#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CREBBP	1387	hgsc.bcm.edu	37	16	3781324	3781326	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	AGG	AGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr16:3781324_3781326delAGG	ENST00000262367.5	-	30	5848_5850	c.5039_5041delCCT	c.(5038-5043)tccttg>ttg	p.S1680del	CREBBP_ENST00000382070.3_In_Frame_Del_p.S1642del	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1680	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Interaction with TRERF1.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.S1680delS(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GAGCGGCGCAAGGAGGAGAACTC	0.645			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.1680_1681del		Pindel,Atlas-Indel	.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	546	.	1	Deletion - In frame(1)	large_intestine(1)	c.5040_5042del	GRCh37	CD084702	CREBBP	D		PASS	.																																			SO:0001651	inframe_deletion	1387	exon30			.	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.5039_5041delCCT	16.37:g.3781327_3781329delAGG	ENSP00000262367:p.Ser1680del	Somatic	111	.	.		WXS	Illumina HiSeq	Phase_I	103	21	0.204	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	In_Frame_Del	DEL	ENST00000262367.5	37	CCDS10509.1																																																																																			.	.	none		0.645	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
KCNMB3	27094	hgsc.bcm.edu	37	3	178960904	178960904	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr3:178960904delT	ENST00000314235.5	-	4	1139	c.628delA	c.(628-630)atcfs	p.I210fs	KCNMB3_ENST00000486944.1_Intron|KCNMB3_ENST00000497599.1_Intron|KCNMB3_ENST00000392685.2_Frame_Shift_Del_p.I206fs|KCNMB3_ENST00000349697.2_Frame_Shift_Del_p.I208fs|KCNMB3_ENST00000485523.1_Frame_Shift_Del_p.I188fs	NM_014407.3	NP_055222.3	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M beta member 3	210					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)		Miconazole(DB01110)|Procaine(DB00721)	CAGTGGAAGATAGCCATTTGG	0.418																																					p.I210fs		Atlas-Indel	.											.	KCNMB3	46	.	0			c.629delT						PASS	.						15.0	16.0	16.0					3																	178960904		2135	4244	6379	SO:0001589	frameshift_variant	27094	exon4			.	AF139471	CCDS3225.1, CCDS3226.1, CCDS43172.1, CCDS43173.1, CCDS54683.1	3q26.3-q27	2010-09-30			ENSG00000171121	ENSG00000171121		"""Potassium channels"""	6287	protein-coding gene	gene with protein product		605222		KCNMB2, KCNMBL		10585773	Standard	NM_001163677		Approved		uc003fjm.3	Q9NPA1	OTTHUMG00000157337	ENST00000314235.5:c.628delA	3.37:g.178960904delT	ENSP00000319370:p.Ile210fs	Somatic	333	0	0		WXS	Illumina HiSeq	Phase_I	452	47	0.103982	NM_014407	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Frame_Shift_Del	DEL	ENST00000314235.5	37	CCDS3226.1																																																																																			.	.	none		0.418	KCNMB3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348484.1		
CACNA2D1	781	hgsc.bcm.edu	37	7	81642816	81642818	+	In_Frame_Del	DEL	ATA	ATA	-			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	ATA	ATA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr7:81642816_81642818delATA	ENST00000356253.5	-	14	1486_1488	c.1231_1233delTAT	c.(1231-1233)tatdel	p.Y411del	MIR1255B1_ENST00000454066.1_RNA|MIR1255B1_ENST00000439234.1_RNA|CACNA2D1_ENST00000464354.1_5'UTR|CACNA2D1_ENST00000356860.3_In_Frame_Del_p.Y411del			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	411	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	AAGGAATTTCATAATAATAACCT	0.197																																					p.411_412del		Atlas-Indel	.											.	CACNA2D1	191	.	0			c.1232_1234del						PASS	.																																			SO:0001651	inframe_deletion	781	exon14			.	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.1231_1233delTAT	7.37:g.81642822_81642824delATA	ENSP00000348589:p.Tyr411del	Somatic	416	0	0		WXS	Illumina HiSeq	Phase_I	524	54	0.103053	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	In_Frame_Del	DEL	ENST00000356253.5	37																																																																																				.	.	none		0.197	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
LCE1F	353137	hgsc.bcm.edu	37	1	152749008	152749009	+	In_Frame_Ins	INS	-	-	CAGCTCTGGGGGCTGCTG	rs544759833|rs200931119	byFrequency	TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr1:152749008_152749009insCAGCTCTGGGGGCTGCTG	ENST00000334371.2	+	1	161_162	c.161_162insCAGCTCTGGGGGCTGCTG	c.(160-165)tccagc>tcCAGCTCTGGGGGCTGCTGcagc	p.61_62insSGGCCS		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	61					keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCTGTGGCTCCAGCTCTGGGG	0.683																																					p.S54delinsSSSGGCC		Atlas-Indel	.											LCE1F,colon,carcinoma,0,2	LCE1F	42	2	0			c.161_162insCAGCTCTGGGGGCTGCTG						PASS	.																																			SO:0001652	inframe_insertion	353137	exon1			.		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.162_179dupCAGCTCTGGGGGCTGCTG	1.37:g.152749008_152749009insCAGCTCTGGGGGCTGCTG	ENSP00000334187:p.Ser56_Ser61dup	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	158	25	0.158228	NM_178354		In_Frame_Ins	INS	ENST00000334371.2	37	CCDS1023.1																																																																																			.	.	none		0.683	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354	
MUC2	4583	hgsc.bcm.edu	37	11	1092618	1092619	+	In_Frame_Ins	INS	-	-	CCA	rs201595190|rs201608750|rs547682241	byFrequency	TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr11:1092618_1092619insCCA	ENST00000441003.2	+	30	4464_4465	c.4437_4438insCCA	c.(4438-4440)cca>CCAcca	p.1480_1480P>PP	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_In_Frame_Ins_p.1481_1481P>PP|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4215	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ctcccagccctccaaccaccac	0.639																																					p.P1479delinsPP		Atlas-Indel	.											.	MUC2	614	.	0			c.4437_4438insCCA						PASS	.																																			SO:0001652	inframe_insertion	4583	exon30			.	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4438_4440dupCCA	11.37:g.1092619_1092621dupCCA	ENSP00000415183:p.Pro1480dup	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	58	19	0.327586	NM_002457	Q14878	In_Frame_Ins	INS	ENST00000441003.2	37																																																																																				.	.	none		0.639	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
TRAK1	22906	hgsc.bcm.edu	37	3	42251577	42251578	+	Intron	INS	-	-	GGA	rs10634555|rs35624871		TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr3:42251577_42251578insGGA	ENST00000327628.5	+	14	2363				TRAK1_ENST00000341421.3_In_Frame_Ins_p.640_641insE|TRAK1_ENST00000487159.1_Intron|TRAK1_ENST00000396175.1_Intron	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1						endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.E640delE(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						CCAGCGGCCACggaggaggagg	0.629																																					p.T688delinsTE	GBM(44;195 884 22595 31865 41850)	Pindel	.											TRAK1,caecum,carcinoma,0,1	TRAK1	188	1	1	Deletion - In frame(1)	kidney(1)	c.2063_2064insGGA						PASS	.																																			SO:0001627	intron_variant	22906	exon14			.		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.1963+100->GGA	3.37:g.42251584_42251586dupGGA		Somatic	58	.	.		WXS	Illumina HiSeq	Phase_I	78	12	0.154	NM_001265608	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	In_Frame_Ins	INS	ENST00000327628.5	37	CCDS43072.1																																																																																			.	.	strong		0.629	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
