#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NEFH	4744	hgsc.bcm.edu	37	22	29885567	29885568	+	In_Frame_Ins	INS	-	-	AAGTCCCCTGAGAAGGCC	rs147489453|rs559153194|rs75808076|rs59279731		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr22:29885567_29885568insAAGTCCCCTGAGAAGGCC	ENST00000310624.6	+	4	1971_1972	c.1938_1939insAAGTCCCCTGAGAAGGCC	c.(1939-1941)aag>AAGTCCCCTGAGAAGGCCaag	p.647_647K>KSPEKAK		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	653	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGAGGAAGCAAAGTCCCCTGA	0.569																																					p.A646delinsAKSPEKA		Atlas-Indel	.											NEFH,rectum,carcinoma,0,1	NEFH	178	1	0			c.1938_1939insAAGTCCCCTGAGAAGGCC						PASS	.			2816,1448		937,942,253						-5.3	0.0		dbSNP_134	77	5046,3206		1537,1972,617	no	coding	NEFH	NM_021076.3		2474,2914,870	A1A1,A1R,RR		38.8512,33.9587,37.1844				7862,4654				SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1939_1956dupAAGTCCCCTGAGAAGGCC	22.37:g.29885567_29885568insAAGTCCCCTGAGAAGGCC	Exception_encountered	Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	43	14	0.325581	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	strong		0.569	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
SERPIND1	3053	hgsc.bcm.edu	37	22	21133944	21133944	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr22:21133944delA	ENST00000215727.5	+	2	627	c.344delA	c.(343-345)cagfs	p.Q115fs	PI4KA_ENST00000572273.1_Intron|SERPIND1_ENST00000406799.1_Frame_Shift_Del_p.Q115fs|PI4KA_ENST00000255882.6_Intron|PI4KA_ENST00000466162.1_Intron	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	115					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	AACATCCTCCAGCTTTTTCAT	0.502																																					p.Q115fs		Pindel,Atlas-Indel	.											.	SERPIND1	92	.	0			c.343delC						PASS	.						75.0	67.0	69.0					22																	21133944		2203	4300	6503	SO:0001589	frameshift_variant	3053	exon2			.	M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.344delA	22.37:g.21133944delA	ENSP00000215727:p.Gln115fs	Somatic	95	.	.		WXS	Illumina HiSeq	Phase_I	114	27	0.237	NM_000185	B2RAI1|D3DX34|Q6IBZ5	Frame_Shift_Del	DEL	ENST00000215727.5	37	CCDS13783.1																																																																																			.	.	none		0.502	SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319961.1	NM_000185	
C14orf23	387978	hgsc.bcm.edu	37	14	29261305	29261306	+	In_Frame_Ins	INS	-	-	AAC	rs202195469|rs200251419|rs565026588	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr14:29261305_29261306insAAC	ENST00000399387.4	+	3	446_447	c.342_343insAAC	c.(343-345)aaa>AACaaa	p.114_115insN	C14orf23_ENST00000548213.1_Intron|C14orf23_ENST00000550266.1_Intron					chromosome 14 open reading frame 23											central_nervous_system(1)	1						CTTCAGCACTAAAAAAAACAAA	0.376																																					.		Atlas-Indel	.											.	C14orf23	5	.	0			.						PASS	.																																			SO:0001652	inframe_insertion	387978	.			.			14q11.2	2013-01-15			ENSG00000186960	ENSG00000186960			19828	other	unknown							Standard	NR_026731		Approved		uc001wqf.3	Q86U37	OTTHUMG00000029410	Exception_encountered	14.37:g.29261305_29261306insAAC	ENSP00000382318:p.Leu114_Lys115insAsn	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	136	39	0.286765	.		RNA	INS	ENST00000399387.4	37																																																																																				-|0.668;AAC|0.332	0.332	strong		0.376	C14orf23-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000134019.2	NR_026731	
APOB	338	hgsc.bcm.edu	37	2	21241888	21241888	+	Frame_Shift_Del	DEL	G	G	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:21241888delG	ENST00000233242.1	-	20	3224	c.3097delC	c.(3097-3099)ctgfs	p.L1033fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1033					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACAAACTTCAGGGTATCCACC	0.473																																					p.L1033fs		Atlas-Indel	.											APOB,caecum,carcinoma,+1,1	APOB	761	1	0			c.3098delT						PASS	.						133.0	123.0	127.0					2																	21241888		2203	4300	6503	SO:0001589	frameshift_variant	338	exon20			.	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3097delC	2.37:g.21241888delG	ENSP00000233242:p.Leu1033fs	Somatic	194	0	0		WXS	Illumina HiSeq	Phase_I	132	34	0.257576	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Del	DEL	ENST00000233242.1	37	CCDS1703.1																																																																																			.	.	none		0.473	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
CHEK2	11200	hgsc.bcm.edu	37	22	29130418	29130419	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr22:29130418_29130419insAT	ENST00000405598.1	-	3	482_483	c.291_292insAT	c.(289-294)tgggccfs	p.A98fs	CHEK2_ENST00000404276.1_Frame_Shift_Ins_p.A98fs|CHEK2_ENST00000382566.1_Frame_Shift_Ins_p.A98fs|CHEK2_ENST00000348295.3_Frame_Shift_Ins_p.A98fs|CHEK2_ENST00000403642.1_Frame_Shift_Ins_p.A98fs|CHEK2_ENST00000382578.1_Frame_Shift_Ins_p.A98fs|CHEK2_ENST00000544772.1_De_novo_Start_OutOfFrame|CHEK2_ENST00000328354.6_Frame_Shift_Ins_p.A98fs|CHEK2_ENST00000382580.2_Frame_Shift_Ins_p.A98fs|CHEK2_ENST00000382565.1_Frame_Shift_Ins_p.A98fs|CHEK2_ENST00000402731.1_Frame_Shift_Ins_p.A98fs			O96017	CHK2_HUMAN	checkpoint kinase 2	98					cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						TCCTGAAGGGCCCATAATCGAG	0.47			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																													p.A98fs		Pindel,Atlas-Indel	.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	.	CHEK2	438	.	0			c.292_293insAT						PASS	.																																			SO:0001589	frameshift_variant	11200	exon2			.	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.291_292insAT	22.37:g.29130418_29130419insAT	ENSP00000386087:p.Ala98fs	Somatic	71	.	.		WXS	Illumina HiSeq	Phase_I	84	15	0.179	NM_007194	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Frame_Shift_Ins	INS	ENST00000405598.1	37	CCDS13843.1																																																																																			.	.	none		0.470	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
AASS	10157	hgsc.bcm.edu	37	7	121726174	121726174	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr7:121726174delA	ENST00000393376.1	-	18	2171	c.2076delT	c.(2074-2076)tttfs	p.F692fs	AASS_ENST00000417368.2_Frame_Shift_Del_p.F692fs|AASS_ENST00000473553.1_5'UTR			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	692	Saccharopine dehydrogenase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)	p.P693fs*3(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						TTAATCCTGGAAAAAAATCCA	0.443																																					p.P693fs		Pindel,Atlas-Indel	.											.	AASS	123	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2077delC						PASS	.						81.0	79.0	80.0					7																	121726174		2203	4300	6503	SO:0001589	frameshift_variant	10157	exon19			.	AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.2076delT	7.37:g.121726174delA	ENSP00000377040:p.Phe692fs	Somatic	126	.	.		WXS	Illumina HiSeq	Phase_I	66	16	0.242	NM_005763	O95462	Frame_Shift_Del	DEL	ENST00000393376.1	37	CCDS5783.1																																																																																			.	.	none		0.443	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763	
NCAM2	4685	hgsc.bcm.edu	37	21	22881305	22881306	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr21:22881305_22881306delGA	ENST00000400546.1	+	16	2460_2461	c.2211_2212delGA	c.(2209-2214)aggagafs	p.RR737fs	NCAM2_ENST00000284894.7_Frame_Shift_Del_p.RR595fs	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	737					axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GCATCACTAGGAGAATGTGTGG	0.45																																					p.737_737del		Atlas-Indel	.											NCAM2,NS,carcinoma,+1,1	NCAM2	220	1	0			c.2210_2211del						PASS	.																																			SO:0001589	frameshift_variant	4685	exon16			.		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.2211_2212delGA	21.37:g.22881307_22881308delGA	ENSP00000383392:p.Arg737fs	Somatic	198	0	0		WXS	Illumina HiSeq	Phase_I	159	21	0.132075	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Frame_Shift_Del	DEL	ENST00000400546.1	37	CCDS42910.1																																																																																			.	.	none		0.450	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
HECTD1	25831	hgsc.bcm.edu	37	14	31598249	31598250	+	Frame_Shift_Ins	INS	-	-	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr14:31598249_31598250insC	ENST00000399332.1	-	25	4815_4816	c.4327_4328insG	c.(4327-4329)tctfs	p.S1443fs	HECTD1_ENST00000553700.1_Frame_Shift_Ins_p.S1443fs	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1443	Ser-rich.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TGCACTGGAAGATGACCCTACT	0.45																																					p.S1443fs		Atlas-Indel	.											.	HECTD1	159	.	0			c.4328_4329insG						PASS	.																																			SO:0001589	frameshift_variant	25831	exon25			.	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.4327_4328insG	14.37:g.31598249_31598250insC	ENSP00000382269:p.Ser1443fs	Somatic	290	0	0		WXS	Illumina HiSeq	Phase_I	206	28	0.135922	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Frame_Shift_Ins	INS	ENST00000399332.1	37	CCDS41939.1																																																																																			.	.	none		0.450	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
HECTD1	25831	hgsc.bcm.edu	37	14	31598245	31598247	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	GGA	GGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr14:31598245_31598247delGGA	ENST00000399332.1	-	25	4818_4820	c.4330_4332delTCC	c.(4330-4332)tccdel	p.S1445del	HECTD1_ENST00000553700.1_In_Frame_Del_p.S1445del	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1445	Ser-rich.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)	p.S1444S(1)		breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TGCTTGCACTGGAAGATGACCCT	0.458																																					p.1444_1445del		Atlas-Indel	.											.	HECTD1	159	.	1	Substitution - coding silent(1)	lung(1)	c.4331_4333del						PASS	.																																			SO:0001651	inframe_deletion	25831	exon25			.	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.4330_4332delTCC	14.37:g.31598245_31598247delGGA	ENSP00000382269:p.Ser1445del	Somatic	282	0	0		WXS	Illumina HiSeq	Phase_I	208	27	0.129808	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	In_Frame_Del	DEL	ENST00000399332.1	37	CCDS41939.1																																																																																			.	.	none		0.458	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
IFIH1	64135	hgsc.bcm.edu	37	2	163144683	163144684	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:163144683_163144684insT	ENST00000263642.2	-	5	1451_1452	c.1056_1057insA	c.(1054-1059)aaagcafs	p.A353fs		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	353	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)	p.A353T(1)|p.K352N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						GGCTCAGATGCTTTTTTCTTCT	0.366																																					p.A353fs		Pindel,Atlas-Indel	.											IFIH1,scalp,carcinoma,0,1	IFIH1	102	1	2	Substitution - Missense(2)	kidney(1)|skin(1)	c.1057_1058insA						PASS	.																																			SO:0001589	frameshift_variant	64135	exon5			.	AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.1057dupA	2.37:g.163144689_163144689dupT	ENSP00000263642:p.Ala353fs	Somatic	365	.	.		WXS	Illumina HiSeq	Phase_I	334	53	0.159	NM_022168	Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Frame_Shift_Ins	INS	ENST00000263642.2	37	CCDS2217.1																																																																																			.	.	none		0.366	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	NM_022168	
SIPA1L1	26037	hgsc.bcm.edu	37	14	72152170	72152172	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	AAC	AAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr14:72152170_72152172delAAC	ENST00000555818.1	+	10	3544_3546	c.3196_3198delAAC	c.(3196-3198)aacdel	p.N1066del	SIPA1L1_ENST00000358550.2_In_Frame_Del_p.N1066del|SIPA1L1_ENST00000537413.1_In_Frame_Del_p.N541del|SIPA1L1_ENST00000381232.3_In_Frame_Del_p.N1066del	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1066					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CCGAAATAATAACAAGTGGCAGA	0.498																																					p.1065_1066del		Pindel,Atlas-Indel	.											.	SIPA1L1	219	.	0			c.3195_3197del						PASS	.																																			SO:0001651	inframe_deletion	26037	exon10			.	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.3196_3198delAAC	14.37:g.72152170_72152172delAAC	ENSP00000450832:p.Asn1066del	Somatic	81	.	.		WXS	Illumina HiSeq	Phase_I	94	28	0.298	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	In_Frame_Del	DEL	ENST00000555818.1	37	CCDS9807.1																																																																																			.	.	none		0.498	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
UACA	55075	hgsc.bcm.edu	37	15	70961075	70961076	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr15:70961075_70961076insT	ENST00000322954.6	-	16	2132_2133	c.1947_1948insA	c.(1945-1950)aaattafs	p.L650fs	UACA_ENST00000560441.1_Frame_Shift_Ins_p.L635fs|UACA_ENST00000379983.2_Frame_Shift_Ins_p.L637fs|UACA_ENST00000539319.1_Frame_Shift_Ins_p.L541fs	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	650					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						ATTTCTACTAATTTTTTTGCTT	0.351																																					p.L650fs		Pindel,Atlas-Indel	.											.	UACA	235	.	0			c.1948_1949insA						PASS	.																																			SO:0001589	frameshift_variant	55075	exon16			.	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.1948dupA	15.37:g.70961082_70961082dupT	ENSP00000314556:p.Leu650fs	Somatic	504	.	.		WXS	Illumina HiSeq	Phase_I	424	80	0.189	NM_018003	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Frame_Shift_Ins	INS	ENST00000322954.6	37	CCDS10235.1																																																																																			.	.	none		0.351	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2		
B2M	567	hgsc.bcm.edu	37	15	45003781	45003782	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr15:45003781_45003782delCT	ENST00000558401.1	+	1	107_108	c.37_38delCT	c.(37-39)ctcfs	p.L13fs	PATL2_ENST00000558573.1_5'Flank|B2M_ENST00000559916.1_Frame_Shift_Del_p.L13fs|B2M_ENST00000544417.1_Frame_Shift_Del_p.L13fs	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	13					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.L15fs*41(4)|p.A11fs*42(1)|p.L13F(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		GCTCGCGCTACTCTCTCTTTCT	0.614																																					p.12_13del		Atlas-Indel	.											B2M,colon,carcinoma,+1,2	B2M	99	2	6	Deletion - Frameshift(5)|Substitution - Missense(1)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|skin(1)	c.36_37del						PASS	.																																			SO:0001589	frameshift_variant	567	exon1			.	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.37_38delCT	15.37:g.45003787_45003788delCT	ENSP00000452780:p.Leu13fs	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	57	13	0.22807	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Frame_Shift_Del	DEL	ENST00000558401.1	37	CCDS10113.1																																																																																			.	.	none		0.614	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
C21orf67	84536	hgsc.bcm.edu	37	21	46355747	46355748	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr21:46355747_46355748delTC	ENST00000397841.1	-	2	378_379	c.133_134delGA	c.(133-135)gacfs	p.D45fs	LL21NC02-1C16.2_ENST00000609953.1_RNA|C21orf67_ENST00000380070.4_Frame_Shift_Del_p.D42fs|C21orf67_ENST00000330551.3_Frame_Shift_Del_p.D42fs					chromosome 21 open reading frame 67											breast(1)	1						AGGACGCAGGTCTCTCACTAGA	0.569																																					.		Pindel,Atlas-Indel	.											.	C21orf67	8	.	0			.						PASS	.																																			SO:0001589	frameshift_variant	84536	.			.	AY040088		21q22.3	2013-01-15			ENSG00000183250	ENSG00000183250			15707	other	unknown			"""chromosome 21 open reading frame 69"""	C21orf69		11707072	Standard	NR_027128		Approved		uc011afm.2	P58512	OTTHUMG00000090294	ENST00000397841.1:c.133_134delGA	21.37:g.46355751_46355752delTC	ENSP00000380941:p.Asp45fs	Somatic	51	.	.		WXS	Illumina HiSeq	Phase_I	69	25	0.362	.		RNA	DEL	ENST00000397841.1	37																																																																																				.	.	none		0.569	C21orf67-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000206644.1	NR_027128	
TMSB4X	7114	hgsc.bcm.edu	37	X	12994405	12994410	+	In_Frame_Del	DEL	GAGATC	GAGATC	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	GAGATC	GAGATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:12994405_12994410delGAGATC	ENST00000380635.1	+	2	241_246	c.25_30delGAGATC	c.(25-30)gagatcdel	p.EI9del	TMSB4X_ENST00000380633.1_In_Frame_Del_p.EI9del|TMSB4X_ENST00000380636.1_In_Frame_Del_p.EI9del|TMSB4X_ENST00000451311.2_In_Frame_Del_p.EI9del			P62328	TYB4_HUMAN	thymosin beta 4, X-linked	9					actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sequestering of actin monomers (GO:0042989)	cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	poly(A) RNA binding (GO:0044822)			upper_aerodigestive_tract(1)	1						CGATATGGCTGAGATCGAGAAATTCG	0.529																																					p.8_10del		Atlas-Indel	.											.	TMSB4X	3	.	0			c.24_29del						PASS	.																																			SO:0001651	inframe_deletion	7114	exon2			.		CCDS35202.1	Xp22.2	2013-05-14	2008-02-25		ENSG00000205542	ENSG00000205542			11881	protein-coding gene	gene with protein product		300159	"""thymosin, beta 4, X chromosome"""	TMSB4		2677145, 9381176	Standard	NM_021109		Approved	TB4X	uc004cvf.3	P62328	OTTHUMG00000021144	ENST00000380635.1:c.25_30delGAGATC	X.37:g.12994405_12994410delGAGATC	ENSP00000370009:p.Glu9_Ile10del	Somatic	400	0	0		WXS	Illumina HiSeq	Phase_I	312	41	0.13141	NM_021109	P01253|P01254|Q546P5|Q63576|Q9UE55	In_Frame_Del	DEL	ENST00000380635.1	37	CCDS35202.1																																																																																			.	.	none		0.529	TMSB4X-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000055779.1	NM_021109	
LRRIQ1	84125	hgsc.bcm.edu	37	12	85449643	85449643	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:85449643delA	ENST00000393217.2	+	8	1133	c.1072delA	c.(1072-1074)aaafs	p.K358fs		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	358	Glu-rich.									breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		agaggaaaggaaaaggagaga	0.318																																					p.R357fs		Pindel,Atlas-Indel	.											.	LRRIQ1	512	.	0			c.1071delG						PASS	.						19.0	21.0	20.0					12																	85449643		2186	4268	6454	SO:0001589	frameshift_variant	84125	exon8			.	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.1072delA	12.37:g.85449643delA	ENSP00000376910:p.Lys358fs	Somatic	110	.	.		WXS	Illumina HiSeq	Phase_I	96	16	0.167	NM_001079910	Q567P4|Q9BS17|Q9HA36	Frame_Shift_Del	DEL	ENST00000393217.2	37	CCDS41816.1																																																																																			.	.	none		0.318	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
PEG3	5178	hgsc.bcm.edu	37	19	57325865	57325865	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:57325865delA	ENST00000326441.9	-	10	4308	c.3945delT	c.(3943-3945)tatfs	p.Y1315fs	ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000598410.1_Frame_Shift_Del_p.Y1191fs|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000423103.2_Frame_Shift_Del_p.Y1315fs|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000593695.1_Frame_Shift_Del_p.Y1189fs|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1315					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGGTGTGAGTATAGGAGGACC	0.438																																					p.T1316fs		Atlas-Indel	.											.	PEG3	414	.	0			c.3946delA						PASS	.						103.0	99.0	101.0					19																	57325865		2203	4300	6503	SO:0001589	frameshift_variant	5178	exon9			.	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.3945delT	19.37:g.57325865delA	ENSP00000326581:p.Tyr1315fs	Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	118	23	0.194915	NM_001146184	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Frame_Shift_Del	DEL	ENST00000326441.9	37	CCDS12948.1																																																																																			.	.	none		0.438	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
NCAM2	4685	hgsc.bcm.edu	37	21	22881298	22881299	+	Frame_Shift_Ins	INS	-	-	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr21:22881298_22881299insC	ENST00000400546.1	+	16	2453_2454	c.2204_2205insC	c.(2203-2208)atcactfs	p.T736fs	NCAM2_ENST00000284894.7_Frame_Shift_Ins_p.T594fs	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	736					axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		CTGATGTGCATCACTAGGAGAA	0.465																																					p.I735fs		Atlas-Indel	.											.	NCAM2	220	.	0			c.2204_2205insC						PASS	.																																			SO:0001589	frameshift_variant	4685	exon16			.		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.2205dupC	21.37:g.22881299_22881299dupC	ENSP00000383392:p.Thr736fs	Somatic	212	0	0		WXS	Illumina HiSeq	Phase_I	167	25	0.149701	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Frame_Shift_Ins	INS	ENST00000400546.1	37	CCDS42910.1																																																																																			.	.	none		0.465	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
NR2F2	7026	hgsc.bcm.edu	37	15	96877601	96877615	+	In_Frame_Del	DEL	CTCACCTGGAGCGAG	CTCACCTGGAGCGAG	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	CTCACCTGGAGCGAG	CTCACCTGGAGCGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr15:96877601_96877615delCTCACCTGGAGCGAG	ENST00000394166.3	+	2	2128_2142	c.739_753delCTCACCTGGAGCGAG	c.(739-753)ctcacctggagcgagdel	p.LTWSE247del	NR2F2_ENST00000453270.2_In_Frame_Del_p.LTWSE94del|MIR1469_ENST00000410719.1_RNA|NR2F2_ENST00000421109.2_In_Frame_Del_p.LTWSE114del|NR2F2_ENST00000394171.2_In_Frame_Del_p.LTWSE94del	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	247	Interaction with ZFPM2. {ECO:0000250}.|Ligand-binding. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			CCTGCTTCGCCTCACCTGGAGCGAGCTGTTTGTGT	0.688																																					p.246_251del		Pindel,Atlas-Indel	.											.	NR2F2	35	.	0			c.738_752del						PASS	.																																			SO:0001651	inframe_deletion	7026	exon2			.	M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	ENST00000394166.3:c.739_753delCTCACCTGGAGCGAG	15.37:g.96877601_96877615delCTCACCTGGAGCGAG	ENSP00000377721:p.Leu247_Glu251del	Somatic	74	.	.		WXS	Illumina HiSeq	Phase_I	55	11	0.200	NM_021005	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	In_Frame_Del	DEL	ENST00000394166.3	37	CCDS10375.1																																																																																			.	.	none		0.688	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313534.1		
C4orf17	84103	hgsc.bcm.edu	37	4	100461611	100461618	+	Splice_Site	DEL	AGGTTAAG	AGGTTAAG	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	AGGTTAAG	AGGTTAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr4:100461611_100461618delAGGTTAAG	ENST00000326581.4	+	8	1241_1242	c.879_880delAGGTTAAG	c.(877-882)aaaggt>aagt	p.G294fs	C4orf17_ENST00000514652.1_Stop_Codon_Del	NM_032149.2	NP_115525.2	Q53FE4	CD017_HUMAN	chromosome 4 open reading frame 17	294										central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|urinary_tract(3)	18				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		AAGTACCAAAAGGTTAAGTACAGTTTTT	0.317																																					p.293_294del		Pindel,Atlas-Indel	.											.	C4orf17	42	.	0			c.878_880del						PASS	.																																			SO:0001630	splice_region_variant	84103	exon8			.	AL136838	CCDS3649.1	4q23	2008-02-05			ENSG00000138813	ENSG00000138813			25274	protein-coding gene	gene with protein product						11230166	Standard	NM_032149		Approved	DKFZP434G072	uc003huw.3	Q53FE4	OTTHUMG00000131027	ENST00000326581.4:c.880+1AGGTTAAG>-	4.37:g.100461611_100461618delAGGTTAAG		Somatic	137	.	.		WXS	Illumina HiSeq	Phase_I	114	25	0.219	NM_032149	Q6FI84|Q6IS77|Q8NA78|Q9H0D9	In_Frame_Del	DEL	ENST00000326581.4	37	CCDS3649.1																																																																																			.	.	none		0.317	C4orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253670.2	NM_032149	Frame_Shift_Del
APOB	338	hgsc.bcm.edu	37	2	21241889	21241890	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:21241889_21241890delGG	ENST00000233242.1	-	20	3222_3223	c.3095_3096delCC	c.(3094-3096)accfs	p.T1032fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1032					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAAACTTCAGGGTATCCACCAA	0.47																																					p.1032_1033del		Pindel	.											APOB,caecum,carcinoma,+2,1	APOB	761	1	0			c.3096_3097del						PASS	.																																			SO:0001589	frameshift_variant	338	exon20			.	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3095_3096delCC	2.37:g.21241889_21241890delGG	ENSP00000233242:p.Thr1032fs	Somatic	197	.	.		WXS	Illumina HiSeq	Phase_I	131	27	0.206	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Del	DEL	ENST00000233242.1	37	CCDS1703.1																																																																																			.	.	none		0.470	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
PEG3	5178	hgsc.bcm.edu	37	19	57325865	57325866	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:57325865_57325866delAT	ENST00000326441.9	-	10	4307_4308	c.3944_3945delAT	c.(3943-3945)tatfs	p.Y1315fs	ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000598410.1_Frame_Shift_Del_p.Y1191fs|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000423103.2_Frame_Shift_Del_p.Y1315fs|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000593695.1_Frame_Shift_Del_p.Y1189fs|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1315					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGGTGTGAGTATAGGAGGACCC	0.436																																					p.1315_1316del		Pindel	.											.	PEG3	414	.	0			c.3945_3946del						PASS	.																																			SO:0001589	frameshift_variant	5178	exon9			.	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.3944_3945delAT	19.37:g.57325865_57325866delAT	ENSP00000326581:p.Tyr1315fs	Somatic	142	.	.		WXS	Illumina HiSeq	Phase_I	122	19	0.156	NM_001146184	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Frame_Shift_Del	DEL	ENST00000326441.9	37	CCDS12948.1																																																																																			.	.	none		0.436	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
ISL1	3670	hgsc.bcm.edu	37	5	50683348	50683348	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:50683348G>A	ENST00000230658.7	+	3	828	c.243G>A	c.(241-243)aaG>aaA	p.K81K	ISL1_ENST00000505475.2_3'UTR|ISL1_ENST00000511384.1_Silent_p.K81K	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	81	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				AATGCGCCAAGTGCAGCATCG	0.627																																					p.K81K		Atlas-SNP	.											.	ISL1	65	.	0			c.G243A						PASS	.						35.0	37.0	37.0					5																	50683348		2052	4189	6241	SO:0001819	synonymous_variant	3670	exon3			CGCCAAGTGCAGC	BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.243G>A	5.37:g.50683348G>A		Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	147	18	0.122449	NM_002202	P20663|P47894	Silent	SNP	ENST00000230658.7	37	CCDS43314.1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.283104	0.23392	.	.	ENSG00000016082	ENST00000505475	T	0.56776	0.44	5.51	4.61	0.57282	.	.	.	.	.	T	0.60843	0.2300	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63616	-0.6597	6	0.87932	D	0	.	8.5384	0.33377	0.2478:0.0:0.7522:0.0	.	.	.	.	M	28	ENSP00000421737:V28M	ENSP00000421737:V28M	V	+	1	0	ISL1	50719105	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.379000	0.34340	1.272000	0.44329	0.505000	0.49811	GTG	.	.	none		0.627	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202	
KDM3A	55818	hgsc.bcm.edu	37	2	86669185	86669185	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:86669185C>T	ENST00000409556.1	+	3	380	c.15C>T	c.(13-15)ctC>ctT	p.L5L	KDM3A_ENST00000312912.5_Silent_p.L5L|KDM3A_ENST00000409064.1_Silent_p.L5L|KDM3A_ENST00000542128.1_Silent_p.L5L			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	5					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						TGCTCACGCTCGGAGAAAGTT	0.642																																					p.L5L	NSCLC(96;1150 1523 6936 46253 49736)	Atlas-SNP	.											.	KDM3A	179	.	0			c.C15T						PASS	.						96.0	99.0	98.0					2																	86669185		2203	4300	6503	SO:0001819	synonymous_variant	55818	exon2			CACGCTCGGAGAA	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.15C>T	2.37:g.86669185C>T		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	51	20	0.392157	NM_001146688	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Silent	SNP	ENST00000409556.1	37	CCDS1990.1																																																																																			.	.	none		0.642	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	
MIS18BP1	55320	hgsc.bcm.edu	37	14	45693171	45693171	+	Silent	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr14:45693171A>G	ENST00000310806.4	-	11	3077	c.2619T>C	c.(2617-2619)ggT>ggC	p.G873G		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	873					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						CCTGAATTAAACCAGGTAAGC	0.383																																					p.G873G		Atlas-SNP	.											.	MIS18BP1	92	.	0			c.T2619C						PASS	.						87.0	83.0	84.0					14																	45693171		2203	4300	6503	SO:0001819	synonymous_variant	55320	exon11			AATTAAACCAGGT	AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.2619T>C	14.37:g.45693171A>G		Somatic	173	0	0		WXS	Illumina HiSeq	Phase_I	140	42	0.3	NM_018353	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Silent	SNP	ENST00000310806.4	37	CCDS9684.1																																																																																			.	.	none		0.383	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2		
AKAP17A	8227	hgsc.bcm.edu	37	X	1712439	1712439	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:1712439C>T	ENST00000313871.3	+	2	280	c.84C>T	c.(82-84)acC>acT	p.T28T	AKAP17A_ENST00000381261.3_Silent_p.T28T	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	28					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						AGCCCATCACCAAGATGACCA	0.617																																					p.T28T		Atlas-SNP	.											.	AKAP17A	46	.	0			c.C84T						PASS	.						129.0	113.0	118.0					X																	1712439		2203	4296	6499	SO:0001819	synonymous_variant	8227	exon2			CATCACCAAGATG	L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.84C>T	X.37:g.1712439C>T		Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	144	37	0.256944	NM_005088	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Silent	SNP	ENST00000313871.3	37	CCDS14116.1																																																																																			.	.	none		0.617	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055609.2	NM_005088	
MUC4	4585	hgsc.bcm.edu	37	3	195505772	195505772	+	Missense_Mutation	SNP	C	C	G	rs556354486		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:195505772C>G	ENST00000463781.3	-	2	13138	c.12679G>C	c.(12679-12681)Gtc>Ctc	p.V4227L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V4227L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	984					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V4227L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGCTGGTGACAGGAAGAGGG	0.582													.|||	1	0.000199681	0.0	0.0	5008	,	,		15508	0.0		0.001	False		,,,				2504	0.0				p.V4227L		Atlas-SNP	.											MUC4_ENST00000463781,bladder,carcinoma,0,4	MUC4	1505	4	1	Substitution - Missense(1)	lung(1)	c.G12679C						scavenged	.																																			SO:0001583	missense	4585	exon2			TGGTGACAGGAAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12679G>C	3.37:g.195505772C>G	ENSP00000417498:p.Val4227Leu	Somatic	94	4	0.0425532		WXS	Illumina HiSeq	Phase_I	84	7	0.0833333	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	5.247	0.230981	0.09969	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.56;1.6	1.57	0.566	0.17317	.	.	.	.	.	T	0.14227	0.0344	N	0.14661	0.345	0.19300	N	0.999978	B	0.27765	0.188	B	0.22601	0.04	T	0.27640	-1.0068	8	.	.	.	.	5.595	0.17321	0.0:0.6491:0.3509:0.0	.	4099	E7ESK3	.	L	4227	ENSP00000417498:V4227L;ENSP00000420243:V4227L	.	V	-	1	0	MUC4	196990551	0.000000	0.05858	0.020000	0.16555	0.011000	0.07611	-0.070000	0.11523	0.201000	0.20466	0.484000	0.47621	GTC	.	.	none		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
KLHL7	55975	hgsc.bcm.edu	37	7	23165412	23165412	+	Intron	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr7:23165412G>A	ENST00000339077.5	+	4	685				KLHL7_ENST00000322275.5_Missense_Mutation_p.E159K|KLHL7_ENST00000322231.7_Intron|KLHL7_ENST00000539124.1_Intron|KLHL7_ENST00000410047.1_Missense_Mutation_p.E137K|KLHL7_ENST00000409689.1_Intron|KLHL7_ENST00000545443.1_Intron|KLHL7_ENST00000542558.1_Intron|KLHL7_ENST00000479288.1_Intron	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7						protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GAGCCTTCCAGAGTGTGGTAT	0.413																																					p.E159K		Atlas-SNP	.											.	KLHL7	102	.	0			c.G475A						PASS	.																																			SO:0001627	intron_variant	55975	exon5			CTTCCAGAGTGTG		CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.442+621G>A	7.37:g.23165412G>A		Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	84	42	0.5	NM_001172428	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Missense_Mutation	SNP	ENST00000339077.5	37	CCDS34609.1	.	.	.	.	.	.	.	.	.	.	G	7.947	0.743932	0.15642	.	.	ENSG00000122550	ENST00000322275;ENST00000410047	T;T	0.73897	-0.73;-0.79	2.26	0.299	0.15771	.	.	.	.	.	T	0.58807	0.2148	.	.	.	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.50030	-0.8875	8	0.59425	D	0.04	.	4.0126	0.09629	0.4137:0.0:0.5863:0.0	.	159;137	Q8IXQ5-3;Q8IXQ5-4	.;.	K	159;137	ENSP00000323270:E159K;ENSP00000386999:E137K	ENSP00000323270:E159K	E	+	1	0	KLHL7	23131937	0.000000	0.05858	0.001000	0.08648	0.204000	0.24138	-0.620000	0.05565	0.064000	0.16427	0.563000	0.77884	GAG	.	.	none		0.413	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3	NM_018846	
RGS8	85397	hgsc.bcm.edu	37	1	182640795	182640795	+	5'UTR	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:182640795C>A	ENST00000483095.2	-	0	151				RGS8_ENST00000491420.2_5'UTR|RGS8_ENST00000367557.4_5'UTR|RGS8_ENST00000258302.4_Missense_Mutation_p.R26I|RGS8_ENST00000367556.1_5'UTR			P57771	RGS8_HUMAN	regulator of G-protein signaling 8						positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			haematopoietic_and_lymphoid_tissue(1)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	5						TACTCACTGTCTTTGGCCAGT	0.448																																					p.R26I	Ovarian(189;1262 3804 41973)	Atlas-SNP	.											.	RGS8	51	.	0			c.G77T						PASS	.						153.0	155.0	154.0					1																	182640795		2203	4300	6503	SO:0001623	5_prime_UTR_variant	85397	exon2			CACTGTCTTTGGC	AF297015	CCDS1349.1, CCDS41443.1	1q25	2008-07-18	2007-08-14		ENSG00000135824	ENSG00000135824		"""Regulators of G-protein signaling"""	16810	protein-coding gene	gene with protein product		607189	"""regulator of G-protein signalling 8"""			11318611	Standard	NM_001102450		Approved	MGC119067, MGC119068, MGC119069	uc001gpm.1	P57771	OTTHUMG00000035219	ENST00000483095.2:c.-107G>T	1.37:g.182640795C>A		Somatic	279	0	0		WXS	Illumina HiSeq	Phase_I	223	73	0.327354	NM_033345	B4DGL9|Q3SYD2	Missense_Mutation	SNP	ENST00000483095.2	37	CCDS41443.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.168356	0.57584	.	.	ENSG00000135824	ENST00000258302	T	0.46063	0.88	5.28	2.37	0.29283	.	4.860240	0.00357	N	0.000025	T	0.34366	0.0895	.	.	.	0.80722	D	1	P	0.35982	0.531	B	0.31245	0.126	T	0.02829	-1.1105	9	0.40728	T	0.16	.	8.5475	0.33430	0.0:0.7619:0.0:0.238	.	26	P57771-2	.	I	26	ENSP00000258302:R26I	ENSP00000258302:R26I	R	-	2	0	RGS8	180907418	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.286000	0.33273	0.219000	0.20840	0.563000	0.77884	AGA	.	.	none		0.448	RGS8-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358979.1	NM_033345	
OR2A25	392138	hgsc.bcm.edu	37	7	143771336	143771336	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr7:143771336C>T	ENST00000408898.2	+	1	62	c.24C>T	c.(22-24)atC>atT	p.I8I		NM_001004488.1	NP_001004488.1	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A, member 25	8						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(16)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	24	Melanoma(164;0.0783)					AGACTTCCATCACAGAGTTCC	0.468																																					p.I8I		Atlas-SNP	.											OR2A25,caecum,carcinoma,+2,1	OR2A25	66	1	0			c.C24T						PASS	.						75.0	83.0	80.0					7																	143771336		2201	4299	6500	SO:0001819	synonymous_variant	392138	exon1			TTCCATCACAGAG		CCDS43669.1	7q35	2012-08-09		2004-03-10	ENSG00000221933	ENSG00000221933		"""GPCR / Class A : Olfactory receptors"""	19562	protein-coding gene	gene with protein product				OR2A25P, OR2A27			Standard	NM_001004488		Approved		uc011ktx.2	A4D2G3	OTTHUMG00000158013	ENST00000408898.2:c.24C>T	7.37:g.143771336C>T		Somatic	181	0	0		WXS	Illumina HiSeq	Phase_I	146	26	0.178082	NM_001004488	B2RNC9	Silent	SNP	ENST00000408898.2	37	CCDS43669.1																																																																																			.	.	none		0.468	OR2A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350000.1		
FREM2	341640	hgsc.bcm.edu	37	13	39262600	39262600	+	Silent	SNP	C	C	T	rs558517957		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr13:39262600C>T	ENST00000280481.7	+	1	1335	c.1119C>T	c.(1117-1119)acC>acT	p.T373T		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	373					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGGTGAGCACCGATGATCGCA	0.582																																					p.T373T		Atlas-SNP	.											.	FREM2	385	.	0			c.C1119T						PASS	.						107.0	104.0	105.0					13																	39262600		2203	4300	6503	SO:0001819	synonymous_variant	341640	exon1			GAGCACCGATGAT	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1119C>T	13.37:g.39262600C>T		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	56	11	0.196429	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	37	CCDS31960.1																																																																																			.	.	none		0.582	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
PER3	8863	hgsc.bcm.edu	37	1	7890024	7890024	+	Missense_Mutation	SNP	T	T	G	rs201662971|rs57875989		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:7890024T>G	ENST00000361923.2	+	18	3165	c.2990T>G	c.(2989-2991)aTg>aGg	p.M997R	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.M1006R	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	997	5 X 18 AA tandem repeats of S-[HP]-[AP]- T-[AT]-[GST]-[ATV]-L-S-[MT]-G-[LS]-P-P- [MRS]-[EKR]-[NST]-P.|Ser-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.M997R(1)		breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		TCGCCTCCCATGAAGAATCCA	0.582																																					p.M997R		Atlas-SNP	.											PER3,NS,carcinoma,0,3	PER3	95	3	1	Substitution - Missense(1)	central_nervous_system(1)	c.T2990G						scavenged	.						85.0	70.0	75.0					1																	7890024		2001	3894	5895	SO:0001583	missense	8863	exon18			CTCCCATGAAGAA	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2990T>G	1.37:g.7890024T>G	ENSP00000355031:p.Met997Arg	Somatic	114	6	0.0526316		WXS	Illumina HiSeq	Phase_I	86	6	0.0697674	NM_016831	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	37	CCDS89.1	.	.	.	.	.	.	.	.	.	.	T	0.033	-1.321421	0.01320	.	.	ENSG00000049246	ENST00000377532;ENST00000361923	T;T	0.14640	2.49;2.49	.	.	.	Period circadian-like, C-terminal (1);	31.945600	0.01768	N	0.031022	T	0.04861	0.0131	N	0.04508	-0.205	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.25152	-1.0140	8	0.11485	T	0.65	.	.	.	.	.	997;1006;1006;997	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	R	1006;997	ENSP00000366755:M1006R;ENSP00000355031:M997R	ENSP00000355031:M997R	M	+	2	0	PER3	7812611	0.004000	0.15560	0.012000	0.15200	0.013000	0.08279	-1.043000	0.03535	-1.402000	0.02056	-1.459000	0.01027	ATG	.	.	weak		0.582	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
PCLO	27445	hgsc.bcm.edu	37	7	82584908	82584908	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr7:82584908C>G	ENST00000333891.9	-	5	5698	c.5361G>C	c.(5359-5361)aaG>aaC	p.K1787N	PCLO_ENST00000423517.2_Missense_Mutation_p.K1787N	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTTCTTGCTCCTTTAATAATT	0.403																																					p.K1787N		Atlas-SNP	.											.	PCLO	1506	.	0			c.G5361C						PASS	.						90.0	83.0	85.0					7																	82584908		1837	4081	5918	SO:0001583	missense	27445	exon5			TTGCTCCTTTAAT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5361G>C	7.37:g.82584908C>G	ENSP00000334319:p.Lys1787Asn	Somatic	505	1	0.0019802		WXS	Illumina HiSeq	Phase_I	331	96	0.29003	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	5.765	0.325561	0.10900	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.19938	2.11;2.11	5.56	2.63	0.31362	.	.	.	.	.	T	0.13200	0.0320	N	0.08118	0	0.80722	D	1	P;P	0.41848	0.763;0.763	P;P	0.44897	0.463;0.463	T	0.09378	-1.0677	9	0.87932	D	0	.	8.1683	0.31239	0.0:0.5911:0.0:0.4089	.	1787;1787	Q9Y6V0-5;Q9Y6V0-6	.;.	N	1718;1787;1787	ENSP00000334319:K1787N;ENSP00000388393:K1787N	ENSP00000334319:K1787N	K	-	3	2	PCLO	82422844	0.989000	0.36119	0.956000	0.39512	0.996000	0.88848	0.330000	0.19715	0.238000	0.21222	0.650000	0.86243	AAG	.	.	none		0.403	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
CLEC7A	64581	hgsc.bcm.edu	37	12	10278006	10278006	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:10278006C>A	ENST00000304084.8	-	4	536	c.382G>T	c.(382-384)Gag>Tag	p.E128*	CLEC7A_ENST00000298523.5_Nonsense_Mutation_p.E82*|CLEC7A_ENST00000533022.1_Nonsense_Mutation_p.E128*|CLEC7A_ENST00000353231.5_Nonsense_Mutation_p.E82*|CLEC7A_ENST00000396484.2_Nonsense_Mutation_p.E49*	NM_197947.2	NP_922938.1	Q9BXN2	CLC7A_HUMAN	C-type lectin domain family 7, member A	128	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate mediated signaling (GO:0009756)|cell recognition (GO:0008037)|defense response to protozoan (GO:0042832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|MHC protein binding (GO:0042287)|signaling pattern recognition receptor activity (GO:0008329)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						CAGCTCTTCTCATATATAATC	0.398																																					p.E128X		Atlas-SNP	.											.	CLEC7A	55	.	0			c.G382T						PASS	.						68.0	67.0	67.0					12																	10278006		2203	4300	6503	SO:0001587	stop_gained	64581	exon4			TCTTCTCATATAT	AY009090	CCDS8613.1, CCDS8614.1, CCDS8617.1, CCDS41753.1, CCDS41754.1, CCDS53744.1	12p13.2-p12.3	2014-09-17		2005-02-09	ENSG00000172243	ENSG00000172243		"""C-type lectin domain containing"""	14558	protein-coding gene	gene with protein product		606264	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12"""	CLECSF12			Standard	XM_005253468		Approved	dectin-1, hDectin-1	uc001qxg.2	Q9BXN2	OTTHUMG00000133597	ENST00000304084.8:c.382G>T	12.37:g.10278006C>A	ENSP00000302569:p.Glu128*	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	56	20	0.357143	NM_197947	B2R861|B7Z494|B7Z5A9|B7Z5B9|Q6IPS7|Q96D32|Q96DR9|Q96LD3|Q96PA4|Q96PA5|Q96PA6|Q96PA7|Q96PA8|Q9H1K3	Nonsense_Mutation	SNP	ENST00000304084.8	37	CCDS41753.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.166740	0.57476	.	.	ENSG00000172243	ENST00000353231;ENST00000298523;ENST00000396484;ENST00000304084;ENST00000533022	.	.	.	4.68	1.88	0.25563	.	0.545935	0.16857	N	0.196677	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	4.8851	0.13699	0.0:0.6358:0.1758:0.1884	.	.	.	.	X	82;82;49;128;128	.	ENSP00000298523:E82X	E	-	1	0	CLEC7A	10169273	0.004000	0.15560	0.001000	0.08648	0.738000	0.42128	0.694000	0.25512	0.452000	0.26830	0.650000	0.86243	GAG	.	.	none		0.398	CLEC7A-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390772.1	NM_197954	
SLC26A7	115111	hgsc.bcm.edu	37	8	92301369	92301369	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr8:92301369G>A	ENST00000276609.3	+	3	438	c.199G>A	c.(199-201)Gcc>Acc	p.A67T	SLC26A7_ENST00000523719.1_Missense_Mutation_p.A67T|SLC26A7_ENST00000309536.2_Missense_Mutation_p.A67T	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7											breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			CACAGGATTGGCCTTTGCTGT	0.393																																					p.A67T		Atlas-SNP	.											SLC26A7_ENST00000309536,rectum,carcinoma,-1,2	SLC26A7	207	2	0			c.G199A						PASS	.						235.0	212.0	220.0					8																	92301369		2203	4300	6503	SO:0001583	missense	115111	exon3			GGATTGGCCTTTG	AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.199G>A	8.37:g.92301369G>A	ENSP00000276609:p.Ala67Thr	Somatic	425	1	0.00235294		WXS	Illumina HiSeq	Phase_I	466	124	0.266094	NM_134266		Missense_Mutation	SNP	ENST00000276609.3	37	CCDS6254.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.372351	0.82573	.	.	ENSG00000147606	ENST00000522862;ENST00000523719;ENST00000276609;ENST00000309536	D;D;D;D	0.95103	-3.61;-3.61;-3.61;-3.61	6.17	3.25	0.37280	.	0.338048	0.28198	N	0.016238	D	0.95332	0.8485	M	0.93106	3.38	0.27340	N	0.956538	P;P	0.40000	0.51;0.698	B;B	0.38803	0.154;0.282	D	0.89804	0.3977	10	0.72032	D	0.01	.	14.3597	0.66764	0.0:0.0:0.5817:0.4183	.	67;67	Q8TE54-2;Q8TE54	.;S26A7_HUMAN	T	67	ENSP00000428881:A67T;ENSP00000428849:A67T;ENSP00000276609:A67T;ENSP00000309504:A67T	ENSP00000276609:A67T	A	+	1	0	SLC26A7	92370545	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.242000	0.43106	0.380000	0.24823	0.655000	0.94253	GCC	.	.	none		0.393	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1		
EMC1	23065	hgsc.bcm.edu	37	1	19559222	19559222	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:19559222A>T	ENST00000477853.1	-	15	1720	c.1678T>A	c.(1678-1680)Tat>Aat	p.Y560N	RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375208.3_Missense_Mutation_p.Y538N|EMC1_ENST00000375199.3_Missense_Mutation_p.Y559N	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	560						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											TTGGGTAGATACTGTTTCCAC	0.473																																					p.Y560N		Atlas-SNP	.											.	.	.	.	0			c.T1678A						PASS	.						179.0	176.0	177.0					1																	19559222		2203	4300	6503	SO:0001583	missense	23065	exon15			GTAGATACTGTTT		CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.1678T>A	1.37:g.19559222A>T	ENSP00000420608:p.Tyr560Asn	Somatic	170	0	0		WXS	Illumina HiSeq	Phase_I	162	43	0.265432	NM_015047	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Missense_Mutation	SNP	ENST00000477853.1	37	CCDS190.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.9|22.9	4.347263|4.347263	0.82022|0.82022	.|.	.|.	ENSG00000127463|ENSG00000127463	ENST00000375197|ENST00000477853;ENST00000375199;ENST00000375208	.|T;T;T	.|0.24723	.|1.85;1.85;1.84	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.49660|0.49660	0.1570|0.1570	M|M	0.76574|0.76574	2.34|2.34	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.76494	.|0.981;0.991;0.999;0.999	.|D;D;D;D	.|0.71656	.|0.923;0.947;0.974;0.942	T|T	0.42515|0.42515	-0.9447|-0.9447	5|10	.|0.27785	.|T	.|0.31	-13.0003|-13.0003	15.2191|15.2191	0.73296|0.73296	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|538;559;559;560	.|Q8N766-4;Q8N766-2;Q8N766-3;Q8N766	.|.;.;.;K0090_HUMAN	E|N	293|560;559;538	.|ENSP00000420608:Y560N;ENSP00000364345:Y559N;ENSP00000364354:Y538N	.|ENSP00000364345:Y559N	V|Y	-|-	2|1	0|0	KIAA0090|KIAA0090	19431809|19431809	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.938000|0.938000	0.57974|0.57974	8.711000|8.711000	0.91396|0.91396	2.272000|2.272000	0.75746|0.75746	0.460000|0.460000	0.39030|0.39030	GTA|TAT	.	.	none		0.473	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2	NM_015047	
MUC6	4588	hgsc.bcm.edu	37	11	1016849	1016849	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr11:1016849C>G	ENST00000421673.2	-	31	6002	c.5952G>C	c.(5950-5952)atG>atC	p.M1984I		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1984	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.M1984I(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ATGTTGCAGTCATAGGACCTG	0.582																																					p.M1984I		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,0,2	MUC6	408	2	2	Substitution - Missense(2)	lung(2)	c.G5952C						scavenged	.						1544.0	1533.0	1537.0					11																	1016849		2203	4298	6501	SO:0001583	missense	4588	exon31			TGCAGTCATAGGA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5952G>C	11.37:g.1016849C>G	ENSP00000406861:p.Met1984Ile	Somatic	619	31	0.0500808		WXS	Illumina HiSeq	Phase_I	592	26	0.0439189	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	c	0.326	-0.959077	0.02267	.	.	ENSG00000184956	ENST00000421673	T	0.17691	2.26	2.64	-5.29	0.02747	.	.	.	.	.	T	0.09598	0.0236	L	0.43152	1.355	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.27839	-1.0062	9	0.14656	T	0.56	.	1.5757	0.02624	0.1743:0.1847:0.3717:0.2692	.	1984	Q6W4X9	MUC6_HUMAN	I	1984	ENSP00000406861:M1984I	ENSP00000406861:M1984I	M	-	3	0	MUC6	1006849	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.496000	0.02291	-4.003000	0.00082	-2.547000	0.00178	ATG	.	.	none		0.582	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
ESRP1	54845	hgsc.bcm.edu	37	8	95676969	95676969	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr8:95676969G>A	ENST00000433389.2	+	7	879	c.689G>A	c.(688-690)cGa>cAa	p.R230Q	ESRP1_ENST00000423620.2_Missense_Mutation_p.R230Q|ESRP1_ENST00000454170.2_Missense_Mutation_p.R230Q|ESRP1_ENST00000358397.5_Missense_Mutation_p.R230Q	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	230	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						GTCAGGGCACGAGGTTTACCA	0.383																																					p.R230Q		Atlas-SNP	.											ESRP1_ENST00000433389,NS,carcinoma,+1,2	ESRP1	148	2	0			c.G689A						PASS	.						137.0	127.0	130.0					8																	95676969		1924	4146	6070	SO:0001583	missense	54845	exon7			GGGCACGAGGTTT	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.689G>A	8.37:g.95676969G>A	ENSP00000405738:p.Arg230Gln	Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	145	59	0.406897	NM_001122827	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	ENST00000433389.2	37	CCDS47897.1	.	.	.	.	.	.	.	.	.	.	G	36	5.754248	0.96890	.	.	ENSG00000104413	ENST00000423620;ENST00000433389;ENST00000358397;ENST00000454170;ENST00000522756;ENST00000517610	T;T;T;T;T;T	0.09723	2.95;3.31;3.31;2.95;2.95;3.31	5.68	5.68	0.88126	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	T	0.40171	0.1106	M	0.83483	2.645	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	T	0.28138	-1.0053	10	0.87932	D	0	-9.7887	19.798	0.96494	0.0:0.0:1.0:0.0	.	230;230;230;230;230;230	D7PBN3;Q6NXG1-4;Q6NXG1-2;E9PB47;Q6NXG1-3;Q6NXG1	.;.;.;.;.;ESRP1_HUMAN	Q	230;230;230;230;13;89	ENSP00000407349:R230Q;ENSP00000405738:R230Q;ENSP00000351168:R230Q;ENSP00000402766:R230Q;ENSP00000428490:R13Q;ENSP00000429125:R89Q	ENSP00000351168:R230Q	R	+	2	0	ESRP1	95746145	1.000000	0.71417	0.992000	0.48379	0.987000	0.75469	9.869000	0.99810	2.677000	0.91161	0.563000	0.77884	CGA	.	.	none		0.383	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379326.1	NM_017697	
CD1A	909	hgsc.bcm.edu	37	1	158226646	158226646	+	Silent	SNP	C	C	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:158226646C>G	ENST00000289429.5	+	4	1208	c.675C>G	c.(673-675)gtC>gtG	p.V225V		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	225	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	TGTGCCATGTCTCAGGATTCT	0.587																																					p.V225V		Atlas-SNP	.											.	CD1A	88	.	0			c.C675G						PASS	.						83.0	80.0	81.0					1																	158226646		2203	4300	6503	SO:0001819	synonymous_variant	909	exon4			CCATGTCTCAGGA	M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.675C>G	1.37:g.158226646C>G		Somatic	242	0	0		WXS	Illumina HiSeq	Phase_I	245	71	0.289796	NM_001763	D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Silent	SNP	ENST00000289429.5	37	CCDS1174.1																																																																																			.	.	none		0.587	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046349.2	NM_001763	
