#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MESP2	145873	hgsc.bcm.edu	37	15	90320135	90320146	+	In_Frame_Del	DEL	GGGCAGGGGCAG	GGGCAGGGGCAG	-	rs56192595|rs28546919|rs200021459|rs199821487	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	GGGCAGGGGCAG	GGGCAGGGGCAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:90320135_90320146delGGGCAGGGGCAG	ENST00000341735.3	+	1	547_558	c.547_558delGGGCAGGGGCAG	c.(547-558)gggcaggggcagdel	p.GQGQ199del	MESP2_ENST00000560219.1_Intron|MESP2_ENST00000558723.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	199	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q198_G205delQGQGQGQG(1)		kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			gcaggggcaagggcaggggcaggggcaggggc	0.783																																					p.182_186del		Atlas-Indel	.											MESP2,NS,carcinoma,0,1	MESP2	20	1	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.546_557del						PASS	.																																			SO:0001651	inframe_deletion	145873	exon1			.		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.547_558delGGGCAGGGGCAG	15.37:g.90320135_90320146delGGGCAGGGGCAG	ENSP00000342392:p.Gly199_Gln202del	Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	18	13	0.722222	NM_001039958	Q7RTU2	In_Frame_Del	DEL	ENST00000341735.3	37	CCDS42078.1																																																																																			GGGCAGGGGCAG|0.112;-|0.888	0.888	strong		0.783	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416421.1	XM_085261	
HLA-A	3105	hgsc.bcm.edu	37	6	29910559	29910565	+	Frame_Shift_Del	DEL	CACATCC	CACATCC	-	rs41562020|rs41543612|rs199474355|rs1059418|rs281864725|rs199474356	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	CACATCC	CACATCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:29910559_29910565delCACATCC	ENST00000396634.1	+	4	440_446	c.99_105delCACATCC	c.(97-105)ttcacatccfs	p.FTS33fs	HLA-A_ENST00000376802.2_Frame_Shift_Del_p.FTS33fs|HLA-A_ENST00000376806.5_Frame_Shift_Del_p.FTS33fs|HLA-A_ENST00000376809.5_Frame_Shift_Del_p.FTS33fs			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	33	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						GGTATTTCTTCACATCCGTGTCCCGGC	0.72									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.33_35del		Pindel,Atlas-Indel	.											HLA-A,NS,lymphoid_neoplasm,0,1	HLA-A	89	1	0			c.98_104del						PASS	.																																			SO:0001589	frameshift_variant	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	.	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.99_105delCACATCC	6.37:g.29910559_29910565delCACATCC	ENSP00000379873:p.Phe33fs	Somatic	83	.	.		WXS	Illumina HiSeq	Phase_I	52	14	0.269	NM_002116	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Frame_Shift_Del	DEL	ENST00000396634.1	37	CCDS34373.1																																																																																			.	.	none		0.720	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
PSMG2	56984	hgsc.bcm.edu	37	18	12720538	12720538	+	Frame_Shift_Del	DEL	C	C	-			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr18:12720538delC	ENST00000317615.6	+	5	1119	c.437delC	c.(436-438)tccfs	p.S146fs	PSMG2_ENST00000590217.1_Frame_Shift_Del_p.S146fs|PSMG2_ENST00000585331.2_Frame_Shift_Del_p.S115fs	NM_020232.4	NP_064617.2			proteasome (prosome, macropain) assembly chaperone 2											lung(1)|prostate(2)|skin(1)	4						CTTACACCTTCCATGCAAAAA	0.338																																					p.S146fs		Atlas-Indel	.											.	PSMG2	17	.	0			c.436delT						PASS	.						55.0	55.0	55.0					18																	12720538		2203	4300	6503	SO:0001589	frameshift_variant	56984	exon5			.	AF276707	CCDS11862.1, CCDS67440.1	18p11.21	2012-01-25	2007-10-23	2007-10-23	ENSG00000128789	ENSG00000128789			24929	protein-coding gene	gene with protein product	"""hepatocellular carcinoma susceptibility protein"", ""CD40 ligand-activated specific transcript 3"""	609702	"""tumor necrosis factor superfamily, member 5-induced protein 1"""	TNFSF5IP1		11854909, 12147697, 17189198	Standard	NM_147163		Approved	HCCA3, MDS003, MGC15092, CLAST3, HsT1707, PAC2	uc002krk.3	Q969U7	OTTHUMG00000131703	ENST00000317615.6:c.437delC	18.37:g.12720538delC	ENSP00000325919:p.Ser146fs	Somatic	201	0	0		WXS	Illumina HiSeq	Phase_I	144	17	0.118056	NM_020232		Frame_Shift_Del	DEL	ENST00000317615.6	37	CCDS11862.1																																																																																			.	.	none		0.338	PSMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254615.1	NM_020232	
UACA	55075	hgsc.bcm.edu	37	15	70959921	70959926	+	In_Frame_Del	DEL	CTTTAA	CTTTAA	-			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	CTTTAA	CTTTAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:70959921_70959926delCTTTAA	ENST00000322954.6	-	16	3282_3287	c.3097_3102delTTAAAG	c.(3097-3102)ttaaagdel	p.LK1033del	UACA_ENST00000560441.1_In_Frame_Del_p.LK1018del|UACA_ENST00000379983.2_In_Frame_Del_p.LK1020del|UACA_ENST00000539319.1_In_Frame_Del_p.LK924del	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	1033					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						AAATCTCCTTCTTTAACTTGTCATTC	0.364																																					p.1033_1035del		Pindel,Atlas-Indel	.											.	UACA	235	.	0			c.3098_3103del						PASS	.																																			SO:0001651	inframe_deletion	55075	exon16			.	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.3097_3102delTTAAAG	15.37:g.70959921_70959926delCTTTAA	ENSP00000314556:p.Leu1033_Lys1034del	Somatic	266	.	.		WXS	Illumina HiSeq	Phase_I	218	33	0.151	NM_018003	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	In_Frame_Del	DEL	ENST00000322954.6	37	CCDS10235.1																																																																																			.	.	none		0.364	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2		
SALL1	6299	hgsc.bcm.edu	37	16	51175656	51175664	+	In_Frame_Del	DEL	GCTGCTGCT	GCTGCTGCT	-	rs13336129|rs139646526|rs372299573	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	GCTGCTGCT	GCTGCTGCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:51175656_51175664delGCTGCTGCT	ENST00000251020.4	-	2	502_510	c.469_477delAGCAGCAGC	c.(469-477)agcagcagcdel	p.SSS157del	SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_In_Frame_Del_p.SSS60del|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	157	Poly-Ser.				adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S159G(1)|p.S157G(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			cgccgccgccgctgctgctgctgctgctg	0.627																																					p.157_160del	GBM(103;1352 1446 1855 4775 8890)	Atlas-Indel	.											.	SALL1	301	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.470_478del						PASS	.																																			SO:0001651	inframe_deletion	6299	exon2			.	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.469_477delAGCAGCAGC	16.37:g.51175665_51175673delGCTGCTGCT	ENSP00000251020:p.Ser157_Ser159del	Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	125	25	0.2	NM_002968	Q99881|Q9NSC3|Q9P1R0	In_Frame_Del	DEL	ENST00000251020.4	37	CCDS10747.1																																																																																			-|0.500;GCC|0.250;GCT|0.250	0.500	strong		0.627	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
DMKN	93099	hgsc.bcm.edu	37	19	36002362	36002412	+	In_Frame_Del	DEL	CTGCTGCCACCACTGCTGCCGCCACTGCTGCCGCCACTGCTGCTGCCACTG	CTGCTGCCACCACTGCTGCCGCCACTGCTGCCGCCACTGCTGCTGCCACTG	-	rs112672248|rs142519211|rs144877871|rs544198244|rs199498909|rs11667007|rs12981076|rs146822312|rs148799704|rs138902616|rs56743379|rs140071083|rs371511253|rs117522133|rs59309505|rs113540509|rs111543270|rs58579970|rs201369392	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	CTGCTGCCACCACTGCTGCCGCCACTGCTGCCGCCACTGCTGCTGCCACTG	CTGCTGCCACCACTGCTGCCGCCACTGCTGCCGCCACTGCTGCTGCCACTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:36002362_36002412delCTGCTGCCACCACTGCTGCCGCCACTGCTGCCGCCACTGCTGCTGCCACTG	ENST00000339686.3	-	5	995_1045	c.819_869delCAGTGGCAGCAGCAGTGGCGGCAGCAGTGGCGGCAGCAGTGGTGGCAGCAG	c.(817-870)agcagtggcagcagcagtggcggcagcagtggcggcagcagtggtggcagcagt>agt	p.273_290SSGSSSGGSSGGSSGGSS>S	DMKN_ENST00000451297.2_In_Frame_Del_p.273_290SSGSSSGGSSGGSSGGSS>S|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000418261.1_In_Frame_Del_p.273_290SSGSSSGGSSGGSSGGSS>S|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000440396.1_In_Frame_Del_p.273_290SSGSSSGGSSGGSSGGSS>S|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000424570.2_In_Frame_Del_p.273_290SSGSSSGGSSGGSSGGSS>S|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000447113.2_In_Frame_Del_p.273_290SSGSSSGGSSGGSSGGSS>S|DMKN_ENST00000472252.2_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	273	Gly-rich.		G -> S (in dbSNP:rs11667007). {ECO:0000269|PubMed:17380110}.	G -> GSSSG (in Ref. 4; AAQ88778). {ECO:0000305}.		extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.S274_S290del(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			actgttgccactgctgccaccactgctgccgccactgctgccgccactgctgctgccactgctgctgccac	0.641																																					p.274_290del		Atlas-Indel	.											.	DMKN	116	.	1	Deletion - In frame(1)	ovary(1)	c.820_870del						PASS	.		,,,,,,	1051,3093		133,785,1154					,,,,,,	-3.2	0.0		dbSNP_130	28	1360,6640		184,992,2824	no	coding,coding,coding,intron,coding,coding,intron	DMKN	NM_033317.4,NM_001190349.1,NM_001190348.1,NM_001190347.1,NM_001126058.2,NM_001126057.2,NM_001126056.2	,,,,,,	317,1777,3978	A1A1,A1R,RR		17.0,25.362,19.8534	,,,,,,	,,,,,,		2411,9733				SO:0001651	inframe_deletion	93099	exon5			.	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.819_869delCAGTGGCAGCAGCAGTGGCGGCAGCAGTGGCGGCAGCAGTGGTGGCAGCAG	19.37:g.36002362_36002412delCTGCTGCCACCACTGCTGCCGCCACTGCTGCCGCCACTGCTGCTGCCACTG	ENSP00000342012:p.Ser273_Ser289del	Somatic	23	0	0		WXS	Illumina HiSeq	Phase_I	38	13	0.342105	NM_033317	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	In_Frame_Del	DEL	ENST00000339686.3	37	CCDS12463.1																																																																																			.	.	none		0.641	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
MYL6	4637	hgsc.bcm.edu	37	12	56554083	56554083	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:56554083delA	ENST00000550697.1	+	5	647	c.406delA	c.(406-408)aatfs	p.N136fs	MYL6_ENST00000548293.1_Frame_Shift_Del_p.N136fs|MYL6_ENST00000548400.1_Frame_Shift_Del_p.N100fs|MYL6_ENST00000536128.1_Frame_Shift_Del_p.N229fs|MYL6_ENST00000549017.1_Frame_Shift_Del_p.N32fs|MYL6_ENST00000293422.5_Frame_Shift_Del_p.N137fs|MYL6_ENST00000548580.1_Frame_Shift_Del_p.N88fs|MYL6_ENST00000348108.4_Frame_Shift_Del_p.N137fs|RP11-977G19.5_ENST00000553176.1_RNA|RP11-603J24.14_ENST00000548731.1_RNA|MYL6_ENST00000547649.1_Frame_Shift_Del_p.N136fs|MYL6_ENST00000547408.1_Frame_Shift_Del_p.N136fs|MYL6_ENST00000549566.1_Frame_Shift_Del_p.N181fs|MYL6_ENST00000551589.1_Frame_Shift_Del_p.N136fs	NM_021019.4	NP_066299.2	P60660	MYL6_HUMAN	myosin, light chain 6, alkali, smooth muscle and non-muscle	136	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle tissue development (GO:0007519)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|unconventional myosin complex (GO:0016461)|vesicle (GO:0031982)	actin-dependent ATPase activity (GO:0030898)|calcium ion binding (GO:0005509)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			large_intestine(1)|lung(1)|ovary(1)|prostate(3)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			TGAGGACAGCAATGGTTGTAT	0.483																																					p.S135fs		Atlas-Indel	.											.	MYL6	16	.	0			c.405delC						PASS	.						79.0	71.0	74.0					12																	56554083		2203	4300	6503	SO:0001589	frameshift_variant	4637	exon5			.	AB046613	CCDS8906.1, CCDS31834.1	12q13.13	2013-01-10	2006-09-29			ENSG00000092841		"""Myosins / Light chain"", ""EF-hand domain containing"""	7587	protein-coding gene	gene with protein product		609931	"""myosin, light polypeptide 6, alkali, smooth muscle and non-muscle"""			8188229, 2304459, 2722814	Standard	NM_021019		Approved	ESMLC, MLC3NM, MLC1SM	uc001sjx.2	P60660		ENST00000550697.1:c.406delA	12.37:g.56554083delA	ENSP00000446955:p.Asn136fs	Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	77	12	0.155844	NM_079423	P16475|P24572|P24573|Q12790|Q561V9|Q6IAZ0|Q6IPY5	Frame_Shift_Del	DEL	ENST00000550697.1	37	CCDS8906.1																																																																																			.	.	none		0.483	MYL6-003	KNOWN	NAGNAG_splice_site|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407928.3		
THOC5	8563	hgsc.bcm.edu	37	22	29938874	29938876	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr22:29938874_29938876delCTT	ENST00000490103.1	-	5	546_548	c.424_426delAAG	c.(424-426)aagdel	p.K142del	THOC5_ENST00000397871.1_In_Frame_Del_p.K142del|THOC5_ENST00000397872.1_In_Frame_Del_p.K142del|THOC5_ENST00000397873.2_In_Frame_Del_p.K142del	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	142	Interaction with CSF1R. {ECO:0000250}.|Interaction with THOC7.				blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TGGTGATCTCCTTCTGTAGGTGC	0.453																																					p.142_143del		Atlas-Indel	.											.	THOC5	58	.	0			c.425_427del						PASS	.																																			SO:0001651	inframe_deletion	8563	exon5			.	AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.424_426delAAG	22.37:g.29938874_29938876delCTT	ENSP00000420306:p.Lys142del	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	64	15	0.234375	NM_001002879	O60839|Q9UPZ5	In_Frame_Del	DEL	ENST00000490103.1	37	CCDS13859.1																																																																																			.	.	none		0.453	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322097.1	NM_003678	
KLRK1	22914	hgsc.bcm.edu	37	12	10539559	10539559	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:10539559delA	ENST00000240618.6	-	3	231	c.91delT	c.(91-93)tcafs	p.S31fs	KLRK1_ENST00000540818.1_Frame_Shift_Del_p.S31fs|KLRC4-KLRK1_ENST00000539300.1_3'UTR|RP11-277P12.20_ENST00000500682.1_RNA	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	31					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						CATCGTGTTGAAAAATCACTC	0.343																																					p.S31X		Atlas-Indel	.											.	.	.	.	0			c.92delC						PASS	.						173.0	161.0	165.0					12																	10539559		2203	4298	6501	SO:0001589	frameshift_variant	0	exon8			.	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.91delT	12.37:g.10539559delA	ENSP00000240618:p.Ser31fs	Somatic	246	0	0		WXS	Illumina HiSeq	Phase_I	260	59	0.226923	NM_001199805	A8K7K5|A8K7P4|Q9NR41	Frame_Shift_Del	DEL	ENST00000240618.6	37	CCDS8623.1																																																																																			.	.	none		0.343	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
HLA-A	3105	hgsc.bcm.edu	37	6	29911113	29911115	+	In_Frame_Del	DEL	CGG	CGG	-	rs3173420|rs41540315|rs66488547|rs1059498|rs12721717	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	CGG	CGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:29911113_29911115delCGG	ENST00000396634.1	+	5	753_755	c.412_414delCGG	c.(412-414)cggdel	p.R138del	HLA-A_ENST00000376802.2_In_Frame_Del_p.R138del|HLA-A_ENST00000376806.5_In_Frame_Del_p.R138del|HLA-A_ENST00000376809.5_In_Frame_Del_p.R138del			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	138	Alpha-2.		Q -> R (in allele A*31:03, allele A*31:04 and allele A*31:06).		antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CCGCGGGTACCGGCAGGACGCCT	0.665									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.137_138del		Pindel,Atlas-Indel	.											.	HLA-A	89	.	0			c.411_413del						PASS	.																																			SO:0001651	inframe_deletion	3105	exon3	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	.	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.412_414delCGG	6.37:g.29911113_29911115delCGG	ENSP00000379873:p.Arg138del	Somatic	171	.	.		WXS	Illumina HiSeq	Phase_I	67	24	0.358	NM_002116	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	In_Frame_Del	DEL	ENST00000396634.1	37	CCDS34373.1																																																																																			.	.	none		0.665	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
CA3	761	hgsc.bcm.edu	37	8	86352126	86352127	+	Frame_Shift_Ins	INS	-	-	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:86352126_86352127insA	ENST00000285381.2	+	2	303_304	c.220_221insA	c.(220-222)tatfs	p.Y74fs	RP11-317J10.2_ENST00000521761.1_RNA|RP11-317J10.2_ENST00000517697.1_RNA	NM_005181.3	NP_005172.1	P07451	CAH3_HUMAN	carbonic anhydrase III, muscle specific	74					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|response to ethanol (GO:0045471)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	carbonate dehydratase activity (GO:0004089)|nickel cation binding (GO:0016151)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23					Acetazolamide(DB00819)|Zonisamide(DB00909)	TGATGATACTTATGATAGGTCA	0.411																																					p.Y74_D75delinsX		Pindel,Atlas-Indel	.											.	CA3	47	.	0			c.220_221insA						PASS	.																																			SO:0001589	frameshift_variant	761	exon2			.	AJ006473	CCDS6238.1	8q21.2	2012-10-02					4.2.1.1	"""Carbonic anhydrases"""	1374	protein-coding gene	gene with protein product		114750				6221502	Standard	NM_005181		Approved	Car3, CAIII	uc003ydj.3	P07451		ENST00000285381.2:c.221dupA	8.37:g.86352127_86352127dupA	ENSP00000285381:p.Tyr74fs	Somatic	29	.	.		WXS	Illumina HiSeq	Phase_I	52	18	0.346	NM_005181	B2R867|B3KUC8|O60842	Frame_Shift_Ins	INS	ENST00000285381.2	37	CCDS6238.1																																																																																			.	.	none		0.411	CA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381090.1	NM_005181	
HLA-B	3106	hgsc.bcm.edu	37	6	31324195	31324201	+	Frame_Shift_Del	DEL	TACATGC	TACATGC	-	rs151341218|rs1071652|rs151341216|rs151341217|rs41545614|rs1140412|rs41547332|rs41562913	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	TACATGC	TACATGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:31324195_31324201delTACATGC	ENST00000412585.2	-	3	390_396	c.362_368delGCATGTA	c.(361-369)agcatgtacfs	p.SMY121fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	121	Alpha-2.		S -> R (in allele B*48:03).		antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GTCGCAGCCGTACATGCTCTGGAGGGT	0.71									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.121_123del		Pindel,Atlas-Indel	.											.	HLA-B	54	.	0			c.363_369del						PASS	.																																			SO:0001589	frameshift_variant	3106	exon3	Familial Cancer Database	;Lichen Sclerosis, Familial	.	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.362_368delGCATGTA	6.37:g.31324195_31324201delTACATGC	ENSP00000399168:p.Ser121fs	Somatic	55	.	.		WXS	Illumina HiSeq	Phase_I	36	13	0.361	NM_005514	Q29764	Frame_Shift_Del	DEL	ENST00000412585.2	37	CCDS34394.1																																																																																			.	.	alt		0.710	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
PCED1A	64773	hgsc.bcm.edu	37	20	2816203	2816204	+	Frame_Shift_Ins	INS	-	-	C	rs371156741		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:2816203_2816204insC	ENST00000360652.2	-	8	1771_1772	c.1269_1270insG	c.(1267-1272)gggcccfs	p.P424fs	PCED1A_ENST00000356872.3_Frame_Shift_Ins_p.P373fs	NM_022760.4	NP_073597.2	Q9H1Q7	PED1A_HUMAN	PC-esterase domain containing 1A	424																	TGCCTGCAGGGCCCCCCCATTC	0.624																																					p.P424fs		Pindel,Atlas-Indel	.											.	.	.	.	0			c.1270_1271insG						PASS	.																																			SO:0001589	frameshift_variant	64773	exon8			.	AK026029	CCDS13035.1, CCDS59442.1	20p13	2012-06-11	2012-06-11	2012-06-11	ENSG00000132635	ENSG00000132635			16212	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 81"", ""family with sequence similarity 113, member A"""	C20orf81, FAM113A		20056006	Standard	NM_022760		Approved	bA12M19.1, FLJ22376	uc002wgz.2	Q9H1Q7	OTTHUMG00000031716	ENST00000360652.2:c.1270dupG	20.37:g.2816210_2816210dupC	ENSP00000353868:p.Pro424fs	Somatic	120	.	.		WXS	Illumina HiSeq	Phase_I	94	22	0.234	NM_022760	Q5JUA5|Q5JUA6|Q6PK19|Q86WF5|Q96CG7|Q9H1Q6|Q9H6D1	Frame_Shift_Ins	INS	ENST00000360652.2	37	CCDS13035.1																																																																																			.	.	none		0.624	PCED1A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077676.2	NM_022760	
RLF	6018	hgsc.bcm.edu	37	1	40697260	40697262	+	In_Frame_Del	DEL	GTC	GTC	-			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	GTC	GTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:40697260_40697262delGTC	ENST00000372771.4	+	7	1046_1048	c.1019_1021delGTC	c.(1018-1023)tgtcgt>tgt	p.R341del		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	341					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TTGGAGCGCTGTCGTCAGTTTGG	0.365																																					p.340_340del		Pindel,Atlas-Indel	.											.	RLF	152	.	0			c.1018_1020del						PASS	.																																			SO:0001651	inframe_deletion	6018	exon7			.		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.1019_1021delGTC	1.37:g.40697263_40697265delGTC	ENSP00000361857:p.Arg341del	Somatic	200	.	.		WXS	Illumina HiSeq	Phase_I	179	36	0.201	NM_012421	Q14CQ1|Q9NU60	In_Frame_Del	DEL	ENST00000372771.4	37	CCDS448.1																																																																																			.	.	none		0.365	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421	
MYO1H	283446	hgsc.bcm.edu	37	12	109858795	109858795	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:109858795delA	ENST00000431443.2	+	15	1589	c.1589delA	c.(1588-1590)gaafs	p.E530fs	MYO1H_ENST00000310903.5_Frame_Shift_Del_p.E520fs	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	530	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.N522fs*9(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						GGATTCTTGGAAAAAAACAAT	0.303																																					p.E520fs		Atlas-Indel	.											.	MYO1H	98	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1558delG						PASS	.						66.0	64.0	64.0					12																	109858795		1793	4065	5858	SO:0001589	frameshift_variant	283446	exon15			.		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.1589delA	12.37:g.109858795delA	ENSP00000444076:p.Glu530fs	Somatic	181	0	0		WXS	Illumina HiSeq	Phase_I	194	15	0.0773196	NM_001101421	F5H3C6	Frame_Shift_Del	DEL	ENST00000431443.2	37																																																																																				.	.	none		0.303	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	
SOCS1	8651	hgsc.bcm.edu	37	16	11349102	11349103	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:11349102_11349103delTC	ENST00000332029.2	-	2	383_384	c.233_234delGA	c.(232-234)ggafs	p.G78fs	RMI2_ENST00000572173.1_Intron	NM_003745.1	NP_003736.1	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	78	Extended SH2 subdomain (ESS).				cellular response to amino acid stimulus (GO:0071230)|cytokine-mediated signaling pathway (GO:0019221)|fat cell differentiation (GO:0045444)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein phosphorylation (GO:0001932)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	insulin-like growth factor receptor binding (GO:0005159)|kinase inhibitor activity (GO:0019210)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.Y64fs*1(1)|p.0?(1)|p.D63_Q108del(1)|p.S71fs*29(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(66)|lung(3)	71						CCCAGTAGAATCCGCAGGCGTC	0.743			"""F, O"""		"""Hodgkin Lymphoma, PMBL"""																																p.78_79del	Colon(177;456 3548 27231)	Atlas-Indel	.		Rec	yes		16	16p13.13	8651	suppressor of cytokine signaling 1		L	SOCS1,lymph_node,lymphoid_neoplasm,+1,1	SOCS1	84	1	4	Deletion - Frameshift(2)|Whole gene deletion(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(4)	c.234_235del						PASS	.																																			SO:0001589	frameshift_variant	8651	exon2			.	U88326	CCDS10546.1	16p13.13	2013-02-14			ENSG00000185338	ENSG00000185338		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19383	protein-coding gene	gene with protein product		603597				7796808, 9266833	Standard	NM_003745		Approved	SOCS-1, SSI-1, JAB, TIP3, Cish1	uc002dar.1	O15524	OTTHUMG00000129792	ENST00000332029.2:c.233_234delGA	16.37:g.11349102_11349103delTC	ENSP00000329418:p.Gly78fs	Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	21	10	0.47619	NM_003745	O15097|Q9NSA7	Frame_Shift_Del	DEL	ENST00000332029.2	37	CCDS10546.1																																																																																			.	.	none		0.743	SOCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252018.1		
IGSF3	3321	hgsc.bcm.edu	37	1	117122288	117122289	+	In_Frame_Ins	INS	-	-	TCC	rs56982445|rs647711	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:117122288_117122289insTCC	ENST00000369486.3	-	10	3824_3825	c.3059_3060insGGA	c.(3058-3060)gac>gaGGAc	p.1019_1020insE	IGSF3_ENST00000369483.1_In_Frame_Ins_p.1039_1040insE|IGSF3_ENST00000318837.6_In_Frame_Ins_p.1039_1040insE	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	1019	Ig-like C2-type 8.		D -> E (in dbSNP:rs647711). {ECO:0000269|PubMed:9790749}.		lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		cgtcgtcgtcgtcctcctcctc	0.634																																					p.D1040delinsED		Atlas-Indel	.											IGSF3_ENST00000369483,caecum,carcinoma,0,2	IGSF3	294	2	0			c.3120_3121insGGA						PASS	.																																			SO:0001652	inframe_insertion	3321	exon11			.	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.3057_3059dupGGA	1.37:g.117122295_117122297dupTCC	ENSP00000358498:p.Glu1019_Glu1019dup	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	88	15	0.170455	NM_001542	A6NJZ6|A6NMC7	In_Frame_Ins	INS	ENST00000369486.3	37	CCDS30813.1																																																																																			.	.	none		0.634	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230415	23230416	+	In_Frame_Ins	INS	-	-	CAG	rs180844836	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr22:23230415_23230416insCAG	ENST00000526893.1	+	1	456_457	c.182_183insCAG	c.(181-186)tccagc>tcCAGcagc	p.61_62SS>SSS	IGLL5_ENST00000532223.2_In_Frame_Ins_p.61_62SS>SSS|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_In_Frame_Ins_p.61_62SS>SSS	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	61						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						AGCAGCCGATCCAGCCTGCGGA	0.653																																					p.S61delinsSS		Pindel,Atlas-Indel	.											.	IGLL5	26	.	0			c.182_183insCAG						PASS	.																																			SO:0001652	inframe_insertion	100423062	exon1			.	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.183_185dupCAG	22.37:g.23230416_23230418dupCAG	ENSP00000431254:p.Ser61_Ser61dup	Somatic	113	.	.		WXS	Illumina HiSeq	Phase_I	65	14	0.215	NM_001178126		In_Frame_Ins	INS	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.653	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
ABCA2	20	hgsc.bcm.edu	37	9	139909868	139909869	+	Frame_Shift_Ins	INS	-	-	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:139909868_139909869insG	ENST00000371605.3	-	23	3838_3839	c.3691_3692insC	c.(3691-3693)caafs	p.Q1231fs	ABCA2_ENST00000341511.6_Frame_Shift_Ins_p.Q1232fs|ABCA2_ENST00000265662.5_Frame_Shift_Ins_p.Q1232fs|ABCA2_ENST00000492260.1_5'Flank			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1231					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ACACAGACCTTGGGGGCCCCCC	0.678																																					p.Q1262fs		Atlas-Indel	.											.	ABCA2	113	.	0			c.3785_3786insC						PASS	.																																			SO:0001589	frameshift_variant	20	exon24			.	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.3692dupC	9.37:g.139909873_139909873dupG	ENSP00000360666:p.Gln1231fs	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	47	10	0.212766	NM_212533	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Frame_Shift_Ins	INS	ENST00000371605.3	37																																																																																				.	.	none		0.678	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
NR1H2	7376	hgsc.bcm.edu	37	19	50881822	50881823	+	In_Frame_Ins	INS	-	-	CAG	rs57821899|rs61751954|rs34296657|rs66611742|rs1052533	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:50881822_50881823insCAG	ENST00000253727.5	+	6	751_752	c.516_517insCAG	c.(517-519)cag>CAGcag	p.173_173Q>QQ	NR1H2_ENST00000411902.2_In_Frame_Ins_p.76_76Q>QQ|NR1H2_ENST00000598168.1_In_Frame_Ins_p.173_173Q>QQ|NR1H2_ENST00000593926.1_In_Frame_Ins_p.173_173Q>QQ|NR1H2_ENST00000542413.1_5'UTR|NR1H2_ENST00000599105.1_In_Frame_Ins_p.173_173Q>QQ	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	173					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		AGATTCGGAAACAGCAGCAGGA	0.644														1987	0.396765	0.621	0.4294	5008	,	,		16931	0.1677		0.3161	False		,,,				2504	0.3896				p.K172delinsKQ		Pindel	.											.	NR1H2	47	.	0			c.516_517insCAG						PASS	.																																			SO:0001652	inframe_insertion	7376	exon6			.	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.523_525dupCAG	19.37:g.50881829_50881831dupCAG	ENSP00000253727:p.Gln175dup	Somatic	60	.	.		WXS	Illumina HiSeq	Phase_I	42	14	0.333	NM_007121	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	In_Frame_Ins	INS	ENST00000253727.5	37	CCDS42593.1																																																																																			CAG|1.000	.	weak		0.644	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464724.2		
AP3M1	26985	hgsc.bcm.edu	37	10	75896531	75896531	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:75896531T>C	ENST00000355264.4	-	3	615	c.304A>G	c.(304-306)Att>Gtt	p.I102V	AP3M1_ENST00000487653.1_5'Flank|AP3M1_ENST00000372745.1_Missense_Mutation_p.I102V	NM_012095.4	NP_036227.1	Q9Y2T2	AP3M1_HUMAN	adaptor-related protein complex 3, mu 1 subunit	102					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|protein targeting to lysosome (GO:0006622)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	Rab GTPase binding (GO:0017137)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	13	Prostate(51;0.0112)					TTATCCTTAATTGCAGCCTCT	0.348																																					p.I102V		Atlas-SNP	.											.	AP3M1	28	.	0			c.A304G						PASS	.						105.0	97.0	100.0					10																	75896531		2203	4300	6503	SO:0001583	missense	26985	exon4			CCTTAATTGCAGC	AF092092	CCDS7342.1	10q22.1-q22.3	2008-07-07			ENSG00000185009	ENSG00000185009			569	protein-coding gene	gene with protein product		610366				10024875	Standard	NM_207012		Approved		uc001jwh.3	Q9Y2T2	OTTHUMG00000018497	ENST00000355264.4:c.304A>G	10.37:g.75896531T>C	ENSP00000347408:p.Ile102Val	Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	141	48	0.340426	NM_207012	Q5JQ12|Q9H5L2	Missense_Mutation	SNP	ENST00000355264.4	37	CCDS7342.1	.	.	.	.	.	.	.	.	.	.	T	16.48	3.134462	0.56828	.	.	ENSG00000185009	ENST00000355264;ENST00000372745	D;D	0.81739	-1.53;-1.53	5.88	4.75	0.60458	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	T	0.77611	0.4156	L	0.52823	1.66	0.58432	D	0.999999	B	0.20550	0.046	B	0.30495	0.116	T	0.71859	-0.4465	10	0.36615	T	0.2	.	11.7276	0.51718	0.0:0.0685:0.0:0.9315	.	102	Q9Y2T2	AP3M1_HUMAN	V	102	ENSP00000347408:I102V;ENSP00000361831:I102V	ENSP00000347408:I102V	I	-	1	0	AP3M1	75566537	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.755000	0.62198	1.060000	0.40578	0.533000	0.62120	ATT	.	.	none		0.348	AP3M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048747.1		
PCDHA5	56143	hgsc.bcm.edu	37	5	140201800	140201800	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:140201800C>T	ENST00000529859.1	+	1	440	c.440C>T	c.(439-441)cCa>cTa	p.P147L	PCDHA5_ENST00000529619.1_Missense_Mutation_p.P147L|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.P147L|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	147					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAAGAATGCCAGATTCGCGG	0.433																																					p.P147L		Atlas-SNP	.											.	PCDHA5	361	.	0			c.C440T						PASS	.						50.0	55.0	54.0					5																	140201800		2203	4300	6503	SO:0001583	missense	56143	exon1			GAATGCCAGATTC	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.440C>T	5.37:g.140201800C>T	ENSP00000436557:p.Pro147Leu	Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	149	38	0.255034	NM_018908	O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	C	1.960	-0.439103	0.04636	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.21031	2.03;2.03;2.03	4.02	-0.26	0.12967	Cadherin (1);Cadherin-like (1);	.	.	.	.	T	0.14098	0.0341	L	0.35644	1.08	0.09310	N	1	B;B;B	0.16603	0.012;0.01;0.018	B;B;B	0.32289	0.143;0.008;0.008	T	0.44329	-0.9335	9	0.07813	T	0.8	.	5.1007	0.14759	0.1425:0.6129:0.0:0.2446	.	147;147;147	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	L	147	ENSP00000433416:P147L;ENSP00000436557:P147L;ENSP00000367366:P147L	ENSP00000367366:P147L	P	+	2	0	PCDHA5	140181984	0.000000	0.05858	0.826000	0.32828	0.990000	0.78478	-1.759000	0.01808	0.004000	0.14682	0.591000	0.81541	CCA	.	.	none		0.433	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908	
OR5M1	390168	hgsc.bcm.edu	37	11	56380719	56380719	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:56380719G>A	ENST00000526538.1	-	1	259	c.260C>T	c.(259-261)tCa>tTa	p.S87L		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						CTTCTGTTCTGAGAGGAAATT	0.448																																					p.S87L		Atlas-SNP	.											.	OR5M1	92	.	0			c.C260T						PASS	.						145.0	136.0	139.0					11																	56380719		1908	4127	6035	SO:0001583	missense	390168	exon1			TGTTCTGAGAGGA	AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.260C>T	11.37:g.56380719G>A	ENSP00000435416:p.Ser87Leu	Somatic	228	0	0		WXS	Illumina HiSeq	Phase_I	174	100	0.574713	NM_001004740	Q6IF60|Q96RB6	Missense_Mutation	SNP	ENST00000526538.1	37	CCDS53631.1	.	.	.	.	.	.	.	.	.	.	G	10.36	1.328996	0.24167	.	.	ENSG00000255012	ENST00000526538	T	0.01335	5.0	3.71	2.77	0.32553	GPCR, rhodopsin-like superfamily (1);	0.244803	0.21257	N	0.077529	T	0.02012	0.0063	M	0.64630	1.985	0.09310	N	1	B	0.25850	0.136	B	0.30782	0.12	T	0.42430	-0.9452	10	0.22706	T	0.39	-28.6778	6.4532	0.21916	0.0:0.2037:0.5864:0.2099	.	87	Q8NGP8	OR5M1_HUMAN	L	87	ENSP00000435416:S87L	ENSP00000435416:S87L	S	-	2	0	OR5M1	56137295	0.000000	0.05858	0.617000	0.29091	0.796000	0.44982	0.694000	0.25512	0.775000	0.33450	0.280000	0.19369	TCA	.	.	none		0.448	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391610.1	NM_001004740	
SLC30A4	7782	hgsc.bcm.edu	37	15	45814311	45814311	+	Nonsense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:45814311A>T	ENST00000261867.4	-	2	556	c.242T>A	c.(241-243)tTa>tAa	p.L81*	SLC30A4_ENST00000559667.1_5'UTR|HMGN2P46_ENST00000409454.1_RNA	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	81	Asp-rich (acidic).				regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		GGTCAAAGGTAAGTCTTGGTC	0.547																																					p.L81X		Atlas-SNP	.											.	SLC30A4	25	.	0			c.T242A						PASS	.						158.0	150.0	152.0					15																	45814311		2198	4298	6496	SO:0001587	stop_gained	7782	exon2			AAAGGTAAGTCTT		CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.242T>A	15.37:g.45814311A>T	ENSP00000261867:p.Leu81*	Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	97	27	0.278351	NM_013309	Q8TC39	Nonsense_Mutation	SNP	ENST00000261867.4	37	CCDS10125.1	.	.	.	.	.	.	.	.	.	.	A	38	7.239480	0.98157	.	.	ENSG00000104154	ENST00000261867	.	.	.	5.23	1.3	0.21679	.	0.228496	0.38217	N	0.001763	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-2.4494	7.0695	0.25171	0.6784:0.2421:0.0796:0.0	.	.	.	.	X	81	.	ENSP00000261867:L81X	L	-	2	0	SLC30A4	43601603	0.016000	0.18221	0.042000	0.18584	0.991000	0.79684	1.812000	0.38952	0.844000	0.35094	0.533000	0.62120	TTA	.	.	none		0.547	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254236.1		
NCAPG	64151	hgsc.bcm.edu	37	4	17843962	17843962	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:17843962A>C	ENST00000251496.2	+	20	3060	c.2884A>C	c.(2884-2886)Acg>Ccg	p.T962P	LCORL_ENST00000326877.4_3'UTR	NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	962					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		TTCAGCTAGGACGAACAGGAG	0.368																																					p.T962P		Atlas-SNP	.											.	NCAPG	76	.	0			c.A2884C						PASS	.						85.0	82.0	83.0					4																	17843962		2203	4299	6502	SO:0001583	missense	64151	exon20			GCTAGGACGAACA	AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.2884A>C	4.37:g.17843962A>C	ENSP00000251496:p.Thr962Pro	Somatic	252	0	0		WXS	Illumina HiSeq	Phase_I	209	84	0.401914	NM_022346	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	ENST00000251496.2	37	CCDS3424.1	.	.	.	.	.	.	.	.	.	.	A	4.242	0.043803	0.08196	.	.	ENSG00000109805	ENST00000251496	T	0.30981	1.51	5.35	3.2	0.36748	.	1.403140	0.04112	N	0.314705	T	0.26810	0.0656	L	0.43152	1.355	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20207	-1.0282	10	0.28530	T	0.3	1.9728	4.3865	0.11319	0.6264:0.0:0.3736:0.0	.	962	Q9BPX3	CND3_HUMAN	P	962	ENSP00000251496:T962P	ENSP00000251496:T962P	T	+	1	0	NCAPG	17453060	0.057000	0.20700	0.011000	0.14972	0.298000	0.27526	0.865000	0.27940	0.527000	0.28560	0.533000	0.62120	ACG	.	.	none		0.368	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250375.1	NM_022346	