USP39	10713	hgsc.bcm.edu	37	2	85857936	85857936	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr2:85857936G>C	ENST00000323701.6	+	6	826	c.816G>C	c.(814-816)ttG>ttC	p.L272F	USP39_ENST00000409025.1_Missense_Mutation_p.L272F|USP39_ENST00000409766.3_Missense_Mutation_p.L272F|USP39_ENST00000450066.2_Missense_Mutation_p.L169F|USP39_ENST00000409470.1_Missense_Mutation_p.L272F|USP39_ENST00000459775.1_3'UTR	NM_006590.3	NP_006581.2	Q53GS9	SNUT2_HUMAN	ubiquitin specific peptidase 39	272	USP.				cell cycle (GO:0007049)|cell division (GO:0051301)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|ubiquitin-dependent protein catabolic process (GO:0006511)	spliceosomal complex (GO:0005681)	ubiquitinyl hydrolase activity (GO:0036459)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	19						TCATGTTCTTGTTGGTCCAGC	0.438																																					p.L272F		Atlas-SNP	.											.	USP39	33	.	0			c.G816C						PASS	.						147.0	148.0	148.0					2																	85857936		2203	4300	6503	SO:0001583	missense	10713	exon6			GTTCTTGTTGGTC	AF132955	CCDS33234.1, CCDS58716.1, CCDS58717.1, CCDS74534.1	2p11.2	2009-01-06	2005-08-08		ENSG00000168883	ENSG00000168883		"""Ubiquitin-specific peptidases"""	20071	protein-coding gene	gene with protein product	"""snRNP assembly defective 1 homolog (S.cerevisiae)"", ""small nuclear ribonucleoprotein 65kDa (U4/U6.U5)"""	611594	"""ubiquitin specific protease 39"""			12838346	Standard	NM_006590		Approved	SAD1, CGI-21, SNRNP65	uc002sqg.4	Q53GS9	OTTHUMG00000153090	ENST00000323701.6:c.816G>C	2.37:g.85857936G>C	ENSP00000312981:p.Leu272Phe	Somatic	212	0	0		WXS	Illumina HiSeq	Phase_I	258	67	0.25969	NM_001256725	A8K086|B3KM40|B4DHT4|D6W5L4|G5E9H0|Q6NX47|Q96RK9|Q9BV89|Q9H381|Q9P050|Q9Y310	Missense_Mutation	SNP	ENST00000323701.6	37	CCDS33234.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.518167	0.64634	.	.	ENSG00000168883	ENST00000450066;ENST00000409268;ENST00000409025;ENST00000409470;ENST00000323701;ENST00000409766	T;T;T;T;T	0.32272	1.46;4.1;1.46;1.46;1.46	5.97	0.741	0.18336	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.49932	0.1586	M	0.84219	2.685	0.49798	D	0.999825	D;P;D;D;D;D	0.71674	0.972;0.738;0.995;0.998;0.992;0.969	D;P;D;D;D;D	0.71414	0.924;0.738;0.918;0.973;0.933;0.924	T	0.47611	-0.9104	10	0.56958	D	0.05	-5.3478	6.4861	0.22089	0.2936:0.123:0.5834:0.0	.	169;194;272;272;272;272	B4DHT4;B7Z7L9;G5E9H0;B3KM40;B9A018;Q53GS9	.;.;.;.;.;SNUT2_HUMAN	F	169;272;272;272;272;272	ENSP00000396133:L169F;ENSP00000386572:L272F;ENSP00000386864:L272F;ENSP00000312981:L272F;ENSP00000386803:L272F	ENSP00000312981:L272F	L	+	3	2	USP39	85711447	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	0.904000	0.28491	0.421000	0.25980	-0.229000	0.12294	TTG	.	.	none		0.438	USP39-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329892.1	NM_006590	
B3GAT2	135152	hgsc.bcm.edu	37	6	71571677	71571677	+	Silent	SNP	A	A	G			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr6:71571677A>G	ENST00000230053.6	-	3	1349	c.741T>C	c.(739-741)ttT>ttC	p.F247F	SMAP1_ENST00000370455.3_3'UTR	NM_080742.2	NP_542780.1	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	247					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						GACTTACAGCAAATCCTTTGT	0.328																																					p.F247F		Atlas-SNP	.											.	B3GAT2	33	.	0			c.T741C						PASS	.						54.0	57.0	56.0					6																	71571677		2203	4300	6503	SO:0001819	synonymous_variant	135152	exon3			TACAGCAAATCCT	AB075843	CCDS4974.1	6q12	2014-07-08	2014-07-08		ENSG00000112309	ENSG00000112309	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	922	protein-coding gene	gene with protein product	"""glucuronosyltransferase S"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2"""	607497				12383500	Standard	NM_080742		Approved	GlcAT-S	uc003pfv.3	Q9NPZ5	OTTHUMG00000014997	ENST00000230053.6:c.741T>C	6.37:g.71571677A>G		Somatic	229	0	0		WXS	Illumina HiSeq	Phase_I	217	28	0.129032	NM_080742	Q5JS09|Q8TF38|Q96NK4	Silent	SNP	ENST00000230053.6	37	CCDS4974.1																																																																																			.	.	none		0.328	B3GAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041150.2	NM_080742	
BPTF	2186	hgsc.bcm.edu	37	17	65955758	65955758	+	Silent	SNP	T	T	C	rs139709271|rs202116659		TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr17:65955758T>C	ENST00000321892.4	+	26	8467	c.8406T>C	c.(8404-8406)gcT>gcC	p.A2802A	BPTF_ENST00000424123.3_Silent_p.A2520A|BPTF_ENST00000306378.6_Silent_p.A2676A|BPTF_ENST00000335221.5_Silent_p.A2659A			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2802	Pro-rich.			AP -> VL (in Ref. 1; BAA89208). {ECO:0000305}.	anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A2676A(1)|p.A2659A(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TGACAccagctcctccagccc	0.582																																					p.A2676A		Atlas-SNP	.											BPTF_ENST00000335221,rectum,carcinoma,0,2	BPTF	415	2	2	Substitution - coding silent(2)	large_intestine(2)	c.T8028C						scavenged	.						40.0	33.0	36.0					17																	65955758		2203	4300	6503	SO:0001819	synonymous_variant	2186	exon24			ACCAGCTCCTCCA	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.8406T>C	17.37:g.65955758T>C		Somatic	99	5	0.050505		WXS	Illumina HiSeq	Phase_I	110	21	0.190909	NM_182641	Q6NX67|Q7Z7D6|Q9UIG2	Silent	SNP	ENST00000321892.4	37																																																																																				.	.	weak		0.582	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
ASXL2	55252	hgsc.bcm.edu	37	2	25966254	25966254	+	Silent	SNP	T	T	C			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr2:25966254T>C	ENST00000435504.4	-	13	3245	c.2952A>G	c.(2950-2952)gcA>gcG	p.A984A	ASXL2_ENST00000404843.1_Intron|ASXL2_ENST00000272341.4_Intron|ASXL2_ENST00000336112.4_Silent_p.A956A			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	984					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTCCTCTTTTGCAGTCAGTG	0.473																																					p.A984A		Atlas-SNP	.											.	ASXL2	217	.	0			c.A2952G						PASS	.						82.0	82.0	82.0					2																	25966254		1908	4135	6043	SO:0001819	synonymous_variant	55252	exon12			CTCTTTTGCAGTC			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.2952A>G	2.37:g.25966254T>C		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	77	16	0.207792	NM_018263	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Silent	SNP	ENST00000435504.4	37																																																																																				.	.	none		0.473	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263	
TTBK1	84630	hgsc.bcm.edu	37	6	43250767	43250767	+	Silent	SNP	G	G	A			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr6:43250767G>A	ENST00000259750.4	+	14	2372	c.2289G>A	c.(2287-2289)gaG>gaA	p.E763E		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	763	Glu-rich.				substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			aggaagaagaggaggaggagg	0.587																																					p.E763E		Atlas-SNP	.											.	TTBK1	124	.	0			c.G2289A						PASS	.						14.0	14.0	14.0					6																	43250767		2201	4297	6498	SO:0001819	synonymous_variant	84630	exon14			AGAAGAGGAGGAG	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.2289G>A	6.37:g.43250767G>A		Somatic	21	0	0		WXS	Illumina HiSeq	Phase_I	32	7	0.21875	NM_032538	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	ENST00000259750.4	37	CCDS34455.1																																																																																			.	.	none		0.587	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
PREX1	57580	hgsc.bcm.edu	37	20	47262400	47262400	+	Silent	SNP	G	G	A	rs141398646	byFrequency	TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr20:47262400G>A	ENST00000371941.3	-	26	3523	c.3501C>T	c.(3499-3501)cgC>cgT	p.R1167R	PREX1_ENST00000396220.1_Silent_p.R1167R	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1167					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TGTAGGAGTCGCGATAACTCA	0.602													g|||	2	0.000399361	0.0008	0.0	5008	,	,		22326	0.001		0.0	False		,,,				2504	0.0				p.R1167R		Atlas-SNP	.											.	PREX1	441	.	0			c.C3501T						PASS	.	A		7,4399	11.4+/-27.6	0,7,2196	125.0	86.0	99.0		3501	-9.6	0.5	20	dbSNP_134	99	0,8600		0,0,4300	no	coding-synonymous	PREX1	NM_020820.3		0,7,6496	AA,AG,GG		0.0,0.1589,0.0538		1167/1660	47262400	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	57580	exon26			GGAGTCGCGATAA	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3501C>T	20.37:g.47262400G>A		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	54	12	0.222222	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	37	CCDS13410.1																																																																																			G|0.999;A|0.001	0.001	strong		0.602	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
