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394235.1	NM_001004705	
NUMBL	9253	hgsc.bcm.edu	37	19	41173904	41173904	+	Silent	SNP	T	T	C	rs79658769		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr19:41173904T>C	ENST00000252891.4	-	10	1466	c.1299A>G	c.(1297-1299)caA>caG	p.Q433Q	NUMBL_ENST00000540131.1_Silent_p.Q392Q|NUMBL_ENST00000598779.1_Silent_p.Q392Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	433	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			gctgttgctgttgctgctgct	0.662																																					p.Q433Q		Atlas-SNP	.											NUMBL,colon,carcinoma,0,2	NUMBL	49	2	0			c.A1299G						scavenged	.						8.0	8.0	8.0					19																	41173904		2119	4125	6244	SO:0001819	synonymous_variant	9253	exon10			TTGCTGTTGCTGC	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1299A>G	19.37:g.41173904T>C		Somatic	45	1	0.0222222		WXS	Illumina HiSeq	Phase_I	29	8	0.275862	NM_004756	Q7Z4J9	Silent	SNP	ENST00000252891.4	37	CCDS12561.1																																																																																			C|1.000;|0.000	1.000	weak		0.662	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756	
LRRTM4	80059	hgsc.bcm.edu	37	2	77745507	77745507	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:77745507C>T	ENST00000409093.1	-	3	1824	c.1488G>A	c.(1486-1488)atG>atA	p.M496I	LRRTM4_ENST00000409088.3_Missense_Mutation_p.M496I|LRRTM4_ENST00000409911.1_Missense_Mutation_p.M497I|LRRTM4_ENST00000409884.1_Missense_Mutation_p.M496I|LRRTM4_ENST00000409282.1_Missense_Mutation_p.M497I			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	496					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.M496I(2)		autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		CCGATATATCCATGGTCTCAG	0.458																																					p.M496I		Atlas-SNP	.											LRRTM4_ENST00000409093,larynx,carcinoma,0,2	LRRTM4	334	2	2	Substitution - Missense(2)	upper_aerodigestive_tract(2)	c.G1488A						scavenged	.						90.0	88.0	88.0					2																	77745507		1882	4122	6004	SO:0001583	missense	80059	exon3			TATATCCATGGTC	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1488G>A	2.37:g.77745507C>T	ENSP00000386357:p.Met496Ile	Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	92	2	0.0217391	NM_024993	Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.871162	0.33069	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.50277	0.75;0.77;0.77;0.87;0.88	5.54	5.54	0.83059	.	0.038849	0.85682	D	0.000000	T	0.47248	0.1435	L	0.54323	1.7	0.58432	D	0.999999	B;B;B	0.28082	0.126;0.2;0.128	B;B;B	0.26770	0.033;0.073;0.048	T	0.43442	-0.9391	10	0.51188	T	0.08	.	18.0311	0.89285	0.0:1.0:0.0:0.0	.	497;496;496	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	I	497;496;496;496;497	ENSP00000387228:M497I;ENSP00000387297:M496I;ENSP00000386357:M496I;ENSP00000386236:M496I;ENSP00000386286:M497I	ENSP00000386236:M496I	M	-	3	0	LRRTM4	77599015	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.992000	0.70609	2.592000	0.87571	0.551000	0.68910	ATG	.	.	none		0.458	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993	
PCMTD1	115294	hgsc.bcm.edu	37	8	52733214	52733214	+	Missense_Mutation	SNP	A	A	C	rs200377849		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr8:52733214A>C	ENST00000360540.5	-	7	1177	c.771T>G	c.(769-771)aaT>aaG	p.N257K	PCMTD1_ENST00000522514.1_Missense_Mutation_p.N257K|PCMTD1_ENST00000544451.1_Missense_Mutation_p.N181K|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	257						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)	p.N257K(1)		NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CATTTATGAAATTTCTAAGTG	0.388																																					p.N257K		Atlas-SNP	.											PCMTD1,trunk,malignant_melanoma,0,1	PCMTD1	73	1	1	Substitution - Missense(1)	skin(1)	c.T771G						scavenged	.						78.0	81.0	80.0					8																	52733214		2203	4300	6503	SO:0001583	missense	115294	exon6			TATGAAATTTCTA		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.771T>G	8.37:g.52733214A>C	ENSP00000353739:p.Asn257Lys	Somatic	247	3	0.0121457		WXS	Illumina HiSeq	Phase_I	231	4	0.017316	NM_052937	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.991059	0.35131	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.47528	0.84;0.84;0.84	5.56	-0.996	0.10218	.	0.046341	0.85682	D	0.000000	T	0.38983	0.1061	N	0.20530	0.585	0.53005	D	0.999961	P;D;B	0.65815	0.651;0.995;0.002	B;P;B	0.60886	0.122;0.88;0.002	T	0.41556	-0.9502	10	0.02654	T	1	-22.28	11.477	0.50304	0.3747:0.0:0.6253:0.0	.	127;181;257	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	K	257;181;257	ENSP00000353739:N257K;ENSP00000444026:N181K;ENSP00000428099:N257K	ENSP00000353739:N257K	N	-	3	2	PCMTD1	52895767	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	3.249000	0.51437	-0.122000	0.11766	-0.250000	0.11733	AAT	.	.	weak		0.388	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
ATRX	546	hgsc.bcm.edu	37	X	76907651	76907651	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:76907651G>A	ENST00000373344.5	-	15	4724	c.4510C>T	c.(4510-4512)Cga>Tga	p.R1504*	ATRX_ENST00000395603.3_Nonsense_Mutation_p.R1466*|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1504					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ATACGTTTTCGTCTCTCTTCC	0.388			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.R1504X		Atlas-SNP	.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	833	.	1	Unknown(1)	bone(1)	c.C4510T						PASS	.						346.0	308.0	321.0					X																	76907651		2203	4300	6503	SO:0001587	stop_gained	546	exon15			GTTTTCGTCTCTC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.4510C>T	X.37:g.76907651G>A	ENSP00000362441:p.Arg1504*	Somatic	303	0	0		WXS	Illumina HiSeq	Phase_I	255	15	0.0588235	NM_000489	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	G	46	12.165867	0.99642	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	.	.	.	4.9	2.85	0.33270	.	0.066609	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.0156	10.5199	0.44912	0.0:0.0:0.3258:0.6742	.	.	.	.	X	1504;1466	.	ENSP00000362441:R1504X	R	-	1	2	ATRX	76794307	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	2.678000	0.46900	0.817000	0.34445	0.594000	0.82650	CGA	.	.	none		0.388	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
CS	1431	hgsc.bcm.edu	37	12	56676279	56676279	+	Silent	SNP	A	A	G	rs528162217	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr12:56676279A>G	ENST00000351328.3	-	6	703	c.513T>C	c.(511-513)gcT>gcC	p.A171A	CS_ENST00000548567.1_Silent_p.A105A|CS_ENST00000542324.2_Silent_p.A158A	NM_004077.2	NP_004068.2	O75390	CISY_HUMAN	citrate synthase	171					carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	citrate (Si)-synthase activity (GO:0004108)|poly(A) RNA binding (GO:0044822)	p.A171A(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	17		Myeloproliferative disorder(1001;0.000374)		BRCA - Breast invasive adenocarcinoma(357;6.17e-07)		GGGCTGTAACAGCTGCACTGA	0.527													A|||	44	0.00878594	0.0272	0.0014	5008	,	,		18707	0.003		0.003	False		,,,				2504	0.001				p.A171A		Atlas-SNP	.											CS,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	CS	44	1	1	Substitution - coding silent(1)	central_nervous_system(1)	c.T513C						scavenged	.																																			SO:0001819	synonymous_variant	1431	exon6			TGTAACAGCTGCA		CCDS8913.1	12q13.2	2012-10-02				ENSG00000062485	2.3.3.1		2422	protein-coding gene	gene with protein product		118950					Standard	NM_004077		Approved		uc001sks.1	O75390	OTTHUMG00000170344	ENST00000351328.3:c.513T>C	12.37:g.56676279A>G		Somatic	234	10	0.042735		WXS	Illumina HiSeq	Phase_I	205	18	0.0878049	NM_004077	Q71UT9|Q7KZH0|Q96FZ8|Q9BWN8	Silent	SNP	ENST00000351328.3	37	CCDS8913.1																																																																																			.	.	none		0.527	CS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408588.2	NM_004077	
LTB	4050	hgsc.bcm.edu	37	6	31548738	31548738	+	Silent	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr6:31548738G>A	ENST00000429299.2	-	4	490	c.483C>T	c.(481-483)agC>agT	p.S161S	LTB_ENST00000446745.2_3'UTR|LTB_ENST00000483972.1_5'UTR	NM_002341.1	NP_002332.1	Q06643	TNFC_HUMAN	lymphotoxin beta (TNF superfamily, member 3)	161					cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|signal transduction (GO:0007165)|skin development (GO:0043588)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	9						GGTACAGAGAGCTGCGCAGCG	0.746																																					p.S161S		Atlas-SNP	.											.	LTB	19	.	0			c.C483T						PASS	.						4.0	4.0	4.0					6																	31548738		1367	2501	3868	SO:0001819	synonymous_variant	4050	exon4			CAGAGAGCTGCGC	L11015	CCDS4703.1, CCDS4704.1	6p21.3	2013-05-22			ENSG00000227507	ENSG00000227507		"""Tumor necrosis factor (ligand) superfamily"""	6711	protein-coding gene	gene with protein product		600978		TNFC		7916655, 1714477	Standard	NM_002341		Approved	p33, TNFSF3	uc003nuk.3	Q06643	OTTHUMG00000031136	ENST00000429299.2:c.483C>T	6.37:g.31548738G>A		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	51	4	0.0784314	NM_002341	P78370|Q52LU8|Q99761	Silent	SNP	ENST00000429299.2	37	CCDS4703.1																																																																																			.	.	none		0.746	LTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076239.3		
MUC16	94025	hgsc.bcm.edu	37	19	9002597	9002597	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr19:9002597C>T	ENST00000397910.4	-	51	40422	c.40219G>A	c.(40219-40221)Gac>Aac	p.D13407N	MUC16_ENST00000380951.5_Missense_Mutation_p.D48N	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13409	SEA 9. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CGCTCTCTGTCCAGTCCAGGG	0.592																																					p.D13407N		Atlas-SNP	.											MUC16_ENST00000397910,NS,lymphoid_neoplasm,0,2	MUC16	4315	2	0			c.G40219A						scavenged	.																																			SO:0001583	missense	94025	exon51			CTCTGTCCAGTCC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40219G>A	19.37:g.9002597C>T	ENSP00000381008:p.Asp13407Asn	Somatic	140	13	0.0928571		WXS	Illumina HiSeq	Phase_I	118	12	0.101695	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	11.51|11.51	1.659878|1.659878	0.29515|0.29515	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000397910;ENST00000380951|ENST00000542240	T;T|.	0.45668|.	0.89;0.89|.	2.75|2.75	-0.839|-0.839	0.10759|0.10759	SEA (1);|.	.|.	.|.	.|.	.|.	T|.	0.43344|.	0.1243|.	L|L	0.52759|0.52759	1.655|1.655	.|.	.|.	.|.	B;D|.	0.60575|.	0.007;0.988|.	B;D|.	0.75020|.	0.014;0.985|.	T|.	0.51236|.	-0.8731|.	8|.	0.54805|.	T|.	0.06|.	-11.8857|-11.8857	6.8102|6.8102	0.23801|0.23801	0.0:0.8029:0.0:0.1971|0.0:0.8029:0.0:0.1971	.|.	21052;13407|.	Q8WXI7;B5ME49|.	MUC16_HUMAN;.|.	N|X	13407;48|246	ENSP00000381008:D13407N;ENSP00000370338:D48N|.	ENSP00000370338:D48N|.	D|W	-|-	1|3	0|0	MUC16|MUC16	8863597|8863597	0.045000|0.045000	0.20229|0.20229	0.003000|0.003000	0.11579|0.11579	0.000000|0.000000	0.00434|0.00434	1.258000|1.258000	0.32944|0.32944	-0.029000|-0.029000	0.13827|0.13827	-3.921000|-3.921000	0.00016|0.00016	GAC|TGG	.	.	none		0.592	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ASXL3	80816	hgsc.bcm.edu	37	18	31326209	31326209	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr18:31326209C>T	ENST00000269197.5	+	12	6397	c.6397C>T	c.(6397-6399)Cct>Tct	p.P2133S		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	2133					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GCCACAAAAGCCTTTTACCCA	0.398																																					p.P2133S		Atlas-SNP	.											.	ASXL3	405	.	0			c.C6397T						PASS	.						82.0	87.0	85.0					18																	31326209		1892	4117	6009	SO:0001583	missense	80816	exon12			CAAAAGCCTTTTA	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.6397C>T	18.37:g.31326209C>T	ENSP00000269197:p.Pro2133Ser	Somatic	164	0	0		WXS	Illumina HiSeq	Phase_I	110	7	0.0636364	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938029	0.73557	.	.	ENSG00000141431	ENST00000269197	T	0.15718	2.4	6.17	6.17	0.99709	.	.	.	.	.	T	0.23965	0.0580	N	0.24115	0.695	0.52501	D	0.999954	D	0.59767	0.986	P	0.55615	0.78	T	0.01363	-1.1374	9	0.17369	T	0.5	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	2133	Q9C0F0	ASXL3_HUMAN	S	2133	ENSP00000269197:P2133S	ENSP00000269197:P2133S	P	+	1	0	ASXL3	29580207	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.078000	0.57606	2.941000	0.99782	0.655000	0.94253	CCT	.	.	none		0.398	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
USH2A	7399	hgsc.bcm.edu	37	1	216424362	216424362	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr1:216424362G>T	ENST00000307340.3	-	12	2436	c.2050C>A	c.(2050-2052)Caa>Aaa	p.Q684K	USH2A_ENST00000366942.3_Missense_Mutation_p.Q684K|USH2A_ENST00000366943.2_Missense_Mutation_p.Q684K	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	684	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCCAACTCTTGTAGATTGTAG	0.458										HNSCC(13;0.011)																											p.Q684K		Atlas-SNP	.											.	USH2A	1168	.	0			c.C2050A						PASS	.						152.0	127.0	136.0					1																	216424362		2203	4300	6503	SO:0001583	missense	7399	exon12			ACTCTTGTAGATT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.2050C>A	1.37:g.216424362G>T	ENSP00000305941:p.Gln684Lys	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	103	7	0.0679612	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	2.472	-0.321570	0.05386	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.60548	0.18;0.18;0.18	5.26	4.34	0.51931	EGF-like, laminin (4);	0.000000	0.42172	D	0.000754	T	0.53222	0.1783	M	0.69248	2.105	0.09310	N	1	B;B	0.30146	0.061;0.27	B;B	0.34931	0.041;0.192	T	0.42565	-0.9444	10	0.18710	T	0.47	.	8.7337	0.34514	0.0764:0.0:0.7737:0.1499	.	684;684	O75445-2;O75445	.;USH2A_HUMAN	K	684	ENSP00000305941:Q684K;ENSP00000355910:Q684K;ENSP00000355909:Q684K	ENSP00000305941:Q684K	Q	-	1	0	USH2A	214490985	0.947000	0.32204	0.009000	0.14445	0.997000	0.91878	3.904000	0.56325	1.209000	0.43321	0.655000	0.94253	CAA	.	.	none		0.458	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
MAGI1	9223	hgsc.bcm.edu	37	3	65425603	65425603	+	Silent	SNP	T	T	C	rs113562374|rs62642828	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr3:65425603T>C	ENST00000497477.2	-	9	1220	c.1221A>G	c.(1219-1221)caA>caG	p.Q407Q	MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000483466.1_Silent_p.Q407Q|MAGI1_ENST00000402939.2_Silent_p.Q407Q|MAGI1_ENST00000330909.8_Silent_p.Q407Q			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	407	Poly-Gln.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		gctgctgctgttgctgctgct	0.532											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q407Q		Atlas-SNP	.											.	MAGI1	481	.	0			c.A1221G						PASS	.						77.0	69.0	72.0					3																	65425603		2202	4299	6501	SO:0001819	synonymous_variant	9223	exon9			CTGCTGTTGCTGC	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1221A>G	3.37:g.65425603T>C		Somatic	122	0	0	1084	WXS	Illumina HiSeq	Phase_I	123	6	0.0487805	NM_001033057	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Silent	SNP	ENST00000497477.2	37		.	.	.	.	.	.	.	.	.	.	C	2.459	-0.324601	0.05350	.	.	ENSG00000151276	ENST00000460329	.	.	.	3.74	-1.34	0.09143	.	.	.	.	.	T	0.30665	0.0772	.	.	.	0.28889	N	0.893947	.	.	.	.	.	.	T	0.31668	-0.9935	4	.	.	.	2.613	7.1494	0.25601	0.123:0.2818:0.0:0.5952	.	.	.	.	S	288	.	.	N	-	2	0	MAGI1	65400643	0.949000	0.32298	0.008000	0.14137	0.009000	0.06853	-0.343000	0.07791	-1.060000	0.03189	-1.632000	0.00781	AAC	T|0.742;C|0.258	0.258	strong		0.532	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742	
ZFPM2	23414	hgsc.bcm.edu	37	8	106813894	106813894	+	Silent	SNP	G	G	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr8:106813894G>T	ENST00000407775.2	+	8	1834	c.1584G>T	c.(1582-1584)ctG>ctT	p.L528L	RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000520492.1_Silent_p.L396L|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000517361.1_Silent_p.L396L|ZFPM2_ENST00000378472.4_Silent_p.L259L|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000509144.2_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	528					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			ATCGGCGACTGAGGCATGGCA	0.463																																					p.L528L		Atlas-SNP	.											ZFPM2,NS,carcinoma,+2,1	ZFPM2	219	1	0			c.G1584T						scavenged	.						91.0	93.0	93.0					8																	106813894		1940	4129	6069	SO:0001819	synonymous_variant	23414	exon8			GCGACTGAGGCAT	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1584G>T	8.37:g.106813894G>T		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	78	3	0.0384615	NM_012082	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Silent	SNP	ENST00000407775.2	37	CCDS47908.1																																																																																			.	.	none		0.463	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1		
PLCB1	23236	hgsc.bcm.edu	37	20	8352096	8352096	+	Splice_Site	SNP	A	A	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr20:8352096A>C	ENST00000338037.6	+	3	272	c.245A>C	c.(244-246)aAg>aCg	p.K82T	PLCB1_ENST00000378637.2_Splice_Site_p.K82T|PLCB1_ENST00000378641.3_Splice_Site_p.K82T	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	82					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.K82T(2)		NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						AAAGCTCCCAAGGTAGGAGGT	0.448																																					p.E82A		Atlas-SNP	.											PLCB1_ENST00000378641,caecum,carcinoma,0,2	PLCB1	394	2	2	Substitution - Missense(2)	large_intestine(2)	c.A245C						PASS	.						157.0	127.0	137.0					20																	8352096		2203	4300	6503	SO:0001630	splice_region_variant	23236	exon3			CTCCCAAGGTAGG	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.246+1A>C	20.37:g.8352096A>C		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	86	5	0.0581395	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.337731	0.81911	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000404098	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.52	5.52	0.82312	.	0.058303	0.64402	D	0.000004	T	0.75774	0.3895	M	0.88979	2.995	0.80722	D	1	B;D;D	0.63880	0.048;0.993;0.993	B;P;D	0.74023	0.034;0.849;0.982	T	0.80830	-0.1207	10	0.87932	D	0	.	13.4657	0.61251	1.0:0.0:0.0:0.0	.	82;82;81	Q9NQ66;Q9NQ66-2;B1AK73	PLCB1_HUMAN;.;.	T	82;82;82;81	ENSP00000367908:K82T;ENSP00000338185:K82T;ENSP00000367904:K82T;ENSP00000384001:K81T	ENSP00000338185:K82T	K	+	2	0	PLCB1	8300096	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.240000	0.65378	2.216000	0.71823	0.533000	0.62120	AAG	.	.	none		0.448	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		Missense_Mutation
MST1L	11223	hgsc.bcm.edu	37	1	17085795	17085795	+	RNA	SNP	G	G	T	rs1057379	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr1:17085795G>T	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.I332I(2)|p.I342I(2)									TACAACGCCGGATCTGGTAGC	0.687																																					p.I342I		Atlas-SNP	.											Q13209_HUMAN,NS,carcinoma,0,6	.	.	6	4	Substitution - coding silent(4)	kidney(2)|endometrium(2)	c.C1026A						scavenged	.																																					11223	exon8			ACGCCGGATCTGG	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085795G>T		Somatic	67	3	0.0447761		WXS	Illumina HiSeq	Phase_I	74	12	0.162162	NM_001271733	B7WPB1|Q13209	Silent	SNP	ENST00000455405.2	37																																																																																				G|0.809;T|0.191	0.191	strong		0.687	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733	
HSD17B7	51478	hgsc.bcm.edu	37	1	162769603	162769603	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr1:162769603G>A	ENST00000254521.3	+	5	573	c.518G>A	c.(517-519)aGt>aAt	p.S173N	HSD17B7_ENST00000485405.1_3'UTR|HSD17B7_ENST00000367917.3_Missense_Mutation_p.S173N	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7	173					cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)	p.S173N(4)		endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					TCATCTCGCAGTGCAAGGAAA	0.458																																					p.S173N		Atlas-SNP	.											HSD17B7,NS,carcinoma,0,5	HSD17B7	25	5	4	Substitution - Missense(4)	kidney(2)|endometrium(2)	c.G518A						scavenged	.						76.0	70.0	72.0					1																	162769603		2203	4300	6503	SO:0001583	missense	51478	exon5			CTCGCAGTGCAAG	AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.518G>A	1.37:g.162769603G>A	ENSP00000254521:p.Ser173Asn	Somatic	435	6	0.0137931		WXS	Illumina HiSeq	Phase_I	364	9	0.0247253	NM_016371	Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	Missense_Mutation	SNP	ENST00000254521.3	37	CCDS1242.1	.	.	.	.	.	.	.	.	.	.	A	0.896	-0.723912	0.03158	.	.	ENSG00000132196	ENST00000367917;ENST00000254521;ENST00000413934	T;T;T	0.76578	2.88;-1.03;2.88	4.44	3.31	0.37934	NAD(P)-binding domain (1);	0.000000	0.85682	N	0.000000	T	0.27205	0.0667	N	0.04705	-0.18	0.09310	N	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.06917	-1.0800	9	0.05833	T	0.94	-30.7352	7.9369	0.29935	0.8252:0.0:0.1748:0.0	.	173	P56937	DHB7_HUMAN	N	173;173;26	ENSP00000356894:S173N;ENSP00000254521:S173N;ENSP00000412146:S26N	ENSP00000254521:S173N	S	+	2	0	HSD17B7	161036227	1.000000	0.71417	0.991000	0.47740	0.478000	0.33099	4.183000	0.58317	0.241000	0.21283	-1.007000	0.02485	AGT	.	.	none		0.458	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083207.1	NM_016371	
OR5H1	26341	hgsc.bcm.edu	37	3	97851661	97851661	+	Missense_Mutation	SNP	G	G	T	rs200721525	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr3:97851661G>T	ENST00000354565.2	+	1	120	c.120G>T	c.(118-120)atG>atT	p.M40I	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M40I(4)		breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						TCACCATCATGGGGAATCTTG	0.413																																					p.M40I		Atlas-SNP	.											OR5H1,NS,carcinoma,0,7	OR5H1	71	7	4	Substitution - Missense(4)	endometrium(2)|kidney(2)	c.G120T						scavenged	.						46.0	50.0	48.0					3																	97851661		2173	4250	6423	SO:0001583	missense	26341	exon1			CATCATGGGGAAT	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.120G>T	3.37:g.97851661G>T	ENSP00000346575:p.Met40Ile	Somatic	559	4	0.00715563		WXS	Illumina HiSeq	Phase_I	540	7	0.012963	NM_001005338		Missense_Mutation	SNP	ENST00000354565.2	37	CCDS33797.1	.	.	.	.	.	.	.	.	.	.	G	3.467	-0.108676	0.06924	.	.	ENSG00000231192	ENST00000354565	T	0.00433	7.43	3.63	2.75	0.32379	.	0.578292	0.14348	N	0.325303	T	0.00178	0.0005	N	0.02842	-0.48	0.20764	N	0.999858	B	0.06786	0.001	B	0.04013	0.001	T	0.29882	-0.9997	10	0.33940	T	0.23	.	8.5896	0.33679	0.1182:0.0:0.8818:0.0	.	40	A6NKK0	OR5H1_HUMAN	I	40	ENSP00000346575:M40I	ENSP00000346575:M40I	M	+	3	0	OR5H1	99334351	0.002000	0.14202	0.678000	0.29963	0.118000	0.20060	-0.111000	0.10807	0.729000	0.32403	0.195000	0.17529	ATG	G|0.982;T|0.018	0.018	strong		0.413	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