KCNH5	27133	hgsc.bcm.edu	37	14	63175121	63175121	+	Missense_Mutation	SNP	C	C	T	rs200737420		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr14:63175121C>T	ENST00000322893.7	-	11	2340	c.2072G>A	c.(2071-2073)cGg>cAg	p.R691Q	KCNH5_ENST00000420622.2_3'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	691					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		ATTCTTCTGCCGGAGGCGCTC	0.512																																					p.R691Q		Atlas-SNP	.											KCNH5,NS,malignant_melanoma,-1,5	KCNH5	320	5	0			c.G2072A						PASS	.						91.0	97.0	95.0					14																	63175121		2203	4300	6503	SO:0001583	missense	27133	exon11			TTCTGCCGGAGGC	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2072G>A	14.37:g.63175121C>T	ENSP00000321427:p.Arg691Gln	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	75	12	0.16	NM_139318	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.462267	0.63513	.	.	ENSG00000140015	ENST00000322893	T	0.16073	2.37	5.72	5.72	0.89469	.	0.061597	0.64402	D	0.000005	T	0.21841	0.0526	M	0.62723	1.935	0.80722	D	1	D	0.58620	0.983	B	0.39503	0.301	T	0.02603	-1.1135	10	0.37606	T	0.19	.	19.8965	0.96963	0.0:1.0:0.0:0.0	.	691	Q8NCM2	KCNH5_HUMAN	Q	691	ENSP00000321427:R691Q	ENSP00000321427:R691Q	R	-	2	0	KCNH5	62244874	1.000000	0.71417	0.943000	0.38184	0.992000	0.81027	5.970000	0.70431	2.717000	0.92951	0.655000	0.94253	CGG	C|0.999;T|0.001	0.001	weak		0.512	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
MACC1	346389	hgsc.bcm.edu	37	7	20199461	20199461	+	Missense_Mutation	SNP	G	G	A	rs200826339	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:20199461G>A	ENST00000400331.5	-	5	831	c.523C>T	c.(523-525)Cgg>Tgg	p.R175W	MACC1_ENST00000332878.4_Missense_Mutation_p.R175W|MACC1_ENST00000589011.1_Missense_Mutation_p.R175W	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	175					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						TAAGCCTCCCGATCATTTTTA	0.468													G|||	3	0.000599042	0.0	0.0043	5008	,	,		18694	0.0		0.0	False		,,,				2504	0.0				p.R175W		Atlas-SNP	.											MACC1,bladder,carcinoma,+2,1	MACC1	99	1	0			c.C523T						PASS	.						74.0	71.0	72.0					7																	20199461		2203	4300	6503	SO:0001583	missense	346389	exon5			CCTCCCGATCATT		CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.523C>T	7.37:g.20199461G>A	ENSP00000383185:p.Arg175Trp	Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	105	9	0.0857143	NM_182762	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	37	CCDS5369.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	15.92	2.974997	0.53720	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.25749	1.78;1.78	5.64	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.52240	0.1722	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58584	-0.7611	10	0.87932	D	0	-14.655	15.8848	0.79238	0.0:0.0:0.8633:0.1367	.	175	Q6ZN28	MACC1_HUMAN	W	175	ENSP00000383185:R175W;ENSP00000328410:R175W	ENSP00000328410:R175W	R	-	1	2	MACC1	20165986	1.000000	0.71417	0.909000	0.35828	0.882000	0.50991	2.367000	0.44213	1.349000	0.45751	0.585000	0.79938	CGG	A|0.000;G|0.999;T|0.000	0.000	strong		0.468	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	
FKBP9	11328	hgsc.bcm.edu	37	7	33044805	33044805	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:33044805G>A	ENST00000242209.4	+	10	1724	c.1555G>A	c.(1555-1557)Gcc>Acc	p.A519T	FKBP9_ENST00000490776.2_Missense_Mutation_p.A287T|FKBP9_ENST00000538443.1_Missense_Mutation_p.A381T|AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000538336.1_Missense_Mutation_p.A572T	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	519	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.A519T(2)|p.A287T(2)		central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			GTACATTCACGCCCAGGTGGC	0.537																																					p.A519T		Atlas-SNP	.											FKBP9_ENST00000490776,NS,carcinoma,0,4	FKBP9	335	4	4	Substitution - Missense(4)	lung(2)|endometrium(2)	c.G1555A						PASS	.						46.0	45.0	45.0					7																	33044805		2203	4297	6500	SO:0001583	missense	11328	exon10			ATTCACGCCCAGG	AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.1555G>A	7.37:g.33044805G>A	ENSP00000242209:p.Ala519Thr	Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	94	21	0.223404	NM_007270	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Missense_Mutation	SNP	ENST00000242209.4	37	CCDS5439.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210625	0.39102	.	.	ENSG00000122642	ENST00000242209;ENST00000538336;ENST00000538443;ENST00000490776	T;T;T;T	0.55234	0.53;0.53;0.53;2.25	5.07	5.07	0.68467	EF-hand-like domain (1);	0.271361	0.37348	N	0.002127	T	0.39410	0.1077	L	0.29908	0.895	0.32052	N	0.596862	B;B;B	0.26400	0.004;0.148;0.051	B;B;B	0.14578	0.001;0.011;0.006	T	0.46884	-0.9159	10	0.32370	T	0.25	-10.8601	13.7806	0.63081	0.0761:0.0:0.9239:0.0	.	287;572;519	B7Z1G9;B7Z6H3;O95302	.;.;FKBP9_HUMAN	T	519;572;381;287	ENSP00000242209:A519T;ENSP00000439250:A572T;ENSP00000437504:A381T;ENSP00000441317:A287T	ENSP00000242209:A519T	A	+	1	0	FKBP9	33011330	0.934000	0.31675	0.976000	0.42696	0.969000	0.65631	3.364000	0.52328	2.371000	0.80710	0.555000	0.69702	GCC	.	.	none		0.537	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270	
BMP7	655	hgsc.bcm.edu	37	20	55748291	55748291	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:55748291T>C	ENST00000395863.3	-	6	1616	c.1111A>G	c.(1111-1113)Atg>Gtg	p.M371V	BMP7_ENST00000450594.2_Missense_Mutation_p.M371V|BMP7_ENST00000395864.3_Missense_Mutation_p.M305V|BMP7_ENST00000460817.1_5'UTR	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	371					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)			endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			GTGGCGTTCATGTAGGAGTTC	0.632																																					p.M371V		Atlas-SNP	.											.	BMP7	60	.	0			c.A1111G						PASS	.						214.0	132.0	160.0					20																	55748291		2203	4300	6503	SO:0001583	missense	655	exon6			CGTTCATGTAGGA		CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.1111A>G	20.37:g.55748291T>C	ENSP00000379204:p.Met371Val	Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	39	15	0.384615	NM_001719	Q9H512|Q9NTQ7	Missense_Mutation	SNP	ENST00000395863.3	37	CCDS13455.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.7|24.7	4.564597|4.564597	0.86439|0.86439	.|.	.|.	ENSG00000101144|ENSG00000101144	ENST00000433911|ENST00000395863;ENST00000395864;ENST00000450594	.|D;D;D	.|0.88124	.|-2.34;-2.34;-2.34	4.84|4.84	4.84|4.84	0.62591|0.62591	.|Transforming growth factor-beta, C-terminal (3);	.|0.034872	.|0.85682	.|D	.|0.000000	D|D	0.90338|0.90338	0.6977|0.6977	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	.|P;D;D	.|0.76494	.|0.902;0.994;0.999	.|P;D;D	.|0.91635	.|0.795;0.913;0.999	D|D	0.91561|0.91561	0.5264|0.5264	5|10	.|0.87932	.|D	.|0	.|.	14.7165|14.7165	0.69272|0.69272	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|305;371;371	.|B1AKZ9;P18075;B1AL00	.|.;BMP7_HUMAN;.	R|V	292|371;305;371	.|ENSP00000379204:M371V;ENSP00000379205:M305V;ENSP00000398687:M371V	.|ENSP00000379204:M371V	H|M	-|-	2|1	0|0	BMP7|BMP7	55181698|55181698	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.930000|7.930000	0.87610|0.87610	1.946000|1.946000	0.56461|0.56461	0.482000|0.482000	0.46254|0.46254	CAT|ATG	.	.	none		0.632	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2		
ZNF512B	57473	hgsc.bcm.edu	37	20	62597525	62597525	+	Missense_Mutation	SNP	G	G	A	rs371234637		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:62597525G>A	ENST00000450537.1	-	5	1063	c.1003C>T	c.(1003-1005)Cgt>Tgt	p.R335C	ZNF512B_ENST00000217130.3_Missense_Mutation_p.R335C|ZNF512B_ENST00000369888.1_Missense_Mutation_p.R335C			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	335					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CCTGTGGCACGAGGTGCTTTG	0.582																																					p.R335C		Atlas-SNP	.											ZNF512B,NS,lymphoid_neoplasm,+1,1	ZNF512B	72	1	0			c.C1003T						PASS	.	G	CYS/ARG	2,4402	6.2+/-15.9	0,2,2200	76.0	72.0	73.0		1003	4.4	0.1	20		73	0,8600		0,0,4300	no	missense	ZNF512B	NM_020713.1	180	0,2,6500	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	335/893	62597525	2,13002	2202	4300	6502	SO:0001583	missense	57473	exon5			TGGCACGAGGTGC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1003C>T	20.37:g.62597525G>A	ENSP00000393795:p.Arg335Cys	Somatic	182	0	0		WXS	Illumina HiSeq	Phase_I	133	25	0.18797	NM_020713	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	G	11.14	1.551719	0.27739	4.54E-4	0.0	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.26810	1.71;1.71;1.71	5.43	4.42	0.53409	.	0.669254	0.14337	N	0.325977	T	0.34832	0.0911	L	0.47716	1.5	0.09310	N	0.999999	D	0.76494	0.999	P	0.54924	0.764	T	0.11227	-1.0596	10	0.87932	D	0	-18.6947	10.2751	0.43506	0.0:0.0:0.6755:0.3245	.	335	Q96KM6	Z512B_HUMAN	C	335	ENSP00000358904:R335C;ENSP00000393795:R335C;ENSP00000217130:R335C	ENSP00000217130:R335C	R	-	1	0	ZNF512B	62067969	0.026000	0.19158	0.119000	0.21687	0.022000	0.10575	2.040000	0.41203	2.532000	0.85374	0.585000	0.79938	CGT	.	.	weak		0.582	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
CTAGE5	4253	hgsc.bcm.edu	37	14	39819363	39819363	+	Missense_Mutation	SNP	C	C	A	rs529369922		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr14:39819363C>A	ENST00000280083.3	+	24	2624	c.2310C>A	c.(2308-2310)ttC>ttA	p.F770L	CTAGE5_ENST00000348007.3_Missense_Mutation_p.F727L|CTAGE5_ENST00000556148.1_Missense_Mutation_p.F695L|CTAGE5_ENST00000557038.1_Missense_Mutation_p.F690L|CTAGE5_ENST00000341502.5_Intron|CTAGE5_ENST00000341749.3_Missense_Mutation_p.F758L|CTAGE5_ENST00000553383.1_3'UTR|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.F1305L|CTAGE5_ENST00000396165.4_Missense_Mutation_p.F741L|RP11-407N17.3_ENST00000603904.1_Missense_Mutation_p.F741L|CTAGE5_ENST00000553352.1_Missense_Mutation_p.F741L|CTAGE5_ENST00000396158.2_Missense_Mutation_p.F775L			O15320	CTGE5_HUMAN	CTAGE family, member 5	770	Pro-rich.				positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)		CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		CTGGATTTTTCCCCCCACCCC	0.448																																					p.F775L		Atlas-SNP	.											CTAGE5,colon,carcinoma,0,1	CTAGE5	75	1	0			c.C2325A						scavenged	.																																			SO:0001583	missense	4253	exon24			ATTTTTCCCCCCA	U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.2310C>A	14.37:g.39819363C>A	ENSP00000280083:p.Phe770Leu	Somatic	190	2	0.0105263		WXS	Illumina HiSeq	Phase_I	144	53	0.368056	NM_001247989	B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Missense_Mutation	SNP	ENST00000280083.3	37	CCDS9674.1	.	.	.	.	.	.	.	.	.	.	C	10.03	1.238787	0.22711	.	.	ENSG00000258941;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527	ENST00000553728;ENST00000341749;ENST00000557038;ENST00000382245;ENST00000396165;ENST00000396158;ENST00000280083;ENST00000556148;ENST00000348007;ENST00000553352	T;T;T;T;T;T;T;T;T	0.08102	3.29;3.13;3.13;3.15;3.43;3.43;3.14;3.45;3.15	5.24	0.284	0.15701	.	0.224065	0.22932	N	0.053900	T	0.04543	0.0124	L	0.31664	0.95	0.23076	N	0.998332	B;B;B;B;B	0.06786	0.0;0.001;0.0;0.001;0.0	B;B;B;B;B	0.09377	0.004;0.004;0.004;0.004;0.004	T	0.39251	-0.9623	9	.	.	.	.	2.0465	0.03561	0.1196:0.458:0.1299:0.2924	.	775;727;770;698;758	O15320-5;O15320-2;O15320;O15320-7;G3XAC5	.;.;CTGE5_HUMAN;.;.	L	1305;758;690;638;741;775;770;695;727;741	ENSP00000452252:F1305L;ENSP00000343897:F758L;ENSP00000450869:F690L;ENSP00000379468:F741L;ENSP00000379462:F775L;ENSP00000280083:F770L;ENSP00000452562:F695L;ENSP00000343912:F727L;ENSP00000450449:F741L	.	F	+	3	2	CTAGE5;RP11-407N17.3	38889114	0.007000	0.16637	0.137000	0.22149	0.838000	0.47535	-0.443000	0.06862	-0.253000	0.09514	-0.261000	0.10672	TTC	.	.	none		0.448	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276771.2	NM_005930	
MEPCE	56257	hgsc.bcm.edu	37	7	100028402	100028402	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:100028402C>T	ENST00000310512.2	+	1	1149	c.761C>T	c.(760-762)tCg>tTg	p.S254L	ZCWPW1_ENST00000398027.2_5'Flank|ZCWPW1_ENST00000360951.4_5'Flank|ZCWPW1_ENST00000324725.6_5'Flank|MEPCE_ENST00000414441.1_5'UTR	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	254					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTTCTTGCTTCGCCACTCAAG	0.592																																					p.S254L		Atlas-SNP	.											.	MEPCE	52	.	0			c.C761T						PASS	.						129.0	141.0	137.0					7																	100028402		2203	4300	6503	SO:0001583	missense	56257	exon1			TTGCTTCGCCACT	AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.761C>T	7.37:g.100028402C>T	ENSP00000308546:p.Ser254Leu	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	32	8	0.25	NM_019606	B3KP86|D6W5V7|Q9NPD4	Missense_Mutation	SNP	ENST00000310512.2	37	CCDS5693.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458824	0.84317	.	.	ENSG00000146834	ENST00000310512	.	.	.	4.17	4.17	0.49024	.	0.000000	0.64402	D	0.000001	T	0.69342	0.3100	L	0.49126	1.545	0.58432	D	0.999998	D	0.89917	1.0	D	0.78314	0.991	T	0.71679	-0.4520	9	0.56958	D	0.05	-2.8836	14.0318	0.64619	0.0:1.0:0.0:0.0	.	254	Q7L2J0	MEPCE_HUMAN	L	254	.	ENSP00000308546:S254L	S	+	2	0	MEPCE	99866338	1.000000	0.71417	0.987000	0.45799	0.987000	0.75469	6.607000	0.74163	2.164000	0.68074	0.313000	0.20887	TCG	.	.	none		0.592	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339135.1		
SPRR3	6707	hgsc.bcm.edu	37	1	152975715	152975715	+	Silent	SNP	C	C	T	rs28989168	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:152975715C>T	ENST00000295367.4	+	2	261	c.219C>T	c.(217-219)ggC>ggT	p.G73G	SPRR3_ENST00000331860.3_Silent_p.G73G|SPRR3_ENST00000542696.1_Silent_p.G73G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	73	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGCTGTACCAAGG	0.577													T|||	2	0.000399361	0.0015	0.0	5008	,	,		14904	0.0		0.0	False		,,,				2504	0.0				p.G73G		Atlas-SNP	.											SPRR3,colon,carcinoma,0,3	SPRR3	45	3	0			c.C219T						scavenged	.						42.0	39.0	40.0					1																	152975715		2182	4268	6450	SO:0001819	synonymous_variant	6707	exon2			GCCAGGCTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.219C>T	1.37:g.152975715C>T		Somatic	64	1	0.015625		WXS	Illumina HiSeq	Phase_I	57	9	0.157895	NM_001097589	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			.	.	none		0.577	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
PCDH15	65217	hgsc.bcm.edu	37	10	55782695	55782695	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:55782695A>G	ENST00000320301.6	-	19	2877	c.2483T>C	c.(2482-2484)gTt>gCt	p.V828A	PCDH15_ENST00000395432.2_Missense_Mutation_p.V791A|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395430.1_Missense_Mutation_p.V828A|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000409834.1_Missense_Mutation_p.V439A|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395445.1_Missense_Mutation_p.V835A|PCDH15_ENST00000361849.3_Missense_Mutation_p.V828A|PCDH15_ENST00000414778.1_Missense_Mutation_p.V833A|PCDH15_ENST00000373965.2_Missense_Mutation_p.V835A|PCDH15_ENST00000437009.1_Missense_Mutation_p.V757A|PCDH15_ENST00000373955.1_Missense_Mutation_p.V828A|PCDH15_ENST00000395438.1_Missense_Mutation_p.V828A|PCDH15_ENST00000395433.1_Missense_Mutation_p.V806A	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	828	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ATTCTCTTCAACAAGGACAGT	0.413										HNSCC(58;0.16)																											p.V833A		Atlas-SNP	.											.	PCDH15	1715	.	0			c.T2498C						PASS	.						167.0	151.0	157.0					10																	55782695		2203	4300	6503	SO:0001583	missense	65217	exon20			TCTTCAACAAGGA	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.2483T>C	10.37:g.55782695A>G	ENSP00000322604:p.Val828Ala	Somatic	190	0	0		WXS	Illumina HiSeq	Phase_I	165	42	0.254545	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	A	18.68	3.676898	0.67928	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35;0.35;0.35;0.35;0.35;0.35;0.35;0.35	5.52	5.52	0.82312	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.73690	0.3619	M	0.81614	2.55	0.58432	D	0.999998	D;D;D;P;D;D;D;P;D;D;D;P;P;D	0.69078	0.992;0.997;0.997;0.873;0.996;0.993;0.967;0.932;0.975;0.986;0.975;0.605;0.917;0.986	D;D;D;P;D;D;P;P;P;D;P;B;P;D	0.72075	0.944;0.957;0.976;0.846;0.973;0.963;0.901;0.717;0.858;0.932;0.734;0.257;0.539;0.932	T	0.78006	-0.2373	9	0.87932	D	0	.	15.5913	0.76530	1.0:0.0:0.0:0.0	.	806;828;828;833;757;791;828;828;835;835;828;833;828;828	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	A	835;833;828;828;439;835;791;828;806;828;828;833;757;828	ENSP00000363076:V835A;ENSP00000410304:V833A;ENSP00000378826:V828A;ENSP00000386693:V439A;ENSP00000378832:V835A;ENSP00000378820:V791A;ENSP00000354950:V828A;ENSP00000378821:V806A;ENSP00000322604:V828A;ENSP00000378818:V828A;ENSP00000412628:V757A;ENSP00000363066:V828A	ENSP00000322604:V828A	V	-	2	0	PCDH15	55452701	1.000000	0.71417	0.991000	0.47740	0.361000	0.29550	9.287000	0.95975	2.225000	0.72522	0.477000	0.44152	GTT	.	.	none		0.413	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
PPP1CA	5499	hgsc.bcm.edu	37	11	67168324	67168324	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:67168324C>G	ENST00000376745.4	-	3	402	c.254G>C	c.(253-255)aGc>aCc	p.S85T	PPP1CA_ENST00000532446.1_5'UTR|PPP1CA_ENST00000312989.7_Missense_Mutation_p.S96T|PPP1CA_ENST00000358239.4_Missense_Mutation_p.S41T	NM_001008709.1|NM_002708.3	NP_001008709.1|NP_002699.1	P62136	PP1A_HUMAN	protein phosphatase 1, catalytic subunit, alpha isozyme	85					branching morphogenesis of an epithelial tube (GO:0048754)|cell cycle (GO:0007049)|cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|glycogen metabolic process (GO:0005977)|lung development (GO:0030324)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein dephosphorylation (GO:0006470)|regulation of circadian rhythm (GO:0042752)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|MLL5-L complex (GO:0070688)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein phosphatase type 1 complex (GO:0000164)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)|ribonucleoprotein complex binding (GO:0043021)			breast(1)|lung(2)|pancreas(1)|urinary_tract(3)	7			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			GAGGTAGTTGCTCTCGGGAGG	0.542																																					p.S96T		Atlas-SNP	.											.	PPP1CA	83	.	0			c.G287C						PASS	.						109.0	105.0	106.0					11																	67168324		2200	4295	6495	SO:0001583	missense	5499	exon3			TAGTTGCTCTCGG		CCDS8160.1, CCDS8161.1, CCDS31618.1	11q13	2013-01-18	2010-03-05			ENSG00000172531	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9281	protein-coding gene	gene with protein product		176875	"""protein phosphatase 1, catalytic subunit, alpha isoform"""	PPP1A			Standard	NM_002708		Approved	PP1A, PP-1A, PP1alpha	uc001oku.1	P62136		ENST00000376745.4:c.254G>C	11.37:g.67168324C>G	ENSP00000365936:p.Ser85Thr	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	82	17	0.207317	NM_001008709	A6NNR3|B2R908|P08129|P20653|P22802|Q07161	Missense_Mutation	SNP	ENST00000376745.4	37	CCDS8160.1	.	.	.	.	.	.	.	.	.	.	C	16.33	3.093159	0.56075	.	.	ENSG00000172531	ENST00000312989;ENST00000451458;ENST00000376745;ENST00000358239;ENST00000527663	T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34	5.08	3.19	0.36642	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.64757	0.2627	N	0.12569	0.235	0.52501	D	0.999958	B;B;B;B;B;B	0.18863	0.031;0.031;0.0;0.008;0.0;0.001	B;B;B;B;B;B	0.24269	0.052;0.03;0.006;0.014;0.006;0.01	T	0.58446	-0.7635	10	0.59425	D	0.04	.	9.3804	0.38311	0.0:0.7739:0.1456:0.0805	.	182;182;85;41;96;94	B3KXM2;E9PDP1;P62136;A6NNR3;Q07161;F8W0W8	.;.;PP1A_HUMAN;.;.;.	T	96;182;85;41;85	ENSP00000326031:S96T;ENSP00000365936:S85T;ENSP00000350974:S41T;ENSP00000431146:S85T	ENSP00000326031:S96T	S	-	2	0	PPP1CA	66924900	1.000000	0.71417	0.998000	0.56505	0.651000	0.38670	4.884000	0.63135	0.522000	0.28464	0.563000	0.77884	AGC	.	.	none		0.542	PPP1CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395487.1	NM_002708	
PSEN1	5663	hgsc.bcm.edu	37	14	73614730	73614730	+	Start_Codon_SNP	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr14:73614730G>A	ENST00000324501.5	+	3	275	c.3G>A	c.(1-3)atG>atA	p.M1I	PSEN1_ENST00000344094.3_Start_Codon_SNP_p.M1I|PSEN1_ENST00000357710.4_Start_Codon_SNP_p.M1I|PSEN1_ENST00000557511.1_Start_Codon_SNP_p.M1I|PSEN1_ENST00000261970.3_Start_Codon_SNP_p.M1I|PSEN1_ENST00000394164.1_Start_Codon_SNP_p.M1I|PSEN1_ENST00000394157.3_Start_Codon_SNP_p.M1I|PSEN1_ENST00000553447.2_3'UTR	NM_000021.3|NM_007318.2	NP_000012.1|NP_015557.2	P49768	PSN1_HUMAN	presenilin 1	1					activation of MAPKK activity (GO:0000186)|amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|autophagic vacuole assembly (GO:0000045)|beta-amyloid formation (GO:0034205)|beta-amyloid metabolic process (GO:0050435)|blood vessel development (GO:0001568)|brain morphogenesis (GO:0048854)|Cajal-Retzius cell differentiation (GO:0021870)|calcium ion transmembrane transport (GO:0070588)|canonical Wnt signaling pathway (GO:0060070)|cell fate specification (GO:0001708)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex cell migration (GO:0021795)|choline transport (GO:0015871)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|L-glutamate transport (GO:0015813)|membrane protein ectodomain proteolysis (GO:0006509)|memory (GO:0007613)|mitochondrial transport (GO:0006839)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of axonogenesis (GO:0050771)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of receptor recycling (GO:0001921)|post-embryonic development (GO:0009791)|protein glycosylation (GO:0006486)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of phosphorylation (GO:0042325)|regulation of protein binding (GO:0043393)|regulation of resting membrane potential (GO:0060075)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)|skeletal system morphogenesis (GO:0048705)|skin morphogenesis (GO:0043589)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|somitogenesis (GO:0001756)|synaptic vesicle targeting (GO:0016080)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary rootlet (GO:0035253)|cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|calcium channel activity (GO:0005262)|endopeptidase activity (GO:0004175)|PDZ domain binding (GO:0030165)	p.M1I(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		TTGCTCCAATGACAGAGTTAC	0.428																																					p.M1I		Atlas-SNP	.											PSEN1,NS,carcinoma,0,1	PSEN1	38	1	1	Substitution - Missense(1)	lung(1)	c.G3A						PASS	.						110.0	93.0	99.0					14																	73614730		2203	4300	6503	SO:0001582	initiator_codon_variant	5663	exon3			TCCAATGACAGAG	AJ008005	CCDS9812.1, CCDS9813.1	14q24.3	2014-09-17	2008-07-28		ENSG00000080815	ENSG00000080815			9508	protein-coding gene	gene with protein product		104311	"""Alzheimer disease 3"""	AD3		1411576	Standard	NM_007318		Approved	FAD, S182, PS1	uc001xnr.3	P49768	OTTHUMG00000141279	ENST00000324501.5:c.3G>A	14.37:g.73614730G>A	ENSP00000326366:p.Met1Ile	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	82	32	0.390244	NM_000021	B2R6D3|O95465|Q14762|Q15719|Q15720|Q96P33|Q9UIF0	Missense_Mutation	SNP	ENST00000324501.5	37	CCDS9812.1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137305	0.56936	.	.	ENSG00000080815	ENST00000557356;ENST00000556864;ENST00000556533;ENST00000556951;ENST00000557293;ENST00000553719;ENST00000553599;ENST00000556011;ENST00000394157;ENST00000324501;ENST00000357710;ENST00000555254;ENST00000261970;ENST00000344094;ENST00000553447;ENST00000554131;ENST00000557037;ENST00000394164;ENST00000556066;ENST00000557511	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.99660	-5.47;-3.39;-3.23;-3.5;-5.79;-3.39;-6.32;-6.02;-6.04;-5.83;-6.03;-5.92;-3.86;-6.04;-6.03	5.23	5.23	0.72850	.	0.210963	0.40640	N	0.001041	D	0.98713	0.9568	.	.	.	0.80722	D	1	B;B;P	0.41450	0.0;0.0;0.75	B;B;B	0.39503	0.0;0.0;0.301	D	0.99797	1.1034	9	0.87932	D	0	-10.2899	14.667	0.68915	0.0:0.0:1.0:0.0	.	1;1;1	P49768-2;P49768;P49768-4	.;PSN1_HUMAN;.	I	1	ENSP00000451498:M1I;ENSP00000452128:M1I;ENSP00000450551:M1I;ENSP00000451880:M1I;ENSP00000451674:M1I;ENSP00000452477:M1I;ENSP00000377712:M1I;ENSP00000326366:M1I;ENSP00000350342:M1I;ENSP00000450652:M1I;ENSP00000261970:M1I;ENSP00000339523:M1I;ENSP00000451915:M1I;ENSP00000377719:M1I;ENSP00000451429:M1I	ENSP00000261970:M1I	M	+	3	0	PSEN1	72684483	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.689000	0.61723	2.588000	0.87417	0.563000	0.77884	ATG	.	.	none		0.428	PSEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280500.2		Missense_Mutation
BAI3	577	hgsc.bcm.edu	37	6	70070955	70070955	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:70070955G>A	ENST00000370598.1	+	29	4611	c.3790G>A	c.(3790-3792)Gag>Aag	p.E1264K	BAI3_ENST00000238918.8_Missense_Mutation_p.E470K|BAI3_ENST00000546190.1_Missense_Mutation_p.E228K	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1264					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GAGTATGAATGAGCTTAGCAA	0.413																																					p.E1264K		Atlas-SNP	.											BAI3,right_upper_lobe,carcinoma,-2,1	BAI3	451	1	0			c.G3790A						PASS	.						92.0	85.0	87.0					6																	70070955		2203	4299	6502	SO:0001583	missense	577	exon29			ATGAATGAGCTTA	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3790G>A	6.37:g.70070955G>A	ENSP00000359630:p.Glu1264Lys	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	95	25	0.263158	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.512258	0.64522	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.48201	1.97;2.58;0.82	5.58	5.58	0.84498	.	0.052110	0.85682	D	0.000000	T	0.29491	0.0735	L	0.32530	0.975	0.47009	D	0.999288	B;P	0.46395	0.319;0.877	B;B	0.37731	0.055;0.257	T	0.27502	-1.0072	10	0.72032	D	0.01	.	19.9199	0.97084	0.0:0.0:1.0:0.0	.	470;1264	B7Z356;O60242	.;BAI3_HUMAN	K	1264;470;228	ENSP00000359630:E1264K;ENSP00000238918:E470K;ENSP00000441821:E228K	ENSP00000238918:E470K	E	+	1	0	BAI3	70127676	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	9.174000	0.94824	2.781000	0.95711	0.591000	0.81541	GAG	.	.	none		0.413	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
TRHDE	29953	hgsc.bcm.edu	37	12	73046814	73046814	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:73046814G>A	ENST00000261180.4	+	17	2823	c.2727G>A	c.(2725-2727)ctG>ctA	p.L909L		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	909					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						ATCTGTCACTGAATTCTGAGG	0.343																																					p.L909L		Atlas-SNP	.											.	TRHDE	194	.	0			c.G2727A						PASS	.						75.0	75.0	75.0					12																	73046814		2203	4300	6503	SO:0001819	synonymous_variant	29953	exon17			GTCACTGAATTCT	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2727G>A	12.37:g.73046814G>A		Somatic	158	0	0		WXS	Illumina HiSeq	Phase_I	134	60	0.447761	NM_013381	A5PL19|Q6UWJ4	Silent	SNP	ENST00000261180.4	37	CCDS9004.1																																																																																			.	.	none		0.343	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381	
SOCS1	8651	hgsc.bcm.edu	37	16	11348988	11348988	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:11348988G>A	ENST00000332029.2	-	2	498	c.348C>T	c.(346-348)agC>agT	p.S116S	RMI2_ENST00000572173.1_Intron	NM_003745.1	NP_003736.1	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	116	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cellular response to amino acid stimulus (GO:0071230)|cytokine-mediated signaling pathway (GO:0019221)|fat cell differentiation (GO:0045444)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein phosphorylation (GO:0001932)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	insulin-like growth factor receptor binding (GO:0005159)|kinase inhibitor activity (GO:0019210)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.R107_I126del(1)|p.Y64fs*1(1)|p.0?(1)|p.L115fs*1(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(66)|lung(3)	71						CCATCTTCACGCTAAGGGCGA	0.687			"""F, O"""		"""Hodgkin Lymphoma, PMBL"""																																p.S116S	Colon(177;456 3548 27231)	Atlas-SNP	.		Rec	yes		16	16p13.13	8651	suppressor of cytokine signaling 1		L	SOCS1,NS,lymphoid_neoplasm,0,2	SOCS1	84	2	4	Deletion - Frameshift(2)|Whole gene deletion(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(4)	c.C348T						PASS	.						16.0	17.0	17.0					16																	11348988		2188	4291	6479	SO:0001819	synonymous_variant	8651	exon2			CTTCACGCTAAGG	U88326	CCDS10546.1	16p13.13	2013-02-14			ENSG00000185338	ENSG00000185338		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19383	protein-coding gene	gene with protein product		603597				7796808, 9266833	Standard	NM_003745		Approved	SOCS-1, SSI-1, JAB, TIP3, Cish1	uc002dar.1	O15524	OTTHUMG00000129792	ENST00000332029.2:c.348C>T	16.37:g.11348988G>A		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	40	11	0.275	NM_003745	O15097|Q9NSA7	Silent	SNP	ENST00000332029.2	37	CCDS10546.1																																																																																			.	.	none		0.687	SOCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252018.1		
PTPN9	5780	hgsc.bcm.edu	37	15	75762326	75762326	+	Silent	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:75762326G>T	ENST00000306726.2	-	12	1886	c.1374C>A	c.(1372-1374)cgC>cgA	p.R458R		NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	458	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGGTCACCTGGCGTTTCTGCC	0.488																																					p.R458R		Atlas-SNP	.											.	PTPN9	53	.	0			c.C1374A						PASS	.						93.0	73.0	79.0					15																	75762326		2197	4294	6491	SO:0001819	synonymous_variant	5780	exon12			CACCTGGCGTTTC		CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.1374C>A	15.37:g.75762326G>T		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	100	25	0.25	NM_002833	Q53XR9	Silent	SNP	ENST00000306726.2	37	CCDS10280.1																																																																																			.	.	none		0.488	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286474.1		
FRG1	2483	hgsc.bcm.edu	37	4	190878626	190878626	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:190878626G>A	ENST00000226798.4	+	6	728	c.506G>A	c.(505-507)aGt>aAt	p.S169N	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	169					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.S169N(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		GAAGCAAAAAGTAAAACAGCA	0.363																																					p.S169N		Atlas-SNP	.											FRG1,NS,carcinoma,+1,3	FRG1	76	3	1	Substitution - Missense(1)	skin(1)	c.G506A						scavenged	.						49.0	46.0	47.0					4																	190878626		2184	4282	6466	SO:0001583	missense	2483	exon6			CAAAAAGTAAAAC	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.506G>A	4.37:g.190878626G>A	ENSP00000226798:p.Ser169Asn	Somatic	433	6	0.0138568		WXS	Illumina HiSeq	Phase_I	381	10	0.0262467	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	14.80	2.642895	0.47153	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.48522	1.77;0.81	4.19	2.41	0.29592	Actin cross-linking (1);	0.160510	0.64402	N	0.000002	T	0.36552	0.0971	N	0.17723	0.515	0.45777	D	0.998661	P	0.35982	0.531	P	0.45406	0.479	T	0.07578	-1.0765	10	0.30854	T	0.27	0.1847	7.6816	0.28518	0.219:0.0:0.781:0.0	.	169	Q14331	FRG1_HUMAN	N	169;41;106	ENSP00000226798:S169N;ENSP00000435943:S106N	ENSP00000226798:S169N	S	+	2	0	FRG1	191115620	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	1.784000	0.38674	0.340000	0.23745	0.454000	0.30748	AGT	G|0.500;A|0.500	0.500	weak		0.363	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
CSNK2A1	1457	hgsc.bcm.edu	37	20	485848	485848	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:485848G>A	ENST00000217244.3	-	4	502	c.127C>T	c.(127-129)Cga>Tga	p.R43*	CSNK2A1_ENST00000400217.2_5'UTR|CSNK2A1_ENST00000349736.5_Nonsense_Mutation_p.R43*|CSNK2A1_ENST00000400227.3_Nonsense_Mutation_p.R43*	NM_177559.2	NP_808227.1	P68400	CSK21_HUMAN	casein kinase 2, alpha 1 polypeptide	43	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|chaperone-mediated protein folding (GO:0061077)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	ATP binding (GO:0005524)|Hsp90 protein binding (GO:0051879)|protein N-terminus binding (GO:0047485)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)			CCTAATTTTCGAACCAGCTGG	0.338																																					p.R43X		Atlas-SNP	.											.	CSNK2A1	36	.	0			c.C127T						PASS	.						79.0	66.0	70.0					20																	485848		2203	4299	6502	SO:0001587	stop_gained	1457	exon3			ATTTTCGAACCAG	M55265	CCDS13003.1, CCDS13004.1	20p13	2013-01-17			ENSG00000101266	ENSG00000101266			2457	protein-coding gene	gene with protein product		115440				2174700, 1766873	Standard	NM_177559		Approved		uc002wdx.1	P68400	OTTHUMG00000031636	ENST00000217244.3:c.127C>T	20.37:g.485848G>A	ENSP00000217244:p.Arg43*	Somatic	567	1	0.00176367		WXS	Illumina HiSeq	Phase_I	421	105	0.249406	NM_001895	B4DYS6|D3DVV8|P19138|P20426|Q14013|Q5U065	Nonsense_Mutation	SNP	ENST00000217244.3	37	CCDS13003.1	.	.	.	.	.	.	.	.	.	.	G	37	6.022125	0.97211	.	.	ENSG00000101266	ENST00000400227;ENST00000349736;ENST00000217244;ENST00000381973	.	.	.	4.56	1.35	0.21983	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.2591	13.1247	0.59346	0.0:0.0:0.4164:0.5836	.	.	.	.	X	43	.	ENSP00000217244:R43X	R	-	1	2	CSNK2A1	433848	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	1.156000	0.31712	0.210000	0.20664	0.555000	0.69702	CGA	.	.	none		0.338	CSNK2A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077466.1	NM_001895	
CNTLN	54875	hgsc.bcm.edu	37	9	17135148	17135148	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:17135148G>A	ENST00000380647.3	+	1	169	c.85G>A	c.(85-87)Gct>Act	p.A29T	CNTLN_ENST00000425824.1_Missense_Mutation_p.A29T|CNTLN_ENST00000484374.1_3'UTR|CNTLN_ENST00000262360.5_Missense_Mutation_p.A29T|CNTLN_ENST00000380641.4_Missense_Mutation_p.A29T			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	29					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		TGGGCGGGGAGCTGAAGTACA	0.677																																					p.A29T		Atlas-SNP	.											.	CNTLN	128	.	0			c.G85A						PASS	.						12.0	16.0	15.0					9																	17135148		1956	4128	6084	SO:0001583	missense	54875	exon1			CGGGGAGCTGAAG	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.85G>A	9.37:g.17135148G>A	ENSP00000370021:p.Ala29Thr	Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	163	33	0.202454	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	37	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614003	0.66672	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360;ENST00000380641	T;T;T;T	0.14391	2.51;2.51;2.51;2.51	5.07	2.1	0.27182	.	.	.	.	.	T	0.11239	0.0274	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.20550	0.017;0.017;0.002;0.046	B;B;B;B	0.18871	0.005;0.005;0.002;0.023	T	0.26573	-1.0099	9	0.87932	D	0	.	7.3253	0.26551	0.0906:0.3251:0.5843:0.0	.	29;29;29;29	C9J1F9;Q9NXG0-2;Q9NXG0-3;B1AMC8	.;.;.;.	T	29	ENSP00000370021:A29T;ENSP00000392798:A29T;ENSP00000262360:A29T;ENSP00000370015:A29T	ENSP00000262360:A29T	A	+	1	0	CNTLN	17125148	0.188000	0.23250	0.014000	0.15608	0.985000	0.73830	0.310000	0.19356	0.217000	0.20800	-0.315000	0.08773	GCT	.	.	none		0.677	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
ST6GAL2	84620	hgsc.bcm.edu	37	2	107460134	107460134	+	Silent	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:107460134G>T	ENST00000409382.3	-	2	910	c.300C>A	c.(298-300)gcC>gcA	p.A100A	ST6GAL2_ENST00000409087.3_Silent_p.A100A|AC016994.2_ENST00000425419.1_RNA|ST6GAL2_ENST00000361686.4_Silent_p.A100A	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	100					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						CTTGGGACTGGGCCCATTTCT	0.587																																					p.A100A		Atlas-SNP	.											.	ST6GAL2	159	.	0			c.C300A						PASS	.						41.0	50.0	47.0					2																	107460134		2190	4288	6478	SO:0001819	synonymous_variant	84620	exon2			GGACTGGGCCCAT	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.300C>A	2.37:g.107460134G>T		Somatic	204	0	0		WXS	Illumina HiSeq	Phase_I	185	69	0.372973	NM_032528	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Silent	SNP	ENST00000409382.3	37	CCDS2073.1																																																																																			.	.	none		0.587	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528	