C7orf62	219557	hgsc.bcm.edu	37	7	88424178	88424178	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr7:88424178G>A	ENST00000297203.2	-	2	264	c.79C>T	c.(79-81)Cgt>Tgt	p.R27C	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	27										NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						TAATTGCTACGTGGGACTTGG	0.418																																					p.R27C		Atlas-SNP	.											C7orf62,right_upper_lobe,carcinoma,0,2	C7orf62	63	2	0			c.C79T						scavenged	.																																			SO:0001583	missense	219557	exon2			TGCTACGTGGGAC	BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.79C>T	7.37:g.88424178G>A	ENSP00000297203:p.Arg27Cys	Somatic	360	0	0		WXS	Illumina HiSeq	Phase_I	460	8	0.0173913	NM_152706		Missense_Mutation	SNP	ENST00000297203.2	37	CCDS34678.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.446869	0.84101	.	.	ENSG00000164645	ENST00000297203	T	0.23348	1.91	6.16	6.16	0.99307	.	0.149795	0.46758	D	0.000264	T	0.52933	0.1765	M	0.73598	2.24	0.50171	D	0.999855	D	0.89917	1.0	D	0.97110	1.0	T	0.51076	-0.8751	10	0.72032	D	0.01	-6.0823	16.3599	0.83257	0.0:0.0:1.0:0.0	.	27	Q8TBZ9	CG062_HUMAN	C	27	ENSP00000297203:R27C	ENSP00000297203:R27C	R	-	1	0	C7orf62	88262114	1.000000	0.71417	0.946000	0.38457	0.827000	0.46813	2.999000	0.49473	2.937000	0.99478	0.650000	0.86243	CGT	.	.	none		0.418	C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332714.1	NM_152706	
LRP1B	53353	hgsc.bcm.edu	37	2	141819775	141819775	+	Silent	SNP	G	G	T			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr2:141819775G>T	ENST00000389484.3	-	8	2052	c.1081C>A	c.(1081-1083)Cga>Aga	p.R361R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	361					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATCCTTGTTCGGTTCATCCCA	0.413										TSP Lung(27;0.18)																											p.R361R	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											LRP1B,NS,carcinoma,+1,3	LRP1B	1315	3	0			c.C1081A						PASS	.						153.0	134.0	140.0					2																	141819775		2203	4300	6503	SO:0001819	synonymous_variant	53353	exon8			TTGTTCGGTTCAT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1081C>A	2.37:g.141819775G>T		Somatic	181	0	0		WXS	Illumina HiSeq	Phase_I	141	26	0.184397	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1																																																																																			.	.	none		0.413	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
IGSF3	3321	hgsc.bcm.edu	37	1	117122285	117122285	+	Missense_Mutation	SNP	G	G	C	rs576658823|rs114915440	byFrequency	TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr1:117122285G>C	ENST00000369486.3	-	10	3828	c.3063C>G	c.(3061-3063)gaC>gaG	p.D1021E	IGSF3_ENST00000318837.6_Missense_Mutation_p.D1041E|IGSF3_ENST00000369483.1_Missense_Mutation_p.D1041E	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	1021	Ig-like C2-type 8.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.D1041D(1)|p.D1021D(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		cgtcgtcgtcgtcgtcctcct	0.632																																					p.D1041E		Atlas-SNP	.											IGSF3_ENST00000369483,NS,carcinoma,0,4	IGSF3	294	4	2	Substitution - coding silent(2)	prostate(2)	c.C3123G						scavenged	.						28.0	28.0	28.0					1																	117122285		2203	4300	6503	SO:0001583	missense	3321	exon11			GTCGTCGTCGTCC	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.3063C>G	1.37:g.117122285G>C	ENSP00000358498:p.Asp1021Glu	Somatic	80	2	0.025		WXS	Illumina HiSeq	Phase_I	90	16	0.177778	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	g	0.001	-3.470330	0.00011	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.02890	4.12;4.12;4.12	0.329	0.329	0.15924	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.329841	0.23883	N	0.043632	T	0.00468	0.0015	N	0.22421	0.69	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46925	-0.9156	8	0.02654	T	1	-2.9576	.	.	.	.	1021;1041	O75054;A6NJZ6	IGSF3_HUMAN;.	E	1021;1041;1041	ENSP00000358498:D1021E;ENSP00000358495:D1041E;ENSP00000321184:D1041E	ENSP00000321184:D1041E	D	-	3	2	IGSF3	116923808	0.026000	0.19158	0.036000	0.18154	0.121000	0.20230	-1.340000	0.02650	-0.471000	0.06891	-0.473000	0.04963	GAC	.	.	weak		0.632	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
EFR3B	22979	hgsc.bcm.edu	37	2	25351099	25351099	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr2:25351099C>A	ENST00000403714.3	+	6	716	c.533C>A	c.(532-534)aCg>aAg	p.T178K	EFR3B_ENST00000402191.1_Missense_Mutation_p.T143K|EFR3B_ENST00000405108.1_Missense_Mutation_p.T30K|EFR3B_ENST00000401432.3_Missense_Mutation_p.T178K	NM_014971.1	NP_055786.1	Q9Y2G0	EFR3B_HUMAN	EFR3 homolog B (S. cerevisiae)	178										endometrium(1)	1						GTGAGGAAGACGGTGAATGAT	0.502																																					p.T178K		Atlas-SNP	.											.	EFR3B	29	.	0			c.C533A						PASS	.						151.0	122.0	131.0					2																	25351099		692	1591	2283	SO:0001583	missense	22979	exon6			GGAAGACGGTGAA	AB023170	CCDS46231.1	2p24.1	2008-02-05	2007-11-14	2007-11-14	ENSG00000084710	ENSG00000084710			29155	protein-coding gene	gene with protein product			"""KIAA0953"""	KIAA0953		10231032	Standard	NM_014971		Approved	FLJ37871	uc010eyh.3	Q9Y2G0	OTTHUMG00000151988	ENST00000403714.3:c.533C>A	2.37:g.25351099C>A	ENSP00000384081:p.Thr178Lys	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	106	33	0.311321	NM_014971	B7WPL8|Q86XU6	Missense_Mutation	SNP	ENST00000403714.3	37	CCDS46231.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.033589	0.93575	.	.	ENSG00000084710	ENST00000401432;ENST00000403714;ENST00000402191;ENST00000545169;ENST00000405108;ENST00000264719	T;T;T;T;T	0.19105	2.17;2.17;2.17;2.17;2.17	4.98	4.98	0.66077	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51261	0.1664	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.981	T	0.56141	-0.8028	10	0.72032	D	0.01	-24.8837	17.3512	0.87324	0.0:1.0:0.0:0.0	.	178;178	Q9Y2G0;Q9Y2G0-3	EFR3B_HUMAN;.	K	178;178;143;143;30;57	ENSP00000386082:T178K;ENSP00000384081:T178K;ENSP00000385832:T143K;ENSP00000384454:T30K;ENSP00000264719:T57K	ENSP00000264719:T57K	T	+	2	0	EFR3B	25204603	1.000000	0.71417	0.973000	0.42090	0.995000	0.86356	7.541000	0.82084	2.736000	0.93811	0.655000	0.94253	ACG	.	.	none		0.502	EFR3B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324808.1	NM_014971	
OR52I2	143502	hgsc.bcm.edu	37	11	4608393	4608393	+	Silent	SNP	A	A	G	rs56002758	byFrequency	TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr11:4608393A>G	ENST00000312614.4	+	1	373	c.351A>G	c.(349-351)tcA>tcG	p.S117S		NM_001005170.2	NP_001005170.1	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I, member 2	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|pancreas(1)|skin(1)	19		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCTTCTGCTCAGGAGACAGCT	0.512													A|||	138	0.0275559	0.0915	0.0029	5008	,	,		24334	0.0109		0.0	False		,,,				2504	0.0041				p.S117S		Atlas-SNP	.											OR52I2,NS,carcinoma,0,1	OR52I2	50	1	0			c.A351G						scavenged	.						202.0	191.0	195.0					11																	4608393		2201	4298	6499	SO:0001819	synonymous_variant	143502	exon1			CTGCTCAGGAGAC	BK004264	CCDS31355.1	11p15.4	2012-08-09			ENSG00000226288	ENSG00000226288		"""GPCR / Class A : Olfactory receptors"""	15221	protein-coding gene	gene with protein product							Standard	NM_001005170		Approved		uc010qyh.2	Q8NH67	OTTHUMG00000165721	ENST00000312614.4:c.351A>G	11.37:g.4608393A>G		Somatic	270	19	0.0703704		WXS	Illumina HiSeq	Phase_I	295	23	0.0779661	NM_001005170	B2RNJ5|B9EKV8|Q6IFJ8	Silent	SNP	ENST00000312614.4	37	CCDS31355.1																																																																																			A|0.972;G|0.028	0.028	strong		0.512	OR52I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385946.1	NM_001005170	