PROKR1	10887	hgsc.bcm.edu	37	2	68882188	68882188	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:68882188G>A	ENST00000303786.3	+	3	1082	c.662G>A	c.(661-663)tGg>tAg	p.W221*	PROKR1_ENST00000394342.2_Nonsense_Mutation_p.W221*			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	221					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						GGCCAGATCTGGCCTGTGGAC	0.552																																					p.W221X		Atlas-SNP	.											.	PROKR1	69	.	0			c.G662A						PASS	.						152.0	140.0	144.0					2																	68882188		2203	4300	6503	SO:0001587	stop_gained	10887	exon2			AGATCTGGCCTGT	AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.662G>A	2.37:g.68882188G>A	ENSP00000303775:p.Trp221*	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	88	6	0.0681818	NM_138964	A5JUU2|Q53QT9|Q8NFJ7	Nonsense_Mutation	SNP	ENST00000303786.3	37	CCDS1889.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765035	0.90020	.	.	ENSG00000169618	ENST00000303786;ENST00000394342	.	.	.	4.55	4.55	0.56014	.	0.050126	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6333	0.76929	0.0:0.0:1.0:0.0	.	.	.	.	X	221	.	ENSP00000303775:W221X	W	+	2	0	PROKR1	68735692	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.297000	0.96120	2.816000	0.96949	0.563000	0.77884	TGG	.	.	none		0.552	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251760.2		
APEH	327	hgsc.bcm.edu	37	3	49723881	49723881	+	IGR	SNP	G	G	C	rs6777426	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr3:49723881G>C	ENST00000296456.5	+	0	3220				AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000449682.2_Missense_Mutation_p.T294S|MST1_ENST00000494828.2_5'Flank|MST1_ENST00000383728.3_Missense_Mutation_p.T219S|MST1_ENST00000545762.1_3'UTR	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.T280S(1)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCAGCTGACAGTTGTGGCCTC	0.652																																					p.T294S		Atlas-SNP	.											MST1,extremity,malignant_melanoma,0,1	MST1	84	1	1	Substitution - Missense(1)	skin(1)	c.C881G						scavenged	.						33.0	36.0	35.0					3																	49723881		2201	4298	6499	SO:0001628	intergenic_variant	4485	exon8			CTGACAGTTGTGG	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723881G>C		Somatic	80	1	0.0125		WXS	Illumina HiSeq	Phase_I	92	5	0.0543478	NM_020998	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.417297	0.83449	.	.	ENSG00000173531	ENST00000449682;ENST00000383728	D;T	0.87887	-2.31;-0.48	5.67	4.75	0.60458	Kringle (1);	0.339887	0.21177	N	0.078900	T	0.81545	0.4845	L	0.33137	0.985	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.77723	-0.2481	10	0.54805	T	0.06	.	14.5452	0.68024	0.0:0.0:0.8533:0.1467	rs6777426	280;294	P26927;G3XAK1	HGFL_HUMAN;.	S	294;219	ENSP00000414287:T294S;ENSP00000373234:T219S	ENSP00000373234:T219S	T	-	2	0	MST1	49698885	1.000000	0.71417	0.025000	0.17156	0.854000	0.48673	6.531000	0.73820	2.673000	0.90976	0.655000	0.94253	ACT	G|0.986;C|0.014	0.014	strong		0.652	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
CS	1431	hgsc.bcm.edu	37	12	56676232	56676232	+	Missense_Mutation	SNP	T	T	C	rs77708038		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr12:56676232T>C	ENST00000351328.3	-	6	750	c.560A>G	c.(559-561)cAg>cGg	p.Q187R	CS_ENST00000548567.1_Missense_Mutation_p.Q121R|CS_ENST00000542324.2_Missense_Mutation_p.Q174R	NM_004077.2	NP_004068.2	O75390	CISY_HUMAN	citrate synthase	187				Q -> R (in Ref. 1; AAC25560). {ECO:0000305}.	carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	citrate (Si)-synthase activity (GO:0004108)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	17		Myeloproliferative disorder(1001;0.000374)		BRCA - Breast invasive adenocarcinoma(357;6.17e-07)		GCTGATACCCTGTGCATATGC	0.502																																					p.Q187R		Atlas-SNP	.											CS,NS,adenoma,0,1	CS	44	1	0			c.A560G						scavenged	.						101.0	76.0	85.0					12																	56676232		2203	4300	6503	SO:0001583	missense	1431	exon6			ATACCCTGTGCAT		CCDS8913.1	12q13.2	2012-10-02				ENSG00000062485	2.3.3.1		2422	protein-coding gene	gene with protein product		118950					Standard	NM_004077		Approved		uc001sks.1	O75390	OTTHUMG00000170344	ENST00000351328.3:c.560A>G	12.37:g.56676232T>C	ENSP00000342056:p.Gln187Arg	Somatic	188	1	0.00531915		WXS	Illumina HiSeq	Phase_I	182	11	0.0604396	NM_004077	Q71UT9|Q7KZH0|Q96FZ8|Q9BWN8	Missense_Mutation	SNP	ENST00000351328.3	37	CCDS8913.1	.	.	.	.	.	.	.	.	.	.	T	16.44	3.123447	0.56613	.	.	ENSG00000062485	ENST00000548567;ENST00000351328;ENST00000542324;ENST00000549221;ENST00000546930;ENST00000551936;ENST00000550734;ENST00000551253;ENST00000552688;ENST00000546554	.	.	.	4.79	4.79	0.61399	Citrate synthase-like, large alpha subdomain (1);Citrate synthase-like, core (1);	0.098661	0.64402	D	0.000002	T	0.35158	0.0922	N	0.25245	0.725	0.28067	N	0.932723	B;B;B;B	0.09022	0.002;0.0;0.001;0.001	B;B;B;B	0.12837	0.008;0.003;0.005;0.003	T	0.25984	-1.0116	9	0.42905	T	0.14	-9.4858	14.0038	0.64449	0.0:0.0:0.0:1.0	.	121;174;142;187	B7Z1E1;B4DJV2;B3KTN4;O75390	.;.;.;CISY_HUMAN	R	121;187;174;112;121;121;121;121;151;137	.	ENSP00000342056:Q187R	Q	-	2	0	CS	54962499	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.602000	0.82796	2.094000	0.63399	0.528000	0.53228	CAG	T|0.994;C|0.006	0.006	weak		0.502	CS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408588.2	NM_004077	
KAT2B	8850	hgsc.bcm.edu	37	3	20178459	20178459	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr3:20178459A>G	ENST00000263754.4	+	12	2230	c.1775A>G	c.(1774-1776)cAt>cGt	p.H592R	MIR3135A_ENST00000578460.1_RNA	NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	592	N-acetyltransferase. {ECO:0000250|UniProtKB:Q92830, ECO:0000255|PROSITE-ProRule:PRU00532}.				cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						CTGATGAATCATTTGAAAGAA	0.353																																					p.H592R		Atlas-SNP	.											KAT2B,trunk,malignant_melanoma,+1,1	KAT2B	73	1	0			c.A1775G						PASS	.						129.0	112.0	118.0					3																	20178459		2203	4300	6503	SO:0001583	missense	8850	exon12			TGAATCATTTGAA	U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.1775A>G	3.37:g.20178459A>G	ENSP00000263754:p.His592Arg	Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	100	7	0.07	NM_003884	Q6NSK1	Missense_Mutation	SNP	ENST00000263754.4	37	CCDS2634.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.709027	0.89018	.	.	ENSG00000114166	ENST00000263754	T	0.24908	1.83	5.66	5.66	0.87406	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.55194	0.1905	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.61657	-0.7018	10	0.87932	D	0	-21.8842	16.2026	0.82095	1.0:0.0:0.0:0.0	.	592	Q92831	KAT2B_HUMAN	R	592	ENSP00000263754:H592R	ENSP00000263754:H592R	H	+	2	0	KAT2B	20153463	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.287000	0.95975	2.285000	0.76669	0.533000	0.62120	CAT	.	.	none		0.353	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252880.1	NM_003884	
TET1	80312	hgsc.bcm.edu	37	10	70405864	70405864	+	Silent	SNP	A	A	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr10:70405864A>G	ENST00000373644.4	+	4	3587	c.3378A>G	c.(3376-3378)aaA>aaG	p.K1126K		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1126					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						TACAACAGAAACCACCTTCAA	0.388																																					p.K1126K		Atlas-SNP	.											.	TET1	255	.	0			c.A3378G						PASS	.						89.0	77.0	81.0					10																	70405864		2203	4300	6503	SO:0001819	synonymous_variant	80312	exon4			ACAGAAACCACCT	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.3378A>G	10.37:g.70405864A>G		Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	121	14	0.115702	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Silent	SNP	ENST00000373644.4	37	CCDS7281.1																																																																																			.	.	none		0.388	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
COPS3	8533	hgsc.bcm.edu	37	17	17163724	17163724	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr17:17163724C>T	ENST00000268717.5	-	8	933	c.827G>A	c.(826-828)cGa>cAa	p.R276Q	COPS3_ENST00000539941.2_Missense_Mutation_p.R256Q|COPS3_ENST00000439936.2_Intron	NM_003653.3	NP_003644.2	Q9UNS2	CSN3_HUMAN	COP9 signalosome subunit 3	276	PCI.				cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				NS(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						CACCAGGTTTCGGAGTTCTGA	0.418																																					p.R276Q		Atlas-SNP	.											.	COPS3	41	.	0			c.G827A						PASS	.						223.0	186.0	198.0					17																	17163724		2203	4300	6503	SO:0001583	missense	8533	exon8			AGGTTTCGGAGTT	AF031647	CCDS11183.1, CCDS56022.1	17p11.2	2013-03-14	2013-03-14		ENSG00000141030	ENSG00000141030			2239	protein-coding gene	gene with protein product		604665	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 3"", ""COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)"""			9535219, 10191102	Standard	NM_003653		Approved	SGN3, CSN3	uc002grd.3	Q9UNS2	OTTHUMG00000059281	ENST00000268717.5:c.827G>A	17.37:g.17163724C>T	ENSP00000268717:p.Arg276Gln	Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	173	19	0.109827	NM_003653	B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	ENST00000268717.5	37	CCDS11183.1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.527788	0.64860	.	.	ENSG00000141030	ENST00000268717;ENST00000539941;ENST00000417352	T;T	0.29917	1.55;1.55	5.47	4.5	0.54988	Proteasome component (PCI) domain (1);	0.000000	0.85682	D	0.000000	T	0.22589	0.0545	L	0.35723	1.085	0.80722	D	1	B	0.27853	0.191	B	0.26416	0.069	T	0.03212	-1.1060	10	0.10377	T	0.69	-10.3403	13.1739	0.59615	0.0:0.9235:0.0:0.0765	.	276	Q9UNS2	CSN3_HUMAN	Q	276;256;307	ENSP00000268717:R276Q;ENSP00000437606:R256Q	ENSP00000268717:R276Q	R	-	2	0	COPS3	17104449	1.000000	0.71417	0.994000	0.49952	0.987000	0.75469	7.481000	0.81124	1.306000	0.44926	0.655000	0.94253	CGA	.	.	none		0.418	COPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131603.2		
TECPR2	9895	hgsc.bcm.edu	37	14	102894692	102894692	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr14:102894692A>G	ENST00000359520.7	+	7	1283	c.1057A>G	c.(1057-1059)Agc>Ggc	p.S353G	TECPR2_ENST00000558678.1_Missense_Mutation_p.S353G	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	353					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						AAGAATTTCAAGCAGGCCTGA	0.338																																					p.S353G		Atlas-SNP	.											.	TECPR2	114	.	0			c.A1057G						PASS	.						69.0	75.0	73.0					14																	102894692		2203	4300	6503	SO:0001583	missense	9895	exon7			ATTTCAAGCAGGC	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.1057A>G	14.37:g.102894692A>G	ENSP00000352510:p.Ser353Gly	Somatic	305	0	0		WXS	Illumina HiSeq	Phase_I	297	14	0.047138	NM_001172631	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	ENST00000359520.7	37	CCDS32162.1	.	.	.	.	.	.	.	.	.	.	a	19.19	3.779964	0.70222	.	.	ENSG00000196663	ENST00000359520;ENST00000380088	T	0.15487	2.42	5.31	5.31	0.75309	.	0.087074	0.85682	D	0.000000	T	0.22475	0.0542	L	0.51422	1.61	0.38609	D	0.950842	P;P	0.49447	0.86;0.924	B;P	0.45167	0.243;0.472	T	0.03933	-1.0991	10	0.56958	D	0.05	.	15.3084	0.74011	1.0:0.0:0.0:0.0	.	353;353	A5PKY3;O15040	.;TCPR2_HUMAN	G	353	ENSP00000352510:S353G	ENSP00000352510:S353G	S	+	1	0	TECPR2	101964445	1.000000	0.71417	0.940000	0.37924	0.997000	0.91878	8.560000	0.90712	2.029000	0.59856	0.472000	0.43445	AGC	.	.	none		0.338	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844	
MUC4	4585	hgsc.bcm.edu	37	3	195509429	195509429	+	Missense_Mutation	SNP	A	A	G	rs28542401	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr3:195509429A>G	ENST00000463781.3	-	2	9481	c.9022T>C	c.(9022-9024)Tct>Cct	p.S3008P	MUC4_ENST00000475231.1_Missense_Mutation_p.S3008P|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGAGGTGGCGTGA	0.592																																					p.S3008P		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	0			c.T9022C						scavenged	.						16.0	13.0	14.0					3																	195509429		653	1561	2214	SO:0001583	missense	4585	exon2			GAAGAGAGGTGGC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9022T>C	3.37:g.195509429A>G	ENSP00000417498:p.Ser3008Pro	Somatic	85	2	0.0235294		WXS	Illumina HiSeq	Phase_I	77	6	0.0779221	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	1217	0.5572344322344323	303	0.6158536585365854	180	0.4972375690607735	360	0.6293706293706294	374	0.49340369393139843	N	1.745	-0.490680	0.04322	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.37;1.43	.	.	.	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.46028	P	0.0011740000000000084	B	0.14438	0.01	B	0.15870	0.014	T	0.41466	-0.9507	6	.	.	.	.	3.1064	0.06344	0.6149:0.0:0.0:0.385	rs28542401;rs57320341	2880	E7ESK3	.	P	3008	ENSP00000417498:S3008P;ENSP00000420243:S3008P	.	S	-	1	0	MUC4	196994208	0.018000	0.18449	0.195000	0.23364	0.000000	0.00434	-2.448000	0.01009	0.402000	0.25451	0.000000	0.15137	TCT	A|0.389;C|0.096;G|0.515	0.515	strong		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ZNF407	55628	hgsc.bcm.edu	37	18	72347482	72347482	+	Silent	SNP	T	T	C	rs12327359	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr18:72347482T>C	ENST00000299687.5	+	1	4507	c.4507T>C	c.(4507-4509)Tta>Cta	p.L1503L	ZNF407_ENST00000309902.6_Silent_p.L1503L|ZNF407_ENST00000582337.1_Silent_p.L1503L|ZNF407_ENST00000577538.1_Silent_p.L1503L	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1503					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.L1503L(1)		central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GAATTTATTTTTACATATTAA	0.473													C|||	2123	0.423922	0.7201	0.3271	5008	,	,		19354	0.1845		0.4175	False		,,,				2504	0.3456				p.L1503L		Atlas-SNP	.											ZNF407,NS,carcinoma,0,1	ZNF407	231	1	1	Substitution - coding silent(1)	prostate(1)	c.T4507C						PASS	.	C	,,	2571,1165		885,801,182	41.0	43.0	43.0		4507,4507,4507	4.8	0.9	18	dbSNP_120	43	3538,4686		754,2030,1328	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF407	NM_001146189.1,NM_001146190.1,NM_017757.2	,,	1639,2831,1510	CC,CT,TT		43.0204,31.1831,48.9214	,,	1503/1816,1503/1661,1503/2249	72347482	6109,5851	1868	4112	5980	SO:0001819	synonymous_variant	55628	exon1			TTATTTTTACATA	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.4507T>C	18.37:g.72347482T>C		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	95	5	0.0526316	NM_001146190	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Silent	SNP	ENST00000299687.5	37	CCDS45885.1																																																																																			T|0.567;C|0.433	0.433	strong		0.473	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757	
ATG4A	115201	hgsc.bcm.edu	37	X	107396261	107396261	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:107396261C>T	ENST00000372232.3	+	12	1229	c.1070C>T	c.(1069-1071)tCa>tTa	p.S357L	ATG4A_ENST00000372254.3_Missense_Mutation_p.S333L|ATG4A_ENST00000489247.1_3'UTR|ATG4A_ENST00000545696.1_Missense_Mutation_p.S218L|COL4A6_ENST00000418180.1_Intron|ATG4A_ENST00000345734.3_Missense_Mutation_p.S295L	NM_052936.3	NP_443168.2	Q8WYN0	ATG4A_HUMAN	autophagy related 4A, cysteine peptidase	357					autophagy (GO:0006914)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)			endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)	11						AAACATCCATCACACTGGCCT	0.428																																					p.S357L		Atlas-SNP	.											.	ATG4A	68	.	0			c.C1070T						PASS	.						72.0	58.0	63.0					X																	107396261		2203	4300	6503	SO:0001583	missense	115201	exon12			ATCCATCACACTG	AJ320508	CCDS14538.1, CCDS14539.1	Xq22.1-q22.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000101844	ENSG00000101844			16489	protein-coding gene	gene with protein product		300663	"""AUT-like 2, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog A (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog A (S. cerevisiae)"""	AUTL2, APG4A		12446702, 12473658	Standard	NM_052936		Approved		uc004enr.3	Q8WYN0	OTTHUMG00000022176	ENST00000372232.3:c.1070C>T	X.37:g.107396261C>T	ENSP00000361306:p.Ser357Leu	Somatic	565	0	0		WXS	Illumina HiSeq	Phase_I	469	33	0.0703625	NM_052936	A6NCH2|B2RAZ7|D3DUY0|O95534|Q5JYY9|Q5JYZ0|Q86VE5|Q96KQ0|Q96KQ1	Missense_Mutation	SNP	ENST00000372232.3	37	CCDS14538.1	.	.	.	.	.	.	.	.	.	.	C	17.18	3.323638	0.60634	.	.	ENSG00000101844	ENST00000372232;ENST00000345734;ENST00000372254;ENST00000545696	T;T;T;T	0.46819	0.86;0.88;0.87;0.89	5.88	5.88	0.94601	.	0.358447	0.29080	N	0.013207	T	0.42517	0.1206	L	0.41824	1.3	0.80722	D	1	B;B;B	0.25169	0.119;0.001;0.002	B;B;B	0.19666	0.026;0.002;0.002	T	0.17776	-1.0358	10	0.25751	T	0.34	-2.0371	19.2176	0.93783	0.0:1.0:0.0:0.0	.	218;295;357	F5H3G3;Q8WYN0-2;Q8WYN0	.;.;ATG4A_HUMAN	L	357;295;333;218	ENSP00000361306:S357L;ENSP00000298131:S295L;ENSP00000361328:S333L;ENSP00000438936:S218L	ENSP00000298131:S295L	S	+	2	0	ATG4A	107282917	0.998000	0.40836	0.986000	0.45419	0.985000	0.73830	6.135000	0.71696	2.489000	0.83994	0.600000	0.82982	TCA	.	.	none		0.428	ATG4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057860.1	NM_052936	
HLA-A	3105	hgsc.bcm.edu	37	6	29910335	29910335	+	Missense_Mutation	SNP	C	C	T	rs200058378		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr6:29910335C>T	ENST00000396634.1	+	3	346	c.5C>T	c.(4-6)gCc>gTc	p.A2V	HLA-A_ENST00000376809.5_Missense_Mutation_p.A2V|HLA-A_ENST00000376802.2_Missense_Mutation_p.A2V|HLA-A_ENST00000376806.5_Missense_Mutation_p.A2V			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	2					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CCGAGGATGGCCGTCATGGCG	0.672									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.A2V		Atlas-SNP	.											HLA-A,NS,carcinoma,-1,1	HLA-A	89	1	0			c.C5T						scavenged	.						36.0	38.0	37.0					6																	29910335		2201	4296	6497	SO:0001583	missense	3105	exon1	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	GGATGGCCGTCAT	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.5C>T	6.37:g.29910335C>T	ENSP00000379873:p.Ala2Val	Somatic	89	1	0.011236		WXS	Illumina HiSeq	Phase_I	67	5	0.0746269	NM_001242758	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	8.183	0.794292	0.16327	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00662	5.94;5.93;5.94;5.94	2.6	-4.04	0.04010	.	.	.	.	.	T	0.00552	0.0018	L	0.27053	0.805	0.09310	N	1	D;B;D;B	0.76494	0.999;0.003;0.997;0.001	D;B;D;B	0.75484	0.986;0.014;0.986;0.014	T	0.50065	-0.8871	9	0.56958	D	0.05	.	4.6272	0.12484	0.4071:0.1733:0.4196:0.0	.	2;2;2;2	Q5SRN7;P16188;Q5SRN5;P04439	.;1A30_HUMAN;.;1A03_HUMAN	V	2	ENSP00000379873:A2V;ENSP00000366002:A2V;ENSP00000366005:A2V;ENSP00000365998:A2V	ENSP00000348012:A2V	A	+	2	0	HLA-A	30018314	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.890000	0.01613	-0.952000	0.03649	-0.531000	0.04308	GCC	C|0.999;T|0.001	0.001	weak		0.672	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
MUC5B	727897	hgsc.bcm.edu	37	11	1258241	1258241	+	Silent	SNP	A	A	G	rs79773885		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr11:1258241A>G	ENST00000529681.1	+	25	3202	c.3144A>G	c.(3142-3144)gcA>gcG	p.A1048A	MUC5B_ENST00000447027.1_Silent_p.A1051A	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1048	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TGGGGGACGCACTGGAGTTTG	0.672																																					p.A1048A		Atlas-SNP	.											MUC5B,NS,carcinoma,+2,2	MUC5B	473	2	0			c.A3144G						scavenged	.						39.0	55.0	50.0					11																	1258241		2117	4226	6343	SO:0001819	synonymous_variant	727897	exon25			GGACGCACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3144A>G	11.37:g.1258241A>G		Somatic	43	5	0.116279		WXS	Illumina HiSeq	Phase_I	38	5	0.131579	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			A|0.500;G|0.500	0.500	weak		0.672	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
ZNF217	7764	hgsc.bcm.edu	37	20	52193210	52193210	+	Missense_Mutation	SNP	G	G	A	rs369074794		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr20:52193210G>A	ENST00000371471.2	-	4	2518	c.2093C>T	c.(2092-2094)cCg>cTg	p.P698L	ZNF217_ENST00000302342.3_Missense_Mutation_p.P698L|RP4-724E16.2_ENST00000424252.1_RNA			O75362	ZN217_HUMAN	zinc finger protein 217	698					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.P698Q(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			AGAAATTGCCGGGCAATTGTG	0.428																																					p.P698L		Atlas-SNP	.											.	ZNF217	227	.	2	Substitution - Missense(2)	lung(2)	c.C2093T						PASS	.	G	LEU/PRO	0,4406		0,0,2203	74.0	83.0	80.0		2093	4.2	0.0	20		80	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF217	NM_006526.2	98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	698/1049	52193210	1,13005	2203	4300	6503	SO:0001583	missense	7764	exon3			ATTGCCGGGCAAT	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.2093C>T	20.37:g.52193210G>A	ENSP00000360526:p.Pro698Leu	Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	160	18	0.1125	NM_006526	E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	37	CCDS13443.1	.	.	.	.	.	.	.	.	.	.	G	10.50	1.366604	0.24771	0.0	1.16E-4	ENSG00000171940	ENST00000371471;ENST00000302342	T;T	0.08984	3.03;3.03	5.18	4.22	0.49857	.	0.790776	0.11324	N	0.575710	T	0.06735	0.0172	L	0.34521	1.04	0.20196	N	0.999922	B	0.18166	0.026	B	0.08055	0.003	T	0.34378	-0.9831	10	0.10636	T	0.68	-6.4731	10.3081	0.43693	0.1521:0.0:0.8479:0.0	.	698	O75362	ZN217_HUMAN	L	698	ENSP00000360526:P698L;ENSP00000304308:P698L	ENSP00000304308:P698L	P	-	2	0	ZNF217	51626617	0.963000	0.33076	0.029000	0.17559	0.089000	0.18198	3.870000	0.56070	2.411000	0.81874	0.555000	0.69702	CCG	.	.	weak		0.428	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526	
FOXN3	1112	hgsc.bcm.edu	37	14	89628930	89628930	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr14:89628930G>T	ENST00000345097.4	-	7	1417	c.1301C>A	c.(1300-1302)aCa>aAa	p.T434K	FOXN3_ENST00000555353.1_Missense_Mutation_p.T412K|FOXN3_ENST00000261302.5_Missense_Mutation_p.T434K|FOXN3_ENST00000557258.1_Missense_Mutation_p.T412K	NM_001085471.1	NP_001078940.1	O00409	FOXN3_HUMAN	forkhead box N3	434					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T412I(1)		endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GAGGGGCAGTGTGTCGCTGGG	0.612																																					p.T434K		Atlas-SNP	.											FOXN3,NS,carcinoma,0,1	FOXN3	78	1	1	Substitution - Missense(1)	ovary(1)	c.C1301A						scavenged	.						94.0	86.0	89.0					14																	89628930		2203	4300	6503	SO:0001583	missense	1112	exon7			GGCAGTGTGTCGC		CCDS32138.1, CCDS41977.1	14q32.11	2012-04-17	2007-05-02	2007-05-02	ENSG00000053254	ENSG00000053254		"""Forkhead boxes"""	1928	protein-coding gene	gene with protein product		602628	"""chromosome 14 open reading frame 116"", ""checkpoint suppressor 1"""	C14orf116, CHES1		9154802	Standard	NM_005197		Approved		uc001xxo.4	O00409	OTTHUMG00000170898	ENST00000345097.4:c.1301C>A	14.37:g.89628930G>T	ENSP00000343288:p.Thr434Lys	Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	151	5	0.0331126	NM_001085471	Q96II7|Q9UIE7	Missense_Mutation	SNP	ENST00000345097.4	37	CCDS41977.1	.	.	.	.	.	.	.	.	.	.	G	9.922	1.212523	0.22289	.	.	ENSG00000053254	ENST00000345097;ENST00000261302;ENST00000557258;ENST00000555353	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	5.95	5.95	0.96441	.	0.114128	0.64402	D	0.000017	T	0.57695	0.2071	L	0.40543	1.245	0.58432	D	0.999998	P;P	0.40515	0.561;0.719	B;B	0.44085	0.079;0.44	T	0.53078	-0.8489	10	0.02654	T	1	.	19.9882	0.97356	0.0:0.0:1.0:0.0	.	434;412	O00409;O00409-2	FOXN3_HUMAN;.	K	434;434;412;412	ENSP00000343288:T434K;ENSP00000261302:T434K;ENSP00000452005:T412K;ENSP00000452227:T412K	ENSP00000261302:T434K	T	-	2	0	FOXN3	88698683	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.816000	0.99350	2.824000	0.97209	0.655000	0.94253	ACA	.	.	none		0.612	FOXN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410902.2	NM_005197	