INVS	27130	hgsc.bcm.edu	37	9	103054777	103054777	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr9:103054777C>T	ENST00000262457.2	+	14	2423	c.2238C>T	c.(2236-2238)tcC>tcT	p.S746S	INVS_ENST00000262456.2_Intron|INVS_ENST00000541287.1_Silent_p.S650S	NM_014425.3	NP_055240.2	Q9Y283	INVS_HUMAN	inversin	746					embryonic heart tube left/right pattern formation (GO:0060971)|kidney development (GO:0001822)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|pancreas development (GO:0031016)|post-embryonic development (GO:0009791)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Acute lymphoblastic leukemia(62;0.056)				AGCAGCCCTCCTGTATCAGGG	0.612																																					p.S746S		Atlas-SNP	.											.	INVS	81	.	0			c.C2238T						PASS	.						56.0	50.0	52.0					9																	103054777		2203	4300	6503	SO:0001819	synonymous_variant	27130	exon14			GCCCTCCTGTATC	AF039217	CCDS6746.1, CCDS6747.1	9q31	2013-01-10	2003-08-11		ENSG00000119509	ENSG00000119509		"""Ankyrin repeat domain containing"""	17870	protein-coding gene	gene with protein product	"""nephrocystin 2"""	243305	"""nephronophthisis 2 (infantile)"""	NPHP2		12872123	Standard	NM_014425		Approved		uc004bap.2	Q9Y283	OTTHUMG00000020364	ENST00000262457.2:c.2238C>T	9.37:g.103054777C>T		Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	174	47	0.270115	NM_014425	A2A2Y2|Q2NKL0|Q5W0T6|Q8IVX8|Q9BRB9|Q9Y488|Q9Y498	Silent	SNP	ENST00000262457.2	37	CCDS6746.1																																																																																			.	.	none		0.612	INVS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053407.1	NM_014425	
SLC22A4	6583	hgsc.bcm.edu	37	5	131630330	131630330	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:131630330G>A	ENST00000200652.3	+	1	195	c.21G>A	c.(19-21)gtG>gtA	p.V7V	P4HA2_ENST00000471826.1_Intron	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	7					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	ACGACGAGGTGATCGCCTTCC	0.592																																					p.V7V		Atlas-SNP	.											.	SLC22A4	45	.	0			c.G21A						PASS	.						78.0	84.0	82.0					5																	131630330		2203	4300	6503	SO:0001819	synonymous_variant	6583	exon1			CGAGGTGATCGCC	AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.21G>A	5.37:g.131630330G>A		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	107	15	0.140187	NM_003059	O14546	Silent	SNP	ENST00000200652.3	37	CCDS4153.1																																																																																			.	.	none		0.592	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1	NM_003059	
ZNF814	730051	hgsc.bcm.edu	37	19	58385762	58385762	+	Silent	SNP	C	C	G	rs199732634		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:58385762C>G	ENST00000435989.2	-	3	1230	c.996G>C	c.(994-996)tcG>tcC	p.S332S	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	332					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S332S(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ATTTGCTAAACGATTTCCCAC	0.358																																					p.S332S		Atlas-SNP	.											ZNF814,NS,carcinoma,0,15	ZNF814	93	15	2	Substitution - coding silent(2)	kidney(2)	c.G996C						scavenged	.						25.0	25.0	25.0					19																	58385762		692	1589	2281	SO:0001819	synonymous_variant	730051	exon3			GCTAAACGATTTC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.996G>C	19.37:g.58385762C>G		Somatic	289	3	0.0103806		WXS	Illumina HiSeq	Phase_I	353	99	0.280453	NM_001144989	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.	.	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF445	353274	hgsc.bcm.edu	37	3	44488625	44488625	+	Silent	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:44488625C>A	ENST00000396077.2	-	8	2885	c.2538G>T	c.(2536-2538)ggG>ggT	p.G846G	ZNF445_ENST00000425708.2_Silent_p.G846G	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	846					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		TAAAGGTTTTCCCACATTCTT	0.373																																					p.G846G		Atlas-SNP	.											.	ZNF445	91	.	0			c.G2538T						PASS	.						126.0	131.0	129.0					3																	44488625		2203	4300	6503	SO:0001819	synonymous_variant	353274	exon8			GGTTTTCCCACAT	AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.2538G>T	3.37:g.44488625C>A		Somatic	245	0	0		WXS	Illumina HiSeq	Phase_I	235	75	0.319149	NM_181489	Q3MJD1	Silent	SNP	ENST00000396077.2	37	CCDS2713.1																																																																																			.	.	none		0.373	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256647.2	NM_181489	
CACNA1H	8912	hgsc.bcm.edu	37	16	1268451	1268451	+	Missense_Mutation	SNP	C	C	T	rs35828403|rs139080716		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr16:1268451C>T	ENST00000348261.5	+	33	5935	c.5687C>T	c.(5686-5688)gCg>gTg	p.A1896V	CACNA1H_ENST00000358590.4_Missense_Mutation_p.A1890V|CACNA1H_ENST00000565831.1_Missense_Mutation_p.A1890V	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1896					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CGGGTGGACGCGGACAGGCCT	0.692													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14672	0.0		0.0	False		,,,				2504	0.0				p.A1896V		Atlas-SNP	.											.	CACNA1H	317	.	0			c.C5687T						PASS	.						28.0	36.0	33.0					16																	1268451		2040	4074	6114	SO:0001583	missense	8912	exon33			TGGACGCGGACAG	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.5687C>T	16.37:g.1268451C>T	ENSP00000334198:p.Ala1896Val	Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	49	20	0.408163	NM_021098	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	CCDS45375.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	5.801	0.332173	0.10956	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96554	-4.05;-4.0	2.6	-0.801	0.10893	.	3.511550	0.00951	N	0.002976	D	0.89291	0.6673	N	0.22421	0.69	0.09310	N	1	B;B;B;B;P	0.36768	0.002;0.0;0.0;0.087;0.569	B;B;B;B;B	0.21708	0.001;0.001;0.001;0.006;0.036	D	0.83591	0.0123	10	0.49607	T	0.09	.	0.331	0.00318	0.2142:0.3259:0.193:0.2669	.	642;631;637;1890;1896	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	V	1896;1890	ENSP00000334198:A1896V;ENSP00000351401:A1890V	ENSP00000334198:A1896V	A	+	2	0	CACNA1H	1208452	.	.	0.000000	0.03702	0.002000	0.02628	.	.	-0.123000	0.11745	-0.643000	0.03959	GCG	C|0.999;T|0.001	0.001	strong		0.692	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
KCNK13	56659	hgsc.bcm.edu	37	14	90650648	90650648	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr14:90650648G>A	ENST00000282146.4	+	2	969	c.528G>A	c.(526-528)ctG>ctA	p.L176L		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	176					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				AGGAGAGCCTGAAGGATGCGG	0.617																																					p.L176L		Atlas-SNP	.											.	KCNK13	76	.	0			c.G528A						PASS	.						81.0	78.0	79.0					14																	90650648		2203	4300	6503	SO:0001819	synonymous_variant	56659	exon2			GAGCCTGAAGGAT	AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.528G>A	14.37:g.90650648G>A		Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	88	26	0.295455	NM_022054	B5TJL8|Q96E79	Silent	SNP	ENST00000282146.4	37	CCDS9889.1																																																																																			.	.	none		0.617	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411251.1	NM_022054	
DSCAM	1826	hgsc.bcm.edu	37	21	41648055	41648055	+	Silent	SNP	G	G	A	rs372175757		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr21:41648055G>A	ENST00000400454.1	-	11	2802	c.2325C>T	c.(2323-2325)gaC>gaT	p.D775D		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	775	Ig-like C2-type 8.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				ACTTGCTGACGTCTGCGCCCA	0.468																																					p.D775D	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											DSCAM,colon,carcinoma,0,1	DSCAM	347	1	0			c.C2325T						PASS	.	G		0,4152		0,0,2076	95.0	101.0	99.0		2325	4.7	1.0	21		99	1,8507		0,1,4253	no	coding-synonymous	DSCAM	NM_001389.3		0,1,6329	AA,AG,GG		0.0118,0.0,0.0079		775/2013	41648055	1,12659	2076	4254	6330	SO:0001819	synonymous_variant	1826	exon11			GCTGACGTCTGCG	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.2325C>T	21.37:g.41648055G>A		Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	123	45	0.365854	NM_001271534	O60468	Silent	SNP	ENST00000400454.1	37	CCDS42929.1																																																																																			.	.	weak		0.468	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
SELL	6402	hgsc.bcm.edu	37	1	169677562	169677562	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:169677562G>A	ENST00000236147.4	-	3	667	c.507C>T	c.(505-507)taC>taT	p.Y169Y	C1orf112_ENST00000498289.1_Intron|SELL_ENST00000463108.1_5'UTR	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	156	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					CCCTACCTGTGTAACAGAGGG	0.502																																					p.Y169Y		Atlas-SNP	.											.	SELL	43	.	0			c.C507T						PASS	.						98.0	93.0	95.0					1																	169677562		1975	4151	6126	SO:0001819	synonymous_variant	6402	exon3			ACCTGTGTAACAG	M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.507C>T	1.37:g.169677562G>A		Somatic	181	0	0		WXS	Illumina HiSeq	Phase_I	146	41	0.280822	NM_000655	B2R6Q8|P15023|Q9UJ43	Silent	SNP	ENST00000236147.4	37	CCDS53427.1																																																																																			.	.	none		0.502	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084233.1	NM_000655	
SH3RF3	344558	hgsc.bcm.edu	37	2	110049003	110049003	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:110049003G>A	ENST00000309415.6	+	6	1450	c.1450G>A	c.(1450-1452)Gag>Aag	p.E484K		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	484	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						TGACGAGCTGGAGCTGCACAA	0.637																																					p.E484K		Atlas-SNP	.											.	SH3RF3	62	.	0			c.G1450A						PASS	.						39.0	45.0	43.0					2																	110049003		2020	4203	6223	SO:0001583	missense	344558	exon6			GAGCTGGAGCTGC	AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.1450G>A	2.37:g.110049003G>A	ENSP00000309186:p.Glu484Lys	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	41	15	0.365854	NM_001099289	A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	ENST00000309415.6	37		.	.	.	.	.	.	.	.	.	.	G	34	5.408357	0.96051	.	.	ENSG00000172985	ENST00000418513;ENST00000309415	T;T	0.29917	1.55;1.55	4.9	4.9	0.64082	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.58708	0.2141	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.61173	-0.7116	9	0.54805	T	0.06	-50.5295	18.6073	0.91271	0.0:0.0:1.0:0.0	.	484	Q8TEJ3	SH3R3_HUMAN	K	484	ENSP00000414997:E484K;ENSP00000309186:E484K	ENSP00000309186:E484K	E	+	1	0	SH3RF3	109415435	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.271000	0.95698	2.688000	0.91661	0.561000	0.74099	GAG	.	.	none		0.637	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001099289	
BAIAP2L1	55971	hgsc.bcm.edu	37	7	97991678	97991678	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr7:97991678C>A	ENST00000005260.8	-	2	333	c.118G>T	c.(118-120)Gct>Tct	p.A40S	BAIAP2L1_ENST00000462558.1_5'UTR	NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	40	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			CCGTTTACAGCTTTCTCATAA	0.284																																					p.A40S		Atlas-SNP	.											BAIAP2L1,right_upper_lobe,carcinoma,0,1	BAIAP2L1	61	1	0			c.G118T						PASS	.						75.0	82.0	80.0					7																	97991678		2202	4300	6502	SO:0001583	missense	55971	exon2			TTACAGCTTTCTC	AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.118G>T	7.37:g.97991678C>A	ENSP00000005260:p.Ala40Ser	Somatic	411	0	0		WXS	Illumina HiSeq	Phase_I	351	59	0.168091	NM_018842	A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	Missense_Mutation	SNP	ENST00000005260.8	37	CCDS34687.1	.	.	.	.	.	.	.	.	.	.	C	18.13	3.556132	0.65425	.	.	ENSG00000006453	ENST00000005260	T	0.31247	1.5	5.45	5.45	0.79879	IRSp53/MIM homology domain (IMD) (3);	0.167136	0.53938	D	0.000051	T	0.42063	0.1186	L	0.43923	1.385	0.54753	D	0.999981	D	0.61080	0.989	P	0.57283	0.817	T	0.10064	-1.0646	10	0.42905	T	0.14	-18.9119	14.7855	0.69800	0.0:1.0:0.0:0.0	.	40	Q9UHR4	BI2L1_HUMAN	S	40	ENSP00000005260:A40S	ENSP00000005260:A40S	A	-	1	0	AC093799.1	97829614	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	1.770000	0.38532	2.575000	0.86900	0.591000	0.81541	GCT	.	.	none		0.284	BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334681.1	NM_018842	
GPR98	84059	hgsc.bcm.edu	37	5	90052843	90052843	+	Silent	SNP	C	C	T	rs144269892	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:90052843C>T	ENST00000405460.2	+	57	11901	c.11805C>T	c.(11803-11805)aaC>aaT	p.N3935N		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3935	Calx-beta 26. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CACCCTTGAACGTTCTTCAAG	0.443													C|||	6	0.00119808	0.0045	0.0	5008	,	,		15792	0.0		0.0	False		,,,				2504	0.0				p.N3935N		Atlas-SNP	.											.	GPR98	605	.	0			c.C11805T						PASS	.	C		10,3696		0,10,1843	101.0	98.0	99.0		11805	-9.8	0.0	5	dbSNP_134	99	0,8178		0,0,4089	no	coding-synonymous	GPR98	NM_032119.3		0,10,5932	TT,TC,CC		0.0,0.2698,0.0841		3935/6307	90052843	10,11874	1853	4089	5942	SO:0001819	synonymous_variant	84059	exon57			CTTGAACGTTCTT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.11805C>T	5.37:g.90052843C>T		Somatic	211	0	0		WXS	Illumina HiSeq	Phase_I	192	26	0.135417	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	37	CCDS47246.1	4	0.0018315018315018315	2	0.0040650406504065045	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	C	1.028	-0.682857	0.03353	0.002698	0.0	ENSG00000164199	ENST00000509621	.	.	.	5.3	-9.79	0.00494	.	.	.	.	.	T	0.63745	0.2537	.	.	.	0.35190	D	0.773244	.	.	.	.	.	.	T	0.71297	-0.4635	4	.	.	.	.	19.5309	0.95228	0.0:0.1654:0.0:0.8346	.	.	.	.	M	1501	.	.	T	+	2	0	GPR98	90088599	0.000000	0.05858	0.000000	0.03702	0.358000	0.29455	-0.645000	0.05409	-2.179000	0.00767	-0.670000	0.03821	ACG	C|0.998;T|0.002	0.002	strong		0.443	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
ZNF814	730051	hgsc.bcm.edu	37	19	58385790	58385790	+	Missense_Mutation	SNP	G	G	T	rs111727691		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:58385790G>T	ENST00000435989.2	-	3	1202	c.968C>A	c.(967-969)cCt>cAt	p.P323H	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	323					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACATTCATAAGGTCTTTTCCC	0.358																																					p.P323H		Atlas-SNP	.											.	ZNF814	93	.	0			c.C968A						PASS	.						15.0	12.0	13.0					19																	58385790		688	1563	2251	SO:0001583	missense	730051	exon3			TCATAAGGTCTTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.968C>A	19.37:g.58385790G>T	ENSP00000410545:p.Pro323His	Somatic	221	0	0		WXS	Illumina HiSeq	Phase_I	211	20	0.0947867	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	8.139	0.784825	0.16189	.	.	ENSG00000204514	ENST00000435989	T	0.29397	1.57	2.27	1.18	0.20946	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57080	0.2029	M	0.90019	3.08	0.20764	N	0.999853	D	0.89917	1.0	D	0.67231	0.95	T	0.46247	-0.9205	9	0.66056	D	0.02	.	9.258	0.37595	0.0:0.0:0.7811:0.2189	.	323	B7Z6K7	ZN814_HUMAN	H	323	ENSP00000410545:P323H	ENSP00000410545:P323H	P	-	2	0	ZNF814	63077602	0.000000	0.05858	0.028000	0.17463	0.016000	0.09150	-0.439000	0.06897	0.330000	0.23485	-1.407000	0.01130	CCT	G|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	hgsc.bcm.edu	37	19	58385793	58385793	+	Missense_Mutation	SNP	C	C	T	rs113623532		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:58385793C>T	ENST00000435989.2	-	3	1199	c.965G>A	c.(964-966)aGa>aAa	p.R322K	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	322					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTCATAAGGTCTTTTCCCAGT	0.358																																					p.R322K		Atlas-SNP	.											.	ZNF814	93	.	0			c.G965A						PASS	.						15.0	12.0	13.0					19																	58385793		687	1562	2249	SO:0001583	missense	730051	exon3			TAAGGTCTTTTCC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.965G>A	19.37:g.58385793C>T	ENSP00000410545:p.Arg322Lys	Somatic	215	0	0		WXS	Illumina HiSeq	Phase_I	205	21	0.102439	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.395361	0.01175	.	.	ENSG00000204514	ENST00000435989	T	0.12361	2.69	2.27	9.47E-4	0.14044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.02225	-0.63	0.09310	N	0.999999	B	0.29301	0.241	B	0.28916	0.096	T	0.40534	-0.9558	9	0.02654	T	1	.	4.6969	0.12808	0.0:0.4166:0.0:0.5834	.	322	B7Z6K7	ZN814_HUMAN	K	322	ENSP00000410545:R322K	ENSP00000410545:R322K	R	-	2	0	ZNF814	63077605	0.000000	0.05858	0.024000	0.17045	0.009000	0.06853	-1.883000	0.01623	0.331000	0.23511	-1.381000	0.01174	AGA	C|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
BANP	54971	hgsc.bcm.edu	37	16	88039846	88039846	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr16:88039846C>T	ENST00000393207.1	+	6	827	c.606C>T	c.(604-606)gtC>gtT	p.V202V	BANP_ENST00000479780.2_Silent_p.V171V|BANP_ENST00000393208.2_Silent_p.V171V|BANP_ENST00000355022.4_Silent_p.V171V|BANP_ENST00000355163.5_Silent_p.V177V|BANP_ENST00000538234.1_Silent_p.V210V|BANP_ENST00000286122.7_Silent_p.V202V	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	202	Interaction with CUX1 and HDAC1. {ECO:0000250}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		GGAGCAACGTCACGCTCATCA	0.582																																					p.V210V		Atlas-SNP	.											.	BANP	67	.	0			c.C630T						PASS	.						78.0	78.0	78.0					16																	88039846		2198	4300	6498	SO:0001819	synonymous_variant	54971	exon6			CAACGTCACGCTC	AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.606C>T	16.37:g.88039846C>T		Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	58	15	0.258621	NM_001173542	A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Silent	SNP	ENST00000393207.1	37	CCDS54054.1																																																																																			.	.	none		0.582	BANP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269166.1	NM_017869	
ABLIM3	22885	hgsc.bcm.edu	37	5	148620293	148620293	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:148620293C>G	ENST00000506113.1	+	13	1741	c.1259C>G	c.(1258-1260)tCc>tGc	p.S420C	ABLIM3_ENST00000517451.1_5'Flank|AC012613.2_ENST00000523176.1_RNA|RP11-331K21.1_ENST00000512647.2_RNA|ABLIM3_ENST00000326685.7_Intron|ABLIM3_ENST00000504238.1_Intron|ABLIM3_ENST00000356541.3_Intron|ABLIM3_ENST00000309868.7_Missense_Mutation_p.S420C|ABLIM3_ENST00000508983.1_Intron|RP11-331K21.1_ENST00000522685.1_RNA			O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	420					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|cilium assembly (GO:0042384)|lamellipodium assembly (GO:0030032)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGAGGTCCTCCACTCCAACC	0.577																																					p.S420C		Atlas-SNP	.											.	ABLIM3	91	.	0			c.C1259G						PASS	.						126.0	116.0	119.0					5																	148620293		2203	4300	6503	SO:0001583	missense	22885	exon14			GGTCCTCCACTCC	AB020650	CCDS4294.1	5q33.1	2008-02-05			ENSG00000173210	ENSG00000173210			29132	protein-coding gene	gene with protein product		611305					Standard	XM_005268392		Approved	KIAA0843	uc003lpy.2	O94929	OTTHUMG00000129932	ENST00000506113.1:c.1259C>G	5.37:g.148620293C>G	ENSP00000425394:p.Ser420Cys	Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	71	43	0.605634	NM_014945	A8K121|Q19VH3|Q658S1|Q68CI5|Q9BV32	Missense_Mutation	SNP	ENST00000506113.1	37	CCDS4294.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.221000	0.79464	.	.	ENSG00000173210	ENST00000309868;ENST00000506113	T;T	0.45276	0.9;0.9	5.73	5.73	0.89815	.	0.304822	0.35970	N	0.002864	T	0.52996	0.1769	L	0.38175	1.15	0.80722	D	1	D	0.71674	0.998	P	0.58721	0.844	T	0.48833	-0.9000	10	0.52906	T	0.07	.	19.8552	0.96755	0.0:1.0:0.0:0.0	.	420	O94929	ABLM3_HUMAN	C	420	ENSP00000310309:S420C;ENSP00000425394:S420C	ENSP00000310309:S420C	S	+	2	0	ABLIM3	148600486	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.375000	0.52410	2.861000	0.98227	0.655000	0.94253	TCC	.	.	none		0.577	ABLIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373435.1	NM_014945	
C1orf112	55732	hgsc.bcm.edu	37	1	169821960	169821960	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:169821960C>A	ENST00000286031.6	+	24	3094	c.2394C>A	c.(2392-2394)ttC>ttA	p.F798L	C1orf112_ENST00000498289.1_3'UTR|C1orf112_ENST00000359326.4_Missense_Mutation_p.F798L|SCYL3_ENST00000367772.4_3'UTR|SCYL3_ENST00000367771.6_3'UTR	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	798										breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GTCAGGAGTTCCCCTGGGAAG	0.443																																					p.F798L		Atlas-SNP	.											.	C1orf112	74	.	0			c.C2394A						PASS	.						85.0	96.0	92.0					1																	169821960		2203	4300	6503	SO:0001583	missense	55732	exon24			GGAGTTCCCCTGG	AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.2394C>A	1.37:g.169821960C>A	ENSP00000286031:p.Phe798Leu	Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	119	31	0.260504	NM_018186	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Missense_Mutation	SNP	ENST00000286031.6	37	CCDS1285.1	.	.	.	.	.	.	.	.	.	.	C	9.708	1.156280	0.21454	.	.	ENSG00000000460	ENST00000359326;ENST00000286031	T;T	0.40225	1.04;1.04	5.42	1.96	0.26148	.	1.278610	0.04710	N	0.417527	T	0.04998	0.0134	N	0.02736	-0.51	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24905	-1.0147	10	0.06236	T	0.91	9.7704	6.7373	0.23417	0.0:0.5238:0.3553:0.1209	.	798	Q9NSG2	CA112_HUMAN	L	798	ENSP00000352276:F798L;ENSP00000286031:F798L	ENSP00000286031:F798L	F	+	3	2	C1orf112	168088584	0.000000	0.05858	0.002000	0.10522	0.469000	0.32828	-0.140000	0.10342	0.589000	0.29677	0.591000	0.81541	TTC	.	.	none		0.443	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087126.3	NM_018186	
GABRQ	55879	hgsc.bcm.edu	37	X	151817742	151817742	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:151817742G>C	ENST00000370306.2	+	5	576	c.556G>C	c.(556-558)Gat>Cat	p.D186H		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	186					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTGTTCCCTGGATCTGCATAA	0.507																																					p.D186H		Atlas-SNP	.											.	GABRQ	131	.	0			c.G556C						PASS	.						188.0	147.0	161.0					X																	151817742		2203	4300	6503	SO:0001583	missense	55879	exon5			TCCCTGGATCTGC	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.556G>C	X.37:g.151817742G>C	ENSP00000359329:p.Asp186His	Somatic	200	0	0		WXS	Illumina HiSeq	Phase_I	153	60	0.392157	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.676104	0.47886	.	.	ENSG00000147402	ENST00000370306	T	0.81415	-1.49	5.8	1.89	0.25635	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.399455	0.21498	N	0.073562	D	0.84656	0.5520	L	0.50847	1.595	0.35231	D	0.776932	D	0.76494	0.999	D	0.69824	0.966	D	0.85842	0.1398	10	0.66056	D	0.02	.	11.1219	0.48296	0.2236:0.0:0.7764:0.0	.	186	Q9UN88	GBRT_HUMAN	H	186	ENSP00000359329:D186H	ENSP00000359329:D186H	D	+	1	0	GABRQ	151568398	1.000000	0.71417	0.116000	0.21606	0.233000	0.25261	2.860000	0.48372	-0.063000	0.13065	0.600000	0.82982	GAT	.	.	none		0.507	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
PTPRC	5788	hgsc.bcm.edu	37	1	198685901	198685901	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:198685901C>T	ENST00000367376.2	+	13	1547	c.1376C>T	c.(1375-1377)gCc>gTc	p.A459V	PTPRC_ENST00000348564.6_Missense_Mutation_p.A300V|PTPRC_ENST00000594404.1_Missense_Mutation_p.A298V|PTPRC_ENST00000352140.3_Missense_Mutation_p.A411V|PTPRC_ENST00000442510.2_Missense_Mutation_p.A461V	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	459	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						TCATTACATGCCTACATCATT	0.313																																					p.A461V		Atlas-SNP	.											.	PTPRC	229	.	0			c.C1382T						PASS	.						81.0	83.0	82.0					1																	198685901		2202	4300	6502	SO:0001583	missense	5788	exon13			TACATGCCTACAT	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1376C>T	1.37:g.198685901C>T	ENSP00000356346:p.Ala459Val	Somatic	554	1	0.00180505		WXS	Illumina HiSeq	Phase_I	499	156	0.312625	NM_002838	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	37		.	.	.	.	.	.	.	.	.	.	C	18.56	3.650718	0.67472	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564	T	0.68624	-0.34	4.43	4.43	0.53597	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.49916	D	0.000129	T	0.77948	0.4207	M	0.64404	1.975	0.23628	N	0.997254	D;D;D;D;D	0.89917	0.984;0.997;1.0;1.0;1.0	D;D;D;D;D	0.80764	0.926;0.974;0.994;0.994;0.994	T	0.68899	-0.5287	10	0.87932	D	0	.	12.8585	0.57899	0.0:1.0:0.0:0.0	.	395;395;300;411;459	F5GXZ3;B4DSZ5;B1ALS3;E9PC28;P08575	.;.;.;.;PTPRC_HUMAN	V	461;395;411;411;345;459;393;298	ENSP00000193532:A411V	ENSP00000306782:A298V	A	+	2	0	PTPRC	196952524	0.391000	0.25221	0.192000	0.23308	0.044000	0.14063	2.994000	0.49433	2.741000	0.93983	0.650000	0.86243	GCC	.	.	none		0.313	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
ZNF513	130557	hgsc.bcm.edu	37	2	27601207	27601207	+	Silent	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:27601207A>G	ENST00000323703.6	-	4	1029	c.831T>C	c.(829-831)caT>caC	p.H277H	ZNF513_ENST00000491924.1_Intron|ZNF513_ENST00000407879.1_Silent_p.H215H	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	277					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGGTGGCACATGGAGGCTCA	0.592																																					p.H277H		Atlas-SNP	.											.	ZNF513	45	.	0			c.T831C						PASS	.						34.0	37.0	36.0					2																	27601207		2203	4300	6503	SO:0001819	synonymous_variant	130557	exon4			TGGCACATGGAGG	AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.831T>C	2.37:g.27601207A>G		Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	22	7	0.318182	NM_144631	A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Silent	SNP	ENST00000323703.6	37	CCDS1751.1																																																																																			.	.	none		0.592	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215026.2	NM_144631	
FOXRED2	80020	hgsc.bcm.edu	37	22	36886232	36886232	+	Silent	SNP	C	C	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr22:36886232C>G	ENST00000397224.4	-	9	1971	c.1878G>C	c.(1876-1878)gtG>gtC	p.V626V	FOXRED2_ENST00000216187.6_Silent_p.V626V|FOXRED2_ENST00000366463.3_Silent_p.V178V|FOXRED2_ENST00000397223.4_Silent_p.V626V	NM_001102371.1	NP_001095841.1	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	626					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	flavin adenine dinucleotide binding (GO:0050660)|glycoprotein binding (GO:0001948)|oxidoreductase activity (GO:0016491)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						TCTCGGTACTCACGAGTCCCT	0.612																																					p.V626V		Atlas-SNP	.											FOXRED2,right_upper_lobe,carcinoma,0,1	FOXRED2	48	1	0			c.G1878C						PASS	.						99.0	101.0	100.0					22																	36886232		2203	4300	6503	SO:0001819	synonymous_variant	80020	exon9			GGTACTCACGAGT	BC027716	CCDS13929.1	22q12.3	2006-07-05			ENSG00000100350	ENSG00000100350			26264	protein-coding gene	gene with protein product		613777				12477932	Standard	NM_024955		Approved	FLJ23322	uc003app.4	Q8IWF2	OTTHUMG00000044614	ENST00000397224.4:c.1878G>C	22.37:g.36886232C>G		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	49	14	0.285714	NM_001102371	B2RDI4|Q8N378|Q96BD1|Q9H5L5|Q9H6M8	Silent	SNP	ENST00000397224.4	37	CCDS13929.1																																																																																			.	.	none		0.612	FOXRED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104098.2	NM_024955	
FRMD4B	23150	hgsc.bcm.edu	37	3	69237039	69237039	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:69237039G>A	ENST00000398540.3	-	19	1884	c.1801C>T	c.(1801-1803)Cga>Tga	p.R601*	FRMD4B_ENST00000478263.1_Nonsense_Mutation_p.R253*|FRMD4B_ENST00000542259.1_Nonsense_Mutation_p.R547*	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	601					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		GAACTTGATCGCTGCCCAGGA	0.378																																					p.R601X		Atlas-SNP	.											.	FRMD4B	90	.	0			c.C1801T						PASS	.						43.0	41.0	42.0					3																	69237039		1860	4089	5949	SO:0001587	stop_gained	23150	exon19			TTGATCGCTGCCC	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.1801C>T	3.37:g.69237039G>A	ENSP00000381549:p.Arg601*	Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	110	24	0.218182	NM_015123	Q8TAI3	Nonsense_Mutation	SNP	ENST00000398540.3	37	CCDS46863.1	.	.	.	.	.	.	.	.	.	.	G	37	6.631150	0.97718	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263	.	.	.	6.02	4.21	0.49690	.	0.064071	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.9519	8.9524	0.35796	0.0686:0.0:0.5937:0.3377	.	.	.	.	X	601;547;253	.	ENSP00000381549:R601X	R	-	1	2	FRMD4B	69319729	1.000000	0.71417	1.000000	0.80357	0.612000	0.37316	1.858000	0.39408	0.854000	0.35336	0.591000	0.81541	CGA	.	.	none		0.378	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
CEP85	64793	hgsc.bcm.edu	37	1	26601519	26601519	+	Missense_Mutation	SNP	G	G	T	rs201784964		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:26601519G>T	ENST00000252992.4	+	12	1990	c.1859G>T	c.(1858-1860)cGa>cTa	p.R620L	CEP85_ENST00000469609.1_3'UTR|CEP85_ENST00000451429.2_Missense_Mutation_p.R569L	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa	620						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						GAGGCCCAGCGAAGGGATTCA	0.532																																					p.R620L		Atlas-SNP	.											.	CEP85	61	.	0			c.G1859T						PASS	.						51.0	47.0	48.0					1																	26601519		2188	4284	6472	SO:0001583	missense	64793	exon12			CCCAGCGAAGGGA	AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.1859G>T	1.37:g.26601519G>T	ENSP00000252992:p.Arg620Leu	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	103	33	0.320388	NM_022778	B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	Missense_Mutation	SNP	ENST00000252992.4	37	CCDS277.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.30|17.30	3.355206|3.355206	0.61293|0.61293	.|.	.|.	ENSG00000130695|ENSG00000130695	ENST00000453146|ENST00000451429;ENST00000252992	.|T;T	.|0.11821	.|2.74;2.74	5.57|5.57	3.69|3.69	0.42338|0.42338	.|.	.|0.266541	.|0.43919	.|D	.|0.000505	.|T	.|0.14141	.|0.0342	L|L	0.54323|0.54323	1.7|1.7	0.42111|0.42111	D|D	0.991387|0.991387	.|B;B;P	.|0.36438	.|0.021;0.086;0.553	.|B;B;B	.|0.34418	.|0.014;0.058;0.182	.|T	.|0.04650	.|-1.0936	.|10	.|0.52906	.|T	.|0.07	-14.5059|-14.5059	11.5657|11.5657	0.50805|0.50805	0.144:0.0:0.856:0.0|0.144:0.0:0.856:0.0	.|.	.|569;620;620	.|F8W7K4;Q6P2H3;Q6P2H3-2	.|.;CEP85_HUMAN;.	X|L	294|569;620	.|ENSP00000417002:R569L;ENSP00000252992:R620L	.|ENSP00000252992:R620L	E|R	+|+	1|2	0|0	CEP85|CEP85	26474106|26474106	0.955000|0.955000	0.32602|0.32602	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	0.919000|0.919000	0.28692|0.28692	1.363000|1.363000	0.46019|0.46019	0.561000|0.561000	0.74099|0.74099	GAA|CGA	G|0.998;A|0.002	.	alt		0.532	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009492.2	NM_022778	
CBFA2T3	863	hgsc.bcm.edu	37	16	89043112	89043112	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr16:89043112G>A	ENST00000268679.4	-	1	500	c.104C>T	c.(103-105)gCa>gTa	p.A35V	CBFA2T3_ENST00000448839.1_Missense_Mutation_p.A35V|CBFA2T3_ENST00000360302.2_5'UTR|CBFA2T3_ENST00000436887.2_Missense_Mutation_p.A35V	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	35	Mediates interaction with PDE7A (in isoform 2).|Mediates localization to the nucleus. {ECO:0000250}.|Required for nucleolar targeting (in isoform 1).				cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		GCCGGCAGATGCCAGGAGGCC	0.697			T	RUNX1	AML																																p.A35V		Atlas-SNP	.		Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	.	CBFA2T3	47	.	0			c.C104T						PASS	.						16.0	16.0	16.0					16																	89043112		2158	4249	6407	SO:0001583	missense	863	exon1			GCAGATGCCAGGA	AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.104C>T	16.37:g.89043112G>A	ENSP00000268679:p.Ala35Val	Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	102	38	0.372549	NM_005187	D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Missense_Mutation	SNP	ENST00000268679.4	37	CCDS10972.1	.	.	.	.	.	.	.	.	.	.	G	1.357	-0.589751	0.03799	.	.	ENSG00000129993	ENST00000268679;ENST00000436887;ENST00000448839	T;T;T	0.45668	0.96;0.89;1.22	2.41	0.253	0.15551	.	10.454500	0.01079	U	0.004953	T	0.20129	0.0484	N	0.08118	0	0.20196	N	0.999927	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23833	-1.0177	10	0.02654	T	1	.	5.1646	0.15079	0.3359:0.0:0.6641:0.0	.	35;35	B2RBQ7;O75081	.;MTG16_HUMAN	V	35	ENSP00000268679:A35V;ENSP00000395739:A35V;ENSP00000401254:A35V	ENSP00000268679:A35V	A	-	2	0	CBFA2T3	87570613	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.173000	0.16724	-0.072000	0.12864	-0.657000	0.03884	GCA	.	.	none		0.697	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269545.2	NM_005187	
AGBL3	340351	hgsc.bcm.edu	37	7	134730655	134730655	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr7:134730655G>A	ENST00000436302.2	+	11	2087	c.1834G>A	c.(1834-1836)Gag>Aag	p.E612K	AGBL3_ENST00000435976.2_Missense_Mutation_p.E612K|AGBL3_ENST00000458078.1_Missense_Mutation_p.E586K	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	612						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						ATTGGATGTAGAGTCTAGGTA	0.363																																					p.E612K		Atlas-SNP	.											.	AGBL3	45	.	0			c.G1834A						PASS	.						71.0	64.0	66.0					7																	134730655		692	1590	2282	SO:0001583	missense	340351	exon11			GATGTAGAGTCTA	BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.1834G>A	7.37:g.134730655G>A	ENSP00000388275:p.Glu612Lys	Somatic	189	0	0		WXS	Illumina HiSeq	Phase_I	126	37	0.293651	NM_178563	B7Z827|Q9H965	Missense_Mutation	SNP	ENST00000436302.2	37	CCDS47718.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744816	0.89663	.	.	ENSG00000146856	ENST00000436302;ENST00000458078;ENST00000435976	T;T;T	0.14516	2.5;5.04;2.78	5.24	5.24	0.73138	.	0.269300	0.32563	N	0.005921	T	0.31451	0.0797	M	0.75777	2.31	0.40434	D	0.979978	D	0.55172	0.97	P	0.53224	0.721	T	0.02661	-1.1127	10	0.44086	T	0.13	-20.5036	18.5933	0.91222	0.0:0.0:1.0:0.0	.	612	Q8NEM8-4	.	K	612;586;612	ENSP00000388275:E612K;ENSP00000395969:E586K;ENSP00000401220:E612K	ENSP00000275763:E612K	E	+	1	0	AGBL3	134381195	1.000000	0.71417	0.998000	0.56505	0.765000	0.43378	3.047000	0.49854	2.712000	0.92718	0.650000	0.86243	GAG	.	.	none		0.363	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376655.1	NM_178563	
RGPD8	727851	hgsc.bcm.edu	37	2	113147666	113147666	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:113147666C>A	ENST00000302558.3	-	20	3047	c.2856G>T	c.(2854-2856)agG>agT	p.R952S	RGPD8_ENST00000409750.1_Missense_Mutation_p.R812S	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	952					protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)			endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						TCTTCCGGCCCCTAATATCCT	0.413																																					p.R952S		Atlas-SNP	.											RGPD8_ENST00000302558,NS,carcinoma,-1,2	RGPD8	81	2	0			c.G2856T						scavenged	.						170.0	130.0	143.0					2																	113147666		688	1572	2260	SO:0001583	missense	727851	exon20			CCGGCCCCTAATA	AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.2856G>T	2.37:g.113147666C>A	ENSP00000306637:p.Arg952Ser	Somatic	1142	92	0.0805604		WXS	Illumina HiSeq	Phase_I	1160	89	0.0767241	NM_001164463	Q5CZA8	Missense_Mutation	SNP	ENST00000302558.3	37	CCDS46394.1	.	.	.	.	.	.	.	.	.	.	-	0.001	-3.797847	0.00004	.	.	ENSG00000169629	ENST00000302558;ENST00000409750	T;T	0.36340	1.26;1.26	2.33	2.33	0.28932	.	.	.	.	.	T	0.05410	0.0143	N	0.00067	-2.295	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36089	-0.9762	9	0.05525	T	0.97	-3.6976	3.1911	0.06618	0.5145:0.2459:0.0:0.2395	.	952	O14715	RGPD8_HUMAN	S	952;812	ENSP00000306637:R952S;ENSP00000386511:R812S	ENSP00000306637:R952S	R	-	3	2	RGPD8	112864137	0.000000	0.05858	0.012000	0.15200	0.011000	0.07611	0.325000	0.19628	0.153000	0.19213	-1.882000	0.00544	AGG	C|0.500;A|0.500	0.500	weak		0.413	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375951.1	XM_001722279	
ASIC5	51802	hgsc.bcm.edu	37	4	156757920	156757920	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr4:156757920T>G	ENST00000537611.2	-	8	1202	c.1156A>C	c.(1156-1158)Att>Ctt	p.I386L		NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	386					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)										GAATAAGAAATAGTGGCCGGG	0.358																																					p.I386L		Atlas-SNP	.											.	.	.	.	0			c.A1156C						PASS	.						72.0	80.0	77.0					4																	156757920		2203	4300	6503	SO:0001583	missense	51802	exon8			AAGAAATAGTGGC	AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.1156A>C	4.37:g.156757920T>G	ENSP00000442477:p.Ile386Leu	Somatic	182	0	0		WXS	Illumina HiSeq	Phase_I	138	46	0.333333	NM_017419		Missense_Mutation	SNP	ENST00000537611.2	37	CCDS3793.1	.	.	.	.	.	.	.	.	.	.	T	10.44	1.350945	0.24512	.	.	ENSG00000256394	ENST00000537611	T	0.61742	0.08	4.8	-0.965	0.10323	.	0.519192	0.17888	N	0.158638	T	0.34193	0.0889	N	0.20483	0.58	0.09310	N	0.999997	B	0.09022	0.002	B	0.15484	0.013	T	0.14924	-1.0455	10	0.22706	T	0.39	-13.9873	6.8804	0.24170	0.0:0.2563:0.1169:0.6268	.	386	Q9NY37	ACCN5_HUMAN	L	386	ENSP00000442477:I386L	ENSP00000264432:I386L	I	-	1	0	ACCN5	156977370	0.013000	0.17824	0.049000	0.19019	0.972000	0.66771	-0.092000	0.11129	-0.199000	0.10317	0.533000	0.62120	ATT	.	.	none		0.358	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366464.1		
EDA	1896	hgsc.bcm.edu	37	X	69253328	69253328	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:69253328G>C	ENST00000374552.4	+	7	1116	c.874G>C	c.(874-876)Gag>Cag	p.E292Q	EDA_ENST00000374553.2_Missense_Mutation_p.E292Q|EDA_ENST00000524573.1_Missense_Mutation_p.E289Q	NM_001399.4	NP_001390.1	Q92838	EDA_HUMAN	ectodysplasin A	292					cell differentiation (GO:0030154)|cell-matrix adhesion (GO:0007160)|ectoderm development (GO:0007398)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|immune response (GO:0006955)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|salivary gland cavitation (GO:0060662)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	apical part of cell (GO:0045177)|collagen trimer (GO:0005581)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.E292K(2)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|urinary_tract(1)	14						CCGCAGCGGGGAGCTGGAGGT	0.502											OREG0019847	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E292Q		Atlas-SNP	.											.	EDA	61	.	2	Substitution - Missense(2)	endometrium(2)	c.G874C						PASS	.						121.0	98.0	106.0					X																	69253328		2203	4300	6503	SO:0001583	missense	1896	exon7			AGCGGGGAGCTGG	U59227	CCDS14394.1, CCDS35318.1, CCDS35319.1, CCDS43966.1, CCDS35318.2, CCDS35319.2, CCDS55436.1	Xq12-q13.1	2013-05-22	2004-08-09	2004-08-12	ENSG00000158813	ENSG00000158813		"""Tumor necrosis factor (ligand) superfamily"""	3157	protein-coding gene	gene with protein product		300451	"""ectodermal dysplasia 1, anhidrotic"", ""oligodontia 1"""	ED1, EDA2, ODT1		8696334, 18657636, 16583127	Standard	NM_001005612		Approved	EDA1, XLHED, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2	uc004dxs.3	Q92838	OTTHUMG00000021764	ENST00000374552.4:c.874G>C	X.37:g.69253328G>C	ENSP00000363680:p.Glu292Gln	Somatic	139	0	0	1113	WXS	Illumina HiSeq	Phase_I	74	21	0.283784	NM_001399	A0AUZ2|A2A337|B7ZLU2|B7ZLU4|O75910|Q5JS00|Q5JUM7|Q9UP77|Q9Y6L0|Q9Y6L1|Q9Y6L2|Q9Y6L3|Q9Y6L4	Missense_Mutation	SNP	ENST00000374552.4	37	CCDS14394.1	.	.	.	.	.	.	.	.	.	.	G	17.73	3.462303	0.63513	.	.	ENSG00000158813	ENST00000374552;ENST00000374553;ENST00000524573	D;D;D	0.94931	-3.56;-3.56;-3.56	5.48	5.48	0.80851	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.062571	0.64402	D	0.000007	D	0.91798	0.7405	N	0.17723	0.515	0.80722	D	1	P;P;P	0.37466	0.541;0.596;0.541	B;B;B	0.43331	0.292;0.416;0.292	D	0.92537	0.6038	10	0.59425	D	0.04	-14.3379	17.2271	0.86973	0.0:0.0:1.0:0.0	.	289;292;292	Q92838-9;Q92838;Q92838-3	.;EDA_HUMAN;.	Q	292;292;289	ENSP00000363680:E292Q;ENSP00000363681:E292Q;ENSP00000432585:E289Q	ENSP00000363680:E292Q	E	+	1	0	EDA	69170053	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.062000	0.71155	2.279000	0.76181	0.600000	0.82982	GAG	.	.	none		0.502	EDA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057048.2	NM_001399	
CCSER1	401145	hgsc.bcm.edu	37	4	91230610	91230610	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr4:91230610G>A	ENST00000509176.1	+	2	1463	c.1175G>A	c.(1174-1176)aGg>aAg	p.R392K	CCSER1_ENST00000333691.8_Missense_Mutation_p.R392K|CCSER1_ENST00000432775.2_Missense_Mutation_p.R392K	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	392																	AACTCCCCAAGGAAACTTGGA	0.393																																					p.R392K		Atlas-SNP	.											.	.	.	.	0			c.G1175A						PASS	.						124.0	120.0	121.0					4																	91230610		1849	4089	5938	SO:0001583	missense	401145	exon2			CCCCAAGGAAACT		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.1175G>A	4.37:g.91230610G>A	ENSP00000425040:p.Arg392Lys	Somatic	185	0	0		WXS	Illumina HiSeq	Phase_I	145	21	0.144828	NM_001145065	Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	37	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	G	7.084	0.570881	0.13623	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.41065	1.55;1.01;1.55	4.96	3.24	0.37175	.	0.506740	0.20055	N	0.100219	T	0.21227	0.0511	N	0.25647	0.755	0.23126	N	0.998254	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.30679	-0.9970	10	0.02654	T	1	-11.0531	4.6727	0.12698	0.3615:0.1536:0.4849:0.0	.	392;392;392	Q9C0I3-2;Q9C0I3;E7EUW0	.;F190A_HUMAN;.	K	392	ENSP00000425040:R392K;ENSP00000389283:R392K;ENSP00000329482:R392K	ENSP00000329482:R392K	R	+	2	0	FAM190A	91449633	0.991000	0.36638	0.994000	0.49952	0.436000	0.31835	0.953000	0.29162	0.769000	0.33313	0.585000	0.79938	AGG	.	.	none		0.393	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
USP24	23358	hgsc.bcm.edu	37	1	55587126	55587126	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:55587126C>T	ENST00000294383.6	-	37	4329	c.4330G>A	c.(4330-4332)Gga>Aga	p.G1444R	USP24_ENST00000407756.1_Missense_Mutation_p.G1284R	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1444					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						CTTGGTGATCCGAGCAGAATA	0.413																																					p.G1444R		Atlas-SNP	.											.	USP24	323	.	0			c.G4330A						PASS	.						104.0	102.0	102.0					1																	55587126		1910	4135	6045	SO:0001583	missense	23358	exon37			GTGATCCGAGCAG	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.4330G>A	1.37:g.55587126C>T	ENSP00000294383:p.Gly1444Arg	Somatic	204	0	0		WXS	Illumina HiSeq	Phase_I	198	49	0.247475	NM_015306	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996122	0.74703	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.02258	4.37;4.38	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.06325	0.0163	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	T	0.59337	-0.7473	10	0.11794	T	0.64	.	18.0452	0.89330	0.0:1.0:0.0:0.0	.	1284	B7WPF4	.	R	1444;1284	ENSP00000294383:G1444R;ENSP00000385700:G1284R	ENSP00000294383:G1444R	G	-	1	0	USP24	55359714	1.000000	0.71417	0.984000	0.44739	0.962000	0.63368	6.971000	0.76105	2.499000	0.84300	0.650000	0.86243	GGA	.	.	none		0.413	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
EIF3L	51386	hgsc.bcm.edu	37	22	38270414	38270414	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr22:38270414C>A	ENST00000412331.2	+	9	1371	c.789C>A	c.(787-789)caC>caA	p.H263Q	EIF3L_ENST00000381683.6_Missense_Mutation_p.H215Q|EIF3L_ENST00000406934.1_Missense_Mutation_p.H165Q	NM_016091.3	NP_057175.1			eukaryotic translation initiation factor 3, subunit L											kidney(2)|large_intestine(3)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						ATGGGCGGCACTCCCTCTACA	0.552																																					p.H263Q		Atlas-SNP	.											.	EIF3L	35	.	0			c.C789A						PASS	.						216.0	170.0	186.0					22																	38270414		2203	4300	6503	SO:0001583	missense	51386	exon9			GCGGCACTCCCTC	AF083243	CCDS13960.1, CCDS56230.1	22q	2012-12-20	2009-01-07	2009-01-07	ENSG00000100129	ENSG00000100129			18138	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 3, subunit 6 interacting protein"", ""eukaryotic translation initiation factor 3, subunit E interacting protein"""	EIF3S6IP, EIF3EIP		11042152, 11590142	Standard	NM_016091		Approved	HSPC021, HSPC025, EIF3S11	uc003auf.3	Q9Y262	OTTHUMG00000150671	ENST00000412331.2:c.789C>A	22.37:g.38270414C>A	ENSP00000416892:p.His263Gln	Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	161	49	0.304348	NM_016091		Missense_Mutation	SNP	ENST00000412331.2	37	CCDS13960.1	.	.	.	.	.	.	.	.	.	.	C	17.51	3.406613	0.62399	.	.	ENSG00000100129	ENST00000412331;ENST00000425539;ENST00000381683;ENST00000262832;ENST00000406934	T;T;T	0.40476	1.03;1.03;1.03	5.57	4.54	0.55810	.	0.099918	0.64402	D	0.000001	T	0.58424	0.2121	M	0.78049	2.395	0.58432	D	0.999997	P;P;D;D	0.58620	0.539;0.748;0.966;0.983	P;P;P;D	0.63877	0.486;0.588;0.859;0.919	T	0.58493	-0.7627	10	0.14252	T	0.57	-33.9179	11.9022	0.52690	0.0:0.8588:0.0:0.1412	.	215;165;263;306	B4DYB2;B0QY90;Q9Y262;B0QY89	.;.;EIF3L_HUMAN;.	Q	263;306;215;230;165	ENSP00000416892:H263Q;ENSP00000371099:H215Q;ENSP00000384634:H165Q	ENSP00000262832:H230Q	H	+	3	2	EIF3L	36600360	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.779000	0.38624	1.368000	0.46115	0.573000	0.79308	CAC	.	.	none		0.552	EIF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319551.2	NM_016091	
ITPKB	3707	hgsc.bcm.edu	37	1	226924770	226924770	+	Silent	SNP	C	C	T	rs144653273	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:226924770C>T	ENST00000272117.3	-	1	389	c.390G>A	c.(388-390)aaG>aaA	p.K130K	ITPKB_ENST00000366784.1_Silent_p.K130K|ITPKB_ENST00000429204.1_Silent_p.K130K			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	130					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				AGATCCGCAGCTTCCTCTTGG	0.652													C|||	4	0.000798722	0.0	0.0	5008	,	,		14921	0.004		0.0	False		,,,				2504	0.0				p.K130K	Colon(84;110 1851 5306 33547)	Atlas-SNP	.											.	ITPKB	158	.	0			c.G390A						PASS	.						59.0	60.0	60.0					1																	226924770		2180	4279	6459	SO:0001819	synonymous_variant	3707	exon2			CCGCAGCTTCCTC	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.390G>A	1.37:g.226924770C>T		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	48	17	0.354167	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Silent	SNP	ENST00000272117.3	37	CCDS1555.1																																																																																			C|1.000;T|0.000	0.000	strong		0.652	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
TNPO1	3842	hgsc.bcm.edu	37	5	72189245	72189245	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:72189245A>C	ENST00000337273.5	+	17	2364	c.1938A>C	c.(1936-1938)aaA>aaC	p.K646N	TNPO1_ENST00000506351.2_Missense_Mutation_p.K638N|TNPO1_ENST00000523768.1_Missense_Mutation_p.K596N|TNPO1_ENST00000454282.1_Missense_Mutation_p.K596N	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	646					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		CTCCAGATAAAGATTTTATGA	0.373																																					p.K646N		Atlas-SNP	.											.	TNPO1	90	.	0			c.A1938C						PASS	.						56.0	59.0	58.0					5																	72189245		2203	4298	6501	SO:0001583	missense	3842	exon17			AGATAAAGATTTT	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.1938A>C	5.37:g.72189245A>C	ENSP00000336712:p.Lys646Asn	Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	105	13	0.12381	NM_002270	B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	ENST00000337273.5	37	CCDS43329.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.388130	0.82902	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351;ENST00000519220	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.62	5.62	0.85841	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.70894	0.3276	H	0.95004	3.61	0.80722	D	1	D;D	0.67145	0.97;0.996	D;D	0.64776	0.92;0.929	T	0.79245	-0.1883	10	0.87932	D	0	-7.2071	12.0175	0.53321	0.9305:0.0:0.0695:0.0	.	596;646	Q92973-3;Q92973	.;TNPO1_HUMAN	N	646;596;596;638;157	ENSP00000336712:K646N;ENSP00000398524:K596N;ENSP00000428899:K596N;ENSP00000425118:K638N	ENSP00000336712:K646N	K	+	3	2	TNPO1	72225001	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.461000	0.53035	2.260000	0.74910	0.528000	0.53228	AAA	.	.	none		0.373	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	
TMPRSS6	164656	hgsc.bcm.edu	37	22	37485626	37485626	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr22:37485626G>A	ENST00000346753.3	-	7	971	c.855C>T	c.(853-855)ctC>ctT	p.L285L	TMPRSS6_ENST00000442782.2_Silent_p.L285L|TMPRSS6_ENST00000406725.1_Silent_p.L276L|TMPRSS6_ENST00000406856.1_Silent_p.L276L|TMPRSS6_ENST00000381792.2_Silent_p.L276L	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	285	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						ACGAGGTGATGAGCCTCTTCT	0.602																																					p.L285L		Atlas-SNP	.											.	TMPRSS6	99	.	0			c.C855T						PASS	.						21.0	20.0	21.0					22																	37485626		2201	4298	6499	SO:0001819	synonymous_variant	164656	exon7			GGTGATGAGCCTC	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.855C>T	22.37:g.37485626G>A		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	87	27	0.310345	NM_153609	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Silent	SNP	ENST00000346753.3	37	CCDS13941.1																																																																																			.	.	none		0.602	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609	
JARID2	3720	hgsc.bcm.edu	37	6	15504821	15504821	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr6:15504821G>A	ENST00000341776.2	+	9	2783	c.2539G>A	c.(2539-2541)Gag>Aag	p.E847K	JARID2_ENST00000541660.1_Missense_Mutation_p.E809K|JARID2_ENST00000397311.3_Missense_Mutation_p.E675K|JARID2_ENST00000474854.1_3'UTR	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	847					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AGCCGAAATCGAGGTGAGAGA	0.557																																					p.E847K		Atlas-SNP	.											.	JARID2	135	.	0			c.G2539A						PASS	.						51.0	56.0	54.0					6																	15504821		2203	4300	6503	SO:0001583	missense	3720	exon9			GAAATCGAGGTGA	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.2539G>A	6.37:g.15504821G>A	ENSP00000341280:p.Glu847Lys	Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	43	23	0.534884	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	G	35	5.552389	0.96501	.	.	ENSG00000008083	ENST00000341776;ENST00000397311;ENST00000541660	D;D;D	0.96522	-3.28;-3.28;-4.04	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.98507	0.9502	M	0.91510	3.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.986	D	0.99624	1.0984	10	0.87932	D	0	-21.4897	18.8078	0.92045	0.0:0.0:1.0:0.0	.	809;847	F5H590;Q92833	.;JARD2_HUMAN	K	847;675;809	ENSP00000341280:E847K;ENSP00000380478:E675K;ENSP00000444623:E809K	ENSP00000341280:E847K	E	+	1	0	JARID2	15612800	1.000000	0.71417	0.985000	0.45067	0.750000	0.42670	9.544000	0.98092	2.435000	0.82474	0.561000	0.74099	GAG	.	.	none		0.557	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
SPRED2	200734	hgsc.bcm.edu	37	2	65561836	65561836	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:65561836C>G	ENST00000356388.4	-	3	465	c.276G>C	c.(274-276)aaG>aaC	p.K92N	SPRED2_ENST00000443619.2_Missense_Mutation_p.K89N|SPRED2_ENST00000474228.1_5'UTR	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2	92	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						TATTATCGACCTTCCAGTGAT	0.453																																					p.K92N		Atlas-SNP	.											.	SPRED2	70	.	0			c.G276C						PASS	.						212.0	198.0	202.0					2																	65561836		2203	4300	6503	SO:0001583	missense	200734	exon3			ATCGACCTTCCAG	AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.276G>C	2.37:g.65561836C>G	ENSP00000348753:p.Lys92Asn	Somatic	189	0	0		WXS	Illumina HiSeq	Phase_I	162	51	0.314815	NM_181784	A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Missense_Mutation	SNP	ENST00000356388.4	37	CCDS33211.1	.	.	.	.	.	.	.	.	.	.	C	14.76	2.630623	0.46944	.	.	ENSG00000198369	ENST00000356388;ENST00000443619;ENST00000452315;ENST00000421087;ENST00000440972	D;D;D;D;D	0.98666	-5.06;-5.06;-5.06;-5.06;-5.06	5.28	-0.546	0.11840	EVH1 (2);Pleckstrin homology-type (1);	0.144353	0.64402	D	0.000010	D	0.97498	0.9181	M	0.73962	2.25	0.51482	D	0.999928	B;B	0.22146	0.065;0.049	B;B	0.34418	0.182;0.112	D	0.93945	0.7227	10	0.72032	D	0.01	-18.6884	9.8976	0.41329	0.0:0.329:0.0:0.671	.	89;92	E9PEP0;Q7Z698	.;SPRE2_HUMAN	N	92;89;107;24;92	ENSP00000348753:K92N;ENSP00000393697:K89N;ENSP00000390595:K107N;ENSP00000407627:K24N;ENSP00000406481:K92N	ENSP00000348753:K92N	K	-	3	2	SPRED2	65415340	0.976000	0.34144	0.998000	0.56505	0.993000	0.82548	0.200000	0.17257	-0.033000	0.13736	-0.136000	0.14681	AAG	.	.	none		0.453	SPRED2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327632.1		
GTPBP8	29083	hgsc.bcm.edu	37	3	112719765	112719765	+	Silent	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:112719765A>G	ENST00000383678.2	+	6	936	c.854A>G	c.(853-855)tAa>tGa	p.*285*	GTPBP8_ENST00000473129.1_Silent_p.*135*|GTPBP8_ENST00000383677.3_Silent_p.*252*|GTPBP8_ENST00000467752.1_Silent_p.*174*	NM_014170.2	NP_054889.2	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 (putative)	0					barrier septum assembly (GO:0000917)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	6						AGTCTTGACTAATGGTTCCCG	0.338																																					p.X285X		Atlas-SNP	.											.	GTPBP8	22	.	0			c.A854G						PASS	.						97.0	94.0	95.0					3																	112719765		2203	4300	6503	SO:0001819	synonymous_variant	29083	exon6			TTGACTAATGGTT	BC037163	CCDS33820.1, CCDS33821.1	3q13.2	2008-02-05			ENSG00000163607	ENSG00000163607			25007	protein-coding gene	gene with protein product							Standard	NM_014170		Approved	HSPC135	uc003dzn.3	Q8N3Z3	OTTHUMG00000159268	ENST00000383678.2:c.854A>G	3.37:g.112719765A>G		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	99	32	0.323232	NM_014170	A6NE99|A6NN11|A8K0P6|Q5I0Y4	Silent	SNP	ENST00000383678.2	37	CCDS33820.1																																																																																			.	.	none		0.338	GTPBP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354260.2	NM_014170	