GTF2IRD2	84163	hgsc.bcm.edu	37	7	74211819	74211819	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr7:74211819C>T	ENST00000405086.2	-	16	2221	c.2032G>A	c.(2032-2034)Gtg>Atg	p.V678M	GTF2IRD2_ENST00000451013.2_Missense_Mutation_p.V225M	NM_173537.2	NP_775808	Q86UP8	GTD2A_HUMAN	GTF2I repeat domain containing 2	678					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	11						atccagttcacggacttcact	0.507																																					p.V678M	NSCLC(40;560 1096 7501 40315 49546)	Atlas-SNP	.											GTF2IRD2,NS,carcinoma,+2,1	GTF2IRD2	38	1	0			c.G2032A						scavenged	.						48.0	42.0	44.0					7																	74211819		2200	4297	6497	SO:0001583	missense	84163	exon16			AGTTCACGGACTT	BC047706	CCDS5576.1, CCDS64682.1	7q11.23	2014-05-06			ENSG00000196275	ENSG00000196275			30775	protein-coding gene	gene with protein product	"""transcription factor GTF2IRD2"""	608899				15243160	Standard	NM_173537		Approved	FLJ37938, GTF2IRD2A	uc003ubd.1	Q86UP8	OTTHUMG00000181527	ENST00000405086.2:c.2032G>A	7.37:g.74211819C>T	ENSP00000385491:p.Val678Met	Somatic	411	1	0.00243309		WXS	Illumina HiSeq	Phase_I	503	11	0.0218688	NM_173537	A8K5W6|B3KUZ2|Q69G40|Q6EKI8|Q6EKI9|Q6NVW2|Q6P7N8|Q86WX4|Q8ND85|Q8NDE5	Missense_Mutation	SNP	ENST00000405086.2	37	CCDS5576.1	.	.	.	.	.	.	.	.	.	.	c	13.20	2.165726	0.38217	.	.	ENSG00000196275	ENST00000405086;ENST00000451013	T;T	0.26067	1.76;1.76	1.74	1.74	0.24563	Ribonuclease H-like (1);	.	.	.	.	T	0.47820	0.1466	M	0.84082	2.675	0.58432	D	0.999998	D	0.89917	1.0	D	0.76575	0.988	T	0.50750	-0.8791	9	0.87932	D	0	-10.5608	7.1297	0.25493	0.0:1.0:0.0:0.0	.	678	Q86UP8	GTD2A_HUMAN	M	678;225	ENSP00000385491:V678M;ENSP00000406723:V225M	ENSP00000385491:V678M	V	-	1	0	GTF2IRD2	73849755	0.838000	0.29461	0.710000	0.30468	0.827000	0.46813	1.812000	0.38952	1.317000	0.45149	0.442000	0.29010	GTG	.	.	none		0.507	GTF2IRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252712.3	NM_173537	
CDC27	996	hgsc.bcm.edu	37	17	45234727	45234727	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr17:45234727T>A	ENST00000066544.3	-	6	592	c.499A>T	c.(499-501)Aca>Tca	p.T167S	CDC27_ENST00000527547.1_Missense_Mutation_p.T167S|CDC27_ENST00000531206.1_Missense_Mutation_p.T167S|CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000446365.2_Missense_Mutation_p.T106S	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	167					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AATTTAAATGTTTGGTCAGGA	0.368																																					p.T167S		Atlas-SNP	.											CDC27_ENST00000531206,NS,carcinoma,+2,10	CDC27	337	10	0			c.A499T						scavenged	.						73.0	73.0	73.0					17																	45234727		2203	4300	6503	SO:0001583	missense	996	exon6			TAAATGTTTGGTC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.499A>T	17.37:g.45234727T>A	ENSP00000066544:p.Thr167Ser	Somatic	225	1	0.00444444		WXS	Illumina HiSeq	Phase_I	228	12	0.0526316	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	14.73	2.623232	0.46840	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67171	-0.25;-0.25;0.04;-0.25;0.89	5.39	5.39	0.77823	.	0.119985	0.64402	D	0.000020	T	0.47192	0.1432	N	0.08118	0	0.39122	D	0.961682	P;P;P;B	0.38677	0.475;0.528;0.642;0.211	B;B;B;B	0.36092	0.049;0.217;0.204;0.067	T	0.59762	-0.7393	10	0.72032	D	0.01	-19.1215	13.3763	0.60741	0.0:0.0:0.0:1.0	.	106;167;167;167	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	S	167;167;106;167;167	ENSP00000066544:T167S;ENSP00000434614:T167S;ENSP00000392802:T106S;ENSP00000437339:T167S;ENSP00000432105:T167S	ENSP00000066544:T167S	T	-	1	0	CDC27	42589726	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.374000	0.66167	2.053000	0.61076	0.528000	0.53228	ACA	.	.	none		0.368	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
CELSR3	1951	hgsc.bcm.edu	37	3	48698377	48698377	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr3:48698377A>C	ENST00000164024.4	-	1	1971	c.1691T>G	c.(1690-1692)gTg>gGg	p.V564G	RP11-148G20.1_ENST00000421275.1_RNA|CELSR3_ENST00000544264.1_Missense_Mutation_p.V564G	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	564	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GACGCGCAGCACGACTGTGTG	0.587																																					p.V564G		Atlas-SNP	.											.	CELSR3	237	.	0			c.T1691G						PASS	.						69.0	49.0	56.0					3																	48698377		2203	4300	6503	SO:0001583	missense	1951	exon1			CGCAGCACGACTG	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.1691T>G	3.37:g.48698377A>C	ENSP00000164024:p.Val564Gly	Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	81	15	0.185185	NM_001407	O75092	Missense_Mutation	SNP	ENST00000164024.4	37	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.607092	0.87157	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.02103	4.45;4.45	5.62	5.62	0.85841	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.18002	0.0432	M	0.92970	3.365	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.71656	0.974;0.939	T	0.02144	-1.1206	9	0.87932	D	0	.	15.8125	0.78576	1.0:0.0:0.0:0.0	.	564;634	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	G	564	ENSP00000164024:V564G;ENSP00000445694:V564G	ENSP00000164024:V564G	V	-	2	0	CELSR3	48673381	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.277000	0.95755	2.134000	0.65973	0.533000	0.62120	GTG	.	.	none		0.587	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
OR2L2	26246	hgsc.bcm.edu	37	1	248202348	248202348	+	Missense_Mutation	SNP	G	G	A	rs138166879		TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr1:248202348G>A	ENST00000366479.2	+	1	875	c.779G>A	c.(778-780)cGt>cAt	p.R260H	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			ACCTATGTACGTCCAAGATCC	0.493																																					p.R260H		Atlas-SNP	.											OR2L2,right_upper_lobe,carcinoma,+1,2	OR2L2	115	2	0			c.G779A						PASS	.	G	HIS/ARG,	1,4405		0,1,2202	149.0	135.0	139.0		779,	-0.3	0.0	1	dbSNP_134	139	1,8599		0,1,4299	no	missense,intron	OR2L2,OR2L13	NM_001004686.2,NM_175911.2	29,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign,	260/313,	248202348	2,13004	2203	4300	6503	SO:0001583	missense	26246	exon1			ATGTACGTCCAAG	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.779G>A	1.37:g.248202348G>A	ENSP00000355435:p.Arg260His	Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	116	18	0.155172	NM_001004686	Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	37	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	7.027	0.559906	0.13436	2.27E-4	1.16E-4	ENSG00000203663	ENST00000366479	T	0.37752	1.18	1.9	-0.295	0.12828	GPCR, rhodopsin-like superfamily (1);	1.359230	0.05838	N	0.618748	T	0.15652	0.0377	N	0.02876	-0.465	0.09310	N	1	B	0.18741	0.03	B	0.20955	0.032	T	0.24728	-1.0152	10	0.27785	T	0.31	.	5.8101	0.18462	0.6147:0.0:0.3853:0.0	.	260	Q8NH16	OR2L2_HUMAN	H	260	ENSP00000355435:R260H	ENSP00000355435:R260H	R	+	2	0	OR2L2	246268971	0.000000	0.05858	0.001000	0.08648	0.129000	0.20672	-0.108000	0.10857	0.035000	0.15519	0.194000	0.17425	CGT	G|1.000;A|0.000	0.000	weak		0.493	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686	
HIST1H2BL	8340	hgsc.bcm.edu	37	6	27775319	27775319	+	Nonsense_Mutation	SNP	G	G	T	rs141178835	byFrequency	TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr6:27775319G>T	ENST00000377401.2	-	1	390	c.366C>A	c.(364-366)taC>taA	p.Y122*	HIST1H2AI_ENST00000358739.3_5'Flank|HIST1H3H_ENST00000369163.2_5'Flank	NM_003519.3	NP_003510.1	Q99880	H2B1L_HUMAN	histone cluster 1, H2bl	122					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						TGGAGCTGGTGTACTTGGTGA	0.562																																					p.Y122X		Atlas-SNP	.											HIST1H2BL,NS,carcinoma,0,2	HIST1H2BL	48	2	0			c.C366A						PASS	.						81.0	83.0	82.0					6																	27775319		2203	4300	6503	SO:0001587	stop_gained	8340	exon1			GCTGGTGTACTTG	Z83740	CCDS4625.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000185130	ENSG00000185130		"""Histones / Replication-dependent"""	4748	protein-coding gene	gene with protein product		602800	"""H2B histone family, member C"", ""histone 1, H2bl"""	H2BFC		9439656, 12408966	Standard	NM_003519		Approved	H2B/c, dJ97D16.4	uc003njl.3	Q99880	OTTHUMG00000014485	ENST00000377401.2:c.366C>A	6.37:g.27775319G>T	ENSP00000366618:p.Tyr122*	Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	139	17	0.122302	NM_003519	B2R5A3|Q52LW9	Nonsense_Mutation	SNP	ENST00000377401.2	37	CCDS4625.1	.	.	.	.	.	.	.	.	.	.	.	17.71	3.456850	0.63401	.	.	ENSG00000185130	ENST00000377401	.	.	.	4.35	1.58	0.23477	.	0.163302	0.23690	U	0.045538	.	.	.	.	.	.	0.33563	D	0.597642	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.4147	0.38514	0.2395:0.0:0.7605:0.0	.	.	.	.	X	122	.	ENSP00000366618:Y122X	Y	-	3	2	HIST1H2BL	27883298	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.813000	0.48002	0.180000	0.19960	-0.768000	0.03414	TAC	G|1.000;A|0.000	.	alt		0.562	HIST1H2BL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040153.1	NM_003519	