TRIM48	79097	hgsc.bcm.edu	37	11	55032609	55032609	+	Missense_Mutation	SNP	C	C	T	rs146290222	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr11:55032609C>T	ENST00000417545.2	+	2	364	c.278C>T	c.(277-279)gCc>gTc	p.A93V		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	77						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						GCTTCCCTTGCCAGAAAAGCC	0.448													c|||	2	0.000399361	0.0	0.0014	5008	,	,		17310	0.0		0.001	False		,,,				2504	0.0				p.A93V		Atlas-SNP	.											TRIM48_ENST00000417545,NS,carcinoma,0,2	TRIM48	149	2	0			c.C278T						scavenged	.	C	VAL/ALA	1,4377	2.1+/-5.4	0,1,2188	117.0	113.0	114.0		278	0.6	0.2	11	dbSNP_134	114	25,8489	17.9+/-57.8	3,19,4235	no	missense	TRIM48	NM_024114.3	64	3,20,6423	TT,TC,CC		0.2936,0.0228,0.2017	benign	93/225	55032609	26,12866	2189	4257	6446	SO:0001583	missense	79097	exon2			CCCTTGCCAGAAA	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.278C>T	11.37:g.55032609C>T	ENSP00000402414:p.Ala93Val	Somatic	613	2	0.00326264		WXS	Illumina HiSeq	Phase_I	467	5	0.0107066	NM_024114	Q9BUW4	Missense_Mutation	SNP	ENST00000417545.2	37	CCDS7947.2	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	c	14.30	2.494114	0.44352	2.28E-4	0.002936	ENSG00000150244	ENST00000417545	D	0.83335	-1.71	0.596	0.596	0.17496	Zinc finger, RING/FYVE/PHD-type (1);	.	.	.	.	T	0.71762	0.3378	L	0.33137	0.985	0.19575	N	0.999961	B	0.27656	0.184	B	0.27608	0.081	T	0.59941	-0.7359	9	0.38643	T	0.18	.	7.1377	0.25537	0.0:0.9999:0.0:1.0E-4	.	77	Q8IWZ4	TRI48_HUMAN	V	93	ENSP00000402414:A93V	ENSP00000402414:A93V	A	+	2	0	TRIM48	54789185	0.000000	0.05858	0.165000	0.22776	0.335000	0.28730	-0.841000	0.04359	0.629000	0.30376	0.413000	0.27773	GCC	C|0.997;T|0.003	0.003	strong		0.448	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1		
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240796	39240796	+	Missense_Mutation	SNP	G	G	C	rs553572799|rs199957151	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr17:39240796G>C	ENST00000391417.4	+	1	338	c.338G>C	c.(337-339)aGc>aCc	p.S113T		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	138	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.R111_C115delRPSCC(1)|p.?(1)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						tgccgccccagctgctgccgc	0.667																																					p.S113T		Atlas-SNP	.											KRTAP4-7,NS,carcinoma,+1,1	KRTAP4-7	49	1	2	Unknown(1)|Deletion - In frame(1)	NS(2)	c.G338C						scavenged	.																																			SO:0001583	missense	100132476	exon1			GCCCCAGCTGCTG	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.338G>C	17.37:g.39240796G>C	ENSP00000375236:p.Ser113Thr	Somatic	11	0	0		WXS	Illumina HiSeq	Phase_I	33	4	0.121212	NM_033061	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	0.047	-1.263726	0.01433	.	.	ENSG00000240871	ENST00000391417	T	0.00627	6.12	2.73	1.66	0.24008	.	2.038930	0.02697	N	0.111300	T	0.00552	0.0018	.	.	.	0.21290	N	0.999731	B	0.13145	0.007	B	0.12837	0.008	T	0.47222	-0.9134	9	0.17832	T	0.49	.	5.1702	0.15107	0.0:0.2319:0.5315:0.2367	.	168	Q9BYR0	KRA47_HUMAN	T	113	ENSP00000375236:S113T	ENSP00000375236:S113T	S	+	2	0	KRTAP4-7	36494322	0.010000	0.17322	0.067000	0.19924	0.024000	0.10985	-0.517000	0.06275	0.191000	0.20236	0.289000	0.19496	AGC	.	.	weak		0.667	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
PCDHB7	56129	hgsc.bcm.edu	37	5	140552992	140552992	+	Silent	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr5:140552992C>T	ENST00000231137.3	+	1	750	c.576C>T	c.(574-576)ccC>ccT	p.P192P		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	192	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATATCTATCCCGAATTGGTGC	0.493																																					p.P192P		Atlas-SNP	.											PCDHB7,bladder,carcinoma,0,1	PCDHB7	231	1	0			c.C576T						scavenged	.						69.0	66.0	67.0					5																	140552992		2203	4300	6503	SO:0001819	synonymous_variant	56129	exon1			CTATCCCGAATTG	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.576C>T	5.37:g.140552992C>T		Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	121	4	0.0330578	NM_018940	A1L3Y8	Silent	SNP	ENST00000231137.3	37	CCDS4249.1																																																																																			.	.	none		0.493	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
ANKRD30B	374860	hgsc.bcm.edu	37	18	14797834	14797834	+	Silent	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr18:14797834C>T	ENST00000358984.4	+	20	2190	c.2010C>T	c.(2008-2010)gaC>gaT	p.D670D	ANKRD30B_ENST00000579292.1_3'UTR	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	670										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						AATTAAAGGACAGAGAAACAC	0.308																																					p.D670D		Atlas-SNP	.											.	ANKRD30B	237	.	0			c.C2010T						PASS	.						60.0	47.0	51.0					18																	14797834		692	1587	2279	SO:0001819	synonymous_variant	374860	exon20			AAAGGACAGAGAA	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.2010C>T	18.37:g.14797834C>T		Somatic	281	0	0		WXS	Illumina HiSeq	Phase_I	258	19	0.0736434	NM_001145029	B4DGP1|F8WAG3|Q4G175	Silent	SNP	ENST00000358984.4	37	CCDS54182.1																																																																																			.	.	none		0.308	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
GRIN3A	116443	hgsc.bcm.edu	37	9	104356771	104356771	+	Intron	SNP	C	C	T	rs140969417		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr9:104356771C>T	ENST00000361820.3	-	7	3367				PPP3R2_ENST00000374806.1_Missense_Mutation_p.D148N	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A						calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.D148N(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	ATCTTCCCATCGCCATCCTTG	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		19615	0.0		0.001	False		,,,				2504	0.0				p.D148N		Atlas-SNP	.											PPP3R2,caecum,carcinoma,+2,2	PPP3R2	38	2	1	Substitution - Missense(1)	skin(1)	c.G442A						scavenged	.						127.0	108.0	114.0					9																	104356771		2203	4300	6503	SO:0001627	intron_variant	5535	exon1			TCCCATCGCCATC		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2767-15129G>A	9.37:g.104356771C>T		Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	126	4	0.031746	NM_147180	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	26.6	4.751382	0.89753	.	.	ENSG00000188386	ENST00000374806	T	0.79352	-1.26	4.15	4.15	0.48705	EF-hand-like domain (1);	0.000000	0.43579	D	0.000545	D	0.85687	0.5754	M	0.64997	1.995	0.46260	D	0.998958	D	0.89917	1.0	D	0.85130	0.997	D	0.87008	0.2121	10	0.87932	D	0	-22.173	14.7505	0.69522	0.0:1.0:0.0:0.0	.	145	Q96LZ3	CANB2_HUMAN	N	148	ENSP00000363939:D148N	ENSP00000363939:D148N	D	-	1	0	PPP3R2	103396592	1.000000	0.71417	0.044000	0.18714	0.925000	0.55904	7.410000	0.80065	2.610000	0.88304	0.563000	0.77884	GAT	C|1.000;T|0.000	0.000	strong		0.517	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
GALNS	2588	hgsc.bcm.edu	37	16	88901673	88901673	+	Silent	SNP	G	G	A	rs35232749	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr16:88901673G>A	ENST00000268695.5	-	8	934	c.846C>T	c.(844-846)ttC>ttT	p.F282F	GALNS_ENST00000542788.1_Silent_p.F207F	NM_000512.4	NP_000503.1	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfatase	282	Catalytic domain.		Missing (in MPS4A; mild form).		carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)|N-acetylgalactosamine-6-sulfatase activity (GO:0043890)|sulfuric ester hydrolase activity (GO:0008484)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(8)	22				BRCA - Breast invasive adenocarcinoma(80;0.0496)		TGAAGAAGACGAAGGTGTTGT	0.592													G|||	225	0.0449281	0.0242	0.072	5008	,	,		17284	0.0228		0.0358	False		,,,				2504	0.0859				p.F282F	GBM(129;1929 2344 25209 33204)	Atlas-SNP	.											.	GALNS	37	.	0			c.C846T						PASS	.	G		153,4241	103.8+/-142.4	0,153,2044	145.0	103.0	117.0		846	-7.7	0.1	16	dbSNP_126	117	316,8284	111.4+/-171.7	3,310,3987	no	coding-synonymous	GALNS	NM_000512.4		3,463,6031	AA,AG,GG		3.6744,3.482,3.6094		282/523	88901673	469,12525	2197	4300	6497	SO:0001819	synonymous_variant	2588	exon8			GAAGACGAAGGTG	D17629	CCDS10970.1	16q24.3	2014-07-03	2014-07-03		ENSG00000141012	ENSG00000141012	3.1.6.4	"""Arylsulfatase family"""	4122	protein-coding gene	gene with protein product	"""Morquio syndrome"", ""mucopolysaccharidosis type IVA"""	612222	"""galactosamine (N-acetyl)-6-sulfate sulfatase"""			1755850	Standard	NM_000512		Approved	GAS, GALNAC6S	uc002fly.4	P34059	OTTHUMG00000137862	ENST00000268695.5:c.846C>T	16.37:g.88901673G>A		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	60	5	0.0833333	NM_000512	Q86VK3	Silent	SNP	ENST00000268695.5	37	CCDS10970.1																																																																																			G|0.965;A|0.035	0.035	strong		0.592	GALNS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269543.1		
FANK1	92565	hgsc.bcm.edu	37	10	127585212	127585212	+	Start_Codon_SNP	SNP	A	A	T	rs145156460		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr10:127585212A>T	ENST00000368693.1	+	1	105	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	FANK1_ENST00000449042.2_De_novo_Start_InFrame|FANK1_ENST00000368695.1_De_novo_Start_InFrame			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	1						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.M1L(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				GCAGCCGACCATGGAGCCCCA	0.761																																					p.M1L		Atlas-SNP	.											FANK1,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,2	FANK1	46	2	1	Substitution - Missense(1)	central_nervous_system(1)	c.A1T						scavenged	.						9.0	12.0	11.0					10																	127585212		2172	4263	6435	SO:0001582	initiator_codon_variant	92565	exon1			CCGACCATGGAGC	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.1A>T	10.37:g.127585212A>T	ENSP00000357682:p.Met1Leu	Somatic	73	2	0.0273973		WXS	Illumina HiSeq	Phase_I	72	3	0.0416667	NM_145235	Q6UXY9|Q6X7T6	Missense_Mutation	SNP	ENST00000368693.1	37	CCDS31309.1	.	.	.	.	.	.	.	.	.	.	A	7.904	0.735016	0.15574	.	.	ENSG00000203780	ENST00000368693	T	0.36520	1.25	2.62	2.62	0.31277	.	.	.	.	.	T	0.21801	0.0525	.	.	.	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.0;0.002	T	0.05886	-1.0858	8	0.25751	T	0.34	.	7.1163	0.25418	1.0:0.0:0.0:0.0	.	1;1	Q8TC84-3;Q8TC84	.;FANK1_HUMAN	L	1	ENSP00000357682:M1L	ENSP00000357682:M1L	M	+	1	0	FANK1	127575202	0.921000	0.31238	0.955000	0.39395	0.220000	0.24768	1.121000	0.31283	1.433000	0.47394	0.379000	0.24179	ATG	.	.	weak		0.761	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	Missense_Mutation
FBXO38	81545	hgsc.bcm.edu	37	5	147813265	147813265	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr5:147813265T>C	ENST00000340253.5	+	17	2990	c.2822T>C	c.(2821-2823)gTg>gCg	p.V941A	FBXO38_ENST00000394370.3_Missense_Mutation_p.V866A|CTD-2283N19.1_ENST00000520980.2_RNA|FBXO38_ENST00000296701.6_Missense_Mutation_p.V696A|FBXO38_ENST00000513826.1_Missense_Mutation_p.V696A			Q6PIJ6	FBX38_HUMAN	F-box protein 38	941					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGATCTAGTGCTAAAAGAC	0.328																																					p.V866A		Atlas-SNP	.											.	FBXO38	115	.	0			c.T2597C						PASS	.						147.0	150.0	149.0					5																	147813265		2203	4300	6503	SO:0001583	missense	81545	exon17			ATCTAGTGCTAAA	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.2822T>C	5.37:g.147813265T>C	ENSP00000342023:p.Val941Ala	Somatic	275	0	0		WXS	Illumina HiSeq	Phase_I	226	10	0.0442478	NM_030793	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	37		.	.	.	.	.	.	.	.	.	.	T	23.5	4.426516	0.83667	.	.	ENSG00000145868	ENST00000340253;ENST00000296701;ENST00000394370;ENST00000513826	T;T;T;T	0.38240	1.15;1.24;1.21;1.24	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.48874	0.1524	L	0.34521	1.04	0.35153	D	0.769977	P;D;D	0.71674	0.954;0.998;0.998	D;D;D	0.77557	0.932;0.979;0.99	T	0.62431	-0.6856	10	0.87932	D	0	-14.1344	14.1172	0.65161	0.0:0.0:0.0:1.0	.	696;866;941	Q6PIJ6-3;Q6PIJ6-2;Q6PIJ6	.;.;FBX38_HUMAN	A	941;696;866;696	ENSP00000342023:V941A;ENSP00000296701:V696A;ENSP00000377895:V866A;ENSP00000426410:V696A	ENSP00000296701:V696A	V	+	2	0	FBXO38	147793458	1.000000	0.71417	0.997000	0.53966	0.937000	0.57800	7.679000	0.84048	2.069000	0.61940	0.460000	0.39030	GTG	.	.	none		0.328	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346591	39346591	+	Silent	SNP	C	C	T	rs76923645|rs148036927		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr17:39346591C>T	ENST00000398470.1	+	1	453	c.453C>T	c.(451-453)ccC>ccT	p.P151P	KRTAP9-1_ENST00000377723.3_Intron|KRTAP9-1_ENST00000318329.5_Silent_p.P68P	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	151	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)				breast(1)|lung(3)	4						CTTGCCAGCCCACCTGCTGTG	0.582																																					p.P151P		Atlas-SNP	.											KRTAP9-1_ENST00000398470,caecum,carcinoma,0,2	KRTAP9-1	34	2	0			c.C453T						scavenged	.																																			SO:0001819	synonymous_variant	728318	exon1			CCAGCCCACCTGC	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	ENST00000398470.1:c.453C>T	17.37:g.39346591C>T		Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	81	30	0.37037	NM_001190460		Silent	SNP	ENST00000398470.1	37	CCDS56029.1																																																																																			C|0.500;T|0.500	0.500	weak		0.582	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
OGG1	4968	hgsc.bcm.edu	37	3	9792009	9792009	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr3:9792009T>G	ENST00000344629.7	+	1	382	c.39T>G	c.(37-39)caT>caG	p.H13Q	OGG1_ENST00000449570.2_Missense_Mutation_p.H13Q|OGG1_ENST00000436092.1_3'UTR|OGG1_ENST00000383826.5_Missense_Mutation_p.H13Q|OGG1_ENST00000339511.5_Missense_Mutation_p.H13Q|OGG1_ENST00000349503.5_Missense_Mutation_p.H13Q|OGG1_ENST00000302036.7_Missense_Mutation_p.H13Q|OGG1_ENST00000302008.8_Missense_Mutation_p.H13Q|OGG1_ENST00000302003.7_Missense_Mutation_p.H13Q			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase	13					acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)			kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					GCATGGGGCATCGTACTCTAG	0.667								Base excision repair (BER), DNA glycosylases																													p.H13Q		Atlas-SNP	.											.	OGG1	57	.	0			c.T39G						PASS	.						51.0	46.0	48.0					3																	9792009		2203	4300	6503	SO:0001583	missense	4968	exon1			GGGGCATCGTACT	U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	ENST00000344629.7:c.39T>G	3.37:g.9792009T>G	ENSP00000342851:p.His13Gln	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	119	12	0.10084	NM_016819	A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	Missense_Mutation	SNP	ENST00000344629.7	37	CCDS2581.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.645755	0.87958	.	.	ENSG00000114026	ENST00000302003;ENST00000344629;ENST00000302036;ENST00000349503;ENST00000339511;ENST00000449570;ENST00000302008;ENST00000383826	T;T;T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58	5.85	-2.38	0.06622	Transcription factor TFIID, C-terminal/DNA glycosylase, N-terminal (1);	0.044063	0.85682	D	0.000000	T	0.62441	0.2428	M	0.61703	1.905	0.36706	D	0.88038	D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.997;0.993;0.996;0.994;0.996	D;D;P;P;P;P;P;P	0.65573	0.915;0.936;0.892;0.765;0.701;0.764;0.832;0.843	T	0.67776	-0.5583	10	0.72032	D	0.01	-25.825	12.1556	0.54074	0.0:0.6561:0.1289:0.215	.	13;13;13;13;13;13;13;13	E5KPM8;E5KPM6;E5KPM5;E5KPM7;E5KPM9;E5KPN0;O15527;O15527-2	.;.;.;.;.;.;OGG1_HUMAN;.	Q	13	ENSP00000305584:H13Q;ENSP00000342851:H13Q;ENSP00000306561:H13Q;ENSP00000303132:H13Q;ENSP00000345520:H13Q;ENSP00000403598:H13Q;ENSP00000305527:H13Q;ENSP00000373337:H13Q	ENSP00000305584:H13Q	H	+	3	2	OGG1	9767009	0.905000	0.30787	0.598000	0.28837	0.920000	0.55202	-0.374000	0.07484	-0.414000	0.07495	0.533000	0.62120	CAT	.	.	none		0.667	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214223.2	NM_016821	
CBWD3	445571	hgsc.bcm.edu	37	9	70871836	70871836	+	Splice_Site	SNP	C	C	G	rs376362566		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr9:70871836C>G	ENST00000360171.6	+	5	981		c.e5-1		CBWD3_ENST00000377342.5_Intron	NM_201453.2	NP_958861.2	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3								ATP binding (GO:0005524)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		TATATTTTCACGTGCAGTGGC	0.289																																					.		Atlas-SNP	.											CBWD3,rectum,carcinoma,-1,1	CBWD3	10	1	0			c.431-1C>G						scavenged	.						25.0	31.0	29.0					9																	70871836		2190	4250	6440	SO:0001630	splice_region_variant	445571	exon5			TTTTCACGTGCAG	BC069006	CCDS35038.1, CCDS35038.2	9q13	2014-05-06			ENSG00000196873	ENSG00000196873			18519	protein-coding gene	gene with protein product		611080				15233989, 12421752	Standard	XM_005277637		Approved	bA561O23.1	uc004aga.4	Q5JTY5	OTTHUMG00000184383	ENST00000360171.6:c.431-1C>G	9.37:g.70871836C>G		Somatic	1510	17	0.0112583		WXS	Illumina HiSeq	Phase_I	1490	29	0.0194631	NM_201453	B4DNG9|Q6VB91	Splice_Site	SNP	ENST00000360171.6	37	CCDS35038.1	.	.	.	.	.	.	.	.	.	.	c	14.78	2.637800	0.47049	.	.	ENSG00000196873	ENST00000360171;ENST00000447896;ENST00000455061;ENST00000455820;ENST00000377344	.	.	.	3.38	3.38	0.38709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.714	0.51641	0.0:0.1812:0.8188:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CBWD3	70061656	1.000000	0.71417	0.991000	0.47740	0.802000	0.45316	7.061000	0.76699	0.543000	0.28864	-0.676000	0.03789	.	C|0.500;G|0.500	0.500	weak		0.289	CBWD3-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052526.1	NM_201453	Intron
ZNF343	79175	hgsc.bcm.edu	37	20	2464182	2464182	+	Silent	SNP	A	A	G	rs528685225	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr20:2464182A>G	ENST00000278772.4	-	6	1912	c.1425T>C	c.(1423-1425)agT>agC	p.S475S	RP4-734P14.4_ENST00000461548.1_Intron	NM_001282495.1|NM_001282496.1|NM_024325.4	NP_001269424.1|NP_001269425.1|NP_077301.4	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	475					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S475S(2)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|skin(4)|upper_aerodigestive_tract(1)	25						GTGATTTCCGACTAAAGCCTC	0.527													A|||	5	0.000998403	0.003	0.0	5008	,	,		22125	0.0		0.0	False		,,,				2504	0.001				p.S475S		Atlas-SNP	.											ZNF343,NS,carcinoma,0,1	ZNF343	47	1	2	Substitution - coding silent(2)	lung(1)|kidney(1)	c.T1425C						scavenged	.						113.0	95.0	101.0					20																	2464182		2203	4300	6503	SO:0001819	synonymous_variant	79175	exon6			TTTCCGACTAAAG	AK096911	CCDS13028.1, CCDS74692.1, CCDS74693.1, CCDS74694.1	20p13	2013-01-08			ENSG00000088876	ENSG00000088876		"""Zinc fingers, C2H2-type"", ""-"""	16017	protein-coding gene	gene with protein product							Standard	NM_001282498		Approved	MGC10715	uc002wge.1	Q6P1L6	OTTHUMG00000031701	ENST00000278772.4:c.1425T>C	20.37:g.2464182A>G		Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	85	3	0.0352941	NM_024325	Q5JXU8|Q5JXU9|Q8N8F2|Q96EX8|Q96NA5|Q9BQB0	Silent	SNP	ENST00000278772.4	37	CCDS13028.1																																																																																			.	.	none		0.527	ZNF343-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077617.1	NM_024325	
OR8H2	390151	hgsc.bcm.edu	37	11	55872537	55872537	+	Missense_Mutation	SNP	A	A	G	rs61746549	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr11:55872537A>G	ENST00000313503.1	+	1	19	c.19A>G	c.(19-21)Aac>Gac	p.N7D		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	7						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N7D(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					TAGAAGGAATAACACAAATGT	0.438										HNSCC(53;0.14)			N|||	4	0.000798722	0.0008	0.0014	5008	,	,		18426	0.0		0.0	False		,,,				2504	0.002				p.N7D		Atlas-SNP	.											OR8H2,colon,carcinoma,0,3	OR8H2	117	3	1	Substitution - Missense(1)	kidney(1)	c.A19G						scavenged	.						196.0	187.0	190.0					11																	55872537		2201	4296	6497	SO:0001583	missense	390151	exon1			AGGAATAACACAA	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.19A>G	11.37:g.55872537A>G	ENSP00000323982:p.Asn7Asp	Somatic	148	1	0.00675676		WXS	Illumina HiSeq	Phase_I	121	6	0.0495868	NM_001005200	Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	37	CCDS31518.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	N	7.027	0.559788	0.13436	.	.	ENSG00000181767	ENST00000313503	T	0.00509	6.91	3.74	-2.34	0.06704	.	1.169330	0.06223	N	0.687064	T	0.00300	0.0009	N	0.17723	0.515	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41805	-0.9488	10	0.30854	T	0.27	.	0.2174	0.00164	0.3775:0.1477:0.1868:0.288	rs61746549	7	Q8N162	OR8H2_HUMAN	D	7	ENSP00000323982:N7D	ENSP00000323982:N7D	N	+	1	0	OR8H2	55629113	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-1.679000	0.01940	-0.566000	0.06054	-1.639000	0.00775	AAC	A|0.999;G|0.001	0.001	strong		0.438	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200	
ZNF217	7764	hgsc.bcm.edu	37	20	52198483	52198483	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr20:52198483T>G	ENST00000371471.2	-	2	1308	c.883A>C	c.(883-885)Acc>Ccc	p.T295P	ZNF217_ENST00000540425.1_5'Flank|ZNF217_ENST00000302342.3_Missense_Mutation_p.T295P			O75362	ZN217_HUMAN	zinc finger protein 217	295					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			GCCTGGAAGGTGGTGAACGGA	0.532																																					p.T295P		Atlas-SNP	.											.	ZNF217	227	.	0			c.A883C						PASS	.						122.0	114.0	117.0					20																	52198483		2203	4300	6503	SO:0001583	missense	7764	exon1			GGAAGGTGGTGAA	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.883A>C	20.37:g.52198483T>G	ENSP00000360526:p.Thr295Pro	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	155	10	0.0645161	NM_006526	E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	37	CCDS13443.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.386055	0.82902	.	.	ENSG00000171940	ENST00000371471;ENST00000302342	T;T	0.10382	2.88;2.88	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.35008	0.0917	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.06092	-1.0846	10	0.49607	T	0.09	-39.6624	15.6258	0.76855	0.0:0.0:0.0:1.0	.	295	O75362	ZN217_HUMAN	P	295	ENSP00000360526:T295P;ENSP00000304308:T295P	ENSP00000304308:T295P	T	-	1	0	ZNF217	51631890	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	7.585000	0.82584	2.170000	0.68504	0.482000	0.46254	ACC	.	.	none		0.532	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526	