ZNF616	90317	hgsc.bcm.edu	37	19	52618943	52618943	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:52618943G>A	ENST00000600228.1	-	4	1735	c.1474C>T	c.(1474-1476)Cct>Tct	p.P492S	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	492					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		CATTTGTAAGGTTTCTCTCCA	0.408																																					p.P492S		Atlas-SNP	.											.	ZNF616	109	.	0			c.C1474T						PASS	.						106.0	99.0	102.0					19																	52618943		2203	4300	6503	SO:0001583	missense	90317	exon4			TGTAAGGTTTCTC	AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.1474C>T	19.37:g.52618943G>A	ENSP00000471000:p.Pro492Ser	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	128	38	0.296875	NM_178523	B3KRV1|Q0P658|Q658V7	Missense_Mutation	SNP	ENST00000600228.1	37	CCDS33090.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.120924	0.56613	.	.	ENSG00000204611	ENST00000330123	.	.	.	1.08	-0.00954	0.14000	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.49304	0.1549	L	0.59912	1.85	0.20196	N	0.999921	D	0.65815	0.995	P	0.59357	0.856	T	0.35076	-0.9803	8	0.59425	D	0.04	.	5.0165	0.14339	0.2201:0.0:0.7799:0.0	.	492	Q08AN1	ZN616_HUMAN	S	492	.	ENSP00000328722:P492S	P	-	1	0	ZNF616	57310755	0.995000	0.38212	0.008000	0.14137	0.900000	0.52787	3.357000	0.52277	0.031000	0.15407	0.305000	0.20034	CCT	.	.	none		0.408	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462451.1	XM_030892	
ATP10B	23120	hgsc.bcm.edu	37	5	160071166	160071166	+	Missense_Mutation	SNP	C	C	T	rs369830205		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:160071166C>T	ENST00000327245.5	-	9	1693	c.847G>A	c.(847-849)Gtt>Att	p.V283I		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	283					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACAATGCCAACAGCCATCTCG	0.488																																					p.V283I		Atlas-SNP	.											.	ATP10B	201	.	0			c.G847A						PASS	.						129.0	131.0	131.0					5																	160071166		2003	4177	6180	SO:0001583	missense	23120	exon9			TGCCAACAGCCAT	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.847G>A	5.37:g.160071166C>T	ENSP00000313600:p.Val283Ile	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	77	33	0.428571	NM_025153	Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.046598	0.36085	.	.	ENSG00000118322	ENST00000327245	T	0.72942	-0.7	4.9	2.14	0.27477	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.319926	0.29348	N	0.012417	T	0.47303	0.1438	N	0.11870	0.19	0.09310	N	1	B;B;B;B	0.31227	0.02;0.002;0.314;0.014	B;B;B;B	0.29077	0.044;0.012;0.098;0.028	T	0.28808	-1.0032	9	.	.	.	.	9.5577	0.39348	0.0:0.6982:0.0:0.3018	.	327;283;255;283	B4DHG1;O94823-2;O94823-3;O94823	.;.;.;AT10B_HUMAN	I	283	ENSP00000313600:V283I	.	V	-	1	0	ATP10B	160003744	0.000000	0.05858	0.723000	0.30687	0.996000	0.88848	-0.043000	0.12043	0.132000	0.18615	0.563000	0.77884	GTT	.	.	alt		0.488	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
ZNF257	113835	hgsc.bcm.edu	37	19	22271296	22271296	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:22271296G>A	ENST00000594947.1	+	4	888	c.744G>A	c.(742-744)aaG>aaA	p.K248K		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				CTCAACATAAGGTAATTCATA	0.388																																					p.K248K		Atlas-SNP	.											.	ZNF257	156	.	0			c.G744A						PASS	.						37.0	40.0	39.0					19																	22271296		2124	4259	6383	SO:0001819	synonymous_variant	113835	exon4			ACATAAGGTAATT	AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.744G>A	19.37:g.22271296G>A		Somatic	219	0	0		WXS	Illumina HiSeq	Phase_I	197	52	0.263959	NM_033468	B3KPS4|E9PG34|Q8NE34	Silent	SNP	ENST00000594947.1	37	CCDS46030.1																																																																																			.	.	none		0.388	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1		
RPUSD3	285367	hgsc.bcm.edu	37	3	9885228	9885228	+	Silent	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:9885228G>T	ENST00000383820.5	-	2	184	c.183C>A	c.(181-183)ccC>ccA	p.P61P	RPUSD3_ENST00000485705.1_5'UTR|RPUSD3_ENST00000424438.1_Silent_p.P29P|TTLL3_ENST00000455274.1_Intron|RPUSD3_ENST00000433535.2_Silent_p.P61P	NM_173659.3	NP_775930.2	Q6P087	RUSD3_HUMAN	RNA pseudouridylate synthase domain containing 3	61					pseudouridine synthesis (GO:0001522)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			central_nervous_system(2)|endometrium(3)|lung(2)	7	Medulloblastoma(99;0.227)					GCCCCGCGAAGGGCTGGTCCC	0.667																																					p.P61P		Atlas-SNP	.											.	RPUSD3	19	.	0			c.C183A						PASS	.						26.0	29.0	28.0					3																	9885228		2203	4298	6501	SO:0001819	synonymous_variant	285367	exon2			CGCGAAGGGCTGG	BC032135	CCDS2586.2, CCDS46744.1	3p25.3	2013-02-11			ENSG00000156990	ENSG00000156990		"""RNA pseudouridylate synthase domain containing"""	28437	protein-coding gene	gene with protein product						12477932	Standard	NM_173659		Approved	MGC29784	uc011atk.2	Q6P087	OTTHUMG00000128441	ENST00000383820.5:c.183C>A	3.37:g.9885228G>T		Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	117	30	0.25641	NM_001142547	B4DS39|Q6P6A9|Q8N1B2|Q8NAV3	Silent	SNP	ENST00000383820.5	37	CCDS2586.2	.	.	.	.	.	.	.	.	.	.	G	14.80	2.644836	0.47258	.	.	ENSG00000156990	ENST00000427174	T	0.47528	0.84	4.77	-4.74	0.03249	.	0.288732	0.33959	N	0.004381	T	0.32615	0.0835	.	.	.	0.25345	N	0.988917	.	.	.	.	.	.	T	0.32455	-0.9906	7	0.87932	D	0	.	0.3873	0.00405	0.382:0.1558:0.2102:0.252	.	.	.	.	H	52	ENSP00000400397:P52H	ENSP00000400397:P52H	P	-	2	0	RPUSD3	9860228	0.045000	0.20229	0.031000	0.17742	0.805000	0.45488	-0.355000	0.07671	-1.117000	0.02965	0.655000	0.94253	CCT	.	.	none		0.667	RPUSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250238.1	NM_173659	
CISH	1154	hgsc.bcm.edu	37	3	50645816	50645816	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:50645816G>T	ENST00000348721.3	-	2	409	c.229C>A	c.(229-231)Ctt>Att	p.L77I	CISH_ENST00000443053.2_Missense_Mutation_p.L94I	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein	77					intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		GATTCCCGAAGGTAGGAGAAG	0.567																																					p.L94I		Atlas-SNP	.											.	CISH	27	.	0			c.C280A						PASS	.						71.0	62.0	65.0					3																	50645816		2203	4300	6503	SO:0001583	missense	1154	exon3			CCCGAAGGTAGGA	Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.229C>A	3.37:g.50645816G>T	ENSP00000294173:p.Leu77Ile	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	35	12	0.342857	NM_013324	B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Missense_Mutation	SNP	ENST00000348721.3	37	CCDS2831.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.833132	0.91036	.	.	ENSG00000114737	ENST00000443053;ENST00000348721	T;T	0.65732	-0.17;-0.12	6.03	6.03	0.97812	SH2 motif (1);	0.066847	0.64402	N	0.000007	T	0.79997	0.4543	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.991	T	0.75619	-0.3255	10	0.33141	T	0.24	-0.1319	20.177	0.98182	0.0:0.0:1.0:0.0	.	94;77	G5E9R1;Q9NSE2	.;CISH_HUMAN	I	94;77	ENSP00000409346:L94I;ENSP00000294173:L77I	ENSP00000294173:L77I	L	-	1	0	CISH	50620820	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.876000	0.87215	2.854000	0.98071	0.655000	0.94253	CTT	.	.	none		0.567	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346245.1	NM_145071	
SMC1B	27127	hgsc.bcm.edu	37	22	45789587	45789587	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr22:45789587G>A	ENST00000357450.4	-	9	1471	c.1472C>T	c.(1471-1473)aCc>aTc	p.T491I	SMC1B_ENST00000404354.3_Missense_Mutation_p.T491I	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	491	Flexible hinge.				meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TCCCTCATGGGTATCAATCCC	0.348																																					p.T491I		Atlas-SNP	.											.	SMC1B	215	.	0			c.C1472T						PASS	.						134.0	119.0	124.0					22																	45789587		1849	4099	5948	SO:0001583	missense	27127	exon9			TCATGGGTATCAA	AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.1472C>T	22.37:g.45789587G>A	ENSP00000350036:p.Thr491Ile	Somatic	315	0	0		WXS	Illumina HiSeq	Phase_I	270	76	0.281481	NM_148674	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	ENST00000357450.4	37	CCDS43027.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.764130	0.31228	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	D;D	0.85013	-1.93;-1.93	6.07	-11.8	0.00035	SMCs flexible hinge (1);RecF/RecN/SMC (1);	0.886598	0.09782	N	0.756484	T	0.67702	0.2921	N	0.19112	0.55	0.09310	N	1	B;B;B	0.19445	0.019;0.036;0.036	B;B;B	0.18871	0.006;0.023;0.023	T	0.54925	-0.8220	10	0.45353	T	0.12	.	10.1489	0.42780	0.1425:0.0951:0.6149:0.1475	.	491;491;491	Q8NDV3;Q8NDV3-2;Q8NDV3-3	SMC1B_HUMAN;.;.	I	491	ENSP00000350036:T491I;ENSP00000385902:T491I	ENSP00000350036:T491I	T	-	2	0	SMC1B	44168251	0.000000	0.05858	0.001000	0.08648	0.680000	0.39746	-1.271000	0.02828	-2.950000	0.00293	-0.375000	0.07067	ACC	.	.	none		0.348	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322256.2	NM_148674	
UNC5C	8633	hgsc.bcm.edu	37	4	96222814	96222814	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:96222814C>T	ENST00000453304.1	-	3	781	c.433G>A	c.(433-435)Gtg>Atg	p.V145M	UNC5C_ENST00000504962.1_Missense_Mutation_p.V145M|UNC5C_ENST00000506749.1_Missense_Mutation_p.V145M	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	145	Ig-like.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CTCCAGGCCACACACTGGCAC	0.507																																					p.V145M		Atlas-SNP	.											.	UNC5C	141	.	0			c.G433A						PASS	.						94.0	79.0	84.0					4																	96222814		2203	4300	6503	SO:0001583	missense	8633	exon3			AGGCCACACACTG	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.433G>A	4.37:g.96222814C>T	ENSP00000406022:p.Val145Met	Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	50	20	0.4	NM_003728	Q8IUT0	Missense_Mutation	SNP	ENST00000453304.1	37	CCDS3643.1	.	.	.	.	.	.	.	.	.	.	C	33	5.289972	0.95546	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749;ENST00000504962	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.57	5.57	0.84162	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.71151	0.3306	M	0.87269	2.87	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.99	D;D;D	0.80764	0.971;0.994;0.979	T	0.76119	-0.3076	10	0.87932	D	0	.	19.5525	0.95326	0.0:1.0:0.0:0.0	.	145;145;145	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	M	145;104;145;145;145	ENSP00000406022:V145M;ENSP00000426924:V145M;ENSP00000426153:V145M;ENSP00000425117:V145M	ENSP00000328673:V104M	V	-	1	0	UNC5C	96441837	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.626000	0.88956	0.650000	0.86243	GTG	.	.	none		0.507	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728	
ACTB	60	hgsc.bcm.edu	37	7	5568300	5568300	+	Silent	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:5568300A>T	ENST00000331789.5	-	4	605	c.414T>A	c.(412-414)gcT>gcA	p.A138A	ACTB_ENST00000464611.1_5'Flank|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	138					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		GGGATAGCACAGCCTGGATAG	0.577																																					p.A138A		Atlas-SNP	.											.	ACTB	45	.	0			c.T414A						PASS	.						106.0	107.0	107.0					7																	5568300		2203	4300	6503	SO:0001819	synonymous_variant	60	exon4			TAGCACAGCCTGG	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.414T>A	7.37:g.5568300A>T		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	69	18	0.26087	NM_001101	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Silent	SNP	ENST00000331789.5	37	CCDS5341.1																																																																																			.	.	none		0.577	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059589.4	NM_001101	
FBLN1	2192	hgsc.bcm.edu	37	22	45958992	45958992	+	Intron	SNP	G	G	A	rs11551		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr22:45958992G>A	ENST00000327858.6	+	15	1792				FBLN1_ENST00000442170.2_Intron|FBLN1_ENST00000348697.2_Intron|FBLN1_ENST00000402984.3_Missense_Mutation_p.R671Q|FBLN1_ENST00000262722.7_Missense_Mutation_p.R633Q	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1						embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TTCACCACCCGGAAGGTGAGC	0.667													G|||	1	0.000199681	0.0008	0.0	5008	,	,		13832	0.0		0.0	False		,,,				2504	0.0				p.R633Q		Atlas-SNP	.											.	FBLN1	143	.	0			c.G1898A						PASS	.	G	GLN/ARG,,	1,4405	2.1+/-5.4	0,1,2202	43.0	48.0	46.0		1898,,	-3.0	1.0	22	dbSNP_52	46	0,8600		0,0,4300	no	missense,intron,intron	FBLN1	NM_001996.3,NM_006485.3,NM_006486.2	43,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	633/684,,	45958992	1,13005	2203	4300	6503	SO:0001627	intron_variant	2192	exon15			CCACCCGGAAGGT		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1698-11399G>A	22.37:g.45958992G>A		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	81	26	0.320988	NM_001996	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.981906	0.34942	2.27E-4	0.0	ENSG00000077942	ENST00000402984;ENST00000262722	D;D	0.86030	-2.06;-1.93	4.72	-3.03	0.05429	.	.	.	.	.	T	0.69806	0.3152	N	0.17248	0.465	0.58432	D	0.999998	B;B	0.20052	0.041;0.038	B;B	0.08055	0.002;0.003	T	0.48387	-0.9040	9	0.25751	T	0.34	.	11.7537	0.51863	0.8271:0.0:0.1729:0.0	.	671;633	B1AHL2;P23142-4	.;.	Q	671;633	ENSP00000385521:R671Q;ENSP00000262722:R633Q	ENSP00000262722:R633Q	R	+	2	0	FBLN1	44337656	0.998000	0.40836	0.977000	0.42913	0.972000	0.66771	1.151000	0.31651	-0.447000	0.07138	-0.444000	0.05651	CGG	G|1.000	.	weak		0.667	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486	
HIST1H1B	3009	hgsc.bcm.edu	37	6	27835055	27835055	+	Silent	SNP	G	G	A	rs116008322	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:27835055G>A	ENST00000331442.3	-	1	304	c.253C>T	c.(253-255)Ctg>Ttg	p.L85L		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	85	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						TTGAGGCCCAGCTTAATGCGG	0.577													G|||	45	0.00898562	0.0038	0.0101	5008	,	,		16701	0.004		0.0278	False		,,,				2504	0.001				p.L85L		Atlas-SNP	.											.	HIST1H1B	54	.	0			c.C253T						PASS	.	G		40,4366	43.8+/-77.6	0,40,2163	124.0	135.0	131.0		253	3.7	1.0	6	dbSNP_132	131	238,8362	96.6+/-158.3	4,230,4066	no	coding-synonymous	HIST1H1B	NM_005322.2		4,270,6229	AA,AG,GG		2.7674,0.9079,2.1375		85/227	27835055	278,12728	2203	4300	6503	SO:0001819	synonymous_variant	3009	exon1			GGCCCAGCTTAAT	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.253C>T	6.37:g.27835055G>A		Somatic	176	0	0		WXS	Illumina HiSeq	Phase_I	149	15	0.100671	NM_005322	Q14529|Q3MJ42	Silent	SNP	ENST00000331442.3	37	CCDS4635.1																																																																																			G|0.982;A|0.018	0.018	strong		0.577	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	NM_005322	
UNC13C	440279	hgsc.bcm.edu	37	15	54860103	54860103	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:54860103G>A	ENST00000260323.11	+	29	6064	c.6064G>A	c.(6064-6066)Gat>Aat	p.D2022N	UNC13C_ENST00000545554.1_Missense_Mutation_p.D2022N|UNC13C_ENST00000537900.1_Missense_Mutation_p.D2020N	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	2022	MHD2. {ECO:0000255|PROSITE- ProRule:PRU00588}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CCAAACTACTGATGCCTTGAT	0.358																																					p.D2022N		Atlas-SNP	.											.	UNC13C	674	.	0			c.G6064A						PASS	.						60.0	57.0	58.0					15																	54860103		1805	4071	5876	SO:0001583	missense	440279	exon28			ACTACTGATGCCT	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.6064G>A	15.37:g.54860103G>A	ENSP00000260323:p.Asp2022Asn	Somatic	284	0	0		WXS	Illumina HiSeq	Phase_I	175	48	0.274286	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	G	33	5.271380	0.95429	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.75938	-0.98;-0.98;-0.98	5.81	5.81	0.92471	Mammalian uncoordinated homology 13, domain 2 (1);Mammalian uncoordinated homology 13, subgroup, domain 2 (1);	0.000000	0.85682	D	0.000000	D	0.87842	0.6279	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88178	0.2869	10	0.59425	D	0.04	.	19.0637	0.93101	0.0:0.0:1.0:0.0	.	2022	Q8NB66	UN13C_HUMAN	N	2022;2022;2020	ENSP00000260323:D2022N;ENSP00000438156:D2022N;ENSP00000442569:D2020N	ENSP00000260323:D2022N	D	+	1	0	UNC13C	52647395	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.799000	0.99117	2.749000	0.94314	0.460000	0.39030	GAT	.	.	none		0.358	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
IQGAP1	8826	hgsc.bcm.edu	37	15	90976986	90976986	+	Silent	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:90976986A>G	ENST00000268182.5	+	5	550	c.426A>G	c.(424-426)cgA>cgG	p.R142R	IQGAP1_ENST00000560738.1_Intron	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	142	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TCTATGATCGAAAGAACATGC	0.338																																					p.R142R		Atlas-SNP	.											.	IQGAP1	140	.	0			c.A426G						PASS	.						128.0	126.0	127.0					15																	90976986		2198	4298	6496	SO:0001819	synonymous_variant	8826	exon5			TGATCGAAAGAAC	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.426A>G	15.37:g.90976986A>G		Somatic	196	0	0		WXS	Illumina HiSeq	Phase_I	175	49	0.28	NM_003870	A7MBM3	Silent	SNP	ENST00000268182.5	37	CCDS10362.1																																																																																			.	.	none		0.338	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
CPEB4	80315	hgsc.bcm.edu	37	5	173317293	173317293	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:173317293A>C	ENST00000265085.5	+	1	2011	c.557A>C	c.(556-558)gAt>gCt	p.D186A	CPEB4_ENST00000519835.1_Missense_Mutation_p.D186A|CPEB4_ENST00000334035.5_Missense_Mutation_p.D186A|CPEB4_ENST00000522336.1_5'Flank|CPEB4_ENST00000517880.1_5'Flank|CPEB4_ENST00000520867.1_Missense_Mutation_p.D186A	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	186					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ATCAATGAAGATGCAAGTTTC	0.488																																					p.D186A		Atlas-SNP	.											.	CPEB4	54	.	0			c.A557C						PASS	.						70.0	75.0	73.0					5																	173317293		2203	4300	6503	SO:0001583	missense	80315	exon1			ATGAAGATGCAAG	BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.557A>C	5.37:g.173317293A>C	ENSP00000265085:p.Asp186Ala	Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	189	40	0.21164	NM_030627	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Missense_Mutation	SNP	ENST00000265085.5	37	CCDS4390.1	.	.	.	.	.	.	.	.	.	.	A	15.50	2.851834	0.51270	.	.	ENSG00000113742	ENST00000265085;ENST00000520867;ENST00000334035;ENST00000519835	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.41627	0.1167	L	0.29908	0.895	0.80722	D	1	P;P;B;P	0.52316	0.884;0.93;0.413;0.952	B;P;B;P	0.47827	0.355;0.558;0.214;0.449	T	0.38714	-0.9648	10	0.72032	D	0.01	-20.7982	16.1839	0.81934	1.0:0.0:0.0:0.0	.	186;186;186;186	B7ZLQ8;Q17RY0-2;E5RJM0;Q17RY0	.;.;.;CPEB4_HUMAN	A	186	ENSP00000265085:D186A;ENSP00000429092:D186A;ENSP00000334533:D186A;ENSP00000429048:D186A	ENSP00000265085:D186A	D	+	2	0	CPEB4	173249899	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.923000	0.92808	2.222000	0.72286	0.533000	0.62120	GAT	.	.	none		0.488	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252964.2	NM_030627	
DOCK6	57572	hgsc.bcm.edu	37	19	11325005	11325005	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:11325005C>T	ENST00000294618.7	-	34	4295	c.4284G>A	c.(4282-4284)caG>caA	p.Q1428Q	CTC-510F12.2_ENST00000588634.1_RNA|DOCK6_ENST00000319867.7_Silent_p.Q767Q	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1428					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						AGAGGGCACTCTGGGCACTGC	0.582																																					p.Q1428Q		Atlas-SNP	.											.	DOCK6	104	.	0			c.G4284A						PASS	.						42.0	44.0	43.0					19																	11325005		1986	4158	6144	SO:0001819	synonymous_variant	57572	exon34			GGCACTCTGGGCA		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.4284G>A	19.37:g.11325005C>T		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	60	19	0.316667	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Silent	SNP	ENST00000294618.7	37	CCDS45975.1																																																																																			.	.	none		0.582	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
SGIP1	84251	hgsc.bcm.edu	37	1	67133214	67133214	+	Splice_Site	SNP	G	G	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:67133214G>C	ENST00000371037.4	+	9	550	c.473G>C	c.(472-474)aGg>aCg	p.R158T	SGIP1_ENST00000371036.3_Intron|SGIP1_ENST00000468286.1_Intron|SGIP1_ENST00000237247.6_Splice_Site_p.R162T|SGIP1_ENST00000371035.3_Splice_Site_p.R115T|SGIP1_ENST00000371039.1_Intron|AL139147.1_ENST00000502413.2_Intron	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	158					endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						TGATCACAGAGGCGCAGCCCG	0.423																																					p.R158T		Atlas-SNP	.											.	SGIP1	272	.	0			c.G473C						PASS	.						171.0	173.0	172.0					1																	67133214		2203	4300	6503	SO:0001630	splice_region_variant	84251	exon9			CACAGAGGCGCAG	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.472-1G>C	1.37:g.67133214G>C		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	90	20	0.222222	NM_032291	A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	ENST00000371037.4	37	CCDS30744.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.974426	0.74246	.	.	ENSG00000118473	ENST00000237247;ENST00000371035;ENST00000371037	T;T;T	0.17528	2.27;2.27;2.27	6.01	6.01	0.97437	.	1.194550	0.05982	N	0.644385	T	0.28928	0.0718	L	0.50333	1.59	0.80722	D	1	D	0.54601	0.967	D	0.63597	0.916	T	0.00484	-1.1712	10	0.29301	T	0.29	0.4172	18.015	0.89236	0.0:0.0:1.0:0.0	.	158	Q9BQI5	SGIP1_HUMAN	T	162;115;158	ENSP00000237247:R162T;ENSP00000360074:R115T;ENSP00000360076:R158T	ENSP00000237247:R162T	R	+	2	0	SGIP1	66905802	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.078000	0.76821	2.861000	0.98227	0.650000	0.86243	AGG	.	.	none		0.423	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4	NM_032291	Missense_Mutation
ZDHHC17	23390	hgsc.bcm.edu	37	12	77243231	77243231	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:77243231T>G	ENST00000426126.2	+	16	2390	c.1741T>G	c.(1741-1743)Tct>Gct	p.S581A	ZDHHC17_ENST00000334822.5_Missense_Mutation_p.S581A	NM_015336.2	NP_056151.2	Q8IUH5	ZDH17_HUMAN	zinc finger, DHHC-type containing 17	581					lipoprotein transport (GO:0042953)|magnesium ion transport (GO:0015693)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein palmitoylation (GO:0018345)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(3)|liver(2)|lung(14)	23						CACAACAACGTCTATTGAAAG	0.294																																					p.S581A		Atlas-SNP	.											.	ZDHHC17	45	.	0			c.T1741G						PASS	.						55.0	53.0	54.0					12																	77243231		1808	4057	5865	SO:0001583	missense	23390	exon16			ACAACGTCTATTG	AB023163	CCDS44946.1	12q21.2	2013-01-10				ENSG00000186908		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18412	protein-coding gene	gene with protein product		607799				9700202, 18794299	Standard	NM_015336		Approved	HIP14, HYPH, KIAA0946	uc001syk.1	Q8IUH5	OTTHUMG00000169917	ENST00000426126.2:c.1741T>G	12.37:g.77243231T>G	ENSP00000403397:p.Ser581Ala	Somatic	342	0	0		WXS	Illumina HiSeq	Phase_I	328	38	0.115854	NM_015336	B4DR39|O75407|Q7Z2I0|Q86W89|Q86YK0|Q9P088|Q9UPZ8	Missense_Mutation	SNP	ENST00000426126.2	37	CCDS44946.1	.	.	.	.	.	.	.	.	.	.	T	13.24	2.178323	0.38511	.	.	ENSG00000186908	ENST00000426126;ENST00000334822	T;T	0.32515	1.45;1.45	5.62	5.62	0.85841	.	.	.	.	.	T	0.25827	0.0629	L	0.36672	1.1	0.80722	D	1	P	0.40931	0.733	B	0.39935	0.314	T	0.03354	-1.1045	9	0.11794	T	0.64	-13.0474	15.8846	0.79238	0.0:0.0:0.0:1.0	.	581	Q8IUH5	ZDH17_HUMAN	A	581	ENSP00000403397:S581A;ENSP00000334868:S581A	ENSP00000334868:S581A	S	+	1	0	ZDHHC17	75767362	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	6.082000	0.71318	2.159000	0.67721	0.373000	0.22412	TCT	.	.	none		0.294	ZDHHC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406555.1	NM_015336	
LYST	1130	hgsc.bcm.edu	37	1	235966354	235966354	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:235966354G>C	ENST00000389794.3	-	8	3740	c.3566C>G	c.(3565-3567)tCt>tGt	p.S1189C	LYST_ENST00000389793.2_Missense_Mutation_p.S1189C|LYST_ENST00000536965.1_Missense_Mutation_p.S1189C			Q99698	LYST_HUMAN	lysosomal trafficking regulator	1189					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TTCTTCTGCAGATTGATGACT	0.328																																					p.S1189C		Atlas-SNP	.											.	LYST	370	.	0			c.C3566G						PASS	.						59.0	57.0	58.0					1																	235966354		2203	4300	6503	SO:0001583	missense	1130	exon8			TCTGCAGATTGAT	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.3566C>G	1.37:g.235966354G>C	ENSP00000374444:p.Ser1189Cys	Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	92	35	0.380435	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.727281	0.48833	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	T;T;T	0.63417	-0.04;-0.04;1.13	5.2	5.2	0.72013	.	1.585600	0.03487	N	0.216015	T	0.67683	0.2919	N	0.22421	0.69	0.28915	N	0.892491	D;P	0.61697	0.99;0.77	P;P	0.52031	0.688;0.497	T	0.68281	-0.5450	10	0.59425	D	0.04	.	18.7355	0.91753	0.0:0.0:1.0:0.0	.	1189;1189	Q99698-3;Q99698	.;LYST_HUMAN	C	1189	ENSP00000374444:S1189C;ENSP00000374443:S1189C;ENSP00000438315:S1189C	ENSP00000374443:S1189C	S	-	2	0	LYST	234032977	0.699000	0.27786	0.992000	0.48379	0.504000	0.33889	1.100000	0.31025	2.452000	0.82932	0.655000	0.94253	TCT	.	.	none		0.328	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
MLLT3	4300	hgsc.bcm.edu	37	9	20414376	20414376	+	Silent	SNP	A	A	G	rs1761445|rs373338988	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:20414376A>G	ENST00000380338.4	-	5	754	c.468T>C	c.(466-468)agT>agC	p.S156S	MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S153S|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	156	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.527			T	MLL	ALL								A|||	608	0.121406	0.1354	0.1037	5008	,	,		12979	0.0774		0.1282	False		,,,				2504	0.1534				p.S156S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,colon,carcinoma,0,3	MLLT3	125	3	0			c.T468C						PASS	.						9.0	14.0	13.0					9																	20414376		1854	3811	5665	SO:0001819	synonymous_variant	4300	exon5			GCTGCTACTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.468T>C	9.37:g.20414376A>G		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	118	51	0.432203	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			A|0.906;G|0.094	0.094	strong		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
PRRC2B	84726	hgsc.bcm.edu	37	9	134319653	134319653	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:134319653C>T	ENST00000357304.4	+	5	606	c.551C>T	c.(550-552)gCt>gTt	p.A184V	PRRC2B_ENST00000405995.1_Missense_Mutation_p.A184V|PRRC2B_ENST00000372249.1_5'Flank|PRRC2B_ENST00000458550.1_Missense_Mutation_p.A184V	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	184							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						CAGGACAAGGCTGGCAAAGAA	0.557																																					p.A184V		Atlas-SNP	.											.	PRRC2B	266	.	0			c.C551T						PASS	.						52.0	54.0	54.0					9																	134319653		2027	4190	6217	SO:0001583	missense	84726	exon5			ACAAGGCTGGCAA	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.551C>T	9.37:g.134319653C>T	ENSP00000349856:p.Ala184Val	Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	52	18	0.346154	NM_013318	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	37	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	C	19.63	3.863201	0.71949	.	.	ENSG00000130723	ENST00000405995;ENST00000541684;ENST00000357304;ENST00000458550	T;T;T	0.27256	1.68;1.68;1.68	5.54	4.53	0.55603	BAT2, N-terminal (1);	0.190217	0.24359	U	0.039207	T	0.15046	0.0363	N	0.20401	0.57	0.80722	D	1	B	0.17038	0.02	B	0.20184	0.028	T	0.08269	-1.0730	10	0.30078	T	0.28	-32.5767	7.4546	0.27258	0.0:0.8271:0.0:0.1729	.	184	Q5JSZ5	PRC2B_HUMAN	V	184	ENSP00000384606:A184V;ENSP00000349856:A184V;ENSP00000398853:A184V	ENSP00000349856:A184V	A	+	2	0	PRRC2B	133309474	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.821000	0.39041	2.618000	0.88619	0.462000	0.41574	GCT	.	.	none		0.557	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
VN1R1	57191	hgsc.bcm.edu	37	19	57967400	57967400	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:57967400G>T	ENST00000321039.3	-	1	454	c.455C>A	c.(454-456)cCc>cAc	p.P152H	AC004076.9_ENST00000596831.1_Intron|AC004076.9_ENST00000415705.3_Intron	NM_020633.3	NP_065684.1	Q9GZP7	VN1R1_HUMAN	vomeronasal 1 receptor 1	152					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)|Breast(46;0.222)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)|Lung(386;0.171)		GCATATACTGGGGTTGAGCTT	0.463																																					p.P152H		Atlas-SNP	.											.	VN1R1	48	.	0			c.C455A						PASS	.						99.0	91.0	94.0					19																	57967400		2203	4300	6503	SO:0001583	missense	57191	exon1			ATACTGGGGTTGA	AF255342	CCDS12951.1	19q13.4	2012-08-22	2003-01-15		ENSG00000178201	ENSG00000178201		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	13548	protein-coding gene	gene with protein product		605234	"""vomeronasal olfactory receptor, (chromosome 19) subtype I, member 1"""	VNR19I1		10973240	Standard	NM_020633		Approved	V1RL1, ZVNR1, ZVNH1	uc002qos.2	Q9GZP7		ENST00000321039.3:c.455C>A	19.37:g.57967400G>T	ENSP00000322339:p.Pro152His	Somatic	214	0	0		WXS	Illumina HiSeq	Phase_I	171	43	0.251462	NM_020633	B3KSV5|Q7Z5H8|Q7Z5H9	Missense_Mutation	SNP	ENST00000321039.3	37	CCDS12951.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.602874	0.46423	.	.	ENSG00000178201	ENST00000321039	T	0.10763	2.84	4.24	3.19	0.36642	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.39937	0.1097	H	0.94503	3.545	0.09310	N	1	D	0.55172	0.97	D	0.64042	0.921	T	0.28138	-1.0053	9	0.66056	D	0.02	.	10.4287	0.44393	0.0977:0.0:0.9023:0.0	.	152	Q9GZP7	VN1R1_HUMAN	H	152	ENSP00000322339:P152H	ENSP00000322339:P152H	P	-	2	0	VN1R1	62659212	0.904000	0.30761	0.002000	0.10522	0.008000	0.06430	1.682000	0.37628	1.140000	0.42260	0.644000	0.83932	CCC	.	.	none		0.463	VN1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466464.1	NM_020633	
VCPIP1	80124	hgsc.bcm.edu	37	8	67577327	67577327	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:67577327A>T	ENST00000310421.4	-	1	2125	c.1867T>A	c.(1867-1869)Tac>Aac	p.Y623N	C8orf44-SGK3_ENST00000519289.1_5'Flank|C8orf44_ENST00000519561.1_5'Flank|C8orf44_ENST00000521889.1_5'Flank	NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	623					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			GCAACATCGTAAACATTACTA	0.383																																					p.Y623N	NSCLC(179;265 2915 6144 43644)	Atlas-SNP	.											.	VCPIP1	110	.	0			c.T1867A						PASS	.						120.0	124.0	123.0					8																	67577327		2203	4300	6503	SO:0001583	missense	80124	exon1			CATCGTAAACATT	AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.1867T>A	8.37:g.67577327A>T	ENSP00000309031:p.Tyr623Asn	Somatic	168	0	0		WXS	Illumina HiSeq	Phase_I	180	76	0.422222	NM_025054	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	ENST00000310421.4	37	CCDS6192.1	.	.	.	.	.	.	.	.	.	.	A	16.47	3.132876	0.56828	.	.	ENSG00000175073	ENST00000310421	T	0.39997	1.05	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.61400	0.2344	L	0.59436	1.845	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.64728	-0.6339	10	0.87932	D	0	-11.2244	15.7082	0.77602	1.0:0.0:0.0:0.0	.	623	Q96JH7	VCIP1_HUMAN	N	623	ENSP00000309031:Y623N	ENSP00000309031:Y623N	Y	-	1	0	VCPIP1	67739881	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.287000	0.95975	2.163000	0.67991	0.533000	0.62120	TAC	.	.	none		0.383	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379227.1		
DMD	1756	hgsc.bcm.edu	37	X	33146262	33146262	+	Splice_Site	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chrX:33146262A>G	ENST00000378677.2	-	1	214		c.e1+1		DMD_ENST00000357033.4_Intron|DMD_ENST00000288447.4_Intron	NM_004009.3|NM_004010.3|NM_004011.3|NM_004012.3|NM_004014.2	NP_004000|NP_004001.1|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin						cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GCTTTTACTCACCAGATGAGA	0.418																																					.		Atlas-SNP	.											.	DMD	2127	.	0			c.19+2T>C						PASS	.						112.0	90.0	97.0					X																	33146262		1857	4091	5948	SO:0001630	splice_region_variant	1756	exon2			TTACTCACCAGAT	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000378677.2:c.19+1T>C	X.37:g.33146262A>G		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	99	63	0.636364	NM_004009	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Splice_Site	SNP	ENST00000378677.2	37	CCDS55395.1	.	.	.	.	.	.	.	.	.	.	A	15.17	2.754929	0.49362	.	.	ENSG00000198947	ENST00000378677	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0527	0.53515	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DMD	33056183	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.789000	0.69029	2.056000	0.61249	0.441000	0.28932	.	.	.	none		0.418	DMD-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056187.2	NM_004006	Intron
INO80D	54891	hgsc.bcm.edu	37	2	206921607	206921607	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:206921607C>A	ENST00000403263.1	-	4	683	c.279G>T	c.(277-279)aaG>aaT	p.K93N		NM_017759.4	NP_060229.3	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	93					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	26						TAGGATCATTCTTTTTCTTCC	0.463																																					p.K93N		Atlas-SNP	.											.	INO80D	134	.	0			c.G279T						PASS	.						133.0	118.0	123.0					2																	206921607		1943	4138	6081	SO:0001583	missense	54891	exon4			ATCATTCTTTTTC		CCDS46500.1	2q33.3	2011-07-06			ENSG00000114933	ENSG00000114933		"""INO80 complex subunits"""	25997	protein-coding gene	gene with protein product						16230350	Standard	NM_017759		Approved	FLJ20309	uc002vaz.4	Q53TQ3	OTTHUMG00000154649	ENST00000403263.1:c.279G>T	2.37:g.206921607C>A	ENSP00000384198:p.Lys93Asn	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	184	60	0.326087	NM_017759	B3KU68|B9EG77|Q6PJC6|Q6PJU1|Q6PKA1|Q9NXD5	Missense_Mutation	SNP	ENST00000403263.1	37	CCDS46500.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.218033	0.79352	.	.	ENSG00000114933	ENST00000403263;ENST00000233270	T	0.36157	1.27	5.38	5.38	0.77491	.	0.000000	0.64402	D	0.000004	T	0.50120	0.1597	L	0.27053	0.805	0.58432	D	0.999997	D	0.76494	0.999	D	0.83275	0.996	T	0.53365	-0.8449	10	0.66056	D	0.02	.	19.1182	0.93351	0.0:1.0:0.0:0.0	.	93	Q53TQ3-2	.	N	93	ENSP00000384198:K93N	ENSP00000233270:K93N	K	-	3	2	INO80D	206629852	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.759000	0.62227	2.522000	0.85027	0.462000	0.41574	AAG	.	.	none		0.463	INO80D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336459.1	NM_017759	
BRCA2	675	hgsc.bcm.edu	37	13	32906689	32906689	+	Silent	SNP	G	G	A	rs276174805		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr13:32906689G>A	ENST00000380152.3	+	10	1307	c.1074G>A	c.(1072-1074)gtG>gtA	p.V358V	BRCA2_ENST00000544455.1_Silent_p.V358V			P51587	BRCA2_HUMAN	breast cancer 2, early onset	358					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TATCTGAAGTGGAACCAAATG	0.358			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.V358V	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	812	.	0			c.G1074A						PASS	.						140.0	159.0	153.0					13																	32906689		2194	4296	6490	SO:0001819	synonymous_variant	675	exon10	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	TGAAGTGGAACCA	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.1074G>A	13.37:g.32906689G>A		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	89	14	0.157303	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Silent	SNP	ENST00000380152.3	37	CCDS9344.1																																																																																			.	.	alt		0.358	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
AHNAK	79026	hgsc.bcm.edu	37	11	62284325	62284325	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:62284325A>T	ENST00000378024.4	-	5	17838	c.17564T>A	c.(17563-17565)cTg>cAg	p.L5855Q	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000525875.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5855					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CTTAGAGGCCAGGGACACCCC	0.527																																					p.L5855Q		Atlas-SNP	.											.	AHNAK	532	.	0			c.T17564A						PASS	.						196.0	174.0	181.0					11																	62284325		2202	4299	6501	SO:0001583	missense	79026	exon5			GAGGCCAGGGACA	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.17564T>A	11.37:g.62284325A>T	ENSP00000367263:p.Leu5855Gln	Somatic	140	0	0		WXS	Illumina HiSeq	Phase_I	138	78	0.565217	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	A	11.99	1.803170	0.31869	.	.	ENSG00000124942	ENST00000378024	T	0.03065	4.06	4.89	3.75	0.43078	.	.	.	.	.	T	0.02418	0.0074	N	0.12182	0.205	0.32889	D	0.511639	B	0.32753	0.383	B	0.27608	0.081	T	0.40887	-0.9539	9	0.38643	T	0.18	-0.5722	10.1511	0.42794	0.9194:0.0:0.0806:0.0	.	5855	Q09666	AHNK_HUMAN	Q	5855	ENSP00000367263:L5855Q	ENSP00000367263:L5855Q	L	-	2	0	AHNAK	62040901	0.979000	0.34478	0.998000	0.56505	0.991000	0.79684	2.803000	0.47924	0.711000	0.32018	0.448000	0.29417	CTG	.	.	none		0.527	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