ZDHHC6	64429	hgsc.bcm.edu	37	10	114200386	114200386	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr10:114200386A>C	ENST00000369405.3	-	5	1010	c.587T>G	c.(586-588)gTt>gGt	p.V196G	ZDHHC6_ENST00000369404.3_Missense_Mutation_p.V192G	NM_022494.1	NP_071939.1	Q9H6R6	ZDHC6_HUMAN	zinc finger, DHHC-type containing 6	196					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Colorectal(252;0.198)		Epithelial(162;0.0291)|all cancers(201;0.117)		TCCAAATGGAACAATTGGAAG	0.458																																					p.V196G		Atlas-SNP	.											.	ZDHHC6	32	.	0			c.T587G						PASS	.						172.0	155.0	161.0					10																	114200386		2203	4300	6503	SO:0001583	missense	64429	exon5			AATGGAACAATTG	AK025605	CCDS7574.1	10q26.11	2008-05-02			ENSG00000023041	ENSG00000023041		"""Zinc fingers, DHHC-type"""	19160	protein-coding gene	gene with protein product							Standard	NM_022494		Approved	ZNF376, FLJ21952	uc001kzv.3	Q9H6R6	OTTHUMG00000019062	ENST00000369405.3:c.587T>G	10.37:g.114200386A>C	ENSP00000358413:p.Val196Gly	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	96	17	0.177083	NM_022494	D3DRB6|Q53G45|Q96IV7|Q9H605	Missense_Mutation	SNP	ENST00000369405.3	37	CCDS7574.1	.	.	.	.	.	.	.	.	.	.	A	19.72	3.880428	0.72294	.	.	ENSG00000023041	ENST00000369405;ENST00000369404	T;T	0.66815	0.51;-0.23	5.92	5.92	0.95590	.	0.364419	0.32343	N	0.006237	T	0.65291	0.2677	L	0.49699	1.58	0.80722	D	1	B;B	0.26672	0.156;0.029	B;B	0.32805	0.153;0.11	T	0.62011	-0.6944	10	0.38643	T	0.18	-12.459	16.3492	0.83195	1.0:0.0:0.0:0.0	.	192;196	Q9H6R6-2;Q9H6R6	.;ZDHC6_HUMAN	G	196;192	ENSP00000358413:V196G;ENSP00000358412:V192G	ENSP00000358412:V192G	V	-	2	0	ZDHHC6	114190376	1.000000	0.71417	0.267000	0.24556	0.872000	0.50106	9.300000	0.96151	2.266000	0.75297	0.528000	0.53228	GTT	.	.	none		0.458	ZDHHC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050393.1	NM_022494	
ASXL2	55252	hgsc.bcm.edu	37	2	25966225	25966225	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr2:25966225A>T	ENST00000435504.4	-	13	3274	c.2981T>A	c.(2980-2982)aTa>aAa	p.I994K	ASXL2_ENST00000404843.1_Intron|ASXL2_ENST00000272341.4_Intron|ASXL2_ENST00000336112.4_Missense_Mutation_p.I966K			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	994					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTGGTAGCTATGAGCGCTCC	0.478																																					p.I994K		Atlas-SNP	.											.	ASXL2	217	.	0			c.T2981A						PASS	.						69.0	71.0	70.0					2																	25966225		1942	4150	6092	SO:0001583	missense	55252	exon12			GTAGCTATGAGCG			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.2981T>A	2.37:g.25966225A>T	ENSP00000391447:p.Ile994Lys	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	74	14	0.189189	NM_018263	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	ENST00000435504.4	37		.	.	.	.	.	.	.	.	.	.	A	1.432	-0.570090	0.03910	.	.	ENSG00000143970	ENST00000435504;ENST00000336112	T;T	0.22134	1.97;1.97	5.94	2.99	0.34606	.	1.396170	0.03804	N	0.264897	T	0.16599	0.0399	N	0.22421	0.69	0.09310	N	0.999999	B	0.15473	0.013	B	0.12156	0.007	T	0.25779	-1.0122	10	0.87932	D	0	6.8419	5.2126	0.15325	0.2217:0.3059:0.4723:0.0	.	994	Q76L83	ASXL2_HUMAN	K	994;966	ENSP00000391447:I994K;ENSP00000337250:I966K	ENSP00000337250:I966K	I	-	2	0	ASXL2	25819729	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.088000	0.14979	0.775000	0.33450	0.460000	0.39030	ATA	.	.	none		0.478	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263	
REV1	51455	hgsc.bcm.edu	37	2	100065955	100065955	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr2:100065955C>T	ENST00000258428.3	-	4	421	c.193G>A	c.(193-195)Gag>Aag	p.E65K	REV1_ENST00000465835.1_5'UTR|REV1_ENST00000393445.3_Missense_Mutation_p.E65K	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	65	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTCAATTCCTCAGCGGAAGGA	0.318								Direct reversal of damage																													p.E65K		Atlas-SNP	.											.	REV1	100	.	0			c.G193A						PASS	.						79.0	80.0	80.0					2																	100065955		2203	4300	6503	SO:0001583	missense	51455	exon4			ATTCCTCAGCGGA	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.193G>A	2.37:g.100065955C>T	ENSP00000258428:p.Glu65Lys	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	126	27	0.214286	NM_001037872	O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	ENST00000258428.3	37	CCDS2045.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.794160	0.90453	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	T;T	0.79940	-1.32;-1.32	6.07	6.07	0.98685	BRCT (4);	0.145050	0.64402	D	0.000009	T	0.79534	0.4462	L	0.52126	1.63	0.52501	D	0.999959	P;B;B	0.43352	0.804;0.389;0.029	B;B;B	0.39840	0.311;0.21;0.036	T	0.80538	-0.1338	10	0.59425	D	0.04	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	44;65;65	Q9UBZ9-3;Q9UBZ9;Q9UBZ9-2	.;REV1_HUMAN;.	K	65	ENSP00000377091:E65K;ENSP00000258428:E65K	ENSP00000258428:E65K	E	-	1	0	REV1	99432387	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.456000	0.80751	2.885000	0.99019	0.655000	0.94253	GAG	.	.	none		0.318	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	
SETMAR	6419	hgsc.bcm.edu	37	3	4354652	4354652	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr3:4354652T>C	ENST00000358065.4	+	2	294	c.227T>C	c.(226-228)aTt>aCt	p.I76T	SETMAR_ENST00000430981.1_Missense_Mutation_p.I76T|SETMAR_ENST00000425863.1_Missense_Mutation_p.I76T|SETMAR_ENST00000462115.1_3'UTR|SUMF1_ENST00000534863.1_Intron	NM_006515.3	NP_006506.3	Q53H47	SETMR_HUMAN	SET domain and mariner transposase fusion gene	76	Histone-lysine N-methyltransferase.|Pre-SET. {ECO:0000255|PROSITE- ProRule:PRU00157}.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA integration (GO:0015074)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of chromosome organization (GO:2001251)|positive regulation of double-strand break repair via nonhomologous end joining (GO:2001034)|transposition, DNA-mediated (GO:0006313)	chromosome (GO:0005694)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|histone-lysine N-methyltransferase activity (GO:0018024)|protein homodimerization activity (GO:0042803)|structure-specific DNA binding (GO:0043566)|transposase activity (GO:0004803)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9		Melanoma(143;0.0657)		Epithelial(13;0.0025)|OV - Ovarian serous cystadenocarcinoma(96;0.011)|all cancers(10;0.0114)		CCCGGATGCATTTGTGTCAAA	0.458								Chromatin Structure																													p.I76T		Atlas-SNP	.											.	SETMAR	30	.	0			c.T227C						PASS	.						113.0	107.0	109.0					3																	4354652		2203	4300	6503	SO:0001583	missense	6419	exon2			GATGCATTTGTGT	U80776	CCDS2563.2, CCDS58814.1, CCDS63528.1	3p26.2	2013-01-31			ENSG00000170364	ENSG00000170364			10762	protein-coding gene	gene with protein product		609834				9461395	Standard	NM_006515		Approved	metnase	uc011asp.2	Q53H47	OTTHUMG00000090265	ENST00000358065.4:c.227T>C	3.37:g.4354652T>C	ENSP00000373354:p.Ile76Thr	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	171	50	0.292398	NM_001243723	B4DY74|E7EN68|Q13579|Q1G668|Q96F41	Missense_Mutation	SNP	ENST00000358065.4	37	CCDS2563.2	.	.	.	.	.	.	.	.	.	.	T	8.760	0.923452	0.18056	.	.	ENSG00000170364	ENST00000358065;ENST00000430981;ENST00000425863	D;D;T	0.88354	-2.37;-2.37;-1.26	5.13	-7.57	0.01318	Pre-SET zinc-binding sub-group (1);Pre-SET domain (2);	.	.	.	.	T	0.75459	0.3852	N	0.20685	0.6	0.09310	N	1	B;B;B	0.16396	0.017;0.006;0.0	B;B;B	0.22753	0.031;0.041;0.008	T	0.60576	-0.7236	9	0.23302	T	0.38	.	7.2937	0.26380	0.0851:0.536:0.1722:0.2066	.	76;63;76	E7EN68;Q53H47;C9JHK2	.;SETMR_HUMAN;.	T	76	ENSP00000373354:I76T;ENSP00000403000:I76T;ENSP00000403145:I76T	ENSP00000373354:I76T	I	+	2	0	SETMAR	4329652	0.000000	0.05858	0.000000	0.03702	0.984000	0.73092	-2.058000	0.01394	-1.487000	0.01849	0.455000	0.32223	ATT	.	.	none		0.458	SETMAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206587.4	NM_006515	