JMJD1C	221037	hgsc.bcm.edu	37	10	64967691	64967691	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr10:64967691T>A	ENST00000399262.2	-	10	3956	c.3738A>T	c.(3736-3738)gaA>gaT	p.E1246D	JMJD1C_ENST00000402544.1_Missense_Mutation_p.E1027D|JMJD1C_ENST00000542921.1_Missense_Mutation_p.E1064D|JMJD1C_ENST00000399251.1_Missense_Mutation_p.E1027D	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1246					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					GCTTCTGTGATTCTTGAACTT	0.443																																					p.E1246D		Atlas-SNP	.											.	JMJD1C	347	.	0			c.A3738T						PASS	.						90.0	86.0	87.0					10																	64967691		1851	4104	5955	SO:0001583	missense	221037	exon10			CTGTGATTCTTGA	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.3738A>T	10.37:g.64967691T>A	ENSP00000382204:p.Glu1246Asp	Somatic	182	0	0		WXS	Illumina HiSeq	Phase_I	193	48	0.248705	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	T	12.35	1.912957	0.33815	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.60672	0.52;0.17;1.99;0.53	5.58	1.88	0.25563	.	0.000000	0.85682	D	0.000000	T	0.69797	0.3151	M	0.62723	1.935	0.43761	D	0.996277	D;D;D	0.89917	1.0;0.998;0.997	D;D;D	0.83275	0.996;0.942;0.92	T	0.65853	-0.6067	10	0.49607	T	0.09	-20.8338	11.4093	0.49917	0.0:0.3183:0.0:0.6817	.	787;1246;1064	A6PW35;Q15652;A0T124	.;JHD2C_HUMAN;.	D	1246;1027;1027;1064	ENSP00000382204:E1246D;ENSP00000384990:E1027D;ENSP00000382195:E1027D;ENSP00000444682:E1064D	ENSP00000382195:E1027D	E	-	3	2	JMJD1C	64637697	1.000000	0.71417	0.996000	0.52242	0.585000	0.36419	0.869000	0.27996	-0.168000	0.10853	-1.773000	0.00660	GAA	.	.	none		0.443	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
FAM26E	254228	hgsc.bcm.edu	37	6	116836827	116836827	+	Missense_Mutation	SNP	G	G	A	rs571775020		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr6:116836827G>A	ENST00000368599.3	+	2	656	c.605G>A	c.(604-606)cGc>cAc	p.R202H	TRAPPC3L_ENST00000368602.3_Intron	NM_153711.2	NP_714922.1	Q8N5C1	FA26E_HUMAN	family with sequence similarity 26, member E	202					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7		all_cancers(87;0.0608)|all_epithelial(87;0.05)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0242)|all cancers(137;0.0419)|OV - Ovarian serous cystadenocarcinoma(136;0.0671)|Epithelial(106;0.212)		TGTTATGCTCGCTGCCGATCT	0.413													G|||	1	0.000199681	0.0	0.0	5008	,	,		21409	0.0		0.0	False		,,,				2504	0.001				p.R202H		Atlas-SNP	.											FAM26E,NS,carcinoma,+1,1	FAM26E	26	1	0			c.G605A						PASS	.						154.0	155.0	155.0					6																	116836827		2203	4300	6503	SO:0001583	missense	254228	exon2			ATGCTCGCTGCCG	BC032556	CCDS5108.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000178033	ENSG00000178033			21568	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 188"""	C6orf188			Standard	NM_153711		Approved	dJ493F7.3, MGC45451	uc003pwy.3	Q8N5C1	OTTHUMG00000015442	ENST00000368599.3:c.605G>A	6.37:g.116836827G>A	ENSP00000357588:p.Arg202His	Somatic	285	0	0		WXS	Illumina HiSeq	Phase_I	224	62	0.276786	NM_153711	B2RDJ9|B3KSR3	Missense_Mutation	SNP	ENST00000368599.3	37	CCDS5108.1	.	.	.	.	.	.	.	.	.	.	G	16.56	3.158090	0.57368	.	.	ENSG00000178033	ENST00000368599	T	0.19250	2.16	6.03	6.03	0.97812	.	0.106321	0.64402	D	0.000002	T	0.23289	0.0563	L	0.43152	1.355	0.45464	D	0.99843	D	0.69078	0.997	P	0.58873	0.847	T	0.00436	-1.1740	10	0.46703	T	0.11	-4.565	12.8091	0.57629	0.0738:0.0:0.9262:0.0	.	202	Q8N5C1	FA26E_HUMAN	H	202	ENSP00000357588:R202H	ENSP00000357588:R202H	R	+	2	0	FAM26E	116943520	1.000000	0.71417	1.000000	0.80357	0.161000	0.22273	6.809000	0.75211	2.854000	0.98071	0.655000	0.94253	CGC	.	.	none		0.413	FAM26E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041956.1	NM_153711	
KCNH8	131096	hgsc.bcm.edu	37	3	19322823	19322823	+	Splice_Site	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:19322823T>C	ENST00000328405.2	+	3	708		c.e3+2			NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8						potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						AAAAAGAAGGTTTGTACCGTT	0.308																																					.	NSCLC(124;1625 1765 8018 24930 42026)	Atlas-SNP	.											.	KCNH8	189	.	0			c.442+2T>C						PASS	.						65.0	72.0	69.0					3																	19322823		2203	4297	6500	SO:0001630	splice_region_variant	131096	exon3			AGAAGGTTTGTAC	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.442+2T>C	3.37:g.19322823T>C		Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	129	39	0.302326	NM_144633	B7Z2I7|Q59GQ6	Splice_Site	SNP	ENST00000328405.2	37	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.487429	0.84854	.	.	ENSG00000183960	ENST00000328405	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	KCNH8	19297827	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	.	.	.	none		0.308	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	Intron
CTRC	11330	hgsc.bcm.edu	37	1	15771170	15771170	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:15771170G>A	ENST00000375949.4	+	6	589	c.563G>A	c.(562-564)aGg>aAg	p.R188K	CTRC_ENST00000483406.1_Intron|CTRC_ENST00000375943.2_Intron	NM_007272.2	NP_009203.2	Q99895	CTRC_HUMAN	chymotrypsin C (caldecrin)	188	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	13		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ACGTGCTCCAGGATTGACTGG	0.612																																					p.R188K		Atlas-SNP	.											.	CTRC	28	.	0			c.G563A						PASS	.						82.0	75.0	77.0					1																	15771170		2203	4300	6503	SO:0001583	missense	11330	exon6			GCTCCAGGATTGA	BC015118	CCDS156.1	1p36.21	2009-02-18			ENSG00000162438	ENSG00000162438	3.4.21.2		2523	protein-coding gene	gene with protein product	"""elastase 4"""	601405				8635596	Standard	NM_007272		Approved	CLCR, ELA4	uc001awi.1	Q99895	OTTHUMG00000002255	ENST00000375949.4:c.563G>A	1.37:g.15771170G>A	ENSP00000365116:p.Arg188Lys	Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	101	10	0.0990099	NM_007272	A8K082|O00765|Q9NUH5	Missense_Mutation	SNP	ENST00000375949.4	37	CCDS156.1	.	.	.	.	.	.	.	.	.	.	G	0.477	-0.881497	0.02530	.	.	ENSG00000162438	ENST00000375949	D	0.88818	-2.43	5.13	-1.03	0.10102	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.672011	0.15148	N	0.277902	T	0.76666	0.4019	N	0.26162	0.8	0.09310	N	0.999999	B	0.06786	0.001	B	0.15484	0.013	T	0.59553	-0.7433	10	0.20519	T	0.43	-10.5099	5.303	0.15788	0.5736:0.0:0.2879:0.1384	.	188	Q99895	CTRC_HUMAN	K	188	ENSP00000365116:R188K	ENSP00000365116:R188K	R	+	2	0	CTRC	15643757	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.177000	0.16801	-0.046000	0.13446	-0.367000	0.07326	AGG	.	.	none		0.612	CTRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006435.1	NM_007272	
ERCC6L	54821	hgsc.bcm.edu	37	X	71426262	71426262	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:71426262C>T	ENST00000334463.3	-	2	2490	c.2355G>A	c.(2353-2355)gaG>gaA	p.E785E	ERCC6L_ENST00000373657.1_Silent_p.E662E|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	785					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					GATCTTGTTTCTCACCCTCTT	0.423																																					p.E785E		Atlas-SNP	.											.	ERCC6L	98	.	0			c.G2355A						PASS	.						128.0	118.0	121.0					X																	71426262		2203	4299	6502	SO:0001819	synonymous_variant	54821	exon2			TTGTTTCTCACCC	AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.2355G>A	X.37:g.71426262C>T		Somatic	273	0	0		WXS	Illumina HiSeq	Phase_I	225	64	0.284444	NM_017669	Q8NCI1|Q96H93|Q9NXQ8	Silent	SNP	ENST00000334463.3	37	CCDS35329.1																																																																																			.	.	none		0.423	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669	
ZFC3H1	196441	hgsc.bcm.edu	37	12	72038798	72038798	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:72038798G>A	ENST00000378743.3	-	4	1496	c.1138C>T	c.(1138-1140)Cag>Tag	p.Q380*		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	380					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CTGGCTGACTGAAGAGCCAAA	0.333																																					p.Q380X		Atlas-SNP	.											.	ZFC3H1	172	.	0			c.C1138T						PASS	.						100.0	87.0	91.0					12																	72038798		1825	4087	5912	SO:0001587	stop_gained	196441	exon4			CTGACTGAAGAGC	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.1138C>T	12.37:g.72038798G>A	ENSP00000368017:p.Gln380*	Somatic	469	0	0		WXS	Illumina HiSeq	Phase_I	376	118	0.31383	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Nonsense_Mutation	SNP	ENST00000378743.3	37	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	G	37	6.417400	0.97550	.	.	ENSG00000133858	ENST00000378743	.	.	.	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	19.5809	0.95467	0.0:0.0:1.0:0.0	.	.	.	.	X	380	.	ENSP00000368017:Q380X	Q	-	1	0	ZFC3H1	70325065	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	8.519000	0.90563	2.629000	0.89072	0.650000	0.86243	CAG	.	.	none		0.333	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
ABT1	29777	hgsc.bcm.edu	37	6	26598677	26598677	+	Missense_Mutation	SNP	C	C	T	rs367868700		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr6:26598677C>T	ENST00000274849.1	+	3	654	c.623C>T	c.(622-624)tCc>tTc	p.S208F		NM_013375.3	NP_037507.1	Q9ULW3	ABT1_HUMAN	activator of basal transcription 1	208					regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron differentiation (GO:0021522)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11						CCAGATGGCTCCTGGACATTT	0.617																																					p.S208F		Atlas-SNP	.											.	ABT1	39	.	0			c.C623T						PASS	.						37.0	39.0	38.0					6																	26598677		2203	4300	6503	SO:0001583	missense	29777	exon3			ATGGCTCCTGGAC	AB027258	CCDS4616.1	6p21.31	2008-07-07			ENSG00000146109	ENSG00000146109			17369	protein-coding gene	gene with protein product						10648625	Standard	NM_013375		Approved		uc003nii.3	Q9ULW3	OTTHUMG00000016319	ENST00000274849.1:c.623C>T	6.37:g.26598677C>T	ENSP00000274849:p.Ser208Phe	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	116	51	0.439655	NM_013375		Missense_Mutation	SNP	ENST00000274849.1	37	CCDS4616.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.080257	0.76528	.	.	ENSG00000146109	ENST00000274849	.	.	.	5.49	5.49	0.81192	.	0.354787	0.30602	N	0.009280	T	0.61400	0.2344	L	0.57536	1.79	0.42957	D	0.994399	P	0.41569	0.755	P	0.48141	0.568	T	0.64812	-0.6319	9	0.59425	D	0.04	-9.8858	17.2409	0.87013	0.0:1.0:0.0:0.0	.	208	Q9ULW3	ABT1_HUMAN	F	208	.	ENSP00000274849:S208F	S	+	2	0	ABT1	26706656	0.982000	0.34865	0.938000	0.37757	0.698000	0.40448	1.381000	0.34362	2.741000	0.93983	0.655000	0.94253	TCC	.	.	alt		0.617	ABT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043698.1		
DPYD	1806	hgsc.bcm.edu	37	1	98187169	98187169	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:98187169C>T	ENST00000370192.3	-	5	480	c.380G>A	c.(379-381)gGa>gAa	p.G127E	DPYD_ENST00000423006.2_Missense_Mutation_p.G90E|DPYD_ENST00000306031.5_Missense_Mutation_p.G127E|DPYD_ENST00000474241.1_5'UTR	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	127					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	ACATACCATTCCACAAGTCAG	0.353																																					p.G127E		Atlas-SNP	.											.	DPYD	219	.	0			c.G380A						PASS	.						105.0	101.0	103.0					1																	98187169		2203	4299	6502	SO:0001583	missense	1806	exon5			ACCATTCCACAAG	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.380G>A	1.37:g.98187169C>T	ENSP00000359211:p.Gly127Glu	Somatic	243	0	0		WXS	Illumina HiSeq	Phase_I	182	61	0.335165	NM_000110	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	C	31	5.090406	0.94149	.	.	ENSG00000188641	ENST00000370192;ENST00000423006;ENST00000306031	T;T;T	0.81163	-1.46;-1.46;-1.46	6.06	6.06	0.98353	Fumarate reductase, C-terminal (1);Alpha-helical ferredoxin (1);	0.000000	0.85682	D	0.000000	D	0.93585	0.7952	H	0.96916	3.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94584	0.7782	10	0.87932	D	0	-17.6068	20.6397	0.99537	0.0:1.0:0.0:0.0	.	127;127	E9PFN1;Q12882	.;DPYD_HUMAN	E	127;90;127	ENSP00000359211:G127E;ENSP00000398884:G90E;ENSP00000307107:G127E	ENSP00000307107:G127E	G	-	2	0	DPYD	97959757	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.433000	0.80362	2.880000	0.98712	0.650000	0.86243	GGA	.	.	none		0.353	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
COL14A1	7373	hgsc.bcm.edu	37	8	121219248	121219248	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr8:121219248T>G	ENST00000297848.3	+	10	1376	c.1106T>G	c.(1105-1107)tTt>tGt	p.F369C	COL14A1_ENST00000537875.1_Missense_Mutation_p.F369C|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Missense_Mutation_p.F369C|COL14A1_ENST00000247781.3_Missense_Mutation_p.F274C	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GCCAGAAGCTTTATGGTTAAC	0.433																																					p.F369C		Atlas-SNP	.											.	COL14A1	292	.	0			c.T1106G						PASS	.						72.0	67.0	69.0					8																	121219248		2203	4300	6503	SO:0001583	missense	7373	exon10			GAAGCTTTATGGT		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1106T>G	8.37:g.121219248T>G	ENSP00000297848:p.Phe369Cys	Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	208	68	0.326923	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.947976	0.73787	.	.	ENSG00000187955	ENST00000537875;ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34	5.64	5.64	0.86602	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.77968	0.4210	M	0.89904	3.07	0.47819	D	0.999524	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.83146	-0.0106	10	0.87932	D	0	.	15.8462	0.78895	0.0:0.0:0.0:1.0	.	369;369	Q05707-2;Q05707	.;COEA1_HUMAN	C	369;369;369;274;182	ENSP00000443974:F369C;ENSP00000311809:F369C;ENSP00000297848:F369C;ENSP00000247781:F274C;ENSP00000409461:F182C	ENSP00000247781:F274C	F	+	2	0	COL14A1	121288429	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.881000	0.69706	2.143000	0.66587	0.482000	0.46254	TTT	.	.	none		0.433	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
SLC38A6	145389	hgsc.bcm.edu	37	14	61446275	61446275	+	5'Flank	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr14:61446275T>C	ENST00000267488.4	+	0	0				SLC38A6_ENST00000456840.2_5'Flank|SLC38A6_ENST00000354886.2_5'Flank|TRMT5_ENST00000261249.6_Missense_Mutation_p.K114R|RP11-193F5.1_ENST00000553946.1_RNA	NM_153811.2	NP_722518.2	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6						amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		TGCTGCCCTTTTTAGGGATCG	0.383																																					p.K114R		Atlas-SNP	.											.	TRMT5	44	.	0			c.A341G						PASS	.						178.0	180.0	179.0					14																	61446275		2203	4300	6503	SO:0001631	upstream_gene_variant	57570	exon2			GCCCTTTTTAGGG	AF070578	CCDS9751.1, CCDS53900.1	14q23.1	2013-05-22			ENSG00000139974	ENSG00000139974		"""Solute carriers"""	19863	protein-coding gene	gene with protein product							Standard	NM_153811		Approved	NAT-1	uc001xfh.2	Q8IZM9	OTTHUMG00000140335		14.37:g.61446275T>C	Exception_encountered	Somatic	282	0	0		WXS	Illumina HiSeq	Phase_I	238	28	0.117647	NM_020810	C9JWA6|Q86SY5	Missense_Mutation	SNP	ENST00000267488.4	37	CCDS9751.1	.	.	.	.	.	.	.	.	.	.	T	9.300	1.052932	0.19907	.	.	ENSG00000126814	ENST00000261249;ENST00000553903;ENST00000555420	T	0.25250	1.81	4.54	2.16	0.27623	.	0.208180	0.49916	N	0.000135	T	0.19604	0.0471	L	0.41236	1.265	0.30390	N	0.781102	B	0.06786	0.001	B	0.12837	0.008	T	0.13282	-1.0515	10	0.30078	T	0.28	-15.4659	10.5438	0.45047	0.0:0.1521:0.0:0.8479	.	114	Q32P41	TRM5_HUMAN	R	114;142;141	ENSP00000261249:K114R	ENSP00000261249:K114R	K	-	2	0	TRMT5	60516028	1.000000	0.71417	0.945000	0.38365	0.511000	0.34104	1.923000	0.40055	0.039000	0.15632	-1.139000	0.01908	AAA	.	.	none		0.383	SLC38A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276957.1		
OPRM1	4988	hgsc.bcm.edu	37	6	154411241	154411241	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr6:154411241G>A	ENST00000330432.7	+	2	808	c.571G>A	c.(571-573)Gtc>Atc	p.V191I	OPRM1_ENST00000522236.1_Missense_Mutation_p.V91I|OPRM1_ENST00000428397.2_Missense_Mutation_p.V191I|OPRM1_ENST00000434900.2_Missense_Mutation_p.V284I|OPRM1_ENST00000435918.2_Missense_Mutation_p.V191I|OPRM1_ENST00000520708.1_Missense_Mutation_p.V91I|OPRM1_ENST00000360422.4_Missense_Mutation_p.V191I|OPRM1_ENST00000337049.4_Missense_Mutation_p.V191I|OPRM1_ENST00000229768.5_Missense_Mutation_p.V191I|OPRM1_ENST00000518759.1_Missense_Mutation_p.V110I|OPRM1_ENST00000419506.2_Missense_Mutation_p.V191I|OPRM1_ENST00000524163.1_Missense_Mutation_p.V191I|OPRM1_ENST00000452687.2_Missense_Mutation_p.V191I|OPRM1_ENST00000522555.1_Missense_Mutation_p.V91I|OPRM1_ENST00000414028.2_Missense_Mutation_p.V191I	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1	191					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	AATTATCAATGTCTGCAACTG	0.468																																					p.V284I		Atlas-SNP	.											.	OPRM1	241	.	0			c.G850A						PASS	.						161.0	153.0	155.0					6																	154411241		2052	4235	6287	SO:0001583	missense	4988	exon4			ATCAATGTCTGCA	L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.571G>A	6.37:g.154411241G>A	ENSP00000328264:p.Val191Ile	Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	82	36	0.439024	NM_001145279	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	ENST00000330432.7	37	CCDS55070.1	.	.	.	.	.	.	.	.	.	.	G	8.766	0.924735	0.18056	.	.	ENSG00000112038	ENST00000434900;ENST00000520708;ENST00000518759;ENST00000330432;ENST00000360422;ENST00000428397;ENST00000452687;ENST00000229768;ENST00000419506;ENST00000524163;ENST00000414028;ENST00000435918;ENST00000337049;ENST00000522555;ENST00000522236	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17	5.8	2.95	0.34219	GPCR, rhodopsin-like superfamily (1);	0.108809	0.64402	N	0.000008	T	0.09642	0.0237	N	0.14661	0.345	0.41124	D	0.985834	B;B;B;B;B;B;B;B;B;B;B;B;B	0.19073	0.007;0.001;0.001;0.019;0.033;0.005;0.004;0.001;0.004;0.001;0.002;0.018;0.001	B;B;B;B;B;B;B;B;B;B;B;B;B	0.29353	0.013;0.027;0.014;0.034;0.101;0.074;0.027;0.045;0.044;0.024;0.019;0.071;0.014	T	0.10268	-1.0637	10	0.22109	T	0.4	.	10.791	0.46432	0.213:0.0:0.787:0.0	.	191;191;191;191;284;110;191;91;191;191;191;191;191	P35372-4;P35372-8;P35372-11;P35372-9;P35372-10;B8Q1L9;P35372-6;Q6UPP1;P35372-5;P35372;P35372-7;P35372-3;P35372-2	.;.;.;.;.;.;.;.;.;OPRM_HUMAN;.;.;.	I	284;91;110;191;191;191;191;191;191;191;191;191;191;91;91	ENSP00000394624:V284I;ENSP00000430876:V91I;ENSP00000430260:V110I;ENSP00000328264:V191I;ENSP00000353598:V191I;ENSP00000411903:V191I;ENSP00000410497:V191I;ENSP00000229768:V191I;ENSP00000403549:V191I;ENSP00000430097:V191I;ENSP00000399359:V191I;ENSP00000413752:V191I;ENSP00000338381:V191I;ENSP00000429719:V91I;ENSP00000429373:V91I	ENSP00000229768:V191I	V	+	1	0	OPRM1	154452934	1.000000	0.71417	0.938000	0.37757	0.998000	0.95712	2.492000	0.45311	0.317000	0.23160	0.655000	0.94253	GTC	.	.	none		0.468	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914	
OBSCN	84033	hgsc.bcm.edu	37	1	228471339	228471339	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:228471339C>T	ENST00000422127.1	+	33	8917	c.8873C>T	c.(8872-8874)tCa>tTa	p.S2958L	OBSCN_ENST00000366707.4_Missense_Mutation_p.S77L|OBSCN_ENST00000359599.6_Missense_Mutation_p.S1805L|OBSCN_ENST00000570156.2_Missense_Mutation_p.S3387L|OBSCN_ENST00000284548.11_Missense_Mutation_p.S2958L|OBSCN_ENST00000366709.4_Missense_Mutation_p.S77L	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2958	Ig-like 29.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CTACGGGCCTCAGGGAAGCAC	0.647																																					p.S3387L		Atlas-SNP	.											.	OBSCN	2142	.	0			c.C10160T						PASS	.						32.0	38.0	36.0					1																	228471339		2129	4236	6365	SO:0001583	missense	84033	exon38			GGGCCTCAGGGAA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.8873C>T	1.37:g.228471339C>T	ENSP00000409493:p.Ser2958Leu	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	77	23	0.298701	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	c	23.6	4.436810	0.83885	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599;ENST00000366706;ENST00000366704	T;T;T;T;T	0.06371	3.31;3.31;3.31;3.31;3.31	5.67	5.67	0.87782	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.302534	0.25613	N	0.029461	T	0.22282	0.0537	M	0.89030	3	0.26131	N	0.980411	P;P;P	0.49358	0.785;0.923;0.887	P;P;P	0.51582	0.674;0.56;0.511	T	0.14699	-1.0463	10	0.66056	D	0.02	.	14.2576	0.66062	0.0:0.7337:0.2663:0.0	.	2958;2958;2958	Q5VST9;Q5VST9-2;Q5VST9-3	OBSCN_HUMAN;.;.	L	2958;2958;77;77;1805;657;364	ENSP00000284548:S2958L;ENSP00000409493:S2958L;ENSP00000355668:S77L;ENSP00000355670:S77L;ENSP00000352613:S1805L	ENSP00000284548:S2958L	S	+	2	0	OBSCN	226537962	0.996000	0.38824	0.806000	0.32338	0.095000	0.18619	4.055000	0.57441	2.673000	0.90976	0.550000	0.68814	TCA	.	.	none		0.647	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
RNASE3	6037	hgsc.bcm.edu	37	14	21360199	21360199	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr14:21360199G>A	ENST00000304639.3	+	2	412	c.354G>A	c.(352-354)caG>caA	p.Q118Q		NM_002935.2	NP_002926.2	P12724	ECP_HUMAN	ribonuclease, RNase A family, 3	118					antibacterial humoral response (GO:0019731)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)	9	all_cancers(95;0.00453)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	Pranlukast(DB01411)	CAGGTGCACAGAATATTTCAA	0.468																																					p.Q118Q		Atlas-SNP	.											.	RNASE3	24	.	0			c.G354A						PASS	.						90.0	91.0	91.0					14																	21360199		2189	4300	6489	SO:0001819	synonymous_variant	6037	exon2			TGCACAGAATATT	X55990	CCDS9560.1	14q11.2	2014-03-13	2010-05-07		ENSG00000169397	ENSG00000169397	3.1.27.-	"""Ribonucleases, RNase A"""	10046	protein-coding gene	gene with protein product	"""eosinophil cationic protein"""	131398		RNS3		1577491	Standard	NM_002935		Approved	ECP	uc001vyj.3	P12724	OTTHUMG00000029604	ENST00000304639.3:c.354G>A	14.37:g.21360199G>A		Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	129	42	0.325581	NM_002935	Q4VBC1|Q8WTP7|Q8WZ62|Q9GZN9	Silent	SNP	ENST00000304639.3	37	CCDS9560.1																																																																																			.	.	none		0.468	RNASE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073795.2	NM_002935	
PDE1B	5153	hgsc.bcm.edu	37	12	54963009	54963009	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:54963009C>T	ENST00000243052.3	+	4	705	c.269C>T	c.(268-270)tCa>tTa	p.S90L	PDE1B_ENST00000550620.1_Missense_Mutation_p.S70L|PDE1B_ENST00000538346.1_Missense_Mutation_p.S49L|PDE1B_ENST00000394277.3_Intron	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	90					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	GAGCTGCGGTCAGATGCCGTG	0.637																																					p.S90L		Atlas-SNP	.											.	PDE1B	76	.	0			c.C269T						PASS	.						67.0	70.0	69.0					12																	54963009		2203	4300	6503	SO:0001583	missense	5153	exon4			TGCGGTCAGATGC	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.269C>T	12.37:g.54963009C>T	ENSP00000243052:p.Ser90Leu	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	79	38	0.481013	NM_000924	Q92825|Q96KP3	Missense_Mutation	SNP	ENST00000243052.3	37	CCDS8882.1	.	.	.	.	.	.	.	.	.	.	C	37	6.389836	0.97529	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	T;T;T	0.70164	-0.46;-0.43;-0.44	4.97	4.97	0.65823	-cyclic nucleotide phosphodiesterase N-terminal (1);5&apos (1);3&apos (1);	0.162433	0.42682	D	0.000677	T	0.71074	0.3297	L	0.45581	1.43	0.58432	D	0.999992	P;P	0.43701	0.779;0.815	P;P	0.52189	0.484;0.692	T	0.70285	-0.4914	10	0.40728	T	0.16	.	16.096	0.81123	0.0:1.0:0.0:0.0	.	70;90	Q01064-2;Q01064	.;PDE1B_HUMAN	L	90;49;70	ENSP00000243052:S90L;ENSP00000442559:S49L;ENSP00000448519:S70L	ENSP00000243052:S90L	S	+	2	0	PDE1B	53249276	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.653000	0.83643	2.459000	0.83118	0.655000	0.94253	TCA	.	.	none		0.637	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1		
AVIL	10677	hgsc.bcm.edu	37	12	58197374	58197374	+	Nonsense_Mutation	SNP	C	C	A	rs143313987	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:58197374C>A	ENST00000257861.3	-	14	2180	c.1750G>T	c.(1750-1752)Gag>Tag	p.E584*	RP11-571M6.17_ENST00000602802.1_lincRNA|RNU6-1083P_ENST00000384022.1_RNA|AVIL_ENST00000550083.1_Intron|AVIL_ENST00000537081.1_Nonsense_Mutation_p.E577*|TSFM_ENST00000548851.1_Intron	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	584	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					TCCTGGCCCTCGGCCACAGTG	0.602											OREG0021955	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E584X		Atlas-SNP	.											.	AVIL	60	.	0			c.G1750T						PASS	.						44.0	40.0	41.0					12																	58197374		2203	4300	6503	SO:0001587	stop_gained	10677	exon14			GGCCCTCGGCCAC	AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.1750G>T	12.37:g.58197374C>A	ENSP00000257861:p.Glu584*	Somatic	101	0	0	1029	WXS	Illumina HiSeq	Phase_I	98	21	0.214286	NM_006576	B2RAU7|Q2NKM9	Nonsense_Mutation	SNP	ENST00000257861.3	37	CCDS8959.1	.	.	.	.	.	.	.	.	.	.	C	38	6.941279	0.97952	.	.	ENSG00000135407	ENST00000537081;ENST00000257861	.	.	.	4.86	3.95	0.45737	.	0.098954	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-25.788	13.9775	0.64282	0.0:0.8466:0.1534:0.0	.	.	.	.	X	577;584	.	ENSP00000257861:E584X	E	-	1	0	AVIL	56483641	1.000000	0.71417	0.982000	0.44146	0.197000	0.23852	5.839000	0.69395	1.216000	0.43427	0.561000	0.74099	GAG	C|1.000;T|0.000	.	alt		0.602	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409276.1	NM_006576	
OR5H14	403273	hgsc.bcm.edu	37	3	97868377	97868377	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:97868377T>C	ENST00000437310.1	+	1	208	c.148T>C	c.(148-150)Tgg>Cgg	p.W50R	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TGCTGTCATCTGGAAAGACCC	0.403																																					p.W50R		Atlas-SNP	.											OR5H14,NS,malignant_melanoma,-2,1	OR5H14	56	1	0			c.T148C						scavenged	.						311.0	313.0	312.0					3																	97868377		2203	4300	6503	SO:0001583	missense	403273	exon1			GTCATCTGGAAAG		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.148T>C	3.37:g.97868377T>C	ENSP00000401706:p.Trp50Arg	Somatic	530	4	0.00754717		WXS	Illumina HiSeq	Phase_I	494	12	0.0242915	NM_001005514	B9EH15	Missense_Mutation	SNP	ENST00000437310.1	37	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	T	3.061	-0.193169	0.06259	.	.	ENSG00000236032	ENST00000437310	T	0.03801	3.8	2.49	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.993003	0.08167	N	0.987570	T	0.06142	0.0159	N	0.10760	0.04	0.09310	N	1	D	0.56968	0.978	P	0.58266	0.836	T	0.50101	-0.8867	10	0.25106	T	0.35	.	8.4219	0.32705	0.0:0.0:0.0:1.0	.	50	A6NHG9	O5H14_HUMAN	R	50	ENSP00000401706:W50R	ENSP00000401706:W50R	W	+	1	0	OR5H14	99351067	0.000000	0.05858	0.995000	0.50966	0.396000	0.30629	-0.007000	0.12810	1.132000	0.42129	0.164000	0.16699	TGG	.	.	none		0.403	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
P2RY8	286530	hgsc.bcm.edu	37	X	1584685	1584685	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:1584685A>G	ENST00000381297.4	-	2	977	c.767T>C	c.(766-768)gTg>gCg	p.V256A	P2RY8_ENST00000460672.1_5'Flank	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CGCCAGGAGCACGAAGTTGTT	0.647			T	CRLF2	"""B-ALL, Downs associated ALL"""																																p.V256A		Atlas-SNP	.		Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	286530	"""purinergic receptor P2Y, G-protein coupled, 8"""		L	.	P2RY8	53	.	0			c.T767C						PASS	.						72.0	69.0	70.0					X																	1584685		2203	4296	6499	SO:0001583	missense	286530	exon2			AGGAGCACGAAGT	AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.767T>C	X.37:g.1584685A>G	ENSP00000370697:p.Val256Ala	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	61	28	0.459016	NM_178129		Missense_Mutation	SNP	ENST00000381297.4	37	CCDS14115.1	.	.	.	.	.	.	.	.	.	.	a	15.47	2.841842	0.51057	.	.	ENSG00000182162	ENST00000381297	T	0.73152	-0.72	2.73	2.73	0.32206	GPCR, rhodopsin-like superfamily (1);	0.235347	0.27618	U	0.018564	T	0.61615	0.2361	L	0.38175	1.15	0.09310	N	1	P	0.44090	0.826	B	0.44315	0.446	T	0.52540	-0.8562	10	0.33141	T	0.24	.	10.658	0.45686	1.0:0.0:0.0:0.0	.	256	Q86VZ1	P2RY8_HUMAN	A	256	ENSP00000370697:V256A	ENSP00000370697:V256A	V	-	2	0	P2RY8	1544685	1.000000	0.71417	0.981000	0.43875	0.668000	0.39293	5.411000	0.66386	0.823000	0.34589	0.230000	0.17803	GTG	.	.	none		0.647	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055602.1	NM_178129	
KIAA1024	23251	hgsc.bcm.edu	37	15	79749276	79749276	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr15:79749276G>A	ENST00000305428.3	+	2	862	c.787G>A	c.(787-789)Gat>Aat	p.D263N		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	263						integral component of membrane (GO:0016021)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						CTTCAAAGAGGATTTTCACAA	0.493																																					p.D263N		Atlas-SNP	.											KIAA1024,NS,carcinoma,0,1	KIAA1024	146	1	0			c.G787A						PASS	.						75.0	85.0	81.0					15																	79749276		2196	4293	6489	SO:0001583	missense	23251	exon2			AAAGAGGATTTTC	AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.787G>A	15.37:g.79749276G>A	ENSP00000307461:p.Asp263Asn	Somatic	190	0	0		WXS	Illumina HiSeq	Phase_I	138	18	0.130435	NM_015206	A7MD43	Missense_Mutation	SNP	ENST00000305428.3	37	CCDS32306.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.003181	0.74932	.	.	ENSG00000169330	ENST00000305428	T	0.38240	1.15	5.29	5.29	0.74685	.	0.049295	0.85682	D	0.000000	T	0.53417	0.1795	M	0.71581	2.175	0.58432	D	0.999997	D	0.59767	0.986	P	0.53954	0.738	T	0.54009	-0.8357	9	.	.	.	.	18.9224	0.92530	0.0:0.0:1.0:0.0	.	263	Q9UPX6	K1024_HUMAN	N	263	ENSP00000307461:D263N	.	D	+	1	0	KIAA1024	77536331	1.000000	0.71417	0.995000	0.50966	0.785000	0.44390	7.146000	0.77373	2.454000	0.82982	0.591000	0.81541	GAT	.	.	none		0.493	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206	
ZSCAN20	7579	hgsc.bcm.edu	37	1	33960285	33960285	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:33960285C>T	ENST00000361328.3	+	8	2494	c.2341C>T	c.(2341-2343)Ctc>Ttc	p.L781F		NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	781					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CCATTCTAATCTCATCACTCA	0.438																																					p.L781F		Atlas-SNP	.											.	ZSCAN20	107	.	0			c.C2341T						PASS	.						77.0	82.0	80.0					1																	33960285		2110	4257	6367	SO:0001583	missense	7579	exon8			TCTAATCTCATCA	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.2341C>T	1.37:g.33960285C>T	ENSP00000355053:p.Leu781Phe	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	90	32	0.355556	NM_145238	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	ENST00000361328.3	37	CCDS41300.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.287144	0.40494	.	.	ENSG00000121903	ENST00000326544;ENST00000361328;ENST00000401072	.	.	.	5.9	4.03	0.46877	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.168641	0.29403	N	0.012248	T	0.61110	0.2321	L	0.56280	1.765	0.28900	N	0.893326	P;D	0.89917	0.755;1.0	B;D	0.97110	0.31;1.0	T	0.57376	-0.7822	9	0.51188	T	0.08	-15.1702	10.8189	0.46593	0.0:0.8458:0.0:0.1542	.	780;781	P17040-3;P17040	.;ZSC20_HUMAN	F	781;715;715	.	ENSP00000324450:L781F	L	+	1	0	ZSCAN20	33732872	0.913000	0.31002	0.034000	0.17996	0.809000	0.45718	2.193000	0.42658	0.828000	0.34709	0.561000	0.74099	CTC	.	.	none		0.438	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238	
SULT1B1	27284	hgsc.bcm.edu	37	4	70615486	70615486	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr4:70615486G>A	ENST00000310613.3	-	4	625	c.328C>T	c.(328-330)Cta>Tta	p.L110L		NM_014465.3	NP_055280.2	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member 1	110					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|cellular biogenic amine metabolic process (GO:0006576)|epithelial cell differentiation (GO:0030855)|flavonoid metabolic process (GO:0009812)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|thyroid hormone metabolic process (GO:0042403)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|sulfotransferase activity (GO:0008146)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(14)|prostate(1)|upper_aerodigestive_tract(1)	24						TCAGTCGGTAGATGTGTTTTC	0.393																																					p.L110L		Atlas-SNP	.											.	SULT1B1	46	.	0			c.C328T						PASS	.						162.0	168.0	166.0					4																	70615486		2203	4300	6503	SO:0001819	synonymous_variant	27284	exon4			TCGGTAGATGTGT	D89479	CCDS3530.1	4q13.3	2008-02-05			ENSG00000173597	ENSG00000173597		"""Sulfotransferases, cytosolic"""	17845	protein-coding gene	gene with protein product		608436				11688987, 9443824	Standard	NM_014465		Approved	ST1B2	uc003hen.3	O43704	OTTHUMG00000129407	ENST00000310613.3:c.328C>T	4.37:g.70615486G>A		Somatic	274	0	0		WXS	Illumina HiSeq	Phase_I	231	38	0.164502	NM_014465	O15497|Q96FI1|Q9UK34	Silent	SNP	ENST00000310613.3	37	CCDS3530.1																																																																																			.	.	none		0.393	SULT1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251563.2	NM_014465	
PRB1	5542	hgsc.bcm.edu	37	12	11508468	11508468	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:11508468G>T	ENST00000500254.2	-	1	57	c.20C>A	c.(19-21)tCa>tAa	p.S7*	PRB1_ENST00000545626.1_Nonsense_Mutation_p.S7*|PRB1_ENST00000546254.1_Intron	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1	0						extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			CAAGGCCACTGACAGCAGAAT	0.498																																					p.S7X		Atlas-SNP	.											.	PRB1	33	.	0			c.C20A						PASS	.						79.0	77.0	78.0					12																	11508468		2180	4276	6456	SO:0001587	stop_gained	5542	exon1			GCCACTGACAGCA		CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.20C>A	12.37:g.11508468G>T	ENSP00000420826:p.Ser7*	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	138	27	0.195652	NM_199353	Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Nonsense_Mutation	SNP	ENST00000500254.2	37	CCDS8642.1	.	.	.	.	.	.	.	.	.	.	.	12.85	2.061179	0.36373	.	.	ENSG00000251655	ENST00000545626;ENST00000500254	.	.	.	1.39	-2.22	0.06952	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.4435	0.16521	0.6557:0.0:0.3443:0.0	.	.	.	.	X	7	.	ENSP00000420826:S7X	S	-	2	0	PRB1	11399735	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.518000	0.22847	-0.773000	0.04596	-0.259000	0.10710	TCA	.	.	none		0.498	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1	NM_005039	
NR2E1	7101	hgsc.bcm.edu	37	6	108499427	108499427	+	Silent	SNP	G	G	A	rs561977068	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr6:108499427G>A	ENST00000368986.4	+	5	1332	c.624G>A	c.(622-624)acG>acA	p.T208T	NR2E1_ENST00000368983.3_Silent_p.T245T	NM_003269.3	NP_003260.1	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1	208	Ligand-binding. {ECO:0000250}.				aggressive behavior (GO:0002118)|amygdala development (GO:0021764)|anterior commissure morphogenesis (GO:0021960)|behavioral fear response (GO:0001662)|cell fate commitment (GO:0045165)|cerebral cortex neuron differentiation (GO:0021895)|dentate gyrus development (GO:0021542)|extracellular matrix organization (GO:0030198)|forebrain generation of neurons (GO:0021872)|gene expression (GO:0010467)|glial cell migration (GO:0008347)|layer formation in cerebral cortex (GO:0021819)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|olfactory bulb development (GO:0021772)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of stem cell proliferation (GO:2000648)|regulation of cell migration involved in sprouting angiogenesis (GO:0090049)|regulation of dendrite morphogenesis (GO:0048814)|regulation of timing of neuron differentiation (GO:0060164)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(16)|prostate(1)|skin(3)	30		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		CCTTCTCCACGCTGTCTTTGC	0.507													G|||	8	0.00159744	0.0	0.0	5008	,	,		18263	0.0		0.0	False		,,,				2504	0.0082				p.T208T		Atlas-SNP	.											NR2E1,NS,carcinoma,0,1	NR2E1	57	1	0			c.G624A						PASS	.						98.0	81.0	87.0					6																	108499427		2203	4300	6503	SO:0001819	synonymous_variant	7101	exon5			CTCCACGCTGTCT	Y13276	CCDS5063.1, CCDS69165.1	6q21	2013-01-16			ENSG00000112333	ENSG00000112333		"""Nuclear hormone receptors"""	7973	protein-coding gene	gene with protein product		603849		TLX		9628820	Standard	NM_003269		Approved	TLL, XTLL	uc003psg.3	Q9Y466	OTTHUMG00000015319	ENST00000368986.4:c.624G>A	6.37:g.108499427G>A		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	89	19	0.213483	NM_003269	Q6ZMP8	Silent	SNP	ENST00000368986.4	37	CCDS5063.1																																																																																			.	.	none		0.507	NR2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041712.2		
DUSP16	80824	hgsc.bcm.edu	37	12	12653527	12653527	+	Missense_Mutation	SNP	G	G	C	rs369986596		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:12653527G>C	ENST00000228862.2	-	4	1088	c.457C>G	c.(457-459)Cct>Gct	p.P153A	DUSP16_ENST00000545864.1_5'UTR|DUSP16_ENST00000298573.4_Intron	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	153					dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		TTGGCAACAGGTAAGCAAGGC	0.468																																					p.P153A	Ovarian(158;443 1896 15437 36069 46477)	Atlas-SNP	.											.	DUSP16	64	.	0			c.C457G						PASS	.	G	ALA/PRO	0,4406		0,0,2203	117.0	104.0	108.0		457	5.2	1.0	12		108	1,8599	1.2+/-3.3	0,1,4299	no	missense	DUSP16	NM_030640.2	27	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	probably-damaging	153/666	12653527	1,13005	2203	4300	6503	SO:0001583	missense	80824	exon4			CAACAGGTAAGCA	AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.457C>G	12.37:g.12653527G>C	ENSP00000228862:p.Pro153Ala	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	114	38	0.333333	NM_030640	Q547C7|Q96QS2|Q9C0G3	Missense_Mutation	SNP	ENST00000228862.2	37	CCDS8650.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.622442	0.87460	0.0	1.16E-4	ENSG00000111266	ENST00000228862	T	0.59364	0.27	5.24	5.24	0.73138	.	0.260739	0.37393	N	0.002114	T	0.59985	0.2234	L	0.59436	1.845	0.80722	D	1	P	0.38455	0.632	B	0.39339	0.297	T	0.65352	-0.6189	10	0.72032	D	0.01	.	19.1583	0.93520	0.0:0.0:1.0:0.0	.	153	Q9BY84	DUS16_HUMAN	A	153	ENSP00000228862:P153A	ENSP00000228862:P153A	P	-	1	0	DUSP16	12544794	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	5.929000	0.70096	2.606000	0.88127	0.551000	0.68910	CCT	.	.	weak		0.468	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400311.1	NM_030640	
MET	4233	hgsc.bcm.edu	37	7	116422095	116422095	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr7:116422095G>A	ENST00000318493.6	+	18	3817	c.3630G>A	c.(3628-3630)atG>atA	p.M1210I	MET_ENST00000539704.1_Missense_Mutation_p.M62I|MET_ENST00000397752.3_Missense_Mutation_p.M1192I			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CCAAAGGCATGAAATATCTTG	0.373			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.M1210I		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET	412	.	0			c.G3630A						PASS	.						60.0	58.0	58.0					7																	116422095		1831	4083	5914	SO:0001583	missense	4233	exon18	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	AGGCATGAAATAT	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3630G>A	7.37:g.116422095G>A	ENSP00000317272:p.Met1210Ile	Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	120	21	0.175	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799113	0.90538	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	T;T;T	0.34072	1.38;1.38;1.38	5.87	5.87	0.94306	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.64159	0.2573	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.91635	0.999;0.992	T	0.64292	-0.6442	10	0.87932	D	0	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	1210;1192	P08581-2;P08581	.;MET_HUMAN	I	1192;1210;62	ENSP00000380860:M1192I;ENSP00000317272:M1210I;ENSP00000445020:M62I	ENSP00000317272:M1210I	M	+	3	0	MET	116209331	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.781000	0.99029	2.941000	0.99782	0.655000	0.94253	ATG	.	.	none		0.373	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
CBWD3	445571	hgsc.bcm.edu	37	9	70871836	70871836	+	Splice_Site	SNP	C	C	G	rs376362566		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr9:70871836C>G	ENST00000360171.6	+	5	981		c.e5-1		CBWD3_ENST00000377342.5_Intron	NM_201453.2	NP_958861.2	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3								ATP binding (GO:0005524)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		TATATTTTCACGTGCAGTGGC	0.289																																					.		Atlas-SNP	.											CBWD3,rectum,carcinoma,-1,1	CBWD3	10	1	0			c.431-1C>G						scavenged	.						25.0	31.0	29.0					9																	70871836		2190	4250	6440	SO:0001630	splice_region_variant	445571	exon5			TTTTCACGTGCAG	BC069006	CCDS35038.1, CCDS35038.2	9q13	2014-05-06			ENSG00000196873	ENSG00000196873			18519	protein-coding gene	gene with protein product		611080				15233989, 12421752	Standard	XM_005277637		Approved	bA561O23.1	uc004aga.4	Q5JTY5	OTTHUMG00000184383	ENST00000360171.6:c.431-1C>G	9.37:g.70871836C>G		Somatic	1496	13	0.00868984		WXS	Illumina HiSeq	Phase_I	2010	30	0.0149254	NM_201453	B4DNG9|Q6VB91	Splice_Site	SNP	ENST00000360171.6	37	CCDS35038.1	.	.	.	.	.	.	.	.	.	.	c	14.78	2.637800	0.47049	.	.	ENSG00000196873	ENST00000360171;ENST00000447896;ENST00000455061;ENST00000455820;ENST00000377344	.	.	.	3.38	3.38	0.38709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.714	0.51641	0.0:0.1812:0.8188:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CBWD3	70061656	1.000000	0.71417	0.991000	0.47740	0.802000	0.45316	7.061000	0.76699	0.543000	0.28864	-0.676000	0.03789	.	C|0.500;G|0.500	0.500	weak		0.289	CBWD3-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052526.1	NM_201453	Intron
DNHD1	144132	hgsc.bcm.edu	37	11	6567484	6567484	+	Missense_Mutation	SNP	G	G	A	rs553002964		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr11:6567484G>A	ENST00000527990.2	+	19	5315	c.5315G>A	c.(5314-5316)cGa>cAa	p.R1772Q	DNHD1_ENST00000254579.6_Missense_Mutation_p.R1772Q			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1772					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GAGGCTTCCCGAAACACAAGC	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		20636	0.001		0.0	False		,,,				2504	0.0				p.R1772Q		Atlas-SNP	.											DNHD1,NS,carcinoma,+1,2	DNHD1	198	2	0			c.G5315A						PASS	.						41.0	38.0	39.0					11																	6567484		692	1591	2283	SO:0001583	missense	144132	exon21			CTTCCCGAAACAC	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.5315G>A	11.37:g.6567484G>A	ENSP00000436180:p.Arg1772Gln	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	107	53	0.495327	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	6.129	0.391949	0.11581	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000533649	T;T	0.56444	0.46;0.46	5.23	-1.78	0.07957	.	0.765678	0.12088	N	0.500700	T	0.39118	0.1066	L	0.46157	1.445	0.09310	N	0.999997	B	0.28512	0.214	B	0.22601	0.04	T	0.25779	-1.0122	10	0.16896	T	0.51	.	11.3716	0.49702	0.4825:0.0:0.5175:0.0	.	1772	Q96M86	DNHD1_HUMAN	Q	1772;1772;63	ENSP00000254579:R1772Q;ENSP00000436180:R1772Q	ENSP00000254579:R1772Q	R	+	2	0	DNHD1	6524060	0.055000	0.20627	0.403000	0.26384	0.455000	0.32408	-0.215000	0.09279	-0.191000	0.10448	-0.345000	0.07892	CGA	.	.	none		0.582	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
TGS1	96764	hgsc.bcm.edu	37	8	56715141	56715141	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr8:56715141G>C	ENST00000260129.5	+	9	2452	c.1975G>C	c.(1975-1977)Gat>Cat	p.D659H		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	659	Sufficient for catalytic activity.				7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			CTCCCGTTTTGATGATGGGAT	0.373																																					p.D659H	Esophageal Squamous(34;275 823 4842 34837 48447)	Atlas-SNP	.											.	TGS1	66	.	0			c.G1975C						PASS	.						100.0	94.0	96.0					8																	56715141		2203	4300	6503	SO:0001583	missense	96764	exon9			CGTTTTGATGATG	AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.1975G>C	8.37:g.56715141G>C	ENSP00000260129:p.Asp659His	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	69	11	0.15942	NM_024831	A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Missense_Mutation	SNP	ENST00000260129.5	37	CCDS34894.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.947691	0.92593	.	.	ENSG00000137574	ENST00000260129	T	0.49139	0.79	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.79907	0.4527	H	0.95043	3.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.84845	0.0810	10	0.87932	D	0	-34.8829	20.4192	0.99033	0.0:0.0:1.0:0.0	.	659;659	B2RBJ7;Q96RS0	.;TGS1_HUMAN	H	659	ENSP00000260129:D659H	ENSP00000260129:D659H	D	+	1	0	TGS1	56877695	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.624000	0.98398	2.831000	0.97527	0.650000	0.86243	GAT	.	.	none		0.373	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378152.1	NM_024831	
FANCL	55120	hgsc.bcm.edu	37	2	58459217	58459217	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:58459217G>A	ENST00000233741.4	-	2	163	c.127C>T	c.(127-129)Cct>Tct	p.P43S	FANCL_ENST00000540646.1_Missense_Mutation_p.P43S|FANCL_ENST00000403676.1_Intron|FANCL_ENST00000481670.1_5'Flank|FANCL_ENST00000402135.3_Missense_Mutation_p.P43S|FANCL_ENST00000403295.3_Missense_Mutation_p.P43S	NM_018062.3	NP_060532.2	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L	43					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|gamete generation (GO:0007276)|protein monoubiquitination (GO:0006513)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(4)|ovary(2)	8						AAATCTTCAGGCAACACTATC	0.348								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.P43S		Atlas-SNP	.											.	FANCL	35	.	0			c.C127T						PASS	.						122.0	105.0	111.0					2																	58459217		2201	4300	6501	SO:0001583	missense	55120	exon2	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CTTCAGGCAACAC	AK001197	CCDS1860.1, CCDS46294.1	2p16.1	2014-09-17	2003-10-14	2003-10-15	ENSG00000115392	ENSG00000115392		"""Zinc fingers, PHD-type"", ""Fanconi anemia, complementation groups"""	20748	protein-coding gene	gene with protein product		608111	"""PHD finger protein 9"""	PHF9			Standard	NM_018062		Approved	FLJ10335, FAAP43, Pog	uc002rzx.4	Q9NW38	OTTHUMG00000129349	ENST00000233741.4:c.127C>T	2.37:g.58459217G>A	ENSP00000233741:p.Pro43Ser	Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	126	40	0.31746	NM_018062	Q6GU60	Missense_Mutation	SNP	ENST00000233741.4	37	CCDS1860.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.82|19.82	3.898417|3.898417	0.72639|0.72639	.|.	.|.	ENSG00000115392|ENSG00000115392	ENST00000427708|ENST00000403295;ENST00000233741;ENST00000402135;ENST00000540646	.|T;T;T;T	.|0.77489	.|-1.1;-1.1;-1.1;-1.1	6.01|6.01	6.01|6.01	0.97437|0.97437	.|Fanconi anemia complex, subunit FancL, WD-repeat containing domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.87034|0.87034	0.6077|0.6077	M|M	0.69248|0.69248	2.105|2.105	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D	.|0.89917	.|0.981;1.0;1.0	.|P;D;D	.|0.81914	.|0.869;0.991;0.995	D|D	0.86133|0.86133	0.1576|0.1576	5|10	.|0.49607	.|T	.|0.09	-21.5012|-21.5012	17.4309|17.4309	0.87539|0.87539	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|43;43;43	.|B5MC31;Q9NW38-2;Q9NW38	.|.;.;FANCL_HUMAN	V|S	42|43	.|ENSP00000386097:P43S;ENSP00000233741:P43S;ENSP00000385021:P43S;ENSP00000441431:P43S	.|ENSP00000233741:P43S	A|P	-|-	2|1	0|0	FANCL|FANCL	58312721|58312721	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.813000|0.813000	0.45954|0.45954	5.093000|5.093000	0.64517|0.64517	2.850000|2.850000	0.98022|0.98022	0.655000|0.655000	0.94253|0.94253	GCC|CCT	.	.	none		0.348	FANCL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251497.1	NM_018062	
CDCA7	83879	hgsc.bcm.edu	37	2	174224116	174224116	+	Intron	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:174224116A>G	ENST00000347703.3	+	2	291				CDCA7_ENST00000306721.3_Missense_Mutation_p.K94R|CDCA7_ENST00000410101.3_Splice_Site_p.K50R|CDCA7_ENST00000392567.2_Intron|CDCA7_ENST00000410019.3_Intron	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7						apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			TTTTTACAGAAACCAAGGCCA	0.413																																					p.K94R		Atlas-SNP	.											.	CDCA7	48	.	0			c.A281G						PASS	.						99.0	100.0	99.0					2																	174224116		2203	4300	6503	SO:0001627	intron_variant	83879	exon3			TACAGAAACCAAG	BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.147+551A>G	2.37:g.174224116A>G		Somatic	200	0	0		WXS	Illumina HiSeq	Phase_I	232	71	0.306034	NM_031942	B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Missense_Mutation	SNP	ENST00000347703.3	37	CCDS2253.1	.	.	.	.	.	.	.	.	.	.	A	14.22	2.470673	0.43942	.	.	ENSG00000144354	ENST00000306721;ENST00000410101	T;T	0.48522	0.81;0.81	6.06	6.06	0.98353	.	0.219733	0.31772	N	0.007090	T	0.49081	0.1536	.	.	.	0.80722	D	1	D;B	0.62365	0.991;0.2	P;B	0.47603	0.551;0.051	T	0.43310	-0.9399	9	0.31617	T	0.26	-21.9646	14.8662	0.70419	1.0:0.0:0.0:0.0	.	50;94	B4DV66;Q9BWT1-2	.;.	R	94;50	ENSP00000306968:K94R;ENSP00000386656:K50R	ENSP00000306968:K94R	K	+	2	0	CDCA7	173932362	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.236000	0.65354	2.323000	0.78572	0.528000	0.53228	AAA	.	.	none		0.413	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255400.1	NM_031942	
MAGI1	9223	hgsc.bcm.edu	37	3	65376868	65376868	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:65376868G>T	ENST00000497477.2	-	14	2364	c.2365C>A	c.(2365-2367)Cca>Aca	p.P789T	MAGI1_ENST00000330909.8_Missense_Mutation_p.P789T|MAGI1_ENST00000483466.1_Missense_Mutation_p.P789T|MAGI1_ENST00000402939.2_Missense_Mutation_p.P789T			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	789					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)	p.P789T(2)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		AAAGGATCTGGTTTTTTCTGG	0.567																																					p.P789T		Atlas-SNP	.											MAGI1_ENST00000402939,NS,lymphoid_neoplasm,0,4	MAGI1	481	4	2	Substitution - Missense(2)	large_intestine(2)	c.C2365A						PASS	.						96.0	96.0	96.0					3																	65376868		2203	4300	6503	SO:0001583	missense	9223	exon14			GATCTGGTTTTTT	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.2365C>A	3.37:g.65376868G>T	ENSP00000424369:p.Pro789Thr	Somatic	176	0	0		WXS	Illumina HiSeq	Phase_I	138	45	0.326087	NM_001033057	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	ENST00000497477.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.3|24.3	4.516730|4.516730	0.85495|0.85495	.|.	.|.	ENSG00000151276|ENSG00000151276	ENST00000460329|ENST00000402939;ENST00000330909;ENST00000422949;ENST00000463103;ENST00000483466;ENST00000497477;ENST00000472257	.|T;T;T;T;T;T	.|0.24908	.|2.42;2.21;2.21;2.22;1.83;2.02	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	.|0.103697	.|0.64402	.|D	.|0.000002	T|T	0.51278|0.51278	0.1665|0.1665	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	.|D;B;D;D;D	.|0.89917	.|0.998;0.033;1.0;1.0;0.998	.|D;B;D;D;D	.|0.87578	.|0.96;0.04;0.992;0.998;0.974	T|T	0.20472|0.20472	-1.0274|-1.0274	5|10	.|0.35671	.|T	.|0.21	-8.0913|-8.0913	20.5407|20.5407	0.99260|0.99260	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|789;789;789;789;789	.|A8K188;Q96QZ7-4;Q96QZ7-3;Q96QZ7-2;Q96QZ7-5	.|.;.;.;.;.	K|T	669|789;789;685;664;789;789;575	.|ENSP00000385450:P789T;ENSP00000331157:P789T;ENSP00000418177:P664T;ENSP00000420323:P789T;ENSP00000424369:P789T;ENSP00000420796:P575T	.|ENSP00000331157:P789T	N|P	-|-	3|1	2|0	MAGI1|MAGI1	65351908|65351908	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	9.476000|9.476000	0.97823|0.97823	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	AAC|CCA	.	.	none		0.567	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742	
MYCBP2	23077	hgsc.bcm.edu	37	13	77754319	77754319	+	De_novo_Start_OutOfFrame	SNP	G	G	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr13:77754319G>T	ENST00000360084.5	-	0	5054				MYCBP2_ENST00000544440.2_Silent_p.T1654T|MYCBP2_ENST00000407578.2_Silent_p.T1692T|MYCBP2_ENST00000357337.6_Silent_p.T1654T					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GTAATCCACAGGTGTTAGAGA	0.458																																					p.T1692T		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.C5076A						PASS	.						140.0	136.0	137.0					13																	77754319		2203	4300	6503			23077	exon34			TCCACAGGTGTTA	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000360084.5:c.-2650C>A	13.37:g.77754319G>T		Somatic	182	0	0		WXS	Illumina HiSeq	Phase_I	206	62	0.300971	NM_015057		Silent	SNP	ENST00000360084.5	37																																																																																				.	.	none		0.458	MYCBP2-202	KNOWN	basic	protein_coding	protein_coding		NM_015057	