ASPM	259266	hgsc.bcm.edu	37	1	197093397	197093397	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:197093397C>T	ENST00000367409.4	-	13	3489	c.3233G>A	c.(3232-3234)aGt>aAt	p.S1078N	ASPM_ENST00000367408.1_Missense_Mutation_p.S328N|ASPM_ENST00000294732.7_Missense_Mutation_p.S1078N	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1078					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TTTCTTTATACTCTTTGTGTG	0.289																																					p.S1078N		Atlas-SNP	.											.	ASPM	444	.	0			c.G3233A						PASS	.						79.0	81.0	80.0					1																	197093397		2202	4283	6485	SO:0001583	missense	259266	exon13			TTTATACTCTTTG	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.3233G>A	1.37:g.197093397C>T	ENSP00000356379:p.Ser1078Asn	Somatic	765	0	0		WXS	Illumina HiSeq	Phase_I	579	154	0.265976	NM_001206846	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	3.744	-0.052963	0.07362	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408	T;T;T	0.58060	0.36;1.62;1.29	5.53	-0.305	0.12784	Calponin homology domain (1);	0.516189	0.20992	N	0.082012	T	0.15609	0.0376	N	0.01267	-0.92	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.17806	-1.0357	10	0.13853	T	0.58	.	2.2892	0.04134	0.1201:0.3525:0.1182:0.4092	.	1078;1078	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	N	1078;1078;328	ENSP00000356379:S1078N;ENSP00000294732:S1078N;ENSP00000356378:S328N	ENSP00000294732:S1078N	S	-	2	0	ASPM	195360020	0.000000	0.05858	0.001000	0.08648	0.861000	0.49209	0.013000	0.13310	0.101000	0.17610	0.585000	0.79938	AGT	.	.	none		0.289	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
LMAN2	10960	hgsc.bcm.edu	37	5	176778602	176778602	+	Missense_Mutation	SNP	C	C	T	rs143985896	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:176778602C>T	ENST00000303127.7	-	1	251	c.47G>A	c.(46-48)tGc>tAc	p.C16Y	LMAN2_ENST00000515209.1_Missense_Mutation_p.C16Y|LMAN2_ENST00000506310.1_5'UTR	NM_006816.2	NP_006807.1	Q12907	LMAN2_HUMAN	lectin, mannose-binding 2	16					positive regulation of phagocytosis (GO:0050766)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|heat shock protein binding (GO:0031072)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCTTCCCAGGCACCGCCGGCC	0.647													C|||	3	0.000599042	0.0023	0.0	5008	,	,		15298	0.0		0.0	False		,,,				2504	0.0				p.C16Y		Atlas-SNP	.											.	LMAN2	35	.	0			c.G47A						PASS	.	C	TYR/CYS	10,4396	15.5+/-35.6	0,10,2193	22.0	28.0	26.0		47	3.4	1.0	5	dbSNP_134	26	0,8600		0,0,4300	yes	missense	LMAN2	NM_006816.2	194	0,10,6493	TT,TC,CC		0.0,0.227,0.0769	benign	16/357	176778602	10,12996	2203	4300	6503	SO:0001583	missense	10960	exon1			CCCAGGCACCGCC	U10362	CCDS4417.1	5q35	2008-02-05		2003-07-04	ENSG00000169223	ENSG00000169223			16986	protein-coding gene	gene with protein product		609551	"""chromosome 5 open reading frame 8"""	C5orf8		12609988	Standard	NM_006816		Approved	GP36B, VIP36	uc003mge.3	Q12907	OTTHUMG00000130860	ENST00000303127.7:c.47G>A	5.37:g.176778602C>T	ENSP00000303366:p.Cys16Tyr	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	79	13	0.164557	NM_006816	Q53HH1	Missense_Mutation	SNP	ENST00000303127.7	37	CCDS4417.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	15.76	2.929099	0.52759	0.00227	0.0	ENSG00000169223	ENST00000303127;ENST00000515209;ENST00000514458;ENST00000502560	T;T;T;T	0.64085	-0.02;-0.04;-0.08;-0.02	5.25	3.44	0.39384	.	0.338095	0.32372	N	0.006186	T	0.36826	0.0981	N	0.08118	0	0.28596	N	0.909398	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.19353	-1.0308	10	0.38643	T	0.18	-16.1925	6.4711	0.22009	0.1786:0.7304:0.0:0.0909	.	16;16	Q12907;D6RBV2	LMAN2_HUMAN;.	Y	16	ENSP00000303366:C16Y;ENSP00000423998:C16Y;ENSP00000424132:C16Y;ENSP00000425229:C16Y	ENSP00000303366:C16Y	C	-	2	0	LMAN2	176711208	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.282000	0.33226	0.769000	0.33313	0.644000	0.83932	TGC	C|0.999;T|0.001	0.001	strong		0.647	LMAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253434.1	NM_006816	
COL23A1	91522	hgsc.bcm.edu	37	5	177695744	177695744	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:177695744G>A	ENST00000390654.3	-	7	839	c.482C>T	c.(481-483)cCg>cTg	p.P161L	COL23A1_ENST00000407622.1_Missense_Mutation_p.P125L	NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	161	Collagen-like 1.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		TTCCCCTTTCGGGCCTGGAAG	0.572																																					p.P161L		Atlas-SNP	.											.	COL23A1	47	.	0			c.C482T						PASS	.						66.0	69.0	68.0					5																	177695744		1960	4149	6109	SO:0001583	missense	91522	exon7			CCTTTCGGGCCTG	AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.482C>T	5.37:g.177695744G>A	ENSP00000375069:p.Pro161Leu	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	54	8	0.148148	NM_173465	Q8IVR4|Q9NT93	Missense_Mutation	SNP	ENST00000390654.3	37	CCDS4436.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700780	0.48307	.	.	ENSG00000050767	ENST00000390654;ENST00000407622	D;D	0.95885	-3.2;-3.84	4.9	4.9	0.64082	.	0.288677	0.27971	N	0.017120	D	0.91415	0.7291	L	0.41632	1.29	0.58432	D	0.999998	B	0.23128	0.08	B	0.04013	0.001	D	0.87953	0.2725	10	0.18276	T	0.48	1.1631	13.9866	0.64339	0.0:0.0:1.0:0.0	.	161	Q86Y22	CONA1_HUMAN	L	161;125	ENSP00000375069:P161L;ENSP00000385092:P125L	ENSP00000375069:P161L	P	-	2	0	COL23A1	177628350	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	3.625000	0.54238	2.442000	0.82660	0.555000	0.69702	CCG	.	.	none		0.572	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253475.1	NM_173465	
ACTB	60	hgsc.bcm.edu	37	7	5568897	5568897	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:5568897C>G	ENST00000331789.5	-	3	449	c.258G>C	c.(256-258)tgG>tgC	p.W86C	ACTB_ENST00000464611.1_5'Flank|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	86					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		AGGTGTGGTGCCAGATTTTCT	0.612																																					p.W86C		Atlas-SNP	.											.	ACTB	45	.	0			c.G258C						PASS	.						66.0	65.0	66.0					7																	5568897		2203	4300	6503	SO:0001583	missense	60	exon3			GTGGTGCCAGATT	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.258G>C	7.37:g.5568897C>G	ENSP00000349960:p.Trp86Cys	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	72	16	0.222222	NM_001101	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000331789.5	37	CCDS5341.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.643886	0.47258	.	.	ENSG00000075624	ENST00000331789;ENST00000445914;ENST00000400179;ENST00000320713;ENST00000432588;ENST00000443528;ENST00000417101	D;D;D;D	0.96522	-4.04;-4.04;-4.04;-4.04	5.01	5.01	0.66863	.	0.316889	0.27375	N	0.019646	D	0.99105	0.9692	H	0.99726	4.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98789	1.0735	10	0.87932	D	0	.	15.8267	0.78711	0.0:1.0:0.0:0.0	.	86	P60709	ACTB_HUMAN	C	86;86;58;5;86;86;89	ENSP00000349960:W86C;ENSP00000407473:W86C;ENSP00000393951:W86C;ENSP00000399487:W89C	ENSP00000440549:W5C	W	-	3	0	ACTB	5535423	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.868000	0.69605	2.312000	0.78011	0.563000	0.77884	TGG	.	.	none		0.612	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059589.4	NM_001101	
RGPD4	285190	hgsc.bcm.edu	37	2	108487901	108487901	+	Silent	SNP	A	A	G	rs372225810	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:108487901A>G	ENST00000408999.3	+	20	3518	c.3441A>G	c.(3439-3441)ttA>ttG	p.L1147L	RGPD4_ENST00000354986.4_Silent_p.L1147L	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1147	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TAGAGCGGTTAGCAGCAAAAT	0.448													N|||	2709	0.540935	0.8086	0.402	5008	,	,		8200	0.13		0.5895	False		,,,				2504	0.6513				p.L1147L		Atlas-SNP	.											RGPD4,NS,carcinoma,0,1	RGPD4	112	1	0			c.A3441G						scavenged	.																																			SO:0001819	synonymous_variant	285190	exon20			GCGGTTAGCAGCA	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3441A>G	2.37:g.108487901A>G		Somatic	4	4	1		WXS	Illumina HiSeq	Phase_I	7	7	1	NM_182588	B9A029	Silent	SNP	ENST00000408999.3	37	CCDS46381.1																																																																																			G|1.000;|0.000	1.000	weak		0.448	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
PRDM8	56978	hgsc.bcm.edu	37	4	81123614	81123614	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:81123614G>A	ENST00000504452.1	+	8	1837	c.998G>A	c.(997-999)cGg>cAg	p.R333Q	PRDM8_ENST00000339711.4_Missense_Mutation_p.R333Q|PRDM8_ENST00000415738.2_Missense_Mutation_p.R333Q			Q9NQV8	PRDM8_HUMAN	PR domain containing 8	333	Gly-rich.				corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(2)	10						GTAGGGGGCCGGGGCCGCTTC	0.701																																					p.R333Q		Atlas-SNP	.											.	PRDM8	44	.	0			c.G998A						PASS	.						2.0	2.0	2.0					4																	81123614		1024	2626	3650	SO:0001583	missense	56978	exon4			GGGGCCGGGGCCG	AF275815	CCDS43243.1	4q21	2008-08-21				ENSG00000152784			13993	protein-coding gene	gene with protein product							Standard	NM_020226		Approved		uc003hmc.4	Q9NQV8		ENST00000504452.1:c.998G>A	4.37:g.81123614G>A	ENSP00000423985:p.Arg333Gln	Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	43	25	0.581395	NM_001099403	A8K7X2|Q6IQ36	Missense_Mutation	SNP	ENST00000504452.1	37	CCDS43243.1	.	.	.	.	.	.	.	.	.	.	G	10.94	1.494241	0.26774	.	.	ENSG00000152784	ENST00000504452;ENST00000515013;ENST00000339711;ENST00000415738	T;T;T;T	0.65549	-0.16;0.39;-0.16;-0.16	4.28	3.41	0.39046	.	0.462300	0.18430	N	0.141459	T	0.46580	0.1400	N	0.24115	0.695	0.29957	N	0.819696	B	0.23058	0.079	B	0.12156	0.007	T	0.49523	-0.8931	10	0.59425	D	0.04	.	11.106	0.48203	0.0:0.1879:0.8121:0.0	.	333	Q9NQV8	PRDM8_HUMAN	Q	333	ENSP00000423985:R333Q;ENSP00000425149:R333Q;ENSP00000339764:R333Q;ENSP00000406998:R333Q	ENSP00000339764:R333Q	R	+	2	0	PRDM8	81342638	0.971000	0.33674	0.998000	0.56505	0.274000	0.26718	-0.370000	0.07523	0.967000	0.38186	0.491000	0.48974	CGG	.	.	none		0.701	PRDM8-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362793.1		
CSNK2A1	1457	hgsc.bcm.edu	37	20	472918	472918	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:472918C>T	ENST00000217244.3	-	9	976	c.601G>A	c.(601-603)Gag>Aag	p.E201K	CSNK2A1_ENST00000400217.2_Missense_Mutation_p.E65K|CSNK2A1_ENST00000349736.5_Missense_Mutation_p.E201K|CSNK2A1_ENST00000400227.3_Missense_Mutation_p.E201K	NM_177559.2	NP_808227.1	P68400	CSK21_HUMAN	casein kinase 2, alpha 1 polypeptide	201	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|chaperone-mediated protein folding (GO:0061077)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	ATP binding (GO:0005524)|Hsp90 protein binding (GO:0051879)|protein N-terminus binding (GO:0047485)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)			ACAAGTAGCTCAGGACCTTTG	0.388																																					p.E201K		Atlas-SNP	.											.	CSNK2A1	36	.	0			c.G601A						PASS	.						88.0	81.0	83.0					20																	472918		2203	4300	6503	SO:0001583	missense	1457	exon8			GTAGCTCAGGACC	M55265	CCDS13003.1, CCDS13004.1	20p13	2013-01-17			ENSG00000101266	ENSG00000101266			2457	protein-coding gene	gene with protein product		115440				2174700, 1766873	Standard	NM_177559		Approved		uc002wdx.1	P68400	OTTHUMG00000031636	ENST00000217244.3:c.601G>A	20.37:g.472918C>T	ENSP00000217244:p.Glu201Lys	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	59	13	0.220339	NM_001895	B4DYS6|D3DVV8|P19138|P20426|Q14013|Q5U065	Missense_Mutation	SNP	ENST00000217244.3	37	CCDS13003.1	.	.	.	.	.	.	.	.	.	.	C	35	5.500490	0.96355	.	.	ENSG00000101266	ENST00000400227;ENST00000349736;ENST00000217244;ENST00000381973;ENST00000400217	T;T;T;T	0.71103	1.52;1.52;1.52;-0.54	4.83	4.83	0.62350	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86615	0.5975	H	0.98295	4.195	0.80722	D	1	P	0.48089	0.905	P	0.49085	0.6	D	0.91949	0.5569	10	0.87932	D	0	-5.5019	17.4514	0.87593	0.0:1.0:0.0:0.0	.	201	P68400	CSK21_HUMAN	K	201;201;201;201;65	ENSP00000383086:E201K;ENSP00000339247:E201K;ENSP00000217244:E201K;ENSP00000383076:E65K	ENSP00000217244:E201K	E	-	1	0	CSNK2A1	420918	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.580000	0.82523	2.674000	0.91012	0.650000	0.86243	GAG	.	.	none		0.388	CSNK2A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077466.1	NM_001895	
NAA38	84316	hgsc.bcm.edu	37	7	117832025	117832025	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:117832025G>A	ENST00000249299.2	+	4	452	c.260G>A	c.(259-261)cGa>cAa	p.R87Q	NAA38_ENST00000424702.1_3'UTR|NAA38_ENST00000422760.1_Missense_Mutation_p.R66Q	NM_016200.4	NP_057284.1	Q9BRA0	LSMD1_HUMAN	N(alpha)-acetyltransferase 38, NatC auxiliary subunit	0					negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	8						GGGAATATTCGAGCAGAACCT	0.343																																					p.R87Q		Atlas-SNP	.											NAA38,NS,carcinoma,+1,1	NAA38	16	1	0			c.G260A						scavenged	.						96.0	99.0	98.0					7																	117832025		2203	4299	6502	SO:0001583	missense	51691	exon4			ATATTCGAGCAGA		CCDS11122.1	17p13.1	2014-01-21	2014-01-21	2014-01-21		ENSG00000183011		"""N(alpha)-acetyltransferase subunits"""	28212	protein-coding gene	gene with protein product			"""LSM domain containing 1"""	LSMD1		16484612, 19398576	Standard	NM_032356		Approved	MGC14151, PFAAP2	uc002gja.3	Q9BRA0		ENST00000249299.2:c.260G>A	7.37:g.117832025G>A	ENSP00000249299:p.Arg87Gln	Somatic	141	1	0.0070922		WXS	Illumina HiSeq	Phase_I	119	31	0.260504	NM_016200	Q8N4M0	Missense_Mutation	SNP	ENST00000249299.2	37	CCDS5775.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.575046	0.86542	.	.	ENSG00000128534	ENST00000249299;ENST00000422760	.	.	.	5.76	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.55433	0.1920	.	.	.	0.80722	D	1	P	0.51653	0.947	B	0.42771	0.397	T	0.60835	-0.7184	8	0.56958	D	0.05	-10.2314	14.6387	0.68708	0.0697:0.0:0.9303:0.0	.	87	O95777	NAA38_HUMAN	Q	87;66	.	ENSP00000249299:R87Q	R	+	2	0	NAA38	117619261	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.868000	0.92320	1.444000	0.47605	0.655000	0.94253	CGA	.	.	none		0.343	NAA38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346774.2	NM_032356	
DDX47	51202	hgsc.bcm.edu	37	12	12966365	12966365	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:12966365G>C	ENST00000358007.3	+	1	86	c.64G>C	c.(64-66)Gaa>Caa	p.E22Q	DDX47_ENST00000352940.4_Missense_Mutation_p.E22Q	NM_016355.3	NP_057439.2	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	22					extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)		GGAAGAGGAGGAAACTAAAAC	0.557											OREG0021680	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E22Q		Atlas-SNP	.											.	DDX47	37	.	0			c.G64C						PASS	.						66.0	64.0	65.0					12																	12966365		2203	4300	6503	SO:0001583	missense	51202	exon1			GAGGAGGAAACTA	AK127712	CCDS8655.1, CCDS8656.1	12p13.2	2010-07-06			ENSG00000213782	ENSG00000213782		"""DEAD-boxes"""	18682	protein-coding gene	gene with protein product		615428					Standard	NM_016355		Approved	DKFZp564O176, FLJ30012, HQ0256, RRP3	uc001rax.3	Q9H0S4	OTTHUMG00000168709	ENST00000358007.3:c.64G>C	12.37:g.12966365G>C	ENSP00000350698:p.Glu22Gln	Somatic	53	0	0	683	WXS	Illumina HiSeq	Phase_I	47	12	0.255319	NM_201224	B3KXP4|G5E955|Q96GM0|Q96NV8|Q9UI98	Missense_Mutation	SNP	ENST00000358007.3	37	CCDS8655.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.608805	0.28623	.	.	ENSG00000213782	ENST00000352940;ENST00000358007;ENST00000544400	T;T;T	0.43688	0.94;1.66;0.94	4.98	4.98	0.66077	.	0.054639	0.64402	D	0.000001	T	0.30603	0.0770	N	0.21545	0.675	0.43622	D	0.996008	B;B;B;B	0.15141	0.008;0.012;0.009;0.003	B;B;B;B	0.12837	0.008;0.007;0.007;0.002	T	0.06698	-1.0812	10	0.16420	T	0.52	-14.5554	17.5534	0.87884	0.0:0.0:1.0:0.0	.	22;22;22;22	B4DYP6;Q9H4E3;G5E955;Q9H0S4	.;.;.;DDX47_HUMAN	Q	22	ENSP00000319578:E22Q;ENSP00000350698:E22Q;ENSP00000444000:E22Q	ENSP00000319578:E22Q	E	+	1	0	DDX47	12857632	1.000000	0.71417	1.000000	0.80357	0.568000	0.35870	3.126000	0.50477	2.756000	0.94617	0.655000	0.94253	GAA	.	.	none		0.557	DDX47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400674.1	NM_016355	
PKD1	5310	hgsc.bcm.edu	37	16	2161349	2161349	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:2161349G>A	ENST00000262304.4	-	15	4027	c.3819C>T	c.(3817-3819)acC>acT	p.T1273T	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Silent_p.T1273T	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1273	PKD 7. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCGCACCCACGGTCACTGTGC	0.687																																					p.T1273T		Atlas-SNP	.											.	PKD1	184	.	0			c.C3819T						PASS	.						12.0	13.0	12.0					16																	2161349		2081	4116	6197	SO:0001819	synonymous_variant	5310	exon15			ACCCACGGTCACT	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.3819C>T	16.37:g.2161349G>A		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	46	17	0.369565	NM_000296	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			.	.	none		0.687	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
CSMD1	64478	hgsc.bcm.edu	37	8	2966134	2966134	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:2966134T>C	ENST00000520002.1	-	45	7303	c.6748A>G	c.(6748-6750)Aat>Gat	p.N2250D	CSMD1_ENST00000537824.1_Missense_Mutation_p.N2249D|CSMD1_ENST00000542608.1_Missense_Mutation_p.N2249D|CSMD1_ENST00000602723.1_Missense_Mutation_p.N2250D|CSMD1_ENST00000400186.3_Missense_Mutation_p.N2250D|CSMD1_ENST00000602557.1_Missense_Mutation_p.N2250D			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2250	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CCGTGGAAATTGAGGACAAAG	0.478																																					p.N2249D		Atlas-SNP	.											.	CSMD1	1469	.	0			c.A6745G						PASS	.						71.0	71.0	71.0					8																	2966134		1938	4145	6083	SO:0001583	missense	64478	exon44			GGAAATTGAGGAC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6748A>G	8.37:g.2966134T>C	ENSP00000430733:p.Asn2250Asp	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	45	20	0.444444	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.32|10.32	1.317341|1.317341	0.23908|0.23908	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	T;T;T;T|.	0.59906|.	0.23;0.23;0.23;0.23|.	4.95|4.95	4.95|4.95	0.65309|0.65309	CUB (3);|.	0.127016|.	0.49916|.	D|.	0.000128|.	T|T	0.57388|0.57388	0.2050|0.2050	L|L	0.35854|0.35854	1.095|1.095	0.80722|0.80722	D|D	1|1	D;B;D|.	0.76494|.	0.992;0.012;0.999|.	D;B;D|.	0.85130|.	0.987;0.021;0.997|.	T|T	0.54516|0.54516	-0.8282|-0.8282	10|5	0.16420|.	T|.	0.52|.	.|.	14.8886|14.8886	0.70590|0.70590	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2250;2250;2249|.	E5RIG2;Q96PZ7;F5H2I8|.	.;CSMD1_HUMAN;.|.	D|R	2250;2250;2111;2249;2249|1729	ENSP00000383047:N2250D;ENSP00000430733:N2250D;ENSP00000441462:N2249D;ENSP00000446243:N2249D|.	ENSP00000320445:N2111D|.	N|Q	-|-	1|2	0|0	CSMD1|CSMD1	2953541|2953541	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.184000|0.184000	0.23303|0.23303	4.667000|4.667000	0.61561|0.61561	1.971000|1.971000	0.57363|0.57363	0.472000|0.472000	0.43445|0.43445	AAT|CAA	.	.	none		0.478	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
PLXNA2	5362	hgsc.bcm.edu	37	1	208216538	208216538	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:208216538C>T	ENST00000367033.3	-	21	4642	c.3885G>A	c.(3883-3885)gaG>gaA	p.E1295E		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1295					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CCGTCTGGAGCTCAGCAAAAG	0.552																																					p.E1295E		Atlas-SNP	.											.	PLXNA2	178	.	0			c.G3885A						PASS	.						76.0	73.0	74.0					1																	208216538		2203	4300	6503	SO:0001819	synonymous_variant	5362	exon21			CTGGAGCTCAGCA	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.3885G>A	1.37:g.208216538C>T		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	70	10	0.142857	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Silent	SNP	ENST00000367033.3	37	CCDS31013.1																																																																																			.	.	none		0.552	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
LOX	4015	hgsc.bcm.edu	37	5	121412595	121412595	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:121412595G>C	ENST00000231004.4	-	2	1032	c.733C>G	c.(733-735)Ctg>Gtg	p.L245V	LOX_ENST00000513319.1_Intron	NM_001178102.1|NM_002317.5	NP_001171573.1|NP_002308.2	P28300	LYOX_HUMAN	lysyl oxidase	245	Lysyl-oxidase like.				blood vessel development (GO:0001568)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|wound healing (GO:0042060)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)			endometrium(1)|lung(6)|prostate(1)	8		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)		TACCTGGCCAGACAGTTTTCC	0.612											OREG0016741	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L245V		Atlas-SNP	.											LOX,NS,carcinoma,+1,1	LOX	29	1	0			c.C733G						PASS	.						108.0	104.0	105.0					5																	121412595		2203	4300	6503	SO:0001583	missense	4015	exon2			TGGCCAGACAGTT		CCDS4129.1	5q23.3-q31.2	2008-02-05			ENSG00000113083	ENSG00000113083	1.4.3.13		6664	protein-coding gene	gene with protein product		153455				1685472	Standard	NM_002317		Approved		uc003ksu.3	P28300	OTTHUMG00000128914	ENST00000231004.4:c.733C>G	5.37:g.121412595G>C	ENSP00000231004:p.Leu245Val	Somatic	24	0	0	1511	WXS	Illumina HiSeq	Phase_I	44	5	0.113636	NM_002317	B2R5Q3|Q5FWF0	Missense_Mutation	SNP	ENST00000231004.4	37	CCDS4129.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.804101	0.50315	.	.	ENSG00000113083	ENST00000231004;ENST00000543620	T	0.43688	0.94	5.45	3.54	0.40534	.	0.000000	0.85682	D	0.000000	T	0.53883	0.1824	L	0.58583	1.82	0.43724	D	0.996202	D	0.56287	0.975	D	0.67382	0.951	T	0.52563	-0.8559	10	0.87932	D	0	.	6.351	0.21375	0.5873:0.0:0.4127:0.0	.	245	P28300	LYOX_HUMAN	V	245;205	ENSP00000231004:L245V	ENSP00000231004:L245V	L	-	1	2	LOX	121440494	0.996000	0.38824	0.986000	0.45419	0.951000	0.60555	1.336000	0.33850	0.554000	0.29061	0.555000	0.69702	CTG	.	.	none		0.612	LOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250887.2		
PLCE1	51196	hgsc.bcm.edu	37	10	96018781	96018781	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:96018781C>T	ENST00000371380.3	+	12	3923	c.3688C>T	c.(3688-3690)Cgc>Tgc	p.R1230C	PLCE1_ENST00000371385.3_Missense_Mutation_p.R922C|PLCE1_ENST00000260766.3_Missense_Mutation_p.R1230C|PLCE1_ENST00000371375.1_Missense_Mutation_p.R922C			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1230				SR -> QA (in Ref. 8; AAF22005). {ECO:0000305}.	activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TGTCAGGAGCCGCAAGGACCT	0.463																																					p.R1230C		Atlas-SNP	.											PLCE1_ENST00000371375,NS,carcinoma,-1,3	PLCE1	543	3	0			c.C3688T						PASS	.						125.0	119.0	121.0					10																	96018781		1957	4149	6106	SO:0001583	missense	51196	exon13			AGGAGCCGCAAGG		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.3688C>T	10.37:g.96018781C>T	ENSP00000360431:p.Arg1230Cys	Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	126	39	0.309524	NM_016341	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.410254	0.83340	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.60171	0.21;0.21;0.21;0.21	5.77	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.73900	0.3646	M	0.62723	1.935	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	T	0.77416	-0.2596	10	0.87932	D	0	.	16.238	0.82389	0.1339:0.8661:0.0:0.0	.	1214;922;1230	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	C	1230;1230;922;922	ENSP00000260766:R1230C;ENSP00000360431:R1230C;ENSP00000360438:R922C;ENSP00000360426:R922C	ENSP00000260766:R1230C	R	+	1	0	PLCE1	96008771	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.002000	0.57053	1.420000	0.47138	0.555000	0.69702	CGC	.	.	none		0.463	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
BPIFB4	149954	hgsc.bcm.edu	37	20	31671452	31671452	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:31671452G>A	ENST00000375483.3	+	3	449	c.449G>A	c.(448-450)cGa>cAa	p.R150Q		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	150	Gly-rich.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										CTTCACCGGCGAGAGCTGCAG	0.642																																					p.R150Q		Atlas-SNP	.											C20orf186,NS,carcinoma,+1,1	.	.	1	0			c.G449A						scavenged	.						43.0	44.0	44.0					20																	31671452		2203	4300	6503	SO:0001583	missense	149954	exon3			ACCGGCGAGAGCT	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.449G>A	20.37:g.31671452G>A	ENSP00000364632:p.Arg150Gln	Somatic	138	2	0.0144928		WXS	Illumina HiSeq	Phase_I	100	27	0.27	NM_182519	Q5TDX6	Missense_Mutation	SNP	ENST00000375483.3	37	CCDS13213.2	.	.	.	.	.	.	.	.	.	.	G	11.88	1.769766	0.31320	.	.	ENSG00000186191	ENST00000375483	T	0.01495	4.83	3.28	2.32	0.28847	.	0.230809	0.28883	N	0.013835	T	0.01661	0.0053	L	0.32530	0.975	0.18873	N	0.999989	B	0.21147	0.052	B	0.08055	0.003	T	0.44421	-0.9329	10	0.87932	D	0	-7.3415	6.7308	0.23383	0.1358:0.0:0.8642:0.0	.	150	P59827	BPIB4_HUMAN	Q	150	ENSP00000364632:R150Q	ENSP00000364632:R150Q	R	+	2	0	BPIFB4	31135113	0.088000	0.21588	0.762000	0.31397	0.036000	0.12997	1.645000	0.37238	0.715000	0.32103	-0.369000	0.07265	CGA	.	.	none		0.642	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
SLC30A4	7782	hgsc.bcm.edu	37	15	45814252	45814252	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:45814252G>T	ENST00000261867.4	-	2	615	c.301C>A	c.(301-303)Cag>Aag	p.Q101K	SLC30A4_ENST00000559667.1_5'UTR|HMGN2P46_ENST00000409454.1_RNA	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	101					regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		ATCTCTCTCTGTTTGCTGCAG	0.483																																					p.Q101K		Atlas-SNP	.											SLC30A4,bladder,carcinoma,+2,1	SLC30A4	25	1	0			c.C301A						PASS	.						202.0	176.0	185.0					15																	45814252		2198	4298	6496	SO:0001583	missense	7782	exon2			CTCTCTGTTTGCT		CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.301C>A	15.37:g.45814252G>T	ENSP00000261867:p.Gln101Lys	Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	143	30	0.20979	NM_013309	Q8TC39	Missense_Mutation	SNP	ENST00000261867.4	37	CCDS10125.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.312051	0.23821	.	.	ENSG00000104154	ENST00000261867	T	0.62364	0.03	5.23	5.23	0.72850	.	0.430782	0.27437	N	0.019367	T	0.44201	0.1282	N	0.12182	0.205	0.26034	N	0.981701	B	0.02656	0.0	B	0.01281	0.0	T	0.09058	-1.0692	10	0.13470	T	0.59	-0.0024	17.3837	0.87411	0.0:0.0:1.0:0.0	.	101	O14863	ZNT4_HUMAN	K	101	ENSP00000261867:Q101K	ENSP00000261867:Q101K	Q	-	1	0	SLC30A4	43601544	1.000000	0.71417	0.046000	0.18839	0.932000	0.56968	5.303000	0.65738	2.449000	0.82847	0.655000	0.94253	CAG	.	.	none		0.483	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254236.1		
AQP7	364	hgsc.bcm.edu	37	9	33385698	33385698	+	Missense_Mutation	SNP	A	A	G	rs145516206	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:33385698A>G	ENST00000537089.1	-	6	734	c.416T>C	c.(415-417)cTg>cCg	p.L139P	AQP7_ENST00000377425.4_Missense_Mutation_p.L174P|AQP7_ENST00000541274.1_Silent_p.P99P|AQP7_ENST00000539936.1_Missense_Mutation_p.L231P			O14520	AQP7_HUMAN	aquaporin 7	231					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GCGGGGGGGCAGGTCCCGGGA	0.592																																					p.L231P		Atlas-SNP	.											AQP7,colon,carcinoma,0,2	AQP7	58	2	0			c.T692C						scavenged	.						79.0	84.0	82.0					9																	33385698		2203	4300	6503	SO:0001583	missense	364	exon7			GGGGGCAGGTCCC	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.416T>C	9.37:g.33385698A>G	ENSP00000441619:p.Leu139Pro	Somatic	8	2	0.25		WXS	Illumina HiSeq	Phase_I	46	8	0.173913	NM_001170	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.	.	.	.	.	.	.	.	.	.	a	16.61	3.170083	0.57584	.	.	ENSG00000165269	ENST00000537089;ENST00000379507;ENST00000447660;ENST00000297988;ENST00000377425;ENST00000439678;ENST00000379506;ENST00000539936;ENST00000379503	D;D;D;D;D;D;D;D;D	0.89746	-2.56;-2.56;-2.56;-2.56;-2.56;-2.56;-2.56;-2.56;-2.56	5.04	5.04	0.67666	Aquaporin-like (2);	0.064929	0.64402	D	0.000009	D	0.94561	0.8248	H	0.98199	4.17	0.80722	D	1	P;B;B;B	0.41131	0.739;0.352;0.1;0.235	P;P;B;B	0.47015	0.534;0.534;0.065;0.101	D	0.95599	0.8661	10	0.62326	D	0.03	-8.1217	12.7904	0.57530	1.0:0.0:0.0:0.0	.	230;231;174;231	Q5T5M0;B7Z4U2;Q6P5T0;O14520	.;.;.;AQP7_HUMAN	P	139;230;99;231;174;139;230;231;167	ENSP00000441619:L139P;ENSP00000368821:L230P;ENSP00000412868:L99P;ENSP00000297988:L231P;ENSP00000396111:L174P;ENSP00000410138:L139P;ENSP00000368820:L230P;ENSP00000439534:L231P;ENSP00000368817:L167P	ENSP00000297988:L231P	L	-	2	0	AQP7	33375698	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	8.795000	0.91872	2.118000	0.64928	0.449000	0.29647	CTG	A|0.934;G|0.066	0.066	strong		0.592	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
OR2T8	343172	hgsc.bcm.edu	37	1	248084440	248084440	+	Missense_Mutation	SNP	T	T	G	rs111379878	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:248084440T>G	ENST00000319968.4	+	1	121	c.121T>G	c.(121-123)Tcc>Gcc	p.S41A		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S41A(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GTTTGGCAATTCCCTCATGAT	0.502													T|||	184	0.0367412	0.059	0.0274	5008	,	,		14500	0.0109		0.0249	False		,,,				2504	0.0521				p.S41A		Atlas-SNP	.											OR2T8,NS,other,0,1	OR2T8	67	1	1	Substitution - Missense(1)	pancreas(1)	c.T121G						scavenged	.						63.0	57.0	59.0					1																	248084440		2202	4280	6482	SO:0001583	missense	343172	exon1			GGCAATTCCCTCA		CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.121T>G	1.37:g.248084440T>G	ENSP00000326225:p.Ser41Ala	Somatic	433	3	0.00692841		WXS	Illumina HiSeq	Phase_I	365	13	0.0356164	NM_001005522		Missense_Mutation	SNP	ENST00000319968.4	37	CCDS31100.1	29	0.013278388278388278	20	0.04065040650406504	5	0.013812154696132596	0	0.0	4	0.005277044854881266	N	3.205	-0.162862	0.06502	.	.	ENSG00000177462	ENST00000319968	T	0.00012	9.33	3.65	-0.565	0.11771	GPCR, rhodopsin-like superfamily (1);	0.792834	0.10272	N	0.694616	T	0.00012	0.0000	N	0.10809	0.05	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13953	-1.0490	10	0.06891	T	0.86	.	0.9955	0.01465	0.2883:0.2491:0.3226:0.14	.	41	A6NH00	OR2T8_HUMAN	A	41	ENSP00000326225:S41A	ENSP00000326225:S41A	S	+	1	0	OR2T8	246151063	0.000000	0.05858	0.060000	0.19600	0.299000	0.27559	-3.158000	0.00579	-0.030000	0.13804	-0.186000	0.12905	TCC	T|0.988;G|0.012	0.012	strong		0.502	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096862.1	NM_001005522	
XPO6	23214	hgsc.bcm.edu	37	16	28187332	28187332	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:28187332G>A	ENST00000304658.5	-	4	792	c.292C>T	c.(292-294)Cac>Tac	p.H98Y	XPO6_ENST00000565698.1_Missense_Mutation_p.H84Y	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	98					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						GTTTTATGGTGAGCCAAAAGG	0.408																																					p.H98Y		Atlas-SNP	.											.	XPO6	177	.	0			c.C292T						PASS	.						90.0	83.0	85.0					16																	28187332		1864	4102	5966	SO:0001583	missense	23214	exon4			TATGGTGAGCCAA	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.292C>T	16.37:g.28187332G>A	ENSP00000302790:p.His98Tyr	Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	116	9	0.0775862	NM_015171	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	ENST00000304658.5	37	CCDS42135.1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.505413	0.64410	.	.	ENSG00000169180	ENST00000304658	T	0.44083	0.93	5.42	5.42	0.78866	Armadillo-like helical (1);Armadillo-type fold (1);	0.048798	0.85682	D	0.000000	T	0.27384	0.0672	N	0.14661	0.345	0.54753	D	0.999981	B;B	0.12630	0.006;0.006	B;B	0.16722	0.003;0.016	T	0.08994	-1.0695	10	0.11182	T	0.66	-18.2154	17.0597	0.86543	0.0:0.0:1.0:0.0	.	98;98	B7ZM10;Q96QU8	.;XPO6_HUMAN	Y	98	ENSP00000302790:H98Y	ENSP00000302790:H98Y	H	-	1	0	XPO6	28094833	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.842000	0.86851	2.698000	0.92095	0.655000	0.94253	CAC	.	.	none		0.408	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195	
FAM198B	51313	hgsc.bcm.edu	37	4	159092202	159092202	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:159092202A>G	ENST00000296530.8	-	2	947	c.326T>C	c.(325-327)aTt>aCt	p.I109T	FAM198B_ENST00000393807.5_Missense_Mutation_p.I109T|RP11-597D13.9_ENST00000505532.1_RNA|FAM198B_ENST00000592057.1_Missense_Mutation_p.I109T|FAM198B_ENST00000585682.1_Missense_Mutation_p.I109T|RP11-597D13.9_ENST00000509463.1_RNA|RP11-597D13.9_ENST00000514381.1_RNA|RP11-597D13.9_ENST00000503611.1_RNA|FAM198B_ENST00000589306.1_Intron	NM_016613.6	NP_057697.2	Q6UWH4	F198B_HUMAN	family with sequence similarity 198, member B	109						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(14)|skin(2)|urinary_tract(1)	26						GCGTAGGGTAATGTACACCAC	0.622																																					p.I109T		Atlas-SNP	.											.	FAM198B	134	.	0			c.T326C						PASS	.						80.0	78.0	79.0					4																	159092202		2203	4300	6503	SO:0001583	missense	51313	exon2			AGGGTAATGTACA		CCDS3798.1, CCDS34087.1	4q32.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000164125	ENSG00000164125			25312	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 18"""	C4orf18		12975309	Standard	NM_001031700		Approved	FLJ38155, DKFZp434L142	uc003ipr.4	Q6UWH4	OTTHUMG00000161537	ENST00000296530.8:c.326T>C	4.37:g.159092202A>G	ENSP00000296530:p.Ile109Thr	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	60	23	0.383333	NM_016613	Q498Z3|Q6IAF9|Q6ZMF2|Q86XL0	Missense_Mutation	SNP	ENST00000296530.8	37	CCDS3798.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.223908	0.79576	.	.	ENSG00000164125	ENST00000337222;ENST00000296530;ENST00000393807;ENST00000417442	T;T	0.47869	0.88;0.83	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.66886	0.2835	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.70876	-0.4753	10	0.87932	D	0	-4.8854	15.0035	0.71492	1.0:0.0:0.0:0.0	.	109;109;109	Q6UWH4-3;Q6UWH4-2;Q6UWH4	.;.;F198B_HUMAN	T	109	ENSP00000296530:I109T;ENSP00000377396:I109T	ENSP00000296530:I109T	I	-	2	0	FAM198B	159311652	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	8.113000	0.89568	2.140000	0.66376	0.533000	0.62120	ATT	.	.	none		0.622	FAM198B-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365230.1	NM_001031700, NM_016613	
PARD3	56288	hgsc.bcm.edu	37	10	34648142	34648142	+	Missense_Mutation	SNP	G	G	C	rs142553947		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:34648142G>C	ENST00000374789.3	-	14	2325	c.2000C>G	c.(1999-2001)tCt>tGt	p.S667C	PARD3_ENST00000374794.3_Missense_Mutation_p.S610C|PARD3_ENST00000350537.4_Missense_Mutation_p.S654C|PARD3_ENST00000346874.4_Missense_Mutation_p.S667C|PARD3_ENST00000545693.1_Missense_Mutation_p.S654C|PARD3_ENST00000544292.1_Missense_Mutation_p.S384C|PARD3_ENST00000374776.1_Missense_Mutation_p.S654C|PARD3_ENST00000374768.1_Missense_Mutation_p.S105C|PARD3_ENST00000545260.1_Missense_Mutation_p.S610C|PARD3_ENST00000374790.3_Missense_Mutation_p.S610C|PARD3_ENST00000340077.5_Missense_Mutation_p.S667C|PARD3_ENST00000374773.1_Missense_Mutation_p.S667C|PARD3_ENST00000374788.3_Missense_Mutation_p.S667C	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	667	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				GCCTTCAGTAGACATAGACCT	0.413																																					p.S667C		Atlas-SNP	.											.	PARD3	131	.	0			c.C2000G						PASS	.						213.0	195.0	201.0					10																	34648142		2203	4300	6503	SO:0001583	missense	56288	exon14			TCAGTAGACATAG	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.2000C>G	10.37:g.34648142G>C	ENSP00000363921:p.Ser667Cys	Somatic	372	0	0		WXS	Illumina HiSeq	Phase_I	290	69	0.237931	NM_001184792	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	37	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659053	0.88154	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773;ENST00000544292;ENST00000374768	T;T;T;T;T;T;T;T;T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25	5.74	5.74	0.90152	PDZ/DHR/GLGF (2);	0.102934	0.64402	D	0.000001	T	0.52058	0.1711	M	0.88775	2.98	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;1.0;1.0;1.0;0.999;0.998;1.0;1.0;0.999;0.999;1.0;0.999	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.997;0.984;0.996;0.997;0.996;0.998;0.998;0.972;0.955;0.998;0.999;0.989;0.954;0.999;0.989	T	0.58983	-0.7539	10	0.87932	D	0	.	19.9192	0.97079	0.0:0.0:1.0:0.0	.	610;610;654;654;654;667;667;667;610;654;667;667;654;667;384	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0;Q5VWV2;Q6IQ47;Q5VWU8;Q8TEW0-8;Q8TEW0-9;Q8TEW0-10;F5GZI3	.;.;.;.;.;.;.;PARD3_HUMAN;.;.;.;.;.;.;.	C	654;610;667;667;667;610;654;610;654;667;667;384;105	ENSP00000443147:S654C;ENSP00000440857:S610C;ENSP00000363921:S667C;ENSP00000363920:S667C;ENSP00000340591:S667C;ENSP00000363926:S610C;ENSP00000311986:S654C;ENSP00000363922:S610C;ENSP00000363908:S654C;ENSP00000341844:S667C;ENSP00000363905:S667C;ENSP00000444429:S384C;ENSP00000363900:S105C	ENSP00000341844:S667C	S	-	2	0	PARD3	34688148	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.869000	0.99810	2.719000	0.93026	0.655000	0.94253	TCT	G|1.000;C|0.000	0.000	weak		0.413	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	