CCDC144A	9720	hgsc.bcm.edu	37	17	16610838	16610838	+	Silent	SNP	C	C	T			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr17:16610838C>T	ENST00000360524.8	+	4	796	c.720C>T	c.(718-720)tgC>tgT	p.C240C	CCDC144A_ENST00000436374.1_3'UTR|RP11-219A15.1_ENST00000448331.3_Silent_p.C240C|CCDC144A_ENST00000399273.1_Silent_p.C240C|CCDC144A_ENST00000340621.5_Silent_p.C239C|RN7SL620P_ENST00000580704.1_RNA|CCDC144A_ENST00000456009.1_Silent_p.C240C|CCDC144A_ENST00000443444.2_Silent_p.C240C	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	240								p.C240C(1)									TTAAAGGATGCGAAAATAAGC	0.348																																					p.C240C		Atlas-SNP	.											CCDC144B,colon,carcinoma,0,2	CCDC144A	53	2	1	Substitution - coding silent(1)	ovary(1)	c.C720T						scavenged	.						36.0	38.0	37.0					17																	16610838		1828	4078	5906	SO:0001819	synonymous_variant	9720	exon4			AGGATGCGAAAAT	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.720C>T	17.37:g.16610838C>T		Somatic	968	2	0.00206612		WXS	Illumina HiSeq	Phase_I	1054	13	0.012334	NM_014695	O60311|Q6ZU57	Silent	SNP	ENST00000360524.8	37	CCDS45621.1	.	.	.	.	.	.	.	.	.	.	.	1.236	-0.622772	0.03636	.	.	ENSG00000170160	ENST00000328495	.	.	.	1.72	1.72	0.24424	.	.	.	.	.	T	0.24353	0.0590	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24119	-1.0169	4	.	.	.	.	3.7817	0.08683	0.0:0.2187:0.0:0.7813	.	.	.	.	V	4	.	.	A	+	2	0	CCDC144A	16551563	0.111000	0.22076	0.001000	0.08648	0.020000	0.10135	0.866000	0.27954	-0.038000	0.13624	-1.514000	0.00941	GCG	.	.	none		0.348	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1		
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274291	39274291	+	Missense_Mutation	SNP	T	T	C	rs200214744|rs565505867	byFrequency	TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr17:39274291T>C	ENST00000391413.2	-	1	315	c.277A>G	c.(277-279)Atg>Gtg	p.M93V		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	93	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.M93V(4)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGGCAGCACATAGACTGGCAG	0.662																																					p.M93V		Atlas-SNP	.											KRTAP4-11,NS,carcinoma,0,12	KRTAP4-11	94	12	4	Substitution - Missense(4)	endometrium(3)|kidney(1)	c.A277G						scavenged	.						6.0	10.0	8.0					17																	39274291		651	1556	2207	SO:0001583	missense	653240	exon1			AGCACATAGACTG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.277A>G	17.37:g.39274291T>C	ENSP00000375232:p.Met93Val	Somatic	43	4	0.0930233		WXS	Illumina HiSeq	Phase_I	44	9	0.204545	NM_033059	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	0.073	-1.199029	0.01581	.	.	ENSG00000212721	ENST00000391413	T	0.00580	6.43	4.25	-4.9	0.03094	.	.	.	.	.	T	0.00109	0.0003	N	0.00040	-2.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43097	-0.9412	9	0.02654	T	1	.	0.4739	0.00536	0.3479:0.2455:0.1203:0.2863	.	93	Q9BYQ6	KR411_HUMAN	V	93	ENSP00000375232:M93V	ENSP00000375232:M93V	M	-	1	0	KRTAP4-11	36527817	.	.	0.012000	0.15200	0.010000	0.07245	.	.	-1.319000	0.02286	-1.132000	0.01976	ATG	.	.	weak		0.662	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
FAT3	120114	hgsc.bcm.edu	37	11	92533495	92533495	+	Missense_Mutation	SNP	G	G	A	rs149993900		TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr11:92533495G>A	ENST00000298047.6	+	9	7333	c.7316G>A	c.(7315-7317)cGg>cAg	p.R2439Q	FAT3_ENST00000409404.2_Missense_Mutation_p.R2439Q|FAT3_ENST00000525166.1_Missense_Mutation_p.R2289Q			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2439	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGGAATGACCGGACGAGCTTT	0.493										TCGA Ovarian(4;0.039)			G|||	1	0.000199681	0.0	0.0	5008	,	,		21024	0.0		0.001	False		,,,				2504	0.0				p.R2439Q		Atlas-SNP	.											.	FAT3	1822	.	0			c.G7316A						PASS	.	G	GLN/ARG	0,3892		0,0,1946	94.0	90.0	91.0		7316	4.9	0.9	11	dbSNP_134	91	5,8277		0,5,4136	yes	missense	FAT3	NM_001008781.2	43	0,5,6082	AA,AG,GG		0.0604,0.0,0.0411	possibly-damaging	2439/4558	92533495	5,12169	1946	4141	6087	SO:0001583	missense	120114	exon9			ATGACCGGACGAG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7316G>A	11.37:g.92533495G>A	ENSP00000298047:p.Arg2439Gln	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	96	12	0.125	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	11.46	1.644572	0.29246	0.0	6.04E-4	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.51325	0.71;0.71;0.71	5.82	4.91	0.64330	.	.	.	.	.	T	0.36608	0.0973	N	0.04162	-0.26	0.80722	D	1	D	0.69078	0.997	P	0.55545	0.778	T	0.20505	-1.0273	9	0.11182	T	0.66	.	14.4549	0.67409	0.0698:0.0:0.9302:0.0	.	2439	Q8TDW7-3	.	Q	2439;2439;2289	ENSP00000298047:R2439Q;ENSP00000387040:R2439Q;ENSP00000432586:R2289Q	ENSP00000298047:R2439Q	R	+	2	0	FAT3	92173143	1.000000	0.71417	0.925000	0.36789	0.967000	0.64934	5.115000	0.64655	1.468000	0.48064	0.561000	0.74099	CGG	G|1.000;A|0.000	0.000	strong		0.493	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
PTPN13	5783	hgsc.bcm.edu	37	4	87696720	87696720	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr4:87696720G>A	ENST00000411767.2	+	35	5869	c.5806G>A	c.(5806-5808)Gga>Aga	p.G1936R	PTPN13_ENST00000316707.6_Missense_Mutation_p.G1745R|PTPN13_ENST00000436978.1_Missense_Mutation_p.G1941R|PTPN13_ENST00000511467.1_Missense_Mutation_p.G1941R|PTPN13_ENST00000427191.2_Missense_Mutation_p.G1917R			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1936	PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TTATGTGAACGGAGTCAGCAC	0.408																																					p.G1941R		Atlas-SNP	.											.	PTPN13	203	.	0			c.G5821A						PASS	.						83.0	84.0	84.0					4																	87696720		2174	4282	6456	SO:0001583	missense	5783	exon35			GTGAACGGAGTCA		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.5806G>A	4.37:g.87696720G>A	ENSP00000407249:p.Gly1936Arg	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	132	22	0.166667	NM_080685	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.981634	0.93044	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77	5.45	5.45	0.79879	PDZ/DHR/GLGF (4);	0.000000	0.47852	D	0.000211	T	0.76835	0.4043	M	0.91510	3.215	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.82321	-0.0515	10	0.87932	D	0	.	19.2786	0.94042	0.0:0.0:1.0:0.0	.	1745;1917;1936;1941	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	R	1917;1941;1745;1936;1941;1885	ENSP00000408368:G1917R;ENSP00000394794:G1941R;ENSP00000322675:G1745R;ENSP00000407249:G1936R;ENSP00000426626:G1941R	ENSP00000322675:G1745R	G	+	1	0	PTPN13	87915744	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	8.930000	0.92872	2.552000	0.86080	0.460000	0.39030	GGA	.	.	none		0.408	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
LPCAT2	54947	hgsc.bcm.edu	37	16	55608567	55608567	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr16:55608567C>T	ENST00000262134.5	+	12	1424	c.1240C>T	c.(1240-1242)Cga>Tga	p.R414*	LPCAT2_ENST00000565056.1_3'UTR	NM_017839.4	NP_060309.2	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	414	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	12						CATTGACTTCCGAGAGTATGT	0.448																																					p.R414X		Atlas-SNP	.											.	LPCAT2	35	.	0			c.C1240T						PASS	.						169.0	131.0	144.0					16																	55608567		2198	4300	6498	SO:0001587	stop_gained	54947	exon12			GACTTCCGAGAGT	AK000488	CCDS10753.1	16q12.2	2013-01-10	2007-12-17	2007-12-17	ENSG00000087253	ENSG00000087253		"""EF-hand domain containing"""	26032	protein-coding gene	gene with protein product		612040	"""acyltransferase like 1"""	AYTL1		16704971	Standard	NM_017839		Approved	FLJ20481	uc002eie.4	Q7L5N7	OTTHUMG00000133238	ENST00000262134.5:c.1240C>T	16.37:g.55608567C>T	ENSP00000262134:p.Arg414*	Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	179	21	0.117318	NM_017839	A3KBM1|Q6MZJ6|Q9NX23	Nonsense_Mutation	SNP	ENST00000262134.5	37	CCDS10753.1	.	.	.	.	.	.	.	.	.	.	C	37	6.602750	0.97697	.	.	ENSG00000087253	ENST00000262134	.	.	.	5.84	3.74	0.42951	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.8774	12.3155	0.54953	0.5722:0.4278:0.0:0.0	.	.	.	.	X	414	.	ENSP00000262134:R414X	R	+	1	2	LPCAT2	54166068	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.870000	0.48451	1.463000	0.47967	0.655000	0.94253	CGA	.	.	none		0.448	LPCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256977.2	NM_017839	