DNAH10	196385	hgsc.bcm.edu	37	12	124272402	124272402	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:124272402C>T	ENST00000409039.3	+	10	1315	c.1290C>T	c.(1288-1290)ctC>ctT	p.L430L		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	430	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GGAACACCCTCAGGCTGTGGA	0.582																																					p.L430L		Atlas-SNP	.											.	DNAH10	888	.	0			c.C1290T						PASS	.						53.0	52.0	52.0					12																	124272402		2203	4300	6503	SO:0001819	synonymous_variant	196385	exon10			CACCCTCAGGCTG	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.1290C>T	12.37:g.124272402C>T		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	61	11	0.180328	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	CCDS9255.2																																																																																			.	.	none		0.582	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
ZNF366	167465	hgsc.bcm.edu	37	5	71756780	71756780	+	Missense_Mutation	SNP	G	G	C	rs140439481	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:71756780G>C	ENST00000318442.5	-	2	1034	c.544C>G	c.(544-546)Ccg>Gcg	p.P182A		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	182					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		ATGAGGCCCGGGTGGACTTTG	0.672													G|||	4	0.000798722	0.003	0.0	5008	,	,		16364	0.0		0.0	False		,,,				2504	0.0				p.P182A		Atlas-SNP	.											.	ZNF366	108	.	0			c.C544G						PASS	.	G	ALA/PRO	5,4401	9.9+/-24.2	0,5,2198	99.0	107.0	104.0		544	4.1	0.8	5	dbSNP_134	104	0,8600		0,0,4300	yes	missense	ZNF366	NM_152625.1	27	0,5,6498	CC,CG,GG		0.0,0.1135,0.0384	possibly-damaging	182/745	71756780	5,13001	2203	4300	6503	SO:0001583	missense	167465	exon2			GGCCCGGGTGGAC	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.544C>G	5.37:g.71756780G>C	ENSP00000313158:p.Pro182Ala	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	73	40	0.547945	NM_152625	Q5HYI9|Q7RTV4	Missense_Mutation	SNP	ENST00000318442.5	37	CCDS4015.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.956642	0.53293	0.001135	0.0	ENSG00000178175	ENST00000318442	T	0.09445	2.98	5.92	4.06	0.47325	.	0.388965	0.25253	N	0.032014	T	0.10380	0.0254	L	0.34521	1.04	0.46927	D	0.999256	B	0.14012	0.009	B	0.12837	0.008	T	0.07121	-1.0789	10	0.27082	T	0.32	-27.0902	16.3517	0.83215	0.0:0.2494:0.7506:0.0	.	182	Q8N895	ZN366_HUMAN	A	182	ENSP00000313158:P182A	ENSP00000313158:P182A	P	-	1	0	ZNF366	71792536	1.000000	0.71417	0.812000	0.32479	0.962000	0.63368	6.566000	0.73978	0.769000	0.33313	0.561000	0.74099	CCG	G|1.000;C|0.000	0.000	strong		0.672	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3		
PRB1	5542	hgsc.bcm.edu	37	12	11506288	11506288	+	Missense_Mutation	SNP	T	T	C	rs140825288	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:11506288T>C	ENST00000500254.2	-	4	387	c.350A>G	c.(349-351)aAa>aGa	p.K117R	PRB1_ENST00000545626.1_Intron|PRB1_ENST00000546254.1_Missense_Mutation_p.K117R	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1	0	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-[PAQ]-Q-[GE]-[GD]- [NKS]-[KSQRN]-[PRQS]-[QS] [GPS]-[PQAR]- [PSR].		Missing (in allele M).|Missing (in clone CP-4).|Missing (in clone CP-5).			extracellular region (GO:0005576)		p.K117R(2)		NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			ACCTTGAGGTTTGTTGCCTCC	0.612													t|||	39	0.00778754	0.0106	0.0086	5008	,	,		16399	0.0079		0.0099	False		,,,				2504	0.001				p.K117R		Atlas-SNP	.											PRB1,NS,carcinoma,0,2	PRB1	33	2	2	Substitution - Missense(2)	prostate(1)|central_nervous_system(1)	c.A350G						scavenged	.						92.0	112.0	105.0					12																	11506288		2098	4245	6343	SO:0001583	missense	5542	exon4			TGAGGTTTGTTGC		CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.350A>G	12.37:g.11506288T>C	ENSP00000420826:p.Lys117Arg	Somatic	565	8	0.0141593		WXS	Illumina HiSeq	Phase_I	524	13	0.0248092	NM_199353	Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Missense_Mutation	SNP	ENST00000500254.2	37	CCDS8642.1	.	.	.	.	.	.	.	.	.	.	.	0.021	-1.431560	0.01108	.	.	ENSG00000251655	ENST00000500254;ENST00000546254	T;T	0.04119	3.7;3.7	1.29	-1.39	0.08997	.	.	.	.	.	T	0.03871	0.0109	L	0.39147	1.195	0.09310	N	1	B;B	0.12013	0.005;0.005	B;B	0.08055	0.002;0.003	T	0.44544	-0.9321	8	.	.	.	.	5.2744	0.15641	0.0:0.2701:0.0:0.7299	.	257;117	Q86YA1;G3V1M9	.;.	R	117	ENSP00000420826:K117R;ENSP00000442127:K117R	.	K	-	2	0	PRB1	11397555	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	0.188000	0.17018	-0.320000	0.08640	0.113000	0.15668	AAA	.	.	weak		0.612	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1	NM_005039	
ATP10B	23120	hgsc.bcm.edu	37	5	160047422	160047422	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:160047422C>T	ENST00000327245.5	-	15	3194	c.2348G>A	c.(2347-2349)gGc>gAc	p.G783D	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	783					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AACAATCTCGCCAGTCAGTGG	0.592																																					p.G783D		Atlas-SNP	.											.	ATP10B	201	.	0			c.G2348A						PASS	.						52.0	55.0	54.0					5																	160047422		2094	4205	6299	SO:0001583	missense	23120	exon15			ATCTCGCCAGTCA	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2348G>A	5.37:g.160047422C>T	ENSP00000313600:p.Gly783Asp	Somatic	167	0	0		WXS	Illumina HiSeq	Phase_I	141	15	0.106383	NM_025153	Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	C	0.612	-0.824493	0.02755	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	T;T	0.71934	-0.61;-0.61	5.48	1.49	0.22878	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	1.165400	0.05887	N	0.627584	T	0.56381	0.1981	L	0.31476	0.935	0.09310	N	1	B;B	0.14012	0.009;0.002	B;B	0.12156	0.007;0.005	T	0.39014	-0.9634	9	.	.	.	.	5.6592	0.17660	0.0:0.5569:0.1414:0.3017	.	391;783	Q2YDW8;O94823	.;AT10B_HUMAN	D	783;391	ENSP00000313600:G783D;ENSP00000431081:G391D	.	G	-	2	0	ATP10B	159980000	0.000000	0.05858	0.000000	0.03702	0.266000	0.26442	0.064000	0.14437	0.680000	0.31366	0.644000	0.83932	GGC	.	.	none		0.592	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
HECTD1	25831	hgsc.bcm.edu	37	14	31598253	31598253	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr14:31598253A>T	ENST00000399332.1	-	25	4812	c.4324T>A	c.(4324-4326)Tca>Aca	p.S1442T	HECTD1_ENST00000553700.1_Missense_Mutation_p.S1442T	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1442	Ser-rich.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		CTGGAAGATGACCCTACTTCT	0.448																																					p.S1442T		Atlas-SNP	.											.	HECTD1	159	.	0			c.T4324A						PASS	.						144.0	130.0	134.0					14																	31598253		1964	4151	6115	SO:0001583	missense	25831	exon25			AAGATGACCCTAC	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.4324T>A	14.37:g.31598253A>T	ENSP00000382269:p.Ser1442Thr	Somatic	280	0	0		WXS	Illumina HiSeq	Phase_I	211	34	0.161137	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	A	8.231	0.804577	0.16467	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957	T;T;T	0.39997	1.05;1.05;1.15	5.86	5.86	0.93980	.	0.808994	0.10739	U	0.639730	T	0.28067	0.0692	N	0.08118	0	0.46356	D	0.999009	B;B	0.32620	0.378;0.378	B;B	0.32211	0.142;0.142	T	0.15350	-1.0440	10	0.23891	T	0.37	-9.1577	16.5602	0.84551	1.0:0.0:0.0:0.0	.	1442;1442	D3DS86;Q9ULT8	.;HECD1_HUMAN	T	1442;1444;1442;869	ENSP00000450697:S1442T;ENSP00000382269:S1442T;ENSP00000451860:S869T	ENSP00000261312:S1444T	S	-	1	0	HECTD1	30668004	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.678000	0.91211	2.367000	0.80283	0.528000	0.53228	TCA	.	.	none		0.448	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
SMC2	10592	hgsc.bcm.edu	37	9	106875690	106875690	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr9:106875690G>T	ENST00000286398.7	+	11	1636	c.1348G>T	c.(1348-1350)Gct>Tct	p.A450S	SMC2_ENST00000374787.3_Missense_Mutation_p.A450S|SMC2_ENST00000303219.8_Missense_Mutation_p.A450S|SMC2_ENST00000374793.3_Missense_Mutation_p.A450S	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	450					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						GGATCAAGAAGCTCTAGAAGC	0.353																																					p.A450S		Atlas-SNP	.											.	SMC2	127	.	0			c.G1348T						PASS	.						68.0	70.0	69.0					9																	106875690		2203	4299	6502	SO:0001583	missense	10592	exon11			CAAGAAGCTCTAG	AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.1348G>T	9.37:g.106875690G>T	ENSP00000286398:p.Ala450Ser	Somatic	270	0	0		WXS	Illumina HiSeq	Phase_I	279	104	0.37276	NM_006444	Q6IEE0|Q9P1P2	Missense_Mutation	SNP	ENST00000286398.7	37	CCDS35086.1	.	.	.	.	.	.	.	.	.	.	G	8.759	0.923235	0.18056	.	.	ENSG00000136824	ENST00000286398;ENST00000374793;ENST00000303219;ENST00000374787	T;T;T;T	0.79653	-1.18;-1.18;-1.29;-1.18	4.86	3.96	0.45880	RecF/RecN/SMC (1);	0.210974	0.49916	D	0.000137	T	0.71213	0.3313	L	0.52011	1.625	0.32986	D	0.524259	B;B;B	0.22983	0.045;0.037;0.078	B;B;B	0.25759	0.055;0.021;0.063	T	0.66333	-0.5950	10	0.09590	T	0.72	-11.9229	9.247	0.37532	0.1751:0.0:0.8249:0.0	.	450;450;450	A8K984;O95347;Q2KQ72	.;SMC2_HUMAN;.	S	450	ENSP00000286398:A450S;ENSP00000363925:A450S;ENSP00000306152:A450S;ENSP00000363919:A450S	ENSP00000286398:A450S	A	+	1	0	SMC2	105915511	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	2.795000	0.47861	1.265000	0.44215	0.650000	0.86243	GCT	.	.	none		0.353	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1		
SPATS2L	26010	hgsc.bcm.edu	37	2	201284179	201284179	+	Silent	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:201284179G>C	ENST00000358677.5	+	6	652	c.405G>C	c.(403-405)tcG>tcC	p.S135S	SPATS2L_ENST00000409385.1_Silent_p.S75S|SPATS2L_ENST00000409718.1_Silent_p.S135S|SPATS2L_ENST00000451764.2_Silent_p.S135S|SPATS2L_ENST00000409755.3_Silent_p.S165S|SPATS2L_ENST00000409140.3_Silent_p.S135S|SPATS2L_ENST00000360760.5_Silent_p.S135S|SPATS2L_ENST00000409151.1_Silent_p.S143S|SPATS2L_ENST00000409988.3_Silent_p.S135S	NM_001282735.1|NM_001282743.1|NM_001282744.1|NM_015535.2	NP_001269664.1|NP_001269672.1|NP_001269673.1|NP_056350.2	Q9NUQ6	SPS2L_HUMAN	spermatogenesis associated, serine-rich 2-like	135						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	10						AAAAGATCTCGATACTTGAGG	0.463																																					p.S135S		Atlas-SNP	.											.	SPATS2L	88	.	0			c.G405C						PASS	.						43.0	44.0	44.0					2																	201284179		1937	4129	6066	SO:0001819	synonymous_variant	26010	exon6			GATCTCGATACTT	AF193059	CCDS46483.1, CCDS46484.1, CCDS74621.1, CCDS74622.1	2q33.1	2009-06-12			ENSG00000196141	ENSG00000196141			24574	protein-coding gene	gene with protein product	"""DNA polymerase transactivated protein 6"""	613817				11230166	Standard	NM_001100422		Approved	DNAPTP6	uc002uvr.4	Q9NUQ6	OTTHUMG00000154589	ENST00000358677.5:c.405G>C	2.37:g.201284179G>C		Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	90	31	0.344444	NM_001100423	A8K381|B4DRE6|B4DT67|B7WNZ7|Q53T22|Q8WV53|Q8WYG1|Q9NTW4	Silent	SNP	ENST00000358677.5	37	CCDS46483.1																																																																																			.	.	none		0.463	SPATS2L-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336208.3	NM_015535	
NRK	203447	hgsc.bcm.edu	37	X	105153118	105153118	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:105153118C>T	ENST00000243300.9	+	13	1788	c.1485C>T	c.(1483-1485)tcC>tcT	p.S495S	NRK_ENST00000428173.2_Silent_p.S496S	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	495	Gln-rich.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						AGGTACAGTCCCAGGTATCCA	0.542										HNSCC(51;0.14)																											p.S495S		Atlas-SNP	.											.	NRK	321	.	0			c.C1485T						PASS	.						53.0	54.0	53.0					X																	105153118		2025	4166	6191	SO:0001819	synonymous_variant	203447	exon13			ACAGTCCCAGGTA	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.1485C>T	X.37:g.105153118C>T		Somatic	236	0	0		WXS	Illumina HiSeq	Phase_I	161	15	0.0931677	NM_198465	Q32ND6|Q5H9K2|Q6ZMP2	Silent	SNP	ENST00000243300.9	37																																																																																				.	.	none		0.542	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465	
DNAH10	196385	hgsc.bcm.edu	37	12	124359986	124359986	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:124359986C>T	ENST00000409039.3	+	46	7818	c.7793C>T	c.(7792-7794)tCa>tTa	p.S2598L		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2598	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CCATTTCCTTCAGAGGAGTCT	0.443																																					p.S2598L		Atlas-SNP	.											.	DNAH10	888	.	0			c.C7793T						PASS	.						130.0	120.0	123.0					12																	124359986		1884	4112	5996	SO:0001583	missense	196385	exon46			TTCCTTCAGAGGA	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7793C>T	12.37:g.124359986C>T	ENSP00000386770:p.Ser2598Leu	Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	143	38	0.265734	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	25.6	4.652837	0.88056	.	.	ENSG00000197653	ENST00000409039	T	0.36157	1.27	5.41	5.41	0.78517	ATPase, AAA+ type, core (1);	0.314931	0.25839	U	0.027979	T	0.70254	0.3203	H	0.94847	3.59	0.47621	D	0.999473	D	0.57571	0.98	P	0.62184	0.899	T	0.78800	-0.2062	10	0.66056	D	0.02	.	19.6104	0.95604	0.0:1.0:0.0:0.0	.	2598	Q8IVF4	DYH10_HUMAN	L	2598	ENSP00000386770:S2598L	ENSP00000386770:S2598L	S	+	2	0	DNAH10	122925939	0.989000	0.36119	0.924000	0.36721	0.866000	0.49608	3.370000	0.52372	2.702000	0.92279	0.558000	0.71614	TCA	.	.	none		0.443	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
KCTD20	222658	hgsc.bcm.edu	37	6	36447473	36447473	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr6:36447473C>T	ENST00000373731.2	+	5	1034	c.643C>T	c.(643-645)Cga>Tga	p.R215*	KCTD20_ENST00000449081.2_Intron|KCTD20_ENST00000544295.1_Intron|KCTD20_ENST00000536244.1_Nonsense_Mutation_p.R70*|KCTD20_ENST00000474988.1_Intron	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	215					protein homooligomerization (GO:0051260)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						CAACACTATCCGATGTCAAGA	0.378																																					p.R215X		Atlas-SNP	.											KCTD20,rectum,carcinoma,-1,1	KCTD20	37	1	0			c.C643T						PASS	.						78.0	72.0	74.0					6																	36447473		2203	4300	6503	SO:0001587	stop_gained	222658	exon5			ACTATCCGATGTC	BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.643C>T	6.37:g.36447473C>T	ENSP00000362836:p.Arg215*	Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	64	29	0.453125	NM_173562	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Nonsense_Mutation	SNP	ENST00000373731.2	37	CCDS4821.1	.	.	.	.	.	.	.	.	.	.	C	37	6.388762	0.97529	.	.	ENSG00000112078	ENST00000373731;ENST00000536244	.	.	.	4.72	2.74	0.32292	.	0.178769	0.34700	N	0.003742	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-9.9284	11.2051	0.48765	0.5758:0.4242:0.0:0.0	.	.	.	.	X	215;70	.	ENSP00000362836:R215X	R	+	1	2	KCTD20	36555451	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.532000	0.60608	1.189000	0.43028	0.591000	0.81541	CGA	.	.	none		0.378	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040345.2	NM_173562	
RNFT1	51136	hgsc.bcm.edu	37	17	58034594	58034594	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr17:58034594G>A	ENST00000305783.8	-	6	1051	c.996C>T	c.(994-996)ctC>ctT	p.L332L	RP11-178C3.1_ENST00000591035.1_Intron|RNFT1_ENST00000442346.2_3'UTR	NM_016125.3	NP_057209.3	Q5M7Z0	RNFT1_HUMAN	ring finger protein, transmembrane 1	332						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	9	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			CTTTTAATATGAGGTAGAGTA	0.358																																					p.L332L		Atlas-SNP	.											RNFT1_ENST00000305783,NS,carcinoma,0,1	RNFT1	30	1	0			c.C996T						PASS	.						93.0	84.0	87.0					17																	58034594		1890	4107	5997	SO:0001819	synonymous_variant	51136	exon6			TAATATGAGGTAG	BC006971	CCDS11622.2	17q23.2	2013-01-09			ENSG00000189050	ENSG00000189050		"""RING-type (C3HC4) zinc fingers"""	30206	protein-coding gene	gene with protein product		615172				12477932	Standard	NM_016125		Approved	PTD016	uc002iya.3	Q5M7Z0	OTTHUMG00000148658	ENST00000305783.8:c.996C>T	17.37:g.58034594G>A		Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	142	61	0.429577	NM_016125	Q8N7D0|Q96IZ9|Q9Y686	Silent	SNP	ENST00000305783.8	37	CCDS11622.2																																																																																			.	.	none		0.358	RNFT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308958.1	NM_016125	
PDP1	54704	hgsc.bcm.edu	37	8	94935821	94935821	+	Nonsense_Mutation	SNP	C	C	T	rs202225648		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr8:94935821C>T	ENST00000297598.4	+	2	1803	c.1534C>T	c.(1534-1536)Cga>Tga	p.R512*	PDP1_ENST00000396200.3_Nonsense_Mutation_p.R537*|PDP1_ENST00000520728.1_Nonsense_Mutation_p.R512*|PDP1_ENST00000517764.1_Nonsense_Mutation_p.R512*	NM_001161781.1|NM_018444.3	NP_001155253.1|NP_060914.2	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 1	512					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18						AGAGCTTGCTCGAATGTACAG	0.453																																					p.R537X		Atlas-SNP	.											PDP1,rectum,carcinoma,-1,1	PDP1	97	1	0			c.C1609T						PASS	.						106.0	96.0	99.0					8																	94935821		2203	4300	6503	SO:0001587	stop_gained	54704	exon3			CTTGCTCGAATGT	AF155661	CCDS6259.1, CCDS55262.1	8q22.1	2012-04-17	2009-06-12	2009-06-12	ENSG00000164951	ENSG00000164951	3.1.3.43	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9279	protein-coding gene	gene with protein product		605993	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit"""	PPM2C		8396421	Standard	NM_001161779		Approved	PDP, PDH	uc003ygf.3	Q9P0J1		ENST00000297598.4:c.1534C>T	8.37:g.94935821C>T	ENSP00000297598:p.Arg512*	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	127	14	0.110236	NM_001161780	B3KX71|J3KPU0|Q5U5K1	Nonsense_Mutation	SNP	ENST00000297598.4	37	CCDS6259.1	.	.	.	.	.	.	.	.	.	.	C	38	6.810033	0.97853	.	.	ENSG00000164951	ENST00000297598;ENST00000520728;ENST00000396200;ENST00000517764	.	.	.	6.17	5.3	0.74995	.	0.058646	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.9484	17.1598	0.86801	0.1273:0.8727:0.0:0.0	.	.	.	.	X	512;512;537;512	.	ENSP00000297598:R512X	R	+	1	2	PDP1	95004997	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.804000	0.55568	1.623000	0.50342	0.655000	0.94253	CGA	C|0.999;T|0.001	0.001	weak		0.453	PDP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378415.2	NM_018444	
ZNF266	10781	hgsc.bcm.edu	37	19	9524292	9524292	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:9524292C>G	ENST00000592904.1	-	5	3385	c.1309G>C	c.(1309-1311)Gag>Cag	p.E437Q	ZNF266_ENST00000361451.2_Missense_Mutation_p.E437Q|ZNF266_ENST00000361151.1_Missense_Mutation_p.E437Q|ZNF266_ENST00000588221.1_Missense_Mutation_p.E437Q|ZNF266_ENST00000588933.1_Missense_Mutation_p.E437Q|ZNF266_ENST00000592292.1_Missense_Mutation_p.E437Q|ZNF266_ENST00000590306.1_Missense_Mutation_p.E437Q			Q14584	ZN266_HUMAN	zinc finger protein 266	437					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						TCCAGGCACTCAAAGGGCTTC	0.433																																					p.E437Q		Atlas-SNP	.											.	ZNF266	65	.	0			c.G1309C						PASS	.						65.0	62.0	63.0					19																	9524292		2203	4300	6503	SO:0001583	missense	10781	exon11			GGCACTCAAAGGG	X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.1309G>C	19.37:g.9524292C>G	ENSP00000466714:p.Glu437Gln	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	100	34	0.34	NM_001271314	A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Missense_Mutation	SNP	ENST00000592904.1	37	CCDS12213.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347587	0.61183	.	.	ENSG00000174652	ENST00000361451;ENST00000361151	T;T	0.07444	3.19;3.19	2.53	-1.76	0.08006	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02807	0.0084	N	0.04335	-0.225	0.09310	N	1	B	0.30634	0.288	B	0.25884	0.064	T	0.39840	-0.9594	9	0.45353	T	0.12	.	1.6977	0.02866	0.1866:0.3032:0.3688:0.1413	.	437	Q14584	ZN266_HUMAN	Q	437	ENSP00000354680:E437Q;ENSP00000355047:E437Q	ENSP00000355047:E437Q	E	-	1	0	ZNF266	9385292	0.000000	0.05858	0.001000	0.08648	0.894000	0.52154	-4.155000	0.00284	-0.243000	0.09653	0.555000	0.69702	GAG	.	.	none		0.433	ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449033.1		
SPTA1	6708	hgsc.bcm.edu	37	1	158622386	158622386	+	Nonsense_Mutation	SNP	A	A	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:158622386A>T	ENST00000368147.4	-	23	3426	c.3246T>A	c.(3244-3246)taT>taA	p.Y1082*		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1082					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AAAATTCATTATAACGTTGCA	0.438																																					p.Y1082X		Atlas-SNP	.											.	SPTA1	720	.	0			c.T3246A						PASS	.						123.0	114.0	117.0					1																	158622386		1900	4119	6019	SO:0001587	stop_gained	6708	exon23			TTCATTATAACGT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3246T>A	1.37:g.158622386A>T	ENSP00000357129:p.Tyr1082*	Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	161	23	0.142857	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Nonsense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	A	43	9.888015	0.99288	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	.	.	.	5.3	2.46	0.29980	.	0.000000	0.29699	N	0.011431	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.3384	0.38065	0.233:0.0:0.767:0.0	.	.	.	.	X	1082	.	ENSP00000357129:Y1082X	Y	-	3	2	SPTA1	156889010	1.000000	0.71417	0.994000	0.49952	0.821000	0.46438	2.557000	0.45871	0.403000	0.25479	-0.132000	0.14878	TAT	.	.	none		0.438	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
APOB	338	hgsc.bcm.edu	37	2	21241890	21241890	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:21241890G>C	ENST00000233242.1	-	20	3222	c.3095C>G	c.(3094-3096)aCc>aGc	p.T1032S		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1032					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAACTTCAGGGTATCCACCAA	0.473																																					p.T1032S		Atlas-SNP	.											.	APOB	761	.	0			c.C3095G						PASS	.						134.0	124.0	128.0					2																	21241890		2203	4300	6503	SO:0001583	missense	338	exon20			TTCAGGGTATCCA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3095C>G	2.37:g.21241890G>C	ENSP00000233242:p.Thr1032Ser	Somatic	198	0	0		WXS	Illumina HiSeq	Phase_I	132	34	0.257576	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.507504	0.44558	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00717	5.79	4.3	-0.221	0.13126	Lipid transport, open beta-sheet (1);Vitellinogen, open beta-sheet, subdomain 2 (1);	0.291638	0.24067	N	0.041848	T	0.00608	0.0020	N	0.26042	0.785	0.80722	D	1	B	0.24963	0.115	B	0.25140	0.058	T	0.62959	-0.6743	10	0.21014	T	0.42	.	6.8881	0.24214	0.1539:0.2639:0.5821:0.0	.	1032	P04114	APOB_HUMAN	S	1032	ENSP00000233242:T1032S	ENSP00000233242:T1032S	T	-	2	0	APOB	21095395	0.998000	0.40836	0.437000	0.26809	0.982000	0.71751	2.741000	0.47426	0.121000	0.18284	0.460000	0.39030	ACC	.	.	none		0.473	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
AARS2	57505	hgsc.bcm.edu	37	6	44274068	44274068	+	Missense_Mutation	SNP	G	G	A	rs143703625	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr6:44274068G>A	ENST00000244571.4	-	9	1251	c.1249C>T	c.(1249-1251)Cgg>Tgg	p.R417W	TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TCAATGATCCGCCTACCCCGC	0.597																																					p.R417W		Atlas-SNP	.											.	AARS2	77	.	0			c.C1249T						PASS	.						102.0	98.0	99.0					6																	44274068		2203	4300	6503	SO:0001583	missense	57505	exon9			TGATCCGCCTACC	AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.1249C>T	6.37:g.44274068G>A	ENSP00000244571:p.Arg417Trp	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	72	12	0.166667	NM_020745		Missense_Mutation	SNP	ENST00000244571.4	37	CCDS34464.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.830210	0.71258	.	.	ENSG00000124608	ENST00000244571	T	0.58940	0.3	4.41	4.41	0.53225	Alanyl-tRNA synthetase, class IIc, anti-codon-binding domain (1);Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.226724	0.43579	D	0.000545	T	0.74604	0.3738	M	0.91818	3.245	0.42141	D	0.991513	D	0.76494	0.999	P	0.59643	0.861	T	0.82458	-0.0447	10	0.87932	D	0	-10.4928	17.1894	0.86875	0.0:0.0:1.0:0.0	.	417	Q5JTZ9	SYAM_HUMAN	W	417	ENSP00000244571:R417W	ENSP00000244571:R417W	R	-	1	2	AARS2	44382046	0.993000	0.37304	0.997000	0.53966	0.846000	0.48090	4.028000	0.57246	2.301000	0.77427	0.655000	0.94253	CGG	G|0.999;T|0.001	.	alt		0.597	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040741.2	NM_020745	
PAK2	5062	hgsc.bcm.edu	37	3	196509522	196509522	+	Missense_Mutation	SNP	C	C	G	rs67093638		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:196509522C>G	ENST00000327134.3	+	2	327	c.5C>G	c.(4-6)tCt>tGt	p.S2C	RNU6-42P_ENST00000384165.1_RNA	NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	2					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)	p.S2C(2)		breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		TGAATCATGTCTGATAACGGA	0.408																																					p.S2C		Atlas-SNP	.											PAK2_ENST00000327134,NS,carcinoma,0,4	PAK2	113	4	2	Substitution - Missense(2)	prostate(2)	c.C5G						scavenged	.						81.0	87.0	85.0					3																	196509522		2203	4300	6503	SO:0001583	missense	5062	exon2			TCATGTCTGATAA	U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.5C>G	3.37:g.196509522C>G	ENSP00000314067:p.Ser2Cys	Somatic	177	1	0.00564972		WXS	Illumina HiSeq	Phase_I	186	9	0.0483871	NM_002577	Q13154|Q6ISC3	Missense_Mutation	SNP	ENST00000327134.3	37	CCDS3321.1	42	0.019230769230769232	6	0.012195121951219513	0	0.0	7	0.012237762237762238	29	0.03825857519788918	C	14.90	2.672409	0.47781	.	.	ENSG00000180370	ENST00000327134	T	0.70631	-0.5	5.21	5.21	0.72293	.	0.055816	0.64402	D	0.000001	T	0.30417	0.0764	N	0.25426	0.745	0.54753	D	0.999985	B	0.15141	0.012	B	0.20577	0.03	T	0.51284	-0.8725	10	0.62326	D	0.03	.	18.756	0.91833	0.0:1.0:0.0:0.0	.	2	Q13177	PAK2_HUMAN	C	2	ENSP00000314067:S2C	ENSP00000314067:S2C	S	+	2	0	PAK2	197993919	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.961000	0.49168	2.456000	0.83038	0.655000	0.94253	TCT	C|0.986;G|0.014	0.014	strong		0.408	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
GPR98	84059	hgsc.bcm.edu	37	5	90151709	90151709	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:90151709T>C	ENST00000405460.2	+	82	17842	c.17746T>C	c.(17746-17748)Tgt>Cgt	p.C5916R	GPR98_ENST00000425867.2_Missense_Mutation_p.C1577R	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5916					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGGATTTATATGTATCTCAGG	0.363																																					p.C5916R		Atlas-SNP	.											.	GPR98	605	.	0			c.T17746C						PASS	.						158.0	146.0	150.0					5																	90151709		1888	4110	5998	SO:0001583	missense	84059	exon82			TTTATATGTATCT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.17746T>C	5.37:g.90151709T>C	ENSP00000384582:p.Cys5916Arg	Somatic	230	0	0		WXS	Illumina HiSeq	Phase_I	225	115	0.511111	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	T	19.38	3.817395	0.70912	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.43294	0.95;0.95	5.49	5.49	0.81192	GPCR, family 2-like (1);	0.041679	0.85682	D	0.000000	T	0.60117	0.2244	L	0.60455	1.87	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.71414	0.96;0.973;0.933	T	0.58858	-0.7562	9	.	.	.	.	15.8828	0.79216	0.0:0.0:0.0:1.0	.	1577;5916;1577	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	R	5916;5916;1577	ENSP00000384582:C5916R;ENSP00000392618:C1577R	.	C	+	1	0	GPR98	90187465	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.552000	0.67281	2.213000	0.71641	0.477000	0.44152	TGT	.	.	none		0.363	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
MUC6	4588	hgsc.bcm.edu	37	11	1016851	1016851	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr11:1016851T>C	ENST00000421673.2	-	31	6000	c.5950A>G	c.(5950-5952)Atg>Gtg	p.M1984V		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1984	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTTGCAGTCATAGGACCTGTG	0.582																																					p.M1984V		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,+2,2	MUC6	408	2	0			c.A5950G						scavenged	.						1531.0	1522.0	1525.0					11																	1016851		2203	4298	6501	SO:0001583	missense	4588	exon31			CAGTCATAGGACC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5950A>G	11.37:g.1016851T>C	ENSP00000406861:p.Met1984Val	Somatic	609	31	0.0509031		WXS	Illumina HiSeq	Phase_I	584	24	0.0410959	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	1.757	-0.487796	0.04352	.	.	ENSG00000184956	ENST00000421673	T	0.17370	2.28	2.75	-1.23	0.09465	.	.	.	.	.	T	0.10809	0.0264	L	0.43152	1.355	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45205	-0.9277	9	0.06365	T	0.9	.	7.0983	0.25321	0.0:0.1589:0.2688:0.5723	.	1984	Q6W4X9	MUC6_HUMAN	V	1984	ENSP00000406861:M1984V	ENSP00000406861:M1984V	M	-	1	0	MUC6	1006851	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.137000	0.00588	-0.732000	0.04856	-2.319000	0.00253	ATG	.	.	none		0.582	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
YES1	7525	hgsc.bcm.edu	37	18	743032	743032	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr18:743032C>T	ENST00000584307.1	-	8	1116	c.946G>A	c.(946-948)Gct>Act	p.A316T	YES1_ENST00000314574.4_Missense_Mutation_p.A316T|YES1_ENST00000577961.1_Missense_Mutation_p.A321T			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	316	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	TGAAGGAAAGCTTCTGGCATC	0.323																																					p.A316T		Atlas-SNP	.											.	YES1	50	.	0			c.G946A						PASS	.						117.0	112.0	114.0					18																	743032		2203	4299	6502	SO:0001583	missense	7525	exon8			GGAAAGCTTCTGG	M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.946G>A	18.37:g.743032C>T	ENSP00000462468:p.Ala316Thr	Somatic	258	0	0		WXS	Illumina HiSeq	Phase_I	293	25	0.0853242	NM_005433	A6NLB3|D3DUH1	Missense_Mutation	SNP	ENST00000584307.1	37	CCDS11824.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.903597	0.92035	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	D	0.83419	-1.72	5.78	5.78	0.91487	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88235	0.6382	L	0.45581	1.43	0.80722	D	1	D	0.58268	0.982	P	0.61533	0.89	D	0.88448	0.3047	10	0.72032	D	0.01	.	20.0216	0.97506	0.0:1.0:0.0:0.0	.	316	P07947	YES_HUMAN	T	316	ENSP00000324740:A316T	ENSP00000324740:A316T	A	-	1	0	YES1	733032	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.638000	0.83328	2.735000	0.93741	0.650000	0.86243	GCT	.	.	none		0.323	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440827.2	NM_005433	
XPO1	7514	hgsc.bcm.edu	37	2	61719472	61719472	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:61719472C>T	ENST00000401558.2	-	15	2438	c.1711G>A	c.(1711-1713)Gaa>Aaa	p.E571K	XPO1_ENST00000406957.1_Missense_Mutation_p.E571K|XPO1_ENST00000404992.2_Missense_Mutation_p.E571K	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	571	Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)	p.E571K(5)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TGCATGAATTCGAACAGCTTG	0.313			Mis		CLL																																p.E571K		Atlas-SNP	.	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	XPO1,NS,carcinoma,0,17	XPO1	108	17	5	Substitution - Missense(5)	haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|prostate(1)|endometrium(1)	c.G1711A						PASS	.						66.0	63.0	64.0					2																	61719472		2203	4300	6503	SO:0001583	missense	7514	exon15			TGAATTCGAACAG	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.1711G>A	2.37:g.61719472C>T	ENSP00000384863:p.Glu571Lys	Somatic	301	0	0		WXS	Illumina HiSeq	Phase_I	278	84	0.302158	NM_003400	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	37	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	C	36	5.629400	0.96671	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	T;T;T	0.66099	-0.19;-0.19;-0.19	5.63	5.63	0.86233	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85856	0.5794	H	0.94734	3.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88632	0.3170	10	0.66056	D	0.02	-19.4383	20.0572	0.97657	0.0:1.0:0.0:0.0	.	218;571	B3KWD0;O14980	.;XPO1_HUMAN	K	571	ENSP00000384863:E571K;ENSP00000385942:E571K;ENSP00000385559:E571K	ENSP00000384863:E571K	E	-	1	0	XPO1	61572976	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	7.722000	0.84778	2.826000	0.97356	0.655000	0.94253	GAA	.	.	none		0.313	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400	
POU3F4	5456	hgsc.bcm.edu	37	X	82764220	82764220	+	Silent	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:82764220T>C	ENST00000373200.2	+	1	952	c.888T>C	c.(886-888)caT>caC	p.H296H	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	296					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						TGGAGACGCATTTCCTCAAGT	0.592																																					p.H296H		Atlas-SNP	.											.	POU3F4	136	.	0			c.T888C						PASS	.						47.0	35.0	39.0					X																	82764220		2203	4300	6503	SO:0001819	synonymous_variant	5456	exon1			GACGCATTTCCTC	X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.888T>C	X.37:g.82764220T>C		Somatic	158	0	0		WXS	Illumina HiSeq	Phase_I	113	19	0.168142	NM_000307	B2RC71|Q5H9G9|Q99410	Silent	SNP	ENST00000373200.2	37	CCDS14450.1																																																																																			.	.	none		0.592	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307	
QRFPR	84109	hgsc.bcm.edu	37	4	122250653	122250653	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr4:122250653C>T	ENST00000394427.2	-	6	1523	c.1112G>A	c.(1111-1113)cGg>cAg	p.R371Q	Y_RNA_ENST00000384419.1_RNA|QRFPR_ENST00000334383.5_3'UTR	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	371					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						TGCTTTCTTCCGCATCATTGT	0.378																																					p.R371Q		Atlas-SNP	.											QRFPR,NS,carcinoma,-1,1	QRFPR	65	1	0			c.G1112A						scavenged	.						192.0	190.0	191.0					4																	122250653		2203	4300	6503	SO:0001583	missense	84109	exon6			TTCTTCCGCATCA	AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.1112G>A	4.37:g.122250653C>T	ENSP00000377948:p.Arg371Gln	Somatic	385	1	0.0025974		WXS	Illumina HiSeq	Phase_I	298	28	0.0939597	NM_198179		Missense_Mutation	SNP	ENST00000394427.2	37	CCDS3719.1	.	.	.	.	.	.	.	.	.	.	C	1.400	-0.578442	0.03854	.	.	ENSG00000186867	ENST00000394427	T	0.72505	-0.66	5.0	-1.01	0.10169	.	0.634163	0.16362	N	0.217722	T	0.34774	0.0909	N	0.02539	-0.55	0.20196	N	0.999929	B	0.02656	0.0	B	0.01281	0.0	T	0.16188	-1.0411	10	0.25106	T	0.35	.	2.3119	0.04188	0.1146:0.2239:0.1177:0.5438	.	371	Q96P65	QRFPR_HUMAN	Q	371	ENSP00000377948:R371Q	ENSP00000377948:R371Q	R	-	2	0	QRFPR	122470103	0.949000	0.32298	0.157000	0.22605	0.088000	0.18126	0.537000	0.23144	0.018000	0.15052	-0.573000	0.04149	CGG	.	.	none		0.378	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256641.2	NM_198179	
SPTA1	6708	hgsc.bcm.edu	37	1	158614070	158614070	+	Silent	SNP	G	G	A	rs189877287	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:158614070G>A	ENST00000368147.4	-	30	4491	c.4311C>T	c.(4309-4311)gaC>gaT	p.D1437D		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1437					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.D1437D(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TGTCCAAATCGTCCCGTTTCT	0.403													g|||	4	0.000798722	0.0015	0.0	5008	,	,		17322	0.0		0.0	False		,,,				2504	0.002				p.D1437D		Atlas-SNP	.											SPTA1,NS,carcinoma,0,1	SPTA1	720	1	1	Substitution - coding silent(1)	endometrium(1)	c.C4311T						PASS	.	T		7,3797		0,7,1895	99.0	95.0	96.0		4311	-1.0	0.7	1		96	0,8222		0,0,4111	no	coding-synonymous	SPTA1	NM_003126.2		0,7,6006	AA,AG,GG		0.0,0.184,0.0582		1437/2420	158614070	7,12019	1902	4111	6013	SO:0001819	synonymous_variant	6708	exon30			CAAATCGTCCCGT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4311C>T	1.37:g.158614070G>A		Somatic	186	0	0		WXS	Illumina HiSeq	Phase_I	145	17	0.117241	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	CCDS41423.1																																																																																			G|1.000;A|0.000	0.000	strong		0.403	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SLC32A1	140679	hgsc.bcm.edu	37	20	37356863	37356863	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr20:37356863G>A	ENST00000217420.1	+	2	1422	c.1159G>A	c.(1159-1161)Gtg>Atg	p.V387M		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	387					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CATCTTTCTGGTGGCCAAGGC	0.622																																					p.V387M		Atlas-SNP	.											.	SLC32A1	81	.	0			c.G1159A						PASS	.						79.0	77.0	78.0					20																	37356863		2203	4300	6503	SO:0001583	missense	140679	exon2			TTTCTGGTGGCCA	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.1159G>A	20.37:g.37356863G>A	ENSP00000217420:p.Val387Met	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	101	27	0.267327	NM_080552	Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402399	0.62288	.	.	ENSG00000101438	ENST00000217420	T	0.02837	4.14	4.45	4.45	0.53987	.	0.000000	0.85682	D	0.000000	T	0.13500	0.0327	M	0.71206	2.165	0.80722	D	1	D	0.67145	0.996	D	0.72982	0.979	T	0.00398	-1.1764	10	0.66056	D	0.02	-20.6777	14.9208	0.70835	0.0:0.0:1.0:0.0	.	387	Q9H598	VIAAT_HUMAN	M	387	ENSP00000217420:V387M	ENSP00000217420:V387M	V	+	1	0	SLC32A1	36790277	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.788000	0.99064	2.202000	0.70862	0.563000	0.77884	GTG	.	.	none		0.622	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
EDRF1	26098	hgsc.bcm.edu	37	10	127429569	127429569	+	Splice_Site	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr10:127429569G>A	ENST00000356792.4	+	17	2402		c.e17-1		C10orf137_ENST00000337623.3_Splice_Site	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN							regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TTTCTAAACAGATACTTATTG	0.378																																					.		Atlas-SNP	.											.	C10orf137	153	.	0			c.2171-1G>A						PASS	.						123.0	125.0	124.0					10																	127429569		2203	4300	6503	SO:0001630	splice_region_variant	26098	exon17			TAAACAGATACTT																												ENST00000356792.4:c.2171-1G>A	10.37:g.127429569G>A		Somatic	254	0	0		WXS	Illumina HiSeq	Phase_I	209	50	0.239234	NM_001202438	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Splice_Site	SNP	ENST00000356792.4	37	CCDS55733.1	.	.	.	.	.	.	.	.	.	.	G	12.85	2.062592	0.36373	.	.	ENSG00000107938	ENST00000356792;ENST00000392732;ENST00000337623;ENST00000368813	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4119	0.94677	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C10orf137	127419559	1.000000	0.71417	0.954000	0.39281	0.103000	0.19146	9.476000	0.97823	2.596000	0.87737	0.650000	0.86243	.	.	.	none		0.378	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1		Intron
SLC4A1AP	22950	hgsc.bcm.edu	37	2	27886844	27886844	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:27886844G>A	ENST00000326019.6	+	1	507	c.225G>A	c.(223-225)aaG>aaA	p.K75K	SUPT7L_ENST00000404798.2_5'Flank|SUPT7L_ENST00000405491.1_5'Flank|SUPT7L_ENST00000337768.5_5'Flank|SUPT7L_ENST00000464789.2_5'Flank|SUPT7L_ENST00000406540.1_5'Flank	NM_018158.2	NP_060628.2	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger), member 1, adaptor protein	75						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.155)					GGGACTTCAAGAAGCCAGCTC	0.597																																					p.K75K		Atlas-SNP	.											.	SLC4A1AP	63	.	0			c.G225A						PASS	.						60.0	63.0	62.0					2																	27886844		2203	4300	6503	SO:0001819	synonymous_variant	22950	exon1			CTTCAAGAAGCCA		CCDS33166.1	2p23.3	2010-03-11	2001-11-28		ENSG00000163798	ENSG00000163798			13813	protein-coding gene	gene with protein product	"""lung cancer oncogene 3"""	602655	"""solute carrier family 4 (anion exchanger), member 1, adapter protein"""			9422766	Standard	NM_018158		Approved	kanadaptin, HLC3	uc002rlk.4	Q9BWU0	OTTHUMG00000151944	ENST00000326019.6:c.225G>A	2.37:g.27886844G>A		Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	62	19	0.306452	NM_018158	A6NJ39|Q4KMT1|Q4KMX0|Q7Z5Q9|Q9NVN2	Silent	SNP	ENST00000326019.6	37	CCDS33166.1																																																																																			.	.	none		0.597	SLC4A1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324550.1	NM_018158	
HKDC1	80201	hgsc.bcm.edu	37	10	70998835	70998835	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr10:70998835G>A	ENST00000354624.5	+	5	666	c.533G>A	c.(532-534)cGa>cAa	p.R178Q	HKDC1_ENST00000395086.2_Missense_Mutation_p.R178Q	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	178	Hexokinase type-1 1.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						TTTAAGGCACGAGGAGTTCAG	0.522																																					p.R178Q		Atlas-SNP	.											HKDC1,NS,carcinoma,+1,2	HKDC1	98	2	0			c.G533A						PASS	.						88.0	78.0	81.0					10																	70998835		2203	4300	6503	SO:0001583	missense	80201	exon5			AGGCACGAGGAGT		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.533G>A	10.37:g.70998835G>A	ENSP00000346643:p.Arg178Gln	Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	88	28	0.318182	NM_025130	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	37	CCDS7288.1	.	.	.	.	.	.	.	.	.	.	G	13.46	2.242803	0.39598	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	D;D	0.98968	-5.28;-5.28	4.92	4.92	0.64577	Hexokinase, N-terminal (1);	0.060279	0.64402	D	0.000004	D	0.96476	0.8850	N	0.25789	0.76	0.19300	N	0.999972	B	0.14805	0.011	B	0.14023	0.01	D	0.90277	0.4312	10	0.72032	D	0.01	-15.4141	18.6753	0.91526	0.0:0.0:1.0:0.0	.	178	Q2TB90	HKDC1_HUMAN	Q	178	ENSP00000346643:R178Q;ENSP00000378521:R178Q	ENSP00000346643:R178Q	R	+	2	0	HKDC1	70668841	0.844000	0.29557	0.186000	0.23195	0.199000	0.23934	4.461000	0.60115	2.708000	0.92522	0.655000	0.94253	CGA	.	.	none		0.522	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130	
ZBTB40	9923	hgsc.bcm.edu	37	1	22838349	22838349	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:22838349C>T	ENST00000375647.4	+	11	2390	c.2183C>T	c.(2182-2184)tCc>tTc	p.S728F	ZBTB40_ENST00000404138.1_Missense_Mutation_p.S728F|ZBTB40_ENST00000374651.4_Missense_Mutation_p.S616F	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	728					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		GCTTCAGCCTCCCCAGACCCT	0.542																																					p.S728F		Atlas-SNP	.											.	ZBTB40	87	.	0			c.C2183T						PASS	.						62.0	57.0	59.0					1																	22838349		2203	4300	6503	SO:0001583	missense	9923	exon12			CAGCCTCCCCAGA	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.2183C>T	1.37:g.22838349C>T	ENSP00000364798:p.Ser728Phe	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	104	33	0.317308	NM_001083621	O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	ENST00000375647.4	37	CCDS224.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.591720	0.46214	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000374651	T;T;T	0.76060	-0.99;-0.99;-0.99	5.73	5.73	0.89815	.	0.117441	0.38720	N	0.001590	D	0.84488	0.5483	M	0.65677	2.01	0.35211	D	0.775199	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.96	D	0.88729	0.3235	10	0.66056	D	0.02	-19.9926	15.4065	0.74884	0.0:1.0:0.0:0.0	.	616;728	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	F	728;728;616	ENSP00000384527:S728F;ENSP00000364798:S728F;ENSP00000363782:S616F	ENSP00000363782:S616F	S	+	2	0	ZBTB40	22710936	0.984000	0.35163	1.000000	0.80357	0.562000	0.35680	1.157000	0.31724	2.693000	0.91896	0.655000	0.94253	TCC	.	.	none		0.542	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870	
PABPC3	5042	hgsc.bcm.edu	37	13	25672209	25672209	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr13:25672209G>A	ENST00000281589.3	+	1	1910	c.1873G>A	c.(1873-1875)Gct>Act	p.A625T		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	625					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AGTTAACAGTGCTACCGGTGT	0.428																																					p.A625T		Atlas-SNP	.											.	PABPC3	129	.	0			c.G1873A						PASS	.						99.0	106.0	104.0					13																	25672209		2203	4300	6503	SO:0001583	missense	5042	exon1			AACAGTGCTACCG	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1873G>A	13.37:g.25672209G>A	ENSP00000281589:p.Ala625Thr	Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	48	21	0.4375	NM_030979	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	G	9.328	1.059714	0.19987	.	.	ENSG00000151846	ENST00000281589	T	0.42131	0.98	0.875	0.875	0.19130	Polyadenylate-binding protein/Hyperplastic disc protein (1);	0.289642	0.23338	U	0.049266	T	0.19565	0.0470	N	0.08118	0	0.25795	N	0.984574	B	0.02656	0.0	B	0.04013	0.001	T	0.15983	-1.0418	10	0.42905	T	0.14	.	7.5489	0.27783	0.0:0.0:1.0:0.0	.	625	Q9H361	PABP3_HUMAN	T	625	ENSP00000281589:A625T	ENSP00000281589:A625T	A	+	1	0	PABPC3	24570209	0.671000	0.27521	0.772000	0.31596	0.202000	0.24057	2.323000	0.43823	0.759000	0.33084	0.313000	0.20887	GCT	.	.	none		0.428	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
NEBL	10529	hgsc.bcm.edu	37	10	21309114	21309114	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr10:21309114A>G	ENST00000417816.2	-	3	534	c.181T>C	c.(181-183)Tcc>Ccc	p.S61P	NEBL_ENST00000377159.4_Missense_Mutation_p.S27P	NM_001173484.1|NM_213569.2	NP_001166955.1|NP_998734.1	O76041	NEBL_HUMAN	nebulette	106					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GTGGTGAAGGACTGCTTCGGG	0.413																																					p.S61P		Atlas-SNP	.											.	NEBL	199	.	0			c.T181C						PASS	.						102.0	96.0	98.0					10																	21309114		2203	4300	6503	SO:0001583	missense	10529	exon3			TGAAGGACTGCTT	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000417816.2:c.181T>C	10.37:g.21309114A>G	ENSP00000393896:p.Ser61Pro	Somatic	180	0	0		WXS	Illumina HiSeq	Phase_I	171	48	0.280702	NM_001173484	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	ENST00000417816.2	37	CCDS7133.1	.	.	.	.	.	.	.	.	.	.	a	14.03	2.414610	0.42817	.	.	ENSG00000078114	ENST00000417816;ENST00000377159	T;T	0.36157	1.27;1.73	5.24	4.11	0.48088	.	.	.	.	.	T	0.35828	0.0945	M	0.76838	2.35	0.29217	N	0.874206	P	0.36990	0.577	B	0.26310	0.068	T	0.37979	-0.9682	9	0.59425	D	0.04	.	10.3484	0.43920	0.9204:0.0:0.0796:0.0	.	61	Q70I54	.	P	61;27	ENSP00000393896:S61P;ENSP00000366364:S27P	ENSP00000366364:S27P	S	-	1	0	NEBL	21349120	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.287000	0.59001	0.932000	0.37266	0.529000	0.55759	TCC	.	.	none		0.413	NEBL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047112.1	NM_006393	
HOXC13	3229	hgsc.bcm.edu	37	12	54339026	54339026	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:54339026C>T	ENST00000243056.3	+	2	1135	c.979C>T	c.(979-981)Ctc>Ttc	p.L327F		NM_017410.2	NP_059106.2	P31276	HXC13_HUMAN	homeobox C13	327					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|hair follicle development (GO:0001942)|nail development (GO:0035878)|tongue morphogenesis (GO:0043587)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(1)|skin(1)	3						AGCGCCTCATCTCCACTCCAC	0.577			T	NUP98	AML																																p.L327F		Atlas-SNP	.		Dom	yes		12	12q13.3	3229	homeo box C13		L	.	HOXC13	24	.	0			c.C979T						PASS	.						70.0	71.0	71.0					12																	54339026		2203	4300	6503	SO:0001583	missense	3229	exon2			CCTCATCTCCACT		CCDS8865.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123364	ENSG00000123364		"""Homeoboxes / ANTP class : HOXL subclass"""	5125	protein-coding gene	gene with protein product		142976	"""homeo box C13"""	HOX3, HOX3G		1973146, 1358459	Standard	NM_017410		Approved		uc001sei.3	P31276	OTTHUMG00000160008	ENST00000243056.3:c.979C>T	12.37:g.54339026C>T	ENSP00000243056:p.Leu327Phe	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	42	13	0.309524	NM_017410	Q5BL02|Q96J32|Q9NR24|Q9NYD5	Missense_Mutation	SNP	ENST00000243056.3	37	CCDS8865.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940705	0.52972	.	.	ENSG00000123364	ENST00000243056	D	0.93712	-3.27	4.57	3.68	0.42216	Homeodomain-like (1);	0.067197	0.56097	D	0.000026	D	0.90184	0.6932	L	0.54863	1.705	0.44694	D	0.997683	B	0.29432	0.244	B	0.26969	0.075	D	0.88725	0.3232	10	0.46703	T	0.11	.	12.2927	0.54827	0.0:0.9148:0.0:0.0851	.	327	P31276	HXC13_HUMAN	F	327	ENSP00000243056:L327F	ENSP00000243056:L327F	L	+	1	0	HOXC13	52625293	.	.	0.997000	0.53966	0.984000	0.73092	.	.	1.530000	0.49136	0.655000	0.94253	CTC	.	.	none		0.577	HOXC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358865.2		
C11orf87	399947	hgsc.bcm.edu	37	11	109294503	109294503	+	Silent	SNP	G	G	A	rs558968039		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr11:109294503G>A	ENST00000327419.6	+	2	547	c.144G>A	c.(142-144)acG>acA	p.T48T	RP11-708B6.2_ENST00000532992.1_RNA|RP11-708B6.2_ENST00000532929.1_RNA	NM_207645.3	NP_997528.2	Q6NUJ2	CK087_HUMAN	chromosome 11 open reading frame 87	48						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17						CCTGCATCACGCAGGTGGGAC	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		17890	0.001		0.0	False		,,,				2504	0.0				p.T48T		Atlas-SNP	.											C11orf87,NS,carcinoma,+1,1	C11orf87	37	1	0			c.G144A						scavenged	.						128.0	101.0	110.0					11																	109294503		2201	4298	6499	SO:0001819	synonymous_variant	399947	exon2			CATCACGCAGGTG	AB096240, BC035798	CCDS31672.1	11q22.3	2013-12-13	2013-12-13	2013-12-13	ENSG00000185742	ENSG00000185742			33788	protein-coding gene	gene with protein product	"""neuronal integral membrane protein 1"""					12477932	Standard	NM_207645		Approved	LOH11CR1A, LOC399947, NEURIM1	uc010rwb.2	Q6NUJ2		ENST00000327419.6:c.144G>A	11.37:g.109294503G>A		Somatic	219	1	0.00456621		WXS	Illumina HiSeq	Phase_I	139	23	0.165468	NM_207645	B4E169	Silent	SNP	ENST00000327419.6	37	CCDS31672.1																																																																																			.	.	none		0.637	C11orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390403.1	NM_207645	
ZNF501	115560	hgsc.bcm.edu	37	3	44776170	44776170	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:44776170C>T	ENST00000396048.2	+	3	694	c.257C>T	c.(256-258)gCc>gTc	p.A86V	KIAA1143_ENST00000484437.1_5'Flank	NM_001258280.1|NM_145044.3	NP_001245209.1|NP_659481.2	Q96CX3	ZN501_HUMAN	zinc finger protein 501	86					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(4)|lung(3)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00843)|KIRC - Kidney renal clear cell carcinoma(197;0.0463)|Kidney(197;0.0579)		TGTGAGAAAGCCTTTCAAACA	0.368																																					p.A86V		Atlas-SNP	.											.	ZNF501	27	.	0			c.C257T						PASS	.						81.0	94.0	90.0					3																	44776170		2194	4297	6491	SO:0001583	missense	115560	exon3			AGAAAGCCTTTCA	BC013762	CCDS2720.2	3p21.32	2013-01-08			ENSG00000186446	ENSG00000186446		"""Zinc fingers, C2H2-type"""	23717	protein-coding gene	gene with protein product			"""zinc finger protein 52"""	ZNF52		1505991	Standard	NM_145044		Approved	MGC21738	uc003cnu.2	Q96CX3	OTTHUMG00000133048	ENST00000396048.2:c.257C>T	3.37:g.44776170C>T	ENSP00000379363:p.Ala86Val	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	94	16	0.170213	NM_001258280	B4DLY7|Q96NU9	Missense_Mutation	SNP	ENST00000396048.2	37	CCDS2720.2	.	.	.	.	.	.	.	.	.	.	C	17.36	3.370854	0.61624	.	.	ENSG00000186446	ENST00000396048;ENST00000332489	T	0.01043	5.41	3.07	3.07	0.35406	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02418	0.0074	N	0.17312	0.475	0.26468	N	0.975336	D;D	0.71674	0.998;0.997	D;D	0.68483	0.948;0.958	T	0.55036	-0.8203	9	0.62326	D	0.03	.	10.2687	0.43470	0.0:0.7964:0.2036:0.0	.	86;86	Q96CX3-2;Q96CX3	.;ZN501_HUMAN	V	86	ENSP00000379363:A86V	ENSP00000330388:A86V	A	+	2	0	ZNF501	44751174	0.000000	0.05858	1.000000	0.80357	0.990000	0.78478	-0.075000	0.11431	1.717000	0.51406	0.563000	0.77884	GCC	.	.	none		0.368	ZNF501-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256654.4	NM_145044	
C18orf54	162681	hgsc.bcm.edu	37	18	51904570	51904570	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr18:51904570G>C	ENST00000300091.5	+	8	1405	c.1073G>C	c.(1072-1074)aGa>aCa	p.R358T	C18orf54_ENST00000382911.4_Missense_Mutation_p.R519T|C18orf54_ENST00000578138.1_Missense_Mutation_p.R137T|C18orf54_ENST00000582188.1_3'UTR	NM_173529.4	NP_775800.3	Q8IYD9	LAS2_HUMAN	chromosome 18 open reading frame 54	358						extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)		TCTCGCCTGAGAGACCTGGTT	0.378																																					p.R358T		Atlas-SNP	.											.	C18orf54	40	.	0			c.G1073C						PASS	.						76.0	70.0	72.0					18																	51904570		2203	4300	6503	SO:0001583	missense	162681	exon8			GCCTGAGAGACCT	AK126503	CCDS11956.1, CCDS74223.1	18q21	2012-10-24			ENSG00000166845	ENSG00000166845			13796	protein-coding gene	gene with protein product	"""lung adenoma susceptibility protein 2"""	613258					Standard	XM_005258201		Approved	MGC33382, LAS2	uc031rij.1	Q8IYD9	OTTHUMG00000132703	ENST00000300091.5:c.1073G>C	18.37:g.51904570G>C	ENSP00000300091:p.Arg358Thr	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	172	40	0.232558	NM_173529	I7HFJ6|Q6MZU3|Q6ZTL6	Missense_Mutation	SNP	ENST00000300091.5	37	CCDS11956.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.908213	0.33721	.	.	ENSG00000166845	ENST00000300091;ENST00000382911	T;T	0.38077	1.19;1.16	5.55	5.55	0.83447	.	0.064020	0.64402	D	0.000010	T	0.54854	0.1884	M	0.72118	2.19	0.26124	N	0.980503	D;D	0.89917	0.999;1.0	D;D	0.71870	0.973;0.975	T	0.54146	-0.8337	10	0.72032	D	0.01	0.02	8.9048	0.35517	0.1603:0.0:0.8397:0.0	.	519;358	Q8IYD9-2;Q8IYD9	.;CR054_HUMAN	T	358;519	ENSP00000300091:R358T;ENSP00000372368:R519T	ENSP00000300091:R358T	R	+	2	0	C18orf54	50158568	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.933000	0.56545	2.755000	0.94549	0.655000	0.94253	AGA	.	.	none		0.378	C18orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256001.1	NM_173529	