GRIN3A	116443	hgsc.bcm.edu	37	9	104449271	104449271	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr9:104449271G>A	ENST00000361820.3	-	2	1511	c.911C>T	c.(910-912)aCc>aTc	p.T304I		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	304					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GAGGTCCTGGGTGGAGGGGAG	0.507																																					p.T304I		Atlas-SNP	.											.	GRIN3A	186	.	0			c.C911T						PASS	.						125.0	114.0	118.0					9																	104449271		2203	4300	6503	SO:0001583	missense	116443	exon2			TCCTGGGTGGAGG		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.911C>T	9.37:g.104449271G>A	ENSP00000355155:p.Thr304Ile	Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	172	12	0.0697674	NM_133445	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	G	9.953	1.220762	0.22457	.	.	ENSG00000198785	ENST00000361820	D	0.86562	-2.14	5.82	3.79	0.43588	.	0.741427	0.13472	N	0.385327	T	0.81158	0.4764	L	0.36672	1.1	0.37462	D	0.915272	B	0.14012	0.009	B	0.10450	0.005	T	0.76830	-0.2814	10	0.34782	T	0.22	.	12.3574	0.55184	0.0:0.242:0.6501:0.108	.	304	Q8TCU5	NMD3A_HUMAN	I	304	ENSP00000355155:T304I	ENSP00000355155:T304I	T	-	2	0	GRIN3A	103489092	0.033000	0.19621	0.999000	0.59377	0.882000	0.50991	0.538000	0.23160	2.759000	0.94783	0.557000	0.71058	ACC	.	.	none		0.507	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
PCDHA2	56146	hgsc.bcm.edu	37	5	140175218	140175218	+	Silent	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr5:140175218G>A	ENST00000526136.1	+	1	669	c.669G>A	c.(667-669)acG>acA	p.T223T	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000378132.1_Silent_p.T223T|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Silent_p.T223T	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	223	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGAGCTCACGGGCACCGTTC	0.418																																					p.T223T		Atlas-SNP	.											PCDHA2_ENST00000526136,NS,carcinoma,+1,2	PCDHA2	404	2	0			c.G669A						scavenged	.						80.0	90.0	86.0					5																	140175218		2202	4300	6502	SO:0001819	synonymous_variant	56146	exon1			GCTCACGGGCACC	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.669G>A	5.37:g.140175218G>A		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	73	2	0.0273973	NM_031495	O75287|Q9BTV3	Silent	SNP	ENST00000526136.1	37	CCDS54914.1																																																																																			.	.	none		0.418	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
CHEK2	11200	hgsc.bcm.edu	37	22	29091841	29091841	+	Silent	SNP	G	G	A	rs146546850	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr22:29091841G>A	ENST00000405598.1	-	12	1307	c.1116C>T	c.(1114-1116)tcC>tcT	p.S372S	CHEK2_ENST00000382580.2_Silent_p.S415S|CHEK2_ENST00000382578.1_Silent_p.S281S|CHEK2_ENST00000544772.1_Silent_p.S151S|CHEK2_ENST00000464581.1_5'Flank|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000403642.1_Silent_p.S281S|CHEK2_ENST00000404276.1_Silent_p.S372S|CHEK2_ENST00000382566.1_3'UTR|CHEK2_ENST00000328354.6_Silent_p.S372S|CHEK2_ENST00000402731.1_Silent_p.S343S|CHEK2_ENST00000348295.3_Silent_p.S343S			O96017	CHK2_HUMAN	checkpoint kinase 2	372	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|T-loop/activation segment.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.S372S(8)		central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CCAAAATCTTGGAGTGCCCAA	0.413			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																													p.S415S		Atlas-SNP	.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	CHEK2,bladder,carcinoma,0,38	CHEK2	438	38	8	Substitution - coding silent(8)	kidney(4)|prostate(2)|endometrium(1)|central_nervous_system(1)	c.C1245T						scavenged	.						43.0	44.0	44.0					22																	29091841		2203	4300	6503	SO:0001819	synonymous_variant	11200	exon12			AATCTTGGAGTGC	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1116C>T	22.37:g.29091841G>A		Somatic	101	2	0.019802		WXS	Illumina HiSeq	Phase_I	122	4	0.0327869	NM_001005735	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Silent	SNP	ENST00000405598.1	37	CCDS13843.1	.	.	.	.	.	.	.	.	.	.	G	5.792	0.330417	0.10956	.	.	ENSG00000183765	ENST00000434810	.	.	.	5.89	-2.11	0.07187	.	.	.	.	.	T	0.42154	0.1190	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33854	-0.9852	4	.	.	.	-7.6356	3.2532	0.06822	0.327:0.1103:0.4613:0.1014	.	.	.	.	L	116	.	.	P	-	2	0	CHEK2	27421841	0.997000	0.39634	0.996000	0.52242	0.470000	0.32858	0.318000	0.19504	-0.075000	0.12798	-0.907000	0.02831	CCA	.	.	weak		0.413	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
LLPH	84298	hgsc.bcm.edu	37	12	66522820	66522820	+	Missense_Mutation	SNP	G	G	C	rs574607020	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr12:66522820G>C	ENST00000266604.2	-	2	137	c.67C>G	c.(67-69)Cca>Gca	p.P23A	RP11-745O10.2_ENST00000510317.2_RNA|LLPH_ENST00000446587.2_Missense_Mutation_p.P23A|TMBIM4_ENST00000556010.1_3'UTR|TMBIM4_ENST00000539652.1_3'UTR	NM_032338.3	NP_115714.1	Q9BRT6	LLPH_HUMAN	LLP homolog, long-term synaptic facilitation (Aplysia)	23	Lys-rich.						poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|skin(1)	5						GCCTCCTTTGGGGCATTCTTT	0.393													G|||	17	0.00339457	0.0129	0.0	5008	,	,		16819	0.0		0.0	False		,,,				2504	0.0				p.P23A		Atlas-SNP	.											LLPH,NS,carcinoma,0,1	LLPH	25	1	0			c.C67G						scavenged	.						90.0	87.0	88.0					12																	66522820		2203	4297	6500	SO:0001583	missense	84298	exon2			CCTTTGGGGCATT	AK057947	CCDS8974.1	12q14.3	2014-05-09	2008-10-02	2008-10-02	ENSG00000139233	ENSG00000139233			28229	protein-coding gene	gene with protein product	"""human LAPS18-like protein"""		"""chromosome 12 open reading frame 31"""	C12orf31		12477932	Standard	NM_032338		Approved	MGC14817, hLLP	uc010ssw.2	Q9BRT6	OTTHUMG00000168959	ENST00000266604.2:c.67C>G	12.37:g.66522820G>C	ENSP00000266604:p.Pro23Ala	Somatic	458	19	0.0414847		WXS	Illumina HiSeq	Phase_I	464	23	0.049569	NM_032338	Q3B766	Missense_Mutation	SNP	ENST00000266604.2	37	CCDS8974.1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.269830	0.59540	.	.	ENSG00000139233	ENST00000266604;ENST00000446587	.	.	.	4.13	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.74680	0.3748	L	0.56340	1.77	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74822	-0.3534	8	.	.	.	-12.6244	16.9492	0.86239	0.0:0.0:1.0:0.0	.	23	Q9BRT6	LLPH_HUMAN	A	23	.	.	P	-	1	0	LLPH	64809087	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.494000	0.90477	2.283000	0.76528	0.467000	0.42956	CCA	.	.	none		0.393	LLPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401752.1	NM_032338	
MYC	4609	hgsc.bcm.edu	37	8	128751013	128751013	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr8:128751013A>T	ENST00000259523.6	+	2	1710	c.505A>T	c.(505-507)Agc>Tgc	p.S169C	MYC_ENST00000377970.2_Missense_Mutation_p.S184C|MYC_ENST00000524013.1_Missense_Mutation_p.S183C			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	169					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	CCGCGGCCACAGCGTCTGCTC	0.677		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S184C		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	.	MYC	168	.	0			c.A550T						PASS	.						20.0	22.0	21.0					8																	128751013		2203	4298	6501	SO:0001583	missense	4609	exon2			GGCCACAGCGTCT		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.505A>T	8.37:g.128751013A>T	ENSP00000259523:p.Ser169Cys	Somatic	56	0	0	1567	WXS	Illumina HiSeq	Phase_I	53	4	0.0754717	NM_002467	A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000259523.6	37		.	.	.	.	.	.	.	.	.	.	A	15.75	2.926604	0.52759	.	.	ENSG00000136997	ENST00000259523;ENST00000517291;ENST00000377970;ENST00000524013;ENST00000454617	T;T;T;T	0.25749	2.14;1.78;2.14;2.14	4.78	-3.13	0.05266	Transcription regulator Myc, N-terminal (1);	0.630931	0.16999	N	0.190997	T	0.28234	0.0697	L	0.52573	1.65	0.21020	N	0.99981	P	0.50156	0.932	P	0.55455	0.776	T	0.12863	-1.0531	10	0.62326	D	0.03	-9.1089	3.8255	0.08852	0.5346:0.1046:0.2554:0.1053	.	169	P01106	MYC_HUMAN	C	169;183;184;183;150	ENSP00000259523:S169C;ENSP00000429441:S183C;ENSP00000367207:S184C;ENSP00000430235:S183C	ENSP00000259523:S169C	S	+	1	0	MYC	128820195	0.000000	0.05858	0.819000	0.32651	0.693000	0.40251	-0.773000	0.04689	-0.571000	0.06014	0.459000	0.35465	AGC	.	.	none		0.677	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
ATXN1	6310	hgsc.bcm.edu	37	6	16327915	16327915	+	Missense_Mutation	SNP	A	A	C	rs11969612|rs369629396	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr6:16327915A>C	ENST00000244769.4	-	8	1563	c.627T>G	c.(625-627)caT>caG	p.H209Q	ATXN1_ENST00000436367.1_Missense_Mutation_p.H209Q	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	209	Poly-Gln.		H -> Q (in dbSNP:rs11969612).		adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.H209delH(2)|p.H209_H211delHQH(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgatgctgatgctgctgct	0.667																																					p.H209Q		Atlas-SNP	.											ATXN1,colon,carcinoma,0,1	ATXN1	117	1	3	Deletion - In frame(3)	upper_aerodigestive_tract(1)|large_intestine(1)|prostate(1)	c.T627G						scavenged	.						4.0	8.0	7.0					6																	16327915		1573	3520	5093	SO:0001583	missense	6310	exon7			ATGCTGATGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.627T>G	6.37:g.16327915A>C	ENSP00000244769:p.His209Gln	Somatic	37	1	0.027027		WXS	Illumina HiSeq	Phase_I	58	16	0.275862	NM_001128164	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	A	0.432	-0.902695	0.02453	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.31510	1.49;1.49	0.0465	-0.093	0.13652	.	.	.	.	.	T	0.03178	0.0093	N	0.08118	0	0.09310	N	1	P	0.34662	0.462	B	0.36534	0.227	T	0.35724	-0.9777	8	0.19147	T	0.46	.	.	.	.	rs11969612	209	P54253	ATX1_HUMAN	Q	209	ENSP00000244769:H209Q;ENSP00000416360:H209Q	ENSP00000244769:H209Q	H	-	3	2	ATXN1	16435894	0.098000	0.21812	0.014000	0.15608	0.050000	0.14768	-1.578000	0.02125	-1.642000	0.01521	-1.674000	0.00743	CAT	A|0.571;C|0.429	0.429	strong		0.667	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
RANBP2	5903	hgsc.bcm.edu	37	2	109392255	109392255	+	Missense_Mutation	SNP	T	T	G	rs367864778		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:109392255T>G	ENST00000283195.6	+	24	8486	c.8360T>G	c.(8359-8361)gTa>gGa	p.V2787G		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	2787					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						GAAGTGATGGTACCTTCTTTC	0.383																																					p.V2787G		Atlas-SNP	.											.	RANBP2	488	.	0			c.T8360G						PASS	.	T	GLY/VAL	0,4406		0,0,2203	172.0	170.0	171.0		8360	-3.3	0.0	2		171	1,8599	1.2+/-3.3	0,1,4299	no	missense	RANBP2	NM_006267.4	109	0,1,6502	GG,GT,TT		0.0116,0.0,0.0077	benign	2787/3225	109392255	1,13005	2203	4300	6503	SO:0001583	missense	5903	exon24			TGATGGTACCTTC	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.8360T>G	2.37:g.109392255T>G	ENSP00000283195:p.Val2787Gly	Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	100	5	0.05	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	T	12.33	1.904645	0.33628	0.0	1.16E-4	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.27720	1.65	5.58	-3.34	0.04943	.	.	.	.	.	T	0.21590	0.0520	L	0.47716	1.5	0.09310	N	1	B	0.20887	0.049	B	0.14023	0.01	T	0.33929	-0.9849	9	0.17369	T	0.5	2.9813	9.2618	0.37616	0.1243:0.6276:0.0:0.248	.	2787	P49792	RBP2_HUMAN	G	1811;2787	ENSP00000283195:V2787G	ENSP00000283195:V2787G	V	+	2	0	RANBP2	108758687	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.045000	0.01410	-0.487000	0.06735	-0.250000	0.11733	GTA	.	.	weak		0.383	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
GPD2	2820	hgsc.bcm.edu	37	2	157369859	157369859	+	Missense_Mutation	SNP	C	C	T	rs143467322		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:157369859C>T	ENST00000310454.6	+	6	884	c.512C>T	c.(511-513)cCt>cTt	p.P171L	GPD2_ENST00000438166.2_Missense_Mutation_p.P171L|GPD2_ENST00000409125.4_Intron|GPD2_ENST00000540309.1_Missense_Mutation_p.P171L|GPD2_ENST00000409674.1_Missense_Mutation_p.P171L	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	171					camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						TGGCAGTTACCTTACTACTGG	0.393																																					p.P171L		Atlas-SNP	.											.	GPD2	59	.	0			c.C512T						PASS	.	C	LEU/PRO,LEU/PRO	0,4406		0,0,2203	153.0	142.0	146.0		512,512	5.0	1.0	2	dbSNP_134	146	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GPD2	NM_000408.4,NM_001083112.2	98,98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	171/728,171/728	157369859	1,13005	2203	4300	6503	SO:0001583	missense	2820	exon6			AGTTACCTTACTA		CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.512C>T	2.37:g.157369859C>T	ENSP00000308610:p.Pro171Leu	Somatic	170	0	0		WXS	Illumina HiSeq	Phase_I	166	7	0.0421687	NM_001083112	A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Missense_Mutation	SNP	ENST00000310454.6	37	CCDS2202.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.385374	0.82792	0.0	1.16E-4	ENSG00000115159	ENST00000310454;ENST00000438166;ENST00000540309;ENST00000409674	D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51	4.99	4.99	0.66335	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.87680	0.6238	M	0.71036	2.16	0.80722	D	1	B	0.27140	0.169	P	0.46885	0.53	D	0.87211	0.2247	10	0.66056	D	0.02	.	18.6714	0.91513	0.0:1.0:0.0:0.0	.	171	P43304	GPDM_HUMAN	L	171	ENSP00000308610:P171L;ENSP00000409708:P171L;ENSP00000440892:P171L;ENSP00000386425:P171L	ENSP00000308610:P171L	P	+	2	0	GPD2	157078105	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	2.489000	0.83994	0.655000	0.94253	CCT	C|1.000;T|0.000	0.000	weak		0.393	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254910.3		
ABCA12	26154	hgsc.bcm.edu	37	2	215855677	215855677	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:215855677T>G	ENST00000272895.7	-	24	3592	c.3373A>C	c.(3373-3375)Acc>Ccc	p.T1125P	ABCA12_ENST00000389661.4_Missense_Mutation_p.T807P	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1125					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATCACGATGGTAACCAGTAAA	0.388																																					p.T1125P	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.A3373C						PASS	.						100.0	102.0	101.0					2																	215855677		2203	4300	6503	SO:0001583	missense	26154	exon24			CGATGGTAACCAG	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.3373A>C	2.37:g.215855677T>G	ENSP00000272895:p.Thr1125Pro	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	87	4	0.045977	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	19.13	3.767808	0.69878	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.85773	-2.03;-2.03	5.39	5.39	0.77823	.	0.158061	0.45361	D	0.000373	D	0.92172	0.7518	M	0.80746	2.51	0.80722	D	1	D;D	0.76494	0.999;0.976	D;D	0.70487	0.969;0.937	D	0.93226	0.6613	10	0.87932	D	0	.	15.5646	0.76281	0.0:0.0:0.0:1.0	.	1125;807	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	P	1125;807	ENSP00000272895:T1125P;ENSP00000374312:T807P	ENSP00000272895:T1125P	T	-	1	0	ABCA12	215563922	1.000000	0.71417	0.998000	0.56505	0.655000	0.38815	7.832000	0.86757	2.263000	0.75096	0.528000	0.53228	ACC	.	.	none		0.388	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
CS	1431	hgsc.bcm.edu	37	12	56676233	56676233	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr12:56676233G>A	ENST00000351328.3	-	6	749	c.559C>T	c.(559-561)Cag>Tag	p.Q187*	CS_ENST00000548567.1_Nonsense_Mutation_p.Q121*|CS_ENST00000542324.2_Nonsense_Mutation_p.Q174*	NM_004077.2	NP_004068.2	O75390	CISY_HUMAN	citrate synthase	187				Q -> R (in Ref. 1; AAC25560). {ECO:0000305}.	carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	citrate (Si)-synthase activity (GO:0004108)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	17		Myeloproliferative disorder(1001;0.000374)		BRCA - Breast invasive adenocarcinoma(357;6.17e-07)		CTGATACCCTGTGCATATGCT	0.507																																					p.Q187X		Atlas-SNP	.											CS,NS,adenoma,+1,1	CS	44	1	0			c.C559T						scavenged	.						102.0	77.0	86.0					12																	56676233		2203	4300	6503	SO:0001587	stop_gained	1431	exon6			TACCCTGTGCATA		CCDS8913.1	12q13.2	2012-10-02				ENSG00000062485	2.3.3.1		2422	protein-coding gene	gene with protein product		118950					Standard	NM_004077		Approved		uc001sks.1	O75390	OTTHUMG00000170344	ENST00000351328.3:c.559C>T	12.37:g.56676233G>A	ENSP00000342056:p.Gln187*	Somatic	192	1	0.00520833		WXS	Illumina HiSeq	Phase_I	185	12	0.0648649	NM_004077	Q71UT9|Q7KZH0|Q96FZ8|Q9BWN8	Nonsense_Mutation	SNP	ENST00000351328.3	37	CCDS8913.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444473	0.83993	.	.	ENSG00000062485	ENST00000548567;ENST00000351328;ENST00000542324;ENST00000549221;ENST00000546930;ENST00000551936;ENST00000550734;ENST00000551253;ENST00000552688;ENST00000546554	.	.	.	4.79	2.95	0.34219	.	0.098661	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.4858	14.6063	0.68481	0.0:0.7188:0.2812:0.0	.	.	.	.	X	121;187;174;112;121;121;121;121;151;137	.	ENSP00000342056:Q187X	Q	-	1	0	CS	54962500	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.603000	0.61105	0.695000	0.31675	-0.139000	0.14373	CAG	.	.	none		0.507	CS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408588.2	NM_004077	
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346622	39346622	+	Missense_Mutation	SNP	T	T	A	rs79470847		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr17:39346622T>A	ENST00000398470.1	+	1	484	c.484T>A	c.(484-486)Tgc>Agc	p.C162S	KRTAP9-1_ENST00000377723.3_Intron|KRTAP9-1_ENST00000318329.5_Splice_Site	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	162	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)				breast(1)|lung(3)	4						CTGCCAGCCTTGCTGCCACCC	0.607																																					p.C162S		Atlas-SNP	.											KRTAP9-1_ENST00000398470,caecum,carcinoma,0,2	KRTAP9-1	34	2	0			c.T484A						PASS	.																																			SO:0001583	missense	728318	exon1			CAGCCTTGCTGCC	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	ENST00000398470.1:c.484T>A	17.37:g.39346622T>A	ENSP00000381488:p.Cys162Ser	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	98	19	0.193878	NM_001190460		Missense_Mutation	SNP	ENST00000398470.1	37	CCDS56029.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|A	6.687|6.687	0.495274|0.495274	0.12762|0.12762	.|.	.|.	ENSG00000240542|ENSG00000240542	ENST00000318329|ENST00000398470	.|T	.|0.02236	.|4.38	3.62|3.62	1.21|1.21	0.21127|0.21127	.|.	.|.	.|.	.|.	.|.	.|T	.|0.00815	.|0.0027	N|N	0.01257|0.01257	-0.925|-0.925	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.48186	.|-0.9057	.|7	.|0.20046	.|T	.|0.44	.|.	4.2082|4.2082	0.10498|0.10498	0.1788:0.109:0.0:0.7122|0.1788:0.109:0.0:0.7122	.|.	.|.	.|.	.|.	.|S	-1|162	.|ENSP00000381488:C162S	.|ENSP00000381488:C162S	.|C	+|+	.|1	.|0	KRTAP9-1|KRTAP9-1	36600148|36600148	0.954000|0.954000	0.32549|0.32549	0.003000|0.003000	0.11579|0.11579	0.039000|0.039000	0.13416|0.13416	0.874000|0.874000	0.28065|0.28065	0.072000|0.072000	0.16694|0.16694	0.460000|0.460000	0.39030|0.39030	.|TGC	T|0.500;A|0.500	0.500	weak		0.607	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
FAM120A	23196	hgsc.bcm.edu	37	9	96318697	96318697	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr9:96318697T>G	ENST00000277165.6	+	13	2502	c.2308T>G	c.(2308-2310)Tca>Gca	p.S770A	FAM120A_ENST00000333936.5_Missense_Mutation_p.S798A|FAM120A_ENST00000340893.4_Missense_Mutation_p.S770A	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	770						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						AATTCAGCTATCAGCTCTCTT	0.393																																					p.S770A		Atlas-SNP	.											.	FAM120A	105	.	0			c.T2308G						PASS	.						135.0	138.0	137.0					9																	96318697		2203	4300	6503	SO:0001583	missense	23196	exon13			CAGCTATCAGCTC	AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.2308T>G	9.37:g.96318697T>G	ENSP00000277165:p.Ser770Ala	Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	171	15	0.0877193	NM_014612	A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	ENST00000277165.6	37	CCDS6706.1	.	.	.	.	.	.	.	.	.	.	T	11.45	1.643701	0.29246	.	.	ENSG00000048828	ENST00000277165;ENST00000333936;ENST00000340893;ENST00000427765	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.68	5.68	0.88126	.	0.000000	0.64402	D	0.000010	T	0.12860	0.0312	N	0.00661	-1.28	0.40403	D	0.979668	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.13407	0.004;0.007;0.009	T	0.27971	-1.0058	10	0.02654	T	1	-11.3047	11.8715	0.52523	0.0:0.0:0.1456:0.8543	.	770;798;770	Q9NZB2-4;Q9NZB2-6;Q9NZB2	.;.;F120A_HUMAN	A	770;798;770;192	ENSP00000277165:S770A;ENSP00000334918:S798A;ENSP00000344698:S770A;ENSP00000412440:S192A	ENSP00000277165:S770A	S	+	1	0	FAM120A	95358518	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.176000	0.65026	2.172000	0.68678	0.533000	0.62120	TCA	.	.	none		0.393	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053160.2	NM_014612	
BCAP29	55973	hgsc.bcm.edu	37	7	107236323	107236323	+	Missense_Mutation	SNP	G	G	A	rs115169101		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr7:107236323G>A	ENST00000005259.4	+	5	695	c.356G>A	c.(355-357)cGt>cAt	p.R119H	BCAP29_ENST00000494086.1_3'UTR|BCAP29_ENST00000465919.1_Missense_Mutation_p.R25H|BCAP29_ENST00000445771.2_Missense_Mutation_p.R119H|BCAP29_ENST00000379121.2_Missense_Mutation_p.R25H|BCAP29_ENST00000379117.2_Missense_Mutation_p.R119H|BCAP29_ENST00000379119.2_Missense_Mutation_p.R119H	NM_018844.3	NP_061332.2	Q9UHQ4	BAP29_HUMAN	B-cell receptor-associated protein 29	119					apoptotic process (GO:0006915)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|osteoblast differentiation (GO:0001649)|protein localization to endoplasmic reticulum exit site (GO:0070973)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	14						GTTTTGAGACGTCTGGTTACG	0.338													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15250	0.0		0.0	False		,,,				2504	0.0				p.R119H		Atlas-SNP	.											BCAP29,colon,carcinoma,+1,1	BCAP29	46	1	0			c.G356A						PASS	.	G	HIS/ARG,HIS/ARG	1,4403	2.1+/-5.4	0,1,2201	112.0	108.0	109.0		356,356	4.6	1.0	7	dbSNP_132	109	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	BCAP29	NM_001008405.2,NM_018844.3	29,29	0,2,6500	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	119/349,119/242	107236323	2,13002	2202	4300	6502	SO:0001583	missense	55973	exon5			TGAGACGTCTGGT		CCDS34730.1, CCDS34731.1	7q22.3	2012-09-20			ENSG00000075790	ENSG00000075790			24131	protein-coding gene	gene with protein product						12477932	Standard	NM_018844		Approved	BAP29, DKFZp686M2086	uc011kma.1	Q9UHQ4	OTTHUMG00000154770	ENST00000005259.4:c.356G>A	7.37:g.107236323G>A	ENSP00000005259:p.Arg119His	Somatic	220	0	0		WXS	Illumina HiSeq	Phase_I	202	10	0.049505	NM_018844	G5E9L4|O95003	Missense_Mutation	SNP	ENST00000005259.4	37	CCDS34731.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323123	0.81580	2.27E-4	1.16E-4	ENSG00000075790	ENST00000005259;ENST00000465919;ENST00000445771;ENST00000479917;ENST00000421217;ENST00000457837;ENST00000379117;ENST00000379119;ENST00000491150;ENST00000379121	.	.	.	5.45	4.57	0.56435	.	0.000000	0.85682	D	0.000000	D	0.84061	0.5389	M	0.90369	3.11	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87335	0.2327	9	0.87932	D	0	0.1468	13.3198	0.60426	0.0778:0.0:0.9222:0.0	.	119;119;119	G5E9L4;C9JTE9;Q9UHQ4	.;.;BAP29_HUMAN	H	119;25;119;119;119;119;119;119;76;25	.	ENSP00000005259:R119H	R	+	2	0	BCAP29	107023559	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	6.256000	0.72473	1.444000	0.47605	0.650000	0.86243	CGT	G|1.000;A|0.000	0.000	strong		0.338	BCAP29-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337011.2	NM_018844	