UBA6	55236	hgsc.bcm.edu	37	4	68530944	68530944	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr4:68530944A>G	ENST00000322244.5	-	10	919	c.860T>C	c.(859-861)aTa>aCa	p.I287T	UBA6_ENST00000420827.2_Missense_Mutation_p.I287T	NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	287					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						TTGGACAGCTATGCCTCCATG	0.308																																					p.I287T		Atlas-SNP	.											.	UBA6	98	.	0			c.T860C						PASS	.						77.0	83.0	81.0					4																	68530944		2203	4297	6500	SO:0001583	missense	55236	exon10			ACAGCTATGCCTC	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.860T>C	4.37:g.68530944A>G	ENSP00000313454:p.Ile287Thr	Somatic	360	0	0		WXS	Illumina HiSeq	Phase_I	396	60	0.151515	NM_018227	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Missense_Mutation	SNP	ENST00000322244.5	37	CCDS3516.1	.	.	.	.	.	.	.	.	.	.	A	15.64	2.892823	0.52121	.	.	ENSG00000033178	ENST00000322244;ENST00000420827	T;T	0.55760	0.5;0.5	5.37	5.37	0.77165	Molybdenum cofactor biosynthesis, MoeB (1);	0.046676	0.85682	D	0.000000	T	0.52613	0.1745	L	0.60957	1.885	0.50632	D	0.999888	P;P;P	0.43885	0.724;0.82;0.803	B;B;B	0.42062	0.259;0.374;0.232	T	0.56092	-0.8036	10	0.45353	T	0.12	-15.3972	15.3307	0.74208	1.0:0.0:0.0:0.0	.	287;287;287	A0AVT1-4;A0AVT1-3;A0AVT1	.;.;UBA6_HUMAN	T	287	ENSP00000313454:I287T;ENSP00000399234:I287T	ENSP00000313454:I287T	I	-	2	0	UBA6	68213539	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.799000	0.69101	2.173000	0.68751	0.377000	0.23210	ATA	.	.	none		0.308	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227	
BIRC8	112401	hgsc.bcm.edu	37	19	53793083	53793083	+	Missense_Mutation	SNP	C	C	T	rs138004934	byFrequency	TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr19:53793083C>T	ENST00000426466.1	-	1	1792	c.545G>A	c.(544-546)cGt>cAt	p.R182H		NM_033341.4	NP_203127.3	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat containing 8	182					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)	p.R182L(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|urinary_tract(1)	19				GBM - Glioblastoma multiforme(134;0.00304)		CTCTTGCAGACGCCTTAGCGG	0.428													c|||	20	0.00399361	0.0	0.0101	5008	,	,		18021	0.002		0.006	False		,,,				2504	0.0051				p.R182H		Atlas-SNP	.											BIRC8,NS,carcinoma,-1,1	BIRC8	54	1	1	Substitution - Missense(1)	lung(1)	c.G545A						scavenged	.	C	HIS/ARG	9,4397	15.5+/-35.6	0,9,2194	87.0	88.0	88.0		545	-1.0	0.0	19	dbSNP_134	88	70,8530	43.1+/-100.9	0,70,4230	yes	missense	BIRC8	NM_033341.4	29	0,79,6424	TT,TC,CC		0.814,0.2043,0.6074	benign	182/237	53793083	79,12927	2203	4300	6503	SO:0001583	missense	112401	exon1			TGCAGACGCCTTA	AF164682	CCDS12863.1	19q13.3-q13.4	2011-01-25	2011-01-25			ENSG00000163098		"""Baculoviral IAP repeat containing"""	14878	protein-coding gene	gene with protein product	"""IAP-like protein 2"", ""inhibitor of apoptosis-like protein 2"""		"""baculoviral IAP repeat-containing 8"""			11390657	Standard	NM_033341		Approved	ILP-2, hILP2	uc002qbk.3	Q96P09		ENST00000426466.1:c.545G>A	19.37:g.53793083C>T	ENSP00000412957:p.Arg182His	Somatic	235	3	0.012766		WXS	Illumina HiSeq	Phase_I	219	39	0.178082	NM_033341	Q6IPY1|Q96RW5	Missense_Mutation	SNP	ENST00000426466.1	37	CCDS12863.1	9	0.004120879120879121	1	0.0020325203252032522	4	0.011049723756906077	0	0.0	4	0.005277044854881266	C	7.449	0.642220	0.14451	0.002043	0.00814	ENSG00000163098	ENST00000426466	T	0.03920	3.76	0.502	-1.0	0.10196	Baculoviral inhibition of apoptosis protein repeat (1);	.	.	.	.	T	0.03305	0.0096	L	0.56769	1.78	0.27067	N	0.963417	B	0.21821	0.061	B	0.17098	0.017	T	0.39981	-0.9587	9	0.72032	D	0.01	-0.1583	1.5656	0.02604	0.3374:0.3836:0.0:0.279	.	182	Q96P09	BIRC8_HUMAN	H	182	ENSP00000412957:R182H	ENSP00000412957:R182H	R	-	2	0	BIRC8	58484895	1.000000	0.71417	0.011000	0.14972	0.010000	0.07245	1.086000	0.30853	-0.440000	0.07211	-0.851000	0.03033	CGT	C|0.995;T|0.005	0.005	strong		0.428	BIRC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464357.1	NM_033341	
NRD1	4898	hgsc.bcm.edu	37	1	52306075	52306075	+	Silent	SNP	T	T	C	rs78724482	byFrequency	TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr1:52306075T>C	ENST00000354831.7	-	2	642	c.453A>G	c.(451-453)gaA>gaG	p.E151E	NRD1_ENST00000352171.7_Silent_p.E151E|NRD1_ENST00000539524.1_Silent_p.E19E|NRD1_ENST00000544028.1_Silent_p.E19E|NRD1_ENST00000485608.1_5'UTR	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	0	Asp/Glu-rich (highly acidic).|Poly-Glu.				cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						cttcttcttcttcctccacct	0.388																																					p.E151E		Atlas-SNP	.											.	NRD1	89	.	0			c.A453G						PASS	.						165.0	136.0	146.0					1																	52306075		2203	4300	6503	SO:0001819	synonymous_variant	4898	exon2			TTCTTCTTCCTCC	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.453A>G	1.37:g.52306075T>C		Somatic	356	0	0		WXS	Illumina HiSeq	Phase_I	370	35	0.0945946	NM_001101662	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Silent	SNP	ENST00000354831.7	37	CCDS559.1																																																																																			T|0.952;C|0.048	0.048	strong		0.388	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
ASXL2	55252	hgsc.bcm.edu	37	2	25966278	25966278	+	Silent	SNP	T	T	C			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr2:25966278T>C	ENST00000435504.4	-	13	3221	c.2928A>G	c.(2926-2928)gaA>gaG	p.E976E	ASXL2_ENST00000404843.1_Intron|ASXL2_ENST00000272341.4_Intron|ASXL2_ENST00000336112.4_Silent_p.E948E			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	976					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCGTTTTCATTTCAACTTTGG	0.448																																					p.E976E		Atlas-SNP	.											.	ASXL2	217	.	0			c.A2928G						PASS	.						108.0	107.0	107.0					2																	25966278		1893	4115	6008	SO:0001819	synonymous_variant	55252	exon12			TTTCATTTCAACT			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.2928A>G	2.37:g.25966278T>C		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	89	14	0.157303	NM_018263	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Silent	SNP	ENST00000435504.4	37																																																																																				.	.	none		0.448	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263	
NRD1	4898	hgsc.bcm.edu	37	1	52306079	52306079	+	Missense_Mutation	SNP	T	T	A	rs62648104		TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr1:52306079T>A	ENST00000354831.7	-	2	638	c.449A>T	c.(448-450)gAg>gTg	p.E150V	NRD1_ENST00000352171.7_Missense_Mutation_p.E150V|NRD1_ENST00000539524.1_Missense_Mutation_p.E18V|NRD1_ENST00000544028.1_Missense_Mutation_p.E18V|NRD1_ENST00000485608.1_5'UTR	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	0	Asp/Glu-rich (highly acidic).|Poly-Glu.				cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						ttcttcttcctccacctcctc	0.378																																					p.E150V		Atlas-SNP	.											.	NRD1	89	.	0			c.A449T						PASS	.						163.0	138.0	146.0					1																	52306079		2203	4300	6503	SO:0001583	missense	4898	exon2			TCTTCCTCCACCT	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.449A>T	1.37:g.52306079T>A	ENSP00000346890:p.Glu150Val	Somatic	354	0	0		WXS	Illumina HiSeq	Phase_I	366	26	0.0710383	NM_001101662	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	37	CCDS559.1	.	.	.	.	.	.	.	.	.	.	T	3.056	-0.194350	0.06259	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000546169;ENST00000544028	T;T;T;T	0.38240	1.31;3.15;1.15;1.22	5.25	2.92	0.33932	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.525899	0.19688	N	0.108344	T	0.18341	0.0440	N	0.14661	0.345	0.09310	N	1	B;B;B	0.23650	0.062;0.089;0.01	B;B;B	0.17098	0.017;0.007;0.007	T	0.14755	-1.0461	10	0.38643	T	0.18	-0.0317	5.1939	0.15225	0.0:0.1704:0.2022:0.6274	rs62648104	150;150;150	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	V	150;150;18;150;18	ENSP00000262679:E150V;ENSP00000346890:E150V;ENSP00000444416:E18V;ENSP00000442262:E18V	ENSP00000262679:E150V	E	-	2	0	NRD1	52078667	0.129000	0.22400	0.012000	0.15200	0.145000	0.21501	0.870000	0.28010	0.317000	0.23160	0.454000	0.30748	GAG	T|0.024;A|0.976	0.976	weak		0.378	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