TRIM25	7706	hgsc.bcm.edu	37	17	54969281	54969281	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr17:54969281A>T	ENST00000316881.4	-	9	1722	c.1673T>A	c.(1672-1674)aTc>aAc	p.I558N	TRIM25_ENST00000573108.1_5'Flank|TRIM25_ENST00000537230.1_Missense_Mutation_p.I558N|MIR3614_ENST00000581261.1_RNA|RP11-670E13.5_ENST00000574826.1_RNA	NM_005082.4	NP_005073.2	Q14258	TRI25_HUMAN	tripartite motif containing 25	558	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)|response to estrogen (GO:0043627)|response to vitamin D (GO:0033280)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Breast(9;6.15e-08)					CCAGGCAGAGATCTTGGTGTT	0.602																																					p.I558N		Atlas-SNP	.											.	TRIM25	52	.	0			c.T1673A						PASS	.						86.0	76.0	79.0					17																	54969281		2203	4300	6503	SO:0001583	missense	7706	exon9			GCAGAGATCTTGG	D21205	CCDS11591.1	17q23.1	2013-01-09	2011-01-25	2004-03-30				"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12932	protein-coding gene	gene with protein product		600453	"""zinc finger protein 147 (estrogen-responsive finger protein)"", ""tripartite motif-containing 25"""	ZNF147		7789997	Standard	NM_005082		Approved	EFP, RNF147	uc002iut.3	Q14258		ENST00000316881.4:c.1673T>A	17.37:g.54969281A>T	ENSP00000323889:p.Ile558Asn	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	82	29	0.353659	NM_005082		Missense_Mutation	SNP	ENST00000316881.4	37	CCDS11591.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.296090	0.81025	.	.	ENSG00000121060	ENST00000316881;ENST00000537230	T;T	0.70399	-0.48;-0.48	4.93	4.93	0.64822	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.102449	0.42821	D	0.000652	T	0.77980	0.4212	L	0.48642	1.525	0.38408	D	0.945854	D	0.67145	0.996	D	0.65323	0.934	T	0.80790	-0.1225	10	0.51188	T	0.08	.	14.5814	0.68295	1.0:0.0:0.0:0.0	.	558	Q14258	TRI25_HUMAN	N	558	ENSP00000323889:I558N;ENSP00000445961:I558N	ENSP00000323889:I558N	I	-	2	0	TRIM25	52324280	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.136000	0.77285	1.849000	0.53698	0.418000	0.28097	ATC	.	.	none		0.602	TRIM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440609.1	NM_005082	
ZNF217	7764	hgsc.bcm.edu	37	20	52198236	52198236	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr20:52198236C>T	ENST00000371471.2	-	2	1555	c.1130G>A	c.(1129-1131)tGc>tAc	p.C377Y	ZNF217_ENST00000302342.3_Missense_Mutation_p.C377Y|ZNF217_ENST00000540425.1_5'Flank			O75362	ZN217_HUMAN	zinc finger protein 217	377					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			GCACTCGGAGCAGTGAGTGGG	0.612																																					p.C377Y		Atlas-SNP	.											.	ZNF217	227	.	0			c.G1130A						PASS	.						96.0	99.0	98.0					20																	52198236		2203	4300	6503	SO:0001583	missense	7764	exon1			TCGGAGCAGTGAG	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.1130G>A	20.37:g.52198236C>T	ENSP00000360526:p.Cys377Tyr	Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	132	50	0.378788	NM_006526	E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	37	CCDS13443.1	.	.	.	.	.	.	.	.	.	.	C	18.74	3.689039	0.68271	.	.	ENSG00000171940	ENST00000371471;ENST00000302342	T;T	0.58358	0.34;0.34	5.7	5.7	0.88788	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.75155	0.3811	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77308	-0.2636	10	0.87932	D	0	-29.0809	19.4277	0.94751	0.0:1.0:0.0:0.0	.	377	O75362	ZN217_HUMAN	Y	377	ENSP00000360526:C377Y;ENSP00000304308:C377Y	ENSP00000304308:C377Y	C	-	2	0	ZNF217	51631643	1.000000	0.71417	0.591000	0.28745	0.413000	0.31143	7.387000	0.79785	2.686000	0.91538	0.591000	0.81541	TGC	.	.	none		0.612	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526	
RPL7	6129	hgsc.bcm.edu	37	8	74204061	74204061	+	Silent	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr8:74204061G>C	ENST00000352983.2	-	4	660	c.375C>G	c.(373-375)ctC>ctG	p.L125L	RPL7_ENST00000396465.1_Silent_p.L85L|RPL7_ENST00000487500.1_5'Flank|RPL7_ENST00000396467.1_Silent_p.L85L|RPL7_ENST00000396466.1_Silent_p.L85L|RDH10_ENST00000240285.5_5'Flank			P18124	RL7_HUMAN	ribosomal protein L7	125					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|kidney(1)|large_intestine(2)|lung(1)	5	Breast(64;0.0954)		Epithelial(68;0.0193)|all cancers(69;0.0766)|BRCA - Breast invasive adenocarcinoma(89;0.134)			AAGCCTTGTTGAGCTTCACAA	0.413																																					p.L125L		Atlas-SNP	.											.	RPL7	20	.	0			c.C375G						PASS	.						91.0	90.0	90.0					8																	74204061		2203	4297	6500	SO:0001819	synonymous_variant	6129	exon4			CTTGTTGAGCTTC	L16557	CCDS6212.1	8q13.3	2011-04-06			ENSG00000147604	ENSG00000147604		"""L ribosomal proteins"""	10363	protein-coding gene	gene with protein product		604166				8360149, 8441630	Standard	XM_006716463		Approved	humL7-1, L7	uc003xzg.3	P18124	OTTHUMG00000134312	ENST00000352983.2:c.375C>G	8.37:g.74204061G>C		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	97	21	0.216495	NM_000971	A8K504|Q15289|Q3KQU0|Q5I0X1|Q6IBM9	Silent	SNP	ENST00000352983.2	37	CCDS6212.1																																																																																			.	.	none		0.413	RPL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259287.1	NM_000971	
DNAJC7	7266	hgsc.bcm.edu	37	17	40128785	40128785	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr17:40128785G>C	ENST00000457167.4	-	14	1687	c.1451C>G	c.(1450-1452)tCt>tGt	p.S484C	DNAJC7_ENST00000426588.3_Missense_Mutation_p.S428C|CNP_ENST00000393892.3_3'UTR|DNAJC7_ENST00000316603.7_Missense_Mutation_p.S428C	NM_003315.3	NP_003306.3	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7	484					chaperone cofactor-dependent protein refolding (GO:0070389)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				CCCTGGACCAGATGCTGAAAG	0.408																																					p.S484C	Colon(63;618 1117 8600 10857 19751)	Atlas-SNP	.											.	DNAJC7	51	.	0			c.C1451G						PASS	.						129.0	122.0	124.0					17																	40128785		1835	4091	5926	SO:0001583	missense	7266	exon14			GGACCAGATGCTG	U46571	CCDS45677.1, CCDS45678.1	17q11.2	2013-01-10				ENSG00000168259		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	12392	protein-coding gene	gene with protein product		601964		TTC2		8836031, 11147971	Standard	NR_029431		Approved	TPR2	uc002hyo.3	Q99615		ENST00000457167.4:c.1451C>G	17.37:g.40128785G>C	ENSP00000406463:p.Ser484Cys	Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	58	21	0.362069	NM_003315	Q7Z784	Missense_Mutation	SNP	ENST00000457167.4	37	CCDS45677.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941364	0.92526	.	.	ENSG00000168259	ENST00000457167;ENST00000426588;ENST00000316603	T;T;T	0.73363	-0.74;-0.74;-0.74	5.92	5.92	0.95590	Heat shock protein DnaJ, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.72028	0.3410	N	0.08118	0	0.80722	D	1	D;D	0.67145	0.985;0.996	P;P	0.56700	0.628;0.804	T	0.78031	-0.2363	10	0.72032	D	0.01	-12.1202	20.3248	0.98698	0.0:0.0:1.0:0.0	.	428;484	Q7Z784;Q99615	.;DNJC7_HUMAN	C	484;428;428	ENSP00000406463:S484C;ENSP00000394327:S428C;ENSP00000313311:S428C	ENSP00000313311:S428C	S	-	2	0	DNAJC7	37382311	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.447000	0.97595	2.818000	0.97014	0.655000	0.94253	TCT	.	.	none		0.408	DNAJC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453366.2		
IQCC	55721	hgsc.bcm.edu	37	1	32672879	32672879	+	Silent	SNP	G	G	A	rs201910762		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:32672879G>A	ENST00000291358.6	+	5	618	c.597G>A	c.(595-597)gcG>gcA	p.A199A	IQCC_ENST00000537469.1_Silent_p.A279A|RP4-622L5.7_ENST00000373604.4_RNA|RP4-622L5.7_ENST00000421616.1_RNA|DCDC2B_ENST00000409358.1_5'Flank	NM_018134.2	NP_060604.2	Q4KMZ1	IQCC_HUMAN	IQ motif containing C	199										endometrium(4)|large_intestine(1)|lung(3)|ovary(4)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CCCCAGAGGCGGGCCCGATCA	0.567													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18496	0.0		0.0	False		,,,				2504	0.0				p.A279A		Atlas-SNP	.											.	IQCC	46	.	0			c.G837A						PASS	.						68.0	76.0	74.0					1																	32672879		2203	4300	6503	SO:0001819	synonymous_variant	55721	exon5			AGAGGCGGGCCCG	AL049795	CCDS355.1, CCDS53293.1	1p36.11-p34.2	2008-02-05			ENSG00000160051	ENSG00000160051			25545	protein-coding gene	gene with protein product							Standard	NM_018134		Approved	FLJ10547	uc001bum.2	Q4KMZ1	OTTHUMG00000005739	ENST00000291358.6:c.597G>A	1.37:g.32672879G>A		Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	76	30	0.394737	NM_001160042	F5H7T8|Q4KMS3|Q4KMZ5|Q53FL2|Q5TFJ8|Q9NVS3	Silent	SNP	ENST00000291358.6	37	CCDS355.1																																																																																			G|1.000;A|0.000	0.000	strong		0.567	IQCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015731.3	NM_018134	
TPR	7175	hgsc.bcm.edu	37	1	186313566	186313566	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:186313566C>T	ENST00000367478.4	-	25	3654	c.3358G>A	c.(3358-3360)Gca>Aca	p.A1120T		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1120					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TGTGATTCTGCTTTCTGTGTT	0.403			T	NTRK1	papillary thyroid																																p.A1120T		Atlas-SNP	.		Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR	441	.	0			c.G3358A						PASS	.						274.0	250.0	257.0					1																	186313566		1924	4146	6070	SO:0001583	missense	7175	exon25			ATTCTGCTTTCTG	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.3358G>A	1.37:g.186313566C>T	ENSP00000356448:p.Ala1120Thr	Somatic	196	0	0		WXS	Illumina HiSeq	Phase_I	152	20	0.131579	NM_003292	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.274866	0.80580	.	.	ENSG00000047410	ENST00000367478	T	0.37235	1.21	5.22	5.22	0.72569	Tetratricopeptide, MLP1/MLP2-like (1);	0.109197	0.64402	D	0.000010	T	0.37571	0.1008	L	0.45470	1.425	0.49687	D	0.99981	B	0.30326	0.276	B	0.32393	0.145	T	0.20874	-1.0262	10	0.49607	T	0.09	.	18.7751	0.91908	0.0:1.0:0.0:0.0	.	1120	P12270	TPR_HUMAN	T	1120	ENSP00000356448:A1120T	ENSP00000356448:A1120T	A	-	1	0	TPR	184580189	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.108000	0.57817	2.447000	0.82792	0.561000	0.74099	GCA	.	.	none		0.403	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
CTTNBP2	83992	hgsc.bcm.edu	37	7	117400606	117400606	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr7:117400606T>G	ENST00000160373.3	-	10	3146	c.3055A>C	c.(3055-3057)Aat>Cat	p.N1019H		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1019					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TGGAAATGATTTGTCAGAGCT	0.418																																					p.N1019H		Atlas-SNP	.											.	CTTNBP2	200	.	0			c.A3055C						PASS	.						235.0	213.0	220.0					7																	117400606		2203	4300	6503	SO:0001583	missense	83992	exon10			AATGATTTGTCAG		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.3055A>C	7.37:g.117400606T>G	ENSP00000160373:p.Asn1019His	Somatic	313	0	0		WXS	Illumina HiSeq	Phase_I	191	74	0.387435	NM_033427	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	CCDS5774.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	20.2|20.2|20.2	3.957458|3.957458|3.957458	0.73902|0.73902|0.73902	.|.|.	.|.|.	ENSG00000077063|ENSG00000077063|ENSG00000077063	ENST00000446636|ENST00000160373|ENST00000435233;ENST00000416239	.|T|.	.|0.68479|.	.|-0.33|.	5.72|5.72|5.72	4.56|4.56|4.56	0.56223|0.56223|0.56223	.|.|.	.|0.312530|.	.|0.37906|.	.|N|.	.|0.001891|.	T|T|T	0.74831|0.74831|0.74831	0.3768|0.3768|0.3768	M|M|M	0.82630|0.82630|0.82630	2.6|2.6|2.6	0.37453|0.37453|0.37453	D|D|D	0.9149|0.9149|0.9149	.|D|.	.|0.53462|.	.|0.96|.	.|P|.	.|0.57204|.	.|0.815|.	T|T|T	0.79451|0.79451|0.79451	-0.1798|-0.1798|-0.1798	5|10|5	.|0.72032|.	.|D|.	.|0.01|.	-0.6073|-0.6073|-0.6073	11.8043|11.8043|11.8043	0.52145|0.52145|0.52145	0.0:0.0687:0.0:0.9313|0.0:0.0687:0.0:0.9313|0.0:0.0687:0.0:0.9313	.|.|.	.|1019|.	.|Q8WZ74|.	.|CTTB2_HUMAN|.	T|H|H	506|1019|32;14	.|ENSP00000160373:N1019H|.	.|ENSP00000160373:N1019H|.	K|N|Q	-|-|-	2|1|3	0|0|2	CTTNBP2|CTTNBP2|CTTNBP2	117187842|117187842|117187842	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.995000|0.995000|0.995000	0.86356|0.86356|0.86356	2.678000|2.678000|2.678000	0.46900|0.46900|0.46900	1.096000|1.096000|1.096000	0.41439|0.41439|0.41439	0.528000|0.528000|0.528000	0.53228|0.53228|0.53228	AAA|AAT|CAA	.	.	none		0.418	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
MYT1L	23040	hgsc.bcm.edu	37	2	1926161	1926161	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:1926161G>C	ENST00000399161.2	-	10	2127	c.1380C>G	c.(1378-1380)gaC>gaG	p.D460E	MYT1L_ENST00000428368.2_Missense_Mutation_p.D460E	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	460					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		ACCTCATATTGTCCCTCCTCC	0.522																																					p.D460E		Atlas-SNP	.											.	MYT1L	241	.	0			c.C1380G						PASS	.						186.0	179.0	181.0					2																	1926161		1995	4157	6152	SO:0001583	missense	23040	exon10			CATATTGTCCCTC	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1380C>G	2.37:g.1926161G>C	ENSP00000382114:p.Asp460Glu	Somatic	268	0	0		WXS	Illumina HiSeq	Phase_I	203	58	0.285714	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	G	4.141	0.024540	0.08054	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.42900	0.96;0.97	5.91	-1.63	0.08345	.	0.204264	0.53938	N	0.000057	T	0.19446	0.0467	N	0.19112	0.55	0.28153	N	0.929329	B;B	0.15141	0.012;0.01	B;B	0.13407	0.006;0.009	T	0.07501	-1.0769	10	0.25106	T	0.35	-41.3752	3.7061	0.08401	0.4795:0.1027:0.3136:0.1041	.	460;460	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	E	460;408;460	ENSP00000382114:D460E;ENSP00000396103:D460E	ENSP00000295067:D408E	D	-	3	2	MYT1L	1905168	1.000000	0.71417	0.017000	0.16124	0.017000	0.09413	1.033000	0.30191	-0.339000	0.08401	0.655000	0.94253	GAC	.	.	none		0.522	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
CHEK2	11200	hgsc.bcm.edu	37	22	29130412	29130412	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr22:29130412G>A	ENST00000405598.1	-	3	489	c.298C>T	c.(298-300)Cag>Tag	p.Q100*	CHEK2_ENST00000404276.1_Nonsense_Mutation_p.Q100*|CHEK2_ENST00000382566.1_Nonsense_Mutation_p.Q100*|CHEK2_ENST00000348295.3_Nonsense_Mutation_p.Q100*|CHEK2_ENST00000403642.1_Nonsense_Mutation_p.Q100*|CHEK2_ENST00000382578.1_Nonsense_Mutation_p.Q100*|CHEK2_ENST00000544772.1_5'UTR|CHEK2_ENST00000328354.6_Nonsense_Mutation_p.Q100*|CHEK2_ENST00000382580.2_Nonsense_Mutation_p.Q100*|CHEK2_ENST00000382565.1_Nonsense_Mutation_p.Q100*|CHEK2_ENST00000402731.1_Nonsense_Mutation_p.Q100*			O96017	CHK2_HUMAN	checkpoint kinase 2	100					cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						AATCCATCCTGAAGGGCCCAT	0.473			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																													p.Q100X		Atlas-SNP	.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	.	CHEK2	438	.	0			c.C298T						PASS	.						42.0	47.0	45.0					22																	29130412		2203	4300	6503	SO:0001587	stop_gained	11200	exon2			CATCCTGAAGGGC	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.298C>T	22.37:g.29130412G>A	ENSP00000386087:p.Gln100*	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	78	20	0.25641	NM_145862	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Nonsense_Mutation	SNP	ENST00000405598.1	37	CCDS13843.1	.	.	.	.	.	.	.	.	.	.	G	32	5.126742	0.94429	.	.	ENSG00000183765	ENST00000348295;ENST00000382578;ENST00000382565;ENST00000382566;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000402731;ENST00000447421;ENST00000439200;ENST00000398017	.	.	.	5.42	4.35	0.52113	.	0.399138	0.30356	N	0.009817	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.7639	14.3897	0.66970	0.0:0.2582:0.7418:0.0	.	.	.	.	X	100;100;100;100;100;100;100;100;100;100;100;100;110	.	ENSP00000329178:Q100X	Q	-	1	0	CHEK2	27460412	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.141000	0.50593	2.704000	0.92352	0.655000	0.94253	CAG	.	.	none		0.473	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
KIAA0922	23240	hgsc.bcm.edu	37	4	154525477	154525477	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr4:154525477C>A	ENST00000409663.3	+	25	3362	c.3310C>A	c.(3310-3312)Ctc>Atc	p.L1104I	KIAA0922_ENST00000440693.1_Missense_Mutation_p.L1021I|KIAA0922_ENST00000409959.3_Missense_Mutation_p.L1105I	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1104						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				GGAACGGGAGCTCTGTCCACT	0.428																																					p.L1105I		Atlas-SNP	.											.	KIAA0922	214	.	0			c.C3313A						PASS	.						52.0	53.0	52.0					4																	154525477		2203	4300	6503	SO:0001583	missense	23240	exon25			CGGGAGCTCTGTC	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.3310C>A	4.37:g.154525477C>A	ENSP00000386574:p.Leu1104Ile	Somatic	215	0	0		WXS	Illumina HiSeq	Phase_I	204	55	0.269608	NM_001131007	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	37	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	C	9.236	1.037062	0.19669	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.20069	2.38;2.1;2.37;2.11	5.79	4.95	0.65309	.	0.405134	0.27886	N	0.017441	T	0.20088	0.0483	L	0.44542	1.39	0.23238	N	0.998066	P;B;B	0.44281	0.831;0.136;0.083	P;B;B	0.45610	0.487;0.071;0.032	T	0.09684	-1.0663	10	0.22706	T	0.39	-4.7104	7.468	0.27332	0.0:0.6985:0.1573:0.1442	.	1021;1105;1104	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	I	1104;1021;1105;882	ENSP00000386574:L1104I;ENSP00000409663:L1021I;ENSP00000386787:L1105I;ENSP00000240487:L882I	ENSP00000240487:L882I	L	+	1	0	KIAA0922	154744927	1.000000	0.71417	0.997000	0.53966	0.662000	0.39071	0.619000	0.24388	1.434000	0.47414	0.655000	0.94253	CTC	.	.	none		0.428	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196	
IFNA14	3448	hgsc.bcm.edu	37	9	21239704	21239704	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr9:21239704G>A	ENST00000380222.2	-	1	274	c.231C>T	c.(229-231)atC>atT	p.I77I		NM_002172.2	NP_002163.2	P01570	IFN14_HUMAN	interferon, alpha 14	77					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)	11				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		GGAGGACAGAGATGGCTTGAG	0.463																																					p.I77I		Atlas-SNP	.											.	IFNA14	29	.	0			c.C231T						PASS	.						115.0	113.0	114.0					9																	21239704		2203	4300	6503	SO:0001819	synonymous_variant	3448	exon1			GACAGAGATGGCT		CCDS6501.1	9p22	2010-08-24			ENSG00000228083	ENSG00000228083		"""Interferons"""	5420	protein-coding gene	gene with protein product		147579				1385305	Standard	NM_002172		Approved	LEIF2H, IFN-alphaH	uc010mis.3	P01570	OTTHUMG00000019665	ENST00000380222.2:c.231C>T	9.37:g.21239704G>A		Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	178	41	0.230337	NM_002172	Q5VZ56|Q7M4S1	Silent	SNP	ENST00000380222.2	37	CCDS6501.1																																																																																			.	.	none		0.463	IFNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051894.1	NM_002172	
EVC	2121	hgsc.bcm.edu	37	4	5811258	5811258	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr4:5811258A>C	ENST00000264956.6	+	19	2886	c.2702A>C	c.(2701-2703)aAc>aCc	p.N901T	EVC_ENST00000382674.2_Missense_Mutation_p.N901T	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	901					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				GCTGAACAGAACTTCATCTCC	0.537																																					p.N901T		Atlas-SNP	.											.	EVC	90	.	0			c.A2702C						PASS	.						93.0	81.0	85.0					4																	5811258		2203	4300	6503	SO:0001583	missense	2121	exon19			AACAGAACTTCAT	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.2702A>C	4.37:g.5811258A>C	ENSP00000264956:p.Asn901Thr	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	55	18	0.327273	NM_153717		Missense_Mutation	SNP	ENST00000264956.6	37	CCDS3383.1	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.766954	0.00645	.	.	ENSG00000072840	ENST00000264956;ENST00000382674	T;T	0.49432	0.78;0.78	4.78	-9.56	0.00566	.	0.707365	0.13224	N	0.404137	T	0.15825	0.0381	N	0.12182	0.205	0.18873	N	0.999988	B	0.02656	0.0	B	0.04013	0.001	T	0.13124	-1.0521	10	0.17832	T	0.49	.	1.2746	0.02027	0.3732:0.3068:0.1372:0.1828	.	901	P57679	EVC_HUMAN	T	901	ENSP00000264956:N901T;ENSP00000372120:N901T	ENSP00000264956:N901T	N	+	2	0	EVC	5862159	0.458000	0.25760	0.121000	0.21740	0.021000	0.10359	-0.389000	0.07342	-1.901000	0.01096	-1.151000	0.01829	AAC	.	.	none		0.537	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		
SGPL1	8879	hgsc.bcm.edu	37	10	72633215	72633215	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr10:72633215C>T	ENST00000373202.3	+	12	1367	c.1167C>T	c.(1165-1167)tcC>tcT	p.S389S		NM_003901.3	NP_003892.2	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	389					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|ceramide metabolic process (GO:0006672)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|fatty acid metabolic process (GO:0006631)|fibroblast migration (GO:0010761)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|regulation of multicellular organism growth (GO:0040014)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid catabolic process (GO:0030149)|sphingolipid metabolic process (GO:0006665)|vasculogenesis (GO:0001570)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)|sphinganine-1-phosphate aldolase activity (GO:0008117)			large_intestine(4)	4						TCTATGCTTCCCCAACCATCG	0.512																																					p.S389S	Colon(151;1054 2458 6676 40971)	Atlas-SNP	.											.	SGPL1	37	.	0			c.C1167T						PASS	.						151.0	130.0	137.0					10																	72633215		2203	4300	6503	SO:0001819	synonymous_variant	8879	exon12			TGCTTCCCCAACC	AI128825	CCDS31216.1	10q21	2008-08-01			ENSG00000166224	ENSG00000166224			10817	protein-coding gene	gene with protein product		603729				9464245, 17090686	Standard	NM_003901		Approved	SPL	uc001jrm.3	O95470	OTTHUMG00000018421	ENST00000373202.3:c.1167C>T	10.37:g.72633215C>T		Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	113	13	0.115044	NM_003901	B2RBD4|Q7Z732|Q9ULG8|Q9UN89	Silent	SNP	ENST00000373202.3	37	CCDS31216.1																																																																																			.	.	none		0.512	SGPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048533.1	NM_003901	
UCHL5	51377	hgsc.bcm.edu	37	1	193020942	193020942	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:193020942G>A	ENST00000367455.4	-	2	317	c.82C>T	c.(82-84)Cga>Tga	p.R28*	UCHL5_ENST00000367454.1_Nonsense_Mutation_p.R28*|UCHL5_ENST00000367452.4_5'UTR|UCHL5_ENST00000483156.1_5'UTR|UCHL5_ENST00000367448.1_Nonsense_Mutation_p.R28*|UCHL5_ENST00000367449.1_Nonsense_Mutation_p.R28*|UCHL5_ENST00000367451.4_Nonsense_Mutation_p.R28*|UCHL5_ENST00000530098.2_5'UTR	NM_001199261.1|NM_015984.3	NP_001186190.1|NP_057068.1	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5	28					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|forebrain morphogenesis (GO:0048853)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein deubiquitination (GO:0016579)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	endopeptidase inhibitor activity (GO:0004866)|omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|proteasome binding (GO:0070628)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(1)|lung(9)|ovary(1)	19						TGGGCTCCTCGGCAACCTGAA	0.264																																					p.R28X		Atlas-SNP	.											UCHL5,NS,carcinoma,+1,1	UCHL5	41	1	0			c.C82T						scavenged	.						42.0	47.0	45.0					1																	193020942		2191	4266	6457	SO:0001587	stop_gained	51377	exon2			CTCCTCGGCAACC		CCDS1378.1, CCDS55668.1, CCDS55669.1, CCDS55670.1	1q32	2011-07-06			ENSG00000116750	ENSG00000116750		"""INO80 complex subunits"""	19678	protein-coding gene	gene with protein product	"""INO80 complex subunit R"""	610667				10810093, 16027725	Standard	NM_015984		Approved	UCH37, CGI-70, INO80R	uc001gsm.3	Q9Y5K5	OTTHUMG00000035561	ENST00000367455.4:c.82C>T	1.37:g.193020942G>A	ENSP00000356425:p.Arg28*	Somatic	931	4	0.00429646		WXS	Illumina HiSeq	Phase_I	879	12	0.0136519	NM_001199261	Q5LJA6|Q5LJA7|Q8TBS4|Q96BJ9|Q9H1W5|Q9P0I3|Q9UQN2	Nonsense_Mutation	SNP	ENST00000367455.4	37	CCDS1378.1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769529	0.69992	.	.	ENSG00000116750	ENST00000367455;ENST00000367454;ENST00000367450;ENST00000367451;ENST00000367448;ENST00000367449;ENST00000391991;ENST00000421683;ENST00000417752	.	.	.	5.29	4.35	0.52113	.	0.057725	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-1.5603	12.7016	0.57035	0.0:0.0:0.7016:0.2984	.	.	.	.	X	28;28;40;28;28;28;18;19;159	.	ENSP00000356418:R28X	R	-	1	2	UCHL5	191287565	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.726000	0.61986	1.326000	0.45319	0.650000	0.86243	CGA	.	.	none		0.264	UCHL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086318.3	NM_015984	
ALX1	8092	hgsc.bcm.edu	37	12	85677538	85677538	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:85677538T>G	ENST00000316824.3	+	2	570	c.415T>G	c.(415-417)Ttc>Gtc	p.F139V		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	139					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		CCGAACCACCTTCACCAGTTT	0.488																																					p.F139V		Atlas-SNP	.											.	ALX1	61	.	0			c.T415G						PASS	.						133.0	129.0	130.0					12																	85677538		2203	4300	6503	SO:0001583	missense	8092	exon2			ACCACCTTCACCA	U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.415T>G	12.37:g.85677538T>G	ENSP00000315417:p.Phe139Val	Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	118	27	0.228814	NM_006982	Q546C8|Q96FH4	Missense_Mutation	SNP	ENST00000316824.3	37	CCDS9028.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.509296	0.85282	.	.	ENSG00000180318	ENST00000316824	D	0.97186	-4.28	5.59	5.59	0.84812	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99093	0.9688	H	0.98629	4.285	0.80722	D	1	D	0.64830	0.994	D	0.68039	0.955	D	0.99097	1.0842	10	0.87932	D	0	.	16.1145	0.81295	0.0:0.0:0.0:1.0	.	139	Q15699	ALX1_HUMAN	V	139	ENSP00000315417:F139V	ENSP00000315417:F139V	F	+	1	0	ALX1	84201669	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.260000	0.74910	0.529000	0.55759	TTC	.	.	none		0.488	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406072.1	NM_006982	
GRIN2C	2905	hgsc.bcm.edu	37	17	72846900	72846900	+	Missense_Mutation	SNP	G	G	A	rs539229067	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr17:72846900G>A	ENST00000293190.5	-	5	1266	c.1120C>T	c.(1120-1122)Cgc>Tgc	p.R374C	GRIN2C_ENST00000578159.1_5'Flank|GRIN2C_ENST00000347612.4_Missense_Mutation_p.R374C	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	374					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGCTCCCAGCGCCCCACCTGT	0.652													G|||	2	0.000399361	0.0015	0.0	5008	,	,		19088	0.0		0.0	False		,,,				2504	0.0				p.R374C		Atlas-SNP	.											.	GRIN2C	144	.	0			c.C1120T						PASS	.						41.0	26.0	31.0					17																	72846900		2203	4298	6501	SO:0001583	missense	2905	exon5			CCCAGCGCCCCAC		CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.1120C>T	17.37:g.72846900G>A	ENSP00000293190:p.Arg374Cys	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	58	18	0.310345	NM_000835	B2RTT1	Missense_Mutation	SNP	ENST00000293190.5	37	CCDS32724.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.745671	0.30955	.	.	ENSG00000161509	ENST00000293190;ENST00000347612	T	0.08634	3.07	4.3	4.3	0.51218	.	0.187992	0.44483	D	0.000450	T	0.15998	0.0385	L	0.48642	1.525	0.43054	D	0.994663	D;D	0.76494	0.989;0.999	P;P	0.55871	0.676;0.786	T	0.00357	-1.1792	10	0.66056	D	0.02	.	11.8257	0.52265	0.0:0.0:0.824:0.1759	.	408;374	Q8IW23;Q14957	.;NMDE3_HUMAN	C	374;408	ENSP00000293190:R374C	ENSP00000293190:R374C	R	-	1	0	GRIN2C	70358495	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	4.479000	0.60236	2.387000	0.81309	0.555000	0.69702	CGC	.	.	none		0.652	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103824.1		
HIST1H3D	8351	hgsc.bcm.edu	37	6	26197219	26197219	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr6:26197219C>G	ENST00000356476.2	-	1	259	c.260G>C	c.(259-261)aGc>aCc	p.S87T	HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000377831.5_Missense_Mutation_p.S87T			P68431	H31_HUMAN	histone cluster 1, H3d	87					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)	14		all_hematologic(11;0.196)				CACCGCCGAGCTCTGAAAACG	0.587																																					p.S87T	GBM(108;3816 4467)	Atlas-SNP	.											.	HIST1H3D	31	.	0			c.G260C						PASS	.						74.0	72.0	73.0					6																	26197219		2203	4300	6503	SO:0001583	missense	8351	exon2			GCCGAGCTCTGAA	Z80784	CCDS4590.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197409	ENSG00000197409		"""Histones / Replication-dependent"""	4767	protein-coding gene	gene with protein product		602811	"""H3 histone family, member B"", ""histone 1, H3d"""	H3FB		9119399, 12408966	Standard	NM_003530		Approved	H3/b	uc003ngv.4	P68431	OTTHUMG00000014433	ENST00000356476.2:c.260G>C	6.37:g.26197219C>G	ENSP00000366999:p.Ser87Thr	Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	132	21	0.159091	NM_003530	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000356476.2	37	CCDS4590.1	.	.	.	.	.	.	.	.	.	.	.	10.35	1.325234	0.24080	.	.	ENSG00000197409	ENST00000356476;ENST00000377831	T;T	0.71341	-0.56;-0.56	4.28	3.41	0.39046	.	.	.	.	.	T	0.63295	0.2499	.	.	.	0.31814	N	0.6269	.	.	.	.	.	.	T	0.63001	-0.6734	6	0.66056	D	0.02	.	11.3981	0.49854	0.0:0.9105:0.0:0.0895	.	.	.	.	T	87	ENSP00000366999:S87T;ENSP00000367062:S87T	ENSP00000366999:S87T	S	-	2	0	HIST1H3D	26305198	1.000000	0.71417	1.000000	0.80357	0.332000	0.28634	7.428000	0.80296	0.915000	0.36847	0.655000	0.94253	AGC	.	.	none		0.587	HIST1H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040096.1	NM_003530	
SCN7A	6332	hgsc.bcm.edu	37	2	167298253	167298253	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:167298253A>T	ENST00000409855.1	-	14	1936	c.1810T>A	c.(1810-1812)Ttc>Atc	p.F604I		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	604					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CCCAACTTGAAAATTCTTAAC	0.353																																					p.F604I		Atlas-SNP	.											.	SCN7A	410	.	0			c.T1810A						PASS	.						72.0	69.0	70.0					2																	167298253		1889	4124	6013	SO:0001583	missense	6332	exon14			ACTTGAAAATTCT	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1810T>A	2.37:g.167298253A>T	ENSP00000386796:p.Phe604Ile	Somatic	224	0	0		WXS	Illumina HiSeq	Phase_I	172	47	0.273256	NM_002976		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.137203	0.77775	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.98474	-4.95;-4.95	4.78	3.59	0.41128	Ion transport (1);	0.113989	0.40302	N	0.001126	D	0.95156	0.8430	L	0.34521	1.04	0.36641	D	0.876824	B	0.29162	0.235	B	0.29524	0.103	D	0.94194	0.7444	10	0.87932	D	0	.	8.9138	0.35570	0.827:0.0:0.0:0.173	.	604	Q01118	SCN7A_HUMAN	I	604	ENSP00000386796:F604I;ENSP00000413699:F604I	ENSP00000259060:F604I	F	-	1	0	SCN7A	167006499	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.203000	0.77864	0.917000	0.36895	0.477000	0.44152	TTC	.	.	none		0.353	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
MT-CO2	4513	hgsc.bcm.edu	37	M	8160	8160	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrM:8160A>G	ENST00000361739.1	+	1	575	c.575A>G	c.(574-576)tAc>tGc	p.Y192C	MT-ATP6_ENST00000361899.2_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ND4_ENST00000361381.2_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	192					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						ACCGGGGGTATACTACGGTCA	0.463																																					p.Y192C		Atlas-SNP	.											.	.	.	.	0			c.A575G						PASS	.																																			SO:0001583	missense	5743	exon1			GGGTATACTACGG			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.575A>G	M.37:g.8160A>G	ENSP00000354876:p.Tyr192Cys	Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	30	26	0.866667	ENST00000361739	Q37526	Missense_Mutation	SNP	ENST00000361739.1	37																																																																																				.	.	none		0.463	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
CLTB	1212	hgsc.bcm.edu	37	5	175824641	175824641	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:175824641C>T	ENST00000310418.4	-	4	636	c.431G>A	c.(430-432)aGt>aAt	p.S144N	CLTB_ENST00000345807.2_Missense_Mutation_p.S144N	NM_007097.3	NP_009028.1	P09497	CLCB_HUMAN	clathrin, light chain B	144	Involved in binding clathrin heavy chain.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	ciliary membrane (GO:0060170)|clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|trans-Golgi network (GO:0005802)	peptide binding (GO:0042277)|structural molecule activity (GO:0005198)			lung(1)	1	all_cancers(89;0.00522)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.098)		TACTTGTTCACTCTGGCGCTG	0.572																																					p.S144N		Atlas-SNP	.											.	CLTB	17	.	0			c.G431A						PASS	.						207.0	186.0	193.0					5																	175824641		2203	4300	6503	SO:0001583	missense	1212	exon4			TGTTCACTCTGGC	M20470	CCDS4402.1, CCDS4403.1	5q35.2	2010-05-11	2010-05-11		ENSG00000175416	ENSG00000175416			2091	protein-coding gene	gene with protein product		118970	"""clathrin, light polypeptide (Lcb)"""			7713494	Standard	NM_007097		Approved	Lcb	uc003meh.4	P09497	OTTHUMG00000130662	ENST00000310418.4:c.431G>A	5.37:g.175824641C>T	ENSP00000309415:p.Ser144Asn	Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	133	15	0.112782	NM_001834	Q53Y37|Q6FHW1	Missense_Mutation	SNP	ENST00000310418.4	37	CCDS4403.1	.	.	.	.	.	.	.	.	.	.	c	8.653	0.898825	0.17686	.	.	ENSG00000175416	ENST00000310418;ENST00000345807	.	.	.	4.16	3.11	0.35812	.	0.215561	0.49916	D	0.000121	T	0.11707	0.0285	N	0.01515	-0.825	0.33890	D	0.637256	B;B	0.13145	0.001;0.007	B;B	0.16289	0.003;0.015	T	0.31752	-0.9932	9	0.02654	T	1	.	5.0552	0.14529	0.0:0.6844:0.0:0.3156	.	144;144	P09497-2;P09497	.;CLCB_HUMAN	N	144	.	ENSP00000309415:S144N	S	-	2	0	CLTB	175757247	0.306000	0.24490	0.999000	0.59377	0.974000	0.67602	0.716000	0.25836	1.850000	0.53721	0.298000	0.19748	AGT	.	.	none		0.572	CLTB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253153.1		
SDHC	6391	hgsc.bcm.edu	37	1	161298187	161298187	+	Splice_Site	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:161298187G>A	ENST00000367975.2	+	3	228	c.79G>A	c.(79-81)Gct>Act	p.A27T	SDHC_ENST00000392169.2_Intron|SDHC_ENST00000470743.3_3'UTR|SDHC_ENST00000513009.1_Intron|SDHC_ENST00000342751.4_Splice_Site_p.A27T|SDHC_ENST00000432287.2_Intron	NM_003001.3	NP_002992.1	Q99643	C560_HUMAN	succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa	27					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)|respiratory chain complex II (GO:0045273)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|succinate dehydrogenase activity (GO:0000104)			urinary_tract(1)	1	all_cancers(52;6.96e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Succinic acid(DB00139)	TTATTTTAGTGCTGTTCCTTT	0.368			"""Mis, N, F"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Carney-Stratakis syndrome																												p.A27T		Atlas-SNP	.	yes	Rec		Familial paraganglioma	1	1q21	6391	"""succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa"""		O	.	SDHC	19	.	0			c.G79A						PASS	.						114.0	119.0	117.0					1																	161298187		2203	4300	6503	SO:0001630	splice_region_variant	6391	exon3	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	TTTAGTGCTGTTC	D49737	CCDS1230.1, CCDS41431.1, CCDS41432.1, CCDS44263.1, CCDS60330.1	1q23.3	2014-09-17	2002-08-29		ENSG00000143252	ENSG00000143252		"""Mitochondrial respiratory chain complex / Complex II"""	10682	protein-coding gene	gene with protein product		602413	"""succinate dehydrogenase complex, subunit C, integral membrane protein, 15kD"""	PGL3		9533030, 12658451	Standard	NM_001278172		Approved		uc001gag.3	Q99643	OTTHUMG00000034468	ENST00000367975.2:c.78-1G>A	1.37:g.161298187G>A		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	58	17	0.293103	NM_001035511	O75609|Q3C259|Q3C2D8|Q3C2H4|Q5VTH3	Missense_Mutation	SNP	ENST00000367975.2	37	CCDS1230.1	.	.	.	.	.	.	.	.	.	.	G	19.05	3.752903	0.69648	.	.	ENSG00000143252	ENST00000367975;ENST00000342751	D;D	0.97328	-4.34;-4.34	5.72	5.72	0.89469	.	0.211314	0.48767	D	0.000168	D	0.97133	0.9063	M	0.68952	2.095	.	.	.	D;P	0.57257	0.979;0.877	P;B	0.54270	0.747;0.417	D	0.97053	0.9765	9	0.56958	D	0.05	.	17.3691	0.87371	0.0:0.0:1.0:0.0	.	27;27	Q99643-2;Q99643	.;C560_HUMAN	T	27	ENSP00000356953:A27T;ENSP00000356952:A27T	ENSP00000356952:A27T	A	+	1	0	SDHC	159564811	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	1.880000	0.39628	2.699000	0.92147	0.591000	0.81541	GCT	.	.	none		0.368	SDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083316.2	NM_003001	Missense_Mutation
FAM120C	54954	hgsc.bcm.edu	37	X	54209068	54209068	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:54209068C>T	ENST00000375180.2	-	1	620	c.564G>A	c.(562-564)caG>caA	p.Q188Q	FAM120C_ENST00000497680.1_5'UTR|FAM120C_ENST00000328235.4_Silent_p.Q188Q|FAM120C_ENST00000477084.1_Silent_p.Q188Q	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	188							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GCCGCTCGGCCTGGCACCGAC	0.711																																					p.Q188Q		Atlas-SNP	.											.	FAM120C	89	.	0			c.G564A						PASS	.						21.0	16.0	18.0					X																	54209068		2171	4260	6431	SO:0001819	synonymous_variant	54954	exon1			CTCGGCCTGGCAC	AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.564G>A	X.37:g.54209068C>T		Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	74	27	0.364865	NM_017848	B2RMT7	Silent	SNP	ENST00000375180.2	37	CCDS14356.1																																																																																			.	.	none		0.711	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056795.2	NM_017848	
FOXD4L1	200350	hgsc.bcm.edu	37	2	114256859	114256859	+	Missense_Mutation	SNP	C	C	T	rs189095552	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:114256859C>T	ENST00000306507.5	+	1	199	c.26C>T	c.(25-27)cCt>cTt	p.P9L		NM_012184.4	NP_036316.1	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	9					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P9L(2)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(2)	26						GCTGAGCGCCCTCGCTCCACA	0.647																																					p.P9L		Atlas-SNP	.											FOXD4L1,NS,malignant_melanoma,0,2	FOXD4L1	48	2	2	Substitution - Missense(2)	NS(1)|skin(1)	c.C26T						scavenged	.						24.0	34.0	31.0					2																	114256859		2142	4164	6306	SO:0001583	missense	200350	exon1			AGCGCCCTCGCTC	AF452723	CCDS2117.1	2q14.1	2008-02-05			ENSG00000184492	ENSG00000184492			18521	protein-coding gene	gene with protein product		611084				12421752, 15233989	Standard	NM_012184		Approved	FOXD5	uc002tjw.4	Q9NU39	OTTHUMG00000131359	ENST00000306507.5:c.26C>T	2.37:g.114256859C>T	ENSP00000302756:p.Pro9Leu	Somatic	175	8	0.0457143		WXS	Illumina HiSeq	Phase_I	162	12	0.0740741	NM_012184	B3KWN1|B9EGF3	Missense_Mutation	SNP	ENST00000306507.5	37	CCDS2117.1	265	0.12133699633699634	29	0.05894308943089431	63	0.17403314917127072	122	0.21328671328671328	51	0.06728232189973615	.	0	-2.671754	0.00104	.	.	ENSG00000184492	ENST00000306507	D	0.93307	-3.2	2.57	0.149	0.14863	.	.	.	.	.	T	0.00178	0.0005	N	0.01168	-0.975	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16988	-1.0384	8	0.18276	T	0.48	.	6.9208	0.24387	0.0:0.5889:0.0:0.4111	rs2757969;rs4644326	9	Q9NU39	FX4L1_HUMAN	L	9	ENSP00000302756:P9L	ENSP00000302756:P9L	P	+	2	0	FOXD4L1	113973329	0.000000	0.05858	0.270000	0.24601	0.060000	0.15804	-0.419000	0.07071	-0.116000	0.11893	-1.461000	0.01025	CCT	.	.	weak		0.647	FOXD4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254148.1	NM_012184	
RAB6B	51560	hgsc.bcm.edu	37	3	133557035	133557035	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:133557035G>A	ENST00000285208.4	-	6	819	c.470C>T	c.(469-471)gCg>gTg	p.A157V	RAB6B_ENST00000469959.1_Intron|RAB6B_ENST00000486858.1_Missense_Mutation_p.A144V|RAB6B_ENST00000543906.1_Missense_Mutation_p.A157V	NM_016577.3	NP_057661.3	Q9NRW1	RAB6B_HUMAN	RAB6B, member RAS oncogene family	157					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	11						GCCAGTCTTCGCACTGGTCTC	0.617																																					p.A157V		Atlas-SNP	.											RAB6B,NS,carcinoma,+1,1	RAB6B	36	1	0			c.C470T						PASS	.						167.0	153.0	158.0					3																	133557035		2203	4300	6503	SO:0001583	missense	51560	exon6			GTCTTCGCACTGG	AF166492	CCDS3082.1	3q22.1	2008-05-15			ENSG00000154917	ENSG00000154917		"""RAB, member RAS oncogene"""	14902	protein-coding gene	gene with protein product		615852					Standard	NM_016577		Approved		uc003epy.3	Q9NRW1	OTTHUMG00000159749	ENST00000285208.4:c.470C>T	3.37:g.133557035G>A	ENSP00000285208:p.Ala157Val	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	63	21	0.333333	NM_016577	B2R5Z9|B7Z337|D3DND3|Q92929	Missense_Mutation	SNP	ENST00000285208.4	37	CCDS3082.1	.	.	.	.	.	.	.	.	.	.	G	31	5.080334	0.94050	.	.	ENSG00000154917	ENST00000285208;ENST00000543906;ENST00000486858;ENST00000477759	D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43	4.47	4.47	0.54385	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.95332	0.8485	M	0.90425	3.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	D	0.96189	0.9136	10	0.87932	D	0	-3.3637	16.4243	0.83809	0.0:0.0:1.0:0.0	.	144;157	B7Z337;Q9NRW1	.;RAB6B_HUMAN	V	157;157;144;124	ENSP00000285208:A157V;ENSP00000437797:A157V;ENSP00000419381:A144V;ENSP00000419941:A124V	ENSP00000285208:A157V	A	-	2	0	RAB6B	135039725	1.000000	0.71417	0.282000	0.24776	0.841000	0.47740	8.857000	0.92250	2.490000	0.84030	0.655000	0.94253	GCG	.	.	none		0.617	RAB6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357152.1		
STK3	6788	hgsc.bcm.edu	37	8	99591963	99591963	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr8:99591963C>T	ENST00000419617.2	-	8	1017	c.877G>A	c.(877-879)Gaa>Aaa	p.E293K	STK3_ENST00000523601.1_Missense_Mutation_p.E321K	NM_006281.3	NP_006272.2	Q13188	STK3_HUMAN	serine/threonine kinase 3	293					apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		TCCATAGCTTCTGTGATCAGG	0.318																																					p.E321K		Atlas-SNP	.											.	STK3	47	.	0			c.G961A						PASS	.						155.0	148.0	150.0					8																	99591963		1818	4093	5911	SO:0001583	missense	6788	exon10			TAGCTTCTGTGAT	BC010640	CCDS47900.1, CCDS59108.1, CCDS75774.1	8q22.2	2011-05-24	2010-06-25		ENSG00000104375	ENSG00000104375			11406	protein-coding gene	gene with protein product		605030	"""serine/threonine kinase 3 (Ste20, yeast homolog)"""			8816758	Standard	NM_006281		Approved	MST2, KRS1	uc003yip.4	Q13188	OTTHUMG00000164651	ENST00000419617.2:c.877G>A	8.37:g.99591963C>T	ENSP00000390500:p.Glu293Lys	Somatic	344	0	0		WXS	Illumina HiSeq	Phase_I	398	33	0.0829146	NM_001256312	A8K722|B3KYA7|Q15445|Q15801|Q96FM6	Missense_Mutation	SNP	ENST00000419617.2	37	CCDS47900.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.413500	0.83449	.	.	ENSG00000104375	ENST00000419617;ENST00000523601;ENST00000518165	T;T;T	0.72505	-0.66;-0.65;0.08	5.69	5.69	0.88448	Protein kinase-like domain (1);	0.054980	0.64402	D	0.000001	T	0.73393	0.3581	M	0.74467	2.265	0.80722	D	1	B;B;B	0.29862	0.155;0.035;0.259	B;B;B	0.28638	0.023;0.023;0.092	T	0.72814	-0.4179	10	0.54805	T	0.06	.	19.8097	0.96542	0.0:1.0:0.0:0.0	.	182;293;321	E5RFQ9;Q13188;B3KYA7	.;STK3_HUMAN;.	K	293;321;182	ENSP00000390500:E293K;ENSP00000429744:E321K;ENSP00000428014:E182K	ENSP00000390500:E293K	E	-	1	0	STK3	99661139	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.346000	0.79347	2.685000	0.91497	0.484000	0.47621	GAA	.	.	none		0.318	STK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379635.1	NM_006281	
HSPA14	51182	hgsc.bcm.edu	37	10	14893270	14893270	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr10:14893270T>C	ENST00000378372.3	+	7	759	c.520T>C	c.(520-522)Tct>Cct	p.S174P		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	174					'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)			breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						TCACGAACCGTCTGCAGCTCT	0.358																																					p.S174P		Atlas-SNP	.											.	HSPA14	42	.	0			c.T520C						PASS	.						137.0	135.0	136.0					10																	14893270		2203	4300	6503	SO:0001583	missense	51182	exon7			GAACCGTCTGCAG	AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.520T>C	10.37:g.14893270T>C	ENSP00000367623:p.Ser174Pro	Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	97	14	0.14433	NM_016299	A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Missense_Mutation	SNP	ENST00000378372.3	37	CCDS7103.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.411879	0.83340	.	.	ENSG00000187522	ENST00000378372	T	0.01034	5.42	5.62	5.62	0.85841	.	0.052571	0.85682	D	0.000000	T	0.03434	0.0099	L	0.58101	1.795	0.80722	D	1	D	0.60575	0.988	P	0.56343	0.796	T	0.49916	-0.8888	10	0.87932	D	0	-17.0919	15.8307	0.78749	0.0:0.0:0.0:1.0	.	174	Q0VDF9	HSP7E_HUMAN	P	174	ENSP00000367623:S174P	ENSP00000367623:S174P	S	+	1	0	HSPA14	14933276	1.000000	0.71417	0.973000	0.42090	0.989000	0.77384	4.081000	0.57627	2.118000	0.64928	0.528000	0.53228	TCT	.	.	none		0.358	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046910.1	NM_016299	
PNPLA5	150379	hgsc.bcm.edu	37	22	44280171	44280171	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr22:44280171G>A	ENST00000597664.1	-	7	1133	c.1004C>T	c.(1003-1005)tCg>tTg	p.S335L	PNPLA5_ENST00000216177.4_Missense_Mutation_p.S335L|PNPLA5_ENST00000593866.1_Missense_Mutation_p.S221L|PNPLA5_ENST00000381198.2_Missense_Mutation_p.S221L			Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	335					lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)	p.S335L(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	16		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				TCCAGGCCCCGAGTGCCAGAA	0.627											OREG0026622	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S335L		Atlas-SNP	.											PNPLA5,NS,carcinoma,0,1	PNPLA5	46	1	1	Substitution - Missense(1)	endometrium(1)	c.C1004T						PASS	.						90.0	90.0	90.0					22																	44280171		2203	4300	6503	SO:0001583	missense	150379	exon7			GGCCCCGAGTGCC	Z97055	CCDS14053.1, CCDS54537.1	22q13.31	2009-01-12			ENSG00000100341	ENSG00000100341		"""Patatin-like phospholipase domain containing"""	24888	protein-coding gene	gene with protein product		611589				16799181, 19029121	Standard	NM_138814		Approved	dJ388M5.4, GS2L	uc003beg.3	Q7Z6Z6	OTTHUMG00000030779	ENST00000597664.1:c.1004C>T	22.37:g.44280171G>A	ENSP00000471069:p.Ser335Leu	Somatic	78	0	0	922	WXS	Illumina HiSeq	Phase_I	52	17	0.326923	NM_138814	B1AHL8|B3KPR1|Q6ZST0	Missense_Mutation	SNP	ENST00000597664.1	37		.	.	.	.	.	.	.	.	.	.	G	4.655	0.121721	0.08931	.	.	ENSG00000100341	ENST00000216177;ENST00000381198;ENST00000438734	T;T;T	0.39056	1.56;1.1;1.94	3.9	1.76	0.24704	.	0.316936	0.21366	N	0.075714	T	0.38825	0.1055	L	0.31926	0.97	0.09310	N	1	D;D;D	0.76494	0.996;0.999;0.998	P;D;P	0.64687	0.823;0.928;0.688	T	0.31888	-0.9927	10	0.02654	T	1	-4.6125	6.2816	0.21011	0.2326:0.0:0.7674:0.0	.	243;221;335	E9PGS4;Q7Z6Z6-2;Q7Z6Z6	.;.;PLPL5_HUMAN	L	335;221;243	ENSP00000216177:S335L;ENSP00000370595:S221L;ENSP00000405732:S243L	ENSP00000216177:S335L	S	-	2	0	PNPLA5	42611504	0.075000	0.21258	0.001000	0.08648	0.010000	0.07245	1.941000	0.40233	0.427000	0.26145	0.313000	0.20887	TCG	.	.	none		0.627	PNPLA5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000075667.4	NM_138814	
NT5DC3	51559	hgsc.bcm.edu	37	12	104186994	104186994	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:104186994C>A	ENST00000392876.3	-	9	1007	c.967G>T	c.(967-969)Gat>Tat	p.D323Y		NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	323						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.D248N(1)		NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						ATGACCACATCGAACAGGTCC	0.428																																					p.D323Y		Atlas-SNP	.											NT5DC3,rectum,carcinoma,0,1	NT5DC3	113	1	1	Substitution - Missense(1)	large_intestine(1)	c.G967T						PASS	.						194.0	204.0	200.0					12																	104186994		2203	4300	6503	SO:0001583	missense	51559	exon9			CCACATCGAACAG	AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.967G>T	12.37:g.104186994C>A	ENSP00000376615:p.Asp323Tyr	Somatic	176	0	0		WXS	Illumina HiSeq	Phase_I	154	42	0.272727	NM_001031701	Q9NUM7|Q9P2T2|Q9P2T3	Missense_Mutation	SNP	ENST00000392876.3	37	CCDS41824.1	.	.	.	.	.	.	.	.	.	.	C	31	5.058257	0.93846	.	.	ENSG00000111696	ENST00000392876	T	0.52057	0.68	5.99	5.99	0.97316	HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.78898	0.4356	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83164	-0.0097	10	0.87932	D	0	-34.2755	20.4777	0.99188	0.0:1.0:0.0:0.0	.	323	Q86UY8	NT5D3_HUMAN	Y	323	ENSP00000376615:D323Y	ENSP00000376615:D323Y	D	-	1	0	NT5DC3	102711124	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	7.776000	0.85560	2.840000	0.97914	0.655000	0.94253	GAT	.	.	none		0.428	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347118.2	NM_016575	
SLC20A1	6574	hgsc.bcm.edu	37	2	113404650	113404650	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:113404650G>C	ENST00000272542.3	+	2	784	c.245G>C	c.(244-246)aGc>aCc	p.S82T	AC079922.3_ENST00000457336.1_lincRNA	NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	82					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						GCCAAAGTGAGCGAAACCATC	0.527																																					p.S82T		Atlas-SNP	.											.	SLC20A1	59	.	0			c.G245C						PASS	.						137.0	125.0	129.0					2																	113404650		2203	4300	6503	SO:0001583	missense	6574	exon2			AAGTGAGCGAAAC		CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.245G>C	2.37:g.113404650G>C	ENSP00000272542:p.Ser82Thr	Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	147	47	0.319728	NM_005415	Q08344|Q6DHX8|Q9UQ82	Missense_Mutation	SNP	ENST00000272542.3	37	CCDS2099.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.562548	0.45694	.	.	ENSG00000144136	ENST00000272542	D	0.90069	-2.61	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.83580	0.5285	N	0.17631	0.505	0.80722	D	1	B	0.25441	0.126	B	0.30316	0.114	T	0.80779	-0.1230	10	0.54805	T	0.06	-21.2441	17.2043	0.86914	0.0:0.0:1.0:0.0	.	82	Q8WUM9	S20A1_HUMAN	T	82	ENSP00000272542:S82T	ENSP00000272542:S82T	S	+	2	0	SLC20A1	113121121	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.806000	0.99153	2.733000	0.93635	0.591000	0.81541	AGC	.	.	none		0.527	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254086.2	NM_005415	
USP24	23358	hgsc.bcm.edu	37	1	55549034	55549034	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:55549034C>T	ENST00000294383.6	-	58	6885	c.6886G>A	c.(6886-6888)Gga>Aga	p.G2296R	USP24_ENST00000407756.1_Missense_Mutation_p.G2136R	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	2296					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						GCCCTAATTCCTTGCTGTCAC	0.398																																					p.G2296R		Atlas-SNP	.											.	USP24	323	.	0			c.G6886A						PASS	.						74.0	70.0	71.0					1																	55549034		1903	4128	6031	SO:0001583	missense	23358	exon58			TAATTCCTTGCTG	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.6886G>A	1.37:g.55549034C>T	ENSP00000294383:p.Gly2296Arg	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	64	9	0.140625	NM_015306	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	C	14.75	2.628881	0.46944	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.03920	3.76;3.78	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.06142	0.0159	L	0.35341	1.055	0.58432	D	0.999996	P	0.36438	0.553	B	0.32465	0.146	T	0.34976	-0.9807	10	0.56958	D	0.05	.	19.6126	0.95616	0.0:1.0:0.0:0.0	.	2136	B7WPF4	.	R	2296;2136	ENSP00000294383:G2296R;ENSP00000385700:G2136R	ENSP00000294383:G2296R	G	-	1	0	USP24	55321622	1.000000	0.71417	0.993000	0.49108	0.502000	0.33828	5.981000	0.70524	2.647000	0.89833	0.650000	0.86243	GGA	.	.	none		0.398	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
GPC3	2719	hgsc.bcm.edu	37	X	132833966	132833966	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:132833966C>A	ENST00000370818.3	-	4	1568	c.1123G>T	c.(1123-1125)Gtt>Ttt	p.V375F	GPC3_ENST00000543339.1_Missense_Mutation_p.V321F|GPC3_ENST00000394299.2_Missense_Mutation_p.V398F	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	375					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					ACATGAGCAACTTTTAATACT	0.333			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																												p.V398F		Atlas-SNP	.	yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	.	GPC3	88	.	0			c.G1192T						PASS	.						66.0	60.0	62.0					X																	132833966		2203	4298	6501	SO:0001583	missense	2719	exon5	Familial Cancer Database	SGBS	GAGCAACTTTTAA	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.1123G>T	X.37:g.132833966C>A	ENSP00000359854:p.Val375Phe	Somatic	976	2	0.00204918		WXS	Illumina HiSeq	Phase_I	583	200	0.343053	NM_001164617	C9JLE3|G3V1R0|Q2L880|Q2L882	Missense_Mutation	SNP	ENST00000370818.3	37	CCDS14638.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.0|21.0	4.077701|4.077701	0.76528|0.76528	.|.	.|.	ENSG00000147257|ENSG00000147257	ENST00000406757|ENST00000370818;ENST00000394299;ENST00000543339	T|T;T;T	0.52526|0.51817	0.66|0.69;0.69;0.69	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	.|0.546935	.|0.17892	.|N	.|0.158471	T|T	0.59770|0.59770	0.2218|0.2218	L|L	0.47716|0.47716	1.5|1.5	0.39149|0.39149	D|D	0.962187|0.962187	.|D;D;P;P	.|0.67145	.|0.984;0.996;0.872;0.647	.|D;D;P;P	.|0.65140	.|0.932;0.93;0.593;0.593	T|T	0.57780|0.57780	-0.7752|-0.7752	7|10	0.29301|0.33141	T|T	0.29|0.24	.|.	15.0436|15.0436	0.71811|0.71811	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|359;321;398;375	.|B4DTD8;G3V1R0;C9JLE3;P51654	.|.;.;.;GPC3_HUMAN	N|F	104|375;398;321	ENSP00000385307:K104N|ENSP00000359854:V375F;ENSP00000377836:V398F;ENSP00000444222:V321F	ENSP00000385307:K104N|ENSP00000359854:V375F	K|V	-|-	3|1	2|0	GPC3|GPC3	132661632|132661632	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.957000|0.957000	0.61999|0.61999	2.376000|2.376000	0.44292|0.44292	2.194000|2.194000	0.70268|0.70268	0.429000|0.429000	0.28392|0.28392	AAG|GTT	.	.	none		0.333	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1	NM_004484	