LRRN3	54674	hgsc.bcm.edu	37	7	110764124	110764124	+	Silent	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:110764124A>G	ENST00000422987.3	+	2	2127	c.1296A>G	c.(1294-1296)ctA>ctG	p.L432L	IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000489381.1_Intron|LRRN3_ENST00000451085.1_Silent_p.L432L|LRRN3_ENST00000308478.5_Silent_p.L432L|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000452895.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	432	Ig-like C2-type.				positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		CTTCTAATCTAAATGTAGAAG	0.438																																					p.L432L		Atlas-SNP	.											LRRN3,caecum,carcinoma,+2,2	LRRN3	132	2	0			c.A1296G						PASS	.						111.0	118.0	115.0					7																	110764124		2203	4300	6503	SO:0001819	synonymous_variant	54674	exon2			TAATCTAAATGTA	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.1296A>G	7.37:g.110764124A>G		Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	54	13	0.240741	NM_018334	O43377|Q6I9V8|Q8IYQ6	Silent	SNP	ENST00000422987.3	37	CCDS5754.1																																																																																			.	.	none		0.438	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
BACH2	60468	hgsc.bcm.edu	37	6	90718537	90718537	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:90718537G>A	ENST00000257749.4	-	6	734	c.27C>T	c.(25-27)tcC>tcT	p.S9S	BACH2_ENST00000343122.3_Silent_p.S9S|BACH2_ENST00000537989.1_Silent_p.S9S	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	9						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CATACATGGGGGAGTCAGGCT	0.478																																					p.S9S		Atlas-SNP	.											.	BACH2	224	.	0			c.C27T						PASS	.						141.0	133.0	136.0					6																	90718537		2203	4300	6503	SO:0001819	synonymous_variant	60468	exon4			CATGGGGGAGTCA	AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.27C>T	6.37:g.90718537G>A		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	67	15	0.223881	NM_001170794	E1P518|Q59H70|Q5T793|Q9NTS5	Silent	SNP	ENST00000257749.4	37	CCDS5026.1																																																																																			.	.	none		0.478	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
ZBTB16	7704	hgsc.bcm.edu	37	11	114027086	114027086	+	Silent	SNP	C	C	T	rs148436647	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:114027086C>T	ENST00000335953.4	+	3	1676	c.1296C>T	c.(1294-1296)taC>taT	p.Y432Y	ZBTB16_ENST00000392996.2_Silent_p.Y432Y	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	432					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		TGAAGACGTACGGGTGCGAGC	0.572																																					p.Y432Y		Atlas-SNP	.											.	ZBTB16	101	.	0			c.C1296T						PASS	.	C	,	0,4402		0,0,2201	149.0	112.0	125.0		1296,1296	3.9	1.0	11	dbSNP_134	125	2,8590	2.2+/-6.3	0,2,4294	no	coding-synonymous,coding-synonymous	ZBTB16	NM_001018011.1,NM_006006.4	,	0,2,6495	TT,TC,CC		0.0233,0.0,0.0154	,	432/674,432/674	114027086	2,12992	2201	4296	6497	SO:0001819	synonymous_variant	7704	exon3			GACGTACGGGTGC	Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1296C>T	11.37:g.114027086C>T		Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	69	13	0.188406	NM_006006	Q8TAL4	Silent	SNP	ENST00000335953.4	37	CCDS8367.1																																																																																			C|1.000;T|0.000	0.000	strong		0.572	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398940.1	NM_006006	
SOCS1	8651	hgsc.bcm.edu	37	16	11348978	11348978	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:11348978C>T	ENST00000332029.2	-	2	508	c.358G>A	c.(358-360)Gcc>Acc	p.A120T	RMI2_ENST00000572173.1_Intron	NM_003745.1	NP_003736.1	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	120	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cellular response to amino acid stimulus (GO:0071230)|cytokine-mediated signaling pathway (GO:0019221)|fat cell differentiation (GO:0045444)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein phosphorylation (GO:0001932)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	insulin-like growth factor receptor binding (GO:0005159)|kinase inhibitor activity (GO:0019210)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.V117fs*93(2)|p.R107_I126del(1)|p.Y64fs*1(1)|p.K118_P123>T(1)|p.0?(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(66)|lung(3)	71						GGTCCCGAGGCCATCTTCACG	0.682			"""F, O"""		"""Hodgkin Lymphoma, PMBL"""																																p.A120T	Colon(177;456 3548 27231)	Atlas-SNP	.		Rec	yes		16	16p13.13	8651	suppressor of cytokine signaling 1		L	SOCS1,NS,lymphoid_neoplasm,+2,1	SOCS1	84	1	6	Deletion - Frameshift(3)|Whole gene deletion(1)|Complex - deletion inframe(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(6)	c.G358A						scavenged	.						17.0	19.0	18.0					16																	11348978		2190	4294	6484	SO:0001583	missense	8651	exon2			CCGAGGCCATCTT	U88326	CCDS10546.1	16p13.13	2013-02-14			ENSG00000185338	ENSG00000185338		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19383	protein-coding gene	gene with protein product		603597				7796808, 9266833	Standard	NM_003745		Approved	SOCS-1, SSI-1, JAB, TIP3, Cish1	uc002dar.1	O15524	OTTHUMG00000129792	ENST00000332029.2:c.358G>A	16.37:g.11348978C>T	ENSP00000329418:p.Ala120Thr	Somatic	38	1	0.0263158		WXS	Illumina HiSeq	Phase_I	40	8	0.2	NM_003745	O15097|Q9NSA7	Missense_Mutation	SNP	ENST00000332029.2	37	CCDS10546.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.851001	0.71719	.	.	ENSG00000185338	ENST00000332029	D	0.88509	-2.39	4.19	3.22	0.36961	SH2 motif (4);	0.585977	0.17953	N	0.156430	D	0.84474	0.5480	L	0.42686	1.345	0.44181	D	0.996992	B	0.32968	0.392	B	0.37989	0.262	T	0.77008	-0.2747	10	0.13108	T	0.6	-33.1096	12.3697	0.55248	0.1698:0.8302:0.0:0.0	.	120	O15524	SOCS1_HUMAN	T	120	ENSP00000329418:A120T	ENSP00000329418:A120T	A	-	1	0	SOCS1	11256479	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	1.808000	0.38912	0.952000	0.37798	0.561000	0.74099	GCC	.	.	none		0.682	SOCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252018.1		
HIST1H2AD	3013	hgsc.bcm.edu	37	6	26199193	26199193	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:26199193C>T	ENST00000341023.1	-	1	278	c.279G>A	c.(277-279)gaG>gaA	p.E93E	HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank|HIST1H3D_ENST00000377831.5_5'UTR	NM_021065.2	NP_066409.1	P20671	H2A1D_HUMAN	histone cluster 1, H2ad	93						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E93D(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6		all_hematologic(11;0.196)				ACTTGTTTAGCTCCTCGTCGT	0.602																																					p.E93E		Atlas-SNP	.											HIST1H2AD,NS,lymphoid_neoplasm,0,1	HIST1H2AD	20	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G279A						scavenged	.						128.0	121.0	123.0					6																	26199193		2203	4300	6503	SO:0001819	synonymous_variant	3013	exon1			GTTTAGCTCCTCG	Z80776	CCDS4591.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196866	ENSG00000196866		"""Histones / Replication-dependent"""	4729	protein-coding gene	gene with protein product		602792	"""H2A histone family, member G"", ""histone 1, H2ad"""	H2AFG		9119399, 12408966	Standard	NM_021065		Approved	H2A/g, H2A.3	uc003ngw.4	P20671	OTTHUMG00000014437	ENST00000341023.1:c.279G>A	6.37:g.26199193C>T		Somatic	259	1	0.003861		WXS	Illumina HiSeq	Phase_I	195	53	0.271795	NM_021065	A0PK91|P57754|Q6FGY6	Silent	SNP	ENST00000341023.1	37	CCDS4591.1																																																																																			.	.	none		0.602	HIST1H2AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040100.1	NM_021065	
PHC1	1911	hgsc.bcm.edu	37	12	9089488	9089488	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:9089488A>C	ENST00000543824.1	+	13	2737	c.2405A>C	c.(2404-2406)tAc>tCc	p.Y802S	PHC1_ENST00000536844.1_Missense_Mutation_p.Y408S|PHC1_ENST00000433083.2_Missense_Mutation_p.Y757S|PHC1_ENST00000544916.1_Missense_Mutation_p.Y802S			P78364	PHC1_HUMAN	polyhomeotic homolog 1 (Drosophila)	802					cellular response to retinoic acid (GO:0071300)|histone ubiquitination (GO:0016574)|multicellular organismal development (GO:0007275)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|large_intestine(8)|liver(2)|lung(3)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	27						AAGTGCGAGTACTGTGGGAAG	0.522																																					p.Y802S		Atlas-SNP	.											.	PHC1	67	.	0			c.A2405C						PASS	.						97.0	83.0	88.0					12																	9089488		2203	4300	6503	SO:0001583	missense	1911	exon12			GCGAGTACTGTGG	U89277	CCDS8597.1	12p13	2013-01-10	2006-09-12	2002-11-15	ENSG00000111752	ENSG00000111752		"""Sterile alpha motif (SAM) domain containing"""	3182	protein-coding gene	gene with protein product		602978	"""early development regulator 1 (homolog of polyhomeotic 1)"", ""polyhomeotic-like 1 (Drosophila)"""	EDR1		9121482	Standard	XM_005253334		Approved	HPH1, RAE28	uc001qvd.3	P78364	OTTHUMG00000168275	ENST00000543824.1:c.2405A>C	12.37:g.9089488A>C	ENSP00000440674:p.Tyr802Ser	Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	101	18	0.178218	NM_004426	D3DUV4|Q8WVM3|Q9BU63	Missense_Mutation	SNP	ENST00000543824.1	37	CCDS8597.1	.	.	.	.	.	.	.	.	.	.	A	17.29	3.353101	0.61293	.	.	ENSG00000111752	ENST00000543824;ENST00000251757;ENST00000433083;ENST00000544916;ENST00000536844	T;T;T;T;T	0.48201	1.78;1.78;1.75;1.78;0.82	5.03	5.03	0.67393	Zinc finger, FCS-type (1);Zinc finger, MYM-type (1);	0.181694	0.38897	N	0.001525	T	0.51261	0.1664	L	0.33485	1.01	0.80722	D	1	D	0.63046	0.992	P	0.59357	0.856	T	0.52786	-0.8529	10	0.56958	D	0.05	-11.3051	10.5323	0.44983	0.8553:0.0:0.0:0.1447	.	802	P78364	PHC1_HUMAN	S	802;802;757;802;408	ENSP00000440674:Y802S;ENSP00000251757:Y802S;ENSP00000399194:Y757S;ENSP00000437659:Y802S;ENSP00000440488:Y408S	ENSP00000251757:Y802S	Y	+	2	0	PHC1	8980755	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.484000	0.66844	2.114000	0.64651	0.459000	0.35465	TAC	.	.	none		0.522	PHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399115.1	NM_004426	
TAPT1	202018	hgsc.bcm.edu	37	4	16168278	16168278	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:16168278C>T	ENST00000405303.2	-	13	1535	c.1452G>A	c.(1450-1452)caG>caA	p.Q484Q	TAPT1_ENST00000304584.8_3'UTR|TAPT1_ENST00000399920.3_Silent_p.Q373Q	NM_153365.2	NP_699196.2	Q6NXT6	TAPT1_HUMAN	transmembrane anterior posterior transformation 1	484					embryonic skeletal system development (GO:0048706)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|post-embryonic development (GO:0009791)	integral component of membrane (GO:0016021)	growth hormone-releasing hormone receptor activity (GO:0016520)			NS(1)|breast(2)|cervix(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)	10						TACATTTGTTCTGTGATTTAC	0.453																																					p.Q484Q		Atlas-SNP	.											.	TAPT1	31	.	0			c.G1452A						PASS	.						182.0	196.0	191.0					4																	16168278		1980	4169	6149	SO:0001819	synonymous_variant	202018	exon13			TTTGTTCTGTGAT	AK074494	CCDS47030.1	4p15.32	2014-01-28			ENSG00000169762	ENSG00000169762			26887	protein-coding gene	gene with protein product		612758				12477932	Standard	NM_153365		Approved	FLJ90013	uc010ied.1	Q6NXT6	OTTHUMG00000160177	ENST00000405303.2:c.1452G>A	4.37:g.16168278C>T		Somatic	200	0	0		WXS	Illumina HiSeq	Phase_I	146	64	0.438356	NM_153365	Q8N2S3|Q9NZK9	Silent	SNP	ENST00000405303.2	37	CCDS47030.1																																																																																			.	.	none		0.453	TAPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359568.1	NM_153365	
PXDN	7837	hgsc.bcm.edu	37	2	1652954	1652954	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:1652954G>T	ENST00000252804.4	-	17	2648	c.2598C>A	c.(2596-2598)gaC>gaA	p.D866E		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	866					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		TGGCCCGGGAGTCATTGGGGG	0.657																																					p.D866E		Atlas-SNP	.											.	PXDN	255	.	0			c.C2598A						PASS	.						16.0	19.0	18.0					2																	1652954		2106	4209	6315	SO:0001583	missense	7837	exon17			CCGGGAGTCATTG	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2598C>A	2.37:g.1652954G>T	ENSP00000252804:p.Asp866Glu	Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	51	19	0.372549	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	G	18.43	3.622388	0.66787	.	.	ENSG00000130508	ENST00000252804	D	0.84800	-1.9	5.36	4.47	0.54385	.	0.000000	0.85682	D	0.000000	D	0.93609	0.7959	H	0.94222	3.51	0.53005	D	0.999969	D	0.71674	0.998	D	0.75484	0.986	D	0.94094	0.7356	10	0.66056	D	0.02	-61.9551	10.546	0.45060	0.172:0.0:0.828:0.0	.	866	Q92626	PXDN_HUMAN	E	866	ENSP00000252804:D866E	ENSP00000252804:D866E	D	-	3	2	PXDN	1631961	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	4.692000	0.61746	1.376000	0.46267	0.558000	0.71614	GAC	.	.	none		0.657	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
MAST4	375449	hgsc.bcm.edu	37	5	66462503	66462503	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:66462503A>T	ENST00000403625.2	+	29	7791	c.7496A>T	c.(7495-7497)aAc>aTc	p.N2499I	MAST4_ENST00000405643.1_Missense_Mutation_p.N2320I|MAST4_ENST00000261569.7_Missense_Mutation_p.N2305I|MAST4_ENST00000403666.1_Missense_Mutation_p.N2310I|MAST4_ENST00000404260.3_Missense_Mutation_p.N2502I	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	2502						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		GCCCCCAGCAACAGGGACCAT	0.657											OREG0016638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N2499I		Atlas-SNP	.											.	MAST4	218	.	0			c.A7496T						PASS	.						17.0	24.0	22.0					5																	66462503		1957	4169	6126	SO:0001583	missense	375449	exon29			CCAGCAACAGGGA	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.7496A>T	5.37:g.66462503A>T	ENSP00000385727:p.Asn2499Ile	Somatic	108	0	0	1092	WXS	Illumina HiSeq	Phase_I	128	31	0.242188	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	37	CCDS54861.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.02|15.02	2.708585|2.708585	0.48517|0.48517	.|.	.|.	ENSG00000069020|ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569|ENST00000443808	T;T;T;T;T|.	0.64260|.	-0.06;-0.06;-0.09;-0.08;-0.06|.	4.64|4.64	-8.76|-8.76	0.00830|0.00830	.|.	1.480450|.	0.03942|.	N|.	0.287123|.	T|T	0.25005|0.25005	0.0607|0.0607	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B|.	0.26483|.	0.092;0.15|.	B;B|.	0.26614|.	0.032;0.071|.	T|T	0.34054|0.34054	-0.9844|-0.9844	10|5	0.36615|.	T|.	0.2|.	-1.2165|-1.2165	11.4774|11.4774	0.50306|0.50306	0.1289:0.3279:0.5432:0.0|0.1289:0.3279:0.5432:0.0	.|.	2502;2310|.	O15021;O15021-3|.	MAST4_HUMAN;.|.	I|H	2502;2499;2310;2320;2320;2305|1555	ENSP00000385048:N2502I;ENSP00000385727:N2499I;ENSP00000384313:N2310I;ENSP00000384099:N2320I;ENSP00000261569:N2305I|.	ENSP00000261569:N2305I|.	N|Q	+|+	2|3	0|2	MAST4|MAST4	66498259|66498259	0.000000|0.000000	0.05858|0.05858	0.138000|0.138000	0.22173|0.22173	0.228000|0.228000	0.25075|0.25075	-1.297000|-1.297000	0.02759|0.02759	-1.305000|-1.305000	0.02327|0.02327	0.379000|0.379000	0.24179|0.24179	AAC|CAA	.	.	none		0.657	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
HCN1	348980	hgsc.bcm.edu	37	5	45262330	45262330	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:45262330G>C	ENST00000303230.4	-	8	2423	c.2366C>G	c.(2365-2367)tCg>tGg	p.S789W		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	789				S -> W (in Ref. 2; AAC39759). {ECO:0000305}.	apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.S789L(1)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						CGAGGGCTGCGAGGCGGAGAG	0.627																																					p.S789W		Atlas-SNP	.											HCN1,NS,carcinoma,0,2	HCN1	298	2	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C2366G						PASS	.						64.0	61.0	62.0					5																	45262330		2203	4300	6503	SO:0001583	missense	348980	exon8			GGCTGCGAGGCGG	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2366C>G	5.37:g.45262330G>C	ENSP00000307342:p.Ser789Trp	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	88	28	0.318182	NM_021072		Missense_Mutation	SNP	ENST00000303230.4	37	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431846	0.62844	.	.	ENSG00000164588	ENST00000303230	T	0.77620	-1.11	5.02	5.02	0.67125	.	0.000000	0.56097	D	0.000034	D	0.82898	0.5137	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.70716	0.97	D	0.84674	0.0713	10	0.62326	D	0.03	.	18.7131	0.91666	0.0:0.0:1.0:0.0	.	789	O60741	HCN1_HUMAN	W	789	ENSP00000307342:S789W	ENSP00000307342:S789W	S	-	2	0	HCN1	45298087	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.689000	0.98673	2.491000	0.84063	0.655000	0.94253	TCG	.	.	none		0.627	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
FGFR4	2264	hgsc.bcm.edu	37	5	176516652	176516652	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:176516652C>T	ENST00000292408.4	+	2	294	c.49C>T	c.(49-51)Cct>Tct	p.P17S	FGFR4_ENST00000507708.1_3'UTR|FGFR4_ENST00000393637.1_Missense_Mutation_p.P17S|FGFR4_ENST00000502906.1_Missense_Mutation_p.P17S|FGFR4_ENST00000393648.2_Missense_Mutation_p.P17S|FGFR4_ENST00000292410.3_Missense_Mutation_p.P17S	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	17					alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	TGTGCCTGGGCCTCCAGTCTT	0.632										TSP Lung(9;0.080)																											p.P17S		Atlas-SNP	.											.	FGFR4	174	.	0			c.C49T						PASS	.						62.0	57.0	58.0					5																	176516652		2203	4300	6503	SO:0001583	missense	2264	exon1			CCTGGGCCTCCAG	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.49C>T	5.37:g.176516652C>T	ENSP00000292408:p.Pro17Ser	Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	159	76	0.477987	NM_022963	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	ENST00000292408.4	37	CCDS4410.1	.	.	.	.	.	.	.	.	.	.	C	0.067	-1.210794	0.01555	.	.	ENSG00000160867	ENST00000292408;ENST00000503708;ENST00000393648;ENST00000514472;ENST00000502906;ENST00000292410;ENST00000510911;ENST00000513166;ENST00000393637	T;T;T;D;T;T;T;D;T	0.87966	-1.06;-0.77;-1.02;-2.32;-1.06;-1.07;1.04;-2.25;-1.07	4.26	-0.824	0.10812	.	.	.	.	.	T	0.70954	0.3283	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.0;0.0;0.001;0.0	T	0.57033	-0.7880	9	0.42905	T	0.14	.	1.7718	0.03013	0.1123:0.1673:0.312:0.4083	.	17;17;17;17;17	B5A965;B4DVP5;P22455-2;E7EWF4;P22455	.;.;.;.;FGFR4_HUMAN	S	17	ENSP00000292408:P17S;ENSP00000424905:P17S;ENSP00000377259:P17S;ENSP00000426492:P17S;ENSP00000424960:P17S;ENSP00000292410:P17S;ENSP00000427222:P17S;ENSP00000422889:P17S;ENSP00000377254:P17S	ENSP00000292408:P17S	P	+	1	0	FGFR4	176449258	0.462000	0.25791	0.417000	0.26559	0.235000	0.25334	0.500000	0.22562	0.049000	0.15920	-0.479000	0.04858	CCT	.	.	none		0.632	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1		
TLR4	7099	hgsc.bcm.edu	37	9	120476234	120476234	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:120476234G>T	ENST00000355622.6	+	3	1929	c.1828G>T	c.(1828-1830)Gca>Tca	p.A610S	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.A570S	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	610	LRRCT.				activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	AATGGAATGTGCAACACCTTC	0.463																																					p.A610S		Atlas-SNP	.											.	TLR4	220	.	0			c.G1828T						PASS	.						154.0	131.0	139.0					9																	120476234		2203	4300	6503	SO:0001583	missense	7099	exon3			GAATGTGCAACAC	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1828G>T	9.37:g.120476234G>T	ENSP00000363089:p.Ala610Ser	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	86	20	0.232558	NM_138554	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	G	5.591	0.293758	0.10567	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.35421	1.58;1.31	6.02	-1.48	0.08745	Cysteine-rich flanking region, C-terminal (1);	1.168330	0.06040	N	0.654752	T	0.28699	0.0711	L	0.49350	1.555	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.32877	-0.9890	10	0.09084	T	0.74	.	8.608	0.33784	0.4529:0.1351:0.4121:0.0	.	610	O00206	TLR4_HUMAN	S	570;610	ENSP00000377997:A570S;ENSP00000363089:A610S	ENSP00000363089:A610S	A	+	1	0	TLR4	119516055	0.000000	0.05858	0.002000	0.10522	0.036000	0.12997	-0.510000	0.06328	-0.155000	0.11098	0.650000	0.86243	GCA	.	.	none		0.463	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554	
PIM2	11040	hgsc.bcm.edu	37	X	48775891	48775891	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chrX:48775891C>G	ENST00000376509.4	-	2	282	c.93G>C	c.(91-93)gaG>gaC	p.E31D		NM_006875.3	NP_006866.2	Q9P1W9	PIM2_HUMAN	Pim-2 proto-oncogene, serine/threonine kinase	31					apoptotic mitochondrial changes (GO:0008637)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|response to virus (GO:0009615)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			lung(3)|stomach(1)	4						CGAGTCGATACTCGGCCTCGA	0.667																																					p.E31D		Atlas-SNP	.											.	PIM2	31	.	0			c.G93C						PASS	.						35.0	32.0	33.0					X																	48775891		2202	4300	6502	SO:0001583	missense	11040	exon2			TCGATACTCGGCC	U77735	CCDS14312.1	Xp11.23	2014-06-25	2014-06-25		ENSG00000102096	ENSG00000102096			8987	protein-coding gene	gene with protein product		300295	"""pim-2 oncogene"""			9804974	Standard	NM_006875		Approved		uc004dls.3	Q9P1W9	OTTHUMG00000024132	ENST00000376509.4:c.93G>C	X.37:g.48775891C>G	ENSP00000365692:p.Glu31Asp	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	109	85	0.779817	NM_006875	A8K4G6|Q99739	Missense_Mutation	SNP	ENST00000376509.4	37	CCDS14312.1	.	.	.	.	.	.	.	.	.	.	C	8.849	0.944106	0.18281	.	.	ENSG00000102096	ENST00000376509	T	0.12569	2.67	3.9	-1.03	0.10102	Protein kinase-like domain (1);	0.277470	0.28989	N	0.013499	T	0.06645	0.0170	N	0.19112	0.55	0.28880	N	0.894448	B	0.18968	0.032	B	0.15484	0.013	T	0.39292	-0.9621	10	0.15952	T	0.53	.	8.1126	0.30924	0.0:0.4588:0.0:0.5412	.	31	Q9P1W9	PIM2_HUMAN	D	31	ENSP00000365692:E31D	ENSP00000365692:E31D	E	-	3	2	PIM2	48660835	0.001000	0.12720	0.982000	0.44146	0.965000	0.64279	-1.883000	0.01623	-0.398000	0.07679	0.544000	0.68410	GAG	.	.	none		0.667	PIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060805.1		
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305785	39305785	+	Missense_Mutation	SNP	A	A	T	rs411367		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:39305785A>T	ENST00000343246.4	-	1	269	c.235T>A	c.(235-237)Tgc>Agc	p.C79S		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	79	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			tggcagcagcaggggcggcag	0.657																																					p.C79S		Atlas-SNP	.											KRTAP4-5,colon,carcinoma,0,3	KRTAP4-5	34	3	0			c.T235A						scavenged	.						12.0	18.0	16.0					17																	39305785		2089	4172	6261	SO:0001583	missense	85289	exon1			AGCAGCAGGGGCG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.235T>A	17.37:g.39305785A>T	ENSP00000340546:p.Cys79Ser	Somatic	43	1	0.0232558		WXS	Illumina HiSeq	Phase_I	32	9	0.28125	NM_033188		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	773	0.35393772893772896	210	0.4268292682926829	126	0.34806629834254144	175	0.30594405594405594	262	0.34564643799472294	.	0.010	-1.763522	0.00651	.	.	ENSG00000198271	ENST00000343246	T	0.00534	6.74	2.78	-5.56	0.02529	.	0.768893	0.10092	N	0.717076	T	0.00012	0.0000	N	0.01431	-0.87	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.23297	-1.0192	9	0.02654	T	1	.	5.4481	0.16548	0.6146:0.0:0.1542:0.2312	rs411367;rs6503604	79	Q9BYR2	KRA45_HUMAN	S	79	ENSP00000340546:C79S	ENSP00000340546:C79S	C	-	1	0	KRTAP4-5	36559311	0.977000	0.34250	0.000000	0.03702	0.000000	0.00434	-0.260000	0.08708	-1.272000	0.02427	-2.057000	0.00402	TGC	A|0.646;T|0.354	0.354	strong		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
KIF2B	84643	hgsc.bcm.edu	37	17	51900705	51900705	+	Missense_Mutation	SNP	C	C	T	rs371085430		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:51900705C>T	ENST00000268919.4	+	1	467	c.311C>T	c.(310-312)tCg>tTg	p.S104L		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	104					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GCGCCCTCTTCGGCCATCAGG	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		15275	0.001		0.0	False		,,,				2504	0.0				p.S104L		Atlas-SNP	.											KIF2B,NS,carcinoma,-1,2	KIF2B	254	2	0			c.C311T						scavenged	.	C	LEU/SER	0,4406		0,0,2203	89.0	98.0	95.0		311	2.9	0.0	17		95	1,8599	1.2+/-3.3	0,1,4299	no	missense	KIF2B	NM_032559.4	145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	104/674	51900705	1,13005	2203	4300	6503	SO:0001583	missense	84643	exon1			CCTCTTCGGCCAT	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.311C>T	17.37:g.51900705C>T	ENSP00000268919:p.Ser104Leu	Somatic	62	1	0.016129		WXS	Illumina HiSeq	Phase_I	47	12	0.255319	NM_032559	Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	37	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	C	2.386	-0.340855	0.05243	0.0	1.16E-4	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.74106	-0.81	4.96	2.93	0.34026	.	1.236910	0.06126	U	0.669728	T	0.64605	0.2613	L	0.49778	1.585	0.09310	N	1	P	0.37731	0.607	B	0.29785	0.107	T	0.49844	-0.8896	10	0.23891	T	0.37	.	7.475	0.27371	0.1646:0.7497:0.0:0.0857	.	104	Q8N4N8	KIF2B_HUMAN	L	104;27	ENSP00000268919:S104L	ENSP00000268919:S104L	S	+	2	0	KIF2B	49255704	0.004000	0.15560	0.001000	0.08648	0.003000	0.03518	1.901000	0.39838	0.763000	0.33175	0.655000	0.94253	TCG	.	.	weak		0.612	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559	
PTPRD	5789	hgsc.bcm.edu	37	9	8504278	8504278	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:8504278G>A	ENST00000381196.4	-	20	2348	c.1805C>T	c.(1804-1806)gCt>gTt	p.A602V	PTPRD_ENST00000397611.3_Missense_Mutation_p.A599V|PTPRD_ENST00000397606.3_Missense_Mutation_p.A592V|PTPRD_ENST00000486161.1_Missense_Mutation_p.A602V|PTPRD_ENST00000356435.5_Missense_Mutation_p.A602V|PTPRD_ENST00000540109.1_Missense_Mutation_p.A602V|PTPRD_ENST00000360074.4_Missense_Mutation_p.A589V|PTPRD_ENST00000537002.1_Missense_Mutation_p.A599V|PTPRD_ENST00000397617.3_Missense_Mutation_p.A592V|PTPRD_ENST00000358503.5_Missense_Mutation_p.A589V|PTPRD_ENST00000355233.5_Missense_Mutation_p.A602V	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	602	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CATGGTTCTAGCTGATATTTC	0.458										TSP Lung(15;0.13)																											p.A602V		Atlas-SNP	.											.	PTPRD	1348	.	0			c.C1805T						PASS	.						194.0	175.0	181.0					9																	8504278		2203	4300	6503	SO:0001583	missense	5789	exon12			GTTCTAGCTGATA	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1805C>T	9.37:g.8504278G>A	ENSP00000370593:p.Ala602Val	Somatic	177	0	0		WXS	Illumina HiSeq	Phase_I	192	12	0.0625	NM_130392	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.395997	0.25205	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.72;0.72;0.72;0.72;0.68;0.72;0.72	5.53	5.53	0.82687	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.35595	0.0937	N	0.16368	0.405	0.50171	D	0.999852	B;B;B;B;B;B;B;B;B	0.33212	0.01;0.029;0.402;0.104;0.022;0.041;0.073;0.047;0.02	B;B;B;B;B;B;B;B;B	0.33690	0.027;0.046;0.168;0.04;0.086;0.087;0.057;0.036;0.012	T	0.11012	-1.0605	9	.	.	.	.	19.4728	0.94969	0.0:0.0:1.0:0.0	.	592;596;602;602;599;599;589;602;602	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	V	602;602;589;589;602;592;599;599;602;602;602;592	ENSP00000370593:A602V;ENSP00000348812:A602V;ENSP00000353187:A589V;ENSP00000351293:A589V;ENSP00000347373:A602V;ENSP00000380741:A592V;ENSP00000380735:A599V;ENSP00000440515:A599V;ENSP00000438164:A602V;ENSP00000417093:A602V;ENSP00000380731:A592V	.	A	-	2	0	PTPRD	8494278	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.324000	0.65863	2.602000	0.87976	0.467000	0.42956	GCT	.	.	none		0.458	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
IRF8	3394	hgsc.bcm.edu	37	16	85942775	85942775	+	Silent	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:85942775A>G	ENST00000268638.5	+	3	776	c.354A>G	c.(352-354)caA>caG	p.Q118Q	IRF8_ENST00000563180.1_Silent_p.Q118Q	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	118					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				AGGAAGAGCAAAAATGTAACT	0.493																																					p.Q118Q		Atlas-SNP	.											.	IRF8	65	.	0			c.A354G						PASS	.						48.0	47.0	47.0					16																	85942775		2198	4300	6498	SO:0001819	synonymous_variant	3394	exon3			AGAGCAAAAATGT	M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.354A>G	16.37:g.85942775A>G		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	75	27	0.36	NM_002163	A0AV82	Silent	SNP	ENST00000268638.5	37	CCDS10956.1																																																																																			.	.	none		0.493	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	NM_002163	
VCPKMT	79609	hgsc.bcm.edu	37	14	50583173	50583173	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr14:50583173T>C	ENST00000395860.2	-	1	102	c.98A>G	c.(97-99)tAt>tGt	p.Y33C	VCPKMT_ENST00000395859.2_Missense_Mutation_p.Y33C	NM_024558.2	NP_078834.2	Q9H867	MT21D_HUMAN	valosin containing protein lysine (K) methyltransferase	33					peptidyl-lysine trimethylation (GO:0018023)	cytoplasm (GO:0005737)	protein-lysine N-methyltransferase activity (GO:0016279)										ACCGGAGCTATACTGCTGTAG	0.592																																					p.Y33C		Atlas-SNP	.											.	METTL21D	11	.	0			c.A98G						PASS	.						60.0	64.0	63.0					14																	50583173		2203	4300	6503	SO:0001583	missense	79609	exon1			GAGCTATACTGCT	AK023982	CCDS9696.2, CCDS41951.1	14q21.3	2013-09-30	2013-09-30	2013-09-30	ENSG00000100483	ENSG00000100483			20352	protein-coding gene	gene with protein product		615260	"""chromosome 14 open reading frame 138"", ""methyltransferase like 21D"""	C14orf138, METTL21D		22948820	Standard	NR_049738		Approved	VCP-KMT	uc001wxo.1	Q9H867	OTTHUMG00000029531	ENST00000395860.2:c.98A>G	14.37:g.50583173T>C	ENSP00000379201:p.Tyr33Cys	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	40	14	0.35	NM_024558	B7ZLA3|B7ZLA4|Q2M2X3|Q86T12	Missense_Mutation	SNP	ENST00000395860.2	37	CCDS9696.2	.	.	.	.	.	.	.	.	.	.	T	14.64	2.595533	0.46318	.	.	ENSG00000100483	ENST00000395859;ENST00000395860	T;T	0.06528	3.29;3.29	6.06	6.06	0.98353	.	0.404301	0.27821	N	0.017709	T	0.03263	0.0095	N	0.05414	-0.055	0.35578	D	0.806016	B;B	0.11235	0.004;0.001	B;B	0.06405	0.002;0.002	T	0.39313	-0.9620	10	0.38643	T	0.18	-3.7456	4.4545	0.11637	0.1689:0.1059:0.0:0.7251	.	33;33	B7ZLA4;Q9H867	.;MT21D_HUMAN	C	33	ENSP00000379200:Y33C;ENSP00000379201:Y33C	ENSP00000379200:Y33C	Y	-	2	0	METTL21D	49652923	0.996000	0.38824	0.966000	0.40874	0.953000	0.61014	3.034000	0.49751	2.323000	0.78572	0.528000	0.53228	TAT	.	.	none		0.592	VCPKMT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276877.1	NM_024558	
CDAN1	146059	hgsc.bcm.edu	37	15	43022925	43022925	+	Missense_Mutation	SNP	C	C	T	rs201057681	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:43022925C>T	ENST00000356231.3	-	14	2068	c.2045G>A	c.(2044-2046)cGa>cAa	p.R682Q		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	682					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R682Q(1)		endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		CTGCAGCCCTCGCTGCAGCAG	0.637													C|||	2	0.000399361	0.0008	0.0	5008	,	,		17535	0.001		0.0	False		,,,				2504	0.0				p.R682Q		Atlas-SNP	.											CDAN1,bladder,carcinoma,0,1	CDAN1	70	1	1	Substitution - Missense(1)	urinary_tract(1)	c.G2045A						scavenged	.	C	GLN/ARG	0,4396		0,0,2198	19.0	22.0	21.0		2045	4.7	1.0	15		21	1,8571		0,1,4285	no	missense	CDAN1	NM_138477.2	43	0,1,6483	TT,TC,CC		0.0117,0.0,0.0077	benign	682/1228	43022925	1,12967	2198	4286	6484	SO:0001583	missense	146059	exon14			AGCCCTCGCTGCA	AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.2045G>A	15.37:g.43022925C>T	ENSP00000348564:p.Arg682Gln	Somatic	71	1	0.0140845		WXS	Illumina HiSeq	Phase_I	65	21	0.323077	NM_138477	Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	ENST00000356231.3	37	CCDS32209.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	7.674	0.687680	0.14973	0.0	1.17E-4	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.89343	-2.5	5.77	4.66	0.58398	.	0.414368	0.29053	N	0.013297	T	0.73087	0.3542	N	0.11651	0.15	0.27851	N	0.940738	B	0.06786	0.001	B	0.06405	0.002	T	0.57751	-0.7757	10	0.02654	T	1	-7.5903	8.3942	0.32546	0.0:0.2218:0.0:0.7782	.	682	Q8IWY9	CDAN1_HUMAN	Q	682;680	ENSP00000348564:R682Q	ENSP00000267892:R680Q	R	-	2	0	CDAN1	40810217	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	0.741000	0.26202	1.022000	0.39626	-0.302000	0.09304	CGA	C|1.000;T|0.000	0.000	strong		0.637	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1	XM_085300	
PGK2	5232	hgsc.bcm.edu	37	6	49754100	49754100	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:49754100T>G	ENST00000304801.3	-	1	953	c.801A>C	c.(799-801)aaA>aaC	p.K267N		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	267					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					CCATGATATCTTTAACGATCT	0.418																																					p.K267N		Atlas-SNP	.											.	PGK2	87	.	0			c.A801C						PASS	.						135.0	128.0	130.0					6																	49754100		2203	4300	6503	SO:0001583	missense	5232	exon1			GATATCTTTAACG	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.801A>C	6.37:g.49754100T>G	ENSP00000305995:p.Lys267Asn	Somatic	206	0	0		WXS	Illumina HiSeq	Phase_I	186	56	0.301075	NM_138733	B2R6Y8|Q9H107	Missense_Mutation	SNP	ENST00000304801.3	37	CCDS4930.1	.	.	.	.	.	.	.	.	.	.	T	2.954	-0.216024	0.06101	.	.	ENSG00000170950	ENST00000304801	D	0.92495	-3.05	4.09	-6.89	0.01660	Phosphoglycerate kinase, C-terminal (1);	0.232879	0.49916	N	0.000136	T	0.67841	0.2936	L	0.38531	1.155	0.38455	D	0.947053	B	0.06786	0.001	B	0.08055	0.003	T	0.39860	-0.9593	10	0.31617	T	0.26	-0.3183	1.399	0.02267	0.3607:0.3258:0.1225:0.1911	.	267	P07205	PGK2_HUMAN	N	267	ENSP00000305995:K267N	ENSP00000305995:K267N	K	-	3	2	PGK2	49862059	0.831000	0.29352	0.519000	0.27824	0.334000	0.28698	-0.119000	0.10676	-1.401000	0.02058	0.477000	0.44152	AAA	.	.	none		0.418	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1		
CALCA	796	hgsc.bcm.edu	37	11	14989251	14989251	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:14989251A>C	ENST00000486207.1	-	3	385	c.377T>G	c.(376-378)cTt>cGt	p.L126R	CALCA_ENST00000361010.3_Missense_Mutation_p.L126R|CALCB_ENST00000523376.1_Intron			P06881	CALCA_HUMAN	calcitonin-related polypeptide alpha	126					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|cytosolic calcium ion homeostasis (GO:0051480)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor internalization (GO:0002031)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of blood pressure (GO:0045776)|negative regulation of bone resorption (GO:0045779)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of osteoclast differentiation (GO:0045671)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of vasodilation (GO:0045909)|protein phosphorylation (GO:0006468)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	protein complex binding (GO:0032403)|receptor binding (GO:0005102)			central_nervous_system(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	8						TCAGGCTTGAAGGTCCCTGCG	0.537																																					p.L126R		Atlas-SNP	.											.	CALCA	30	.	0			c.T377G						PASS	.						61.0	58.0	59.0					11																	14989251		2200	4294	6494	SO:0001583	missense	796	exon4			GCTTGAAGGTCCC	X00356, M64486	CCDS7819.1, CCDS31432.1	11p15.2	2014-09-17	2008-02-20		ENSG00000110680	ENSG00000110680		"""Endogenous ligands"""	1437	protein-coding gene	gene with protein product	"""calcitonin"""	114130	"""calcitonin 1"""	CALC1		6546550	Standard	NM_001033953		Approved		uc001mlw.1	P01258	OTTHUMG00000159731	ENST00000486207.1:c.377T>G	11.37:g.14989251A>C	ENSP00000417833:p.Leu126Arg	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	52	10	0.192308	NM_001033953	Q93048|Q9UCP0	Missense_Mutation	SNP	ENST00000486207.1	37	CCDS31432.1	.	.	.	.	.	.	.	.	.	.	A	18.40	3.615604	0.66672	.	.	ENSG00000110680	ENST00000486207;ENST00000361010	T;T	0.32515	1.45;1.45	4.65	3.5	0.40072	.	.	.	.	.	T	0.54240	0.1846	M	0.78916	2.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.58707	-0.7589	9	0.72032	D	0.01	.	11.7799	0.52008	0.8182:0.1818:0.0:0.0	.	126	P06881	CALCA_HUMAN	R	126	ENSP00000417833:L126R;ENSP00000354286:L126R	ENSP00000354286:L126R	L	-	2	0	CALCA	14945827	0.889000	0.30405	0.186000	0.23195	0.179000	0.23085	1.028000	0.30128	1.033000	0.39918	0.533000	0.62120	CTT	.	.	none		0.537	CALCA-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357068.1	NM_001741	