LTB	4050	hgsc.bcm.edu	37	6	31549350	31549350	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr6:31549350G>A	ENST00000429299.2	-	3	273	c.266C>T	c.(265-267)gCt>gTt	p.A89V	LTB_ENST00000483972.1_5'UTR|LTB_ENST00000446745.2_Silent_p.L74L	NM_002341.1	NP_002332.1	Q06643	TNFC_HUMAN	lymphotoxin beta (TNF superfamily, member 3)	89					cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|signal transduction (GO:0007165)|skin development (GO:0043588)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	9						GAGGTGGGCAGCTGGGAGCCC	0.567																																					p.A89V		Atlas-SNP	.											.	LTB	19	.	0			c.C266T						PASS	.						97.0	115.0	108.0					6																	31549350		1511	2708	4219	SO:0001583	missense	4050	exon3			TGGGCAGCTGGGA	L11015	CCDS4703.1, CCDS4704.1	6p21.3	2013-05-22			ENSG00000227507	ENSG00000227507		"""Tumor necrosis factor (ligand) superfamily"""	6711	protein-coding gene	gene with protein product		600978		TNFC		7916655, 1714477	Standard	NM_002341		Approved	p33, TNFSF3	uc003nuk.3	Q06643	OTTHUMG00000031136	ENST00000429299.2:c.266C>T	6.37:g.31549350G>A	ENSP00000410481:p.Ala89Val	Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	123	19	0.154472	NM_002341	P78370|Q52LU8|Q99761	Missense_Mutation	SNP	ENST00000429299.2	37	CCDS4703.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.088790	0.76756	.	.	ENSG00000227507	ENST00000429299	T	0.24908	1.83	5.26	5.26	0.73747	Tumour necrosis factor (2);Tumour necrosis factor-like (2);	0.184906	0.37955	N	0.001867	T	0.33294	0.0858	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.03922	-1.0992	9	0.19147	T	0.46	-7.4596	14.3569	0.66742	0.0:0.0:1.0:0.0	.	89	Q06643	TNFC_HUMAN	V	89	ENSP00000410481:A89V	ENSP00000410481:A89V	A	-	2	0	LTB	31657329	1.000000	0.71417	0.995000	0.50966	0.871000	0.50021	3.084000	0.50143	2.434000	0.82447	0.655000	0.94253	GCT	.	.	none		0.567	LTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076239.3		
SLC27A6	28965	hgsc.bcm.edu	37	5	128301873	128301873	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr5:128301873G>A	ENST00000262462.4	+	1	1053	c.43G>A	c.(43-45)Gtc>Atc	p.V15I	SLC27A6_ENST00000506176.1_Missense_Mutation_p.V15I|SLC27A6_ENST00000395266.1_Missense_Mutation_p.V15I			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	15					long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		TGGAATGGTCGTCCTGCACTT	0.507																																					p.V15I		Atlas-SNP	.											.	SLC27A6	112	.	0			c.G43A						PASS	.						70.0	68.0	69.0					5																	128301873		2203	4300	6503	SO:0001583	missense	28965	exon1			ATGGTCGTCCTGC	AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.43G>A	5.37:g.128301873G>A	ENSP00000262462:p.Val15Ile	Somatic	195	0	0		WXS	Illumina HiSeq	Phase_I	234	31	0.132479	NM_001017372	Q6IAM5|Q7Z6E6|Q86YF6	Missense_Mutation	SNP	ENST00000262462.4	37	CCDS4145.1	.	.	.	.	.	.	.	.	.	.	G	0.021	-1.432019	0.01108	.	.	ENSG00000113396	ENST00000262462;ENST00000395266;ENST00000506176	T;T;T	0.52526	0.66;0.66;0.66	4.32	-1.02	0.10135	.	0.885476	0.10248	N	0.697577	T	0.18923	0.0454	N	0.02539	-0.55	0.09310	N	1	B	0.14805	0.011	B	0.12156	0.007	T	0.27468	-1.0073	10	0.07325	T	0.83	-9.4273	11.1007	0.48172	0.0:0.0714:0.6016:0.327	.	15	Q9Y2P4	S27A6_HUMAN	I	15	ENSP00000262462:V15I;ENSP00000378684:V15I;ENSP00000421024:V15I	ENSP00000262462:V15I	V	+	1	0	SLC27A6	128329772	0.000000	0.05858	0.026000	0.17262	0.533000	0.34776	-1.019000	0.03622	-0.143000	0.11334	-0.518000	0.04402	GTC	.	.	none		0.507	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250980.1	NM_014031	
FAM118A	55007	hgsc.bcm.edu	37	22	45723920	45723920	+	Silent	SNP	C	C	T	rs111386114		TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr22:45723920C>T	ENST00000216214.3	+	5	1332	c.498C>T	c.(496-498)tcC>tcT	p.S166S	FAM118A_ENST00000405673.1_Silent_p.S166S|FAM118A_ENST00000441876.2_Silent_p.S166S|FAM118A_ENST00000405548.3_5'Flank	NM_001104595.1	NP_001098065.1	Q9NWS6	F118A_HUMAN	family with sequence similarity 118, member A	166						integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	11		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CCATGGAGTCCCTGGACTTGA	0.617																																					p.S166S		Atlas-SNP	.											FAM118A,brain,glioma,0,1	FAM118A	32	1	0			c.C498T						scavenged	.						11.0	10.0	10.0					22																	45723920		2198	4293	6491	SO:0001819	synonymous_variant	55007	exon4			GGAGTCCCTGGAC	BC013696	CCDS14065.1	22q13.3	2006-04-26	2006-04-26	2006-04-26	ENSG00000100376	ENSG00000100376			1313	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 8"""	C22orf8		12477932	Standard	NM_001104595		Approved	FLJ20635, bK268H5.C22.4	uc003bga.4	Q9NWS6	OTTHUMG00000151338	ENST00000216214.3:c.498C>T	22.37:g.45723920C>T		Somatic	50	9	0.18		WXS	Illumina HiSeq	Phase_I	43	18	0.418605	NM_017911	B3KWG4|B4DY02|Q5TII5|Q96CY3	Silent	SNP	ENST00000216214.3	37	CCDS14065.1																																																																																			C|0.500;T|0.500	0.500	weak		0.617	FAM118A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322260.1	NM_017911	
NRD1	4898	hgsc.bcm.edu	37	1	52306066	52306066	+	Missense_Mutation	SNP	T	T	A	rs397701944|rs35723519|rs72663147|rs60220085	byFrequency	TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr1:52306066T>A	ENST00000354831.7	-	2	651	c.462A>T	c.(460-462)gaA>gaT	p.E154D	NRD1_ENST00000352171.7_Missense_Mutation_p.E154D|NRD1_ENST00000539524.1_Missense_Mutation_p.E22D|NRD1_ENST00000544028.1_Missense_Mutation_p.E22D|NRD1_ENST00000485608.1_5'UTR	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	0	Asp/Glu-rich (highly acidic).				cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.E154D(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						catcatcatcttcttcttctt	0.383																																					p.E154D		Atlas-SNP	.											NRD1,NS,other,0,1	NRD1	89	1	1	Substitution - Missense(1)	pancreas(1)	c.A462T						scavenged	.						133.0	87.0	102.0					1																	52306066		2197	4279	6476	SO:0001583	missense	4898	exon2			ATCATCTTCTTCT	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.462A>T	1.37:g.52306066T>A	ENSP00000346890:p.Glu154Asp	Somatic	208	1	0.00480769		WXS	Illumina HiSeq	Phase_I	278	28	0.100719	NM_001101662	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	37	CCDS559.1	.	.	.	.	.	.	.	.	.	.	T	3.657	-0.070254	0.07228	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000546169;ENST00000544028	T;T;T;T	0.35236	1.5;3.33;1.32;1.47	4.18	-8.37	0.00976	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	.	.	.	.	T	0.13713	0.0332	.	.	.	0.27047	N	0.963871	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.30387	-0.9980	8	0.10111	T	0.7	-0.1322	7.3006	0.26418	0.2722:0.0:0.1296:0.5982	.	154;153;154	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	D	154;154;22;154;22	ENSP00000262679:E154D;ENSP00000346890:E154D;ENSP00000444416:E22D;ENSP00000442262:E22D	ENSP00000262679:E154D	E	-	3	2	NRD1	52078654	0.054000	0.20591	0.259000	0.24435	0.479000	0.33129	-0.582000	0.05814	-1.768000	0.01298	-0.542000	0.04241	GAA	.	.	weak		0.383	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
SLC7A14	57709	hgsc.bcm.edu	37	3	170198934	170198934	+	Silent	SNP	G	G	A			TCGA-GS-A9TX-01A-11D-A382-10	TCGA-GS-A9TX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4c499f3-91c4-400e-9d4c-34cc4ba25efd	5d6e6d97-dba3-4087-ba36-3840e5b33520	g.chr3:170198934G>A	ENST00000231706.5	-	7	1452	c.1137C>T	c.(1135-1137)tcC>tcT	p.S379S	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	379					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			TCTCTGTGTAGGAGCTGACGT	0.572																																					p.S379S		Atlas-SNP	.											.	SLC7A14	110	.	0			c.C1137T						PASS	.						33.0	29.0	31.0					3																	170198934		2203	4300	6503	SO:0001819	synonymous_variant	57709	exon7			TGTGTAGGAGCTG	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1137C>T	3.37:g.170198934G>A		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	49	7	0.142857	NM_020949	B3KV33|Q9HCF9	Silent	SNP	ENST00000231706.5	37	CCDS33892.1																																																																																			.	.	none		0.572	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949	