MUC6	4588	hgsc.bcm.edu	37	11	1017797	1017797	+	Silent	SNP	C	C	G	rs76800954	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr11:1017797C>G	ENST00000421673.2	-	31	5054	c.5004G>C	c.(5002-5004)gcG>gcC	p.A1668A		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1668	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TCATTGTTGGCGCTGTGTGGG	0.567																																					p.A1668A		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,-1,2	MUC6	408	2	0			c.G5004C						scavenged	.						700.0	680.0	687.0					11																	1017797		2201	4295	6496	SO:0001819	synonymous_variant	4588	exon31			TGTTGGCGCTGTG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5004G>C	11.37:g.1017797C>G		Somatic	877	78	0.0889396		WXS	Illumina HiSeq	Phase_I	670	57	0.0850746	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																			C|0.500;G|0.500	0.500	strong		0.567	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
JAG1	182	hgsc.bcm.edu	37	20	10620386	10620386	+	Silent	SNP	A	A	G	rs1051419	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr20:10620386A>G	ENST00000254958.5	-	26	3932	c.3417T>C	c.(3415-3417)taT>taC	p.Y1139Y	JAG1_ENST00000423891.2_Silent_p.Y980Y	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	1139					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)	p.Y1139Y(1)		biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						TCTTGTTCTCATAATCCTTGA	0.483									Alagille Syndrome				G|||	3569	0.71266	0.9289	0.6326	5008	,	,		19004	0.494		0.6481	False		,,,				2504	0.7689				p.Y1139Y		Atlas-SNP	.											JAG1_ENST00000254958,NS,carcinoma,0,1	JAG1	213	1	1	Substitution - coding silent(1)	stomach(1)	c.T3417C						scavenged	.	G		3962,444	214.8+/-234.0	1781,400,22	149.0	147.0	148.0		3417	-1.1	1.0	20	dbSNP_86	148	5496,3104	474.2+/-368.8	1737,2022,541	no	coding-synonymous	JAG1	NM_000214.2		3518,2422,563	GG,GA,AA		36.093,10.0772,27.2797		1139/1219	10620386	9458,3548	2203	4300	6503	SO:0001819	synonymous_variant	182	exon26	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GTTCTCATAATCC	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.3417T>C	20.37:g.10620386A>G		Somatic	484	0	0		WXS	Illumina HiSeq	Phase_I	468	6	0.0128205	NM_000214	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Silent	SNP	ENST00000254958.5	37	CCDS13112.1																																																																																			G|0.694;C|0.000;A|0.306	0.694	strong		0.483	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
TP53	7157	hgsc.bcm.edu	37	17	7577565	7577565	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr17:7577565T>C	ENST00000269305.4	-	7	905	c.716A>G	c.(715-717)aAc>aGc	p.N239S	TP53_ENST00000413465.2_Missense_Mutation_p.N239S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.N239S|TP53_ENST00000359597.4_Missense_Mutation_p.N239S|TP53_ENST00000445888.2_Missense_Mutation_p.N239S|TP53_ENST00000420246.2_Missense_Mutation_p.N239S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	239	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> D (in sporadic cancers; somatic mutation).|N -> H (in a sporadic cancer; somatic mutation).|N -> I (in a sporadic cancer; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.N239S(28)|p.0?(8)|p.?(5)|p.N239T(4)|p.M237_N239delMCN(4)|p.N146S(3)|p.N239_C242delNSSC(3)|p.N239fs*25(2)|p.N239_S240delNS(2)|p.Y236_M243delYMCNSSCM(1)|p.N239fs*1(1)|p.N239_S240insN(1)|p.V225fs*23(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.M144_N146delMCN(1)|p.C238fs*21(1)|p.N239I(1)|p.H233fs*6(1)|p.N239*(1)|p.H233_C242del10(1)|p.N239_C242>S(1)|p.N239fs*>48(1)|p.N146fs*>10(1)|p.N239_C242del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGGAACTGTTACACATGTA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.N239S	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,-1,145	TP53	33396	145	76	Substitution - Missense(36)|Deletion - In frame(14)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Insertion - Frameshift(4)|Substitution - Nonsense(1)|Insertion - In frame(1)|Complex - frameshift(1)|Complex - deletion inframe(1)	biliary_tract(10)|urinary_tract(6)|lung(6)|ovary(6)|upper_aerodigestive_tract(5)|haematopoietic_and_lymphoid_tissue(5)|oesophagus(5)|breast(5)|bone(5)|central_nervous_system(4)|large_intestine(4)|endometrium(4)|kidney(4)|stomach(3)|thyroid(1)|soft_tissue(1)|liver(1)|pancreas(1)	c.A716G						scavenged	.						135.0	105.0	115.0					17																	7577565		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GAACTGTTACACA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.716A>G	17.37:g.7577565T>C	ENSP00000269305:p.Asn239Ser	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	84	3	0.0357143	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.565663	0.86439	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99760	-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99736	0.9896	M	0.87381	2.88	0.58432	D	0.999991	D;B;D;D;D;D	0.89917	0.988;0.31;0.999;0.98;0.99;1.0	P;B;D;P;P;D	0.87578	0.826;0.104;0.981;0.815;0.891;0.998	D	0.97237	0.9888	10	0.87932	D	0	-35.9081	12.3101	0.54924	0.0:0.0:0.0:1.0	.	239;239;146;239;239;239	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	239;239;239;239;239;239;228;146;107;146	ENSP00000410739:N239S;ENSP00000352610:N239S;ENSP00000269305:N239S;ENSP00000398846:N239S;ENSP00000391127:N239S;ENSP00000391478:N239S;ENSP00000425104:N107S;ENSP00000423862:N146S	ENSP00000269305:N239S	N	-	2	0	TP53	7518290	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.770000	0.85390	2.074000	0.62210	0.379000	0.24179	AAC	.	.	none		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DOPEY1	23033	hgsc.bcm.edu	37	6	83849764	83849764	+	Silent	SNP	T	T	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr6:83849764T>C	ENST00000349129.2	+	22	5426	c.5166T>C	c.(5164-5166)acT>acC	p.T1722T	DOPEY1_ENST00000369739.3_Silent_p.T1713T|DOPEY1_ENST00000237163.5_Silent_p.T1703T|DOPEY1_ENST00000484282.1_3'UTR	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1722					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TGATTCTTACTCTTTTGGAAG	0.338																																					p.T1722T		Atlas-SNP	.											.	DOPEY1	190	.	0			c.T5166C						PASS	.						141.0	130.0	134.0					6																	83849764		2203	4300	6503	SO:0001819	synonymous_variant	23033	exon22			TCTTACTCTTTTG	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.5166T>C	6.37:g.83849764T>C		Somatic	208	0	0		WXS	Illumina HiSeq	Phase_I	169	8	0.0473373	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Silent	SNP	ENST00000349129.2	37	CCDS4996.1																																																																																			.	.	none		0.338	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
NUBPL	80224	hgsc.bcm.edu	37	14	32142594	32142594	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr14:32142594T>G	ENST00000281081.7	+	5	461	c.416T>G	c.(415-417)aTt>aGt	p.I139S	NUBPL_ENST00000536705.1_Missense_Mutation_p.I43S	NM_001201573.1|NM_001201574.1|NM_025152.2	NP_001188502.1|NP_001188503.1|NP_079428.2	Q8TB37	NUBPL_HUMAN	nucleotide binding protein-like	139					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrion morphogenesis (GO:0070584)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)|prostate(1)|skin(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)		AATTATGGTATTGCTTGGTGA	0.279																																					p.I139S		Atlas-SNP	.											.	NUBPL	21	.	0			c.T416G						PASS	.						46.0	42.0	43.0					14																	32142594		1788	4062	5850	SO:0001583	missense	80224	exon5			ATGGTATTGCTTG	AK022722	CCDS41940.1	14q12	2012-10-12	2005-01-07	2005-01-07	ENSG00000151413	ENSG00000151413		"""Mitochondrial respiratory chain complex assembly factors"""	20278	protein-coding gene	gene with protein product	"""iron-sulfur protein required for NADH dehydrogenase"""	613621	"""chromosome 14 open reading frame 127"""	C14orf127			Standard	NM_025152		Approved	FLJ12660, IND1, huInd1	uc001wrk.4	Q8TB37	OTTHUMG00000170521	ENST00000281081.7:c.416T>G	14.37:g.32142594T>G	ENSP00000281081:p.Ile139Ser	Somatic	382	0	0		WXS	Illumina HiSeq	Phase_I	353	17	0.0481586	NM_025152	B4DHZ1|Q86TZ4|Q9H9M2	Missense_Mutation	SNP	ENST00000281081.7	37	CCDS41940.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.132126	0.77662	.	.	ENSG00000151413	ENST00000281081;ENST00000551314;ENST00000536705	T;T;T	0.49432	0.78;0.87;0.78	5.53	5.53	0.82687	.	0.096119	0.64402	D	0.000001	T	0.67144	0.2862	H	0.96015	3.755	0.48135	D	0.99959	P;P	0.40578	0.586;0.722	B;B	0.43809	0.375;0.432	T	0.77395	-0.2604	10	0.87932	D	0	0.811	13.3964	0.60856	0.0:0.0:0.0:1.0	.	43;139	B4DWB0;Q8TB37	.;NUBPL_HUMAN	S	139;87;43	ENSP00000281081:I139S;ENSP00000447234:I87S;ENSP00000439286:I43S	ENSP00000281081:I139S	I	+	2	0	NUBPL	31212345	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.612000	0.74187	2.097000	0.63578	0.455000	0.32223	ATT	.	.	none		0.279	NUBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409519.1	NM_025152	
RNF19A	25897	hgsc.bcm.edu	37	8	101276899	101276899	+	Splice_Site	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr8:101276899C>T	ENST00000519449.1	-	7	1622	c.1306G>A	c.(1306-1308)Ggt>Agt	p.G436S	RNF19A_ENST00000341084.2_Splice_Site_p.G436S|RNF19A_ENST00000523255.1_5'UTR	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	436					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			ATTTTCTTACCTACAGTCACT	0.353																																					p.G436S		Atlas-SNP	.											.	RNF19A	67	.	0			c.G1306A						PASS	.						175.0	155.0	162.0					8																	101276899		2203	4300	6503	SO:0001630	splice_region_variant	25897	exon7			TCTTACCTACAGT	AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.1306+1G>A	8.37:g.101276899C>T		Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	108	8	0.0740741	NM_015435	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	ENST00000519449.1	37	CCDS6286.1	.	.	.	.	.	.	.	.	.	.	C	35	5.552861	0.96501	.	.	ENSG00000034677	ENST00000519449;ENST00000341084	D;D	0.86097	-2.07;-2.07	5.41	5.41	0.78517	.	0.046563	0.85682	D	0.000000	D	0.91112	0.7202	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89895	0.4040	9	.	.	.	.	19.229	0.93829	0.0:1.0:0.0:0.0	.	436	Q9NV58	RN19A_HUMAN	S	436	ENSP00000428968:G436S;ENSP00000342667:G436S	.	G	-	1	0	RNF19A	101346075	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.776000	0.85560	2.699000	0.92147	0.650000	0.86243	GGT	.	.	none		0.353	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1	NM_015435	Missense_Mutation
OR5H1	26341	hgsc.bcm.edu	37	3	97851659	97851659	+	Missense_Mutation	SNP	A	A	T	rs199787047	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr3:97851659A>T	ENST00000354565.2	+	1	118	c.118A>T	c.(118-120)Atg>Ttg	p.M40L	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M40L(3)		breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						CATCACCATCATGGGGAATCT	0.413																																					p.M40L		Atlas-SNP	.											OR5H1,NS,carcinoma,-2,7	OR5H1	71	7	3	Substitution - Missense(3)	kidney(2)|endometrium(1)	c.A118T						scavenged	.						45.0	49.0	48.0					3																	97851659		2174	4242	6416	SO:0001583	missense	26341	exon1			ACCATCATGGGGA	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.118A>T	3.37:g.97851659A>T	ENSP00000346575:p.Met40Leu	Somatic	546	4	0.00732601		WXS	Illumina HiSeq	Phase_I	526	7	0.013308	NM_001005338		Missense_Mutation	SNP	ENST00000354565.2	37	CCDS33797.1	.	.	.	.	.	.	.	.	.	.	A	3.067	-0.192020	0.06299	.	.	ENSG00000231192	ENST00000354565	T	0.00241	8.46	3.63	-0.16	0.13375	.	0.578292	0.14348	N	0.325303	T	0.00073	0.0002	N	0.04116	-0.275	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.04976	-1.0914	10	0.33940	T	0.23	.	7.0903	0.25279	0.5661:0.0:0.4339:0.0	.	40	A6NKK0	OR5H1_HUMAN	L	40	ENSP00000346575:M40L	ENSP00000346575:M40L	M	+	1	0	OR5H1	99334349	0.000000	0.05858	0.016000	0.15963	0.102000	0.19082	-3.263000	0.00535	-0.297000	0.08934	0.164000	0.16699	ATG	A|0.978;T|0.022	0.022	strong		0.413	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
RBMXL1	494115	hgsc.bcm.edu	37	1	89448539	89448539	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr1:89448539C>G	ENST00000321792.5	-	2	1398	c.971G>C	c.(970-972)cGa>cCa	p.R324P	CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000260508.4_Intron|RBMXL1_ENST00000399794.2_Missense_Mutation_p.R324P|CCBL2_ENST00000446900.2_Intron|RBMXL1_ENST00000413769.1_5'Flank	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	324	Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										GTAACTGTCTCGACTTCCACC	0.517																																					p.R324P		Atlas-SNP	.											CCBL2,NS,carcinoma,-1,1	.	.	1	0			c.G971C						scavenged	.						185.0	184.0	184.0					1																	89448539		2203	4300	6503	SO:0001583	missense	494115	exon3			CTGTCTCGACTTC	BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.971G>C	1.37:g.89448539C>G	ENSP00000318415:p.Arg324Pro	Somatic	245	2	0.00816326		WXS	Illumina HiSeq	Phase_I	197	7	0.035533	NM_001162536		Missense_Mutation	SNP	ENST00000321792.5	37	CCDS716.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.844738	0.51164	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	T;T	0.77358	-1.09;-1.09	1.89	0.895	0.19247	.	0.070349	0.64402	D	0.000016	T	0.62925	0.2468	M	0.65498	2.005	0.33162	D	0.547093	D	0.55172	0.97	P	0.46796	0.527	T	0.60667	-0.7218	10	0.52906	T	0.07	-3.2327	6.12	0.20148	0.0:0.8158:0.0:0.1842	.	324	Q96E39	RBMXL_HUMAN	P	324	ENSP00000318415:R324P;ENSP00000446099:R324P	ENSP00000318415:R324P	R	-	2	0	RBMXL1	89221127	1.000000	0.71417	0.995000	0.50966	0.753000	0.42808	4.995000	0.63908	0.128000	0.18479	0.306000	0.20318	CGA	.	.	none		0.517	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
C2orf44	80304	hgsc.bcm.edu	37	2	24253911	24253911	+	Silent	SNP	A	A	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:24253911A>G	ENST00000295148.4	-	4	2115	c.2058T>C	c.(2056-2058)tcT>tcC	p.S686S	C2orf44_ENST00000406895.3_3'UTR	NM_025203.2	NP_079479.1	Q9H6R7	CB044_HUMAN	chromosome 2 open reading frame 44	686									C2orf44/ALK(2)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTGAGAAAAAGAGTCTCTGA	0.473			T	ALK	NSCLC																																p.S686S		Atlas-SNP	.		Dom	yes		2	2p23.3	80304	chromosome 2 open reading frame 44		E	C2orf44,bladder,carcinoma,-1,1	C2orf44	56	1	0			c.T2058C						scavenged	.						100.0	97.0	98.0					2																	24253911		2203	4300	6503	SO:0001819	synonymous_variant	80304	exon4			AGAAAAAGAGTCT	AK025598	CCDS1705.1, CCDS46229.1	2p23.3	2012-07-30			ENSG00000163026	ENSG00000163026			26157	protein-coding gene	gene with protein product						22327622	Standard	NM_025203		Approved	FLJ21945	uc002rep.2	Q9H6R7	OTTHUMG00000125498	ENST00000295148.4:c.2058T>C	2.37:g.24253911A>G		Somatic	284	0	0		WXS	Illumina HiSeq	Phase_I	256	4	0.015625	NM_025203	D6W532|Q8IYK0|Q9HBP5	Silent	SNP	ENST00000295148.4	37	CCDS1705.1																																																																																			.	.	none		0.473	C2orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246825.1	NM_025203	
SMPDL3A	10924	hgsc.bcm.edu	37	6	123116916	123116916	+	Silent	SNP	T	T	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr6:123116916T>C	ENST00000368440.4	+	2	384	c.207T>C	c.(205-207)aaT>aaC	p.N69N	SMPDL3A_ENST00000487215.1_3'UTR|SMPDL3A_ENST00000539041.1_Intron	NM_006714.3	NP_006705.1	Q92484	ASM3A_HUMAN	sphingomyelin phosphodiesterase, acid-like 3A	69					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|cervix(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	10				GBM - Glioblastoma multiforme(226;0.236)		AAGGTGCAAATGCCTCCAACC	0.403																																					p.N69N		Atlas-SNP	.											.	SMPDL3A	31	.	0			c.T207C						PASS	.						167.0	149.0	155.0					6																	123116916		2203	4300	6503	SO:0001819	synonymous_variant	10924	exon2			TGCAAATGCCTCC	AK000184	CCDS5128.1, CCDS69190.1	6q22.32	2006-04-12			ENSG00000172594	ENSG00000172594			17389	protein-coding gene	gene with protein product	"""acid sphingomyelinase-like phosphodiesterase 3a"""	610728				12442002	Standard	XM_005266798		Approved	FLJ20177, ASM3A, ASML3a, yR36GH4.1	uc003pzg.3	Q92484	OTTHUMG00000015490	ENST00000368440.4:c.207T>C	6.37:g.123116916T>C		Somatic	265	0	0		WXS	Illumina HiSeq	Phase_I	242	10	0.0413223	NM_006714	B7Z729|Q8WV13	Silent	SNP	ENST00000368440.4	37	CCDS5128.1																																																																																			.	.	none		0.403	SMPDL3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042039.1	NM_006714	
B2M	567	hgsc.bcm.edu	37	15	45003779	45003779	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr15:45003779T>C	ENST00000558401.1	+	1	105	c.35T>C	c.(34-36)cTa>cCa	p.L12P	PATL2_ENST00000558573.1_5'Flank|B2M_ENST00000559916.1_Missense_Mutation_p.L12P|B2M_ENST00000544417.1_Missense_Mutation_p.L12P	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	12					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.A11fs*42(1)|p.L12Q(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		GTGCTCGCGCTACTCTCTCTT	0.617																																					p.L12P		Atlas-SNP	.											B2M,colon,carcinoma,0,2	B2M	99	2	2	Substitution - Missense(1)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(2)	c.T35C						PASS	.						132.0	94.0	107.0					15																	45003779		2198	4298	6496	SO:0001583	missense	567	exon1			TCGCGCTACTCTC	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.35T>C	15.37:g.45003779T>C	ENSP00000452780:p.Leu12Pro	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	95	7	0.0736842	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	T	17.66	3.443926	0.63067	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.01388	4.95	5.35	5.35	0.76521	.	9.011740	0.00721	U	0.000881	T	0.10809	0.0264	M	0.74647	2.275	0.29321	N	0.867335	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.17107	-1.0380	10	0.87932	D	0	.	11.9001	0.52678	0.0:0.0:0.0:1.0	.	12;12;12	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	P	12	ENSP00000437604:L12P	ENSP00000340858:L12P	L	+	2	0	B2M	42791071	0.253000	0.23982	0.051000	0.19133	0.007000	0.05969	3.556000	0.53734	2.371000	0.80710	0.533000	0.62120	CTA	.	.	none		0.617	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
ELF4	2000	hgsc.bcm.edu	37	X	129201410	129201410	+	Silent	SNP	C	C	T	rs369363653		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:129201410C>T	ENST00000308167.5	-	9	1657	c.1278G>A	c.(1276-1278)acG>acA	p.T426T	ELF4_ENST00000335997.7_Silent_p.T426T	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)											breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						TGGTCAGCACCGTGGTCAGTG	0.597			T	ERG	AML																																p.T426T		Atlas-SNP	.		Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	.	ELF4	67	.	0			c.G1278A						PASS	.		,	1,3834		0,0,1,1632,570	66.0	62.0	63.0		1278,1278	-0.1	1.0	X		63	0,6728		0,0,0,2428,1872	no	coding-synonymous,coding-synonymous	ELF4	NM_001127197.1,NM_001421.3	,	0,0,1,4060,2442	TT,TC,T,CC,C		0.0,0.0261,0.0095	,	426/664,426/664	129201410	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	2000	exon9			CAGCACCGTGGTC	U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.1278G>A	X.37:g.129201410C>T		Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	146	9	0.0616438	NM_001421		Silent	SNP	ENST00000308167.5	37	CCDS14617.1																																																																																			.	.	weak		0.597	ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058243.1	NM_001421	
TBC1D1	23216	hgsc.bcm.edu	37	4	38053568	38053568	+	Intron	SNP	T	T	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr4:38053568T>C	ENST00000261439.4	+	11	2265				TBC1D1_ENST00000508802.1_Silent_p.S653S	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1						membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						CAGGTCAGTCTTCAGCTCCTG	0.537																																					p.S653S		Atlas-SNP	.											.	TBC1D1	94	.	0			c.T1959C						PASS	.																																			SO:0001627	intron_variant	23216	exon12			TCAGTCTTCAGCT	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.1910+2049T>C	4.37:g.38053568T>C		Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	144	27	0.1875	NM_001253912	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Silent	SNP	ENST00000261439.4	37	CCDS33972.1	.	.	.	.	.	.	.	.	.	.	T	3.720	-0.057741	0.07317	.	.	ENSG00000065882	ENST00000443855	.	.	.	5.56	0.202	0.15190	.	.	.	.	.	T	0.29556	0.0737	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.27157	-1.0082	4	.	.	.	.	6.0231	0.19640	0.0:0.2056:0.1269:0.6675	.	.	.	.	P	145	.	.	L	+	2	0	TBC1D1	37729963	0.305000	0.24481	0.494000	0.27515	0.397000	0.30659	0.907000	0.28531	0.048000	0.15891	0.482000	0.46254	CTT	.	.	none		0.537	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	NM_015173	
FBP2	8789	hgsc.bcm.edu	37	9	97346890	97346890	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr9:97346890G>C	ENST00000375337.3	-	3	461	c.395C>G	c.(394-396)tCc>tGc	p.S132C		NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	132					carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				GGTTCCGATGGAGGCCAGGCA	0.483																																					p.S132C		Atlas-SNP	.											.	FBP2	26	.	0			c.C395G						PASS	.						150.0	122.0	132.0					9																	97346890		2203	4300	6503	SO:0001583	missense	8789	exon3			CCGATGGAGGCCA	Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.395C>G	9.37:g.97346890G>C	ENSP00000364486:p.Ser132Cys	Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	78	8	0.102564	NM_003837	Q17R39|Q6FI53	Missense_Mutation	SNP	ENST00000375337.3	37	CCDS6711.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.555699	0.86231	.	.	ENSG00000130957	ENST00000375337	T	0.79454	-1.27	4.87	4.87	0.63330	.	0.169189	0.53938	D	0.000045	D	0.89543	0.6745	M	0.88640	2.97	0.80722	D	1	D	0.71674	0.998	D	0.66196	0.942	D	0.91770	0.5427	10	0.87932	D	0	-19.1055	18.3657	0.90390	0.0:0.0:1.0:0.0	.	132	O00757	F16P2_HUMAN	C	132	ENSP00000364486:S132C	ENSP00000364486:S132C	S	-	2	0	FBP2	96386711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.542000	0.98086	2.397000	0.81536	0.655000	0.94253	TCC	.	.	none		0.483	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053189.1	NM_003837	