PTPN2	5771	hgsc.bcm.edu	37	18	12884137	12884137	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr18:12884137G>A	ENST00000309660.5	-	1	97	c.4C>T	c.(4-6)Ccc>Tcc	p.P2S	PTPN2_ENST00000591115.1_Missense_Mutation_p.P2S|PTPN2_ENST00000353319.4_Missense_Mutation_p.P2S|PTPN2_ENST00000327283.3_Missense_Mutation_p.P2S	NM_002828.3	NP_002819.2	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type 2	2					B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|erythrocyte differentiation (GO:0030218)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemotaxis (GO:0050922)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of interleukin-2-mediated signaling pathway (GO:1902206)|negative regulation of interleukin-4-mediated signaling pathway (GO:1902215)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage colony-stimulating factor signaling pathway (GO:1902227)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of positive thymic T cell selection (GO:1902233)|negative regulation of prolactin signaling pathway (GO:1902212)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|negative regulation of tyrosine phosphorylation of Stat1 protein (GO:0042512)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|negative regulation of tyrosine phosphorylation of Stat6 protein (GO:0042527)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of gluconeogenesis (GO:0045722)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|syntaxin binding (GO:0019905)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)|skin(3)	13		Lung NSC(161;8.94e-06)				ATGGTGGTGGGCATGGCTGCG	0.711																																					p.P2S		Atlas-SNP	.											.	PTPN2	37	.	0			c.C4T						PASS	.						17.0	15.0	15.0					18																	12884137		2178	4288	6466	SO:0001583	missense	5771	exon1			TGGTGGGCATGGC	M25393	CCDS11863.1, CCDS11864.1, CCDS11865.1, CCDS59306.1	18p11.3-p11.2	2011-06-09			ENSG00000175354	ENSG00000175354		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9650	protein-coding gene	gene with protein product		176887		PTPT		2164224	Standard	NM_002828		Approved	TCELLPTP, TC-PTP, TCPTP	uc002krp.3	P17706	OTTHUMG00000131702	ENST00000309660.5:c.4C>T	18.37:g.12884137G>A	ENSP00000311857:p.Pro2Ser	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	80	15	0.1875	NM_001207013	A8K955|A8MXU3|K7ENG3|Q96AU5|Q96HR2	Missense_Mutation	SNP	ENST00000309660.5	37	CCDS11865.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.685979	0.00738	.	.	ENSG00000175354	ENST00000327283;ENST00000353319;ENST00000309660	T;T;T	0.04049	3.73;3.74;3.72	3.74	0.301	0.15781	.	0.171955	0.27577	N	0.018760	T	0.01254	0.0041	N	0.02011	-0.69	0.20975	N	0.999813	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.44605	-0.9317	10	0.02654	T	1	.	3.1224	0.06396	0.5705:0.2244:0.2051:0.0	.	2;2;2;2	P17706;P17706-2;Q96AU5;A8K3N4	PTN2_HUMAN;.;.;.	S	2	ENSP00000320298:P2S;ENSP00000320546:P2S;ENSP00000311857:P2S	ENSP00000311857:P2S	P	-	1	0	PTPN2	12874137	0.989000	0.36119	0.526000	0.27913	0.038000	0.13279	0.352000	0.20113	-0.103000	0.12175	0.306000	0.20318	CCC	.	.	none		0.711	PTPN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254613.3	NM_002828, NM_080422, NM_080423	
DTL	51514	hgsc.bcm.edu	37	1	212218054	212218054	+	Silent	SNP	A	A	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:212218054A>C	ENST00000366991.4	+	3	545	c.231A>C	c.(229-231)cgA>cgC	p.R77R	DTL_ENST00000542077.1_Silent_p.R35R|DTL_ENST00000475419.1_3'UTR	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)	77					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		GCTTTGTTCGATTGTATAACA	0.303																																					p.R77R		Atlas-SNP	.											DTL,colon,carcinoma,+1,3	DTL	52	3	0			c.A231C						PASS	.						70.0	72.0	72.0					1																	212218054		2203	4300	6503	SO:0001819	synonymous_variant	51514	exon3			TGTTCGATTGTAT	AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.231A>C	1.37:g.212218054A>C		Somatic	724	0	0		WXS	Illumina HiSeq	Phase_I	584	66	0.113014	NM_016448	A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Silent	SNP	ENST00000366991.4	37	CCDS1502.1																																																																																			.	.	none		0.303	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090182.1	NM_016448	
SPAG5	10615	hgsc.bcm.edu	37	17	26919738	26919738	+	Missense_Mutation	SNP	G	G	A	rs149403082		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:26919738G>A	ENST00000321765.5	-	3	856	c.524C>T	c.(523-525)gCa>gTa	p.A175V		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	175					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					CATGCAGGGTGCCACCTCCTC	0.463													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21845	0.0		0.0	False		,,,				2504	0.0				p.A175V		Atlas-SNP	.											.	SPAG5	92	.	0			c.C524T						PASS	.	G	VAL/ALA	4,4402	8.1+/-20.4	0,4,2199	128.0	127.0	128.0		524	1.6	0.0	17	dbSNP_134	128	0,8600		0,0,4300	no	missense	SPAG5	NM_006461.3	64	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	possibly-damaging	175/1194	26919738	4,13002	2203	4300	6503	SO:0001583	missense	10615	exon3			CAGGGTGCCACCT	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.524C>T	17.37:g.26919738G>A	ENSP00000323300:p.Ala175Val	Somatic	161	0	0		WXS	Illumina HiSeq	Phase_I	103	37	0.359223	NM_006461	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	37	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	G	3.453	-0.111589	0.06881	9.08E-4	0.0	ENSG00000076382	ENST00000321765	T	0.25414	1.8	5.89	1.63	0.23807	.	0.635159	0.14929	N	0.290200	T	0.23054	0.0557	M	0.62723	1.935	0.09310	N	1	B	0.23377	0.084	B	0.18561	0.022	T	0.25117	-1.0141	10	0.72032	D	0.01	-0.0103	5.0763	0.14632	0.2345:0.0:0.6218:0.1437	.	175	Q96R06	SPAG5_HUMAN	V	175	ENSP00000323300:A175V	ENSP00000323300:A175V	A	-	2	0	SPAG5	23943865	0.000000	0.05858	0.001000	0.08648	0.048000	0.14542	0.541000	0.23207	0.383000	0.24910	0.655000	0.94253	GCA	G|1.000;A|0.000	0.000	strong		0.463	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461	
ITPKB	3707	hgsc.bcm.edu	37	1	226924300	226924300	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:226924300C>T	ENST00000272117.3	-	1	859	c.860G>A	c.(859-861)aGc>aAc	p.S287N	ITPKB_ENST00000366784.1_Missense_Mutation_p.S287N|ITPKB_ENST00000429204.1_Missense_Mutation_p.S287N			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	287					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				AGCTAGGCAGCTCCGAGTTCC	0.577																																					p.S287N	Colon(84;110 1851 5306 33547)	Atlas-SNP	.											.	ITPKB	158	.	0			c.G860A						PASS	.						47.0	52.0	50.0					1																	226924300		2203	4300	6503	SO:0001583	missense	3707	exon2			AGGCAGCTCCGAG	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.860G>A	1.37:g.226924300C>T	ENSP00000272117:p.Ser287Asn	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	47	11	0.234043	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	ENST00000272117.3	37	CCDS1555.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.837740	0.32513	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.25250	1.82;1.82;1.81	4.21	2.28	0.28536	.	0.705821	0.13409	N	0.389999	T	0.10981	0.0268	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.37009	-0.9724	10	0.13853	T	0.58	.	7.0283	0.24952	0.0:0.7728:0.0:0.2272	.	287	P27987	IP3KB_HUMAN	N	287	ENSP00000272117:S287N;ENSP00000411152:S287N;ENSP00000355748:S287N	ENSP00000272117:S287N	S	-	2	0	ITPKB	224990923	0.021000	0.18746	0.002000	0.10522	0.102000	0.19082	1.392000	0.34486	0.387000	0.25024	0.561000	0.74099	AGC	.	.	none		0.577	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
LRRTM1	347730	hgsc.bcm.edu	37	2	80529909	80529909	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:80529909C>A	ENST00000295057.3	-	2	1692	c.1036G>T	c.(1036-1038)Gag>Tag	p.E346*	CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000402739.4_Intron|LRRTM1_ENST00000409148.1_Nonsense_Mutation_p.E346*|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000540488.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	346	LRRCT.				exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						TGTGCGTACTCCGGGCTGGCG	0.677										HNSCC(69;0.2)																											p.E346X		Atlas-SNP	.											.	LRRTM1	251	.	0			c.G1036T						PASS	.						23.0	22.0	22.0					2																	80529909		2203	4299	6502	SO:0001587	stop_gained	347730	exon2			CGTACTCCGGGCT	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1036G>T	2.37:g.80529909C>A	ENSP00000295057:p.Glu346*	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	58	20	0.344828	NM_178839	A8K397|D6W5K1|Q96DN1	Nonsense_Mutation	SNP	ENST00000295057.3	37	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	C	38	7.030314	0.98013	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	.	.	.	5.32	5.32	0.75619	.	0.123786	0.52532	U	0.000064	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.995	0.92809	0.0:1.0:0.0:0.0	.	.	.	.	X	346	.	.	E	-	1	0	LRRTM1	80383420	1.000000	0.71417	0.984000	0.44739	0.995000	0.86356	4.909000	0.63314	2.452000	0.82932	0.655000	0.94253	GAG	.	.	none		0.677	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839	
MLLT3	4300	hgsc.bcm.edu	37	9	20414280	20414280	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:20414280G>A	ENST00000380338.4	-	5	850	c.564C>T	c.(562-564)agC>agT	p.S188S	MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S185S|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	188	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S188S(1)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		TGGTActactgctgctgctgc	0.502			T	MLL	ALL																																p.S188S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,caecum,carcinoma,0,1	MLLT3	125	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C564T						scavenged	.						77.0	84.0	82.0					9																	20414280		2203	4300	6503	SO:0001819	synonymous_variant	4300	exon5			ACTACTGCTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.564C>T	9.37:g.20414280G>A		Somatic	306	5	0.0163399		WXS	Illumina HiSeq	Phase_I	332	10	0.0301205	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.	.	none		0.502	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
ABCA13	154664	hgsc.bcm.edu	37	7	48312478	48312478	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:48312478A>T	ENST00000435803.1	+	17	3239	c.3215A>T	c.(3214-3216)gAt>gTt	p.D1072V		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1072					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTCATAATTGATGAAGATTTT	0.378																																					p.D1072V		Atlas-SNP	.											.	ABCA13	1192	.	0			c.A3215T						PASS	.						37.0	34.0	35.0					7																	48312478		1822	4083	5905	SO:0001583	missense	154664	exon17			TAATTGATGAAGA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.3215A>T	7.37:g.48312478A>T	ENSP00000411096:p.Asp1072Val	Somatic	186	0	0		WXS	Illumina HiSeq	Phase_I	148	43	0.290541	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	13.55	2.271306	0.40194	.	.	ENSG00000179869	ENST00000435803	D	0.89810	-2.57	5.7	5.7	0.88788	.	0.124747	0.36200	N	0.002738	D	0.92466	0.7608	M	0.64997	1.995	0.29721	N	0.838639	D	0.76494	0.999	D	0.68765	0.96	D	0.89650	0.3869	10	0.87932	D	0	.	11.3534	0.49602	0.8491:0.1509:0.0:0.0	.	1072	Q86UQ4	ABCAD_HUMAN	V	1072	ENSP00000411096:D1072V	ENSP00000411096:D1072V	D	+	2	0	ABCA13	48283024	0.926000	0.31397	0.068000	0.19968	0.512000	0.34134	3.568000	0.53820	2.297000	0.77311	0.533000	0.62120	GAT	.	.	none		0.378	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
DNAH2	146754	hgsc.bcm.edu	37	17	7662326	7662326	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:7662326G>A	ENST00000572933.1	+	15	3792	c.2332G>A	c.(2332-2334)Gaa>Aaa	p.E778K	DNAH2_ENST00000389173.2_Missense_Mutation_p.E778K			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	778	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTGGAATTTGAAGAGGACCA	0.512																																					p.E778K		Atlas-SNP	.											.	DNAH2	498	.	0			c.G2332A						PASS	.						97.0	86.0	90.0					17																	7662326		2203	4300	6503	SO:0001583	missense	146754	exon14			GAATTTGAAGAGG	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.2332G>A	17.37:g.7662326G>A	ENSP00000458355:p.Glu778Lys	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	56	17	0.303571	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.582224	0.46006	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.23348	1.91	5.42	5.42	0.78866	.	0.228580	0.35936	N	0.002888	T	0.24160	0.0585	L	0.46157	1.445	0.80722	D	1	B	0.17268	0.021	B	0.19148	0.024	T	0.02893	-1.1097	10	0.27082	T	0.32	.	13.709	0.62656	0.0:0.1549:0.8451:0.0	.	778	Q9P225	DYH2_HUMAN	K	778	ENSP00000373825:E778K	ENSP00000353818:E778K	E	+	1	0	DNAH2	7603051	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.091000	0.64505	2.535000	0.85469	0.555000	0.69702	GAA	.	.	none		0.512	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
CASD1	64921	hgsc.bcm.edu	37	7	94173774	94173774	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:94173774C>T	ENST00000297273.4	+	11	1695	c.1408C>T	c.(1408-1410)Cag>Tag	p.Q470*		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	470						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			ATATTTATTTCAGACAGGGTA	0.368																																					p.Q470X		Atlas-SNP	.											.	CASD1	70	.	0			c.C1408T						PASS	.						152.0	143.0	146.0					7																	94173774		2203	4298	6501	SO:0001587	stop_gained	64921	exon11			TTATTTCAGACAG	AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.1408C>T	7.37:g.94173774C>T	ENSP00000297273:p.Gln470*	Somatic	384	0	0		WXS	Illumina HiSeq	Phase_I	313	81	0.258786	NM_022900	B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Nonsense_Mutation	SNP	ENST00000297273.4	37	CCDS5636.1	.	.	.	.	.	.	.	.	.	.	C	38	6.872998	0.97901	.	.	ENSG00000127995	ENST00000297273	.	.	.	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.1737	0.89754	0.0:1.0:0.0:0.0	.	.	.	.	X	470	.	ENSP00000297273:Q470X	Q	+	1	0	CASD1	94011710	1.000000	0.71417	1.000000	0.80357	0.419000	0.31324	7.782000	0.85680	2.377000	0.81083	0.455000	0.32223	CAG	.	.	none		0.368	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255216.1	NM_022900	
AGFG1	3267	hgsc.bcm.edu	37	2	228401667	228401667	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:228401667T>G	ENST00000310078.8	+	10	1596	c.1336T>G	c.(1336-1338)Tct>Gct	p.S446A	AGFG1_ENST00000409315.1_Missense_Mutation_p.S425A|AGFG1_ENST00000409171.1_Missense_Mutation_p.S446A|AGFG1_ENST00000409979.2_Missense_Mutation_p.S470A|AGFG1_ENST00000373671.3_Missense_Mutation_p.S406A	NM_001135188.1|NM_001135189.1|NM_004504.4	NP_001128660.1|NP_001128661.1|NP_004495.2	P52594	AGFG1_HUMAN	ArfGAP with FG repeats 1	446					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of ARF GTPase activity (GO:0032312)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)	ARF GTPase activator activity (GO:0008060)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(2)|ovary(1)|prostate(1)|skin(4)|stomach(1)	18						TTCTGTGGCATCTTCTACAAA	0.368																																					p.S470A		Atlas-SNP	.											.	AGFG1	80	.	0			c.T1408G						PASS	.						95.0	98.0	97.0					2																	228401667		2203	4300	6503	SO:0001583	missense	3267	exon11			GTGGCATCTTCTA		CCDS2467.1, CCDS46533.1, CCDS46534.1, CCDS46535.1	2q36	2009-11-30	2008-09-22	2008-09-22	ENSG00000173744	ENSG00000173744		"""ADP-ribosylation factor GTPase activating proteins"""	5175	protein-coding gene	gene with protein product		600862	"""HIV-1 Rev binding protein"""	HRB		7637788	Standard	NM_004504		Approved	RIP, RAB	uc002vpd.2	P52594	OTTHUMG00000133186	ENST00000310078.8:c.1336T>G	2.37:g.228401667T>G	ENSP00000312059:p.Ser446Ala	Somatic	293	0	0		WXS	Illumina HiSeq	Phase_I	261	61	0.233716	NM_001135187	B3KUL1|E9PHX7|Q15277|Q4VAS0|Q4VAS1|Q4VAS3|Q53QT8|Q53R11	Missense_Mutation	SNP	ENST00000310078.8	37	CCDS2467.1	.	.	.	.	.	.	.	.	.	.	T	13.24	2.179454	0.38511	.	.	ENSG00000173744	ENST00000409979;ENST00000542592;ENST00000310078;ENST00000409315;ENST00000373671;ENST00000409171	T;T;T;T;T	0.22539	2.0;2.02;2.02;1.95;2.03	6.06	6.06	0.98353	.	0.104141	0.64402	D	0.000004	T	0.09158	0.0226	N	0.08118	0	0.26605	N	0.972954	B;B;B;B	0.09022	0.002;0.0;0.0;0.001	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.34354	-0.9832	10	0.10111	T	0.7	-17.8795	7.4788	0.27393	0.0:0.1168:0.0:0.8832	.	406;446;470;446	P52594-2;P52594-3;E9PHX7;P52594	.;.;.;AGFG1_HUMAN	A	470;455;446;425;406;446	ENSP00000387282:S470A;ENSP00000312059:S446A;ENSP00000387154:S425A;ENSP00000362775:S406A;ENSP00000387218:S446A	ENSP00000312059:S446A	S	+	1	0	AGFG1	228109911	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.649000	0.37281	2.327000	0.79052	0.533000	0.62120	TCT	.	.	none		0.368	AGFG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256895.2	NM_004504	
PLEKHA7	144100	hgsc.bcm.edu	37	11	17035910	17035910	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:17035910C>T	ENST00000355661.3	-	1	49	c.39G>A	c.(37-39)gaG>gaA	p.E13E	PLEKHA7_ENST00000532079.1_5'UTR|PLEKHA7_ENST00000448080.2_Silent_p.E13E|PLEKHA7_ENST00000531066.1_Silent_p.E13E|OR7E14P_ENST00000530490.1_RNA			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	13	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						AGGACCAATGCTCAGGTAAAG	0.781																																					p.E13E		Atlas-SNP	.											.	PLEKHA7	120	.	0			c.G39A						PASS	.						4.0	3.0	4.0					11																	17035910		1811	3701	5512	SO:0001819	synonymous_variant	144100	exon1			CCAATGCTCAGGT	BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.39G>A	11.37:g.17035910C>T		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	29	15	0.517241	NM_175058	B4DK33|B4DWC3|Q86VZ7	Silent	SNP	ENST00000355661.3	37	CCDS31434.1																																																																																			.	.	none		0.781	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000387242.2	NM_175058	
EGR2	1959	hgsc.bcm.edu	37	10	64575715	64575715	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:64575715G>A	ENST00000242480.3	-	1	400	c.75C>T	c.(73-75)atC>atT	p.I25I	EGR2_ENST00000493899.2_5'UTR|EGR2_ENST00000411732.1_5'UTR|EGR2_ENST00000439032.1_Silent_p.I25I	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	25					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					CCACCGGGTAGATGTTGTCAG	0.577																																					p.I25I		Atlas-SNP	.											EGR2,NS,carcinoma,-1,1	EGR2	77	1	0			c.C75T						scavenged	.						191.0	172.0	178.0					10																	64575715		2203	4300	6503	SO:0001819	synonymous_variant	1959	exon1			CGGGTAGATGTTG	BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.75C>T	10.37:g.64575715G>A		Somatic	73	2	0.0273973		WXS	Illumina HiSeq	Phase_I	63	18	0.285714	NM_000399	B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Silent	SNP	ENST00000242480.3	37	CCDS7267.1																																																																																			.	.	none		0.577	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048245.2	NM_000399	
STXBP3	6814	hgsc.bcm.edu	37	1	109289364	109289364	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:109289364C>T	ENST00000370008.3	+	1	55	c.5C>T	c.(4-6)gCg>gTg	p.A2V		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	2	Mediates interaction with DOC2B. {ECO:0000250}.				blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		GGGAAGATGGCGCCGCCGGTG	0.687											OREG0013625	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A2V		Atlas-SNP	.											.	STXBP3	44	.	0			c.C5T						PASS	.						22.0	28.0	26.0					1																	109289364		2035	3903	5938	SO:0001583	missense	6814	exon1			AGATGGCGCCGCC	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.5C>T	1.37:g.109289364C>T	ENSP00000359025:p.Ala2Val	Somatic	138	0	0	1418	WXS	Illumina HiSeq	Phase_I	93	29	0.311828	NM_007269	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	ENST00000370008.3	37	CCDS790.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.549245	0.86127	.	.	ENSG00000116266	ENST00000370008	T	0.73469	-0.75	4.22	4.22	0.49857	.	0.230025	0.40064	N	0.001189	T	0.72366	0.3451	L	0.36672	1.1	0.39234	D	0.963721	D	0.76494	0.999	D	0.65874	0.939	T	0.77143	-0.2696	10	0.87932	D	0	-4.7439	11.9693	0.53055	0.0:1.0:0.0:0.0	.	2	O00186	STXB3_HUMAN	V	2	ENSP00000359025:A2V	ENSP00000359025:A2V	A	+	2	0	STXBP3	109090887	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	3.716000	0.54904	2.192000	0.70111	0.305000	0.20034	GCG	.	.	none		0.687	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	
MCM10	55388	hgsc.bcm.edu	37	10	13222489	13222489	+	Missense_Mutation	SNP	G	G	A	rs556697001		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:13222489G>A	ENST00000484800.2	+	7	918	c.815G>A	c.(814-816)cGa>cAa	p.R272Q	MCM10_ENST00000378714.3_Missense_Mutation_p.R271Q|MCM10_ENST00000378694.1_Missense_Mutation_p.R271Q			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	272	OB-fold domain. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						ATGACCGGCCGAAAACTGATC	0.413													G|||	1	0.000199681	0.0	0.0	5008	,	,		16663	0.0		0.0	False		,,,				2504	0.001				p.R272Q		Atlas-SNP	.											.	MCM10	76	.	0			c.G815A						PASS	.						110.0	107.0	108.0					10																	13222489		2203	4300	6503	SO:0001583	missense	55388	exon7			CCGGCCGAAAACT	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.815G>A	10.37:g.13222489G>A	ENSP00000418268:p.Arg272Gln	Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	106	15	0.141509	NM_182751	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	37	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	G	36	5.892283	0.97074	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.17370	2.29;2.3;2.28	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.51618	0.1685	M	0.88031	2.925	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.994	T	0.54022	-0.8355	10	0.48119	T	0.1	-24.3162	20.0953	0.97838	0.0:0.0:1.0:0.0	.	271;271;272	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	Q	271;272;272;271	ENSP00000367986:R271Q;ENSP00000418268:R272Q;ENSP00000367966:R271Q	ENSP00000354945:R272Q	R	+	2	0	MCM10	13262495	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.236000	0.95360	2.767000	0.95098	0.655000	0.94253	CGA	.	.	none		0.413	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751	
SLC30A4	7782	hgsc.bcm.edu	37	15	45814226	45814226	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:45814226C>G	ENST00000261867.4	-	2	641	c.327G>C	c.(325-327)aaG>aaC	p.K109N	SLC30A4_ENST00000559667.1_5'UTR|HMGN2P46_ENST00000409454.1_RNA	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	109					regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		TGGCTTTCACCTTTCTCTGCT	0.458																																					p.K109N		Atlas-SNP	.											.	SLC30A4	25	.	0			c.G327C						PASS	.						210.0	177.0	188.0					15																	45814226		2198	4298	6496	SO:0001583	missense	7782	exon2			TTTCACCTTTCTC		CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.327G>C	15.37:g.45814226C>G	ENSP00000261867:p.Lys109Asn	Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	155	32	0.206452	NM_013309	Q8TC39	Missense_Mutation	SNP	ENST00000261867.4	37	CCDS10125.1	.	.	.	.	.	.	.	.	.	.	C	19.18	3.776836	0.70107	.	.	ENSG00000104154	ENST00000261867	T	0.63913	-0.07	5.34	4.4	0.53042	.	0.239529	0.38005	N	0.001851	T	0.55369	0.1916	L	0.27053	0.805	0.50813	D	0.999898	P	0.50066	0.931	P	0.46629	0.522	T	0.59434	-0.7455	10	0.54805	T	0.06	-3.2851	14.5615	0.68140	0.0:0.8525:0.1474:0.0	.	109	O14863	ZNT4_HUMAN	N	109	ENSP00000261867:K109N	ENSP00000261867:K109N	K	-	3	2	SLC30A4	43601518	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.601000	0.36773	1.217000	0.43442	0.655000	0.94253	AAG	.	.	none		0.458	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254236.1		
HOXD1	3231	hgsc.bcm.edu	37	2	177053759	177053759	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:177053759C>T	ENST00000331462.4	+	1	453	c.230C>T	c.(229-231)cCg>cTg	p.P77L	HOXD-AS1_ENST00000425005.1_RNA|HOXD-AS1_ENST00000436126.1_RNA|HOXD-AS1_ENST00000417086.1_RNA|HOXD-AS1_ENST00000452365.1_RNA|HOXD-AS1_ENST00000413969.1_RNA	NM_024501.2	NP_078777.1	Q9GZZ0	HXD1_HUMAN	homeobox D1	77					embryonic skeletal system development (GO:0048706)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.0226)		gtaccgcctccggccgcgccc	0.786																																					p.P77L		Atlas-SNP	.											.	HOXD1	33	.	0			c.C230T						PASS	.						1.0	1.0	1.0					2																	177053759		653	1642	2295	SO:0001583	missense	3231	exon1			CGCCTCCGGCCGC		CCDS2271.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128645	ENSG00000128645		"""Homeoboxes / ANTP class : HOXL subclass"""	5132	protein-coding gene	gene with protein product		142987	"""homeo box D1"""	HOX4, HOX4G		1973146, 1358459	Standard	NM_024501		Approved		uc002ukv.5	Q9GZZ0	OTTHUMG00000132512	ENST00000331462.4:c.230C>T	2.37:g.177053759C>T	ENSP00000328598:p.Pro77Leu	Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	23	7	0.304348	NM_024501	B2RAB4	Missense_Mutation	SNP	ENST00000331462.4	37	CCDS2271.1	.	.	.	.	.	.	.	.	.	.	C	9.823	1.186401	0.21870	.	.	ENSG00000128645	ENST00000331462	D	0.92699	-3.09	3.21	1.19	0.21007	.	0.231155	0.22488	N	0.059410	T	0.80752	0.4683	N	0.24115	0.695	0.09310	N	0.999994	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.62263	-0.6891	10	0.10377	T	0.69	.	4.8389	0.13478	0.0:0.6184:0.176:0.2056	.	77;77	Q96CA4;Q9GZZ0	.;HXD1_HUMAN	L	77	ENSP00000328598:P77L	ENSP00000328598:P77L	P	+	2	0	HOXD1	176762005	0.000000	0.05858	0.030000	0.17652	0.267000	0.26476	-0.349000	0.07731	0.530000	0.28619	0.491000	0.48974	CCG	.	.	none		0.786	HOXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255693.2		
XPO7	23039	hgsc.bcm.edu	37	8	21856273	21856273	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:21856273C>T	ENST00000252512.9	+	22	2453	c.2353C>T	c.(2353-2355)Cga>Tga	p.R785*	XPO7_ENST00000433566.4_Nonsense_Mutation_p.R786*|XPO7_ENST00000434536.1_Nonsense_Mutation_p.R794*	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	785					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		CAGGTCCCAGCGACTCCAGTT	0.478																																					p.R785X		Atlas-SNP	.											XPO7,NS,carcinoma,0,1	XPO7	79	1	0			c.C2353T						PASS	.						117.0	108.0	111.0					8																	21856273		1984	4183	6167	SO:0001587	stop_gained	23039	exon22			TCCCAGCGACTCC	AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.2353C>T	8.37:g.21856273C>T	ENSP00000252512:p.Arg785*	Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	74	24	0.324324	NM_015024	O94846|Q6PJK9|Q8NEK7	Nonsense_Mutation	SNP	ENST00000252512.9	37	CCDS47818.1	.	.	.	.	.	.	.	.	.	.	C	39	7.638127	0.98406	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566;ENST00000517551	.	.	.	5.95	4.07	0.47477	.	0.051284	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.1099	14.1003	0.65051	0.5454:0.4546:0.0:0.0	.	.	.	.	X	794;785;786;95	.	ENSP00000252512:R785X	R	+	1	2	XPO7	21912219	0.990000	0.36364	1.000000	0.80357	0.992000	0.81027	0.895000	0.28363	0.757000	0.33036	0.655000	0.94253	CGA	.	.	none		0.478	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375494.1	NM_015024	
ARHGAP11A	9824	hgsc.bcm.edu	37	15	32929606	32929606	+	Missense_Mutation	SNP	G	G	A	rs144493501		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:32929606G>A	ENST00000361627.3	+	12	3354	c.2632G>A	c.(2632-2634)Ggt>Agt	p.G878S	ARHGAP11A_ENST00000565905.1_Missense_Mutation_p.G689S|ARHGAP11A_ENST00000543522.1_Missense_Mutation_p.G689S	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	878					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		GAGCTGTGACGGTGCTCTTTC	0.413													G|||	1	0.000199681	0.0	0.0	5008	,	,		20692	0.0		0.001	False		,,,				2504	0.0				p.G878S	Colon(45;757 1134 30003 36652)	Atlas-SNP	.											.	ARHGAP11A	84	.	0			c.G2632A						PASS	.						129.0	135.0	133.0					15																	32929606		2201	4300	6501	SO:0001583	missense	9824	exon12			TGTGACGGTGCTC	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.2632G>A	15.37:g.32929606G>A	ENSP00000355090:p.Gly878Ser	Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	140	24	0.171429	NM_014783	B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	ENST00000361627.3	37	CCDS10028.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	0.014	-1.575382	0.00887	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	T	0.04551	3.6	5.67	-0.974	0.10293	.	0.628015	0.15860	N	0.241064	T	0.01092	0.0036	N	0.01048	-1.04	0.20563	N	0.999884	B	0.20550	0.046	B	0.10450	0.005	T	0.45071	-0.9286	10	0.02654	T	1	.	3.1354	0.06437	0.5049:0.1006:0.2866:0.108	.	878	Q6P4F7	RHGBA_HUMAN	S	878;689	ENSP00000355090:G878S	ENSP00000355090:G878S	G	+	1	0	ARHGAP11A	30716898	0.224000	0.23674	0.980000	0.43619	0.254000	0.26022	0.774000	0.26675	0.099000	0.17552	-1.320000	0.01293	GGT	G|1.000;A|0.000	0.000	strong		0.413	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783	
REV3L	5980	hgsc.bcm.edu	37	6	111656671	111656671	+	Splice_Site	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:111656671C>T	ENST00000358835.3	-	23	8135		c.e23+1		REV3L_ENST00000368802.3_Splice_Site|REV3L_ENST00000435970.1_Splice_Site|REV3L_ENST00000368805.1_Splice_Site			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit						DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TGATTTCCCACCTGTGAACCC	0.388								DNA polymerases (catalytic subunits)																													.		Atlas-SNP	.											.	REV3L	386	.	0			c.7680+1G>A						PASS	.						128.0	125.0	126.0					6																	111656671		2203	4300	6503	SO:0001630	splice_region_variant	5980	exon23			TTCCCACCTGTGA	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.7680+1G>A	6.37:g.111656671C>T		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	84	20	0.238095	NM_002912	O43214|Q5TC33	Splice_Site	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	C	27.9	4.872625	0.91587	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970;ENST00000543871	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4635	0.94929	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	REV3L	111763364	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.814000	0.86154	2.585000	0.87301	0.460000	0.39030	.	.	.	none		0.388	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	Intron
PNPLA5	150379	hgsc.bcm.edu	37	22	44287689	44287689	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr22:44287689G>A	ENST00000597664.1	-	1	201	c.72C>T	c.(70-72)caC>caT	p.H24H	PNPLA5_ENST00000381198.2_Silent_p.H24H|PNPLA5_ENST00000216177.4_Silent_p.H24H|PNPLA5_ENST00000593866.1_Silent_p.H24H			Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	24	Patatin.				lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)			endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	16		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				TGGCGCCCACGTGGTGGGCGC	0.711																																					p.H24H		Atlas-SNP	.											.	PNPLA5	46	.	0			c.C72T						PASS	.						4.0	5.0	5.0					22																	44287689		1620	3066	4686	SO:0001819	synonymous_variant	150379	exon1			GCCCACGTGGTGG	Z97055	CCDS14053.1, CCDS54537.1	22q13.31	2009-01-12			ENSG00000100341	ENSG00000100341		"""Patatin-like phospholipase domain containing"""	24888	protein-coding gene	gene with protein product		611589				16799181, 19029121	Standard	NM_138814		Approved	dJ388M5.4, GS2L	uc003beg.3	Q7Z6Z6	OTTHUMG00000030779	ENST00000597664.1:c.72C>T	22.37:g.44287689G>A		Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	83	21	0.253012	NM_138814	B1AHL8|B3KPR1|Q6ZST0	Silent	SNP	ENST00000597664.1	37																																																																																				.	.	none		0.711	PNPLA5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000075667.4	NM_138814	
ADAD2	161931	hgsc.bcm.edu	37	16	84228066	84228066	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:84228066C>T	ENST00000315906.5	+	2	489	c.437C>T	c.(436-438)tCg>tTg	p.S146L	RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.S218L|RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	146	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						TTCCCCTTCTCGGTGAGCGCG	0.647																																					p.S218L		Atlas-SNP	.											.	ADAD2	46	.	0			c.C653T						PASS	.						27.0	29.0	28.0					16																	84228066		2200	4300	6500	SO:0001583	missense	161931	exon3			CCTTCTCGGTGAG	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.437C>T	16.37:g.84228066C>T	ENSP00000325153:p.Ser146Leu	Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	43	9	0.209302	NM_139174	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.923087	0.33908	.	.	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.78003	-1.14;-1.14	4.33	3.36	0.38483	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.000000	0.50627	D	0.000113	T	0.62901	0.2466	L	0.34521	1.04	0.30049	N	0.811913	P;P	0.49862	0.929;0.733	B;B	0.37267	0.245;0.154	T	0.64837	-0.6313	10	0.49607	T	0.09	-16.5901	10.2642	0.43445	0.0:0.7989:0.2011:0.0	.	146;218	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	L	146;218	ENSP00000325153:S146L;ENSP00000268624:S218L	ENSP00000268624:S218L	S	+	2	0	ADAD2	82785567	0.985000	0.35326	0.771000	0.31576	0.338000	0.28826	3.491000	0.53252	1.141000	0.42275	0.511000	0.50034	TCG	.	.	none		0.647	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
POPDC3	64208	hgsc.bcm.edu	37	6	105607586	105607586	+	Splice_Site	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:105607586C>T	ENST00000254765.3	-	3	872	c.594G>A	c.(592-594)caG>caA	p.Q198Q	BVES-AS1_ENST00000369120.2_RNA|BVES-AS1_ENST00000369122.3_RNA|POPDC3_ENST00000474760.1_5'UTR|BVES-AS1_ENST00000580511.1_RNA|BVES-AS1_ENST00000580854.1_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3	198					regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)				NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				TATCCCTTACCTGAAAAATGC	0.398																																					p.Q198Q		Atlas-SNP	.											.	POPDC3	47	.	0			c.G594A						PASS	.						82.0	78.0	80.0					6																	105607586		2203	4300	6503	SO:0001630	splice_region_variant	64208	exon3			CCTTACCTGAAAA	BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293	ENST00000254765.3:c.594+1G>A	6.37:g.105607586C>T		Somatic	219	0	0		WXS	Illumina HiSeq	Phase_I	166	43	0.259036	NM_022361	B2RA98|Q5T3Y8|Q8TBW6	Silent	SNP	ENST00000254765.3	37	CCDS5052.1																																																																																			.	.	none		0.398	POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041651.1	NM_022361	Silent
AFF2	2334	hgsc.bcm.edu	37	X	147743486	147743486	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chrX:147743486G>A	ENST00000370460.2	+	3	717	c.238G>A	c.(238-240)Gaa>Aaa	p.E80K	AFF2_ENST00000370458.1_Missense_Mutation_p.E76K|AFF2_ENST00000370457.5_Missense_Mutation_p.E76K|AFF2_ENST00000342251.3_Missense_Mutation_p.E76K	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	80					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					AAACTATGATGAAATGAAGAA	0.403																																					p.E80K		Atlas-SNP	.											.	AFF2	679	.	0			c.G238A						PASS	.						124.0	124.0	124.0					X																	147743486		2203	4300	6503	SO:0001583	missense	2334	exon3			TATGATGAAATGA	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.238G>A	X.37:g.147743486G>A	ENSP00000359489:p.Glu80Lys	Somatic	213	0	0		WXS	Illumina HiSeq	Phase_I	272	193	0.709559	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.513184	0.85389	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.49	5.49	0.81192	.	0.057352	0.64402	D	0.000003	D	0.86740	0.6005	L	0.58583	1.82	0.80722	D	1	D;D;D;D;D;D	0.89917	0.971;0.971;0.971;0.971;0.977;1.0	P;P;P;P;P;D	0.87578	0.783;0.783;0.783;0.783;0.862;0.998	D	0.87917	0.2701	10	0.87932	D	0	.	18.4456	0.90682	0.0:0.0:1.0:0.0	.	80;76;76;76;80;76	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	K	80;76;76;76	ENSP00000359489:E80K;ENSP00000359486:E76K;ENSP00000345459:E76K;ENSP00000359487:E76K	ENSP00000345459:E76K	E	+	1	0	AFF2	147551178	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.490000	0.97952	2.297000	0.77311	0.600000	0.82982	GAA	.	.	none		0.403	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