MT-ND3	4537	hgsc.bcm.edu	37	M	10178	10178	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrM:10178C>T	ENST00000361227.2	+	1	120	c.120C>T	c.(118-120)ggC>ggT	p.G40G	MT-TL2_ENST00000387456.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TK_ENST00000387421.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-ND5_ENST00000361567.2_5'Flank			P03897	NU3M_HUMAN	mitochondrially encoded NADH dehydrogenase 3	40					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)										TACGAGTGCGGCTTCGACCCT	0.398																																					p.G40G		Atlas-SNP	.											.	.	.	.	0			c.C120T						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			GTGCGGCTTCGAC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198840	ENSG00000198840	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7458	protein-coding gene	gene with protein product	"""complex I ND3 subunit"", ""NADH-ubiquinone oxidoreductase chain 3"""	516002	"""NADH dehydrogenase 3"""	MTND3			Standard			Approved	ND3, NAD3		P03897		ENST00000361227.2:c.120C>T	M.37:g.10178C>T		Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	29	26	0.896552	ENST00000361227		Silent	SNP	ENST00000361227.2	37																																																																																				.	.	none		0.398	MT-ND3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024033	
TTC3	7267	hgsc.bcm.edu	37	21	38520899	38520899	+	Silent	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr21:38520899T>C	ENST00000399017.2	+	23	4817	c.2070T>C	c.(2068-2070)aaT>aaC	p.N690N	TTC3_ENST00000354749.2_Silent_p.N690N|TTC3_ENST00000540756.1_Silent_p.N380N|TTC3_ENST00000355666.1_Silent_p.N690N|TTC3_ENST00000479930.1_3'UTR	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	690					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TTCACATGAATTGCTGGAAGA	0.299																																					p.N690N	Ovarian(38;194 1649 35661)	Atlas-SNP	.											.	TTC3	182	.	0			c.T2070C						PASS	.						71.0	79.0	77.0					21																	38520899		2203	4296	6499	SO:0001819	synonymous_variant	7267	exon23			CATGAATTGCTGG	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.2070T>C	21.37:g.38520899T>C		Somatic	331	0	0		WXS	Illumina HiSeq	Phase_I	353	89	0.252125	NM_001001894	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Silent	SNP	ENST00000399017.2	37	CCDS13651.1																																																																																			.	.	none		0.299	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		
CDKL1	8814	hgsc.bcm.edu	37	14	50808859	50808859	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr14:50808859G>A	ENST00000216378.2	-	5	1092	c.448C>T	c.(448-450)Cgg>Tgg	p.R150W	CDKL1_ENST00000395834.1_Missense_Mutation_p.R150W|CDKL1_ENST00000356146.1_5'UTR	NM_001282236.1	NP_001269165.1	Q00532	CDKL1_HUMAN	cyclin-dependent kinase-like 1 (CDC2-related kinase)	149	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				heart development (GO:0007507)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|stomach(1)	12	all_epithelial(31;0.000746)|Breast(41;0.0102)					CTCAAAAGCCGAGCAAATCCA	0.328																																					p.R150W		Atlas-SNP	.											CDKL1_ENST00000395834,NS,carcinoma,0,2	CDKL1	50	2	0			c.C448T						PASS	.						120.0	103.0	109.0					14																	50808859		2203	4300	6503	SO:0001583	missense	8814	exon4			AAAGCCGAGCAAA	AF390028	CCDS9699.1, CCDS73637.1	14q21.3	2011-11-04			ENSG00000100490	ENSG00000100490		"""Cyclin-dependent kinases"""	1781	protein-coding gene	gene with protein product		603441				1639063, 7595554	Standard	XM_005268157		Approved	KKIALRE	uc010anu.2	Q00532	OTTHUMG00000140290	ENST00000216378.2:c.448C>T	14.37:g.50808859G>A	ENSP00000216378:p.Arg150Trp	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	133	43	0.323308	NM_004196	Q2M3A4|Q6QUA0|Q8WXQ5	Missense_Mutation	SNP	ENST00000216378.2	37		.	.	.	.	.	.	.	.	.	.	G	19.86	3.904913	0.72868	.	.	ENSG00000100490	ENST00000395834;ENST00000216378	T;T	0.68025	-0.3;-0.3	5.04	5.04	0.67666	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.84723	0.5535	M	0.92026	3.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.87607	0.2501	9	0.87932	D	0	.	14.1742	0.65529	0.0:0.0:0.85:0.15	.	821;149	Q00532-2;Q00532	.;CDKL1_HUMAN	W	150	ENSP00000379176:R150W;ENSP00000216378:R150W	ENSP00000216378:R150W	R	-	1	2	CDKL1	49878609	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.593000	0.61034	2.723000	0.93209	0.655000	0.94253	CGG	.	.	none		0.328	CDKL1-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382103.1		
MUC6	4588	hgsc.bcm.edu	37	11	1016770	1016770	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr11:1016770G>A	ENST00000421673.2	-	31	6081	c.6031C>T	c.(6031-6033)Cct>Tct	p.P2011S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2011	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.P2011S(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGGAGAAAGGTGGAACGTGA	0.532																																					p.P2011S		Atlas-SNP	.											MUC6_ENST00000421673,extremity,malignant_melanoma,0,1	MUC6	408	1	1	Substitution - Missense(1)	skin(1)	c.C6031T						scavenged	.																																			SO:0001583	missense	4588	exon31			AGAAAGGTGGAAC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6031C>T	11.37:g.1016770G>A	ENSP00000406861:p.Pro2011Ser	Somatic	576	6	0.0104167		WXS	Illumina HiSeq	Phase_I	531	17	0.0320151	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.638370	0.00799	.	.	ENSG00000184956	ENST00000421673	T	0.17370	2.28	2.4	-4.79	0.03200	.	.	.	.	.	T	0.06735	0.0172	N	0.21194	0.64	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39014	-0.9634	9	0.07990	T	0.79	.	1.1636	0.01810	0.3722:0.1007:0.2914:0.2356	.	2011	Q6W4X9	MUC6_HUMAN	S	2011	ENSP00000406861:P2011S	ENSP00000406861:P2011S	P	-	1	0	MUC6	1006770	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.781000	0.00773	-2.945000	0.00295	-0.671000	0.03813	CCT	.	.	none		0.532	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
COLEC11	78989	hgsc.bcm.edu	37	2	3691387	3691387	+	Silent	SNP	C	C	T	rs545129835		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:3691387C>T	ENST00000349077.4	+	7	598	c.495C>T	c.(493-495)gaC>gaT	p.D165D	COLEC11_ENST00000382062.2_Silent_p.D141D|COLEC11_ENST00000402922.1_Silent_p.D115D|COLEC11_ENST00000403096.3_Silent_p.D139D|COLEC11_ENST00000402794.1_Silent_p.D115D|COLEC11_ENST00000236693.7_Silent_p.D162D|COLEC11_ENST00000404205.1_Silent_p.D91D|COLEC11_ENST00000487365.1_3'UTR|COLEC11_ENST00000418971.2_Silent_p.D179D	NM_024027.4	NP_076932.1	Q9BWP8	COL11_HUMAN	collectin sub-family member 11	165	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				developmental process (GO:0032502)|multicellular organismal development (GO:0007275)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)	mannose binding (GO:0005537)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|soft_tissue(1)	22	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		GCTACGCGGACGCCCAGCTGT	0.662																																					p.D179D		Atlas-SNP	.											.	COLEC11	93	.	0			c.C537T						PASS	.						38.0	40.0	39.0					2																	3691387		2203	4298	6501	SO:0001819	synonymous_variant	78989	exon8			CGCGGACGCCCAG	BC000078	CCDS1649.1, CCDS1650.1, CCDS58689.1, CCDS58690.1, CCDS58691.1, CCDS58692.1, CCDS58693.1, CCDS58694.1	2p25.3	2014-09-17			ENSG00000118004	ENSG00000118004		"""Collectins"""	17213	protein-coding gene	gene with protein product	"""Collectin K1"""	612502					Standard	NM_024027		Approved	MGC3279, CL-K1	uc031rnn.1	Q9BWP8	OTTHUMG00000090304	ENST00000349077.4:c.495C>T	2.37:g.3691387C>T		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	70	16	0.228571	NM_001255985	A1IGE4|A1IGE5|A1IGE6|A7VJJ2|A7VJJ3|A7VJJ4|A7VJJ5|B2R9M5|B4E1G0|J3KQY9|Q5CZ85|Q7Z6N1	Silent	SNP	ENST00000349077.4	37	CCDS1649.1																																																																																			.	.	none		0.662	COLEC11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206666.1	NM_024027	
RUNX3	864	hgsc.bcm.edu	37	1	25256143	25256143	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:25256143T>A	ENST00000308873.6	-	1	225	c.217A>T	c.(217-219)Aac>Tac	p.N73Y	RUNX3_ENST00000338888.3_Missense_Mutation_p.N87Y|RUNX3_ENST00000399916.1_Missense_Mutation_p.N87Y|RUNX3_ENST00000540420.1_5'Flank|RUNX3_ENST00000496967.1_5'Flank	NM_004350.2	NP_004341.1	Q13761	RUNX3_HUMAN	runt-related transcription factor 3	73	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		CAGAGGAAGTTGGGGCTGTCG	0.756																																					p.N87Y		Atlas-SNP	.											.	RUNX3	72	.	0			c.A259T						PASS	.						34.0	30.0	31.0					1																	25256143		2201	4298	6499	SO:0001583	missense	864	exon2			GGAAGTTGGGGCT	BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000308873.6:c.217A>T	1.37:g.25256143T>A	ENSP00000308051:p.Asn73Tyr	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	62	24	0.387097	NM_001031680	B1AJV5|Q12969|Q13760	Missense_Mutation	SNP	ENST00000308873.6	37	CCDS257.1	.	.	.	.	.	.	.	.	.	.	T	15.33	2.802911	0.50315	.	.	ENSG00000020633	ENST00000399916;ENST00000308873;ENST00000338888;ENST00000428150	D;D;D	0.99483	-5.99;-5.99;-5.99	3.37	2.2	0.27929	Acute myeloid leukemia 1 (AML 1)/Runt (2);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.184695	0.45361	N	0.000371	D	0.98979	0.9652	L	0.52126	1.63	0.80722	D	1	D;D;D;P	0.89917	0.983;1.0;1.0;0.719	P;D;D;P	0.78314	0.905;0.985;0.991;0.472	D	0.98235	1.0485	10	0.51188	T	0.08	-19.8886	7.7574	0.28932	0.1874:0.0:0.0:0.8126	.	73;87;87;73	E9PH34;Q13761-2;B1AJV5;Q13761	.;.;.;RUNX3_HUMAN	Y	87;73;87;73	ENSP00000382800:N87Y;ENSP00000308051:N73Y;ENSP00000343477:N87Y	ENSP00000308051:N73Y	N	-	1	0	RUNX3	25128730	1.000000	0.71417	1.000000	0.80357	0.238000	0.25445	5.566000	0.67372	0.376000	0.24707	0.402000	0.26972	AAC	.	.	none		0.756	RUNX3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009284.1	NM_004350	
SMURF1	57154	hgsc.bcm.edu	37	7	98652487	98652487	+	Splice_Site	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr7:98652487G>C	ENST00000361125.1	-	6	724	c.405C>G	c.(403-405)gtC>gtG	p.V135V	SMURF1_ENST00000361368.2_Splice_Site_p.V135V|SMURF1_ENST00000480055.1_5'UTR	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1	135					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			TCTGTAAACTGACTAAAAGAG	0.413																																					p.V135V		Atlas-SNP	.											.	SMURF1	58	.	0			c.C405G						PASS	.						96.0	99.0	98.0					7																	98652487		2203	4300	6503	SO:0001630	splice_region_variant	57154	exon6			TAAACTGACTAAA	AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.404-1C>G	7.37:g.98652487G>C		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	60	16	0.266667	NM_020429	A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	Silent	SNP	ENST00000361125.1	37	CCDS34690.1																																																																																			.	.	none		0.413	SMURF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000335001.2	NM_020429	Silent
LEPR	3953	hgsc.bcm.edu	37	1	66101961	66101961	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:66101961G>A	ENST00000349533.6	+	20	2946	c.2761G>A	c.(2761-2763)Gat>Aat	p.D921N	LEPR_ENST00000406510.3_5'UTR	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)	p.D921Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AATTTCAGAAGATATCAGTGT	0.373																																					p.D921N		Atlas-SNP	.											LEPR_ENST00000349533,colon,carcinoma,0,1	LEPR	284	1	1	Substitution - Missense(1)	large_intestine(1)	c.G2761A						PASS	.						149.0	153.0	152.0					1																	66101961		2203	4300	6503	SO:0001583	missense	3953	exon20			TCAGAAGATATCA	U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.2761G>A	1.37:g.66101961G>A	ENSP00000330393:p.Asp921Asn	Somatic	236	0	0		WXS	Illumina HiSeq	Phase_I	239	43	0.179916	NM_002303	Q6FHL5	Missense_Mutation	SNP	ENST00000349533.6	37	CCDS631.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.888719	0.91814	.	.	ENSG00000116678	ENST00000349533	T	0.57273	0.41	5.79	5.79	0.91817	.	0.259962	0.42420	D	0.000718	T	0.67144	0.2862	M	0.76002	2.32	0.80722	D	1	D	0.71674	0.998	P	0.61800	0.894	T	0.69157	-0.5219	10	0.66056	D	0.02	-17.0787	20.0281	0.97530	0.0:0.0:1.0:0.0	.	921	P48357	LEPR_HUMAN	N	921	ENSP00000330393:D921N	ENSP00000330393:D921N	D	+	1	0	LEPR	65874549	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.681000	0.74523	2.727000	0.93392	0.655000	0.94253	GAT	.	.	none		0.373	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303	
OPTN	10133	hgsc.bcm.edu	37	10	13167997	13167997	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr10:13167997T>G	ENST00000378748.3	+	12	1562	c.1200T>G	c.(1198-1200)caT>caG	p.H400Q	OPTN_ENST00000378764.2_Missense_Mutation_p.H394Q|OPTN_ENST00000378757.2_Missense_Mutation_p.H400Q|OPTN_ENST00000378747.3_Missense_Mutation_p.H400Q|OPTN_ENST00000378752.3_Missense_Mutation_p.H394Q|OPTN_ENST00000263036.5_Missense_Mutation_p.H400Q	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	400					cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						TTCAAGAACATAATAATGCAT	0.313																																					p.H400Q		Atlas-SNP	.											OPTN,colon,carcinoma,+1,1	OPTN	57	1	0			c.T1200G						PASS	.						79.0	78.0	78.0					10																	13167997		2203	4299	6502	SO:0001583	missense	10133	exon11			AGAACATAATAAT	AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.1200T>G	10.37:g.13167997T>G	ENSP00000368022:p.His400Gln	Somatic	249	0	0		WXS	Illumina HiSeq	Phase_I	220	33	0.15	NM_001008212	B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Missense_Mutation	SNP	ENST00000378748.3	37	CCDS7094.1	.	.	.	.	.	.	.	.	.	.	T	7.760	0.705124	0.15172	.	.	ENSG00000123240	ENST00000263036;ENST00000378764;ENST00000378757;ENST00000378752;ENST00000378748;ENST00000378747	D;D;D;D;D;D	0.87103	-2.2;-2.21;-2.2;-2.21;-2.2;-2.2	5.57	-0.125	0.13519	.	0.329091	0.37809	N	0.001921	T	0.81192	0.4771	L	0.47716	1.5	0.09310	N	1	P;P	0.44195	0.828;0.736	B;B	0.43783	0.431;0.352	T	0.72727	-0.4206	10	0.51188	T	0.08	-3.8413	6.6495	0.22955	0.0:0.4744:0.1352:0.3903	.	394;400	Q96CV9-2;Q96CV9	.;OPTN_HUMAN	Q	400;394;400;394;400;400	ENSP00000263036:H400Q;ENSP00000368040:H394Q;ENSP00000368032:H400Q;ENSP00000368027:H394Q;ENSP00000368022:H400Q;ENSP00000368021:H400Q	ENSP00000263036:H400Q	H	+	3	2	OPTN	13208003	0.787000	0.28750	0.052000	0.19188	0.032000	0.12392	0.195000	0.17155	0.003000	0.14656	-0.280000	0.10049	CAT	.	.	none		0.313	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046834.1	NM_021980	
PARD3B	117583	hgsc.bcm.edu	37	2	206166288	206166288	+	Silent	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:206166288C>A	ENST00000406610.2	+	18	2700	c.2493C>A	c.(2491-2493)gcC>gcA	p.A831A	PARD3B_ENST00000358768.2_Silent_p.A769A|PARD3B_ENST00000351153.1_Silent_p.A762A|PARD3B_ENST00000349953.3_Silent_p.A831A|PARD3B_ENST00000462231.1_Silent_p.A831A	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	831	Lys-rich.				cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)				breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		AAAATAAAGCCAGGAAAGTCA	0.443																																					p.A831A		Atlas-SNP	.											.	PARD3B	314	.	0			c.C2493A						PASS	.						78.0	76.0	77.0					2																	206166288		1813	4088	5901	SO:0001819	synonymous_variant	117583	exon18			TAAAGCCAGGAAA	AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.2493C>A	2.37:g.206166288C>A		Somatic	294	0	0		WXS	Illumina HiSeq	Phase_I	273	41	0.150183	NM_205863	E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Silent	SNP	ENST00000406610.2	37																																																																																				.	.	none		0.443	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177	
ACSL3	2181	hgsc.bcm.edu	37	2	223787815	223787815	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:223787815G>A	ENST00000357430.3	+	10	1631	c.1100G>A	c.(1099-1101)gGa>gAa	p.G367E	ACSL3_ENST00000392066.3_Missense_Mutation_p.G367E	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	367					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	ATTAAAAAAGGAAGCAAAGGG	0.318			T	ETV1	prostate																																p.G367E		Atlas-SNP	.		Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	.	ACSL3	107	.	0			c.G1100A						PASS	.						47.0	50.0	49.0					2																	223787815		2200	4299	6499	SO:0001583	missense	2181	exon9			AAAAAGGAAGCAA	D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.1100G>A	2.37:g.223787815G>A	ENSP00000350012:p.Gly367Glu	Somatic	596	1	0.00167785		WXS	Illumina HiSeq	Phase_I	525	122	0.232381	NM_203372	Q60I92|Q8IUM9	Missense_Mutation	SNP	ENST00000357430.3	37	CCDS2455.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.746451	0.89663	.	.	ENSG00000123983	ENST00000357430;ENST00000392066;ENST00000421680	T;T;T	0.72835	1.32;1.32;-0.69	5.36	5.36	0.76844	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.83562	0.5281	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80251	-0.1460	10	0.23302	T	0.38	-18.0091	19.0985	0.93265	0.0:0.0:1.0:0.0	.	367	O95573	ACSL3_HUMAN	E	367;367;137	ENSP00000350012:G367E;ENSP00000375918:G367E;ENSP00000404182:G137E	ENSP00000350012:G367E	G	+	2	0	ACSL3	223496059	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.325000	0.96381	2.524000	0.85096	0.655000	0.94253	GGA	.	.	none		0.318	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256862.2	NM_004457	
MUM1	84939	hgsc.bcm.edu	37	19	1357062	1357062	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:1357062C>G	ENST00000415183.3	+	2	141	c.115C>G	c.(115-117)Cta>Gta	p.L39V	MUM1_ENST00000344663.3_Missense_Mutation_p.L39V|MUM1_ENST00000591806.1_Missense_Mutation_p.L39V|MUM1_ENST00000311401.5_5'UTR			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	38					chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAATATTTTCTAGCTGTGCA	0.358																																					p.L39V		Atlas-SNP	.											MUM1,colon,carcinoma,0,1	MUM1	54	1	0			c.C115G						PASS	.						143.0	145.0	144.0					19																	1357062		2203	4300	6503	SO:0001583	missense	84939	exon3			TATTTTCTAGCTG	AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.115C>G	19.37:g.1357062C>G	ENSP00000394925:p.Leu39Val	Somatic	232	0	0		WXS	Illumina HiSeq	Phase_I	240	70	0.291667	NM_032853	A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Missense_Mutation	SNP	ENST00000415183.3	37		.	.	.	.	.	.	.	.	.	.	C	14.00	2.404734	0.42613	.	.	ENSG00000160953	ENST00000344663;ENST00000356765;ENST00000415183	T;T	0.33865	1.39;1.39	5.2	2.95	0.34219	.	0.135832	0.32655	N	0.005814	T	0.52075	0.1712	M	0.75085	2.285	0.80722	D	1	D;D	0.76494	0.991;0.999	P;D	0.80764	0.818;0.994	T	0.52335	-0.8589	10	0.54805	T	0.06	.	5.3523	0.16042	0.2025:0.6961:0.0:0.1014	.	39;38	B7ZLY8;Q2TAK8	.;MUM1_HUMAN	V	39;65;39	ENSP00000345789:L39V;ENSP00000394925:L39V	ENSP00000345789:L39V	L	+	1	2	MUM1	1308062	0.999000	0.42202	0.971000	0.41717	0.319000	0.28217	1.134000	0.31442	2.581000	0.87130	0.655000	0.94253	CTA	.	.	none		0.358	MUM1-016	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000449510.1	NM_032853	
ZNF439	90594	hgsc.bcm.edu	37	19	11979140	11979140	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:11979140T>C	ENST00000304030.2	+	3	1456	c.1256T>C	c.(1255-1257)tTc>tCc	p.F419S	ZNF439_ENST00000592534.1_Intron|ZNF439_ENST00000455282.1_Missense_Mutation_p.F283S	NM_152262.2	NP_689475.1	Q8NDP4	ZN439_HUMAN	zinc finger protein 439	419					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(7)|pancreas(1)|skin(2)	27						GGGAAAGCCTTCAGATCTGCC	0.453																																					p.F419S		Atlas-SNP	.											.	ZNF439	67	.	0			c.T1256C						PASS	.						70.0	66.0	68.0					19																	11979140		2203	4300	6503	SO:0001583	missense	90594	exon3			AAGCCTTCAGATC	AL833935	CCDS12268.1	19p13.13	2013-01-08			ENSG00000171291	ENSG00000171291		"""Zinc fingers, C2H2-type"", ""-"""	20873	protein-coding gene	gene with protein product							Standard	NM_152262		Approved	DKFZp571K0837	uc002mss.3	Q8NDP4	OTTHUMG00000156527	ENST00000304030.2:c.1256T>C	19.37:g.11979140T>C	ENSP00000305077:p.Phe419Ser	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	98	20	0.204082	NM_152262	Q8IYZ7|Q96SU1	Missense_Mutation	SNP	ENST00000304030.2	37	CCDS12268.1	.	.	.	.	.	.	.	.	.	.	t	14.29	2.490541	0.44249	.	.	ENSG00000171291	ENST00000455282;ENST00000304030	T;T	0.44482	0.92;0.92	0.575	0.575	0.17374	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.63954	0.2555	M	0.88906	2.99	0.33673	D	0.611198	D	0.89917	1.0	D	0.85130	0.997	T	0.70114	-0.4961	9	0.87932	D	0	.	6.7827	0.23654	0.0:0.0:0.0:1.0	.	419	Q8NDP4	ZN439_HUMAN	S	283;419	ENSP00000395632:F283S;ENSP00000305077:F419S	ENSP00000305077:F419S	F	+	2	0	ZNF439	11840140	1.000000	0.71417	0.016000	0.15963	0.049000	0.14656	4.420000	0.59841	0.485000	0.27652	0.163000	0.16589	TTC	.	.	none		0.453	ZNF439-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344513.1		
ZNF107	51427	hgsc.bcm.edu	37	7	64168429	64168429	+	Missense_Mutation	SNP	G	G	A	rs77575429	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr7:64168429G>A	ENST00000395391.1	+	4	3122	c.1747G>A	c.(1747-1749)Gaa>Aaa	p.E583K	ZNF107_ENST00000423627.1_Missense_Mutation_p.E583K|ZNF107_ENST00000344930.3_Missense_Mutation_p.E583K			Q9UII5	ZN107_HUMAN	zinc finger protein 107	583					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				CTACAAATTTGAAGAACATGG	0.343													g|||	4	0.000798722	0.0	0.0	5008	,	,		17991	0.0		0.004	False		,,,				2504	0.0				p.E583K		Atlas-SNP	.											.	ZNF107	107	.	0			c.G1747A						PASS	.	G	LYS/GLU,LYS/GLU	9,4389		0,9,2190	45.0	52.0	50.0		1747,1747	-2.1	0.0	7	dbSNP_131	50	61,8529		0,61,4234	yes	missense,missense	ZNF107	NM_001013746.1,NM_016220.3	56,56	0,70,6424	AA,AG,GG		0.7101,0.2046,0.539	possibly-damaging,possibly-damaging	583/784,583/784	64168429	70,12918	2199	4295	6494	SO:0001583	missense	51427	exon7			AAATTTGAAGAAC	AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.1747G>A	7.37:g.64168429G>A	ENSP00000378789:p.Glu583Lys	Somatic	183	0	0		WXS	Illumina HiSeq	Phase_I	126	27	0.214286	NM_016220		Missense_Mutation	SNP	ENST00000395391.1	37	CCDS5527.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	.	0.124	-1.121605	0.01785	0.002046	0.007101	ENSG00000196247	ENST00000344930;ENST00000423627;ENST00000395391	T;T;T	0.15256	2.44;2.44;2.44	1.27	-2.14	0.07123	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08802	0.0218	N	0.11000	0.08	0.09310	N	1	P	0.50819	0.939	P	0.57425	0.82	T	0.15809	-1.0424	8	.	.	.	.	2.6796	0.05090	0.4658:0.266:0.2682:0.0	.	583	Q9UII5	ZN107_HUMAN	K	583	ENSP00000343443:E583K;ENSP00000400037:E583K;ENSP00000378789:E583K	.	E	+	1	0	ZNF107	63805864	0.000000	0.05858	0.002000	0.10522	0.234000	0.25298	-5.878000	0.00093	-0.186000	0.10533	0.313000	0.20887	GAA	G|0.997;A|0.003	0.003	strong		0.343	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251593.1	NM_016220	
ABCB8	11194	hgsc.bcm.edu	37	7	150733637	150733637	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr7:150733637T>G	ENST00000297504.6	+	10	1235	c.1169T>G	c.(1168-1170)gTc>gGc	p.V390G	ABCB8_ENST00000477719.1_Missense_Mutation_p.V373G|ABCB8_ENST00000477092.1_Missense_Mutation_p.V373G|ABCB8_ENST00000542328.1_Missense_Mutation_p.V285G|ABCB8_ENST00000356058.4_Missense_Mutation_p.V410G|ABCB8_ENST00000498578.1_Missense_Mutation_p.V373G|ABCB8_ENST00000358849.4_Missense_Mutation_p.V373G			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	390	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	GCAGGCATGGTCTTGGGTACC	0.617																																					p.V373G		Atlas-SNP	.											.	ABCB8	65	.	0			c.T1118G						PASS	.						108.0	98.0	101.0					7																	150733637		2203	4300	6503	SO:0001583	missense	11194	exon9			GCATGGTCTTGGG	AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.1169T>G	7.37:g.150733637T>G	ENSP00000297504:p.Val390Gly	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	24	9	0.375	NM_007188	A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	ENST00000297504.6	37		.	.	.	.	.	.	.	.	.	.	T	20.6	4.020757	0.75275	.	.	ENSG00000197150	ENST00000358849;ENST00000360651;ENST00000297504;ENST00000542328;ENST00000498578;ENST00000356058;ENST00000477719;ENST00000477092	D;D;D;D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-2.63	5.17	5.17	0.71159	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95462	0.8526	M	0.86651	2.83	0.80722	D	1	D;D;D;D;D;D	0.89917	0.997;0.999;0.999;0.998;1.0;1.0	D;D;D;D;D;D	0.83275	0.958;0.991;0.991;0.984;0.996;0.996	D	0.95696	0.8745	10	0.56958	D	0.05	1.0E-4	12.955	0.58421	0.0:0.0:0.0:1.0	.	285;373;390;373;373;410	G3XAP3;A5D8W3;Q9NUT2;Q9NUT2-2;C9JTY4;E7ENE8	.;.;ABCB8_HUMAN;.;.;.	G	373;356;390;285;373;410;373;373	ENSP00000351717:V373G;ENSP00000297504:V390G;ENSP00000438776:V285G;ENSP00000418271:V373G;ENSP00000348353:V410G;ENSP00000419891:V373G;ENSP00000419558:V373G	ENSP00000297504:V390G	V	+	2	0	ABCB8	150364570	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	7.085000	0.76875	1.954000	0.56735	0.459000	0.35465	GTC	.	.	none		0.617	ABCB8-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351733.2	NM_007188	
ABHD2	11057	hgsc.bcm.edu	37	15	89694933	89694933	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr15:89694933A>G	ENST00000352732.5	+	4	740	c.220A>G	c.(220-222)Aaa>Gaa	p.K74E	ABHD2_ENST00000355100.3_Missense_Mutation_p.K74E|ABHD2_ENST00000565973.1_Missense_Mutation_p.K74E	NM_152924.4	NP_690888.1	P08910	ABHD2_HUMAN	abhydrolase domain containing 2	74					negative regulation of cell migration (GO:0030336)|response to wounding (GO:0009611)	integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|soft_tissue(1)	23	Lung NSC(78;0.0472)|all_lung(78;0.089)					GATCTGGGGGAAAAGTGGACA	0.458																																					p.K74E	Colon(11;252 417 24570 33239 41878)	Atlas-SNP	.											.	ABHD2	55	.	0			c.A220G						PASS	.						147.0	133.0	138.0					15																	89694933		2200	4299	6499	SO:0001583	missense	11057	exon8			TGGGGGAAAAGTG	X12433	CCDS10348.1	15q26.1	2006-10-06			ENSG00000140526	ENSG00000140526		"""Abhydrolase domain containing"""	18717	protein-coding gene	gene with protein product		612196					Standard	NM_152924		Approved	LABH2	uc002bnk.2	P08910	OTTHUMG00000148684	ENST00000352732.5:c.220A>G	15.37:g.89694933A>G	ENSP00000268129:p.Lys74Glu	Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	123	46	0.373984	NM_007011	Q53G48|Q53GU0|Q5FVD9|Q8TC79	Missense_Mutation	SNP	ENST00000352732.5	37	CCDS10348.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.288792	0.80914	.	.	ENSG00000140526	ENST00000352732;ENST00000355100	T;T	0.14144	2.53;2.53	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.20088	0.0483	L	0.60455	1.87	0.80722	D	1	P	0.39326	0.668	B	0.42188	0.379	T	0.01670	-1.1299	10	0.25106	T	0.35	-0.2077	16.5655	0.84588	1.0:0.0:0.0:0.0	.	74	P08910	ABHD2_HUMAN	E	74	ENSP00000268129:K74E;ENSP00000347217:K74E	ENSP00000268129:K74E	K	+	1	0	ABHD2	87495937	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.937000	0.92936	2.302000	0.77476	0.533000	0.62120	AAA	.	.	none		0.458	ABHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309074.2		
IRX2	153572	hgsc.bcm.edu	37	5	2749795	2749795	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:2749795T>C	ENST00000382611.6	-	2	604	c.356A>G	c.(355-357)aAg>aGg	p.K119R	C5orf38_ENST00000515640.1_5'Flank|C5orf38_ENST00000334000.3_5'Flank|IRX2_ENST00000502957.1_5'UTR|IRX2_ENST00000302057.5_Missense_Mutation_p.K119R|C5orf38_ENST00000457752.2_5'Flank|C5orf38_ENST00000397835.4_5'Flank|C5orf38_ENST00000505778.1_5'Flank	NM_001134222.1	NP_001127694.1	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	119					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)	26				GBM - Glioblastoma multiforme(108;0.204)		CGTGGCGTTCTTGCGGTACGC	0.667																																					p.K119R		Atlas-SNP	.											.	IRX2	60	.	0			c.A356G						PASS	.						125.0	99.0	108.0					5																	2749795		2203	4300	6503	SO:0001583	missense	153572	exon2			GCGTTCTTGCGGT	AF319967	CCDS3868.1	5p15.33	2011-06-20	2007-07-13		ENSG00000170561	ENSG00000170561		"""Homeoboxes / TALE class"""	14359	protein-coding gene	gene with protein product		606198				11435706	Standard	NM_033267		Approved		uc003jdb.3	Q9BZI1	OTTHUMG00000090377	ENST00000382611.6:c.356A>G	5.37:g.2749795T>C	ENSP00000372056:p.Lys119Arg	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	137	28	0.20438	NM_001134222	Q68A19|Q7Z2I7	Missense_Mutation	SNP	ENST00000382611.6	37	CCDS3868.1	.	.	.	.	.	.	.	.	.	.	T	33	5.248878	0.95305	.	.	ENSG00000170561	ENST00000382611;ENST00000302057;ENST00000502957	D;D;D	0.83419	-1.72;-1.72;-1.72	4.85	4.85	0.62838	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.88948	0.6576	M	0.82193	2.58	0.80722	D	1	P	0.44478	0.836	P	0.53490	0.727	D	0.88990	0.3414	10	0.40728	T	0.16	-25.838	14.441	0.67318	0.0:0.0:0.0:1.0	.	119	Q9BZI1	IRX2_HUMAN	R	119;119;26	ENSP00000372056:K119R;ENSP00000307006:K119R;ENSP00000426151:K26R	ENSP00000307006:K119R	K	-	2	0	IRX2	2802795	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.663000	0.83820	1.817000	0.53016	0.533000	0.62120	AAG	.	.	none		0.667	IRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206749.2		
FAM178B	51252	hgsc.bcm.edu	37	2	97637661	97637661	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:97637661T>C	ENST00000417561.3	-	7	984	c.985A>G	c.(985-987)Agc>Ggc	p.S329G	FAM178B_ENST00000490605.2_Missense_Mutation_p.S181G|FAM178B_ENST00000327896.3_Missense_Mutation_p.S149G			Q8IXR5	F178B_HUMAN	family with sequence similarity 178, member B	329										large_intestine(1)|ovary(1)	2						GCCTGCTGGCTCAGGCCTGAC	0.617																																					p.S181G		Atlas-SNP	.											.	FAM178B	35	.	0			c.A541G						PASS	.						16.0	26.0	23.0					2																	97637661		692	1590	2282	SO:0001583	missense	51252	exon3			GCTGGCTCAGGCC	AF151068, BC039488	CCDS33252.1, CCDS46366.1, CCDS46366.2	2q11.2	2008-08-08			ENSG00000168754	ENSG00000168754			28036	protein-coding gene	gene with protein product						11042152	Standard	NM_001122646		Approved	LOC51252	uc002sxl.4	Q8IXR5	OTTHUMG00000155257	ENST00000417561.3:c.985A>G	2.37:g.97637661T>C	ENSP00000413245:p.Ser329Gly	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	124	46	0.370968	NM_001122646	A8MXN2|E9PD86|Q8IUY0|Q9P0P4	Missense_Mutation	SNP	ENST00000417561.3	37		.	.	.	.	.	.	.	.	.	.	T	9.337	1.062118	0.19987	.	.	ENSG00000168754	ENST00000417561;ENST00000327896;ENST00000490605	T;T;T	0.51574	0.7;0.77;0.75	4.23	1.8	0.24995	.	1.317100	0.05971	U	0.642372	T	0.30727	0.0774	L	0.29908	0.895	0.09310	N	1	.	.	.	.	.	.	T	0.21793	-1.0235	8	0.11485	T	0.65	-1.5505	2.919	0.05762	0.212:0.1255:0.0:0.6625	.	.	.	.	G	329;149;181	ENSP00000413245:S329G;ENSP00000333553:S149G;ENSP00000429896:S181G	ENSP00000333553:S149G	S	-	1	0	FAM178B	97001388	0.007000	0.16637	0.002000	0.10522	0.008000	0.06430	1.048000	0.30379	0.393000	0.25203	-0.336000	0.08194	AGC	.	.	none		0.617	FAM178B-202	KNOWN	basic	protein_coding	protein_coding		NM_016490	
METTL16	79066	hgsc.bcm.edu	37	17	2371109	2371109	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr17:2371109G>C	ENST00000263092.6	-	5	658	c.531C>G	c.(529-531)atC>atG	p.I177M	METTL16_ENST00000538844.1_Intron|METTL16_ENST00000571669.2_5'UTR	NM_024086.3	NP_076991.3	Q86W50	MET16_HUMAN	methyltransferase like 16	177							methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(9)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	19						AAAAGTCATAGATTATCTCAG	0.388																																					p.I177M		Atlas-SNP	.											.	METTL16	75	.	0			c.C531G						PASS	.						119.0	109.0	112.0					17																	2371109		1852	4093	5945	SO:0001583	missense	79066	exon5			GTCATAGATTATC	AK027410	CCDS42232.1	17p13.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000127804	ENSG00000127804			28484	protein-coding gene	gene with protein product			"""methyltransferase 10 domain containing"""	METT10D		18021804	Standard	NM_024086		Approved	MGC3329	uc002fut.3	Q86W50		ENST00000263092.6:c.531C>G	17.37:g.2371109G>C	ENSP00000263092:p.Ile177Met	Somatic	228	0	0		WXS	Illumina HiSeq	Phase_I	176	37	0.210227	NM_024086	D3DTI8|Q86TE5|Q96T16|Q9BVG7	Missense_Mutation	SNP	ENST00000263092.6	37	CCDS42232.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.680847	0.29872	.	.	ENSG00000127804	ENST00000263092;ENST00000399834	T	0.16897	2.31	5.45	0.758	0.18432	.	0.104656	0.64402	D	0.000004	T	0.08268	0.0206	N	0.10916	0.065	0.80722	D	1	B;B	0.27264	0.003;0.173	B;B	0.32022	0.005;0.139	T	0.26883	-1.0090	10	0.33141	T	0.24	-15.0476	6.5513	0.22436	0.5681:0.0:0.4319:0.0	.	177;177	Q86W50-2;Q86W50	.;MET16_HUMAN	M	177	ENSP00000263092:I177M	ENSP00000263092:I177M	I	-	3	3	METTL16	2317859	0.998000	0.40836	0.999000	0.59377	0.974000	0.67602	0.534000	0.23098	0.281000	0.22233	0.491000	0.48974	ATC	.	.	none		0.388	METTL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437653.2	NM_024086	
ZNF814	730051	hgsc.bcm.edu	37	19	58385799	58385799	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:58385799C>T	ENST00000435989.2	-	3	1193	c.959G>A	c.(958-960)gGg>gAg	p.G320E	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	320					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G320E(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AGGTCTTTTCCCAGTGTGAAC	0.358																																					p.G320E		Atlas-SNP	.											ZNF814,brain,primitive_neuroectodermal_tumour-medulloblastoma,+1,2	ZNF814	93	2	1	Substitution - Missense(1)	central_nervous_system(1)	c.G959A						PASS	.						14.0	11.0	12.0					19																	58385799		687	1560	2247	SO:0001583	missense	730051	exon3			CTTTTCCCAGTGT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.959G>A	19.37:g.58385799C>T	ENSP00000410545:p.Gly320Glu	Somatic	197	0	0		WXS	Illumina HiSeq	Phase_I	192	21	0.109375	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	7.488	0.650166	0.14516	.	.	ENSG00000204514	ENST00000435989	T	0.25749	1.78	2.37	-4.23	0.03789	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29389	0.0732	L	0.41824	1.3	0.09310	N	0.999992	D	0.76494	0.999	D	0.65573	0.936	T	0.23261	-1.0193	9	0.66056	D	0.02	.	2.112	0.03705	0.1507:0.4859:0.1487:0.2147	.	320	B7Z6K7	ZN814_HUMAN	E	320	ENSP00000410545:G320E	ENSP00000410545:G320E	G	-	2	0	ZNF814	63077611	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.267000	0.08619	-0.341000	0.08376	-3.844000	0.00018	GGG	.	.	none		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
DTX3L	151636	hgsc.bcm.edu	37	3	122288596	122288596	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:122288596G>C	ENST00000296161.4	+	3	1849	c.1660G>C	c.(1660-1662)Gac>Cac	p.D554H	DTX3L_ENST00000383661.3_Intron	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	554					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		CTCAGAACTGGACAAGAAGGA	0.468																																					p.D554H		Atlas-SNP	.											.	DTX3L	59	.	0			c.G1660C						PASS	.						76.0	79.0	78.0					3																	122288596		2203	4300	6503	SO:0001583	missense	151636	exon3			GAACTGGACAAGA		CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.1660G>C	3.37:g.122288596G>C	ENSP00000296161:p.Asp554His	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	81	29	0.358025	NM_138287	B3KWH6|Q53ZZ3|Q5MJP7	Missense_Mutation	SNP	ENST00000296161.4	37	CCDS3015.1	.	.	.	.	.	.	.	.	.	.	G	6.614	0.481645	0.12581	.	.	ENSG00000163840	ENST00000296161	T	0.68765	-0.35	1.83	0.902	0.19290	.	0.659026	0.14112	N	0.340641	T	0.57036	0.2026	L	0.57536	1.79	0.21697	N	0.99958	B	0.26635	0.155	B	0.27887	0.084	T	0.46898	-0.9158	10	0.33940	T	0.23	-3.1283	6.0444	0.19752	0.0:0.3269:0.6731:0.0	.	554	Q8TDB6	DTX3L_HUMAN	H	554	ENSP00000296161:D554H	ENSP00000296161:D554H	D	+	1	0	DTX3L	123771286	0.175000	0.23083	0.031000	0.17742	0.128000	0.20619	0.852000	0.27764	0.304000	0.22809	-0.315000	0.08773	GAC	.	.	none		0.468	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355966.1	NM_138287	
SWAP70	23075	hgsc.bcm.edu	37	11	9761816	9761816	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr11:9761816A>G	ENST00000318950.6	+	9	1380	c.1277A>G	c.(1276-1278)tAc>tGc	p.Y426C	SWAP70_ENST00000447399.2_Missense_Mutation_p.Y368C	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit	426					isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		GAAGACATGTACCTAAAGCTG	0.493																																					p.Y426C		Atlas-SNP	.											.	SWAP70	40	.	0			c.A1277G						PASS	.						102.0	97.0	98.0					11																	9761816		2201	4294	6495	SO:0001583	missense	23075	exon9			ACATGTACCTAAA	AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.1277A>G	11.37:g.9761816A>G	ENSP00000315630:p.Tyr426Cys	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	67	25	0.373134	NM_015055	D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	Missense_Mutation	SNP	ENST00000318950.6	37	CCDS31426.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.948666	0.73787	.	.	ENSG00000133789	ENST00000447399;ENST00000318950	T;T	0.21734	1.99;1.99	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.43010	0.1228	L	0.56769	1.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.997	T	0.22173	-1.0224	10	0.45353	T	0.12	-10.3002	15.2595	0.73610	1.0:0.0:0.0:0.0	.	368;426;368	E7EMB1;Q9UH65;B3KUB9	.;SWP70_HUMAN;.	C	368;426	ENSP00000399056:Y368C;ENSP00000315630:Y426C	ENSP00000315630:Y426C	Y	+	2	0	SWAP70	9718392	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	8.962000	0.93254	2.006000	0.58801	0.402000	0.26972	TAC	.	.	none		0.493	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386766.2	NM_015055	
GRIN2B	2904	hgsc.bcm.edu	37	12	13717016	13717016	+	Silent	SNP	G	G	A	rs543452359		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:13717016G>A	ENST00000609686.1	-	13	3365	c.3156C>T	c.(3154-3156)caC>caT	p.H1052H		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1052					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCAAGTCGTCGTGGCCACTGT	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		17988	0.001		0.0	False		,,,				2504	0.0				p.H1052H		Atlas-SNP	.											.	GRIN2B	303	.	0			c.C3156T						PASS	.						61.0	52.0	55.0					12																	13717016		2203	4300	6503	SO:0001819	synonymous_variant	2904	exon13			GTCGTCGTGGCCA		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3156C>T	12.37:g.13717016G>A		Somatic	248	0	0		WXS	Illumina HiSeq	Phase_I	167	27	0.161677	NM_000834	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	ENST00000609686.1	37	CCDS8662.1																																																																																			.	.	none		0.572	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2		
ANO3	63982	hgsc.bcm.edu	37	11	26538445	26538445	+	Silent	SNP	A	A	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr11:26538445A>C	ENST00000256737.3	+	6	1515	c.663A>C	c.(661-663)gcA>gcC	p.A221A	ANO3_ENST00000537978.1_Silent_p.A205A|ANO3_ENST00000525139.1_Silent_p.A205A|ANO3_ENST00000531568.1_Silent_p.A75A	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	221					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						GCAAGTATGCAGAGAGGCTGA	0.363																																					p.A221A		Atlas-SNP	.											.	ANO3	145	.	0			c.A663C						PASS	.						84.0	83.0	84.0					11																	26538445		2203	4299	6502	SO:0001819	synonymous_variant	63982	exon6			GTATGCAGAGAGG	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.663A>C	11.37:g.26538445A>C		Somatic	218	0	0		WXS	Illumina HiSeq	Phase_I	182	55	0.302198	NM_031418	B7Z3F5	Silent	SNP	ENST00000256737.3	37	CCDS31447.1																																																																																			.	.	none		0.363	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	NM_031418	
HIST4H4	121504	hgsc.bcm.edu	37	12	14923847	14923847	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:14923847C>G	ENST00000539745.1	-	1	218	c.172G>C	c.(172-174)Gtc>Ctc	p.V58L	RP11-174G6.5_ENST00000562691.2_RNA|HIST4H4_ENST00000541592.1_5'Flank	NM_175054.2	NP_778224.1	P62805	H4_HUMAN	histone cluster 4, H4	58					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)	6						ACTTTGAGGACTCCCCGGGTC	0.597											OREG0021698	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V58L		Atlas-SNP	.											.	HIST4H4	13	.	0			c.G172C						PASS	.						83.0	70.0	74.0					12																	14923847		2203	4300	6503	SO:0001583	missense	121504	exon1			TGAGGACTCCCCG	AY128653	CCDS8665.1	12p12.3	2011-01-27	2006-10-11			ENSG00000197837		"""Histones / Replication-dependent"""	20510	protein-coding gene	gene with protein product		615069	"""histone 4, H4"""			12408966	Standard	NM_175054		Approved	MGC24116	uc001rcf.4	P62805		ENST00000539745.1:c.172G>C	12.37:g.14923847C>G	ENSP00000443017:p.Val58Leu	Somatic	116	0	0	698	WXS	Illumina HiSeq	Phase_I	83	12	0.144578	NM_175054	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000539745.1	37	CCDS8665.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442037	0.83993	.	.	ENSG00000197837	ENST00000539745	T	0.71222	-0.55	4.08	4.08	0.47627	.	0.000000	0.39407	U	0.001377	T	0.79551	0.4465	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.82265	-0.0543	7	0.66056	D	0.02	.	14.2139	0.65781	0.0:1.0:0.0:0.0	.	.	.	.	L	58	ENSP00000443017:V58L	ENSP00000350767:V58L	V	-	1	0	HIST4H4	14815114	1.000000	0.71417	0.694000	0.30210	0.948000	0.59901	5.385000	0.66231	2.285000	0.76669	0.585000	0.79938	GTC	.	.	none		0.597	HIST4H4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400844.1	NM_175054	
AR	367	hgsc.bcm.edu	37	X	66937418	66937418	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:66937418G>C	ENST00000374690.3	+	5	2796	c.2272G>C	c.(2272-2274)Gtc>Ctc	p.V758L	AR_ENST00000396044.3_Intron|AR_ENST00000396043.2_Missense_Mutation_p.V226L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	757	Interaction with KAT7.|Interaction with LPXN.|Ligand-binding.		N -> T (in PAIS; 50% reduction in transactivation). {ECO:0000269|PubMed:9607727}.		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTTCACCAATGTCAACTCCAG	0.537									Androgen Insensitivity Syndrome																												p.V758L		Atlas-SNP	.											.	AR	249	.	0			c.G2272C						PASS	.						141.0	99.0	113.0					X																	66937418		2203	4300	6503	SO:0001583	missense	367	exon5	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	ACCAATGTCAACT	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2272G>C	X.37:g.66937418G>C	ENSP00000363822:p.Val758Leu	Somatic	168	0	0		WXS	Illumina HiSeq	Phase_I	109	15	0.137615	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	37	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	g	16.67	3.187222	0.57909	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000396043	D;D	0.96136	-3.92;-3.92	5.09	5.09	0.68999	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.060824	0.64402	D	0.000003	D	0.95072	0.8404	M	0.63428	1.95	0.80722	D	1	B;D	0.54207	0.005;0.965	B;P	0.47673	0.02;0.554	D	0.95438	0.8523	10	0.72032	D	0.01	.	14.7147	0.69259	0.0:0.0:1.0:0.0	.	226;757	F1D8N5;P10275	.;ANDR_HUMAN	L	568;758;226	ENSP00000363822:V758L;ENSP00000379358:V226L	ENSP00000363822:V758L	V	+	1	0	AR	66854143	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.449000	0.73473	2.351000	0.79841	0.597000	0.82753	GTC	.	.	none		0.537	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
MTMR1	8776	hgsc.bcm.edu	37	X	149899968	149899968	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:149899968A>G	ENST00000370390.3	+	8	901	c.744A>G	c.(742-744)atA>atG	p.I248M	MTMR1_ENST00000542156.1_Missense_Mutation_p.I248M|MTMR1_ENST00000451863.2_Missense_Mutation_p.I248M|MTMR1_ENST00000445323.2_Missense_Mutation_p.I256M|MTMR1_ENST00000541925.1_Missense_Mutation_p.I154M|MTMR1_ENST00000538506.1_Missense_Mutation_p.I135M|MTMR1_ENST00000544228.1_Missense_Mutation_p.I248M	NM_003828.2	NP_003819.1	Q13613	MTMR1_HUMAN	myotubularin related protein 1	248	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					GTTGGAAAATATCCAAAATAA	0.388																																					p.I248M		Atlas-SNP	.											.	MTMR1	82	.	0			c.A744G						PASS	.						128.0	122.0	124.0					X																	149899968		2203	4300	6503	SO:0001583	missense	8776	exon8			GAAAATATCCAAA	U58032	CCDS14695.1	Xq28	2011-06-09			ENSG00000063601	ENSG00000063601		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7449	protein-coding gene	gene with protein product		300171				9828128	Standard	XM_005274765		Approved		uc004fei.3	Q13613	OTTHUMG00000024159	ENST00000370390.3:c.744A>G	X.37:g.149899968A>G	ENSP00000359417:p.Ile248Met	Somatic	317	0	0		WXS	Illumina HiSeq	Phase_I	219	74	0.3379	NM_003828	A0A024RC07|Q9UBX6|Q9UEM0|Q9UQD5	Missense_Mutation	SNP	ENST00000370390.3	37	CCDS14695.1	.	.	.	.	.	.	.	.	.	.	A	14.92	2.678394	0.47886	.	.	ENSG00000063601	ENST00000541925;ENST00000542156;ENST00000370390;ENST00000445323;ENST00000544228;ENST00000451863;ENST00000538506	D;D;D;D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5;-3.5;-3.5;-2.85	5.78	1.79	0.24919	Myotubularin phosphatase domain (1);	0.038960	0.85682	D	0.000000	D	0.92996	0.7771	M	0.82433	2.59	0.51767	D	0.999939	B;P;B	0.40180	0.218;0.705;0.368	B;B;B	0.35510	0.09;0.186;0.204	D	0.89151	0.3523	9	.	.	.	.	12.7558	0.57335	0.613:0.387:0.0:0.0	.	248;256;248	Q13613;F8WA39;Q8NEC6	MTMR1_HUMAN;.;.	M	154;248;248;256;248;248;135	ENSP00000441879:I154M;ENSP00000445281:I248M;ENSP00000359417:I248M;ENSP00000414178:I256M;ENSP00000440534:I248M;ENSP00000387446:I248M;ENSP00000443444:I135M	.	I	+	3	3	MTMR1	149650626	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	1.089000	0.30890	0.013000	0.14918	0.441000	0.28932	ATA	.	.	none		0.388	MTMR1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060863.2	NM_003828, NM_176789	
DCLK1	9201	hgsc.bcm.edu	37	13	36428729	36428729	+	Splice_Site	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr13:36428729A>G	ENST00000360631.3	-	6	1153	c.942T>C	c.(940-942)gtT>gtC	p.V314V	DCLK1_ENST00000379893.1_Splice_Site_p.V7V|DCLK1_ENST00000255448.4_Splice_Site_p.V314V|DCLK1_ENST00000460982.1_5'UTR|DCLK1_ENST00000379892.4_Splice_Site_p.V314V			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	314	Pro/Ser-rich.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		GGGTTCCATTAACTAGAAATA	0.453																																					p.V314V		Atlas-SNP	.											.	DCLK1	350	.	0			c.T942C						PASS	.						74.0	74.0	74.0					13																	36428729		2203	4300	6503	SO:0001630	splice_region_variant	9201	exon6			TCCATTAACTAGA	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.941-1T>C	13.37:g.36428729A>G		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	82	21	0.256098	NM_004734	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Silent	SNP	ENST00000360631.3	37																																																																																				.	.	none		0.453	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	Silent
RAB9A	9367	hgsc.bcm.edu	37	X	13727323	13727323	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:13727323C>T	ENST00000464506.1	+	3	737	c.458C>T	c.(457-459)aCa>aTa	p.T153I	RAB9A_ENST00000243325.5_3'UTR	NM_001195328.1|NM_004251.4	NP_001182257.1|NP_004242.1	P51151	RAB9A_HUMAN	RAB9A, member RAS oncogene family	153					GTP catabolic process (GO:0006184)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	7						TATTTTGAAACAAGTGCAAAA	0.473																																					p.T153I		Atlas-SNP	.											.	RAB9A	17	.	0			c.C458T						PASS	.						93.0	94.0	93.0					X																	13727323		2203	4300	6503	SO:0001583	missense	9367	exon3			TTGAAACAAGTGC	U44103	CCDS14156.1	Xp22.2	2010-04-19	2007-01-15	2007-01-15	ENSG00000123595	ENSG00000123595		"""RAB, member RAS oncogene"""	9792	protein-coding gene	gene with protein product		300284	"""RAB9, member RAS oncogene family"""	RAB9		9126495	Standard	NM_004251		Approved		uc010neh.3	P51151	OTTHUMG00000021156	ENST00000464506.1:c.458C>T	X.37:g.13727323C>T	ENSP00000420127:p.Thr153Ile	Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	145	22	0.151724	NM_004251	A8K390|Q6ICN1	Missense_Mutation	SNP	ENST00000464506.1	37	CCDS14156.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.398162	0.83120	.	.	ENSG00000123595	ENST00000464506	T	0.80653	-1.4	5.51	5.51	0.81932	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90590	0.7050	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91021	0.4857	9	.	.	.	-12.6253	18.4388	0.90656	0.0:1.0:0.0:0.0	.	153	P51151	RAB9A_HUMAN	I	153	ENSP00000420127:T153I	.	T	+	2	0	RAB9A	13637244	1.000000	0.71417	0.987000	0.45799	0.901000	0.52897	7.618000	0.83043	2.296000	0.77279	0.594000	0.82650	ACA	.	.	none		0.473	RAB9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055802.1	NM_004251	
DGCR2	9993	hgsc.bcm.edu	37	22	19029399	19029399	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr22:19029399G>A	ENST00000263196.7	-	8	1327	c.1080C>T	c.(1078-1080)atC>atT	p.I360I	DGCR2_ENST00000545799.1_3'UTR|DGCR2_ENST00000537045.1_Silent_p.I319I	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	360					cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					GCAGTGACAGGATGAGGAAGG	0.627																																					p.I360I		Atlas-SNP	.											.	DGCR2	45	.	0			c.C1080T						PASS	.						90.0	72.0	78.0					22																	19029399		2203	4300	6503	SO:0001819	synonymous_variant	9993	exon8			TGACAGGATGAGG	D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.1080C>T	22.37:g.19029399G>A		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	64	21	0.328125	NM_005137	A6NIB5|A8K6K5|B5TY34|B7Z935	Silent	SNP	ENST00000263196.7	37	CCDS33598.1																																																																																			.	.	none		0.627	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316504.1	NM_005137	
RHOBTB2	23221	hgsc.bcm.edu	37	8	22865187	22865187	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr8:22865187G>A	ENST00000251822.6	+	5	1966	c.1429G>A	c.(1429-1431)Gag>Aag	p.E477K	RP11-875O11.1_ENST00000502083.2_RNA|RHOBTB2_ENST00000519685.1_Missense_Mutation_p.E499K|RP11-875O11.1_ENST00000523884.1_RNA|RHOBTB2_ENST00000522948.1_Missense_Mutation_p.E484K	NM_015178.2	NP_055993.2	Q9BYZ6	RHBT2_HUMAN	Rho-related BTB domain containing 2	477					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	31		Prostate(55;0.0513)|Breast(100;0.214)		Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		CATGAACCAGGAGATCACCAA	0.542																																					p.E499K		Atlas-SNP	.											.	RHOBTB2	67	.	0			c.G1495A						PASS	.						106.0	103.0	104.0					8																	22865187		2203	4300	6503	SO:0001583	missense	23221	exon7			AACCAGGAGATCA	AF315385	CCDS6034.1, CCDS55210.1, CCDS55211.1	8p21.2	2013-01-08			ENSG00000008853	ENSG00000008853		"""BTB/POZ domain containing"""	18756	protein-coding gene	gene with protein product		607352				11222756	Standard	NM_001160036		Approved	KIAA0717, DBC2	uc011kzp.1	Q9BYZ6	OTTHUMG00000097827	ENST00000251822.6:c.1429G>A	8.37:g.22865187G>A	ENSP00000251822:p.Glu477Lys	Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	47	12	0.255319	NM_001160036	A8K9Z8|D3DSR8|E9PBU2|E9PEI7|O94825|Q8N4A8|Q9BZK6	Missense_Mutation	SNP	ENST00000251822.6	37	CCDS6034.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.453804	0.84209	.	.	ENSG00000008853	ENST00000519685;ENST00000522948;ENST00000251822	T;T;T	0.10573	2.86;2.87;2.87	5.35	4.47	0.54385	BTB/POZ fold (1);	0.000000	0.85682	D	0.000000	T	0.34919	0.0914	M	0.82323	2.585	0.58432	D	0.999991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.14448	-1.0472	10	0.72032	D	0.01	.	13.2086	0.59811	0.0797:0.0:0.9203:0.0	.	484;477;499	E9PEI7;Q9BYZ6;E9PBU2	.;RHBT2_HUMAN;.	K	499;484;477	ENSP00000427926:E499K;ENSP00000429141:E484K;ENSP00000251822:E477K	ENSP00000251822:E477K	E	+	1	0	RHOBTB2	22921132	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.781000	0.99029	2.476000	0.83614	0.655000	0.94253	GAG	.	.	none		0.542	RHOBTB2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215101.2		
ENOSF1	55556	hgsc.bcm.edu	37	18	697244	697244	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr18:697244C>A	ENST00000251101.7	-	3	393	c.305G>T	c.(304-306)aGa>aTa	p.R102I	ENOSF1_ENST00000383578.3_Intron|ENOSF1_ENST00000340116.7_Missense_Mutation_p.R123I|ENOSF1_ENST00000539164.1_Missense_Mutation_p.R102I|ENOSF1_ENST00000580982.1_Intron	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1	102					cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						CCTTACCCATCTGAGCTGCCC	0.448																																					p.R123I		Atlas-SNP	.											.	ENOSF1	44	.	0			c.G368T						PASS	.						223.0	228.0	226.0					18																	697244		2203	4300	6503	SO:0001583	missense	55556	exon3			ACCCATCTGAGCT	X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.305G>T	18.37:g.697244C>A	ENSP00000251101:p.Arg102Ile	Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	141	50	0.35461	NM_202758	A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Missense_Mutation	SNP	ENST00000251101.7	37	CCDS11822.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.947632	0.92593	.	.	ENSG00000132199	ENST00000251101;ENST00000340116;ENST00000539164	T;T;T	0.50001	0.76;0.76;0.76	5.43	5.43	0.79202	Mandelate racemase/muconate lactonizing enzyme, N-terminal (1);	0.105878	0.64402	D	0.000001	T	0.79046	0.4380	H	0.95043	3.615	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.99;0.996	D	0.85450	0.1160	10	0.87932	D	0	.	18.1826	0.89783	0.0:1.0:0.0:0.0	.	123;147;102	A6NMP3;Q6ZS08;Q7L5Y1	.;.;ENOF1_HUMAN	I	102;123;102	ENSP00000251101:R102I;ENSP00000345974:R123I;ENSP00000446321:R102I	ENSP00000251101:R102I	R	-	2	0	ENOSF1	687244	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.550000	0.60733	2.595000	0.87683	0.644000	0.83932	AGA	.	.	none		0.448	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254312.2	NM_017512	