ZFHX3	463	hgsc.bcm.edu	37	16	72831382	72831382	+	Silent	SNP	T	T	C	rs112722798	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr16:72831382T>C	ENST00000268489.5	-	9	5871	c.5199A>G	c.(5197-5199)caA>caG	p.Q1733Q	ZFHX3_ENST00000397992.5_Silent_p.Q819Q	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1733	Poly-Gln.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				gttgttgttgttgttgctgtt	0.532																																					p.Q1733Q		Atlas-SNP	.											ZFHX3,NS,carcinoma,0,1	ZFHX3	404	1	0			c.A5199G						scavenged	.	T	,	2,4394	2.1+/-5.4	0,2,2196	44.0	41.0	42.0		2457,5199	-9.9	0.5	16	dbSNP_132	42	9,8591	3.7+/-12.6	0,9,4291	no	coding-synonymous,coding-synonymous	ZFHX3	NM_001164766.1,NM_006885.3	,	0,11,6487	CC,CT,TT		0.1047,0.0455,0.0846	,	819/2790,1733/3704	72831382	11,12985	2198	4300	6498	SO:0001819	synonymous_variant	463	exon9			TTGTTGTTGTTGC	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.5199A>G	16.37:g.72831382T>C		Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	112	3	0.0267857	NM_006885	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																			T|0.999;C|0.001	0.001	strong		0.532	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
TMSB4X	7114	hgsc.bcm.edu	37	X	12994394	12994394	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:12994394C>G	ENST00000380635.1	+	2	230	c.14C>G	c.(13-15)cCc>cGc	p.P5R	TMSB4X_ENST00000380636.1_Missense_Mutation_p.P5R|TMSB4X_ENST00000380633.1_Missense_Mutation_p.P5R|TMSB4X_ENST00000451311.2_Missense_Mutation_p.P5R			P62328	TYB4_HUMAN	thymosin beta 4, X-linked	5					actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sequestering of actin monomers (GO:0042989)	cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	poly(A) RNA binding (GO:0044822)			upper_aerodigestive_tract(1)	1						TCTGACAAACCCGATATGGCT	0.542																																					p.P5R		Atlas-SNP	.											.	TMSB4X	3	.	0			c.C14G						PASS	.						66.0	64.0	65.0					X																	12994394		2203	4300	6503	SO:0001583	missense	7114	exon2			ACAAACCCGATAT		CCDS35202.1	Xp22.2	2013-05-14	2008-02-25		ENSG00000205542	ENSG00000205542			11881	protein-coding gene	gene with protein product		300159	"""thymosin, beta 4, X chromosome"""	TMSB4		2677145, 9381176	Standard	NM_021109		Approved	TB4X	uc004cvf.3	P62328	OTTHUMG00000021144	ENST00000380635.1:c.14C>G	X.37:g.12994394C>G	ENSP00000370009:p.Pro5Arg	Somatic	348	0	0		WXS	Illumina HiSeq	Phase_I	323	20	0.0619195	NM_021109	P01253|P01254|Q546P5|Q63576|Q9UE55	Missense_Mutation	SNP	ENST00000380635.1	37	CCDS35202.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023167	0.75275	.	.	ENSG00000205542	ENST00000451311;ENST00000380636;ENST00000380635;ENST00000380633	T;T;T;T	0.61510	0.1;0.1;0.1;0.1	4.66	4.66	0.58398	.	0.000000	0.64402	U	0.000010	T	0.68476	0.3005	.	.	.	0.58432	D	0.99999	P	0.49307	0.922	P	0.51895	0.683	T	0.74685	-0.3582	9	0.87932	D	0	-6.1801	16.7451	0.85470	0.0:1.0:0.0:0.0	.	5	P62328	TYB4_HUMAN	R	5	ENSP00000414376:P5R;ENSP00000370010:P5R;ENSP00000370009:P5R;ENSP00000370007:P5R	ENSP00000370007:P5R	P	+	2	0	TMSB4X	12904315	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.929000	0.75852	2.064000	0.61679	0.600000	0.82982	CCC	.	.	none		0.542	TMSB4X-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000055779.1	NM_021109	
HTATSF1	27336	hgsc.bcm.edu	37	X	135593333	135593333	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:135593333G>A	ENST00000218364.4	+	9	1603	c.1429G>A	c.(1429-1431)Gaa>Aaa	p.E477K	HTATSF1_ENST00000535601.1_Missense_Mutation_p.E477K	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	477	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					AAGAGGGTTTGAAGGCAGCTG	0.443																																					p.E477K		Atlas-SNP	.											.	HTATSF1	66	.	0			c.G1429A						PASS	.						46.0	50.0	49.0					X																	135593333		2193	4279	6472	SO:0001583	missense	27336	exon10			GGGTTTGAAGGCA	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1429G>A	X.37:g.135593333G>A	ENSP00000218364:p.Glu477Lys	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	139	10	0.0719424	NM_001163280	D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	ENST00000218364.4	37	CCDS14657.1	.	.	.	.	.	.	.	.	.	.	G	5.369	0.253360	0.10185	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	T;T	0.04360	3.64;3.64	4.38	2.61	0.31194	.	0.642678	0.16646	N	0.205430	T	0.03477	0.0100	N	0.24115	0.695	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.40440	-0.9563	10	0.41790	T	0.15	-2.2713	5.8919	0.18917	0.3322:0.0:0.6678:0.0	.	477	O43719	HTSF1_HUMAN	K	477	ENSP00000442699:E477K;ENSP00000218364:E477K	ENSP00000218364:E477K	E	+	1	0	HTATSF1	135420999	0.007000	0.16637	0.001000	0.08648	0.006000	0.05464	1.430000	0.34914	0.607000	0.29982	0.523000	0.50628	GAA	.	.	none		0.443	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500	
IRF5	3663	hgsc.bcm.edu	37	7	128587374	128587374	+	Missense_Mutation	SNP	G	G	A	rs199508964|rs113806178|rs60344245	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr7:128587374G>A	ENST00000402030.2	+	6	596	c.524G>A	c.(523-525)cGg>cAg	p.R175Q	IRF5_ENST00000477535.1_Intron|IRF5_ENST00000473745.1_Missense_Mutation_p.R175Q|IRF5_ENST00000357234.5_Missense_Mutation_p.R191Q|IRF5_ENST00000249375.4_Missense_Mutation_p.R175Q	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	175					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						CCCACTCTGCGGCCGCCTACT	0.657																																					p.R191Q		Atlas-SNP	.											IRF5,NS,haematopoietic_neoplasm,0,2	IRF5	40	2	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.G572A						PASS	.						6.0	8.0	7.0					7																	128587374		1947	3850	5797	SO:0001583	missense	3663	exon6			CTCTGCGGCCGCC		CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.524G>A	7.37:g.128587374G>A	ENSP00000385352:p.Arg175Gln	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	89	22	0.247191	NM_001098629	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	Missense_Mutation	SNP	ENST00000402030.2	37	CCDS5808.1	628|628	0.2875457875457875|0.2875457875457875	155|155	0.3150406504065041|0.3150406504065041	88|88	0.2430939226519337|0.2430939226519337	148|148	0.25874125874125875|0.25874125874125875	237|237	0.31266490765171506|0.31266490765171506	G|G	0.019|0.019	-1.454282|-1.454282	0.01071|0.01071	.|.	.|.	ENSG00000128604|ENSG00000128604	ENST00000430204|ENST00000357234;ENST00000402030;ENST00000249375;ENST00000473745	.|D;D;D;D	.|0.97256	.|-4.25;-4.31;-4.31;-4.31	.|.	.|.	.|.	.|.	.|5.726080	.|0.00166	.|N	.|0.000000	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.08118|0.08118	0|0	0.80722|0.80722	P|P	0.0|0.0	.|B;.	.|0.02656	.|0.0;.	.|B;.	.|0.01281	.|0.0;.	T|T	0.62562|0.62562	-0.6828|-0.6828	3|7	0.06757|0.13470	T|T	0.87|0.59	.|.	.|.	.|.	.|.	.|.	164|175;191	E9PC81|Q13568;Q13568-2	.|IRF5_HUMAN;.	S|Q	164|191;175;175;175	.|ENSP00000349770:R191Q;ENSP00000385352:R175Q;ENSP00000249375:R175Q;ENSP00000419149:R175Q	ENSP00000409106:G164S|ENSP00000249375:R175Q	G|R	+|+	1|2	0|0	IRF5|IRF5	128374610|128374610	0.019000|0.019000	0.18553|0.18553	0.128000|0.128000	0.21923|0.21923	0.042000|0.042000	0.13812|0.13812	-1.450000|-1.450000	0.02390|0.02390	-1.505000|-1.505000	0.01807|0.01807	-1.490000|-1.490000	0.00973|0.00973	GGC|CGG	G|0.714;A|0.286	0.286	strong		0.657	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350934.1	NM_001098627	
IL13RA1	3597	hgsc.bcm.edu	37	X	117907928	117907928	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:117907928T>A	ENST00000371666.3	+	9	1163	c.1096T>A	c.(1096-1098)Tac>Aac	p.Y366N	IL13RA1_ENST00000371637.3_Missense_Mutation_p.Y165N	NM_001560.2	NP_001551.1	P78552	I13R1_HUMAN	interleukin 13 receptor, alpha 1	366					cell surface receptor signaling pathway (GO:0007166)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin production (GO:0002639)	interleukin-13 receptor complex (GO:0005898)|plasma membrane (GO:0005886)	interleukin-13 receptor activity (GO:0016515)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)	12						ACTCCTGCTTTACCTAAAAAG	0.428																																					p.Y366N		Atlas-SNP	.											.	IL13RA1	41	.	0			c.T1096A						PASS	.						178.0	150.0	160.0					X																	117907928		2203	4300	6503	SO:0001583	missense	3597	exon9			CTGCTTTACCTAA	U62858	CCDS14573.1	Xq24	2008-02-05			ENSG00000131724	ENSG00000131724		"""Interleukins and interleukin receptors"", ""CD molecules"""	5974	protein-coding gene	gene with protein product	"""IL13 receptor alpha-1 chain"", ""CD213a1 antigen"""	300119				8910586, 9013879	Standard	NM_001560		Approved	IL-13Ra, NR4, CD213a1	uc004eqs.3	P78552	OTTHUMG00000022258	ENST00000371666.3:c.1096T>A	X.37:g.117907928T>A	ENSP00000360730:p.Tyr366Asn	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	92	6	0.0652174	NM_001560	O95646|Q5JSL4|Q99656|Q9UDY5	Missense_Mutation	SNP	ENST00000371666.3	37	CCDS14573.1	.	.	.	.	.	.	.	.	.	.	T	16.51	3.143297	0.57044	.	.	ENSG00000131724	ENST00000371666;ENST00000371637	D	0.90732	-2.72	5.54	4.37	0.52481	.	0.089367	0.49305	D	0.000160	D	0.93504	0.7927	M	0.72894	2.215	0.40981	D	0.984779	D;D	0.89917	1.0;1.0	D;D	0.73708	0.981;0.981	D	0.92830	0.6279	10	0.87932	D	0	-17.3933	7.6269	0.28218	0.0:0.0979:0.0:0.9021	.	366;366	Q5JSL4;P78552	.;I13R1_HUMAN	N	366;165	ENSP00000360730:Y366N	ENSP00000360700:Y165N	Y	+	1	0	IL13RA1	117791956	1.000000	0.71417	0.856000	0.33681	0.596000	0.36781	4.240000	0.58701	0.834000	0.34852	0.439000	0.28862	TAC	.	.	none		0.428	IL13RA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058009.1	NM_001560	
PMPCB	9512	hgsc.bcm.edu	37	7	102937911	102937911	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr7:102937911C>T	ENST00000249269.4	+	1	43	c.5C>T	c.(4-6)gCg>gTg	p.A2V	PMPCB_ENST00000420236.2_5'UTR|PMPCB_ENST00000428154.1_Missense_Mutation_p.A2V	NM_004279.2	NP_004270.2	O75439	MPPB_HUMAN	peptidase (mitochondrial processing) beta	2					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(9)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCAGAAATGGCGGCTGCGGCG	0.652											OREG0018240	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A2V		Atlas-SNP	.											.	PMPCB	35	.	0			c.C5T						PASS	.						31.0	38.0	35.0					7																	102937911		2203	4300	6503	SO:0001583	missense	9512	exon1			AAATGGCGGCTGC	AF054182	CCDS5730.1	7q22.1	2007-07-30			ENSG00000105819	ENSG00000105819			9119	protein-coding gene	gene with protein product		603131				9653160	Standard	XM_005250717		Approved	MPPB, MPPP52	uc003vbl.3	O75439	OTTHUMG00000157205	ENST00000249269.4:c.5C>T	7.37:g.102937911C>T	ENSP00000249269:p.Ala2Val	Somatic	93	0	0	1370	WXS	Illumina HiSeq	Phase_I	95	9	0.0947368	NM_004279	O60416|Q96FV4	Missense_Mutation	SNP	ENST00000249269.4	37	CCDS5730.1	.	.	.	.	.	.	.	.	.	.	.	14.40	2.525458	0.44969	.	.	ENSG00000105819	ENST00000249269;ENST00000428154	T;T	0.13196	2.64;2.61	5.07	4.19	0.49359	.	0.385387	0.27577	N	0.018746	T	0.07503	0.0189	N	0.08118	0	0.80722	D	1	B;B;B	0.30146	0.176;0.176;0.27	B;B;B	0.28991	0.018;0.027;0.097	T	0.24657	-1.0154	10	0.87932	D	0	.	9.924	0.41481	0.0:0.9072:0.0:0.0928	.	2;2;2	B3KM34;O75439;G3V0E4	.;MPPB_HUMAN;.	V	2	ENSP00000249269:A2V;ENSP00000390035:A2V	ENSP00000249269:A2V	A	+	2	0	PMPCB	102725147	1.000000	0.71417	1.000000	0.80357	0.110000	0.19582	1.682000	0.37628	1.512000	0.48834	0.650000	0.86243	GCG	.	.	none		0.652	PMPCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347913.1	NM_004279	
PIKFYVE	200576	hgsc.bcm.edu	37	2	209218719	209218719	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:209218719A>G	ENST00000264380.4	+	40	6100	c.5942A>G	c.(5941-5943)aAg>aGg	p.K1981R		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1981	Catalytic.|PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						AATCTCCTAAAGATGGTTCGA	0.418																																					p.K1981R		Atlas-SNP	.											.	PIKFYVE	223	.	0			c.A5942G						PASS	.						142.0	145.0	144.0					2																	209218719		2203	4300	6503	SO:0001583	missense	200576	exon40			TCCTAAAGATGGT	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.5942A>G	2.37:g.209218719A>G	ENSP00000264380:p.Lys1981Arg	Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	128	7	0.0546875	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	CCDS2382.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.651372	0.88056	.	.	ENSG00000115020	ENST00000264380	T	0.30182	1.54	6.17	6.17	0.99709	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.45617	0.1351	L	0.28458	0.855	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.39860	-0.9593	10	0.59425	D	0.04	-24.4674	16.8222	0.85835	1.0:0.0:0.0:0.0	.	1981	Q9Y2I7	FYV1_HUMAN	R	1981	ENSP00000264380:K1981R	ENSP00000264380:K1981R	K	+	2	0	PIKFYVE	208926964	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.401000	0.79962	2.371000	0.80710	0.533000	0.62120	AAG	.	.	none		0.418	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
PDLIM4	8572	hgsc.bcm.edu	37	5	131607911	131607911	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr5:131607911G>A	ENST00000253754.3	+	7	1046	c.982G>A	c.(982-984)Gaa>Aaa	p.E328K	PDLIM4_ENST00000379018.3_3'UTR|P4HA2_ENST00000471826.1_Intron	NM_001131027.1|NM_003687.3	NP_001124499.1|NP_003678.2	P50479	PDLI4_HUMAN	PDZ and LIM domain 4	328							zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|urinary_tract(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGCCAAGGTGGAACTCGTCTG	0.607																																					p.E328K		Atlas-SNP	.											.	PDLIM4	22	.	0			c.G982A						PASS	.						44.0	45.0	45.0					5																	131607911		2203	4300	6503	SO:0001583	missense	8572	exon7			AAGGTGGAACTCG	AF153882	CCDS4152.1, CCDS47261.1	5q31.1	2008-02-05			ENSG00000131435	ENSG00000131435			16501	protein-coding gene	gene with protein product		603422				9573374	Standard	NM_001131027		Approved	RIL	uc003kwn.3	P50479	OTTHUMG00000059645	ENST00000253754.3:c.982G>A	5.37:g.131607911G>A	ENSP00000253754:p.Glu328Lys	Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	52	6	0.115385	NM_003687	B2R8U1|Q53Y39|Q96AT8|Q9BTW8|Q9Y292	Missense_Mutation	SNP	ENST00000253754.3	37	CCDS4152.1	.	.	.	.	.	.	.	.	.	.	G	32	5.192528	0.94960	.	.	ENSG00000131435	ENST00000253754	T	0.14516	2.5	5.05	4.16	0.48862	.	0.276256	0.34435	N	0.003965	T	0.28001	0.0690	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.02526	-1.1146	10	0.87932	D	0	-8.9848	15.2133	0.73244	0.0:0.1416:0.8584:0.0	.	328	P50479	PDLI4_HUMAN	K	328	ENSP00000253754:E328K	ENSP00000253754:E328K	E	+	1	0	PDLIM4	131635810	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	9.617000	0.98361	1.068000	0.40764	0.655000	0.94253	GAA	.	.	none		0.607	PDLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132644.2	NM_003687	
FSIP2	401024	hgsc.bcm.edu	37	2	186671112	186671112	+	Silent	SNP	T	T	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:186671112T>G	ENST00000424728.1	+	17	17079	c.17079T>G	c.(17077-17079)tcT>tcG	p.S5693S	FSIP2_ENST00000343098.5_Silent_p.S5782S			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5693										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AACTATCTTCTTCTCCAGAAC	0.373																																					p.S5782S		Atlas-SNP	.											.	FSIP2	251	.	0			c.T17346G						PASS	.						91.0	85.0	87.0					2																	186671112		1827	4088	5915	SO:0001819	synonymous_variant	401024	exon17			ATCTTCTTCTCCA	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.17079T>G	2.37:g.186671112T>G		Somatic	206	0	0		WXS	Illumina HiSeq	Phase_I	195	8	0.0410256	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Silent	SNP	ENST00000424728.1	37																																																																																				.	.	none		0.373	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
CACNA1C	775	hgsc.bcm.edu	37	12	2794937	2794937	+	Missense_Mutation	SNP	C	C	T	rs201777030		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr12:2794937C>T	ENST00000347598.4	+	46	5753	c.5753C>T	c.(5752-5754)aCg>aTg	p.T1918M	CACNA1C_ENST00000399634.1_Missense_Mutation_p.T1941M|CACNA1C_ENST00000399629.1_Missense_Mutation_p.T1887M|CACNA1C_ENST00000399641.1_Missense_Mutation_p.T1870M|CACNA1C_ENST00000406454.3_Missense_Mutation_p.T1941M|CACNA1C_ENST00000399597.1_Missense_Mutation_p.T1870M|CACNA1C_ENST00000399617.1_Missense_Mutation_p.T1905M|CACNA1C_ENST00000335762.5_Missense_Mutation_p.T1895M|CACNA1C_ENST00000399603.1_Missense_Mutation_p.T1870M|CACNA1C_ENST00000399637.1_Missense_Mutation_p.T1889M|CACNA1C_ENST00000399591.1_Missense_Mutation_p.T1878M|CACNA1C_ENST00000399644.1_Missense_Mutation_p.T1870M|CACNA1C_ENST00000399606.1_Missense_Mutation_p.T1890M|CACNA1C_ENST00000344100.3_Missense_Mutation_p.T1911M|CACNA1C_ENST00000399638.1_Missense_Mutation_p.T1898M|CACNA1C_ENST00000399595.1_Missense_Mutation_p.T1878M|CACNA1C_ENST00000399621.1_Missense_Mutation_p.T1889M|CACNA1C_ENST00000399601.1_Missense_Mutation_p.T1870M|CACNA1C_ENST00000327702.7_Missense_Mutation_p.T1905M|CACNA1C_ENST00000402845.3_Missense_Mutation_p.T1889M|CACNA1C_ENST00000399649.1_Missense_Mutation_p.T1876M|CACNA1C_ENST00000399655.1_Missense_Mutation_p.T1870M|CACNA1C-AS1_ENST00000501371.1_RNA	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1953					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.T1911M(1)|p.T1983M(1)|p.T1405M(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CGGCAACTGACGCTCCCAGAG	0.582																																					p.T1953M		Atlas-SNP	.											Q6YL47_HUMAN,trunk,malignant_melanoma,0,3	CACNA1C	1023	3	3	Substitution - Missense(3)	skin(3)	c.C5858T						scavenged	.						49.0	49.0	49.0					12																	2794937		2012	4159	6171	SO:0001583	missense	775	exon47			AACTGACGCTCCC	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5753C>T	12.37:g.2794937C>T	ENSP00000266376:p.Thr1918Met	Somatic	62	5	0.0806452		WXS	Illumina HiSeq	Phase_I	53	6	0.113208	NM_199460	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	C	15.33	2.802724	0.50315	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55	4.26	4.26	0.50523	.	29.029300	0.00550	N	0.000258	T	0.70133	0.3189	L	0.56769	1.78	0.34775	D	0.734153	P;P;D;P;P;D;D;P;P;D;P;D;P;P;D;P;P;B;P;P;D;P;P;D;D	0.65815	0.863;0.922;0.995;0.664;0.934;0.988;0.992;0.869;0.638;0.966;0.922;0.989;0.927;0.783;0.992;0.677;0.927;0.317;0.922;0.485;0.985;0.869;0.869;0.981;0.995	B;P;P;B;P;P;P;P;B;P;P;P;P;P;P;B;P;B;P;B;P;P;P;P;P	0.56916	0.238;0.595;0.809;0.146;0.756;0.647;0.795;0.595;0.282;0.553;0.595;0.736;0.521;0.595;0.65;0.391;0.521;0.299;0.595;0.229;0.542;0.595;0.595;0.46;0.809	T	0.60281	-0.7294	10	0.38643	T	0.18	.	16.9179	0.86156	0.0:1.0:0.0:0.0	.	561;1911;1867;1953;1905;1889;1870;1887;1898;1870;1890;1870;1901;1918;1870;1905;1941;1878;1876;1878;1859;1889;1889;1870;1870	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	M	1895;1870;1870;1898;1870;1889;1889;1878;1870;1918;1890;1870;1911;1887;1905;1876;1889;1870;1941;1905;1941;1878;1771	ENSP00000336982:T1895M;ENSP00000382563:T1870M;ENSP00000382552:T1870M;ENSP00000382547:T1898M;ENSP00000382506:T1870M;ENSP00000382530:T1889M;ENSP00000382546:T1889M;ENSP00000382500:T1878M;ENSP00000382549:T1870M;ENSP00000266376:T1918M;ENSP00000382515:T1890M;ENSP00000382510:T1870M;ENSP00000341092:T1911M;ENSP00000382537:T1887M;ENSP00000329877:T1905M;ENSP00000382557:T1876M;ENSP00000385724:T1889M;ENSP00000382512:T1870M;ENSP00000382542:T1941M;ENSP00000382526:T1905M;ENSP00000385896:T1941M;ENSP00000382504:T1878M	ENSP00000323129:T1771M	T	+	2	0	CACNA1C	2665198	1.000000	0.71417	0.106000	0.21319	0.488000	0.33401	5.733000	0.68571	2.202000	0.70862	0.449000	0.29647	ACG	.	.	weak		0.582	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
BTC	685	hgsc.bcm.edu	37	4	75681165	75681165	+	Missense_Mutation	SNP	C	C	T	rs375367986		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr4:75681165C>T	ENST00000395743.3	-	3	545	c.185G>A	c.(184-186)cGg>cAg	p.R62Q		NM_001729.2	NP_001720.1	P35070	BTC_HUMAN	betacellulin	62					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitosis (GO:0045840)|positive regulation of urine volume (GO:0035810)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	10			Lung(101;0.219)			GTGGCCTTTCCGCTTTGATTG	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		20016	0.0		0.0	False		,,,				2504	0.001				p.R62Q		Atlas-SNP	.											BTC,NS,carcinoma,-1,3	BTC	23	3	0			c.G185A						scavenged	.	C	GLN/ARG	0,4406	2.1+/-5.4	0,0,2203	228.0	211.0	217.0		185	2.0	0.0	4		217	1,8599	1.2+/-3.3	0,1,4299	no	missense	BTC	NM_001729.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	62/179	75681165	1,13005	2203	4300	6503	SO:0001583	missense	685	exon3			CCTTTCCGCTTTG	S55606	CCDS3566.1	4q13.3	2012-09-20			ENSG00000174808	ENSG00000174808			1121	protein-coding gene	gene with protein product		600345				8439318, 11522793	Standard	NM_001729		Approved		uc003hig.2	P35070	OTTHUMG00000130107	ENST00000395743.3:c.185G>A	4.37:g.75681165C>T	ENSP00000379092:p.Arg62Gln	Somatic	275	0	0		WXS	Illumina HiSeq	Phase_I	276	6	0.0217391	NM_001729	Q96F48	Missense_Mutation	SNP	ENST00000395743.3	37	CCDS3566.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.24|11.24	1.581121|1.581121	0.28180|0.28180	0.0|0.0	1.16E-4|1.16E-4	ENSG00000174808|ENSG00000174808	ENST00000512743|ENST00000395743	.|T	.|0.14391	.|2.51	4.69|4.69	1.96|1.96	0.26148|0.26148	.|.	.|0.483385	.|0.23847	.|N	.|0.043992	T|T	0.11410|0.11410	0.0278|0.0278	L|L	0.57536|0.57536	1.79|1.79	0.22050|0.22050	N|N	0.999393|0.999393	.|P	.|0.52577	.|0.954	.|B	.|0.41332	.|0.354	T|T	0.21211|0.21211	-1.0252|-1.0252	5|10	.|0.23891	.|T	.|0.37	-8.4393|-8.4393	5.219|5.219	0.15358|0.15358	0.1475:0.6263:0.1427:0.0835|0.1475:0.6263:0.1427:0.0835	.|.	.|62	.|P35070	.|BTC_HUMAN	R|Q	41|62	.|ENSP00000379092:R62Q	.|ENSP00000379092:R62Q	G|R	-|-	1|2	0|0	BTC|BTC	75900189|75900189	0.002000|0.002000	0.14202|0.14202	0.029000|0.029000	0.17559|0.17559	0.599000|0.599000	0.36880|0.36880	0.463000|0.463000	0.21972|0.21972	0.265000|0.265000	0.21872|0.21872	-0.123000|-0.123000	0.14984|0.14984	GGA|CGG	.	.	weak		0.428	BTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252413.1		