OR6B3	150681	hgsc.bcm.edu	37	2	240984801	240984801	+	Missense_Mutation	SNP	G	G	A	rs371957226		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:240984801G>A	ENST00000319423.4	-	1	688	c.689C>T	c.(688-690)tCg>tTg	p.S230L	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		GCCGGTGGCCGAGGGGATGCG	0.582																																					p.S230L		Atlas-SNP	.											.	OR6B3	37	.	0			c.C689T						PASS	.	G	LEU/SER	0,4234		0,0,2117	49.0	56.0	54.0		689	4.1	0.9	2		54	1,8477		0,1,4238	no	missense	OR6B3	NM_173351.1	145	0,1,6355	AA,AG,GG		0.0118,0.0,0.0079	benign	230/332	240984801	1,12711	2117	4239	6356	SO:0001583	missense	150681	exon1			GTGGCCGAGGGGA		CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.689C>T	2.37:g.240984801G>A	ENSP00000322435:p.Ser230Leu	Somatic	181	0	0		WXS	Illumina HiSeq	Phase_I	178	53	0.297753	NM_173351	Q6IFH3	Missense_Mutation	SNP	ENST00000319423.4	37	CCDS42837.1	.	.	.	.	.	.	.	.	.	.	g	10.43	1.347601	0.24426	0.0	1.18E-4	ENSG00000178586	ENST00000319423	T	0.00330	8.08	4.09	4.09	0.47781	GPCR, rhodopsin-like superfamily (1);	0.397274	0.18439	N	0.141189	T	0.00666	0.0022	M	0.93678	3.445	0.09310	N	1	P	0.34522	0.455	B	0.40285	0.325	T	0.05131	-1.0904	10	0.87932	D	0	.	14.6272	0.68629	0.0:0.0:1.0:0.0	.	230	Q8NGW1	OR6B3_HUMAN	L	230	ENSP00000322435:S230L	ENSP00000322435:S230L	S	-	2	0	OR6B3	240633474	0.415000	0.25416	0.900000	0.35374	0.073000	0.16967	1.832000	0.39151	2.540000	0.85666	0.603000	0.83216	TCG	.	.	weak		0.582	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326078.1		
LEMD3	23592	hgsc.bcm.edu	37	12	65564345	65564345	+	Silent	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:65564345G>T	ENST00000308330.2	+	1	995	c.969G>T	c.(967-969)gcG>gcT	p.A323A	LEMD3_ENST00000541171.1_Intron	NM_001167614.1|NM_014319.4	NP_001161086.1|NP_055134.2	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	323	Poly-Ala.				negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of cell cycle (GO:0051726)|skeletal muscle cell differentiation (GO:0035914)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	36			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		ACAGGGCGGCGGCTGCCGGGA	0.642																																					p.A323A		Atlas-SNP	.											.	LEMD3	68	.	0			c.G969T						PASS	.						22.0	26.0	25.0					12																	65564345		2203	4300	6503	SO:0001819	synonymous_variant	23592	exon1			GGCGGCGGCTGCC	AF263918	CCDS8972.1	12q14	2008-02-05			ENSG00000174106	ENSG00000174106			28887	protein-coding gene	gene with protein product		607844				10671519, 15489854	Standard	NM_014319		Approved	MAN1	uc001ssl.2	Q9Y2U8	OTTHUMG00000168840	ENST00000308330.2:c.969G>T	12.37:g.65564345G>T		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	32	16	0.5	NM_001167614	Q9NT47|Q9NYA5	Silent	SNP	ENST00000308330.2	37	CCDS8972.1																																																																																			.	.	none		0.642	LEMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401312.2		
TYRP1	7306	hgsc.bcm.edu	37	9	12702305	12702305	+	Silent	SNP	T	T	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:12702305T>A	ENST00000388918.5	+	5	1077	c.948T>A	c.(946-948)gcT>gcA	p.A316A	TYRP1_ENST00000381137.2_Silent_p.A26A|RP11-3L8.3_ENST00000417638.1_RNA|TYRP1_ENST00000381136.2_Silent_p.A26A	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	316					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		GAAATCCAGCTGGAAATGTGG	0.448									Oculocutaneous Albinism																												p.A316A		Atlas-SNP	.											.	TYRP1	60	.	0			c.T948A						PASS	.						122.0	107.0	112.0					9																	12702305		2203	4300	6503	SO:0001819	synonymous_variant	7306	exon5	Familial Cancer Database		TCCAGCTGGAAAT	L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.948T>A	9.37:g.12702305T>A		Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	199	36	0.180905	NM_000550	P78468|P78469|Q13721|Q15679	Silent	SNP	ENST00000388918.5	37	CCDS34990.1																																																																																			.	.	none		0.448	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055502.3	NM_000550	
FRMPD4	9758	hgsc.bcm.edu	37	X	12728588	12728588	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chrX:12728588T>A	ENST00000380682.1	+	14	2047	c.1541T>A	c.(1540-1542)cTg>cAg	p.L514Q		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	514	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						TACTACCGGCTGCTTGTTGAT	0.473																																					p.L514Q		Atlas-SNP	.											.	FRMPD4	214	.	0			c.T1541A						PASS	.						166.0	154.0	158.0					X																	12728588		2203	4300	6503	SO:0001583	missense	9758	exon14			ACCGGCTGCTTGT	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.1541T>A	X.37:g.12728588T>A	ENSP00000370057:p.Leu514Gln	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	67	47	0.701493	NM_014728	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	T	15.98	2.993601	0.54041	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.26957	1.7	5.47	5.47	0.80525	FERM domain (1);	0.000000	0.64402	D	0.000015	T	0.53786	0.1818	M	0.80422	2.495	0.45097	D	0.998116	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.993	T	0.60316	-0.7287	10	0.87932	D	0	.	14.5914	0.68368	0.0:0.0:0.0:1.0	.	506;514	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	Q	514;505;503	ENSP00000370057:L514Q	ENSP00000304583:L503Q	L	+	2	0	FRMPD4	12638509	1.000000	0.71417	0.086000	0.20670	0.057000	0.15508	7.621000	0.83083	1.825000	0.53177	0.486000	0.48141	CTG	.	.	none		0.473	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
DCST1	149095	hgsc.bcm.edu	37	1	155013976	155013976	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:155013976C>G	ENST00000295542.1	+	7	731	c.635C>G	c.(634-636)aCc>aGc	p.T212S	DCST1_ENST00000392480.1_Missense_Mutation_p.T212S|DCST1_ENST00000423025.2_Missense_Mutation_p.T187S|DCST1_ENST00000368419.2_Missense_Mutation_p.T212S	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	212						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			CCTGAGGATACCATGGACTCA	0.577																																					p.T212S		Atlas-SNP	.											.	DCST1	69	.	0			c.C635G						PASS	.						53.0	53.0	53.0					1																	155013976		2203	4300	6503	SO:0001583	missense	149095	exon7			AGGATACCATGGA	AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.635C>G	1.37:g.155013976C>G	ENSP00000295542:p.Thr212Ser	Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	76	25	0.328947	NM_152494	B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Missense_Mutation	SNP	ENST00000295542.1	37	CCDS1083.1	.	.	.	.	.	.	.	.	.	.	C	0.205	-1.041740	0.02013	.	.	ENSG00000163357	ENST00000295542;ENST00000392480;ENST00000423025;ENST00000368419	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	4.27	-0.463	0.12164	.	3.667800	0.01104	N	0.005440	T	0.11922	0.0290	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.04229	-1.0967	10	0.17832	T	0.49	-0.0307	2.1458	0.03787	0.1423:0.455:0.2238:0.1789	.	187;237;212	E9PHV3;E9PJX3;Q5T197	.;.;DCST1_HUMAN	S	212;212;187;212	ENSP00000295542:T212S;ENSP00000376271:T212S;ENSP00000387369:T187S;ENSP00000357404:T212S	ENSP00000295542:T212S	T	+	2	0	DCST1	153280600	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.208000	0.09371	-0.171000	0.10797	-0.379000	0.06801	ACC	.	.	none		0.577	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099006.1	NM_152494	
WDR16	146845	hgsc.bcm.edu	37	17	9515643	9515643	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:9515643G>A	ENST00000352665.5	+	8	941	c.872G>A	c.(871-873)gGc>gAc	p.G291D	WDR16_ENST00000396219.3_Missense_Mutation_p.G223D|WDR16_ENST00000299764.5_Missense_Mutation_p.G301D	NM_145054.4	NP_659491.4			WD repeat domain 16											NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						CAGTTACAAGGCGGCATCACT	0.428																																					p.G291D		Atlas-SNP	.											.	WDR16	67	.	0			c.G872A						PASS	.						123.0	108.0	113.0					17																	9515643		2203	4300	6503	SO:0001583	missense	146845	exon8			TACAAGGCGGCAT	AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.872G>A	17.37:g.9515643G>A	ENSP00000339449:p.Gly291Asp	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	61	19	0.311475	NM_145054		Missense_Mutation	SNP	ENST00000352665.5	37	CCDS11149.2	.	.	.	.	.	.	.	.	.	.	G	20.2	3.944743	0.73672	.	.	ENSG00000166596	ENST00000352665;ENST00000396219;ENST00000299764	T;T;T	0.18016	2.47;2.84;2.24	5.53	5.53	0.82687	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);	0.097447	0.64402	D	0.000001	T	0.31451	0.0797	M	0.83603	2.65	0.80722	D	1	P;P;D	0.53885	0.79;0.87;0.963	B;P;P	0.45558	0.377;0.453;0.485	T	0.16041	-1.0416	10	0.37606	T	0.19	-21.2963	18.2327	0.89939	0.0:0.0:1.0:0.0	.	301;223;291	Q8N1V2-2;Q8N1V2-3;Q8N1V2	.;.;WDR16_HUMAN	D	291;223;301	ENSP00000339449:G291D;ENSP00000379521:G223D;ENSP00000299764:G301D	ENSP00000299764:G301D	G	+	2	0	WDR16	9456368	1.000000	0.71417	0.993000	0.49108	0.591000	0.36615	7.220000	0.78008	2.585000	0.87301	0.557000	0.71058	GGC	.	.	none		0.428	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316569.2	NM_145054	
MTMR14	64419	hgsc.bcm.edu	37	3	9695364	9695364	+	Silent	SNP	G	G	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:9695364G>C	ENST00000296003.4	+	2	341	c.219G>C	c.(217-219)gtG>gtC	p.V73V	MTMR14_ENST00000420925.1_Intron|MTMR14_ENST00000353332.5_Silent_p.V73V|MTMR14_ENST00000351233.5_Silent_p.V73V	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	73					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					GTTTCAGCGTGATTCCAAACA	0.498																																					p.V73V		Atlas-SNP	.											.	MTMR14	43	.	0			c.G219C						PASS	.						168.0	163.0	164.0					3																	9695364		1990	4170	6160	SO:0001819	synonymous_variant	64419	exon2			CAGCGTGATTCCA	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.219G>C	3.37:g.9695364G>C		Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	132	22	0.166667	NM_022485	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Silent	SNP	ENST00000296003.4	37	CCDS43043.1																																																																																			.	.	none		0.498	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	
OR5M8	219484	hgsc.bcm.edu	37	11	56258097	56258097	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:56258097G>T	ENST00000327216.2	-	1	774	c.750C>A	c.(748-750)ttC>ttA	p.F250L		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					GGGTTGCATAGAATATAGTGA	0.418																																					p.F250L		Atlas-SNP	.											.	OR5M8	74	.	0			c.C750A						PASS	.						37.0	40.0	39.0					11																	56258097		2201	4296	6497	SO:0001583	missense	219484	exon1			TGCATAGAATATA	AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.750C>A	11.37:g.56258097G>T	ENSP00000323354:p.Phe250Leu	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	82	39	0.47561	NM_001005282	B2RNM5|Q6IEW3|Q96RB8	Missense_Mutation	SNP	ENST00000327216.2	37	CCDS31533.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.483308	0.44147	.	.	ENSG00000181371	ENST00000327216	T	0.00285	8.3	4.26	1.32	0.21799	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40385	U	0.001119	T	0.00496	0.0016	M	0.71581	2.175	0.33824	D	0.629419	D	0.89917	1.0	D	0.91635	0.999	T	0.63129	-0.6706	10	0.59425	D	0.04	-32.5199	7.1207	0.25442	0.375:0.0:0.625:0.0	.	250	Q8NGP6	OR5M8_HUMAN	L	250	ENSP00000323354:F250L	ENSP00000323354:F250L	F	-	3	2	OR5M8	56014673	0.001000	0.12720	0.978000	0.43139	0.568000	0.35870	-0.517000	0.06275	0.066000	0.16515	-1.079000	0.02226	TTC	.	.	none		0.418	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391641.1	NM_001005282	
TTC21B	79809	hgsc.bcm.edu	37	2	166770146	166770146	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:166770146C>T	ENST00000243344.7	-	16	2286	c.2149G>A	c.(2149-2151)Gaa>Aaa	p.E717K		NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	717					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						GCCATTCTTTCAGCAATTTCT	0.308																																					p.E717K		Atlas-SNP	.											.	TTC21B	130	.	0			c.G2149A						PASS	.						96.0	98.0	98.0					2																	166770146		2203	4300	6503	SO:0001583	missense	79809	exon16			TTCTTTCAGCAAT	AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.2149G>A	2.37:g.166770146C>T	ENSP00000243344:p.Glu717Lys	Somatic	381	0	0		WXS	Illumina HiSeq	Phase_I	295	54	0.183051	NM_024753	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Missense_Mutation	SNP	ENST00000243344.7	37	CCDS33315.1	.	.	.	.	.	.	.	.	.	.	C	33	5.216990	0.95104	.	.	ENSG00000123607	ENST00000243344	T	0.61158	0.13	5.39	5.39	0.77823	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.172662	0.56097	D	0.000029	T	0.62134	0.2403	M	0.71581	2.175	0.80722	D	1	P	0.48911	0.917	B	0.43950	0.437	T	0.62248	-0.6894	10	0.27785	T	0.31	-20.5549	19.1426	0.93451	0.0:1.0:0.0:0.0	.	717	Q7Z4L5	TT21B_HUMAN	K	717	ENSP00000243344:E717K	ENSP00000243344:E717K	E	-	1	0	TTC21B	166478392	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	7.487000	0.81328	2.512000	0.84698	0.591000	0.81541	GAA	.	.	none		0.308	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1	NM_024753	
SEC23B	10483	hgsc.bcm.edu	37	20	18492908	18492908	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:18492908C>T	ENST00000336714.3	+	3	693	c.261C>T	c.(259-261)ttC>ttT	p.F87F	SEC23B_ENST00000377465.1_Silent_p.F87F|SEC23B_ENST00000377475.3_Silent_p.F87F|SEC23B_ENST00000262544.2_Silent_p.F87F|SEC23B_ENST00000494645.1_3'UTR	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	87					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						CCTGTAATTTCTGTTTTCAAA	0.229																																					p.F87F		Atlas-SNP	.											.	SEC23B	70	.	0			c.C261T						PASS	.						28.0	30.0	29.0					20																	18492908		2198	4287	6485	SO:0001819	synonymous_variant	10483	exon3			TAATTTCTGTTTT	X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.261C>T	20.37:g.18492908C>T		Somatic	866	1	0.00115473		WXS	Illumina HiSeq	Phase_I	700	82	0.117143	NM_032985	D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Silent	SNP	ENST00000336714.3	37	CCDS13137.1																																																																																			.	.	none		0.229	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078184.5		
FBRSL1	57666	hgsc.bcm.edu	37	12	133151086	133151086	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:133151086G>A	ENST00000434748.2	+	12	2786	c.1766G>A	c.(1765-1767)gGg>gAg	p.G589E	FBRSL1_ENST00000261673.6_Missense_Mutation_p.G516E	NM_001142641.1	NP_001136113.1	Q9HCM7	FBSL_HUMAN	fibrosin-like 1	589							poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(1)|stomach(1)	4						CAGAAGCCGGGGAGGTGGTGT	0.652																																					p.G589E		Atlas-SNP	.											.	FBRSL1	47	.	0			c.G1766A						PASS	.						28.0	33.0	31.0					12																	133151086		692	1591	2283	SO:0001583	missense	57666	exon12			AGCCGGGGAGGTG		CCDS45010.1	12q24.33	2008-12-09			ENSG00000112787	ENSG00000112787			29308	protein-coding gene	gene with protein product						10997877	Standard	NM_001142641		Approved	KIAA1545	uc001ukf.3	Q9HCM7	OTTHUMG00000167991	ENST00000434748.2:c.1766G>A	12.37:g.133151086G>A	ENSP00000396160:p.Gly589Glu	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	72	11	0.152778	NM_001142641	Q86XQ1	Missense_Mutation	SNP	ENST00000434748.2	37	CCDS45010.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936102	0.73442	.	.	ENSG00000112787	ENST00000434748;ENST00000261673	D;D	0.82255	-1.59;-1.5	4.95	4.95	0.65309	.	0.111789	0.64402	U	0.000011	D	0.91195	0.7226	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92337	0.5878	10	0.72032	D	0.01	-22.4549	17.8006	0.88586	0.0:0.0:1.0:0.0	.	589	Q9HCM7	FBSL_HUMAN	E	589;516	ENSP00000396160:G589E;ENSP00000261673:G516E	ENSP00000261673:G516E	G	+	2	0	FBRSL1	131661159	1.000000	0.71417	0.994000	0.49952	0.313000	0.28021	8.992000	0.93519	2.309000	0.77851	0.484000	0.47621	GGG	.	.	none		0.652	FBRSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397404.2		
DTX3L	151636	hgsc.bcm.edu	37	3	122288257	122288257	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:122288257T>A	ENST00000296161.4	+	3	1510	c.1321T>A	c.(1321-1323)Ttt>Att	p.F441I	DTX3L_ENST00000383661.3_Intron	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	441					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		CATCGATGCCTTTCAACATGC	0.423																																					p.F441I		Atlas-SNP	.											.	DTX3L	59	.	0			c.T1321A						PASS	.						133.0	125.0	128.0					3																	122288257		2203	4300	6503	SO:0001583	missense	151636	exon3			GATGCCTTTCAAC		CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.1321T>A	3.37:g.122288257T>A	ENSP00000296161:p.Phe441Ile	Somatic	211	0	0		WXS	Illumina HiSeq	Phase_I	158	46	0.291139	NM_138287	B3KWH6|Q53ZZ3|Q5MJP7	Missense_Mutation	SNP	ENST00000296161.4	37	CCDS3015.1	.	.	.	.	.	.	.	.	.	.	T	17.37	3.371401	0.61624	.	.	ENSG00000163840	ENST00000296161	T	0.50548	0.74	5.65	3.26	0.37387	.	0.523151	0.17799	N	0.161628	T	0.35248	0.0925	L	0.39898	1.24	0.80722	D	1	P	0.46277	0.875	B	0.41440	0.357	T	0.04537	-1.0944	10	0.30854	T	0.27	-34.6537	6.3834	0.21548	0.0:0.08:0.1591:0.7609	.	441	Q8TDB6	DTX3L_HUMAN	I	441	ENSP00000296161:F441I	ENSP00000296161:F441I	F	+	1	0	DTX3L	123770947	1.000000	0.71417	0.983000	0.44433	0.710000	0.40934	1.590000	0.36654	0.553000	0.29044	0.533000	0.62120	TTT	.	.	none		0.423	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355966.1	NM_138287	
LRRC39	127495	hgsc.bcm.edu	37	1	100623819	100623819	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:100623819C>A	ENST00000370137.1	-	6	679	c.481G>T	c.(481-483)Gtt>Ttt	p.V161F	LRRC39_ENST00000370138.1_Missense_Mutation_p.V161F|LRRC39_ENST00000342895.3_Missense_Mutation_p.V161F	NM_001256386.1|NM_144620.3	NP_001243315.1|NP_653221.1	Q96DD0	LRC39_HUMAN	leucine rich repeat containing 39	161										endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	13		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0826)|all cancers(265;0.135)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		TCTCTGTTAACAGCCAGTTCT	0.398																																					p.V161F		Atlas-SNP	.											LRRC39,caecum,carcinoma,+1,1	LRRC39	37	1	0			c.G481T						PASS	.						180.0	186.0	184.0					1																	100623819		2203	4300	6503	SO:0001583	missense	127495	exon6			TGTTAACAGCCAG	AK096892	CCDS766.1, CCDS58014.1	1p21.3	2008-02-05			ENSG00000122477	ENSG00000122477			28228	protein-coding gene	gene with protein product						12975309	Standard	NM_001256385		Approved	MGC14816	uc001dsx.2	Q96DD0	OTTHUMG00000010839	ENST00000370137.1:c.481G>T	1.37:g.100623819C>A	ENSP00000359156:p.Val161Phe	Somatic	231	0	0		WXS	Illumina HiSeq	Phase_I	179	44	0.24581	NM_144620	B3KUD2|D3DT56|Q5VVK7	Missense_Mutation	SNP	ENST00000370137.1	37	CCDS766.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.734973	0.48939	.	.	ENSG00000122477	ENST00000370137;ENST00000370138;ENST00000342895;ENST00000370136	T;T;T	0.17528	2.27;2.27;2.27	5.36	5.36	0.76844	.	0.000000	0.52532	D	0.000062	T	0.25269	0.0614	L	0.51422	1.61	0.54753	D	0.999989	D;D	0.76494	0.999;0.999	D;P	0.66979	0.948;0.888	T	0.00939	-1.1507	10	0.20046	T	0.44	.	19.4651	0.94934	0.0:1.0:0.0:0.0	.	161;161	Q96DD0-2;Q96DD0	.;LRC39_HUMAN	F	161	ENSP00000359156:V161F;ENSP00000359157:V161F;ENSP00000344470:V161F	ENSP00000344470:V161F	V	-	1	0	LRRC39	100396407	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.784000	0.62411	2.671000	0.90904	0.655000	0.94253	GTT	.	.	none		0.398	LRRC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029917.2	NM_144620	
CTNND2	1501	hgsc.bcm.edu	37	5	11364898	11364898	+	Missense_Mutation	SNP	C	C	T	rs148824970	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:11364898C>T	ENST00000304623.8	-	8	1471	c.1282G>A	c.(1282-1284)Gtc>Atc	p.V428I	CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000359640.2_Missense_Mutation_p.V428I|CTNND2_ENST00000458100.2_5'UTR|CTNND2_ENST00000503622.1_Missense_Mutation_p.V91I|CTNND2_ENST00000511377.1_Missense_Mutation_p.V337I	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	428					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V428I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TTCTGATAGACGCGGTCTTCA	0.617																																					p.V428I		Atlas-SNP	.											CTNND2,NS,carcinoma,0,1	CTNND2	289	1	1	Substitution - Missense(1)	lung(1)	c.G1282A						PASS	.	C	ILE/VAL	3,4403	6.2+/-15.9	0,3,2200	50.0	54.0	53.0		1282	4.6	1.0	5	dbSNP_134	53	1,8599	1.2+/-3.3	0,1,4299	yes	missense	CTNND2	NM_001332.2	29	0,4,6499	TT,TC,CC		0.0116,0.0681,0.0308	probably-damaging	428/1226	11364898	4,13002	2203	4300	6503	SO:0001583	missense	1501	exon8			GATAGACGCGGTC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1282G>A	5.37:g.11364898C>T	ENSP00000307134:p.Val428Ile	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	77	26	0.337662	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.977602	0.92982	6.81E-4	1.16E-4	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000503622;ENST00000502551	T;T;T;T	0.78707	-1.08;-1.15;-1.09;-1.2	5.47	4.6	0.57074	.	0.086833	0.45361	N	0.000371	D	0.84129	0.5404	L	0.50333	1.59	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72982	0.959;0.979	D	0.85369	0.1112	10	0.66056	D	0.02	-16.9562	13.9713	0.64242	0.0:0.9272:0.0:0.0728	.	91;428	B4DRK2;Q9UQB3	.;CTND2_HUMAN	I	428;428;337;91;168	ENSP00000307134:V428I;ENSP00000352661:V428I;ENSP00000426510:V337I;ENSP00000426887:V91I	ENSP00000307134:V428I	V	-	1	0	CTNND2	11417898	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	5.748000	0.68697	1.313000	0.45069	0.655000	0.94253	GTC	C|0.999;T|0.001	0.001	strong		0.617	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
ZNF490	57474	hgsc.bcm.edu	37	19	12692409	12692409	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:12692409C>T	ENST00000311437.6	-	5	602	c.480G>A	c.(478-480)gtG>gtA	p.V160V	CTD-2192J16.20_ENST00000593682.1_5'Flank|ZNF490_ENST00000465656.1_5'Flank	NM_020714.2	NP_065765.1	Q9ULM2	ZN490_HUMAN	zinc finger protein 490	160					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V160V(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	18						CTTCCCCACACACACTGCAGT	0.433																																					p.V160V		Atlas-SNP	.											ZNF490,NS,carcinoma,0,1	ZNF490	42	1	1	Substitution - coding silent(1)	lung(1)	c.G480A						PASS	.						195.0	169.0	178.0					19																	12692409		2203	4300	6503	SO:0001819	synonymous_variant	57474	exon5			CCCACACACACTG	AB033024	CCDS12272.1	19p13.2	2013-01-08			ENSG00000188033	ENSG00000188033		"""Zinc fingers, C2H2-type"", ""-"""	23705	protein-coding gene	gene with protein product							Standard	NM_020714		Approved	KIAA1198	uc002mtz.2	Q9ULM2	OTTHUMG00000156398	ENST00000311437.6:c.480G>A	19.37:g.12692409C>T		Somatic	340	0	0		WXS	Illumina HiSeq	Phase_I	288	74	0.256944	NM_020714		Silent	SNP	ENST00000311437.6	37	CCDS12272.1																																																																																			.	.	none		0.433	ZNF490-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344073.1	NM_020714	
ZNF234	10780	hgsc.bcm.edu	37	19	44661732	44661732	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:44661732C>T	ENST00000426739.2	+	6	1821	c.1563C>T	c.(1561-1563)ttC>ttT	p.F521F	ZNF234_ENST00000592437.1_Silent_p.F521F	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	521					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				GGAAGGTCTTCAGTCAGGCCT	0.463																																					p.F521F		Atlas-SNP	.											.	ZNF234	132	.	0			c.C1563T						PASS	.						84.0	90.0	88.0					19																	44661732		2181	4285	6466	SO:0001819	synonymous_variant	10780	exon6			GGTCTTCAGTCAG	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1563C>T	19.37:g.44661732C>T		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	95	22	0.231579	NM_006630	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Silent	SNP	ENST00000426739.2	37	CCDS46101.1																																																																																			.	.	none		0.463	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460586.2		
TGFBR3	7049	hgsc.bcm.edu	37	1	92161330	92161330	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:92161330A>T	ENST00000525962.1	-	15	2397	c.2336T>A	c.(2335-2337)tTc>tAc	p.F779Y	TGFBR3_ENST00000370399.2_Missense_Mutation_p.F778Y|TGFBR3_ENST00000212355.4_Missense_Mutation_p.F779Y			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	779					blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		CAGACCATGGAAAATTGCTAT	0.443																																					p.F779Y		Atlas-SNP	.											.	TGFBR3	103	.	0			c.T2336A						PASS	.						106.0	101.0	103.0					1																	92161330		2203	4300	6503	SO:0001583	missense	7049	exon16			CCATGGAAAATTG	L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.2336T>A	1.37:g.92161330A>T	ENSP00000436127:p.Phe779Tyr	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	124	32	0.258065	NM_003243	A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Missense_Mutation	SNP	ENST00000525962.1	37	CCDS30770.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.923604	0.92319	.	.	ENSG00000069702	ENST00000212355;ENST00000370399;ENST00000525962;ENST00000465892	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.5	5.5	0.81552	.	0.171303	0.52532	D	0.000075	T	0.25005	0.0607	L	0.51422	1.61	0.45822	D	0.998696	P;P;P	0.51653	0.824;0.947;0.824	B;P;B	0.51550	0.258;0.673;0.258	T	0.03296	-1.1051	10	0.14656	T	0.56	-19.6117	15.6091	0.76699	1.0:0.0:0.0:0.0	.	779;778;779	A8K5N0;Q03167-2;Q03167	.;.;TGBR3_HUMAN	Y	779;778;779;778	ENSP00000212355:F779Y;ENSP00000359426:F778Y;ENSP00000436127:F779Y;ENSP00000432638:F778Y	ENSP00000212355:F779Y	F	-	2	0	TGFBR3	91933918	1.000000	0.71417	0.997000	0.53966	0.930000	0.56654	5.420000	0.66441	2.090000	0.63153	0.460000	0.39030	TTC	.	.	none		0.443	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382308.1	NM_003243	
SLC30A4	7782	hgsc.bcm.edu	37	15	45814162	45814162	+	Splice_Site	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:45814162C>G	ENST00000261867.4	-	2	705	c.391G>C	c.(391-393)Ggt>Cgt	p.G131R	SLC30A4_ENST00000559667.1_5'UTR|HMGN2P46_ENST00000409454.1_RNA	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	131					regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		CACAACTCACCTACAAGTTCT	0.448																																					p.G131R		Atlas-SNP	.											.	SLC30A4	25	.	0			c.G391C						PASS	.						143.0	121.0	128.0					15																	45814162		2198	4298	6496	SO:0001630	splice_region_variant	7782	exon2			ACTCACCTACAAG		CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.391+1G>C	15.37:g.45814162C>G		Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	142	43	0.302817	NM_013309	Q8TC39	Missense_Mutation	SNP	ENST00000261867.4	37	CCDS10125.1	.	.	.	.	.	.	.	.	.	.	C	32	5.116162	0.94339	.	.	ENSG00000104154	ENST00000261867	T	0.64260	-0.09	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.86723	0.6001	H	0.96861	3.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90865	0.4741	9	.	.	.	-18.5553	18.2257	0.89916	0.0:1.0:0.0:0.0	.	131	O14863	ZNT4_HUMAN	R	131	ENSP00000261867:G131R	.	G	-	1	0	SLC30A4	43601454	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.307000	0.72815	2.653000	0.90120	0.655000	0.94253	GGT	.	.	none		0.448	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254236.1		Missense_Mutation
SLC30A4	7782	hgsc.bcm.edu	37	15	45814493	45814493	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:45814493C>T	ENST00000261867.4	-	2	374	c.60G>A	c.(58-60)ccG>ccA	p.P20P	SLC30A4_ENST00000559667.1_5'Flank|HMGN2P46_ENST00000409454.1_RNA	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	20	Asp-rich (acidic).				regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		TTAAAAACAGCGGCGCATCAT	0.602																																					p.P20P		Atlas-SNP	.											.	SLC30A4	25	.	0			c.G60A						PASS	.						32.0	38.0	36.0					15																	45814493		2197	4298	6495	SO:0001819	synonymous_variant	7782	exon2			AAACAGCGGCGCA		CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.60G>A	15.37:g.45814493C>T		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	50	20	0.4	NM_013309	Q8TC39	Silent	SNP	ENST00000261867.4	37	CCDS10125.1																																																																																			.	.	none		0.602	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254236.1		
IQGAP3	128239	hgsc.bcm.edu	37	1	156502774	156502774	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:156502774C>T	ENST00000361170.2	-	32	4111	c.4101G>A	c.(4099-4101)ctG>ctA	p.L1367L		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1367					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCACCCACCTCAGAAGCAGGC	0.562																																					p.L1367L		Atlas-SNP	.											.	IQGAP3	146	.	0			c.G4101A						PASS	.						169.0	135.0	146.0					1																	156502774		2203	4300	6503	SO:0001819	synonymous_variant	128239	exon32			CCACCTCAGAAGC	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.4101G>A	1.37:g.156502774C>T		Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	88	25	0.284091	NM_178229	Q5T3H8	Silent	SNP	ENST00000361170.2	37	CCDS1144.1																																																																																			.	.	none		0.562	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	
ACTG1	71	hgsc.bcm.edu	37	17	79479257	79479257	+	Splice_Site	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:79479257C>T	ENST00000575842.1	-	1	550		c.e1+1		ACTG1_ENST00000575087.1_Splice_Site|AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000331925.2_Splice_Site|ACTG1_ENST00000573283.1_Splice_Site|RP13-766D20.2_ENST00000430912.1_RNA			P63261	ACTG_HUMAN	actin, gamma 1						adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			CATCCACTCACCTGGTGTCTG	0.672																																					.		Atlas-SNP	.											.	ACTG1	55	.	0			c.123+1G>A						PASS	.						41.0	50.0	47.0					17																	79479257		2202	4300	6502	SO:0001630	splice_region_variant	71	exon3			CACTCACCTGGTG		CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.123+1G>A	17.37:g.79479257C>T		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	97	10	0.103093	NM_001199954	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Splice_Site	SNP	ENST00000575842.1	37	CCDS11782.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172931	0.38413	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	.	.	.	3.66	3.66	0.41972	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3213	0.66489	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ACTG1	77093852	1.000000	0.71417	0.965000	0.40720	0.234000	0.25298	5.468000	0.66743	1.871000	0.54225	0.563000	0.77884	.	.	.	none		0.672	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2	NM_001614	Intron
SON	6651	hgsc.bcm.edu	37	21	34924682	34924682	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr21:34924682A>C	ENST00000356577.4	+	3	3620	c.3145A>C	c.(3145-3147)Atg>Ctg	p.M1049L	SON_ENST00000290239.6_Missense_Mutation_p.M1049L|SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Missense_Mutation_p.M1049L|SON_ENST00000300278.4_Missense_Mutation_p.M1049L	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1049	14 X 6 AA repeats of [ED]-R-S-M-M-S.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CGAGCGCTCTATGATGTCCCC	0.502																																					p.M1049L		Atlas-SNP	.											.	SON	343	.	0			c.A3145C						PASS	.						103.0	96.0	99.0					21																	34924682		2203	4300	6503	SO:0001583	missense	6651	exon3			CGCTCTATGATGT	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.3145A>C	21.37:g.34924682A>C	ENSP00000348984:p.Met1049Leu	Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	129	46	0.356589	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	A	17.86	3.493740	0.64186	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.27720	1.65;1.65;1.65;1.65	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000003	T	0.51534	0.1680	M	0.68593	2.085	0.33298	D	0.564499	P;P;P;P;P	0.52577	0.93;0.885;0.954;0.93;0.93	P;P;P;P;P	0.62435	0.902;0.801;0.711;0.902;0.902	T	0.64630	-0.6362	10	0.51188	T	0.08	.	14.5614	0.68140	1.0:0.0:0.0:0.0	.	1049;1049;730;1049;1049	P18583-10;P18583;P18583-2;P18583-3;P18583-6	.;SON_HUMAN;.;.;.	L	1049	ENSP00000348984:M1049L;ENSP00000290239:M1049L;ENSP00000300278:M1049L;ENSP00000371095:M1049L	ENSP00000290239:M1049L	M	+	1	0	SON	33846552	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.024000	0.64090	2.324000	0.78689	0.533000	0.62120	ATG	.	.	none		0.502	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
OPRK1	4986	hgsc.bcm.edu	37	8	54147398	54147398	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:54147398G>A	ENST00000265572.3	-	3	828	c.531C>T	c.(529-531)atC>atT	p.I177I	OPRK1_ENST00000524278.1_Silent_p.I88I|OPRK1_ENST00000520287.1_Silent_p.I177I|RP11-162D9.3_ENST00000524425.1_RNA	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	177					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	AGATATTGATGATCTTTGCCT	0.517																																					p.I177I		Atlas-SNP	.											.	OPRK1	90	.	0			c.C531T						PASS	.						117.0	102.0	107.0					8																	54147398		2203	4300	6503	SO:0001819	synonymous_variant	4986	exon3			ATTGATGATCTTT		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.531C>T	8.37:g.54147398G>A		Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	85	20	0.235294	NM_000912	E5RHC9|Q499G4	Silent	SNP	ENST00000265572.3	37	CCDS6152.1																																																																																			.	.	none		0.517	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1		
SIAH2	6478	hgsc.bcm.edu	37	3	150480589	150480589	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:150480589G>A	ENST00000312960.3	-	1	575	c.48C>T	c.(46-48)agC>agT	p.S16S	SIAH2-AS1_ENST00000461943.1_RNA|SIAH2_ENST00000472885.1_Intron	NM_005067.5	NP_005058.3	O43255	SIAH2_HUMAN	siah E3 ubiquitin protein ligase 2	16					axon guidance (GO:0007411)|cell cycle (GO:0007049)|cellular protein catabolic process (GO:0044257)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|regulation of protein ubiquitination (GO:0031396)|regulation of RNA biosynthetic process (GO:2001141)|small GTPase mediated signal transduction (GO:0007264)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)	16			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GCGGCTGCTTGCTGCAGGGTT	0.771																																					p.S16S		Atlas-SNP	.											.	SIAH2	33	.	0			c.C48T						PASS	.						4.0	5.0	5.0					3																	150480589		1114	2511	3625	SO:0001819	synonymous_variant	6478	exon1			CTGCTTGCTGCAG	U76248	CCDS3152.1	3q25	2012-02-23	2012-02-23		ENSG00000181788	ENSG00000181788	6.3.2.1		10858	protein-coding gene	gene with protein product		602213	"""seven in absentia (Drosophila) homolog 2"", ""seven in absentia homolog 2 (Drosophila)"""			9334332	Standard	NM_005067		Approved		uc003eyi.3	O43255	OTTHUMG00000159847	ENST00000312960.3:c.48C>T	3.37:g.150480589G>A		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	88	30	0.340909	NM_005067	O43270	Silent	SNP	ENST00000312960.3	37	CCDS3152.1																																																																																			.	.	none		0.771	SIAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357697.1	NM_005067	
MYBL1	4603	hgsc.bcm.edu	37	8	67479124	67479124	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:67479124C>T	ENST00000522677.3	-	13	2242	c.1832G>A	c.(1831-1833)aGc>aAc	p.S611N	MYBL1_ENST00000517885.1_Missense_Mutation_p.S269N|MYBL1_ENST00000522419.1_5'UTR|MYBL1_ENST00000524176.2_Missense_Mutation_p.S611N	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	611					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			TTGTTTGCAGCTTTTGTAAGC	0.348																																					p.S611N		Atlas-SNP	.											.	MYBL1	73	.	0			c.G1832A						PASS	.						117.0	104.0	108.0					8																	67479124		1804	4076	5880	SO:0001583	missense	4603	exon13			TTGCAGCTTTTGT	X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.1832G>A	8.37:g.67479124C>T	ENSP00000429633:p.Ser611Asn	Somatic	275	0	0		WXS	Illumina HiSeq	Phase_I	328	138	0.420732	NM_001080416	E7EW29|Q495F9	Missense_Mutation	SNP	ENST00000522677.3	37	CCDS47867.1	.	.	.	.	.	.	.	.	.	.	C	10.89	1.477707	0.26511	.	.	ENSG00000185697	ENST00000522677;ENST00000517885;ENST00000524176	T;T;T	0.29142	1.58;1.58;1.58	5.48	3.69	0.42338	C-myb, C-terminal (1);	0.366974	0.34580	N	0.003860	T	0.21387	0.0515	L	0.34521	1.04	0.33887	D	0.636893	B;B;B	0.15930	0.015;0.005;0.015	B;B;B	0.18561	0.015;0.022;0.015	T	0.14671	-1.0464	10	0.46703	T	0.11	-0.9074	6.6436	0.22923	0.0:0.6574:0.1288:0.2137	.	611;610;611	Q495F9;Q495G0;P10243	.;.;MYBA_HUMAN	N	611;269;611	ENSP00000429633:S611N;ENSP00000428265:S269N;ENSP00000428011:S611N	ENSP00000428265:S269N	S	-	2	0	MYBL1	67641678	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	0.830000	0.27462	0.674000	0.31244	-0.142000	0.14014	AGC	.	.	none		0.348	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379221.3	XM_034274	