OR56A3	390083	hgsc.bcm.edu	37	11	5968801	5968801	+	Missense_Mutation	SNP	C	C	G	rs200944882		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr11:5968801C>G	ENST00000329564.6	+	1	232	c.225C>G	c.(223-225)atC>atG	p.I75M	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGCTGGACATCGTGCTCTGCC	0.592																																					p.I75M		Atlas-SNP	.											.	OR56A3	81	.	0			c.C225G						PASS	.						143.0	138.0	140.0					11																	5968801		2201	4296	6497	SO:0001583	missense	390083	exon1			GGACATCGTGCTC		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.225C>G	11.37:g.5968801C>G	ENSP00000331572:p.Ile75Met	Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	142	57	0.401408	NM_001003443	A6NN77|Q6IFF7	Missense_Mutation	SNP	ENST00000329564.6	37	CCDS41614.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.606553	0.00121	.	.	ENSG00000184478	ENST00000329564	T	0.04809	3.55	5.13	-10.3	0.00346	GPCR, rhodopsin-like superfamily (1);	0.200388	0.34628	N	0.003816	T	0.02688	0.0081	L	0.31120	0.905	0.18873	N	0.999985	B	0.19073	0.033	B	0.23419	0.046	T	0.54788	-0.8241	10	0.72032	D	0.01	-6.3985	4.617	0.12432	0.1316:0.3919:0.315:0.1615	.	75	Q8NH54	O56A3_HUMAN	M	75	ENSP00000331572:I75M	ENSP00000331572:I75M	I	+	3	3	OR56A3	5925377	0.000000	0.05858	0.001000	0.08648	0.733000	0.41908	-7.065000	0.00045	-6.004000	0.00007	-1.847000	0.00572	ATC	C|1.000;T|0.000	.	alt		0.592	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383753.1	NM_001003443	
TRIM51	84767	hgsc.bcm.edu	37	11	55655597	55655597	+	Silent	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr11:55655597A>G	ENST00000449290.2	+	4	689	c.597A>G	c.(595-597)gaA>gaG	p.E199E	TRIM51_ENST00000244891.3_Silent_p.E56E	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	199						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										ATCACTTGGAAAGGCTGCGAA	0.433																																					p.E199E		Atlas-SNP	.											SPRYD5_ENST00000327733,NS,carcinoma,+2,2	.	.	2	0			c.A597G						scavenged	.						61.0	58.0	59.0					11																	55655597		2201	4296	6497	SO:0001819	synonymous_variant	84767	exon4			CTTGGAAAGGCTG	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.597A>G	11.37:g.55655597A>G		Somatic	448	16	0.0357143		WXS	Illumina HiSeq	Phase_I	378	19	0.0502645	NM_032681	A6NMG2	Silent	SNP	ENST00000449290.2	37																																																																																				.	.	none		0.433	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	
ATP10B	23120	hgsc.bcm.edu	37	5	160025799	160025799	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:160025799T>G	ENST00000327245.5	-	22	4388	c.3542A>C	c.(3541-3543)tAc>tCc	p.Y1181S		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1181					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCCACTCTTGTATAGCTCAGG	0.493																																					p.Y1181S		Atlas-SNP	.											.	ATP10B	201	.	0			c.A3542C						PASS	.						268.0	254.0	258.0					5																	160025799		1939	4133	6072	SO:0001583	missense	23120	exon22			CTCTTGTATAGCT	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.3542A>C	5.37:g.160025799T>G	ENSP00000313600:p.Tyr1181Ser	Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	117	14	0.119658	NM_025153	Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.698292	0.88830	.	.	ENSG00000118322	ENST00000327245	T	0.75821	-0.97	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.92622	0.7656	H	0.99770	4.765	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95706	0.8753	9	.	.	.	.	14.8727	0.70471	0.0:0.0:0.0:1.0	.	1181	O94823	AT10B_HUMAN	S	1181	ENSP00000313600:Y1181S	.	Y	-	2	0	ATP10B	159958377	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	7.946000	0.87746	2.107000	0.64212	0.533000	0.62120	TAC	.	.	none		0.493	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
DRC1	92749	hgsc.bcm.edu	37	2	26652610	26652610	+	Missense_Mutation	SNP	C	C	T	rs577516330	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:26652610C>T	ENST00000288710.2	+	5	729	c.655C>T	c.(655-657)Cgt>Tgt	p.R219C		NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	219					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)											GAAAACCTTTCGTGAGGAGCT	0.473													C|||	6	0.00119808	0.0	0.0	5008	,	,		17363	0.0		0.0	False		,,,				2504	0.0061				p.R219C		Atlas-SNP	.											.	CCDC164	84	.	0			c.C655T						PASS	.						108.0	107.0	107.0					2																	26652610		2203	4300	6503	SO:0001583	missense	92749	exon5			ACCTTTCGTGAGG	AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.655C>T	2.37:g.26652610C>T	ENSP00000288710:p.Arg219Cys	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	96	32	0.333333	NM_145038	A8K1N8|Q53R91|Q53TA3|Q8NDI5	Missense_Mutation	SNP	ENST00000288710.2	37	CCDS1723.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.987275	0.53934	.	.	ENSG00000157856	ENST00000288710	T	0.17528	2.27	5.35	5.35	0.76521	.	0.053346	0.64402	D	0.000001	T	0.41880	0.1178	M	0.83012	2.62	0.50313	D	0.99986	D	0.71674	0.998	P	0.62813	0.907	T	0.40979	-0.9534	10	0.87932	D	0	-10.8199	12.8901	0.58066	0.1629:0.8371:0.0:0.0	.	219	Q96MC2	CC164_HUMAN	C	219	ENSP00000288710:R219C	ENSP00000288710:R219C	R	+	1	0	CCDC164	26506114	0.848000	0.29623	0.782000	0.31804	0.377000	0.30045	1.849000	0.39318	2.506000	0.84524	0.563000	0.77884	CGT	.	.	none		0.473	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246862.1	NM_145038	
SRM	6723	hgsc.bcm.edu	37	1	11115065	11115065	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:11115065G>C	ENST00000376957.2	-	7	922	c.842C>G	c.(841-843)tCc>tGc	p.S281C		NM_003132.2	NP_003123.2	P19623	SPEE_HUMAN	spermidine synthase	281					cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)|spermidine synthase activity (GO:0004766)			large_intestine(1)|lung(1)|urinary_tract(1)	3	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.228)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)	S-Adenosylmethionine(DB00118)	GTGCACGTCGGAGTTGTAGTA	0.682																																					p.S281C		Atlas-SNP	.											SRM,NS,carcinoma,+1,1	SRM	18	1	0			c.C842G						PASS	.						41.0	44.0	43.0					1																	11115065		2203	4300	6503	SO:0001583	missense	6723	exon7			ACGTCGGAGTTGT	BC033106	CCDS125.1	1p36-p22	2010-11-08			ENSG00000116649	ENSG00000116649	2.5.1.16		11296	protein-coding gene	gene with protein product		182891		SRML1		2344393	Standard	NM_003132		Approved	SPS1	uc001arz.1	P19623	OTTHUMG00000002119	ENST00000376957.2:c.842C>G	1.37:g.11115065G>C	ENSP00000366156:p.Ser281Cys	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	118	20	0.169492	NM_003132	B1AKP9|Q15511	Missense_Mutation	SNP	ENST00000376957.2	37	CCDS125.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357565	0.82243	.	.	ENSG00000116649	ENST00000376957	T	0.77098	-1.07	5.29	4.38	0.52667	.	0.244273	0.42821	D	0.000659	D	0.87297	0.6142	M	0.90483	3.12	0.54753	D	0.99998	D	0.71674	0.998	P	0.57101	0.813	D	0.89582	0.3821	10	0.87932	D	0	.	12.9435	0.58359	0.0784:0.0:0.9216:0.0	.	281	P19623	SPEE_HUMAN	C	281	ENSP00000366156:S281C	ENSP00000366156:S281C	S	-	2	0	SRM	11037652	1.000000	0.71417	0.225000	0.23894	0.864000	0.49448	9.099000	0.94207	1.226000	0.43582	0.561000	0.74099	TCC	.	.	none		0.682	SRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006056.1	NM_003132	
ZNF814	730051	hgsc.bcm.edu	37	19	58385798	58385798	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:58385798C>T	ENST00000435989.2	-	3	1194	c.960G>A	c.(958-960)ggG>ggA	p.G320G	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	320					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G320G(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AAGGTCTTTTCCCAGTGTGAA	0.353																																					p.G320G		Atlas-SNP	.											ZNF814,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,2	ZNF814	93	2	1	Substitution - coding silent(1)	central_nervous_system(1)	c.G960A						scavenged	.						14.0	11.0	12.0					19																	58385798		687	1560	2247	SO:0001819	synonymous_variant	730051	exon3			TCTTTTCCCAGTG		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.960G>A	19.37:g.58385798C>T		Somatic	199	2	0.0100503		WXS	Illumina HiSeq	Phase_I	193	21	0.108808	NM_001144989	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.	.	none		0.353	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
HMCN1	83872	hgsc.bcm.edu	37	1	185953339	185953339	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:185953339G>A	ENST00000271588.4	+	19	3058	c.2829G>A	c.(2827-2829)ggG>ggA	p.G943G	HMCN1_ENST00000485744.1_3'UTR|HMCN1_ENST00000367492.2_Silent_p.G943G	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	943	Ig-like C2-type 6.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GCAGTGATGGGAGCCTCCATA	0.388																																					p.G943G		Atlas-SNP	.											.	HMCN1	797	.	0			c.G2829A						PASS	.						175.0	170.0	172.0					1																	185953339		2203	4300	6503	SO:0001819	synonymous_variant	83872	exon19			TGATGGGAGCCTC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.2829G>A	1.37:g.185953339G>A		Somatic	176	0	0		WXS	Illumina HiSeq	Phase_I	171	32	0.187135	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1																																																																																			.	.	none		0.388	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
REV3L	5980	hgsc.bcm.edu	37	6	111685068	111685068	+	Silent	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr6:111685068T>C	ENST00000358835.3	-	17	7321	c.6867A>G	c.(6865-6867)aaA>aaG	p.K2289K	REV3L_ENST00000435970.1_Silent_p.K2211K|REV3L-IT1_ENST00000411895.1_RNA|REV3L_ENST00000368802.3_Silent_p.K2289K|REV3L_ENST00000368805.1_Silent_p.K2289K			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2289					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CATGTAAAGCTTTTGCCTCCT	0.333								DNA polymerases (catalytic subunits)																													p.K2289K		Atlas-SNP	.											.	REV3L	386	.	0			c.A6867G						PASS	.						178.0	160.0	166.0					6																	111685068		2202	4299	6501	SO:0001819	synonymous_variant	5980	exon16			TAAAGCTTTTGCC	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.6867A>G	6.37:g.111685068T>C		Somatic	197	0	0		WXS	Illumina HiSeq	Phase_I	190	25	0.131579	NM_002912	O43214|Q5TC33	Silent	SNP	ENST00000358835.3	37	CCDS5091.2																																																																																			.	.	none		0.333	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
MANBA	4126	hgsc.bcm.edu	37	4	103585914	103585914	+	Silent	SNP	G	G	A	rs547084645		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr4:103585914G>A	ENST00000226578.4	-	11	1512	c.1413C>T	c.(1411-1413)ttC>ttT	p.F471F	MANBA_ENST00000505239.1_Silent_p.F414F	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	471					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)			cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		GCCGGTCAGTGAAACTGATAT	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		16638	0.0		0.0	False		,,,				2504	0.001				p.F471F		Atlas-SNP	.											.	MANBA	78	.	0			c.C1413T						PASS	.						130.0	124.0	126.0					4																	103585914		2203	4300	6503	SO:0001819	synonymous_variant	4126	exon11			GTCAGTGAAACTG		CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.1413C>T	4.37:g.103585914G>A		Somatic	288	0	0		WXS	Illumina HiSeq	Phase_I	251	79	0.314741	NM_005908	Q96BC3|Q9NYX9	Silent	SNP	ENST00000226578.4	37	CCDS3658.1																																																																																			.	.	none		0.388	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253803.2		
TNRC6A	27327	hgsc.bcm.edu	37	16	24804956	24804956	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr16:24804956C>A	ENST00000395799.3	+	7	3467	c.3338C>A	c.(3337-3339)gCa>gAa	p.A1113E	TNRC6A_ENST00000315183.7_Missense_Mutation_p.A1113E	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1113	Sufficient for interaction with AGO1 and AGO4.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		GGTCCACAAGCATTAAGCAAA	0.483																																					p.A1113E		Atlas-SNP	.											.	TNRC6A	171	.	0			c.C3338A						PASS	.						76.0	77.0	77.0					16																	24804956		2197	4300	6497	SO:0001583	missense	27327	exon7			CACAAGCATTAAG	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.3338C>A	16.37:g.24804956C>A	ENSP00000379144:p.Ala1113Glu	Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	43	14	0.325581	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	C	12.98	2.099624	0.37048	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.44083	0.93;0.93	6.06	3.07	0.35406	Argonaute hook domain (1);	0.704740	0.14503	N	0.315630	T	0.37598	0.1009	L	0.58810	1.83	0.45076	D	0.998093	B;B	0.27910	0.02;0.193	B;B	0.27608	0.06;0.081	T	0.06409	-1.0828	10	0.27082	T	0.32	0.0162	9.747	0.40453	0.0:0.7572:0.1163:0.1264	.	860;1113	Q8NDV7-2;Q8NDV7	.;TNR6A_HUMAN	E	1113	ENSP00000326900:A1113E;ENSP00000379144:A1113E	ENSP00000326900:A1113E	A	+	2	0	TNRC6A	24712457	0.103000	0.21917	0.092000	0.20876	0.896000	0.52359	0.835000	0.27531	0.444000	0.26612	0.650000	0.86243	GCA	.	.	none		0.483	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
POTEC	388468	hgsc.bcm.edu	37	18	14542654	14542654	+	Silent	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr18:14542654C>A	ENST00000358970.5	-	1	491	c.492G>T	c.(490-492)acG>acT	p.T164T	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	164								p.T164T(2)		NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						TGTTCATGTCCGTGTCCCTGA	0.592																																					p.T164T		Atlas-SNP	.											POTEC,NS,carcinoma,-1,5	POTEC	129	5	2	Substitution - coding silent(2)	lung(1)|kidney(1)	c.G492T						scavenged	.						260.0	241.0	247.0					18																	14542654		692	1591	2283	SO:0001819	synonymous_variant	388468	exon1			CATGTCCGTGTCC	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.492G>T	18.37:g.14542654C>A		Somatic	524	6	0.0114504		WXS	Illumina HiSeq	Phase_I	584	10	0.0171233	NM_001137671		Silent	SNP	ENST00000358970.5	37	CCDS45835.1																																																																																			.	.	none		0.592	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
CX3CL1	6376	hgsc.bcm.edu	37	16	57416809	57416809	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr16:57416809C>G	ENST00000006053.6	+	3	1170	c.1059C>G	c.(1057-1059)ttC>ttG	p.F353L	CX3CL1_ENST00000563383.1_Missense_Mutation_p.F359L|CX3CL1_ENST00000565912.1_Missense_Mutation_p.F315L	NM_002996.3	NP_002987.1	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1	353					angiogenesis involved in wound healing (GO:0060055)|cell adhesion (GO:0007155)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|immune response (GO:0006955)|leukocyte adhesive activation (GO:0050902)|leukocyte chemotaxis (GO:0030595)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcium-independent cell-cell adhesion (GO:0051041)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transforming growth factor beta1 production (GO:0032914)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GCCTCCTCTTCTGCCTGGGGG	0.672																																					p.F353L		Atlas-SNP	.											.	CX3CL1	27	.	0			c.C1059G						PASS	.						51.0	55.0	53.0					16																	57416809		2198	4300	6498	SO:0001583	missense	6376	exon3			CCTCTTCTGCCTG	U84487	CCDS10779.1	16q13	2013-02-25	2002-08-22	2002-08-23	ENSG00000006210	ENSG00000006210		"""Endogenous ligands"""	10647	protein-coding gene	gene with protein product		601880	"""small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin)"""	SCYD1		9177350, 9024663	Standard	NM_002996		Approved	NTN, C3Xkine, ABCD-3, CXC3C, CXC3, fractalkine, neurotactin	uc002eli.3	P78423	OTTHUMG00000133469	ENST00000006053.6:c.1059C>G	16.37:g.57416809C>G	ENSP00000006053:p.Phe353Leu	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	39	11	0.282051	NM_002996	O00672	Missense_Mutation	SNP	ENST00000006053.6	37	CCDS10779.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380265	0.82682	.	.	ENSG00000006210	ENST00000006053	T	0.13778	2.56	5.19	4.14	0.48551	.	0.352416	0.20775	N	0.085910	T	0.22475	0.0542	L	0.36672	1.1	0.36879	D	0.889303	D	0.76494	0.999	D	0.78314	0.991	T	0.06534	-1.0821	10	0.87932	D	0	-9.3444	5.7989	0.18401	0.0:0.8319:0.0:0.1681	.	353	P78423	X3CL1_HUMAN	L	353	ENSP00000006053:F353L	ENSP00000006053:F353L	F	+	3	2	CX3CL1	55974310	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.420000	0.21263	2.412000	0.81896	0.558000	0.71614	TTC	.	.	none		0.672	CX3CL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257345.3	NM_002996	
PTPRR	5801	hgsc.bcm.edu	37	12	71092083	71092083	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:71092083C>T	ENST00000283228.2	-	8	1693	c.1241G>A	c.(1240-1242)cGt>cAt	p.R414H	PTPRR_ENST00000549308.1_Missense_Mutation_p.R169H|PTPRR_ENST00000440835.2_Missense_Mutation_p.R169H|PTPRR_ENST00000342084.4_Missense_Mutation_p.R302H|PTPRR_ENST00000378778.1_Missense_Mutation_p.R208H	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	414	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		AGTTCCATGACGCGGAATATC	0.348																																					p.R414H		Atlas-SNP	.											PTPRR,NS,carcinoma,0,1	PTPRR	109	1	0			c.G1241A						PASS	.						86.0	88.0	87.0					12																	71092083		2202	4300	6502	SO:0001583	missense	5801	exon8			CCATGACGCGGAA	D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.1241G>A	12.37:g.71092083C>T	ENSP00000283228:p.Arg414His	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	84	25	0.297619	NM_002849	B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	ENST00000283228.2	37	CCDS8998.1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.303861	0.60305	.	.	ENSG00000153233	ENST00000440835;ENST00000283228;ENST00000378778;ENST00000342084;ENST00000549308;ENST00000550661	T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55	5.79	5.79	0.91817	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.245199	0.28940	N	0.013652	T	0.24812	0.0602	N	0.11756	0.17	0.34452	D	0.700805	P;P;D;P	0.58970	0.921;0.86;0.984;0.863	B;B;B;B	0.44044	0.092;0.136;0.439;0.094	T	0.21586	-1.0241	10	0.49607	T	0.09	-5.594	20.0341	0.97551	0.0:1.0:0.0:0.0	.	263;302;208;414	B7Z998;F5GXR7;Q15256-4;Q15256	.;.;.;PTPRR_HUMAN	H	169;414;208;302;169;169	ENSP00000391750:R169H;ENSP00000283228:R414H;ENSP00000368054:R208H;ENSP00000339605:R302H;ENSP00000446943:R169H;ENSP00000449616:R169H	ENSP00000283228:R414H	R	-	2	0	PTPRR	69378350	0.993000	0.37304	0.998000	0.56505	0.955000	0.61496	3.121000	0.50438	2.753000	0.94483	0.555000	0.69702	CGT	.	.	none		0.348	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404485.1	NM_002849	
ZSCAN32	54925	hgsc.bcm.edu	37	16	3433530	3433530	+	Silent	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr16:3433530A>G	ENST00000396852.4	-	7	1723	c.1416T>C	c.(1414-1416)agT>agC	p.S472S	ZSCAN32_ENST00000304926.3_Silent_p.S260S|NAA60_ENST00000576906.1_Intron|ZSCAN32_ENST00000396846.3_Silent_p.S472S|ZSCAN32_ENST00000439568.2_Silent_p.S183S	NM_001284527.1|NM_001284529.1	NP_001271456.1|NP_001271458.1	Q9NX65	ZSC32_HUMAN	zinc finger and SCAN domain containing 32	472					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)										TTTTCTCCTCACTCTCCCCTG	0.473																																					p.S260S		Atlas-SNP	.											.	.	.	.	0			c.T780C						PASS	.						108.0	102.0	104.0					16																	3433530		2197	4300	6497	SO:0001819	synonymous_variant	54925	exon6			CTCCTCACTCTCC	AK000424	CCDS10503.1, CCDS66920.1, CCDS66921.1	16p13.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000140987	ENSG00000140987		"""-"", ""Zinc fingers, C2H2-type"""	20812	protein-coding gene	gene with protein product			"""zinc finger protein 434"""	ZNF434			Standard	XM_005255402		Approved	FLJ20417	uc002cux.4	Q9NX65	OTTHUMG00000129357	ENST00000396852.4:c.1416T>C	16.37:g.3433530A>G		Somatic	158	0	0		WXS	Illumina HiSeq	Phase_I	124	22	0.177419	NM_017810	B4DWL5|C9JB03|Q6WMU8|Q7Z6G2|Q8NFX8|Q9BU74	Silent	SNP	ENST00000396852.4	37																																																																																				.	.	none		0.473	ZSCAN32-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000251509.2	NM_017810	
PINK1	65018	hgsc.bcm.edu	37	1	20975644	20975644	+	Nonsense_Mutation	SNP	C	C	T	rs45499196		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:20975644C>T	ENST00000321556.4	+	7	1502	c.1408C>T	c.(1408-1410)Cag>Tag	p.Q470*	PINK1-AS_ENST00000451424.1_RNA|PINK1_ENST00000492302.1_3'UTR	NM_032409.2	NP_115785.1	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1	470	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				activation of protein kinase B activity (GO:0032148)|cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|intracellular signal transduction (GO:0035556)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron intrinsic apoptotic signaling pathway (GO:1903384)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|peptidyl-serine autophosphorylation (GO:0036289)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of peptidase activity (GO:0010952)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein complex assembly (GO:0043254)|regulation of protein ubiquitination (GO:0031396)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|TORC2 signaling (GO:0038203)|ubiquitin-dependent protein catabolic process (GO:0006511)	astrocyte projection (GO:0097449)|axon (GO:0030424)|cell body (GO:0044297)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|Lewy body (GO:0097413)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|C3HC4-type RING finger domain binding (GO:0055131)|calcium-dependent protein kinase activity (GO:0010857)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)|protein kinase B binding (GO:0043422)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)	14		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCAAGAGGCTCAGCTACCTGC	0.617																																					p.Q470X	Esophageal Squamous(145;853 1803 8146 34412 35011)	Atlas-SNP	.											.	PINK1	37	.	0			c.C1408T						PASS	.						61.0	54.0	56.0					1																	20975644		2203	4300	6503	SO:0001587	stop_gained	65018	exon7			GAGGCTCAGCTAC	AB053323	CCDS211.1	1p36.12	2011-07-21			ENSG00000158828	ENSG00000158828		"""Parkinson disease"""	14581	protein-coding gene	gene with protein product		608309	"""Parkinson disease (autosomal recessive) 6"""	PARK6		11494141, 15349860	Standard	NM_032409		Approved		uc001bdm.3	Q9BXM7	OTTHUMG00000002841	ENST00000321556.4:c.1408C>T	1.37:g.20975644C>T	ENSP00000364204:p.Gln470*	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	148	40	0.27027	NM_032409	Q8N6T9|Q8NBU3|Q96DE4	Nonsense_Mutation	SNP	ENST00000321556.4	37	CCDS211.1	.	.	.	.	.	.	.	.	.	.	C	38	6.772314	0.97829	.	.	ENSG00000158828	ENST00000321556	.	.	.	6.17	6.17	0.99709	.	0.054055	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-12.4969	16.3795	0.83443	0.0:1.0:0.0:0.0	.	.	.	.	X	470	.	ENSP00000364204:Q470X	Q	+	1	0	PINK1	20848231	0.999000	0.42202	0.999000	0.59377	0.690000	0.40134	3.349000	0.52217	2.941000	0.99782	0.655000	0.94253	CAG	.	.	none		0.617	PINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007954.1	NM_032409	
KNTC1	9735	hgsc.bcm.edu	37	12	123107092	123107092	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:123107092G>A	ENST00000333479.7	+	62	6630	c.6453G>A	c.(6451-6453)aaG>aaA	p.K2151K	KNTC1_ENST00000537348.1_3'UTR|KNTC1_ENST00000534995.1_Silent_p.K72K|KNTC1_ENST00000450485.2_Silent_p.K1076K|KNTC1_ENST00000436959.3_Silent_p.K72K|HCAR1_ENST00000356987.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	2151					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AAATGTTGAAGATGCATGCGA	0.303																																					p.K2151K		Atlas-SNP	.											.	KNTC1	182	.	0			c.G6453A						PASS	.						48.0	45.0	46.0					12																	123107092		1849	4087	5936	SO:0001819	synonymous_variant	9735	exon62			GTTGAAGATGCAT		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.6453G>A	12.37:g.123107092G>A		Somatic	187	0	0		WXS	Illumina HiSeq	Phase_I	192	58	0.302083	NM_014708	A7E2C4|B3KSG2	Silent	SNP	ENST00000333479.7	37	CCDS45002.1																																																																																			.	.	none		0.303	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
SLITRK5	26050	hgsc.bcm.edu	37	13	88328058	88328058	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr13:88328058A>C	ENST00000325089.6	+	2	634	c.415A>C	c.(415-417)Aat>Cat	p.N139H	SLITRK5_ENST00000400028.3_Intron	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	139					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TCTAAACAATAATAAACTGGA	0.463																																					p.N139H		Atlas-SNP	.											.	SLITRK5	192	.	0			c.A415C						PASS	.						94.0	92.0	93.0					13																	88328058		2203	4300	6503	SO:0001583	missense	26050	exon2			AACAATAATAAAC	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.415A>C	13.37:g.88328058A>C	ENSP00000366283:p.Asn139His	Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	148	29	0.195946	NM_015567	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	A	14.76	2.630913	0.46944	.	.	ENSG00000165300	ENST00000325089	T	0.74526	-0.85	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.91216	0.7232	H	0.97896	4.1	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94065	0.7330	9	.	.	.	-10.4756	14.1162	0.65154	1.0:0.0:0.0:0.0	.	139	O94991	SLIK5_HUMAN	H	139	ENSP00000366283:N139H	.	N	+	1	0	SLITRK5	87126059	1.000000	0.71417	1.000000	0.80357	0.651000	0.38670	9.339000	0.96797	2.225000	0.72522	0.379000	0.24179	AAT	.	.	none		0.463	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
ACKR3	57007	hgsc.bcm.edu	37	2	237489798	237489798	+	Silent	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr2:237489798C>A	ENST00000272928.3	+	2	1000	c.690C>A	c.(688-690)gtC>gtA	p.V230V		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	230					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)										TTATCGCTGTCTTCTACTTCC	0.567																																					p.V230V		Atlas-SNP	.											.	CXCR7	72	.	0			c.C690A						PASS	.						102.0	86.0	92.0					2																	237489798		2203	4300	6503	SO:0001819	synonymous_variant	57007	exon2			CGCTGTCTTCTAC	BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.690C>A	2.37:g.237489798C>A		Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	115	24	0.208696	NM_020311	A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Silent	SNP	ENST00000272928.3	37	CCDS2516.1																																																																																			.	.	none		0.567	ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257079.2	NM_020311	
REEP4	80346	hgsc.bcm.edu	37	8	21996529	21996529	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr8:21996529C>T	ENST00000306306.3	-	6	931	c.463G>A	c.(463-465)Gac>Aac	p.D155N	REEP4_ENST00000523293.1_Missense_Mutation_p.D155N|REEP4_ENST00000334530.5_Intron	NM_025232.2	NP_079508.2	Q9H6H4	REEP4_HUMAN	receptor accessory protein 4	155					mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|nuclear envelope organization (GO:0006998)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)	microtubule binding (GO:0008017)			kidney(1)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	7				Colorectal(74;0.00187)|COAD - Colon adenocarcinoma(73;0.061)|READ - Rectum adenocarcinoma(644;0.0993)		GAGCGCAGGTCCTGCATGGAG	0.677																																					p.D155N		Atlas-SNP	.											.	REEP4	13	.	0			c.G463A						PASS	.						21.0	21.0	21.0					8																	21996529		2202	4296	6498	SO:0001583	missense	80346	exon6			GCAGGTCCTGCAT	BC013048	CCDS6024.1	8p21.3	2008-05-02	2006-02-07	2006-02-07	ENSG00000168476	ENSG00000168476		"""Receptor accessory proteins"""	26176	protein-coding gene	gene with protein product		609349	"""chromosome 8 open reading frame 20"""	C8orf20		16271481, 15550249	Standard	NM_025232		Approved	FLJ22246, FLJ22277, PP432	uc003xau.1	Q9H6H4	OTTHUMG00000131491	ENST00000306306.3:c.463G>A	8.37:g.21996529C>T	ENSP00000303482:p.Asp155Asn	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	39	20	0.512821	NM_025232	D3DSQ9|Q86VL1|Q9H6I5|Q9HBP4	Missense_Mutation	SNP	ENST00000306306.3	37	CCDS6024.1	.	.	.	.	.	.	.	.	.	.	C	34	5.400018	0.96030	.	.	ENSG00000168476	ENST00000306306;ENST00000523293;ENST00000518664	D;D;D	0.90444	-2.25;-2.67;-2.64	4.69	4.69	0.59074	.	0.000000	0.64402	D	0.000019	D	0.95063	0.8401	M	0.80183	2.485	0.58432	D	0.999993	D	0.89917	1.0	D	0.80764	0.994	D	0.95497	0.8574	10	0.62326	D	0.03	-24.4594	15.1447	0.72641	0.0:1.0:0.0:0.0	.	155	Q9H6H4	REEP4_HUMAN	N	155	ENSP00000303482:D155N;ENSP00000428709:D155N;ENSP00000428160:D155N	ENSP00000303482:D155N	D	-	1	0	REEP4	22052474	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	7.547000	0.82146	2.156000	0.67533	0.655000	0.94253	GAC	.	.	none		0.677	REEP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254337.2	NM_025232	
GRID1	2894	hgsc.bcm.edu	37	10	87898678	87898678	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr10:87898678G>A	ENST00000327946.7	-	4	709	c.624C>T	c.(622-624)ctC>ctT	p.L208L		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	208					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TCGTGGTGAAGAGGCTGGTGA	0.577										Multiple Myeloma(13;0.14)																											p.L208L		Atlas-SNP	.											.	GRID1	204	.	0			c.C624T						PASS	.						226.0	197.0	207.0					10																	87898678		2203	4300	6503	SO:0001819	synonymous_variant	2894	exon4			GGTGAAGAGGCTG	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.624C>T	10.37:g.87898678G>A		Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	70	14	0.2	NM_017551	B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	ENST00000327946.7	37	CCDS31236.1																																																																																			.	.	none		0.577	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
ZFP28	140612	hgsc.bcm.edu	37	19	57065996	57065996	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:57065996G>A	ENST00000301318.3	+	8	1913	c.1842G>A	c.(1840-1842)gaG>gaA	p.E614E	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	614					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		ATACTGGGGAGAAGCCTTTTG	0.428																																					p.E614E	Ovarian(124;554 1662 19430 21141 52494)	Atlas-SNP	.											.	ZFP28	99	.	0			c.G1842A						PASS	.						97.0	108.0	104.0					19																	57065996		2203	4300	6503	SO:0001819	synonymous_variant	140612	exon8			TGGGGAGAAGCCT		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.1842G>A	19.37:g.57065996G>A		Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	137	36	0.262774	NM_020828	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Silent	SNP	ENST00000301318.3	37	CCDS12946.1																																																																																			.	.	none		0.428	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
SLC25A47	283600	hgsc.bcm.edu	37	14	100795800	100795800	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr14:100795800G>A	ENST00000361529.3	+	6	823	c.745G>A	c.(745-747)Ggg>Agg	p.G249R	SLC25A47_ENST00000557052.1_Missense_Mutation_p.G103R	NM_207117.2	NP_997000.2	Q6Q0C1	S2547_HUMAN	solute carrier family 25, member 47	249					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	13						GCAGGCAGACGGGCAGGGCCA	0.657																																					p.G249R	GBM(11;1289 1351)	Atlas-SNP	.											.	SLC25A47	36	.	0			c.G745A						PASS	.						52.0	55.0	54.0					14																	100795800		2203	4300	6503	SO:0001583	missense	283600	exon6			GCAGACGGGCAGG		CCDS9959.1	14q32.2	2013-05-22	2010-07-19	2010-07-19	ENSG00000140107	ENSG00000140107		"""Solute carriers"""	20115	protein-coding gene	gene with protein product		609911	"""chromosome 14 open reading frame 68"""	C14orf68			Standard	NM_207117		Approved		uc001yhc.3	Q6Q0C1	OTTHUMG00000171571	ENST00000361529.3:c.745G>A	14.37:g.100795800G>A	ENSP00000354886:p.Gly249Arg	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	56	12	0.214286	NM_207117	B2RP39|Q68CL2|Q6PZD8|Q86U14	Missense_Mutation	SNP	ENST00000361529.3	37	CCDS9959.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.357420	0.61293	.	.	ENSG00000140107	ENST00000361529;ENST00000557052	T;T	0.78816	-1.21;-1.21	5.39	4.5	0.54988	Mitochondrial carrier domain (2);	0.047683	0.85682	D	0.000000	D	0.85813	0.5784	M	0.63428	1.95	0.52501	D	0.999953	D	0.89917	1.0	D	0.87578	0.998	D	0.87017	0.2126	10	0.72032	D	0.01	-2.6913	14.0535	0.64751	0.0727:0.0:0.9273:0.0	.	249	Q6Q0C1	S2547_HUMAN	R	249;103	ENSP00000354886:G249R;ENSP00000451078:G103R	ENSP00000354886:G249R	G	+	1	0	SLC25A47	99865553	1.000000	0.71417	0.609000	0.28983	0.110000	0.19582	6.251000	0.72441	1.271000	0.44313	0.561000	0.74099	GGG	.	.	none		0.657	SLC25A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414231.1		
FAF2	23197	hgsc.bcm.edu	37	5	175913491	175913491	+	Splice_Site	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:175913491G>A	ENST00000261942.6	+	3	320		c.e3+1		FAF2_ENST00000510446.1_Splice_Site	NM_014613.2	NP_055428.1	Q96CS3	FAF2_HUMAN	Fas associated factor family member 2						lipid particle organization (GO:0034389)|negative regulation of catalytic activity (GO:0043086)|response to unfolded protein (GO:0006986)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	lipase binding (GO:0035473)|lipase inhibitor activity (GO:0055102)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						TCAACCAAGGGCAAGTTATTT	0.418																																					.		Atlas-SNP	.											.	FAF2	38	.	0			c.267+1G>A						PASS	.						114.0	99.0	104.0					5																	175913491		2203	4300	6503	SO:0001630	splice_region_variant	23197	exon3			CCAAGGGCAAGTT	BC015791	CCDS34296.1	5q35.2	2011-06-28	2008-07-25	2008-07-25	ENSG00000113194	ENSG00000113194		"""UBX domain containing"""	24666	protein-coding gene	gene with protein product	"""expressed in T cells and eosinophils in atopic dermatitis"", ""UBX domain protein 3B"""		"""UBX domain containing 8"""	UBXD8		10048485, 12372427	Standard	NM_014613		Approved	ETEA, KIAA0887, UBXN3B	uc003mej.4	Q96CS3	OTTHUMG00000163228	ENST00000261942.6:c.267+1G>A	5.37:g.175913491G>A		Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	108	45	0.416667	NM_014613	O94963|Q8IUF2|Q9BRP2|Q9BVM7	Splice_Site	SNP	ENST00000261942.6	37	CCDS34296.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.961376	0.92791	.	.	ENSG00000113194	ENST00000261942;ENST00000540174	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAF2	175846097	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.313000	0.96297	2.879000	0.98667	0.650000	0.86243	.	.	.	none		0.418	FAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372194.1	NM_014613	Intron
P2RY8	286530	hgsc.bcm.edu	37	X	1584688	1584688	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:1584688A>G	ENST00000381297.4	-	2	974	c.764T>C	c.(763-765)tTc>tCc	p.F255S	P2RY8_ENST00000460672.1_5'Flank	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CAGGAGCACGAAGTTGTTGGG	0.652			T	CRLF2	"""B-ALL, Downs associated ALL"""																																p.F255S		Atlas-SNP	.		Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	286530	"""purinergic receptor P2Y, G-protein coupled, 8"""		L	.	P2RY8	53	.	0			c.T764C						PASS	.						68.0	65.0	66.0					X																	1584688		2203	4296	6499	SO:0001583	missense	286530	exon2			AGCACGAAGTTGT	AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.764T>C	X.37:g.1584688A>G	ENSP00000370697:p.Phe255Ser	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	54	26	0.481481	NM_178129		Missense_Mutation	SNP	ENST00000381297.4	37	CCDS14115.1	.	.	.	.	.	.	.	.	.	.	a	15.15	2.746727	0.49257	.	.	ENSG00000182162	ENST00000381297	T	0.71698	-0.59	2.73	2.73	0.32206	GPCR, rhodopsin-like superfamily (1);	0.072053	0.49916	U	0.000127	T	0.63861	0.2547	N	0.20766	0.605	0.09310	N	1	D	0.53312	0.959	P	0.52343	0.696	T	0.58239	-0.7671	10	0.72032	D	0.01	.	10.658	0.45686	1.0:0.0:0.0:0.0	.	255	Q86VZ1	P2RY8_HUMAN	S	255	ENSP00000370697:F255S	ENSP00000370697:F255S	F	-	2	0	P2RY8	1544688	1.000000	0.71417	0.986000	0.45419	0.716000	0.41182	4.106000	0.57804	0.823000	0.34589	0.230000	0.17803	TTC	.	.	none		0.652	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055602.1	NM_178129	
LAMA5	3911	hgsc.bcm.edu	37	20	60909029	60909029	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr20:60909029T>C	ENST00000252999.3	-	23	2872	c.2806A>G	c.(2806-2808)Aac>Gac	p.N936D	MIR4758_ENST00000577688.1_RNA	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	936	Domain IV 1 (domain IV B).				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCCCCCCGGTTGACGTATCGG	0.672																																					p.N936D		Atlas-SNP	.											.	LAMA5	268	.	0			c.A2806G						PASS	.						37.0	32.0	34.0					20																	60909029		2201	4296	6497	SO:0001583	missense	3911	exon23			CCCGGTTGACGTA	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.2806A>G	20.37:g.60909029T>C	ENSP00000252999:p.Asn936Asp	Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	97	35	0.360825	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	t	15.02	2.709053	0.48517	.	.	ENSG00000130702	ENST00000252999	T	0.20881	2.04	4.54	4.54	0.55810	.	0.047534	0.85682	U	0.000000	T	0.30854	0.0778	M	0.78456	2.415	0.80722	D	1	P	0.51791	0.948	P	0.46237	0.508	T	0.17623	-1.0363	10	0.66056	D	0.02	.	10.6683	0.45743	0.0:0.0:0.1605:0.8394	.	936	O15230	LAMA5_HUMAN	D	936	ENSP00000252999:N936D	ENSP00000252999:N936D	N	-	1	0	LAMA5	60342424	1.000000	0.71417	0.705000	0.30386	0.132000	0.20833	5.130000	0.64745	1.665000	0.50811	0.444000	0.29173	AAC	.	.	none		0.672	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
ZNF160	90338	hgsc.bcm.edu	37	19	53573446	53573446	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:53573446T>C	ENST00000429604.1	-	7	756	c.341A>G	c.(340-342)cAc>cGc	p.H114R	ZNF160_ENST00000601421.1_Missense_Mutation_p.H78R|ZNF160_ENST00000599056.1_Missense_Mutation_p.H114R|ZNF160_ENST00000418871.1_Missense_Mutation_p.H114R	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	114					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		CACCACTGTGTGGAATACTGC	0.393																																					p.H114R		Atlas-SNP	.											.	ZNF160	75	.	0			c.A341G						PASS	.						122.0	116.0	118.0					19																	53573446		2203	4300	6503	SO:0001583	missense	90338	exon7			ACTGTGTGGAATA	X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.341A>G	19.37:g.53573446T>C	ENSP00000406201:p.His114Arg	Somatic	221	0	0		WXS	Illumina HiSeq	Phase_I	181	28	0.154696	NM_001102603	Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Missense_Mutation	SNP	ENST00000429604.1	37	CCDS12859.1	.	.	.	.	.	.	.	.	.	.	T	7.078	0.569697	0.13560	.	.	ENSG00000170949	ENST00000429604;ENST00000418871	T;T	0.06449	3.3;3.3	2.39	1.33	0.21861	.	.	.	.	.	T	0.05181	0.0138	L	0.38175	1.15	0.23758	N	0.996924	B	0.16396	0.017	B	0.14023	0.01	T	0.42032	-0.9475	9	0.30854	T	0.27	.	5.2183	0.15354	0.0:0.1543:0.0:0.8457	.	114	Q9HCG1	ZN160_HUMAN	R	114	ENSP00000406201:H114R;ENSP00000409597:H114R	ENSP00000409597:H114R	H	-	2	0	ZNF160	58265258	0.000000	0.05858	0.003000	0.11579	0.019000	0.09904	0.037000	0.13840	0.166000	0.19597	-0.379000	0.06801	CAC	.	.	none		0.393	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463994.2	NM_033288	
ROBO3	64221	hgsc.bcm.edu	37	11	124748633	124748633	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr11:124748633C>T	ENST00000397801.1	+	23	3666	c.3474C>T	c.(3472-3474)ccC>ccT	p.P1158P	ROBO3_ENST00000543966.1_5'UTR|ROBO3_ENST00000538940.1_Silent_p.P1136P|ROBO3_ENST00000525482.1_3'UTR	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	1158					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CTCTTACACCCTCACCTCCTG	0.592																																					p.P1158P		Atlas-SNP	.											.	ROBO3	199	.	0			c.C3474T						PASS	.						61.0	72.0	68.0					11																	124748633		2034	4171	6205	SO:0001819	synonymous_variant	64221	exon23			TACACCCTCACCT	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.3474C>T	11.37:g.124748633C>T		Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	24	9	0.375	NM_022370		Silent	SNP	ENST00000397801.1	37	CCDS44755.1																																																																																			.	.	none		0.592	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	XM_370663	
LMAN1L	79748	hgsc.bcm.edu	37	15	75108518	75108518	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr15:75108518G>A	ENST00000309664.5	+	2	335	c.196G>A	c.(196-198)Gaa>Aaa	p.E66K	LMAN1L_ENST00000379709.3_Missense_Mutation_p.E66K	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	66	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GGGCCTGGAGGAAGTGCGGCT	0.647																																					p.E66K		Atlas-SNP	.											.	LMAN1L	43	.	0			c.G196A						PASS	.						30.0	26.0	27.0					15																	75108518		2147	4214	6361	SO:0001583	missense	79748	exon2			CTGGAGGAAGTGC	AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.196G>A	15.37:g.75108518G>A	ENSP00000310431:p.Glu66Lys	Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	31	15	0.483871	NM_021819	Q6UWN2	Missense_Mutation	SNP	ENST00000309664.5	37	CCDS10270.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.201208	0.79015	.	.	ENSG00000140506	ENST00000309664;ENST00000379709	T;T	0.62639	0.01;0.01	5.49	5.49	0.81192	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.073354	0.56097	D	0.000040	T	0.75975	0.3923	L	0.61218	1.895	0.42178	D	0.99167	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.75393	-0.3333	10	0.42905	T	0.14	.	14.8695	0.70444	0.0:0.0:1.0:0.0	.	66;66	Q9HAT1-3;Q9HAT1	.;LMA1L_HUMAN	K	66	ENSP00000310431:E66K;ENSP00000369031:E66K	ENSP00000310431:E66K	E	+	1	0	LMAN1L	72895571	1.000000	0.71417	0.993000	0.49108	0.978000	0.69477	2.160000	0.42348	2.596000	0.87737	0.484000	0.47621	GAA	.	.	none		0.647	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286397.4		
KMT2B	9757	hgsc.bcm.edu	37	19	36218067	36218067	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:36218067C>T	ENST00000222270.7	+	15	4014	c.4014C>T	c.(4012-4014)tgC>tgT	p.C1338C	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Silent_p.C1338C	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1338					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GAAACTACTGCCCGATCTGTA	0.527																																					p.C1338C		Atlas-SNP	.											.	MLL4	229	.	0			c.C4014T						PASS	.						41.0	43.0	42.0					19																	36218067		2149	4270	6419	SO:0001819	synonymous_variant	8085	exon15			CTACTGCCCGATC	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.4014C>T	19.37:g.36218067C>T		Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	65	17	0.261538	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Silent	SNP	ENST00000222270.7	37	CCDS46055.1																																																																																			.	.	none		0.527	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
UBB	7314	hgsc.bcm.edu	37	17	16285294	16285294	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr17:16285294A>T	ENST00000395837.1	+	2	254	c.73A>T	c.(73-75)Aat>Tat	p.N25Y	UBB_ENST00000395839.1_Missense_Mutation_p.N25Y|UBB_ENST00000535788.1_Missense_Mutation_p.N25Y|RP11-138I1.4_ENST00000583934.1_RNA|UBB_ENST00000302182.3_Missense_Mutation_p.N25Y|UBB_ENST00000578649.1_Intron	NM_001281718.1|NM_001281720.1	NP_001268647.1|NP_001268649.1	P0CG47	UBB_HUMAN	ubiquitin B	25	Ubiquitin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		CACCATCGAAAATGTGAAGGC	0.488																																					p.N25Y	Melanoma(163;1126 3406 34901)	Atlas-SNP	.											.	UBB	30	.	0			c.A73T						PASS	.						91.0	89.0	90.0					17																	16285294		2203	4300	6503	SO:0001583	missense	7314	exon2			ATCGAAAATGTGA		CCDS11177.1	17p12-p11.2	2010-11-25			ENSG00000170315	ENSG00000170315			12463	protein-coding gene	gene with protein product	"""polyubiquitin B"""	191339				2154095	Standard	NM_018955		Approved	MGC8385, FLJ25987	uc002gpx.3	P0CG47	OTTHUMG00000058987	ENST00000395837.1:c.73A>T	17.37:g.16285294A>T	ENSP00000379178:p.Asn25Tyr	Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	93	20	0.215054	NM_018955	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000395837.1	37	CCDS11177.1	.	.	.	.	.	.	.	.	.	.	A	16.07	3.018466	0.54576	.	.	ENSG00000170315	ENST00000302182;ENST00000535788;ENST00000395839;ENST00000395837	T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83	4.05	4.05	0.47172	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.53938	U	0.000048	D	0.84497	0.5485	M	0.67517	2.055	0.80722	D	1	B	0.33413	0.411	P	0.58331	0.837	D	0.85769	0.1354	10	0.87932	D	0	.	12.5442	0.56190	1.0:0.0:0.0:0.0	.	25	P0CG47	UBB_HUMAN	Y	25	ENSP00000304697:N25Y;ENSP00000437475:N25Y;ENSP00000379180:N25Y;ENSP00000379178:N25Y	ENSP00000304697:N25Y	N	+	1	0	UBB	16226019	1.000000	0.71417	0.998000	0.56505	0.936000	0.57629	8.435000	0.90297	1.619000	0.50296	0.524000	0.50904	AAT	.	.	none		0.488	UBB-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000130459.1	NM_018955	
NUP62	23636	hgsc.bcm.edu	37	19	50412090	50412090	+	Silent	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:50412090G>A	ENST00000596217.1	-	2	2862	c.975C>T	c.(973-975)agC>agT	p.S325S	NUP62_ENST00000597029.1_Silent_p.S325S|NUP62_ENST00000597723.1_Intron|NUP62_ENST00000422090.2_Silent_p.S325S|IL4I1_ENST00000341114.3_Intron|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000352066.3_Silent_p.S325S|NUP62_ENST00000413454.1_Silent_p.S325S|NUP62_ENST00000600583.1_5'Flank			P37198	NUP62_HUMAN	nucleoporin 62kDa	325	Ala-rich.				carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TCATGGCGGAGCTGGCAGCCG	0.642																																					p.S325S		Atlas-SNP	.											.	NUP62	50	.	0			c.C975T						PASS	.						33.0	40.0	38.0					19																	50412090		2195	4296	6491	SO:0001819	synonymous_variant	23636	exon3			GGCGGAGCTGGCA	X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.975C>T	19.37:g.50412090G>A		Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	44	16	0.363636	NM_153719	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Silent	SNP	ENST00000596217.1	37	CCDS12788.1																																																																																			.	.	none		0.642	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1	NM_153719	
HSP90AB1	3326	hgsc.bcm.edu	37	6	44218144	44218144	+	Silent	SNP	A	A	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr6:44218144A>C	ENST00000371554.1	+	6	979	c.765A>C	c.(763-765)tcA>tcC	p.S255S	HSP90AB1_ENST00000371646.5_Silent_p.S255S|HSP90AB1_ENST00000353801.3_Silent_p.S255S			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	255					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			atgtgggttcagatgaggagg	0.383																																					p.S255S		Atlas-SNP	.											.	HSP90AB1	83	.	0			c.A765C						PASS	.						52.0	52.0	52.0					6																	44218144		2203	4300	6503	SO:0001819	synonymous_variant	3326	exon6			GGGTTCAGATGAG	AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.765A>C	6.37:g.44218144A>C		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	119	16	0.134454	NM_007355	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Silent	SNP	ENST00000371554.1	37	CCDS4909.1																																																																																			.	.	none		0.383	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040730.1	NM_007355	
FREM1	158326	hgsc.bcm.edu	37	9	14775791	14775791	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr9:14775791A>C	ENST00000380880.3	-	25	5636	c.4853T>G	c.(4852-4854)aTt>aGt	p.I1618S	FREM1_ENST00000486223.1_5'UTR|FREM1_ENST00000380894.1_Missense_Mutation_p.I154S|FREM1_ENST00000380881.4_Missense_Mutation_p.I1619S|FREM1_ENST00000422223.2_Missense_Mutation_p.I1618S			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1618					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		ACTTGCCTGAATGGTGAATAA	0.393																																					p.I1618S		Atlas-SNP	.											.	FREM1	261	.	0			c.T4853G						PASS	.						59.0	55.0	56.0					9																	14775791		1885	4123	6008	SO:0001583	missense	158326	exon26			GCCTGAATGGTGA	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.4853T>G	9.37:g.14775791A>C	ENSP00000370262:p.Ile1618Ser	Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	261	54	0.206897	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	A	19.12	3.765498	0.69878	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380894;ENST00000380880	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	5.93	5.93	0.95920	.	0.262356	0.38272	N	0.001744	T	0.72614	0.3482	M	0.78801	2.425	0.54753	D	0.999982	D;D	0.67145	0.996;0.995	D;P	0.65874	0.939;0.878	T	0.76435	-0.2960	10	0.87932	D	0	-20.0105	16.3943	0.83563	1.0:0.0:0.0:0.0	.	1618;154	Q5H8C1;B7ZBX4	FREM1_HUMAN;.	S	1619;1618;154;1618	ENSP00000370263:I1619S;ENSP00000412940:I1618S;ENSP00000370278:I154S;ENSP00000370262:I1618S	ENSP00000370262:I1618S	I	-	2	0	FREM1	14765791	1.000000	0.71417	0.979000	0.43373	0.336000	0.28762	8.677000	0.91203	2.281000	0.76405	0.533000	0.62120	ATT	.	.	none		0.393	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
TMEM245	23731	hgsc.bcm.edu	37	9	111849490	111849490	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr9:111849490A>C	ENST00000374586.3	-	6	1314	c.1283T>G	c.(1282-1284)gTc>gGc	p.V428G		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	428						integral component of membrane (GO:0016021)											TCCAAGCCCGACAATGGGCCA	0.443																																					p.V428G		Atlas-SNP	.											.	.	.	.	0			c.T1283G						PASS	.						93.0	92.0	92.0					9																	111849490		1829	4088	5917	SO:0001583	missense	23731	exon6			AGCCCGACAATGG	AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.1283T>G	9.37:g.111849490A>C	ENSP00000363714:p.Val428Gly	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	129	45	0.348837	NM_032012	B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Missense_Mutation	SNP	ENST00000374586.3	37	CCDS43858.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.382|9.382	1.073379|1.073379	0.20147|0.20147	.|.	.|.	ENSG00000106771|ENSG00000106771	ENST00000413712|ENST00000374587;ENST00000374586;ENST00000223608	.|T	.|0.21734	.|1.99	5.83|5.83	4.67|4.67	0.58626|0.58626	.|.	.|0.366676	.|0.33075	.|N	.|0.005301	T|T	0.09992|0.09992	0.0245|0.0245	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B	.|0.20459	.|0.045;0.039	.|B;B	.|0.18561	.|0.022;0.01	T|T	0.19257|0.19257	-1.0311|-1.0311	5|10	.|0.45353	.|T	.|0.12	-2.8289|-2.8289	5.8357|5.8357	0.18605|0.18605	0.6029:0.2488:0.1483:0.0|0.6029:0.2488:0.1483:0.0	.|.	.|428;428	.|Q9H330-2;Q9H330	.|.;CI005_HUMAN	W|G	28|428	.|ENSP00000363714:V428G	.|ENSP00000223608:V428G	C|V	-|-	3|2	2|0	C9orf5|C9orf5	110889311|110889311	0.233000|0.233000	0.23772|0.23772	0.003000|0.003000	0.11579|0.11579	0.793000|0.793000	0.44817|0.44817	2.435000|2.435000	0.44811|0.44811	0.991000|0.991000	0.38814|0.38814	0.460000|0.460000	0.39030|0.39030	TGT|GTC	.	.	none		0.443	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053587.2	NM_032012	
ITPKB	3707	hgsc.bcm.edu	37	1	226924346	226924346	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr1:226924346C>T	ENST00000272117.3	-	1	813	c.814G>A	c.(814-816)Gct>Act	p.A272T	ITPKB_ENST00000366784.1_Missense_Mutation_p.A272T|ITPKB_ENST00000429204.1_Missense_Mutation_p.A272T			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	272					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				ATTTCCATAGCTGTGGGTGAG	0.602																																					p.A272T	Colon(84;110 1851 5306 33547)	Atlas-SNP	.											.	ITPKB	158	.	0			c.G814A						PASS	.						44.0	48.0	46.0					1																	226924346		2203	4300	6503	SO:0001583	missense	3707	exon2			CCATAGCTGTGGG	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.814G>A	1.37:g.226924346C>T	ENSP00000272117:p.Ala272Thr	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	67	25	0.373134	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	ENST00000272117.3	37	CCDS1555.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.864168	0.32977	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.23147	1.95;1.95;1.92	4.6	-2.09	0.07232	.	1.387480	0.04488	N	0.378907	T	0.13927	0.0337	N	0.19112	0.55	0.09310	N	1	B	0.14438	0.01	B	0.13407	0.009	T	0.24621	-1.0155	10	0.11182	T	0.66	.	5.7879	0.18343	0.0:0.3502:0.3657:0.2841	.	272	P27987	IP3KB_HUMAN	T	272	ENSP00000272117:A272T;ENSP00000411152:A272T;ENSP00000355748:A272T	ENSP00000272117:A272T	A	-	1	0	ITPKB	224990969	0.000000	0.05858	0.000000	0.03702	0.443000	0.32047	-0.766000	0.04725	-0.214000	0.10078	0.561000	0.74099	GCT	.	.	none		0.602	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