GPR82	27197	hgsc.bcm.edu	37	X	41586752	41586752	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:41586752A>C	ENST00000302548.4	+	3	713	c.473A>C	c.(472-474)tAc>tCc	p.Y158S	CASK_ENST00000378158.1_Intron|CASK_ENST00000421587.2_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000378154.1_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000442742.2_Intron|CASK_ENST00000378163.1_Intron	NM_080817.4	NP_543007.1	Q96P67	GPR82_HUMAN	G protein-coupled receptor 82	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	10						CTATGCATTTACATATGGGGA	0.408																																					p.Y158S		Atlas-SNP	.											.	GPR82	52	.	0			c.A473C						PASS	.						59.0	58.0	58.0					X																	41586752		2202	4299	6501	SO:0001583	missense	27197	exon3			GCATTTACATATG	AF411111	CCDS14259.1	Xp11.4	2012-08-21			ENSG00000171657	ENSG00000171657		"""GPCR / Class A : Orphans"""	4533	protein-coding gene	gene with protein product		300748				11574155	Standard	NM_080817		Approved		uc004dft.3	Q96P67	OTTHUMG00000021373	ENST00000302548.4:c.473A>C	X.37:g.41586752A>C	ENSP00000303549:p.Tyr158Ser	Somatic	228	0	0		WXS	Illumina HiSeq	Phase_I	208	18	0.0865385	NM_080817	Q5VT13	Missense_Mutation	SNP	ENST00000302548.4	37	CCDS14259.1	.	.	.	.	.	.	.	.	.	.	A	4.819	0.152221	0.09185	.	.	ENSG00000171657	ENST00000302548	T	0.36340	1.26	5.73	2.98	0.34508	GPCR, rhodopsin-like superfamily (1);	0.469762	0.19219	N	0.119739	T	0.33411	0.0862	L	0.34521	1.04	0.09310	N	1	P	0.51933	0.949	P	0.54815	0.761	T	0.08289	-1.0729	10	0.22706	T	0.39	-4.4926	4.8507	0.13535	0.5399:0.0:0.0899:0.3702	.	158	Q96P67	GPR82_HUMAN	S	158	ENSP00000303549:Y158S	ENSP00000303549:Y158S	Y	+	2	0	GPR82	41471696	0.014000	0.17966	0.138000	0.22173	0.818000	0.46254	0.717000	0.25851	0.766000	0.33244	0.486000	0.48141	TAC	.	.	none		0.408	GPR82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056261.1	NM_080817	
FAM72B	653820	hgsc.bcm.edu	37	1	120846059	120846059	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr1:120846059G>A	ENST00000369390.3	+	3	1124	c.295G>A	c.(295-297)Gga>Aga	p.G99R	FAM72B_ENST00000355228.4_Missense_Mutation_p.G59R|FAM72B_ENST00000471903.2_3'UTR	NM_001100910.1	NP_001094380.1	Q86X60	FA72B_HUMAN	family with sequence similarity 72, member B	99										large_intestine(1)|lung(2)	3	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)		CTGCAACAACGGACACTTCTG	0.388																																					p.G99R		Atlas-SNP	.											FAM72B,NS,carcinoma,0,1	FAM72B	10	1	0			c.G295A						scavenged	.						345.0	316.0	325.0					1																	120846059		1870	4114	5984	SO:0001583	missense	653820	exon3			AACAACGGACACT	AL357493	CCDS72848.1	1p12	2014-05-06			ENSG00000188610	ENSG00000188610			24805	protein-coding gene	gene with protein product		614711					Standard	NM_001100910		Approved	RP11-439A17.6	uc009whp.3	Q86X60	OTTHUMG00000185025	ENST00000369390.3:c.295G>A	1.37:g.120846059G>A	ENSP00000358397:p.Gly99Arg	Somatic	847	8	0.0094451		WXS	Illumina HiSeq	Phase_I	689	13	0.0188679	NM_001100910	B2RPQ5|Q5QP15	Missense_Mutation	SNP	ENST00000369390.3	37	CCDS41374.1	.	.	.	.	.	.	.	.	.	.	g	18.03	3.532588	0.64972	.	.	ENSG00000188610	ENST00000369392;ENST00000369390;ENST00000452190;ENST00000355228	T;T;T	0.38401	1.14;1.14;1.14	2.54	2.54	0.30619	.	0.000000	0.85682	U	0.000000	T	0.36166	0.0957	M	0.83603	2.65	0.54753	D	0.999989	D;B	0.63880	0.993;0.295	P;B	0.49361	0.608;0.056	T	0.42548	-0.9445	10	0.54805	T	0.06	.	10.8119	0.46551	0.0:0.0:1.0:0.0	.	99;59	Q86X60;Q86X60-2	FA72B_HUMAN;.	R	70;99;70;59	ENSP00000358397:G99R;ENSP00000392882:G70R;ENSP00000347368:G59R	ENSP00000347368:G59R	G	+	1	0	FAM72B	120647582	1.000000	0.71417	0.995000	0.50966	0.956000	0.61745	7.236000	0.78154	1.431000	0.47355	0.398000	0.26397	GGA	.	.	weak		0.388	FAM72B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098437.1		
TTN	7273	hgsc.bcm.edu	37	2	179429212	179429212	+	Missense_Mutation	SNP	C	C	A	rs371910831		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:179429212C>A	ENST00000591111.1	-	276	76948	c.76724G>T	c.(76723-76725)cGc>cTc	p.R25575L	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R18343L|TTN_ENST00000589042.1_Missense_Mutation_p.R27216L|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R18151L|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R18276L|TTN_ENST00000342992.6_Missense_Mutation_p.R24648L|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25575	Fibronectin type-III 86. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCATCCAGCGGCCATCAGG	0.368																																					p.R27216L		Atlas-SNP	.											TTN_ENST00000359218,colon,carcinoma,-1,6	TTN	18412	6	0			c.G81647T						scavenged	.						70.0	66.0	67.0					2																	179429212		1863	4106	5969	SO:0001583	missense	7273	exon326			ATCCAGCGGCCAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76724G>T	2.37:g.179429212C>A	ENSP00000465570:p.Arg25575Leu	Somatic	222	0	0		WXS	Illumina HiSeq	Phase_I	211	3	0.014218	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	15.85	2.953735	0.53293	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	6.16	6.16	0.99307	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71459	0.3342	L	0.53671	1.685	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.70421	-0.4876	9	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	18151;18276;18343;25575	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	24648;18151;18343;18276;18149	ENSP00000343764:R24648L;ENSP00000434586:R18151L;ENSP00000340554:R18343L;ENSP00000352154:R18276L	ENSP00000340554:R18343L	R	-	2	0	TTN	179137458	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	7.770000	0.85390	2.937000	0.99478	0.650000	0.86243	CGC	.	.	alt		0.368	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
RBM10	8241	hgsc.bcm.edu	37	X	47045745	47045745	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:47045745G>A	ENST00000377604.3	+	23	3368	c.2626G>A	c.(2626-2628)Ggc>Agc	p.G876S	RBM10_ENST00000329236.7_Missense_Mutation_p.G798S|RBM10_ENST00000345781.6_Missense_Mutation_p.G799S	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	876	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						AGAGGGCAGCGGCCTGGGCCG	0.647																																					p.G941S	Melanoma(171;120 2705 19495 39241)	Atlas-SNP	.											.	RBM10	117	.	0			c.G2821A						PASS	.						56.0	53.0	54.0					X																	47045745		2199	4292	6491	SO:0001583	missense	8241	exon23			GGCAGCGGCCTGG	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.2626G>A	X.37:g.47045745G>A	ENSP00000366829:p.Gly876Ser	Somatic	167	0	0		WXS	Illumina HiSeq	Phase_I	204	16	0.0784314	NM_001204468	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	ENST00000377604.3	37	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006668	0.93287	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	T;T;T	0.80994	-1.44;-1.44;-1.44	5.53	5.53	0.82687	D111/G-patch (3);	0.000000	0.56097	D	0.000033	D	0.91442	0.7299	M	0.90425	3.115	0.58432	D	0.999998	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;0.998	D	0.93001	0.6423	10	0.87932	D	0	-22.4447	16.0209	0.80493	0.0:0.0:1.0:0.0	.	799;941;875;798;876	P98175-3;Q7Z3D7;P98175-2;P98175-4;P98175	.;.;.;.;RBM10_HUMAN	S	876;798;799	ENSP00000366829:G876S;ENSP00000328848:G798S;ENSP00000329659:G799S	ENSP00000328848:G798S	G	+	1	0	RBM10	46930689	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.359000	0.97115	2.471000	0.83476	0.600000	0.82982	GGC	.	.	none		0.647	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	
PLCZ1	89869	hgsc.bcm.edu	37	12	18841114	18841114	+	Silent	SNP	T	T	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr12:18841114T>C	ENST00000538330.1	-	9	1227	c.846A>G	c.(844-846)tcA>tcG	p.S282S	PLCZ1_ENST00000447925.2_Silent_p.S498S|PLCZ1_ENST00000266505.7_Silent_p.S500S|PLCZ1_ENST00000435379.1_Silent_p.S305S|PLCZ1_ENST00000534932.1_5'UTR|PLCZ1_ENST00000541695.1_Silent_p.S363S|PLCZ1_ENST00000539875.1_Silent_p.S307S					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					CTTTGTTAGATGATGAATGAG	0.318																																					p.S500S		Atlas-SNP	.											.	PLCZ1	107	.	0			c.A1500G						PASS	.						94.0	103.0	100.0					12																	18841114		2203	4298	6501	SO:0001819	synonymous_variant	89869	exon13			GTTAGATGATGAA	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.846A>G	12.37:g.18841114T>C		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	93	7	0.0752688	NM_033123		Silent	SNP	ENST00000538330.1	37		.	.	.	.	.	.	.	.	.	.	T	1.226	-0.625562	0.03610	.	.	ENSG00000139151	ENST00000536023	.	.	.	5.39	0.37	0.16160	.	.	.	.	.	T	0.21718	0.0523	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22977	-1.0201	4	.	.	.	.	2.5671	0.04785	0.1216:0.0984:0.3429:0.4371	.	.	.	.	V	70	.	.	I	-	1	0	PLCZ1	18732381	0.003000	0.15002	0.004000	0.12327	0.331000	0.28603	-0.103000	0.10940	0.407000	0.25591	0.260000	0.18958	ATC	.	.	none		0.318	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000401666.3	NM_033123	
ADRM1	11047	hgsc.bcm.edu	37	20	60878716	60878716	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr20:60878716T>G	ENST00000253003.2	+	2	138	c.92T>G	c.(91-93)aTg>aGg	p.M31R	RP11-157P1.4_ENST00000414042.1_RNA|ADRM1_ENST00000462554.1_3'UTR	NM_007002.2|NM_175573.1	NP_008933.2|NP_783163.1	Q16186	ADRM1_HUMAN	adhesion regulating molecule 1	31	Interaction with PSMD1.|PH.				positive regulation of endopeptidase activity (GO:0010950)|proteasome assembly (GO:0043248)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|protease binding (GO:0002020)|proteasome binding (GO:0070628)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|urinary_tract(1)	5	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)			GCGGGAAAGATGTCCCTGAAG	0.587																																					p.M31R		Atlas-SNP	.											.	ADRM1	28	.	0			c.T92G						PASS	.						79.0	84.0	82.0					20																	60878716		2203	4300	6503	SO:0001583	missense	11047	exon2			GAAAGATGTCCCT	D64154	CCDS13496.1, CCDS74747.1	20q13.33	2008-05-22			ENSG00000130706	ENSG00000130706			15759	protein-coding gene	gene with protein product		610650				8033103	Standard	NM_007002		Approved	GP110, Rpn13, ARM1	uc002yco.3	Q16186	OTTHUMG00000032904	ENST00000253003.2:c.92T>G	20.37:g.60878716T>G	ENSP00000253003:p.Met31Arg	Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	37	7	0.189189	NM_175573	A0PKB1|Q96FJ7|Q9H1P2	Missense_Mutation	SNP	ENST00000253003.2	37	CCDS13496.1	.	.	.	.	.	.	.	.	.	.	T	19.55	3.849175	0.71603	.	.	ENSG00000130706	ENST00000370744;ENST00000253003	.	.	.	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	D	0.84051	0.5387	M	0.90145	3.09	0.80722	D	1	D;P	0.65815	0.995;0.935	D;D	0.76575	0.988;0.971	D	0.87579	0.2483	9	0.87932	D	0	-22.7347	13.6872	0.62524	0.0:0.0:0.0:1.0	.	31;31	B4DMP7;Q16186	.;ADRM1_HUMAN	R	31	.	ENSP00000253003:M31R	M	+	2	0	ADRM1	60312111	1.000000	0.71417	0.999000	0.59377	0.825000	0.46686	7.676000	0.84012	1.707000	0.51288	0.459000	0.35465	ATG	.	.	none		0.587	ADRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080007.1		
OR4C13	283092	hgsc.bcm.edu	37	11	49974680	49974680	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr11:49974680T>A	ENST00000555099.1	+	1	738	c.706T>A	c.(706-708)Tct>Act	p.S236T		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						CGAAGCCCTCTCTACCTGTGT	0.463																																					p.S236T		Atlas-SNP	.											.	OR4C13	96	.	0			c.T706A						PASS	.						181.0	155.0	164.0					11																	49974680		2201	4296	6497	SO:0001583	missense	283092	exon1			GCCCTCTCTACCT	AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.706T>A	11.37:g.49974680T>A	ENSP00000452277:p.Ser236Thr	Somatic	227	0	0		WXS	Illumina HiSeq	Phase_I	185	9	0.0486486	NM_001001955	A6NJJ3|B9EH30|Q6IF48|Q96R68	Missense_Mutation	SNP	ENST00000555099.1	37	CCDS31495.1	.	.	.	.	.	.	.	.	.	.	.	9.238	1.037466	0.19669	.	.	ENSG00000258817	ENST00000555099	T	0.00295	8.25	2.91	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46145	D	0.000319	T	0.00695	0.0023	M	0.88031	2.925	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.25222	-1.0138	9	.	.	.	.	9.2733	0.37684	0.0:0.0:0.0:1.0	.	236	Q8NGP0	OR4CD_HUMAN	T	236	ENSP00000452277:S236T	.	S	+	1	0	OR4C13	49931256	0.000000	0.05858	0.955000	0.39395	0.029000	0.11900	0.475000	0.22164	1.342000	0.45619	0.156000	0.16432	TCT	.	.	none		0.463	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391103.1	NM_001001955	
RYR2	6262	hgsc.bcm.edu	37	1	237872827	237872827	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr1:237872827G>T	ENST00000366574.2	+	70	10507	c.10190G>T	c.(10189-10191)cGc>cTc	p.R3397L	RYR2_ENST00000542537.1_Missense_Mutation_p.R3381L|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.R3395L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3397					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAGCTCTTCCGCATGGTGGCT	0.438																																					p.R3397L		Atlas-SNP	.											RYR2,NS,carcinoma,0,1	RYR2	1273	1	0			c.G10190T						scavenged	.						95.0	94.0	94.0					1																	237872827		1937	4135	6072	SO:0001583	missense	6262	exon70			TCTTCCGCATGGT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10190G>T	1.37:g.237872827G>T	ENSP00000355533:p.Arg3397Leu	Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	148	3	0.0202703	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983443	0.53827	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	T;D;T	0.96716	-0.18;-4.1;-0.18	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000005	D	0.97945	0.9324	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97812	1.0251	10	0.45353	T	0.12	-10.8144	19.3938	0.94596	0.0:0.0:1.0:0.0	.	3397	Q92736	RYR2_HUMAN	L	3397;3395;3381;352	ENSP00000355533:R3397L;ENSP00000353174:R3395L;ENSP00000443798:R3381L	ENSP00000353174:R3395L	R	+	2	0	RYR2	235939450	1.000000	0.71417	0.989000	0.46669	0.949000	0.60115	5.425000	0.66470	2.576000	0.86940	0.655000	0.94253	CGC	.	.	none		0.438	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
C4orf48	401115	hgsc.bcm.edu	37	4	2044128	2044128	+	Missense_Mutation	SNP	C	C	T	rs570712	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr4:2044128C>T	ENST00000409860.1	+	2	201	c.50C>T	c.(49-51)cCg>cTg	p.P17L	C4orf48_ENST00000382878.3_Missense_Mutation_p.P61L|C4orf48_ENST00000409248.4_Missense_Mutation_p.P50L	NM_001141936.2	NP_001135408	Q5BLP8	CD048_HUMAN	chromosome 4 open reading frame 48	17				P -> L (in Ref. 4; AI929674). {ECO:0000305}.		extracellular region (GO:0005576)				kidney(1)|skin(2)	3						ccgccgccgccgctgctgctg	0.806													C|||	4972	0.992812	0.9728	1.0	5008	,	,		4692	1.0		1.0	False		,,,				2504	1.0				p.P50L		Atlas-SNP	.											.	C4orf48	4	.	0			c.C149T						PASS	.						1.0	1.0	1.0					4																	2044128		37	208	245	SO:0001583	missense	401115	exon2			CGCCGCCGCTGCT		CCDS47000.1, CCDS47000.2, CCDS54707.1	4p16.3	2012-09-03			ENSG00000243449	ENSG00000243449			34437	protein-coding gene	gene with protein product		614690				21287218	Standard	NM_001141936		Approved		uc021xkn.1	Q5BLP8	OTTHUMG00000154503	ENST00000409860.1:c.50C>T	4.37:g.2044128C>T	ENSP00000386528:p.Pro17Leu	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	7	7	1	NM_001168243	B6ZDN0|B7ZBI7|B7ZBI8	Missense_Mutation	SNP	ENST00000409860.1	37	CCDS47000.2	1880	0.8608058608058609	416	0.8455284552845529	285	0.787292817679558	530	0.9265734265734266	649	0.8562005277044855	C	0.045	-1.270959	0.01421	.	.	ENSG00000243449	ENST00000382878;ENST00000409248;ENST00000409860	.	.	.	2.86	-3.27	0.05048	.	0.685323	0.13031	U	0.419306	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.35151	-0.9800	7	0.02654	T	1	-1.1219	8.057	0.30610	0.0:0.3609:0.0:0.6391	rs570712	17;61	Q5BLP8;Q5BLP8-2	CD048_HUMAN;.	L	61;50;17	.	ENSP00000372331:P61L	P	+	2	0	C4orf48	2013926	0.197000	0.23362	0.016000	0.15963	0.431000	0.31685	1.890000	0.39728	-0.746000	0.04766	-0.450000	0.05554	CCG	C|0.139;T|0.861	0.861	strong		0.806	C4orf48-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335537.1	NM_001141936	
XPO1	7514	hgsc.bcm.edu	37	2	61719472	61719472	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:61719472C>T	ENST00000401558.2	-	15	2438	c.1711G>A	c.(1711-1713)Gaa>Aaa	p.E571K	XPO1_ENST00000406957.1_Missense_Mutation_p.E571K|XPO1_ENST00000404992.2_Missense_Mutation_p.E571K	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	571	Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)	p.E571K(5)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TGCATGAATTCGAACAGCTTG	0.313			Mis		CLL																																p.E571K		Atlas-SNP	.	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	XPO1,NS,carcinoma,0,17	XPO1	108	17	5	Substitution - Missense(5)	haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|prostate(1)|endometrium(1)	c.G1711A						scavenged	.						66.0	63.0	64.0					2																	61719472		2203	4300	6503	SO:0001583	missense	7514	exon15			TGAATTCGAACAG	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.1711G>A	2.37:g.61719472C>T	ENSP00000384863:p.Glu571Lys	Somatic	269	0	0		WXS	Illumina HiSeq	Phase_I	262	8	0.0305344	NM_003400	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	37	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	C	36	5.629400	0.96671	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	T;T;T	0.66099	-0.19;-0.19;-0.19	5.63	5.63	0.86233	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85856	0.5794	H	0.94734	3.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88632	0.3170	10	0.66056	D	0.02	-19.4383	20.0572	0.97657	0.0:1.0:0.0:0.0	.	218;571	B3KWD0;O14980	.;XPO1_HUMAN	K	571	ENSP00000384863:E571K;ENSP00000385942:E571K;ENSP00000385559:E571K	ENSP00000384863:E571K	E	-	1	0	XPO1	61572976	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	7.722000	0.84778	2.826000	0.97356	0.655000	0.94253	GAA	.	.	none		0.313	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400	
KPRP	448834	hgsc.bcm.edu	37	1	152733644	152733644	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr1:152733644C>G	ENST00000606109.1	+	1	1608	c.1580C>G	c.(1579-1581)gCt>gGt	p.A527G	KPRP_ENST00000368773.1_Missense_Mutation_p.A527G			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	527						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACACCGAAGCTCCCTACTGT	0.602																																					p.A527G		Atlas-SNP	.											.	KPRP	152	.	0			c.C1580G						PASS	.						74.0	70.0	71.0					1																	152733644		2203	4300	6503	SO:0001583	missense	448834	exon2			CCGAAGCTCCCTA	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1580C>G	1.37:g.152733644C>G	ENSP00000475216:p.Ala527Gly	Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	83	6	0.0722892	NM_001025231		Missense_Mutation	SNP	ENST00000606109.1	37	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.348734	0.24426	.	.	ENSG00000203786	ENST00000368773	T	0.12984	2.63	4.61	1.46	0.22682	.	0.519669	0.16240	N	0.223183	T	0.02083	0.0065	N	0.21194	0.64	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.46925	-0.9156	10	0.22706	T	0.39	-2.3812	4.8838	0.13692	0.0:0.5548:0.2368:0.2084	.	527	Q5T749	KPRP_HUMAN	G	527	ENSP00000357762:A527G	ENSP00000357762:A527G	A	+	2	0	KPRP	151000268	0.848000	0.29623	0.007000	0.13788	0.317000	0.28152	1.056000	0.30480	0.224000	0.20940	0.462000	0.41574	GCT	.	.	none		0.602	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231	
WDR53	348793	hgsc.bcm.edu	37	3	196281315	196281315	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr3:196281315T>C	ENST00000332629.5	-	4	1411	c.844A>G	c.(844-846)Aca>Gca	p.T282A	WDR53_ENST00000433160.1_Missense_Mutation_p.T123A|WDR53_ENST00000429115.1_Missense_Mutation_p.T121A	NM_182627.1	NP_872433.1	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53	282										breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	13	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		GTACGTTTTGTGGGACTCTTC	0.443																																					p.T282A		Atlas-SNP	.											.	WDR53	26	.	0			c.A844G						PASS	.						244.0	210.0	221.0					3																	196281315		2203	4300	6503	SO:0001583	missense	348793	exon4			GTTTTGTGGGACT	BC054030	CCDS3318.1	3q29	2013-01-09			ENSG00000185798	ENSG00000185798		"""WD repeat domain containing"""	28786	protein-coding gene	gene with protein product		615110				12477932	Standard	NM_182627		Approved	MGC64882, MGC12928	uc003fwt.3	Q7Z5U6	OTTHUMG00000155572	ENST00000332629.5:c.844A>G	3.37:g.196281315T>C	ENSP00000328079:p.Thr282Ala	Somatic	669	0	0		WXS	Illumina HiSeq	Phase_I	619	28	0.0452342	NM_182627	A0MNP1	Missense_Mutation	SNP	ENST00000332629.5	37	CCDS3318.1	.	.	.	.	.	.	.	.	.	.	T	0.841	-0.742019	0.03088	.	.	ENSG00000185798	ENST00000332629;ENST00000429115;ENST00000433160	T;T;T	0.72505	-0.66;1.24;1.24	5.67	1.29	0.21616	.	0.959404	0.08745	N	0.899979	T	0.47154	0.1430	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25012	-1.0144	10	0.14656	T	0.56	-7.5464	8.8373	0.35119	0.0:0.6094:0.0:0.3906	.	282	Q7Z5U6	WDR53_HUMAN	A	282;121;123	ENSP00000328079:T282A;ENSP00000396668:T121A;ENSP00000410677:T123A	ENSP00000328079:T282A	T	-	1	0	WDR53	197765712	0.000000	0.05858	0.008000	0.14137	0.027000	0.11550	0.693000	0.25497	0.229000	0.21039	0.528000	0.53228	ACA	.	.	none		0.443	WDR53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340689.1	NM_182627	
SIGLEC5	8778	hgsc.bcm.edu	37	19	52132668	52132668	+	Missense_Mutation	SNP	T	T	C	rs34553740		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr19:52132668T>C	ENST00000534261.2	-	4	1042	c.643A>G	c.(643-645)Atg>Gtg	p.M215V	SIGLEC5_ENST00000222107.4_Missense_Mutation_p.M215V|SIGLEC5_ENST00000570106.2_Missense_Mutation_p.M215V|SIGLEC5_ENST00000429354.3_Missense_Mutation_p.M215V|SIGLEC5_ENST00000599649.1_Missense_Mutation_p.M215V			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	215	Ig-like C2-type 1.		M -> V (in dbSNP:rs1807124).		cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.M215V(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		TGGCGTTTCATCTGACAGGTG	0.637																																					p.M215V		Atlas-SNP	.											SIGLEC5,NS,carcinoma,0,1	SIGLEC5	67	1	1	Substitution - Missense(1)	prostate(1)	c.A643G						scavenged	.						122.0	109.0	113.0					19																	52132668		2203	4300	6503	SO:0001583	missense	8778	exon3			GTTTCATCTGACA	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.643A>G	19.37:g.52132668T>C	ENSP00000473238:p.Met215Val	Somatic	541	5	0.00924214		WXS	Illumina HiSeq	Phase_I	533	13	0.0243902	NM_003830		Missense_Mutation	SNP	ENST00000534261.2	37	CCDS33088.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.691237	0.00731	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	T;T	0.02050	4.48;4.48	3.69	2.65	0.31530	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.42682	N	0.000676	T	0.00412	0.0013	N	0.00023	-2.71	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44651	-0.9314	10	0.02654	T	1	.	6.1979	0.20559	0.0:0.7599:0.0:0.2401	rs34553740	215	O15389	SIGL5_HUMAN	V	215	ENSP00000222107:M215V;ENSP00000415200:M215V	ENSP00000222107:M215V	M	-	1	0	SIGLEC5	56824480	0.020000	0.18652	0.004000	0.12327	0.034000	0.12701	1.066000	0.30604	0.367000	0.24454	-0.320000	0.08662	ATG	.	.	weak		0.637	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830	