STAP2	55620	hgsc.bcm.edu	37	19	4333777	4333777	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr19:4333777G>C	ENST00000594605.1	-	3	334	c.211C>G	c.(211-213)Ctc>Gtc	p.L71V	STAP2_ENST00000600324.1_Missense_Mutation_p.L71V	NM_001013841.1	NP_001013863.1	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	71	PH.					cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		TCATCTGTGAGTTTCTCAAAT	0.567																																					p.L71V		Atlas-SNP	.											.	STAP2	38	.	0			c.C211G						PASS	.						96.0	88.0	91.0					19																	4333777		2203	4300	6503	SO:0001583	missense	55620	exon3			CTGTGAGTTTCTC	AJ245719	CCDS12128.1, CCDS45926.1	19p13.3	2011-05-03	2007-08-09		ENSG00000178078	ENSG00000178078			30430	protein-coding gene	gene with protein product		607881				10980601, 11441184	Standard	XM_005259592		Approved	STAP-2, BKS	uc002mac.3	Q9UGK3		ENST00000594605.1:c.211C>G	19.37:g.4333777G>C	ENSP00000471052:p.Leu71Val	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	63	15	0.238095	NM_001013841	A6NKK3|Q9NXI2	Missense_Mutation	SNP	ENST00000594605.1	37	CCDS45926.1	.	.	.	.	.	.	.	.	.	.	G	2.350	-0.349058	0.05208	.	.	ENSG00000178078	ENST00000314714;ENST00000424810	.	.	.	5.02	1.66	0.24008	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.554688	0.18063	N	0.152891	T	0.39911	0.1096	L	0.58428	1.81	0.22610	N	0.998936	B;B	0.23891	0.093;0.015	B;B	0.23419	0.033;0.046	T	0.39840	-0.9594	9	0.87932	D	0	-2.2117	5.3364	0.15959	0.1854:0.1667:0.6479:0.0	.	71;71	Q9UGK3-2;Q9UGK3	.;STAP2_HUMAN	V	71	.	ENSP00000317912:L71V	L	-	1	0	STAP2	4284777	0.990000	0.36364	0.204000	0.23530	0.006000	0.05464	1.303000	0.33470	0.170000	0.19704	-0.294000	0.09567	CTC	.	.	none		0.567	STAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458114.2	NM_001013841	
FAM9A	171482	hgsc.bcm.edu	37	X	8763298	8763298	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:8763298C>G	ENST00000543214.1	-	7	787	c.652G>C	c.(652-654)Gta>Cta	p.V218L	FAM9A_ENST00000381003.3_Missense_Mutation_p.V218L	NM_001171186.1	NP_001164657.1	Q8IZU1	FAM9A_HUMAN	family with sequence similarity 9, member A	218	Glu-rich.					nucleus (GO:0005634)				endometrium(11)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	18		Hepatocellular(5;0.219)				tcttctACTACTATTACTTct	0.517																																					p.V218L		Atlas-SNP	.											.	FAM9A	57	.	0			c.G652C						PASS	.						21.0	19.0	20.0					X																	8763298		2191	4281	6472	SO:0001583	missense	171482	exon7			CTACTACTATTAC		CCDS14131.1	Xp22.32	2012-11-29			ENSG00000183304	ENSG00000183304			18403	protein-coding gene	gene with protein product	"""testis expressed 39A"""	300477					Standard	NM_174951		Approved	TEX39A	uc004csg.3	Q8IZU1	OTTHUMG00000021110	ENST00000543214.1:c.652G>C	X.37:g.8763298C>G	ENSP00000440163:p.Val218Leu	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	75	30	0.4	NM_174951	B7ZLH5|Q2M2D1	Missense_Mutation	SNP	ENST00000543214.1	37	CCDS14131.1	.	.	.	.	.	.	.	.	.	.	c	1.212	-0.629328	0.03610	.	.	ENSG00000183304	ENST00000381003;ENST00000543214	.	.	.	0.392	-0.652	0.11450	.	.	.	.	.	T	0.15349	0.0370	N	0.08118	0	0.09310	N	1	B	0.26845	0.161	B	0.23852	0.049	T	0.18366	-1.0339	7	0.36615	T	0.2	.	.	.	.	.	218	Q8IZU1	FAM9A_HUMAN	L	218	.	ENSP00000370391:V218L	V	-	1	0	FAM9A	8723298	0.001000	0.12720	0.012000	0.15200	0.011000	0.07611	-0.729000	0.04920	-0.488000	0.06726	-0.481000	0.04817	GTA	.	.	none		0.517	FAM9A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055697.1	NM_174951	
GEMIN4	50628	hgsc.bcm.edu	37	17	648463	648463	+	Silent	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr17:648463G>C	ENST00000319004.5	-	2	2938	c.2820C>G	c.(2818-2820)gtC>gtG	p.V940V	GEMIN4_ENST00000576778.1_Silent_p.V929V	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	940					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		AGAGGAGTTTGACCACGTGGT	0.582																																					p.V940V		Atlas-SNP	.											.	GEMIN4	116	.	0			c.C2820G						PASS	.						16.0	17.0	17.0					17																	648463		1953	4136	6089	SO:0001819	synonymous_variant	50628	exon2			GAGTTTGACCACG	AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.2820C>G	17.37:g.648463G>C		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	32	11	0.34375	NM_015721	Q9NZS7|Q9UG32|Q9Y4Q2	Silent	SNP	ENST00000319004.5	37	CCDS45559.1																																																																																			.	.	none		0.582	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437181.1	NM_015721	
LRRC23	10233	hgsc.bcm.edu	37	12	7016547	7016547	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:7016547C>T	ENST00000007969.8	+	5	779	c.559C>T	c.(559-561)Cgg>Tgg	p.R187W	LRRC23_ENST00000429740.1_Intron|LRRC23_ENST00000436789.1_Missense_Mutation_p.R187W|LRRC23_ENST00000443597.2_Missense_Mutation_p.R187W|LRRC23_ENST00000323702.5_Missense_Mutation_p.R187W|LRRC23_ENST00000433346.1_Missense_Mutation_p.R187W	NM_001135217.1|NM_201650.2	NP_001128689.1|NP_964013.1	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23	187										NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						AGTGGAGCTTCGGGGGAACCA	0.572																																					p.R187W		Atlas-SNP	.											LRRC23,colon,carcinoma,0,2	LRRC23	46	2	0			c.C559T						PASS	.						123.0	119.0	120.0					12																	7016547		2203	4300	6503	SO:0001583	missense	10233	exon5			GAGCTTCGGGGGA	BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000007969.8:c.559C>T	12.37:g.7016547C>T	ENSP00000007969:p.Arg187Trp	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	85	28	0.329412	NM_001135217	A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	Missense_Mutation	SNP	ENST00000007969.8	37	CCDS8569.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.291656	0.80914	.	.	ENSG00000010626	ENST00000433346;ENST00000007969;ENST00000323702;ENST00000443597;ENST00000436789	T;T;T;T;T	0.63096	1.88;-0.02;2.17;-0.02;2.18	5.59	5.59	0.84812	.	.	.	.	.	D	0.82953	0.5149	M	0.86805	2.84	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.997;0.998;0.998;0.998;0.998	D	0.85330	0.1089	9	0.72032	D	0.01	-26.1317	19.586	0.95490	0.0:1.0:0.0:0.0	.	187;187;187;187;187	C9JEW3;A8K8K2;Q53EV4-2;Q53EV4;C9JKE8	.;.;.;LRC23_HUMAN;.	W	187	ENSP00000402554:R187W;ENSP00000007969:R187W;ENSP00000317464:R187W;ENSP00000390932:R187W;ENSP00000396049:R187W	ENSP00000007969:R187W	R	+	1	2	LRRC23	6886808	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.769000	0.62300	2.624000	0.88883	0.462000	0.41574	CGG	.	.	none		0.572	LRRC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345214.1	NM_006992	
TLN1	7094	hgsc.bcm.edu	37	9	35704399	35704399	+	Missense_Mutation	SNP	C	C	T	rs149639715	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr9:35704399C>T	ENST00000314888.9	-	45	6330	c.5977G>A	c.(5977-5979)Gac>Aac	p.D1993N	TLN1_ENST00000540444.1_Missense_Mutation_p.D1887N|TLN1_ENST00000464379.1_5'UTR	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1993					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ATGGTGGTGTCGAGGTCAGCA	0.602													C|||	6	0.00119808	0.0045	0.0	5008	,	,		21474	0.0		0.0	False		,,,				2504	0.0				p.D1993N		Atlas-SNP	.											.	TLN1	185	.	0			c.G5977A						PASS	.	C	ASN/ASP	32,4374	36.8+/-68.6	0,32,2171	154.0	134.0	141.0		5977	5.0	0.9	9	dbSNP_134	141	0,8600		0,0,4300	yes	missense	TLN1	NM_006289.3	23	0,32,6471	TT,TC,CC		0.0,0.7263,0.246	probably-damaging	1993/2542	35704399	32,12974	2203	4300	6503	SO:0001583	missense	7094	exon45			TGGTGTCGAGGTC	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.5977G>A	9.37:g.35704399C>T	ENSP00000316029:p.Asp1993Asn	Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	148	15	0.101351	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	32	5.139301	0.94560	0.007263	0.0	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.81163	-1.46;-1.34	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.87795	0.6267	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.69654	0.965	D	0.90568	0.4520	10	0.87932	D	0	-19.3792	18.2971	0.90150	0.0:1.0:0.0:0.0	.	1993	Q9Y490	TLN1_HUMAN	N	1993;1887	ENSP00000316029:D1993N;ENSP00000442981:D1887N	ENSP00000316029:D1993N	D	-	1	0	TLN1	35694399	1.000000	0.71417	0.932000	0.37286	0.965000	0.64279	7.795000	0.85887	2.319000	0.78375	0.561000	0.74099	GAC	C|0.998;T|0.002	0.002	strong		0.602	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
CDH2	1000	hgsc.bcm.edu	37	18	25563042	25563042	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr18:25563042C>A	ENST00000269141.3	-	14	2638	c.2215G>T	c.(2215-2217)Gtg>Ttg	p.V739L	CDH2_ENST00000399380.3_Missense_Mutation_p.V708L	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	739					adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						AACATCAGCACAAGGACTAGG	0.313																																					p.V739L		Atlas-SNP	.											.	CDH2	194	.	0			c.G2215T						PASS	.						91.0	92.0	92.0					18																	25563042		2203	4300	6503	SO:0001583	missense	1000	exon14			TCAGCACAAGGAC	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.2215G>T	18.37:g.25563042C>A	ENSP00000269141:p.Val739Leu	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	177	20	0.112994	NM_001792	A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.297604	0.40694	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.58506	0.37;0.33	5.82	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.71953	0.3401	M	0.67700	2.07	0.80722	D	1	B;D	0.89917	0.394;1.0	B;D	0.78314	0.228;0.991	T	0.68903	-0.5286	10	0.12103	T	0.63	.	17.0408	0.86489	0.0:0.8729:0.1271:0.0	.	708;739	A8MWK3;P19022	.;CADH2_HUMAN	L	739;708	ENSP00000269141:V739L;ENSP00000382312:V708L	ENSP00000269141:V739L	V	-	1	0	CDH2	23817040	1.000000	0.71417	0.975000	0.42487	0.958000	0.62258	7.487000	0.81328	1.453000	0.47775	0.655000	0.94253	GTG	.	.	none		0.313	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792	
UMODL1	89766	hgsc.bcm.edu	37	21	43547122	43547122	+	Silent	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr21:43547122C>T	ENST00000408910.2	+	19	3300	c.3300C>T	c.(3298-3300)taC>taT	p.Y1100Y	UMODL1_ENST00000400423.2_3'UTR|UMODL1_ENST00000400427.1_Silent_p.Y1156Y|UMODL1_ENST00000400424.2_Silent_p.Y1028Y|UMODL1_ENST00000408989.2_Silent_p.Y1228Y	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	1100	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						GCAGGGTTTACACCATCATCG	0.522																																					p.Y1228Y	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	Atlas-SNP	.											.	UMODL1	186	.	0			c.C3684T						PASS	.						92.0	93.0	93.0					21																	43547122		1990	4164	6154	SO:0001819	synonymous_variant	89766	exon18			GGTTTACACCATC		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.3300C>T	21.37:g.43547122C>T		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	106	33	0.311321	NM_173568	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Silent	SNP	ENST00000408910.2	37	CCDS42936.1																																																																																			.	.	none		0.522	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
DCSTAMP	81501	hgsc.bcm.edu	37	8	105367391	105367391	+	Missense_Mutation	SNP	G	G	A	rs139698540		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr8:105367391G>A	ENST00000297581.2	+	3	1365	c.1316G>A	c.(1315-1317)cGg>cAg	p.R439Q	DCSTAMP_ENST00000517991.1_Intron|DPYS_ENST00000521601.1_Intron|DCSTAMP_ENST00000520080.1_3'UTR	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	439					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											GTCAAAAGACGGCTGAGTCTC	0.478																																					p.R439Q		Atlas-SNP	.											.	.	.	.	0			c.G1316A						PASS	.	G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	47.0	49.0	49.0		1316	3.8	0.0	8	dbSNP_134	49	0,8600		0,0,4300	no	missense	TM7SF4	NM_030788.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	439/471	105367391	1,13005	2203	4300	6503	SO:0001583	missense	81501	exon3			AAAGACGGCTGAG	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.1316G>A	8.37:g.105367391G>A	ENSP00000297581:p.Arg439Gln	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	109	10	0.0917431	NM_030788	B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	ENST00000297581.2	37	CCDS6301.1	.	.	.	.	.	.	.	.	.	.	G	6.779	0.512749	0.12944	2.27E-4	0.0	ENSG00000164935	ENST00000297581	T	0.33654	1.4	5.04	3.81	0.43845	.	0.727973	0.14085	N	0.342420	T	0.17450	0.0419	N	0.08118	0	0.09310	N	0.999997	B	0.29671	0.254	B	0.17098	0.017	T	0.12192	-1.0557	10	0.39692	T	0.17	-1.5907	8.648	0.34018	0.9091:0.0:0.0909:0.0	.	439	Q9H295	TM7S4_HUMAN	Q	439	ENSP00000297581:R439Q	ENSP00000297581:R439Q	R	+	2	0	TM7SF4	105436567	0.002000	0.14202	0.001000	0.08648	0.005000	0.04900	1.796000	0.38794	0.865000	0.35603	-0.290000	0.09829	CGG	G|1.000;A|0.000	0.000	weak		0.478	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788	
MUSK	4593	hgsc.bcm.edu	37	9	113538189	113538189	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr9:113538189A>C	ENST00000374448.4	+	10	1440	c.1306A>C	c.(1306-1308)Aag>Cag	p.K436Q	MUSK_ENST00000189978.5_Missense_Mutation_p.K436Q|MUSK_ENST00000416899.2_Missense_Mutation_p.K436Q|MUSK_ENST00000374438.1_Missense_Mutation_p.Q27P	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	436	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						AGAATGCAGCAAGCTTCCCAG	0.512																																					p.K436Q		Atlas-SNP	.											.	MUSK	112	.	0			c.A1306C						PASS	.						134.0	131.0	132.0					9																	113538189		1935	4146	6081	SO:0001583	missense	4593	exon9			TGCAGCAAGCTTC	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.1306A>C	9.37:g.113538189A>C	ENSP00000363571:p.Lys436Gln	Somatic	244	0	0		WXS	Illumina HiSeq	Phase_I	326	92	0.282209	NM_005592	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	ENST00000374448.4	37	CCDS48005.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.18|14.18	2.458644|2.458644	0.43634|0.43634	.|.	.|.	ENSG00000030304|ENSG00000030304	ENST00000189978;ENST00000374448;ENST00000543335;ENST00000374447;ENST00000545907;ENST00000416899|ENST00000374441;ENST00000374438	T|D	0.76186|0.81579	-1.0|-1.51	5.74|5.74	5.74|5.74	0.90152|0.90152	Frizzled domain (2);|.	0.216683|.	0.49305|.	D|.	0.000156|.	D|D	0.84338|0.84338	0.5450|0.5450	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	B|.	0.29612|.	0.251|.	B|.	0.34931|.	0.192|.	T|T	0.83225|0.83225	-0.0066|-0.0066	10|7	0.27082|0.36615	T|T	0.32|0.2	.|.	15.2145|15.2145	0.73254|0.73254	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	436|.	O15146|.	MUSK_HUMAN|.	Q|P	442;436;436;358;358;442|27	ENSP00000363571:K436Q|ENSP00000363561:Q27P	ENSP00000189978:K442Q|ENSP00000363561:Q27P	K|Q	+|+	1|2	0|0	MUSK|MUSK	112578010|112578010	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	3.960000|3.960000	0.56752|0.56752	2.189000|2.189000	0.69895|0.69895	0.459000|0.459000	0.35465|0.35465	AAG|CAA	.	.	none		0.512	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
AP3B1	8546	hgsc.bcm.edu	37	5	77412011	77412011	+	Silent	SNP	A	A	T	rs42360	byFrequency	TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:77412011A>T	ENST00000255194.6	-	18	2191	c.2016T>A	c.(2014-2016)gcT>gcA	p.A672A	AP3B1_ENST00000519295.1_Silent_p.A623A	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	672					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		AAAACTTCTTAGCAGAATTCT	0.338									Hermansky-Pudlak syndrome																												p.A672A		Atlas-SNP	.											AP3B1,NS,carcinoma,0,1	AP3B1	94	1	0			c.T2016A						PASS	.						87.0	91.0	89.0					5																	77412011		2203	4300	6503	SO:0001819	synonymous_variant	8546	exon18	Familial Cancer Database	HPS, HPS1-8	CTTCTTAGCAGAA	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.2016T>A	5.37:g.77412011A>T		Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	147	15	0.102041	NM_003664	E5RJ68|O00580|Q7Z393|Q9HD66	Silent	SNP	ENST00000255194.6	37	CCDS4041.1																																																																																			A|0.776;C|0.001	.	alt		0.338	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000225548.2		
ILK	3611	hgsc.bcm.edu	37	11	6629314	6629314	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr11:6629314G>A	ENST00000396751.2	+	2	584	c.128G>A	c.(127-129)cGa>cAa	p.R43Q	ILK_ENST00000537806.1_Intron|ILK_ENST00000420936.2_Missense_Mutation_p.R43Q|RP11-732A19.2_ENST00000527398.1_RNA|ILK_ENST00000528995.1_Missense_Mutation_p.R43Q|ILK_ENST00000299421.4_Missense_Mutation_p.R43Q	NM_001014795.1	NP_001014795.1	Q13418	ILK_HUMAN	integrin-linked kinase	43	Interaction with LIMS1.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell junction assembly (GO:0034329)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|extracellular fibril organization (GO:0043206)|fibroblast migration (GO:0010761)|integrin-mediated signaling pathway (GO:0007229)|myelin assembly (GO:0032288)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|peptidyl-serine phosphorylation (GO:0018105)|platelet aggregation (GO:0070527)|positive regulation of axon extension (GO:0045773)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		TGGGCCTGCCGAGAGGGCCGC	0.582																																					p.R43Q		Atlas-SNP	.											ILK_ENST00000299421,NS,malignant_melanoma,0,1	ILK	41	1	0			c.G128A						PASS	.						66.0	62.0	63.0					11																	6629314		2201	4296	6497	SO:0001583	missense	3611	exon3			CCTGCCGAGAGGG	U40282	CCDS7768.1, CCDS60712.1, CCDS60713.1	11p15.4	2014-09-17			ENSG00000166333	ENSG00000166333		"""Ankyrin repeat domain containing"""	6040	protein-coding gene	gene with protein product		602366				8538749	Standard	NM_004517		Approved		uc001mef.3	Q13418	OTTHUMG00000133407	ENST00000396751.2:c.128G>A	11.37:g.6629314G>A	ENSP00000379975:p.Arg43Gln	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	81	12	0.148148	NM_001014794	B7Z1I0|B7Z418|D3DQU0|P57043|Q68DZ3	Missense_Mutation	SNP	ENST00000396751.2	37	CCDS7768.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.633208	0.87660	.	.	ENSG00000166333	ENST00000299421;ENST00000420936;ENST00000528995;ENST00000396751	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	5.73	5.73	0.89815	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.53286	0.1787	N	0.25031	0.7	0.80722	D	1	B;P	0.38504	0.077;0.634	B;B	0.38428	0.273;0.038	T	0.56733	-0.7930	10	0.52906	T	0.07	.	18.8889	0.92391	0.0:0.0:1.0:0.0	.	43;43	B7Z418;Q13418	.;ILK_HUMAN	Q	43	ENSP00000299421:R43Q;ENSP00000403487:R43Q;ENSP00000435323:R43Q;ENSP00000379975:R43Q	ENSP00000299421:R43Q	R	+	2	0	ILK	6585890	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.415000	0.80131	2.714000	0.92807	0.561000	0.74099	CGA	.	.	none		0.582	ILK-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384519.1	NM_004517	
EXOC4	60412	hgsc.bcm.edu	37	7	132959870	132959870	+	Missense_Mutation	SNP	C	C	T	rs201300506		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr7:132959870C>T	ENST00000253861.4	+	2	249	c.220C>T	c.(220-222)Cgc>Tgc	p.R74C	EXOC4_ENST00000393161.2_Missense_Mutation_p.R74C|EXOC4_ENST00000539845.1_5'UTR	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	74					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				GACAGCCATTCGCACATACCA	0.468																																					p.R74C		Atlas-SNP	.											EXOC4,NS,carcinoma,-1,2	EXOC4	118	2	0			c.C220T						PASS	.	C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	132.0	116.0	122.0		220,220	5.5	1.0	7		122	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	EXOC4	NM_001037126.1,NM_021807.3	180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	74/474,74/975	132959870	1,13005	2203	4300	6503	SO:0001583	missense	60412	exon2			GCCATTCGCACAT	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.220C>T	7.37:g.132959870C>T	ENSP00000253861:p.Arg74Cys	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	72	16	0.222222	NM_021807	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599554	0.87055	0.0	1.16E-4	ENSG00000131558	ENST00000253861;ENST00000393161	.	.	.	5.49	5.49	0.81192	Sec8 exocyst complex component specific domain (1);	0.000000	0.85682	D	0.000000	T	0.74215	0.3687	L	0.43152	1.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.73708	0.981;0.926	T	0.74396	-0.3679	9	0.52906	T	0.07	.	19.3733	0.94498	0.0:1.0:0.0:0.0	.	74;74	Q96A65;Q8TAR2	EXOC4_HUMAN;.	C	74	.	ENSP00000253861:R74C	R	+	1	0	EXOC4	132610410	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.534000	0.53568	2.579000	0.87056	0.650000	0.86243	CGC	C|0.999;T|0.001	0.001	weak		0.468	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
PCDH11X	27328	hgsc.bcm.edu	37	X	91134203	91134203	+	Silent	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:91134203C>A	ENST00000373094.1	+	2	3809	c.2964C>A	c.(2962-2964)ccC>ccA	p.P988P	PCDH11X_ENST00000361724.1_Silent_p.P988P|PCDH11X_ENST00000298274.8_Silent_p.P988P|PCDH11X_ENST00000361655.2_Silent_p.P988P|PCDH11X_ENST00000395337.2_Silent_p.P988P|PCDH11X_ENST00000373097.1_Silent_p.P988P|PCDH11X_ENST00000406881.1_Silent_p.P988P|PCDH11X_ENST00000373088.1_Silent_p.P988P|PCDH11X_ENST00000504220.2_Silent_p.P988P	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	988					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GTTCAGATCCCTACAGCGTTT	0.493																																					p.P988P	NSCLC(38;925 1092 2571 38200 45895)	Atlas-SNP	.											.	PCDH11X	714	.	0			c.C2964A						PASS	.						238.0	182.0	201.0					X																	91134203		2203	4300	6503	SO:0001819	synonymous_variant	27328	exon2			AGATCCCTACAGC	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.2964C>A	X.37:g.91134203C>A		Somatic	251	0	0		WXS	Illumina HiSeq	Phase_I	175	27	0.154286	NM_001168363	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	ENST00000373094.1	37	CCDS14461.1																																																																																			.	.	none		0.493	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
PCDH11X	27328	hgsc.bcm.edu	37	X	91518117	91518117	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chrX:91518117A>T	ENST00000373094.1	+	4	3964	c.3119A>T	c.(3118-3120)aAa>aTa	p.K1040I	PCDH11X_ENST00000298274.8_Intron|PCDH11X_ENST00000361655.2_Intron|PCDH11X_ENST00000373097.1_Intron|PCDH11X_ENST00000406881.1_Missense_Mutation_p.K1040I|PCDH11X_ENST00000373088.1_Intron|PCDH11X_ENST00000504220.2_Missense_Mutation_p.K1040I	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1040					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						AATCAGCGGAAATCTGAAGGG	0.328																																					p.K1040I	NSCLC(38;925 1092 2571 38200 45895)	Atlas-SNP	.											.	PCDH11X	714	.	0			c.A3119T						PASS	.						45.0	40.0	42.0					X																	91518117		2200	4299	6499	SO:0001583	missense	27328	exon4			AGCGGAAATCTGA	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3119A>T	X.37:g.91518117A>T	ENSP00000362186:p.Lys1040Ile	Somatic	873	0	0		WXS	Illumina HiSeq	Phase_I	583	183	0.313894	NM_001168361	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	A	3.420	-0.118458	0.06838	.	.	ENSG00000102290	ENST00000373094;ENST00000504220;ENST00000406881;ENST00000356934	T;T;T	0.55930	0.49;0.58;0.51	4.37	1.99	0.26369	.	2.689910	0.01979	U	0.044639	T	0.48429	0.1499	L	0.27053	0.805	0.18873	N	0.999984	P;P;P	0.48503	0.852;0.911;0.856	P;P;B	0.47705	0.555;0.555;0.352	T	0.31364	-0.9946	10	0.66056	D	0.02	.	5.1595	0.15054	0.735:0.0:0.265:0.0	.	1040;1040;1040	Q9BZA7-6;Q9BZA7-8;Q9BZA7	.;.;PC11X_HUMAN	I	1040	ENSP00000362186:K1040I;ENSP00000423762:K1040I;ENSP00000384758:K1040I	ENSP00000349408:K1040I	K	+	2	0	PCDH11X	91404773	0.968000	0.33430	0.142000	0.22268	0.048000	0.14542	0.914000	0.28624	0.034000	0.15491	0.339000	0.21740	AAA	.	.	none		0.328	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
SDHA	6389	hgsc.bcm.edu	37	5	256455	256455	+	Missense_Mutation	SNP	C	C	G	rs1126697		TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr5:256455C>G	ENST00000264932.6	+	15	2030	c.1915C>G	c.(1915-1917)Ctg>Gtg	p.L639V	SDHA_ENST00000507522.1_Intron|SDHA_ENST00000504309.1_Missense_Mutation_p.L558V|SDHA_ENST00000510361.1_Missense_Mutation_p.L591V	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	639					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CAAGGTCACTCTGGAATATAG	0.418									Familial Paragangliomas																												p.L639V		Atlas-SNP	.											SDHA,NS,adenocarcinoma,0,1	SDHA	80	1	0			c.C1915G						scavenged	.						92.0	103.0	99.0					5																	256455		2203	4300	6503	SO:0001583	missense	6389	exon15	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	GTCACTCTGGAAT	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1915C>G	5.37:g.256455C>G	ENSP00000264932:p.Leu639Val	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	112	6	0.0535714	NM_004168	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	4.275|4.275	0.050102|0.050102	0.08243|0.08243	.|.	.|.	ENSG00000073578|ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361|ENST00000515815	D;D;D|.	0.82344|.	-1.6;-1.6;-1.6|.	4.12|4.12	-1.06|-1.06	0.10002|0.10002	Fumarate reductase/succinate dehydrogenase flavoprotein-like, C-terminal (1);Fumarate reductase/succinate dehydrogenase flavoprotein, C-terminal (1);|.	0.000000|.	0.64402|.	U|.	0.000014|.	T|T	0.53899|0.53899	0.1825|0.1825	L|L	0.50333|0.50333	1.59|1.59	0.50467|0.50467	D|D	0.999871|0.999871	B;B;D;B|.	0.57257|.	0.432;0.049;0.979;0.072|.	B;B;D;B|.	0.71414|.	0.344;0.085;0.973;0.063|.	T|T	0.47799|0.47799	-0.9089|-0.9089	10|5	0.72032|.	D|.	0.01|.	.|.	7.982|7.982	0.30190|0.30190	0.0:0.2524:0.0:0.7476|0.0:0.2524:0.0:0.7476	rs1126697;rs3181866;rs17414511|rs1126697;rs3181866;rs17414511	591;233;558;639|.	E9PBJ5;B3KYA5;D6RFM5;P31040|.	.;.;.;DHSA_HUMAN|.	V|C	639;494;558;591|121	ENSP00000264932:L639V;ENSP00000426514:L558V;ENSP00000427703:L591V|.	ENSP00000264932:L639V|.	L|S	+|+	1|2	2|0	SDHA|SDHA	309455|309455	0.152000|0.152000	0.22762|0.22762	0.492000|0.492000	0.27490|0.27490	0.237000|0.237000	0.25408|0.25408	0.546000|0.546000	0.23284|0.23284	-0.096000|-0.096000	0.12329|0.12329	-0.680000|-0.680000	0.03767|0.03767	CTG|TCT	C|0.998;G|0.002	0.002	weak		0.418	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
RIMS1	22999	hgsc.bcm.edu	37	6	72596832	72596832	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr6:72596832A>G	ENST00000521978.1	+	1	106	c.106A>G	c.(106-108)Atc>Gtc	p.I36V	RIMS1_ENST00000517960.1_Missense_Mutation_p.I36V|RIMS1_ENST00000491071.2_Missense_Mutation_p.I36V|RIMS1_ENST00000264839.7_Missense_Mutation_p.I36V|RIMS1_ENST00000520567.1_Missense_Mutation_p.I36V|RIMS1_ENST00000522291.1_Missense_Mutation_p.I36V|RIMS1_ENST00000518273.1_Missense_Mutation_p.I36V|RIMS1_ENST00000348717.5_Missense_Mutation_p.I36V	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	36	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GAGGAACATTATCATGGCAGT	0.642																																					p.I36V		Atlas-SNP	.											.	RIMS1	278	.	0			c.A106G						PASS	.						40.0	51.0	48.0					6																	72596832		2097	4223	6320	SO:0001583	missense	22999	exon1			AACATTATCATGG	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.106A>G	6.37:g.72596832A>G	ENSP00000428417:p.Ile36Val	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	48	22	0.458333	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.	.	.	.	.	.	.	.	.	.	A	14.90	2.673997	0.47781	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978	T;T;T;T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18;-1.18;-1.18;-1.18	5.05	3.85	0.44370	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.48767	D	0.000176	D	0.84238	0.5428	M	0.84948	2.725	0.80722	D	1	P	0.51351	0.944	D	0.68621	0.959	D	0.85939	0.1457	10	0.72032	D	0.01	-4.4049	11.053	0.47901	0.8441:0.1559:0.0:0.0	.	36	Q86UR5	RIMS1_HUMAN	V	36	ENSP00000430101:I36V;ENSP00000275037:I36V;ENSP00000264839:I36V;ENSP00000429959:I36V;ENSP00000430408:I36V;ENSP00000430502:I36V;ENSP00000430932:I36V;ENSP00000428417:I36V	ENSP00000264839:I36V	I	+	1	0	RIMS1	72653553	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	8.781000	0.91805	0.730000	0.32425	0.454000	0.30748	ATC	.	.	none		0.642	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
CAMK2G	818	hgsc.bcm.edu	37	10	75608359	75608359	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr10:75608359C>T	ENST00000351293.3	-	8	583	c.526G>A	c.(526-528)Ggc>Agc	p.G176S	CAMK2G_ENST00000444854.2_Intron|CAMK2G_ENST00000305762.7_Missense_Mutation_p.G176S|CAMK2G_ENST00000394762.2_Missense_Mutation_p.G176S|CAMK2G_ENST00000372765.1_Missense_Mutation_p.G176S|RP11-574K11.8_ENST00000446730.2_RNA|CAMK2G_ENST00000472912.1_5'UTR|CAMK2G_ENST00000322635.3_Missense_Mutation_p.G176S|CAMK2G_ENST00000423381.1_Missense_Mutation_p.G176S|CAMK2G_ENST00000322680.3_Missense_Mutation_p.G176S	NM_001222.3|NM_172173.2	NP_001213.2|NP_751913.1	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II gamma	176	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|dephosphorylation (GO:0016311)|G1/S transition of mitotic cell cycle (GO:0000082)|insulin secretion (GO:0030073)|interferon-gamma-mediated signaling pathway (GO:0060333)|nervous system development (GO:0007399)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of calcium ion transport (GO:0051924)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of skeletal muscle adaptation (GO:0014733)|synaptic transmission (GO:0007268)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-dependent protein serine/threonine phosphatase activity (GO:0004723)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			kidney(2)|large_intestine(2)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	15	Prostate(51;0.0112)				Bosutinib(DB06616)	CCTGGGGTGCCAGCAAAACCT	0.517											OREG0020267	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G176S		Atlas-SNP	.											.	CAMK2G	79	.	0			c.G526A						PASS	.						46.0	44.0	44.0					10																	75608359		2203	4300	6503	SO:0001583	missense	818	exon8			GGGTGCCAGCAAA	U81554	CCDS7336.1, CCDS7337.1, CCDS7338.1, CCDS73153.1	10q22	2008-10-30	2008-10-30		ENSG00000148660	ENSG00000148660			1463	protein-coding gene	gene with protein product		602123	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma"""	CAMKG		8287681	Standard	NM_001204492		Approved		uc001jvm.2	Q13555	OTTHUMG00000018492	ENST00000351293.3:c.526G>A	10.37:g.75608359C>T	ENSP00000277853:p.Gly176Ser	Somatic	71	0	0	1161	WXS	Illumina HiSeq	Phase_I	85	22	0.258824	NM_172170	O00561|O15378|Q13279|Q13282|Q13556|Q5SQZ3|Q5SQZ4|Q5SWX4|Q7KYX5|Q8N4I3|Q8NIA4	Missense_Mutation	SNP	ENST00000351293.3	37	CCDS7336.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280223	0.80692	.	.	ENSG00000148660	ENST00000351293;ENST00000322635;ENST00000423381;ENST00000394763;ENST00000322680;ENST00000394762;ENST00000433289;ENST00000305762;ENST00000372765	T;T;T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04	5.62	4.71	0.59529	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.127013	0.52532	D	0.000064	T	0.73682	0.3618	M	0.93594	3.435	0.80722	D	1	D;D;D;P;D;D;D;D	0.89917	0.993;0.997;0.968;0.863;0.974;1.0;0.998;0.999	D;D;P;P;D;D;D;D	0.97110	0.964;0.983;0.893;0.677;0.935;1.0;0.977;1.0	T	0.82559	-0.0397	10	0.87932	D	0	.	16.5573	0.84488	0.0:0.8693:0.1307:0.0	.	168;176;176;176;176;176;176;176	B3KY86;Q13555-4;Q13555-6;Q13555-10;A8K6N9;Q13555;Q13555-5;Q13555-8	.;.;.;.;.;KCC2G_HUMAN;.;.	S	176;176;176;176;176;176;111;176;176	ENSP00000277853:G176S;ENSP00000315599:G176S;ENSP00000410298:G176S;ENSP00000319060:G176S;ENSP00000378243:G176S;ENSP00000393784:G111S;ENSP00000307082:G176S;ENSP00000361851:G176S	ENSP00000307082:G176S	G	-	1	0	CAMK2G	75278365	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	7.818000	0.86416	1.351000	0.45789	-0.176000	0.13171	GGC	.	.	none		0.517	CAMK2G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048715.1	NM_172169	
NFATC2IP	84901	hgsc.bcm.edu	37	16	28962525	28962525	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr16:28962525C>T	ENST00000320805.4	+	1	268	c.193C>T	c.(193-195)Cgc>Tgc	p.R65C	NFATC2IP_ENST00000562977.1_3'UTR|NFATC2IP_ENST00000564978.1_Intron	NM_032815.3	NP_116204.3	Q8NCF5	NF2IP_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein	65					cytokine production (GO:0001816)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(2)	11						CGCCACCGCTCGCGGTGCCGC	0.687																																					p.R65C		Atlas-SNP	.											.	NFATC2IP	24	.	0			c.C193T						PASS	.						7.0	6.0	6.0					16																	28962525		1747	3277	5024	SO:0001583	missense	84901	exon1			ACCGCTCGCGGTG	AK074761	CCDS10645.1	16p11.2	2010-09-13			ENSG00000176953	ENSG00000176953			25906	protein-coding gene	gene with protein product		614525				15698469	Standard	NM_032815		Approved	FLJ14639, NIP45, RAD60, ESC2	uc002dru.3	Q8NCF5	OTTHUMG00000097763	ENST00000320805.4:c.193C>T	16.37:g.28962525C>T	ENSP00000324792:p.Arg65Cys	Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	182	25	0.137363	NM_032815	B7Z4G5|Q66K34|Q6NVK1|Q8NFR2|Q96ST9	Missense_Mutation	SNP	ENST00000320805.4	37	CCDS10645.1	.	.	.	.	.	.	.	.	.	.	C	4.485	0.089866	0.08632	.	.	ENSG00000176953	ENST00000320805	T	0.21031	2.03	2.95	-3.58	0.04597	.	2.704170	0.02280	N	0.069349	T	0.11793	0.0287	N	0.17474	0.49	0.09310	N	0.999995	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.22173	-1.0224	10	0.39692	T	0.17	.	3.5809	0.07952	0.189:0.2928:0.0:0.5182	.	65;65	B7Z8Y9;Q8NCF5	.;NF2IP_HUMAN	C	65	ENSP00000324792:R65C	ENSP00000324792:R65C	R	+	1	0	NFATC2IP	28870026	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.829000	0.04415	-0.514000	0.06488	-0.459000	0.05422	CGC	.	.	none		0.687	NFATC2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214999.2	NM_032815	
LRRN1	57633	hgsc.bcm.edu	37	3	3888234	3888234	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:3888234G>C	ENST00000319331.3	+	2	2670	c.1909G>C	c.(1909-1911)Ggg>Cgg	p.G637R	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	637						integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		TGCAGTAATGGGGTCTATGTT	0.428																																					p.G637R		Atlas-SNP	.											.	LRRN1	82	.	0			c.G1909C						PASS	.						92.0	90.0	91.0					3																	3888234		2203	4300	6503	SO:0001583	missense	57633	exon2			GTAATGGGGTCTA	AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.1909G>C	3.37:g.3888234G>C	ENSP00000314901:p.Gly637Arg	Somatic	180	0	0		WXS	Illumina HiSeq	Phase_I	128	26	0.203125	NM_020873	Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	ENST00000319331.3	37	CCDS33685.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013600	0.75161	.	.	ENSG00000175928	ENST00000319331	T	0.43294	0.95	5.35	5.35	0.76521	.	0.101437	0.64402	D	0.000002	T	0.62429	0.2427	L	0.61218	1.895	0.80722	D	1	D	0.65815	0.995	D	0.63957	0.92	T	0.64618	-0.6365	10	0.87932	D	0	.	19.4437	0.94838	0.0:0.0:1.0:0.0	.	637	Q6UXK5	LRRN1_HUMAN	R	637	ENSP00000314901:G637R	ENSP00000314901:G637R	G	+	1	0	LRRN1	3863234	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.338000	0.96553	2.661000	0.90470	0.650000	0.86243	GGG	.	.	none		0.428	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337704.2	NM_020873	
RPL10L	140801	hgsc.bcm.edu	37	14	47120688	47120688	+	Silent	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr14:47120688G>C	ENST00000298283.3	-	1	340	c.252C>G	c.(250-252)ggC>ggG	p.G84G		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	84					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						GCATGTGAAAGCCATCTCTGC	0.527																																					p.G84G		Atlas-SNP	.											.	RPL10L	64	.	0			c.C252G						PASS	.						71.0	69.0	70.0					14																	47120688		2203	4300	6503	SO:0001819	synonymous_variant	140801	exon1			GTGAAAGCCATCT	AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.252C>G	14.37:g.47120688G>C		Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	68	20	0.294118	NM_080746	Q8IUD1	Silent	SNP	ENST00000298283.3	37	CCDS32071.1																																																																																			.	.	none		0.527	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349819.1		
ZCCHC8	55596	hgsc.bcm.edu	37	12	122962423	122962423	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr12:122962423G>A	ENST00000336229.4	-	13	1440	c.1310C>T	c.(1309-1311)tCa>tTa	p.S437L	ZCCHC8_ENST00000543897.1_Missense_Mutation_p.S199L|ZCCHC8_ENST00000538116.1_Missense_Mutation_p.S48L|ZCCHC8_ENST00000536306.1_Missense_Mutation_p.S199L	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	437					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		AGATCCCGCTGAGTTGCTTTC	0.458																																					p.S437L		Atlas-SNP	.											.	ZCCHC8	56	.	0			c.C1310T						PASS	.						90.0	93.0	92.0					12																	122962423		1868	4103	5971	SO:0001583	missense	55596	exon13			CCCGCTGAGTTGC	BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.1310C>T	12.37:g.122962423G>A	ENSP00000337313:p.Ser437Leu	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	119	31	0.260504	NM_017612	Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Missense_Mutation	SNP	ENST00000336229.4	37		.	.	.	.	.	.	.	.	.	.	G	9.319	1.057609	0.19907	.	.	ENSG00000033030	ENST00000536306;ENST00000543897;ENST00000336229;ENST00000538116;ENST00000542892;ENST00000544054	T;T;T;T	0.47177	0.85;0.85;0.86;0.89	5.8	0.785	0.18584	.	0.920654	0.09181	N	0.837368	T	0.33206	0.0855	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24048	-1.0171	10	0.42905	T	0.14	0.0801	8.1198	0.30965	0.2073:0.1097:0.683:0.0	.	437	Q6NZY4	ZCHC8_HUMAN	L	199;199;437;48;48;199	ENSP00000441423:S199L;ENSP00000438993:S199L;ENSP00000337313:S437L;ENSP00000440028:S48L	ENSP00000337313:S437L	S	-	2	0	ZCCHC8	121528376	0.000000	0.05858	0.000000	0.03702	0.575000	0.36095	0.208000	0.17415	-0.120000	0.11809	0.650000	0.86243	TCA	.	.	none		0.458	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017612	
BAI3	577	hgsc.bcm.edu	37	6	70098685	70098685	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr6:70098685G>A	ENST00000370598.1	+	32	5292	c.4471G>A	c.(4471-4473)Gag>Aag	p.E1491K	BAI3_ENST00000238918.8_Missense_Mutation_p.E697K|BAI3_ENST00000546190.1_Missense_Mutation_p.E455K	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1491					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CTTAGACACAGAGGCAAAGGA	0.453																																					p.E1491K		Atlas-SNP	.											BAI3,colon,carcinoma,0,1	BAI3	451	1	0			c.G4471A						PASS	.						112.0	96.0	101.0					6																	70098685		2203	4300	6503	SO:0001583	missense	577	exon32			GACACAGAGGCAA	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.4471G>A	6.37:g.70098685G>A	ENSP00000359630:p.Glu1491Lys	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	81	35	0.432099	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.778507	0.49786	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.42513	2.13;2.73;0.97	5.94	5.94	0.96194	.	0.045450	0.85682	D	0.000000	T	0.16514	0.0397	N	0.19112	0.55	0.58432	D	0.999991	P;P	0.37781	0.608;0.608	B;B	0.29862	0.108;0.108	T	0.04427	-1.0952	10	0.21014	T	0.42	.	20.3812	0.98933	0.0:0.0:1.0:0.0	.	697;1491	B7Z356;O60242	.;BAI3_HUMAN	K	1491;697;455	ENSP00000359630:E1491K;ENSP00000238918:E697K;ENSP00000441821:E455K	ENSP00000238918:E697K	E	+	1	0	BAI3	70155406	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.220000	0.95180	2.823000	0.97156	0.643000	0.83706	GAG	.	.	none		0.453	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
CACNA2D2	9254	hgsc.bcm.edu	37	3	50405270	50405270	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:50405270C>T	ENST00000479441.1	-	26	2227	c.2228G>A	c.(2227-2229)cGt>cAt	p.R743H	XXcos-LUCA11.4_ENST00000607121.1_RNA|XXcos-LUCA11.4_ENST00000607362.1_RNA|XXcos-LUCA11.4_ENST00000607088.1_RNA|XXcos-LUCA11.4_ENST00000607583.1_RNA|XXcos-LUCA11.4_ENST00000606259.1_RNA|CACNA2D2_ENST00000429770.1_Missense_Mutation_p.R736H|CACNA2D2_ENST00000395083.1_Missense_Mutation_p.R736H|XXcos-LUCA11.5_ENST00000606589.1_3'UTR|CACNA2D2_ENST00000423994.2_Missense_Mutation_p.R743H|CACNA2D2_ENST00000435965.1_Missense_Mutation_p.R743H|XXcos-LUCA11.4_ENST00000606665.1_RNA|CACNA2D2_ENST00000360963.3_Missense_Mutation_p.R667H|CACNA2D2_ENST00000266039.3_Missense_Mutation_p.R736H|CACNA2D2_ENST00000424201.2_Missense_Mutation_p.R736H			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	743					energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CCTCCACACACGCTCTACCAG	0.627																																					p.R743H		Atlas-SNP	.											CACNA2D2,colon,carcinoma,-1,2	CACNA2D2	82	2	0			c.G2228A						scavenged	.						72.0	57.0	62.0					3																	50405270		2203	4299	6502	SO:0001583	missense	9254	exon26			CACACACGCTCTA	AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.2228G>A	3.37:g.50405270C>T	ENSP00000418081:p.Arg743His	Somatic	132	1	0.00757576		WXS	Illumina HiSeq	Phase_I	134	21	0.156716	NM_001174051	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Missense_Mutation	SNP	ENST00000479441.1	37	CCDS54588.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.252687	0.59212	.	.	ENSG00000007402	ENST00000423994;ENST00000429770;ENST00000266039;ENST00000360963;ENST00000435965;ENST00000395083;ENST00000424201;ENST00000479441	T;T;T;T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62	5.12	4.11	0.48088	.	0.233753	0.28572	N	0.014878	T	0.68632	0.3022	L	0.51422	1.61	0.09310	N	0.999998	P;D	0.57571	0.944;0.98	B;P	0.49708	0.321;0.62	T	0.62172	-0.6910	10	0.45353	T	0.12	-7.0292	9.6929	0.40139	0.0:0.8325:0.0:0.1675	.	743;736	Q9NY47;Q9NY47-2	CA2D2_HUMAN;.	H	743;736;736;667;743;736;736;743	ENSP00000407393:R743H;ENSP00000404631:R736H;ENSP00000266039:R736H;ENSP00000354228:R667H;ENSP00000390526:R743H;ENSP00000378519:R736H;ENSP00000390329:R736H;ENSP00000418081:R743H	ENSP00000266039:R736H	R	-	2	0	CACNA2D2	50380274	0.938000	0.31826	0.971000	0.41717	0.961000	0.63080	2.318000	0.43779	2.399000	0.81585	0.462000	0.41574	CGT	.	.	none		0.627	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346457.1	NM_006030	
EVC	2121	hgsc.bcm.edu	37	4	5811337	5811337	+	Splice_Site	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr4:5811337A>G	ENST00000264956.6	+	19	2965	c.2781A>G	c.(2779-2781)ctA>ctG	p.L927L	EVC_ENST00000382674.2_Splice_Site_p.L927L	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	927					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				GTGGGCTGCTAGGTGAGTCAc	0.542																																					p.L927L		Atlas-SNP	.											EVC,right_lower_lobe,carcinoma,0,1	EVC	90	1	0			c.A2781G						PASS	.						73.0	59.0	64.0					4																	5811337		2203	4300	6503	SO:0001630	splice_region_variant	2121	exon19			GCTGCTAGGTGAG	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.2782+1A>G	4.37:g.5811337A>G		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	53	16	0.301887	NM_153717		Silent	SNP	ENST00000264956.6	37	CCDS3383.1																																																																																			.	.	none		0.542	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		Silent
KMT2C	58508	hgsc.bcm.edu	37	7	151902302	151902302	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr7:151902302C>T	ENST00000262189.6	-	25	4068	c.3850G>A	c.(3850-3852)Gga>Aga	p.G1284R	KMT2C_ENST00000355193.2_Missense_Mutation_p.G1284R	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1284					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.?(1)									ACCATAAATCCACCAATACCT	0.383																																					p.G1284R		Atlas-SNP	.											.	MLL3	1564	.	1	Unknown(1)	large_intestine(1)	c.G3850A						PASS	.						72.0	69.0	70.0					7																	151902302		2203	4300	6503	SO:0001583	missense	58508	exon25			TAAATCCACCAAT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3850G>A	7.37:g.151902302C>T	ENSP00000262189:p.Gly1284Arg	Somatic	306	0	0		WXS	Illumina HiSeq	Phase_I	234	74	0.316239	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944042	0.73672	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.86956	-2.19;-2.19	5.71	5.71	0.89125	.	0.000000	0.43260	D	0.000591	D	0.94291	0.8166	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.94459	0.7674	10	0.87932	D	0	.	19.8604	0.96781	0.0:1.0:0.0:0.0	.	1284;345	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	R	1284	ENSP00000262189:G1284R;ENSP00000347325:G1284R	ENSP00000262189:G1284R	G	-	1	0	MLL3	151533235	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.993000	0.76245	2.699000	0.92147	0.650000	0.86243	GGA	.	.	none		0.383	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
ATR	545	hgsc.bcm.edu	37	3	142281284	142281284	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr3:142281284C>A	ENST00000350721.4	-	4	1081	c.960G>T	c.(958-960)atG>atT	p.M320I	ATR_ENST00000383101.3_Missense_Mutation_p.M320I	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	320					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TTTCCAGCAGCATATTTAAAT	0.373								Other conserved DNA damage response genes																													p.M320I		Atlas-SNP	.											.	ATR	285	.	0			c.G960T						PASS	.						83.0	90.0	88.0					3																	142281284		2203	4300	6503	SO:0001583	missense	545	exon4			CAGCAGCATATTT	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.960G>T	3.37:g.142281284C>A	ENSP00000343741:p.Met320Ile	Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	177	61	0.344633	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.280953	0.40394	.	.	ENSG00000175054	ENST00000350721;ENST00000383101;ENST00000515149	T;T	0.66099	-0.19;-0.19	5.24	5.24	0.73138	Armadillo-like helical (1);Armadillo-type fold (1);	0.486681	0.24384	N	0.038987	T	0.48484	0.1502	L	0.29908	0.895	0.27328	N	0.956866	B	0.02656	0.0	B	0.04013	0.001	T	0.27773	-1.0064	10	0.20046	T	0.44	-8.2121	13.1607	0.59542	0.0:0.9229:0.0:0.0771	.	320	Q13535	ATR_HUMAN	I	320;320;1	ENSP00000343741:M320I;ENSP00000372581:M320I	ENSP00000343741:M320I	M	-	3	0	ATR	143763974	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.388000	0.52509	2.445000	0.82738	0.591000	0.81541	ATG	.	.	none		0.373	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
PHF12	57649	hgsc.bcm.edu	37	17	27248804	27248804	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr17:27248804C>G	ENST00000332830.4	-	5	1548	c.738G>C	c.(736-738)aaG>aaC	p.K246N	PHF12_ENST00000268756.3_Missense_Mutation_p.K246N|PHF12_ENST00000577226.1_Missense_Mutation_p.K246N|PHF12_ENST00000582655.1_5'UTR	NM_001033561.1	NP_001028733.1			PHD finger protein 12											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			TGGTTTCCTCCTTTCTTCTCC	0.433																																					p.K246N		Atlas-SNP	.											.	PHF12	69	.	0			c.G738C						PASS	.						225.0	202.0	210.0					17																	27248804		2203	4300	6503	SO:0001583	missense	57649	exon5			TTCCTCCTTTCTT	AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.738G>C	17.37:g.27248804C>G	ENSP00000329933:p.Lys246Asn	Somatic	263	0	0		WXS	Illumina HiSeq	Phase_I	235	74	0.314894	NM_020889		Missense_Mutation	SNP	ENST00000332830.4	37	CCDS32598.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.114878	0.56505	.	.	ENSG00000109118	ENST00000332830;ENST00000378879;ENST00000268756	D;D;D	0.95238	-3.62;-3.65;-3.65	5.3	0.225	0.15325	.	0.094754	0.64402	D	0.000001	D	0.95030	0.8391	L	0.55481	1.735	0.58432	D	0.999999	D;D;D;P;D	0.76494	0.998;0.999;0.998;0.875;0.998	D;D;D;B;D	0.83275	0.991;0.996;0.991;0.357;0.991	D	0.92271	0.5825	10	0.40728	T	0.16	-22.7995	9.6823	0.40078	0.0:0.5558:0.0:0.4442	.	228;246;246;246;246	B4DFE2;Q96QT6-2;Q2TAK2;C9J9G2;Q96QT6	.;.;.;.;PHF12_HUMAN	N	246	ENSP00000329933:K246N;ENSP00000368157:K246N;ENSP00000268756:K246N	ENSP00000268756:K246N	K	-	3	2	PHF12	24272930	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.047000	0.30367	0.186000	0.20125	-0.345000	0.07892	AAG	.	.	none		0.433	PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255941.1	NM_020889	
COL14A1	7373	hgsc.bcm.edu	37	8	121219273	121219273	+	Silent	SNP	A	A	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr8:121219273A>T	ENST00000297848.3	+	10	1401	c.1131A>T	c.(1129-1131)ccA>ccT	p.P377P	COL14A1_ENST00000537875.1_Silent_p.P377P|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Silent_p.P377P|COL14A1_ENST00000247781.3_Silent_p.P282P	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CTCATGCCCCAGGAAATGTGG	0.433																																					p.P377P		Atlas-SNP	.											.	COL14A1	292	.	0			c.A1131T						PASS	.						66.0	62.0	63.0					8																	121219273		2203	4300	6503	SO:0001819	synonymous_variant	7373	exon10			TGCCCCAGGAAAT		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1131A>T	8.37:g.121219273A>T		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	183	65	0.355191	NM_021110		Silent	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	A	10.15	1.271484	0.23221	.	.	ENSG00000187955	ENST00000523142	.	.	.	5.82	4.65	0.58169	.	.	.	.	.	T	0.58337	0.2115	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55173	-0.8182	4	.	.	.	.	7.6498	0.28342	0.788:0.1422:0.0698:0.0	.	.	.	.	W	134	.	.	R	+	1	2	COL14A1	121288454	0.996000	0.38824	1.000000	0.80357	0.929000	0.56500	0.568000	0.23623	1.013000	0.39391	0.482000	0.46254	AGG	.	.	none		0.433	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
TTF1	7270	hgsc.bcm.edu	37	9	135261984	135261984	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr9:135261984A>T	ENST00000334270.2	-	9	2376	c.2337T>A	c.(2335-2337)gaT>gaA	p.D779E		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	779					chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		TTTCATTAGTATCTTCCACAT	0.299																																					p.D779E		Atlas-SNP	.											.	TTF1	82	.	0			c.T2337A						PASS	.						63.0	68.0	66.0					9																	135261984		2202	4300	6502	SO:0001583	missense	7270	exon9			ATTAGTATCTTCC	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.2337T>A	9.37:g.135261984A>T	ENSP00000333920:p.Asp779Glu	Somatic	375	0	0		WXS	Illumina HiSeq	Phase_I	408	86	0.210784	NM_007344	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	ENST00000334270.2	37	CCDS6948.1	.	.	.	.	.	.	.	.	.	.	A	13.16	2.155583	0.38021	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.11063	2.81	5.81	-3.64	0.04515	.	0.207027	0.38164	N	0.001784	T	0.05090	0.0136	L	0.46741	1.465	0.22629	N	0.998911	P	0.43750	0.816	B	0.32762	0.152	T	0.34403	-0.9830	10	0.33940	T	0.23	.	2.1505	0.03798	0.4398:0.1188:0.313:0.1284	.	779	Q15361	TTF1_HUMAN	E	779	ENSP00000333920:D779E	ENSP00000245588:D779E	D	-	3	2	TTF1	134251805	0.800000	0.28916	0.174000	0.22961	0.833000	0.47200	0.086000	0.14935	-0.353000	0.08224	0.533000	0.62120	GAT	.	.	none		0.299	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054784.2	NM_007344	
GPR183	1880	hgsc.bcm.edu	37	13	99948277	99948277	+	Silent	SNP	G	G	C			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr13:99948277G>C	ENST00000376414.4	-	2	206	c.123C>G	c.(121-123)gtC>gtG	p.V41V	UBAC2_ENST00000376440.2_Intron|UBAC2_ENST00000403766.3_Intron	NM_004951.4	NP_004942.1	P32249	GP183_HUMAN	G protein-coupled receptor 183	41					G-protein coupled receptor signaling pathway (GO:0007186)|humoral immune response (GO:0006959)|immune response (GO:0006955)|mature B cell differentiation involved in immune response (GO:0002313)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|oxysterol binding (GO:0008142)			cervix(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	23						CAATGATGAAGACGAGGCTGT	0.458																																					p.V41V		Atlas-SNP	.											GPR183,NS,carcinoma,-2,1	GPR183	38	1	0			c.C123G						scavenged	.						79.0	75.0	77.0					13																	99948277		2203	4300	6503	SO:0001819	synonymous_variant	1880	exon2			GATGAAGACGAGG	L08177	CCDS9492.1	13q32.3	2012-08-21	2008-07-21	2008-07-21	ENSG00000169508	ENSG00000169508		"""GPCR / Class A : Orphans"""	3128	protein-coding gene	gene with protein product	"""EBV-induced G-protein coupled receptor 2"""	605741	"""Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor)"""	EBI2		8383238	Standard	NM_004951		Approved		uc001vog.3	P32249	OTTHUMG00000017263	ENST00000376414.4:c.123C>G	13.37:g.99948277G>C		Somatic	218	1	0.00458716		WXS	Illumina HiSeq	Phase_I	173	41	0.236994	NM_004951	B2R8N5|Q53F99|Q5JUH7	Silent	SNP	ENST00000376414.4	37	CCDS9492.1																																																																																			.	.	none		0.458	GPR183-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045582.2	NM_004951	
PGBD4	161779	hgsc.bcm.edu	37	15	34396402	34396402	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TW-01A-11D-A382-10	TCGA-GS-A9TW-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c78bd1a-f7eb-4456-8210-f115aa079df5	e592ed1e-4fa3-459e-8256-01b5e2dc09ce	g.chr15:34396402A>G	ENST00000397766.2	+	1	2129	c.1670A>G	c.(1669-1671)aAa>aGa	p.K557R	EMC7_ENST00000256545.4_5'Flank|EMC7_ENST00000532113.1_5'Flank	NM_152595.4	NP_689808.2	Q96DM1	PGBD4_HUMAN	piggyBac transposable element derived 4	557										breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)|prostate(1)	16		all_lung(180;1.76e-08)		all cancers(64;1.22e-17)|GBM - Glioblastoma multiforme(113;1.78e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0242)		AAGATCCGGAAAGAAACGCGC	0.438																																					p.K557R		Atlas-SNP	.											.	PGBD4	58	.	0			c.A1670G						PASS	.						137.0	115.0	122.0					15																	34396402		2201	4298	6499	SO:0001583	missense	161779	exon1			TCCGGAAAGAAAC	AK057200	CCDS10033.1	15q13.1	2002-10-25			ENSG00000182405	ENSG00000182405			19401	protein-coding gene	gene with protein product							Standard	NM_152595		Approved	FLJ32638, FLJ37497	uc001zho.3	Q96DM1	OTTHUMG00000129370	ENST00000397766.2:c.1670A>G	15.37:g.34396402A>G	ENSP00000380872:p.Lys557Arg	Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	46	14	0.304348	NM_152595	A1L487|A8K0C6|Q8N9E8	Missense_Mutation	SNP	ENST00000397766.2	37	CCDS10033.1	.	.	.	.	.	.	.	.	.	.	a	0.042	-1.280633	0.01398	.	.	ENSG00000182405	ENST00000397766	T	0.19394	2.15	0.978	-0.492	0.12041	.	0.402218	0.14585	U	0.310592	T	0.06005	0.0156	N	0.11560	0.145	0.09310	N	1	P	0.40398	0.716	B	0.35039	0.194	T	0.24621	-1.0155	10	0.02654	T	1	.	3.1695	0.06548	0.7014:0.0:0.2986:0.0	.	557	Q96DM1	PGBD4_HUMAN	R	557	ENSP00000380872:K557R	ENSP00000380872:K557R	K	+	2	0	PGBD4	32183694	0.982000	0.34865	0.004000	0.12327	0.140000	0.21249	-0.042000	0.12063	-0.140000	0.11394	0.255000	0.18592	AAA	.	.	none		0.438	PGBD4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251522.1		