INTS3	65123	hgsc.bcm.edu	37	1	153741377	153741377	+	Missense_Mutation	SNP	T	T	G	rs372522734		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr1:153741377T>G	ENST00000318967.2	+	22	2821	c.2253T>G	c.(2251-2253)gaT>gaG	p.D751E	INTS3_ENST00000456435.1_Missense_Mutation_p.D545E|INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000512605.1_Missense_Mutation_p.D545E|INTS3_ENST00000435409.2_Missense_Mutation_p.D751E	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	752					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AGTTTCCAGATGAAACCTTGA	0.488																																					p.D751E		Atlas-SNP	.											.	INTS3	83	.	0			c.T2253G						PASS	.						93.0	89.0	90.0					1																	153741377		2203	4300	6503	SO:0001583	missense	65123	exon22			TCCAGATGAAACC	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.2253T>G	1.37:g.153741377T>G	ENSP00000318641:p.Asp751Glu	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	84	4	0.047619	NM_023015	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	ENST00000318967.2	37	CCDS1052.1	.	.	.	.	.	.	.	.	.	.	T	12.58	1.979299	0.34942	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	5.46	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.34019	0.0883	N	0.10874	0.06	0.44085	D	0.996848	D;D;D	0.61697	0.99;0.984;0.99	D;D;D	0.75484	0.986;0.935;0.971	T	0.24728	-1.0152	9	0.19590	T	0.45	.	9.4306	0.38608	0.0:0.0845:0.0:0.9155	.	545;752;751	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	E	751;545;751;545	.	ENSP00000318641:D751E	D	+	3	2	INTS3	152008001	0.997000	0.39634	1.000000	0.80357	0.968000	0.65278	0.276000	0.18716	0.920000	0.36970	0.482000	0.46254	GAT	.	.	none		0.488	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	
VMA21	203547	hgsc.bcm.edu	37	X	150573449	150573449	+	Silent	SNP	C	C	G	rs139323488	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chrX:150573449C>G	ENST00000330374.6	+	3	330	c.225C>G	c.(223-225)gcC>gcG	p.A75A	VMA21_ENST00000370361.1_Silent_p.A130A|VMA21_ENST00000477649.1_3'UTR	NM_001017980.3	NP_001017980.1			VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)	7						CAGTGGTCGCCGTCCATGTGG	0.458																																					p.A75A		Atlas-SNP	.											.	VMA21	17	.	0			c.C225G						PASS	.						137.0	108.0	118.0					X																	150573449		2203	4300	6503	SO:0001819	synonymous_variant	203547	exon3			GGTCGCCGTCCAT	AK096835	CCDS35430.1	Xq28	2014-09-17			ENSG00000160131	ENSG00000160131			22082	protein-coding gene	gene with protein product		300913	"""myopathy with excessive autophagy"""	MEAX		2892402, 10757644, 19379691	Standard	NM_001017980		Approved	XMEA	uc004feu.3	Q3ZAQ7	OTTHUMG00000024168	ENST00000330374.6:c.225C>G	X.37:g.150573449C>G		Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	179	11	0.0614525	NM_001017980		Silent	SNP	ENST00000330374.6	37	CCDS35430.1																																																																																			C|0.996;T|0.004	.	alt		0.458	VMA21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060876.1	NM_001017980	
RBMXL2	27288	hgsc.bcm.edu	37	11	7110751	7110751	+	Missense_Mutation	SNP	A	A	G	rs11041171	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr11:7110751A>G	ENST00000306904.5	+	1	587	c.400A>G	c.(400-402)Acg>Gcg	p.T134A		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	134	Arg/Gly/Pro-rich.		T -> A (in dbSNP:rs11041171). {ECO:0000269|PubMed:10958650, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.			nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CGGCGGCTACACGGCGGATTT	0.786													G|||	4837	0.965855	0.8744	0.9928	5008	,	,		3958	1.0		1.0	False		,,,				2504	1.0				p.T134A		Atlas-SNP	.											.	RBMXL2	47	.	0			c.A400G						PASS	.						1.0	1.0	1.0					11																	7110751		553	1369	1922	SO:0001583	missense	27288	exon1			GGCTACACGGCGG	AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.400A>G	11.37:g.7110751A>G	ENSP00000304139:p.Thr134Ala	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	6	6	1	NM_014469	Q6PEZ2|Q9NQU0	Missense_Mutation	SNP	ENST00000306904.5	37	CCDS7777.1	2013	0.9217032967032966	395	0.8028455284552846	339	0.93646408839779	560	0.9790209790209791	719	0.9485488126649076	G	0.046	-1.264680	0.01433	.	.	ENSG00000170748	ENST00000306904	T	0.75050	-0.9	2.1	-2.91	0.05631	.	0.996198	0.08132	N	0.993048	T	0.00012	0.0000	N	0.11560	0.145	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.32025	-0.9922	9	0.14252	T	0.57	.	1.3858	0.02240	0.2169:0.2957:0.3372:0.1502	rs11041171;rs17857473	134	O75526	HNRGT_HUMAN	A	134	ENSP00000304139:T134A	ENSP00000304139:T134A	T	+	1	0	RBMXL2	7067327	0.014000	0.17966	0.000000	0.03702	0.013000	0.08279	-1.159000	0.03150	-1.383000	0.02106	-2.179000	0.00317	ACG	A|0.078;G|0.922	0.922	strong		0.786	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384552.1	NM_014469	
FAM13C	220965	hgsc.bcm.edu	37	10	61022354	61022354	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr10:61022354G>A	ENST00000373868.2	-	10	1163	c.1076C>T	c.(1075-1077)cCt>cTt	p.P359L	FAM13C_ENST00000422313.2_Missense_Mutation_p.P359L|FAM13C_ENST00000442566.3_Missense_Mutation_p.P380L|FAM13C_ENST00000419214.2_Intron|FAM13C_ENST00000468840.2_Missense_Mutation_p.P276L|FAM13C_ENST00000373867.3_Missense_Mutation_p.P276L|FAM13C_ENST00000277705.6_Missense_Mutation_p.P380L|FAM13C_ENST00000435852.2_Missense_Mutation_p.P359L	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	359								p.P359R(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CAGGTTTCTAGGTGGACCTTT	0.493																																					p.P359L		Atlas-SNP	.											FAM13C_ENST00000422313,NS,carcinoma,0,2	FAM13C	124	2	1	Substitution - Missense(1)	lung(1)	c.C1076T						PASS	.						89.0	89.0	89.0					10																	61022354		2203	4300	6503	SO:0001583	missense	220965	exon10			TTTCTAGGTGGAC	U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.1076C>T	10.37:g.61022354G>A	ENSP00000362975:p.Pro359Leu	Somatic	190	0	0		WXS	Illumina HiSeq	Phase_I	159	10	0.0628931	NM_198215	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	ENST00000373868.2	37	CCDS7255.1	.	.	.	.	.	.	.	.	.	.	G	8.792	0.930800	0.18131	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000468840;ENST00000435852;ENST00000422313	T;T;T;T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89	5.72	1.65	0.23941	.	0.704485	0.13552	N	0.379439	T	0.61035	0.2315	L	0.47716	1.5	0.09310	N	1	B;B;B;B	0.11235	0.003;0.001;0.004;0.001	B;B;B;B	0.14023	0.004;0.006;0.01;0.003	T	0.52719	-0.8538	10	0.48119	T	0.1	-0.0153	1.2001	0.01883	0.162:0.2361:0.3334:0.2684	.	359;276;359;359	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31	.;.;.;FA13C_HUMAN	L	276;359;380;380;276;359;359	ENSP00000362974:P276L;ENSP00000362975:P359L;ENSP00000395661:P380L;ENSP00000277705:P380L;ENSP00000423896:P276L;ENSP00000392302:P359L;ENSP00000400241:P359L	ENSP00000277705:P380L	P	-	2	0	FAM13C	60692360	0.287000	0.24315	0.110000	0.21437	0.648000	0.38561	0.848000	0.27710	0.306000	0.22856	0.563000	0.77884	CCT	.	.	none		0.493	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2		
MUC6	4588	hgsc.bcm.edu	37	11	1018511	1018511	+	Silent	SNP	G	G	A			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr11:1018511G>A	ENST00000421673.2	-	31	4340	c.4290C>T	c.(4288-4290)acC>acT	p.T1430T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1430	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GATAGGTAGTGGTGGCATGGA	0.572																																					p.T1430T		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,0,2	MUC6	408	2	0			c.C4290T						scavenged	.						295.0	292.0	293.0					11																	1018511		2173	4264	6437	SO:0001819	synonymous_variant	4588	exon31			GGTAGTGGTGGCA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4290C>T	11.37:g.1018511G>A		Somatic	378	1	0.0026455		WXS	Illumina HiSeq	Phase_I	335	5	0.0149254	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																			.	.	none		0.572	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
ZNF607	84775	hgsc.bcm.edu	37	19	38189064	38189064	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr19:38189064A>C	ENST00000355202.4	-	5	2563	c.1968T>G	c.(1966-1968)agT>agG	p.S656R	CTD-2528L19.4_ENST00000586606.2_Intron|ZNF607_ENST00000395835.3_Missense_Mutation_p.S655R	NM_032689.4	NP_116078.4	Q96SK3	ZN607_HUMAN	zinc finger protein 607	656					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|lung(8)|urinary_tract(1)	27			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			GTTCATGGCTACTATTAAAAG	0.393																																					p.S656R		Atlas-SNP	.											.	ZNF607	82	.	0			c.T1968G						PASS	.						106.0	103.0	104.0					19																	38189064		2203	4300	6503	SO:0001583	missense	84775	exon5			ATGGCTACTATTA	AK127464	CCDS33006.1, CCDS54259.1	19q13.1	2013-01-08				ENSG00000198182		"""Zinc fingers, C2H2-type"", ""-"""	28192	protein-coding gene	gene with protein product						14702039	Standard	NM_032689		Approved	MGC13071, FLJ14802	uc002ohc.2	Q96SK3		ENST00000355202.4:c.1968T>G	19.37:g.38189064A>C	ENSP00000347338:p.Ser656Arg	Somatic	206	0	0		WXS	Illumina HiSeq	Phase_I	188	8	0.0425532	NM_032689	F5H141|Q6ZMN2|Q6ZMN4|Q96C40	Missense_Mutation	SNP	ENST00000355202.4	37	CCDS33006.1	.	.	.	.	.	.	.	.	.	.	A	7.766	0.706483	0.15239	.	.	ENSG00000198182	ENST00000355202;ENST00000395835	T;T	0.28069	1.63;1.63	1.83	-3.66	0.04489	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11623	0.0283	N	0.11698	0.16	0.09310	N	1	B;B	0.26081	0.141;0.068	B;B	0.29077	0.098;0.062	T	0.26395	-1.0104	9	0.12430	T	0.62	.	0.6026	0.00747	0.2396:0.2281:0.3116:0.2206	.	656;655	Q96SK3;F5H141	ZN607_HUMAN;.	R	656;655	ENSP00000347338:S656R;ENSP00000438015:S655R	ENSP00000347338:S656R	S	-	3	2	ZNF607	42880904	0.000000	0.05858	0.000000	0.03702	0.929000	0.56500	-1.367000	0.02583	-2.253000	0.00698	0.260000	0.18958	AGT	.	.	none		0.393	ZNF607-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459502.2	NM_032689	
RFC4	5984	hgsc.bcm.edu	37	3	186507948	186507948	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr3:186507948T>C	ENST00000392481.2	-	10	1260	c.979A>G	c.(979-981)Atc>Gtc	p.I327V	SNORA63_ENST00000363450.1_RNA|RFC4_ENST00000433496.1_Missense_Mutation_p.I300V|SNORA4_ENST00000584302.1_RNA|RFC4_ENST00000296273.2_Missense_Mutation_p.I327V	NM_181573.2	NP_853551.1	P35249	RFC4_HUMAN	replication factor C (activator 1) 4, 37kDa	327					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		TTTTCTGTGATAATAGACTTC	0.353																																					p.I327V		Atlas-SNP	.											.	RFC4	54	.	0			c.A979G						PASS	.						107.0	103.0	105.0					3																	186507948		2203	4300	6503	SO:0001583	missense	5984	exon10			CTGTGATAATAGA		CCDS3283.1	3q27	2010-04-21	2002-08-29		ENSG00000163918	ENSG00000163918		"""ATPases / AAA-type"""	9972	protein-coding gene	gene with protein product	"""A1 37 kDa subunit"", ""activator 1 37 kDa subunit"", ""RFC 37 kDa subunit"""	102577	"""replication factor C (activator 1) 4 (37kD)"""			7774928	Standard	NM_181573		Approved	A1, RFC37	uc003fqz.3	P35249	OTTHUMG00000156515	ENST00000392481.2:c.979A>G	3.37:g.186507948T>C	ENSP00000376272:p.Ile327Val	Somatic	224	0	0		WXS	Illumina HiSeq	Phase_I	241	20	0.0829876	NM_181573	B4DM41|D3DNV2|Q6FHX7	Missense_Mutation	SNP	ENST00000392481.2	37	CCDS3283.1	.	.	.	.	.	.	.	.	.	.	T	15.89	2.966155	0.53507	.	.	ENSG00000163918	ENST00000433496;ENST00000392481;ENST00000296273;ENST00000417876	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	5.85	5.85	0.93711	Replication factor C (1);DNA polymerase III, clamp loader complex, gamma/delta/delta subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.56292	0.1975	M	0.81802	2.56	0.80722	D	1	B	0.16802	0.019	B	0.31614	0.133	T	0.57516	-0.7798	10	0.59425	D	0.04	-17.5765	14.1937	0.65656	0.0:0.0:0.0:1.0	.	327	P35249	RFC4_HUMAN	V	300;327;327;102	ENSP00000399769:I300V;ENSP00000376272:I327V;ENSP00000296273:I327V;ENSP00000401429:I102V	ENSP00000296273:I327V	I	-	1	0	RFC4	187990642	1.000000	0.71417	0.268000	0.24571	0.954000	0.61252	5.725000	0.68507	2.229000	0.72834	0.533000	0.62120	ATC	.	.	none		0.353	RFC4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344471.1	NM_002916	
DSP	1832	hgsc.bcm.edu	37	6	7584037	7584037	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr6:7584037T>G	ENST00000379802.3	+	24	6883	c.6542T>G	c.(6541-6543)gTc>gGc	p.V2181G	DSP_ENST00000418664.2_Missense_Mutation_p.V1582G	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2181	4.5 X 38 AA tandem repeats (Domain A).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AAAAAGAAGGTCAGTTACGTG	0.478																																					p.V2181G		Atlas-SNP	.											.	DSP	306	.	0			c.T6542G						PASS	.						103.0	101.0	102.0					6																	7584037		2203	4300	6503	SO:0001583	missense	1832	exon24			AGAAGGTCAGTTA	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.6542T>G	6.37:g.7584037T>G	ENSP00000369129:p.Val2181Gly	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	57	6	0.105263	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	T	13.57	2.275748	0.40294	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.70749	-0.51;-0.51	5.37	5.37	0.77165	.	0.000000	0.53938	D	0.000058	T	0.62950	0.2470	L	0.55990	1.75	0.41567	D	0.988661	P;D	0.56521	0.925;0.976	P;B	0.46758	0.526;0.335	T	0.67078	-0.5761	10	0.46703	T	0.11	.	15.6695	0.77262	0.0:0.0:0.0:1.0	.	1629;2181	Q4LE79;P15924	.;DESP_HUMAN	G	2181;1582	ENSP00000369129:V2181G;ENSP00000396591:V1582G	ENSP00000369129:V2181G	V	+	2	0	DSP	7529036	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.250000	0.72435	2.178000	0.69098	0.533000	0.62120	GTC	.	.	none		0.478	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
VIT	5212	hgsc.bcm.edu	37	2	37035632	37035632	+	Silent	SNP	C	C	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:37035632C>T	ENST00000389975.3	+	14	1664	c.1362C>T	c.(1360-1362)aaC>aaT	p.N454N	VIT_ENST00000401530.1_Silent_p.N433N|VIT_ENST00000379242.3_Silent_p.N469N|VIT_ENST00000379241.3_Silent_p.N432N|VIT_ENST00000404084.1_Silent_p.N406N|VIT_ENST00000497382.1_Silent_p.N123N	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	454	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				GCAGAACAAACGGCTTCTACT	0.622																																					p.N469N		Atlas-SNP	.											.	VIT	138	.	0			c.C1407T						PASS	.						33.0	29.0	30.0					2																	37035632		2203	4300	6503	SO:0001819	synonymous_variant	5212	exon15			AACAAACGGCTTC	AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.1362C>T	2.37:g.37035632C>T		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	95	8	0.0842105	NM_053276	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Silent	SNP	ENST00000389975.3	37	CCDS54347.1																																																																																			.	.	none		0.622	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding			
EPS15	2060	hgsc.bcm.edu	37	1	51860102	51860102	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr1:51860102G>T	ENST00000371733.3	-	21	2166	c.2070C>A	c.(2068-2070)caC>caA	p.H690Q	EPS15_ENST00000371730.2_Missense_Mutation_p.H556Q|EPS15_ENST00000396122.4_Missense_Mutation_p.H367Q	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	690	15 X 3 AA repeats of D-P-F.				cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(2)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						AAGGATCATTGTGCTTCAACG	0.353			T	MLL	ALL																																p.H690Q		Atlas-SNP	.		Dom	yes		1	1p32	2060	epidermal growth factor receptor pathway substrate 15 (AF1p)		L	EPS15,caecum,carcinoma,-1,1	EPS15	72	1	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)	c.C2070A						scavenged	.						75.0	69.0	71.0					1																	51860102		2203	4300	6503	SO:0001583	missense	2060	exon21			ATCATTGTGCTTC	BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.2070C>A	1.37:g.51860102G>T	ENSP00000360798:p.His690Gln	Somatic	481	2	0.004158		WXS	Illumina HiSeq	Phase_I	425	7	0.0164706	NM_001981	B2R8J7|D3DPJ2|Q5SRH4	Missense_Mutation	SNP	ENST00000371733.3	37	CCDS557.1	.	.	.	.	.	.	.	.	.	.	G	6.116	0.389642	0.11581	.	.	ENSG00000085832	ENST00000371730;ENST00000371733;ENST00000396122	T;T;T	0.16743	2.32;2.32;2.32	4.77	2.8	0.32819	.	0.000000	0.34002	N	0.004348	T	0.07908	0.0198	N	0.22421	0.69	0.30520	N	0.768492	B;B;B	0.19583	0.037;0.037;0.013	B;B;B	0.17098	0.017;0.017;0.007	T	0.20672	-1.0268	10	0.13853	T	0.58	.	1.4628	0.02399	0.1962:0.1673:0.4638:0.1727	.	556;690;376	B1AUU8;P42566;P42566-2	.;EPS15_HUMAN;.	Q	556;690;367	ENSP00000360795:H556Q;ENSP00000360798:H690Q;ENSP00000379428:H367Q	ENSP00000360795:H556Q	H	-	3	2	EPS15	51632690	1.000000	0.71417	0.999000	0.59377	0.539000	0.34962	1.042000	0.30303	0.662000	0.31006	-0.467000	0.05162	CAC	.	.	none		0.353	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022422.1	NM_001981	
OR2T4	127074	hgsc.bcm.edu	37	1	248525639	248525639	+	Missense_Mutation	SNP	A	A	T	rs34079073|rs76878172	byFrequency	TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr1:248525639A>T	ENST00000366475.1	+	1	757	c.757A>T	c.(757-759)Atc>Ttc	p.I253F		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTATTTACTCATCCTCCTCAC	0.522																																					p.I253F		Atlas-SNP	.											OR2T4,brain,glioma,0,1	OR2T4	126	1	0			c.A757T						scavenged	.						94.0	74.0	81.0					1																	248525639		2024	3426	5450	SO:0001583	missense	127074	exon1			TTACTCATCCTCC	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.757A>T	1.37:g.248525639A>T	ENSP00000355431:p.Ile253Phe	Somatic	605	599	0.990083		WXS	Illumina HiSeq	Phase_I	486	467	0.960905	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	A	13.48	2.250012	0.39797	.	.	ENSG00000196944	ENST00000366475	T	0.00414	7.52	3.09	3.09	0.35607	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000219	T	0.01835	0.0058	H	0.96142	3.775	0.40727	D	0.98271	D	0.89917	1.0	D	0.85130	0.997	T	0.25117	-1.0141	10	0.87932	D	0	.	11.1471	0.48436	1.0:0.0:0.0:0.0	.	253	Q8NH00	OR2T4_HUMAN	F	253	ENSP00000355431:I253F	ENSP00000355431:I253F	I	+	1	0	OR2T4	246592262	1.000000	0.71417	0.050000	0.19076	0.010000	0.07245	7.329000	0.79170	1.264000	0.44198	0.477000	0.44152	ATC	.	.	alt		0.522	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
CS	1431	hgsc.bcm.edu	37	12	56676244	56676244	+	Missense_Mutation	SNP	C	C	T	rs116165297		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr12:56676244C>T	ENST00000351328.3	-	6	738	c.548G>A	c.(547-549)cGa>cAa	p.R183Q	CS_ENST00000548567.1_Missense_Mutation_p.R117Q|CS_ENST00000542324.2_Missense_Mutation_p.R170Q	NM_004077.2	NP_004068.2	O75390	CISY_HUMAN	citrate synthase	183				R -> Q (in Ref. 1; AAC25560). {ECO:0000305}.	carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	citrate (Si)-synthase activity (GO:0004108)|poly(A) RNA binding (GO:0044822)	p.R183Q(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	17		Myeloproliferative disorder(1001;0.000374)		BRCA - Breast invasive adenocarcinoma(357;6.17e-07)		TGCATATGCTCGGGCAAAGTT	0.507																																					p.R183Q		Atlas-SNP	.											CS,NS,adenoma,0,3	CS	44	3	1	Substitution - Missense(1)	skin(1)	c.G548A						scavenged	.						110.0	83.0	92.0					12																	56676244		2203	4300	6503	SO:0001583	missense	1431	exon6			TATGCTCGGGCAA		CCDS8913.1	12q13.2	2012-10-02				ENSG00000062485	2.3.3.1		2422	protein-coding gene	gene with protein product		118950					Standard	NM_004077		Approved		uc001sks.1	O75390	OTTHUMG00000170344	ENST00000351328.3:c.548G>A	12.37:g.56676244C>T	ENSP00000342056:p.Arg183Gln	Somatic	195	1	0.00512821		WXS	Illumina HiSeq	Phase_I	194	11	0.056701	NM_004077	Q71UT9|Q7KZH0|Q96FZ8|Q9BWN8	Missense_Mutation	SNP	ENST00000351328.3	37	CCDS8913.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.678105	0.68042	.	.	ENSG00000062485	ENST00000548567;ENST00000351328;ENST00000542324;ENST00000549221;ENST00000546930;ENST00000551936;ENST00000550734;ENST00000551253;ENST00000552688;ENST00000546554;ENST00000551473;ENST00000547298	.	.	.	4.79	4.79	0.61399	Citrate synthase-like, large alpha subdomain (1);Citrate synthase-like, core (1);	0.000000	0.85682	D	0.000000	T	0.38134	0.1029	N	0.04355	-0.22	0.53688	D	0.999977	B;B;B;B	0.15930	0.015;0.005;0.005;0.005	B;B;B;B	0.10450	0.005;0.003;0.002;0.003	T	0.22487	-1.0215	9	0.42905	T	0.14	-8.3747	17.4825	0.87677	0.0:1.0:0.0:0.0	.	117;170;138;183	B7Z1E1;B4DJV2;B3KTN4;O75390	.;.;.;CISY_HUMAN	Q	117;183;170;108;117;117;117;117;147;133;117;117	.	ENSP00000342056:R183Q	R	-	2	0	CS	54962511	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.596000	0.67570	2.591000	0.87537	0.650000	0.86243	CGA	C|0.995;T|0.005	0.005	weak		0.507	CS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408588.2	NM_004077	
RANBP2	5903	hgsc.bcm.edu	37	2	109382170	109382170	+	Silent	SNP	A	A	G	rs535428027		TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr2:109382170A>G	ENST00000283195.6	+	20	5301	c.5175A>G	c.(5173-5175)gaA>gaG	p.E1725E		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1725					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.E1725E(9)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CTAAGAAGGAAGGACAGTGGG	0.418													A|||	1	0.000199681	0.0	0.0014	5008	,	,		23860	0.0		0.0	False		,,,				2504	0.0				p.E1725E		Atlas-SNP	.											RANBP2_ENST00000283195,NS,carcinoma,0,6	RANBP2	488	6	9	Substitution - coding silent(9)	prostate(9)	c.A5175G						scavenged	.						182.0	173.0	176.0					2																	109382170		2203	4300	6503	SO:0001819	synonymous_variant	5903	exon20			GAAGGAAGGACAG	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.5175A>G	2.37:g.109382170A>G		Somatic	343	2	0.0058309		WXS	Illumina HiSeq	Phase_I	334	5	0.0149701	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Silent	SNP	ENST00000283195.6	37	CCDS2079.1																																																																																			.	.	none		0.418	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
ZNF680	340252	hgsc.bcm.edu	37	7	63981682	63981682	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TV-01A-11D-A382-10	TCGA-GS-A9TV-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	856d7068-5d31-4bc0-b50c-e02ed89ced3f	a592e794-fb42-4d16-95b3-c2059390b14c	g.chr7:63981682G>T	ENST00000309683.6	-	4	1601	c.1450C>A	c.(1450-1452)Cat>Aat	p.H484N	ZNF680_ENST00000476563.1_5'Flank	NM_178558.4	NP_848653.2	Q8NEM1	ZN680_HUMAN	zinc finger protein 680	484					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	27		Lung NSC(55;0.118)|all_lung(88;0.243)				TCTCTAGCATGAATTCTCTTA	0.368																																					p.H484N		Atlas-SNP	.											ZNF680,mucosal,malignant_melanoma,0,1	ZNF680	58	1	0			c.C1450A						scavenged	.						64.0	65.0	64.0					7																	63981682		2203	4300	6503	SO:0001583	missense	340252	exon4			TAGCATGAATTCT	AK074911	CCDS34644.1, CCDS47594.1	7q11.21	2013-01-08			ENSG00000173041	ENSG00000173041		"""Zinc fingers, C2H2-type"", ""-"""	26897	protein-coding gene	gene with protein product	"""hypothetical protein FLJ90430"""					12477932	Standard	NM_178558		Approved	FLJ90430	uc003tta.2	Q8NEM1	OTTHUMG00000156542	ENST00000309683.6:c.1450C>A	7.37:g.63981682G>T	ENSP00000309330:p.His484Asn	Somatic	213	0	0		WXS	Illumina HiSeq	Phase_I	185	4	0.0216216	NM_178558	B3KVJ4|Q6ZNF3|Q8NC79	Missense_Mutation	SNP	ENST00000309683.6	37	CCDS34644.1	.	.	.	.	.	.	.	.	.	.	g	14.75	2.627846	0.46944	.	.	ENSG00000173041	ENST00000309683	T	0.26660	1.72	1.31	1.31	0.21738	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.50446	0.1616	M	0.90483	3.12	0.80722	D	1	D	0.58620	0.983	D	0.71656	0.974	T	0.51725	-0.8669	9	0.87932	D	0	.	5.9584	0.19286	0.0:0.0:1.0:0.0	.	484	Q8NEM1	ZN680_HUMAN	N	484	ENSP00000309330:H484N	ENSP00000309330:H484N	H	-	1	0	ZNF680	63619117	1.000000	0.71417	0.113000	0.21522	0.733000	0.41908	4.987000	0.63857	0.690000	0.31570	0.478000	0.44815	CAT	.	.	none		0.368	ZNF680-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344568.1	NM_178558	