FREM1	158326	hgsc.bcm.edu	37	9	14750210	14750210	+	Silent	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:14750210G>T	ENST00000380880.3	-	30	6255	c.5472C>A	c.(5470-5472)gtC>gtA	p.V1824V	FREM1_ENST00000422223.2_Silent_p.V1824V|FREM1_ENST00000486223.1_5'Flank|FREM1_ENST00000380894.1_Silent_p.V360V|FREM1_ENST00000380881.4_Silent_p.V1825V			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1824	Calx-beta.				cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TTACTTCAAAGACCTCATCAT	0.358																																					p.V1824V		Atlas-SNP	.											FREM1_ENST00000380894,NS,carcinoma,0,2	FREM1	261	2	0			c.C5472A						PASS	.						147.0	137.0	140.0					9																	14750210		1858	4092	5950	SO:0001819	synonymous_variant	158326	exon31			TTCAAAGACCTCA	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.5472C>A	9.37:g.14750210G>T		Somatic	225	0	0		WXS	Illumina HiSeq	Phase_I	277	17	0.0613718	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	ENST00000380880.3	37	CCDS47952.1																																																																																			.	.	none		0.358	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
SOCS1	8651	hgsc.bcm.edu	37	16	11348767	11348767	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:11348767T>C	ENST00000332029.2	-	2	719	c.569A>G	c.(568-570)aAc>aGc	p.N190S	RMI2_ENST00000572173.1_Intron	NM_003745.1	NP_003736.1	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	190	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				cellular response to amino acid stimulus (GO:0071230)|cytokine-mediated signaling pathway (GO:0019221)|fat cell differentiation (GO:0045444)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein phosphorylation (GO:0001932)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	insulin-like growth factor receptor binding (GO:0005159)|kinase inhibitor activity (GO:0019210)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.A184_L191del(2)|p.R127_*212del(1)|p.0?(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(66)|lung(3)	71						GCGAGCCAGGTTCTCGCGGCC	0.726			"""F, O"""		"""Hodgkin Lymphoma, PMBL"""																																p.N190S	Colon(177;456 3548 27231)	Atlas-SNP	.		Rec	yes		16	16p13.13	8651	suppressor of cytokine signaling 1		L	.	SOCS1	84	.	4	Deletion - In frame(3)|Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(4)	c.A569G						PASS	.						11.0	11.0	11.0					16																	11348767		2173	4276	6449	SO:0001583	missense	8651	exon2			GCCAGGTTCTCGC	U88326	CCDS10546.1	16p13.13	2013-02-14			ENSG00000185338	ENSG00000185338		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19383	protein-coding gene	gene with protein product		603597				7796808, 9266833	Standard	NM_003745		Approved	SOCS-1, SSI-1, JAB, TIP3, Cish1	uc002dar.1	O15524	OTTHUMG00000129792	ENST00000332029.2:c.569A>G	16.37:g.11348767T>C	ENSP00000329418:p.Asn190Ser	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	78	20	0.25641	NM_003745	O15097|Q9NSA7	Missense_Mutation	SNP	ENST00000332029.2	37	CCDS10546.1	.	.	.	.	.	.	.	.	.	.	T	14.18	2.459110	0.43634	.	.	ENSG00000185338	ENST00000332029	T	0.42900	0.96	4.25	3.14	0.36123	SOCS protein, C-terminal (4);	0.312361	0.34223	N	0.004146	T	0.24812	0.0602	N	0.19112	0.55	0.39165	D	0.962486	B	0.18310	0.027	B	0.26416	0.069	T	0.06752	-1.0809	10	0.07990	T	0.79	-4.2762	10.1694	0.42900	0.0:0.0:0.168:0.832	.	190	O15524	SOCS1_HUMAN	S	190	ENSP00000329418:N190S	ENSP00000329418:N190S	N	-	2	0	SOCS1	11256268	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.092000	0.50207	0.666000	0.31087	-0.466000	0.05196	AAC	.	.	none		0.726	SOCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252018.1		
MUC5B	727897	hgsc.bcm.edu	37	11	1272843	1272843	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:1272843C>T	ENST00000529681.1	+	31	14791	c.14733C>T	c.(14731-14733)agC>agT	p.S4911S	MUC5B_ENST00000447027.1_Silent_p.S4914S|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4911	Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TGCTCCCCAGCAGCCTGCCAA	0.637																																					p.S4911S		Atlas-SNP	.											.	MUC5B	473	.	0			c.C14733T						PASS	.						53.0	63.0	60.0					11																	1272843		2167	4248	6415	SO:0001819	synonymous_variant	727897	exon31			CCCCAGCAGCCTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14733C>T	11.37:g.1272843C>T		Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	33	16	0.484848	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.	.	none		0.637	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
TACC2	10579	hgsc.bcm.edu	37	10	124009153	124009153	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:124009153G>A	ENST00000369005.1	+	22	9095	c.8755G>A	c.(8755-8757)Gcc>Acc	p.A2919T	TACC2_ENST00000369004.3_Missense_Mutation_p.A979T|TACC2_ENST00000358010.1_Missense_Mutation_p.A1065T|TACC2_ENST00000513429.1_Missense_Mutation_p.A1065T|TACC2_ENST00000369001.1_Missense_Mutation_p.A546T|TACC2_ENST00000334433.3_Missense_Mutation_p.A2919T|TACC2_ENST00000360561.3_Missense_Mutation_p.A967T|TACC2_ENST00000369000.1_Missense_Mutation_p.A542T|TACC2_ENST00000515603.1_Missense_Mutation_p.A2797T|TACC2_ENST00000368999.1_Missense_Mutation_p.A1009T|TACC2_ENST00000453444.2_Missense_Mutation_p.A2846T|TACC2_ENST00000260733.3_Missense_Mutation_p.A997T|TACC2_ENST00000515273.1_Missense_Mutation_p.A2846T	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2919					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				GCGAGTGGACGCCCTGGAAAG	0.662																																					p.A2919T		Atlas-SNP	.											.	TACC2	271	.	0			c.G8755A						PASS	.						28.0	30.0	29.0					10																	124009153		2203	4300	6503	SO:0001583	missense	10579	exon22			GTGGACGCCCTGG	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.8755G>A	10.37:g.124009153G>A	ENSP00000358001:p.Ala2919Thr	Somatic	154	0	0		WXS	Illumina HiSeq	Phase_I	128	33	0.257812	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006134	0.54361	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000369001;ENST00000369000;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733	T;T;T;T;T;T;T;T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61	5.16	4.26	0.50523	.	0.000000	0.36703	N	0.002443	T	0.52289	0.1725	N	0.17474	0.49	0.46849	D	0.999228	D;D;D;D;D;P;B;P;D	0.89917	1.0;1.0;1.0;1.0;0.998;0.539;0.434;0.862;1.0	D;D;D;D;D;B;B;B;D	0.91635	0.994;0.999;0.994;0.996;0.921;0.237;0.151;0.39;0.997	T	0.58177	-0.7682	10	0.59425	D	0.04	-14.2358	13.9465	0.64089	0.0734:0.0:0.9265:0.0	.	2846;979;2797;2846;967;997;542;1065;2919	E9PBC6;D6RAA5;E7EMZ9;B7ZMJ9;O95359-6;O95359-1;O95359-2;O95359-5;O95359	.;.;.;.;.;.;.;.;TACC2_HUMAN	T	2919;1065;2846;2797;2919;1065;2846;2832;546;542;967;1009;979;997	ENSP00000358001:A2919T;ENSP00000425062:A1065T;ENSP00000424467:A2846T;ENSP00000427618:A2797T;ENSP00000334280:A2919T;ENSP00000350701:A1065T;ENSP00000395048:A2846T;ENSP00000357997:A546T;ENSP00000357996:A542T;ENSP00000353763:A967T;ENSP00000357995:A1009T;ENSP00000422815:A979T;ENSP00000260733:A997T	ENSP00000260733:A997T	A	+	1	0	TACC2	123999143	1.000000	0.71417	0.249000	0.24280	0.041000	0.13682	5.747000	0.68689	1.322000	0.45245	-0.136000	0.14681	GCC	.	.	none		0.662	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
TSPAN31	6302	hgsc.bcm.edu	37	12	58139640	58139640	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:58139640T>C	ENST00000257910.3	+	2	450	c.176T>C	c.(175-177)aTt>aCt	p.I59T	TSPAN31_ENST00000547472.1_Intron|TSPAN31_ENST00000547992.1_Missense_Mutation_p.I59T|TSPAN31_ENST00000553221.1_3'UTR	NM_005981.3	NP_005972.1	Q12999	TSN31_HUMAN	tetraspanin 31	59					positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(1)|kidney(1)|lung(5)	7	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			CTTCTCCTTATTGCAGTGGCT	0.582																																					p.I59T		Atlas-SNP	.											.	TSPAN31	20	.	0			c.T176C						PASS	.						105.0	94.0	98.0					12																	58139640		2203	4300	6503	SO:0001583	missense	6302	exon2			TCCTTATTGCAGT		CCDS8952.1	12q13-q14	2013-02-14	2005-08-16	2005-08-16		ENSG00000135452		"""Tetraspanins"""	10539	protein-coding gene	gene with protein product		181035	"""sarcoma amplified sequence"""	SAS			Standard	NM_005981		Approved		uc001spt.3	Q12999		ENST00000257910.3:c.176T>C	12.37:g.58139640T>C	ENSP00000257910:p.Ile59Thr	Somatic	170	0	0		WXS	Illumina HiSeq	Phase_I	162	80	0.493827	NM_005981	O00577|Q53X76	Missense_Mutation	SNP	ENST00000257910.3	37	CCDS8952.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.566696	0.86439	.	.	ENSG00000135452	ENST00000257910;ENST00000547992	T	0.80653	-1.4	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	D	0.88829	0.6543	M	0.80616	2.505	0.80722	D	1	D;D	0.76494	0.989;0.999	D;D	0.85130	0.978;0.997	D	0.88313	0.2957	10	0.36615	T	0.2	-6.2344	13.35	0.60597	0.0:0.0:0.0:1.0	.	59;59	F8VS78;Q12999	.;TSN31_HUMAN	T	59	ENSP00000257910:I59T	ENSP00000257910:I59T	I	+	2	0	TSPAN31	56425907	1.000000	0.71417	0.934000	0.37439	0.960000	0.62799	7.506000	0.81665	2.053000	0.61076	0.377000	0.23210	ATT	.	.	none		0.582	TSPAN31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408778.1		
CASKIN1	57524	hgsc.bcm.edu	37	16	2239543	2239543	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:2239543C>T	ENST00000343516.6	-	4	359	c.267G>A	c.(265-267)gcG>gcA	p.A89A		NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	89					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						CCTGCCAGGCCGCATAGTGCA	0.687																																					p.A89A		Atlas-SNP	.											.	CASKIN1	130	.	0			c.G267A						PASS	.						16.0	19.0	18.0					16																	2239543		1958	4121	6079	SO:0001819	synonymous_variant	57524	exon4			CCAGGCCGCATAG	AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.267G>A	16.37:g.2239543C>T		Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	47	16	0.340426	NM_020764	Q9P2P0	Silent	SNP	ENST00000343516.6	37	CCDS42103.1																																																																																			.	.	none		0.687	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1	NM_020764	
PRDM2	7799	hgsc.bcm.edu	37	1	14105995	14105995	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:14105995T>C	ENST00000235372.7	+	8	2561	c.1705T>C	c.(1705-1707)Tat>Cat	p.Y569H	PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.Y368H|PRDM2_ENST00000413440.1_Missense_Mutation_p.Y368H|PRDM2_ENST00000311066.5_Missense_Mutation_p.Y569H|PRDM2_ENST00000505823.1_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	569					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		CTTAAATTACTATATTGATGG	0.383																																					p.Y569H		Atlas-SNP	.											.	PRDM2	147	.	0			c.T1705C						PASS	.						51.0	55.0	53.0					1																	14105995		2203	4300	6503	SO:0001583	missense	7799	exon8			AATTACTATATTG	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.1705T>C	1.37:g.14105995T>C	ENSP00000235372:p.Tyr569His	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	74	12	0.162162	NM_015866	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.963193	0.53507	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.03181	4.16;4.05;4.02;4.02	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.18087	0.0434	M	0.74881	2.28	0.58432	D	0.999993	D;D;D;D	0.89917	0.968;1.0;0.985;0.981	P;D;P;D	0.87578	0.885;0.998;0.888;0.946	T	0.00116	-1.2037	10	0.87932	D	0	.	14.651	0.68797	0.0:0.0:0.0:1.0	.	569;427;569;569	A8MW16;Q5THJ0;Q13029;Q13029-2	.;.;PRDM2_HUMAN;.	H	569;569;569;368;368	ENSP00000235372:Y569H;ENSP00000312352:Y569H;ENSP00000411103:Y368H;ENSP00000341621:Y368H	ENSP00000235372:Y569H	Y	+	1	0	PRDM2	13978582	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.673000	0.83973	2.129000	0.65627	0.533000	0.62120	TAT	.	.	none		0.383	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
UPF1	5976	hgsc.bcm.edu	37	19	18965440	18965440	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:18965440G>A	ENST00000599848.1	+	9	1429	c.1220G>A	c.(1219-1221)cGg>cAg	p.R407Q	UPF1_ENST00000262803.5_Missense_Mutation_p.R396Q			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	407	Sufficient for interaction with RENT2.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						ATTGAGCTGCGGAGCAGCGTG	0.537																																					p.R396Q		Atlas-SNP	.											.	UPF1	88	.	0			c.G1187A						PASS	.						197.0	195.0	196.0					19																	18965440		2203	4300	6503	SO:0001583	missense	5976	exon9			AGCTGCGGAGCAG	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.1220G>A	19.37:g.18965440G>A	ENSP00000470142:p.Arg407Gln	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	82	23	0.280488	NM_002911	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	37		.	.	.	.	.	.	.	.	.	.	G	19.55	3.847933	0.71603	.	.	ENSG00000005007	ENST00000262803	D	0.90197	-2.63	5.02	3.98	0.46160	.	0.052869	0.64402	D	0.000001	D	0.86838	0.6029	L	0.49126	1.545	0.80722	D	1	B;B	0.27229	0.108;0.172	B;B	0.16722	0.011;0.016	D	0.84750	0.0756	10	0.72032	D	0.01	-42.4753	12.6337	0.56671	0.0813:0.0:0.9187:0.0	.	407;396	Q92900;Q92900-2	RENT1_HUMAN;.	Q	396	ENSP00000262803:R396Q	ENSP00000262803:R396Q	R	+	2	0	UPF1	18826440	1.000000	0.71417	0.959000	0.39883	0.846000	0.48090	9.429000	0.97481	1.117000	0.41842	0.655000	0.94253	CGG	.	.	none		0.537	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911	
TMEM135	65084	hgsc.bcm.edu	37	11	86782566	86782566	+	Splice_Site	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:86782566A>T	ENST00000305494.5	+	3	310	c.271A>T	c.(271-273)Aag>Tag	p.K91*	TMEM135_ENST00000340353.7_Splice_Site_p.K91*|TMEM135_ENST00000355734.4_Splice_Site_p.K91*|TMEM135_ENST00000532959.1_Intron|TMEM135_ENST00000535167.1_De_novo_Start_OutOfFrame	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	91					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GAATTTCAGGAAGATACTTGG	0.358																																					p.K91X		Atlas-SNP	.											.	TMEM135	40	.	0			c.A271T						PASS	.						62.0	65.0	64.0					11																	86782566		2201	4299	6500	SO:0001630	splice_region_variant	65084	exon3			TTCAGGAAGATAC	BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.270-1A>T	11.37:g.86782566A>T		Somatic	229	0	0		WXS	Illumina HiSeq	Phase_I	227	107	0.471366	NM_022918	Q6AW91|Q8ND01|Q9H6M3	Nonsense_Mutation	SNP	ENST00000305494.5	37	CCDS8280.1	.	.	.	.	.	.	.	.	.	.	A	40	8.079601	0.98643	.	.	ENSG00000166575	ENST00000340353;ENST00000525018;ENST00000355734;ENST00000305494	.	.	.	5.39	5.39	0.77823	.	0.270861	0.41712	D	0.000840	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-16.2891	14.5832	0.68305	1.0:0.0:0.0:0.0	.	.	.	.	X	91	.	.	K	+	1	0	TMEM135	86460214	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.369000	0.90118	2.048000	0.60808	0.533000	0.62120	AAG	.	.	none		0.358	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393875.1	NM_022918	Nonsense_Mutation
NPEPPS	9520	hgsc.bcm.edu	37	17	45699275	45699275	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:45699275C>G	ENST00000322157.4	+	23	2986	c.2749C>G	c.(2749-2751)Ccc>Gcc	p.P917A	NPEPPS_ENST00000544660.1_Missense_Mutation_p.P837A|RP11-580I16.2_ENST00000584391.1_RNA|RP11-580I16.2_ENST00000582066.1_RNA|NPEPPS_ENST00000530173.1_Missense_Mutation_p.P913A|RP11-580I16.2_ENST00000582389.1_RNA	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	917					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						GGCCTCACCACCCACAGTGTG	0.527																																					p.P917A		Atlas-SNP	.											.	NPEPPS	59	.	0			c.C2749G						PASS	.						35.0	35.0	35.0					17																	45699275		1964	4166	6130	SO:0001583	missense	9520	exon23			TCACCACCCACAG	Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.2749C>G	17.37:g.45699275C>G	ENSP00000320324:p.Pro917Ala	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	62	14	0.225806	NM_006310	B7Z463|Q6P145|Q9NP16|Q9UEM2	Missense_Mutation	SNP	ENST00000322157.4	37	CCDS45721.1	.	.	.	.	.	.	.	.	.	.	C	5.074	0.199356	0.09652	.	.	ENSG00000141279	ENST00000530173;ENST00000322157;ENST00000544660;ENST00000528565	T;T;T;T	0.45668	5.14;5.15;5.03;0.89	5.8	3.78	0.43462	.	0.259526	0.39020	N	0.001489	T	0.24774	0.0601	N	0.22421	0.69	0.21527	N	0.999656	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.13388	-1.0511	10	0.34782	T	0.22	.	5.2014	0.15267	0.1937:0.3949:0.3422:0.0692	.	913;917	E9PLK3;P55786	.;PSA_HUMAN	A	913;917;837;167	ENSP00000433287:P913A;ENSP00000320324:P917A;ENSP00000442461:P837A;ENSP00000433549:P167A	ENSP00000320324:P917A	P	+	1	0	NPEPPS	43054274	0.798000	0.28890	0.059000	0.19551	0.487000	0.33371	1.145000	0.31577	0.761000	0.33130	0.561000	0.74099	CCC	.	.	none		0.527	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1	NM_006310	
FGFR2	2263	hgsc.bcm.edu	37	10	123325112	123325112	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:123325112C>G	ENST00000358487.5	-	3	488	c.216G>C	c.(214-216)tgG>tgC	p.W72C	FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000360144.3_Intron|FGFR2_ENST00000359354.2_Missense_Mutation_p.W72C|FGFR2_ENST00000357555.5_Intron|FGFR2_ENST00000369060.4_Missense_Mutation_p.W72C|FGFR2_ENST00000369056.1_Missense_Mutation_p.W72C|FGFR2_ENST00000346997.2_Missense_Mutation_p.W72C|FGFR2_ENST00000369061.4_Missense_Mutation_p.W72C|FGFR2_ENST00000369059.1_Intron|FGFR2_ENST00000351936.6_Missense_Mutation_p.W72C|FGFR2_ENST00000356226.4_Intron|FGFR2_ENST00000457416.2_Missense_Mutation_p.W72C	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	72	Ig-like C2-type 1.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)			breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	CATCCTTAGTCCAACTGATCA	0.552		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																												p.W72C		Atlas-SNP	.		Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	.	FGFR2	758	.	0			c.G216C						PASS	.						168.0	145.0	153.0					10																	123325112		2203	4300	6503	SO:0001583	missense	2263	exon3	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	CTTAGTCCAACTG	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.216G>C	10.37:g.123325112C>G	ENSP00000351276:p.Trp72Cys	Somatic	185	0	0		WXS	Illumina HiSeq	Phase_I	146	47	0.321918	NM_022970	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Missense_Mutation	SNP	ENST00000358487.5	37	CCDS31298.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182891	0.78677	.	.	ENSG00000066468	ENST00000369062;ENST00000369061;ENST00000358487;ENST00000369060;ENST00000346997;ENST00000457416;ENST00000351936;ENST00000369056;ENST00000369058;ENST00000359354	D;D;D;D;D;D;D;D;D	0.97161	-4.27;-4.27;-4.27;-4.27;-4.27;-4.27;-4.27;-4.27;-4.27	5.24	5.24	0.73138	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.99196	0.9721	H	0.98936	4.375	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.998;0.998;1.0;1.0;1.0	D	0.98786	1.0734	10	0.87932	D	0	.	17.3711	0.87377	0.0:1.0:0.0:0.0	.	91;91;72;91;72;72;91;72	D3DRD9;D3DRD4;B5A960;D3DRD5;P21802-18;P21802;D3DRE0;P21802-17	.;.;.;.;.;FGFR2_HUMAN;.;.	C	72	ENSP00000358057:W72C;ENSP00000351276:W72C;ENSP00000358056:W72C;ENSP00000263451:W72C;ENSP00000410294:W72C;ENSP00000309878:W72C;ENSP00000358052:W72C;ENSP00000358054:W72C;ENSP00000352309:W72C	ENSP00000263451:W72C	W	-	3	0	FGFR2	123315102	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.079000	0.76829	2.587000	0.87381	0.643000	0.83706	TGG	.	.	none		0.552	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050715.1	NM_022976, NM_000141	
CSRP2BP	57325	hgsc.bcm.edu	37	20	18131484	18131484	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:18131484A>T	ENST00000435364.3	+	3	739	c.398A>T	c.(397-399)tAc>tTc	p.Y133F	CSRP2BP_ENST00000489634.2_Missense_Mutation_p.Y5F|CSRP2BP_ENST00000377681.3_Missense_Mutation_p.Y133F	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	133					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						TTGGCAATGTACAACTTGTCT	0.413																																					p.Y133F		Atlas-SNP	.											.	CSRP2BP	80	.	0			c.A398T						PASS	.						264.0	246.0	252.0					20																	18131484		2203	4300	6503	SO:0001583	missense	57325	exon3			CAATGTACAACTT	AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.398A>T	20.37:g.18131484A>T	ENSP00000392318:p.Tyr133Phe	Somatic	213	0	0		WXS	Illumina HiSeq	Phase_I	186	54	0.290323	NM_020536	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.737051	0.89482	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.36878	1.84;1.84;1.84;1.23	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.55752	0.1940	L	0.58510	1.815	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.70935	0.971;0.956	T	0.58962	-0.7543	10	0.66056	D	0.02	-6.9195	15.1792	0.72941	1.0:0.0:0.0:0.0	.	5;133	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	F	133;133;133;5	ENSP00000278816:Y133F;ENSP00000366909:Y133F;ENSP00000392318:Y133F;ENSP00000425909:Y5F	ENSP00000278816:Y133F	Y	+	2	0	CSRP2BP	18079484	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.564000	0.90726	2.044000	0.60594	0.455000	0.32223	TAC	.	.	none		0.413	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536	
XIRP2	129446	hgsc.bcm.edu	37	2	168106466	168106466	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:168106466A>G	ENST00000409195.1	+	9	8653	c.8564A>G	c.(8563-8565)cAa>cGa	p.Q2855R	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.Q2633R|XIRP2_ENST00000295237.9_Missense_Mutation_p.Q2855R|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2680					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GTCGTCAAGCAAAAGGTTATC	0.378																																					p.Q2855R		Atlas-SNP	.											XIRP2,NS,carcinoma,0,1	XIRP2	914	1	0			c.A8564G						scavenged	.						118.0	114.0	116.0					2																	168106466		1885	4112	5997	SO:0001583	missense	129446	exon9			TCAAGCAAAAGGT	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.8564A>G	2.37:g.168106466A>G	ENSP00000386840:p.Gln2855Arg	Somatic	340	2	0.00588235		WXS	Illumina HiSeq	Phase_I	352	114	0.323864	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	A	12.45	1.940991	0.34283	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02763	4.17;4.17;4.17	5.82	4.64	0.57946	.	0.577929	0.18468	N	0.140332	T	0.07773	0.0195	M	0.67953	2.075	0.09310	N	0.999998	P;P;P	0.49090	0.868;0.919;0.919	B;P;P	0.48795	0.386;0.59;0.59	T	0.08166	-1.0735	10	0.66056	D	0.02	-5.8378	12.1135	0.53852	0.8561:0.1439:0.0:0.0	.	2680;2680;2633	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	R	2855;2855;2633;269	ENSP00000386840:Q2855R;ENSP00000295237:Q2855R;ENSP00000387255:Q2633R	ENSP00000295237:Q2855R	Q	+	2	0	XIRP2	167814712	0.995000	0.38212	0.041000	0.18516	0.307000	0.27823	1.995000	0.40767	1.001000	0.39076	0.533000	0.62120	CAA	.	.	none		0.378	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
PAPD4	167153	hgsc.bcm.edu	37	5	78915498	78915498	+	Silent	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:78915498C>A	ENST00000296783.3	+	3	326	c.27C>A	c.(25-27)cgC>cgA	p.R9R	PAPD4_ENST00000453514.1_Silent_p.R9R|PAPD4_ENST00000428308.2_Silent_p.R9R|PAPD4_ENST00000423041.2_Silent_p.R9R|PAPD4_ENST00000504233.1_Silent_p.R9R			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	9				R -> H (in Ref. 1; BAC04629). {ECO:0000305}.	hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)			biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		TTTTGGGTCGCCCACCCTTCA	0.358																																					p.R9R		Atlas-SNP	.											.	PAPD4	51	.	0			c.C27A						PASS	.						104.0	101.0	102.0					5																	78915498		2203	4300	6503	SO:0001819	synonymous_variant	167153	exon3			GGGTCGCCCACCC	AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.27C>A	5.37:g.78915498C>A		Somatic	354	0	0		WXS	Illumina HiSeq	Phase_I	413	169	0.409201	NM_173797	Q86WZ2|Q8N927	Silent	SNP	ENST00000296783.3	37	CCDS4048.1																																																																																			.	.	none		0.358	PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226967.1	NM_173797	
SVIL	6840	hgsc.bcm.edu	37	10	29751241	29751241	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:29751241C>G	ENST00000355867.4	-	36	7119	c.6367G>C	c.(6367-6369)Gag>Cag	p.E2123Q	PTCHD3P1_ENST00000423223.1_RNA|SVIL_ENST00000375400.3_Missense_Mutation_p.E1697Q|PTCHD3P1_ENST00000413405.1_RNA|PTCHD3P1_ENST00000446807.1_RNA|PTCHD3P1_ENST00000455774.1_RNA|SVIL_ENST00000375398.2_Missense_Mutation_p.E2123Q|PTCHD3P1_ENST00000414457.1_RNA|PTCHD3P1_ENST00000445521.1_RNA|SVIL_ENST00000535393.1_Missense_Mutation_p.E1037Q	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	2123					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TCTCTGTGCTCCCAGCTGGGA	0.502																																					p.E2123Q		Atlas-SNP	.											.	SVIL	226	.	0			c.G6367C						PASS	.						143.0	136.0	139.0					10																	29751241		2203	4300	6503	SO:0001583	missense	6840	exon36			TGTGCTCCCAGCT	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.6367G>C	10.37:g.29751241C>G	ENSP00000348128:p.Glu2123Gln	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	109	29	0.266055	NM_021738	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	37	CCDS7164.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.908113	0.92107	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867;ENST00000535393	T;T;T;T	0.14391	2.63;2.65;2.65;2.51	4.54	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.35885	0.0947	M	0.62723	1.935	0.80722	D	1	D;P;P	0.76494	0.999;0.5;0.865	D;B;P	0.76071	0.987;0.336;0.594	T	0.14811	-1.0459	10	0.72032	D	0.01	-23.7608	17.4772	0.87662	0.0:1.0:0.0:0.0	.	1037;1697;2123	F5H2Q5;O95425-2;O95425	.;.;SVIL_HUMAN	Q	1697;2123;2123;1037	ENSP00000364549:E1697Q;ENSP00000364547:E2123Q;ENSP00000348128:E2123Q;ENSP00000445472:E1037Q	ENSP00000348128:E2123Q	E	-	1	0	SVIL	29791247	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.551000	0.82182	2.339000	0.79563	0.561000	0.74099	GAG	.	.	none		0.502	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
LEKR1	389170	hgsc.bcm.edu	37	3	156742690	156742690	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:156742690G>A	ENST00000470811.1	+	12	1768	c.433G>A	c.(433-435)Gaa>Aaa	p.E145K	LEKR1_ENST00000356539.4_Missense_Mutation_p.E449K			Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1	145										breast(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GTATAAGAAAGAACAAGAGGA	0.303																																					p.E449K		Atlas-SNP	.											.	LEKR1	66	.	0			c.G1345A						PASS	.						55.0	57.0	57.0					3																	156742690		2203	4300	6503	SO:0001583	missense	389170	exon11			AAGAAAGAACAAG	AK131473	CCDS54660.1	3q25.31	2014-02-12	2008-02-21		ENSG00000197980	ENSG00000197980			33765	protein-coding gene	gene with protein product		613536					Standard	NM_001004316		Approved	FLJ16641	uc021xgh.1	Q6ZMV7	OTTHUMG00000160130	ENST00000470811.1:c.433G>A	3.37:g.156742690G>A	ENSP00000418214:p.Glu145Lys	Somatic	274	0	0		WXS	Illumina HiSeq	Phase_I	283	40	0.141343	NM_001004316		Missense_Mutation	SNP	ENST00000470811.1	37		.	.	.	.	.	.	.	.	.	.	G	18.14	3.558339	0.65538	.	.	ENSG00000178110	ENST00000470811;ENST00000356539	T;T	0.57107	0.47;0.42	5.63	5.63	0.86233	.	0.102632	0.43110	D	0.000612	T	0.68897	0.3051	M	0.69823	2.125	0.37085	D	0.899169	D	0.64830	0.994	D	0.65773	0.938	T	0.68089	-0.5501	10	0.21014	T	0.42	-10.1711	16.6082	0.84836	0.0:0.0:1.0:0.0	.	145	Q6ZMV7	LEKR1_HUMAN	K	145;449	ENSP00000418214:E145K;ENSP00000348936:E449K	ENSP00000348936:E449K	E	+	1	0	LEKR1	158225384	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.743000	0.68655	2.644000	0.89710	0.563000	0.77884	GAA	.	.	none		0.303	LEKR1-010	KNOWN	upstream_ATG|basic	protein_coding	protein_coding	OTTHUMT00000351625.3	NM_001004316	
RBMXL3	139804	hgsc.bcm.edu	37	X	114426499	114426499	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chrX:114426499G>T	ENST00000424776.3	+	1	2537	c.2495G>T	c.(2494-2496)gGc>gTc	p.G832V	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	832	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						AACAGCGGAGGCCACTCACCC	0.627																																					p.G832V		Atlas-SNP	.											.	RBMXL3	83	.	0			c.G2495T						PASS	.						30.0	30.0	30.0					X																	114426499		692	1591	2283	SO:0001583	missense	139804	exon1			GCGGAGGCCACTC	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.2495G>T	X.37:g.114426499G>T	ENSP00000417451:p.Gly832Val	Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	33	22	0.666667	NM_001145346	B4DXC0	Missense_Mutation	SNP	ENST00000424776.3	37	CCDS55478.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262083	0.23051	.	.	ENSG00000175718	ENST00000424776	T	0.07800	3.16	0.853	0.853	0.19001	.	.	.	.	.	T	0.04003	0.0112	N	0.08118	0	0.26621	N	0.972652	B	0.17667	0.023	B	0.08055	0.003	T	0.38156	-0.9674	9	0.87932	D	0	.	4.3667	0.11228	1.0E-4:0.0:0.6211:0.3788	.	832	Q8N7X1	RMXL3_HUMAN	V	832	ENSP00000417451:G832V	ENSP00000417451:G832V	G	+	2	0	RBMXL3	114332755	0.663000	0.27448	0.006000	0.13384	0.006000	0.05464	0.115000	0.15540	0.108000	0.17862	0.110000	0.15639	GGC	.	.	none		0.627	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
NCKAP1	10787	hgsc.bcm.edu	37	2	183822287	183822287	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:183822287G>A	ENST00000361354.4	-	19	2291	c.1919C>T	c.(1918-1920)gCa>gTa	p.A640V	NCKAP1_ENST00000360982.2_Missense_Mutation_p.A646V	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	640					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			CTTATTCACTGCTTGACTGAT	0.383																																					p.A646V		Atlas-SNP	.											.	NCKAP1	105	.	0			c.C1937T						PASS	.						161.0	141.0	148.0					2																	183822287		2203	4300	6503	SO:0001583	missense	10787	exon20			TTCACTGCTTGAC	AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.1919C>T	2.37:g.183822287G>A	ENSP00000355348:p.Ala640Val	Somatic	348	0	0		WXS	Illumina HiSeq	Phase_I	297	23	0.0774411	NM_205842	O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	ENST00000361354.4	37	CCDS2287.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213566	0.58452	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.31247	1.5;1.5	5.39	4.5	0.54988	.	0.046925	0.85682	D	0.000000	T	0.33498	0.0865	N	0.16656	0.425	0.80722	D	1	D;D	0.57899	0.981;0.976	P;P	0.60117	0.869;0.793	T	0.05886	-1.0858	10	0.17832	T	0.49	-15.0139	15.3439	0.74320	0.0:0.0:0.859:0.141	.	640;646	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	V	640;646	ENSP00000355348:A640V;ENSP00000354251:A646V	ENSP00000354251:A646V	A	-	2	0	NCKAP1	183530532	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.809000	0.99208	1.230000	0.43646	0.655000	0.94253	GCA	.	.	none		0.383	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842	
TRIO	7204	hgsc.bcm.edu	37	5	14397228	14397228	+	Missense_Mutation	SNP	G	G	A	rs373502206		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:14397228G>A	ENST00000344204.4	+	29	4412	c.4388G>A	c.(4387-4389)cGa>cAa	p.R1463Q	TRIO_ENST00000537187.1_Missense_Mutation_p.R1463Q|TRIO_ENST00000509967.2_Missense_Mutation_p.R1414Q	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1463	DH 1. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GTGCCGAAGCGAGCCAATGAT	0.493																																					p.R1463Q		Atlas-SNP	.											.	TRIO	305	.	0			c.G4388A						PASS	.	G	GLN/ARG	0,4406		0,0,2203	97.0	87.0	91.0		4388	5.7	1.0	5		91	1,8597	1.2+/-3.3	0,1,4298	no	missense	TRIO	NM_007118.2	43	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1463/3098	14397228	1,13003	2203	4299	6502	SO:0001583	missense	7204	exon29			CGAAGCGAGCCAA	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.4388G>A	5.37:g.14397228G>A	ENSP00000339299:p.Arg1463Gln	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	118	11	0.0932203	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409928	0.83340	0.0	1.16E-4	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.61980	0.06;0.06;0.06	5.65	5.65	0.86999	Dbl homology (DH) domain (5);	0.058548	0.64402	D	0.000002	T	0.65954	0.2741	L	0.48260	1.515	0.58432	D	0.999997	P;D;D	0.64830	0.931;0.979;0.994	P;B;P	0.48571	0.485;0.34;0.582	T	0.67906	-0.5549	10	0.59425	D	0.04	.	20.0965	0.97849	0.0:0.0:1.0:0.0	.	1414;1463;1463	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	Q	1463;1463;1414;1150	ENSP00000339299:R1463Q;ENSP00000446348:R1463Q;ENSP00000445592:R1414Q	ENSP00000339299:R1463Q	R	+	2	0	TRIO	14450228	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	4.018000	0.57174	2.824000	0.97209	0.655000	0.94253	CGA	.	.	weak		0.493	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
C5orf60	285679	hgsc.bcm.edu	37	5	179071893	179071893	+	Silent	SNP	A	A	G	rs4990388	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:179071893A>G	ENST00000448248.2	-	1	154	c.129T>C	c.(127-129)ttT>ttC	p.F43F	C5orf60_ENST00000506142.1_Intron	NM_001142306.1	NP_001135778.1	A6NFR6	CE060_HUMAN	chromosome 5 open reading frame 60	43						integral component of membrane (GO:0016021)		p.F43F(2)		NS(1)|breast(1)|kidney(5)	7						TGAACACAACAAAGAGGACGA	0.517													-|||	83	0.0165735	0.0575	0.0058	5008	,	,		23296	0.0		0.002	False		,,,				2504	0.001				p.F43F		Atlas-SNP	.											C5orf60,NS,carcinoma,0,2	C5orf60	24	2	2	Substitution - coding silent(2)	kidney(2)	c.T129C						scavenged	.						89.0	84.0	86.0					5																	179071893		692	1591	2283	SO:0001819	synonymous_variant	285679	exon1			CACAACAAAGAGG	BC043435	CCDS47353.1	5q35.3	2010-08-19			ENSG00000204661	ENSG00000204661			27753	protein-coding gene	gene with protein product						12477932	Standard	NM_001142306		Approved		uc003mki.3	A6NFR6	OTTHUMG00000163221	ENST00000448248.2:c.129T>C	5.37:g.179071893A>G		Somatic	120	3	0.025		WXS	Illumina HiSeq	Phase_I	152	8	0.0526316	NM_001142306	A1L488|B7ZM52|B7ZM53	Silent	SNP	ENST00000448248.2	37	CCDS47353.1																																																																																			A|0.993;G|0.007	0.007	strong		0.517	C5orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372148.2	NM_001142306	
C9orf41	138199	hgsc.bcm.edu	37	9	77632226	77632226	+	Silent	SNP	T	T	C	rs541125527		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:77632226T>C	ENST00000376834.3	-	2	521	c.369A>G	c.(367-369)ctA>ctG	p.L123L	C9orf41_ENST00000376830.3_Silent_p.L123L|C9orf41_ENST00000376837.3_Silent_p.L123L|RP11-197P3.5_ENST00000455336.2_RNA	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	123										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						CAATGGTCAGTAGTATTTCTT	0.338																																					p.L123L		Atlas-SNP	.											.	C9orf41	57	.	0			c.A369G						PASS	.						127.0	116.0	120.0					9																	77632226		2203	4300	6503	SO:0001819	synonymous_variant	138199	exon2			GGTCAGTAGTATT	AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.369A>G	9.37:g.77632226T>C		Somatic	161	0	0		WXS	Illumina HiSeq	Phase_I	157	45	0.286624	NM_152420	Q7Z383|Q8N7C5	Silent	SNP	ENST00000376834.3	37	CCDS6649.1																																																																																			.	.	none		0.338	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052703.1	NM_152420	
FAT4	79633	hgsc.bcm.edu	37	4	126240717	126240717	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:126240717C>T	ENST00000394329.3	+	1	3164	c.3151C>T	c.(3151-3153)Caa>Taa	p.Q1051*		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1051	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CCCAGATGGTCAATTGTATAT	0.408																																					p.Q1051X		Atlas-SNP	.											FAT4_ENST00000394329,colon,carcinoma,0,2	FAT4	1752	2	0			c.C3151T						PASS	.						117.0	110.0	112.0					4																	126240717		1863	4101	5964	SO:0001587	stop_gained	79633	exon1			GATGGTCAATTGT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.3151C>T	4.37:g.126240717C>T	ENSP00000377862:p.Gln1051*	Somatic	164	0	0		WXS	Illumina HiSeq	Phase_I	148	23	0.155405	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Nonsense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	42	9.324994	0.99137	.	.	ENSG00000196159	ENST00000394329	.	.	.	4.56	4.56	0.56223	.	0.000000	0.32852	U	0.005574	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	17.5378	0.87837	0.0:1.0:0.0:0.0	.	.	.	.	X	1051	.	ENSP00000377862:Q1051X	Q	+	1	0	FAT4	126460167	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.495000	0.81514	2.354000	0.79902	0.462000	0.41574	CAA	.	.	none		0.408	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
SH3RF2	153769	hgsc.bcm.edu	37	5	145428733	145428733	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:145428733G>C	ENST00000511217.1	+	6	1299	c.1247G>C	c.(1246-1248)gGc>gCc	p.G416A	SH3RF2_ENST00000359120.4_Missense_Mutation_p.G416A			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	416	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGCCAGGACGGCTGGCTCAGG	0.597											OREG0016895	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G416A		Atlas-SNP	.											.	SH3RF2	58	.	0			c.G1247C						PASS	.						65.0	66.0	65.0					5																	145428733		2203	4300	6503	SO:0001583	missense	153769	exon7			AGGACGGCTGGCT	AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.1247G>C	5.37:g.145428733G>C	ENSP00000424497:p.Gly416Ala	Somatic	101	0	0	1694	WXS	Illumina HiSeq	Phase_I	101	23	0.227723	NM_152550	A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Missense_Mutation	SNP	ENST00000511217.1	37	CCDS4280.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.309463	0.81247	.	.	ENSG00000156463	ENST00000359120;ENST00000511217	T;T	0.42513	0.97;0.97	5.51	5.51	0.81932	Src homology-3 domain (4);	0.070489	0.64402	D	0.000018	T	0.58047	0.2095	M	0.91300	3.195	0.80722	D	1	P	0.36753	0.568	B	0.38225	0.268	T	0.68330	-0.5437	10	0.87932	D	0	-25.1307	18.1751	0.89759	0.0:0.0:1.0:0.0	.	416	Q8TEC5	SH3R2_HUMAN	A	416	ENSP00000352028:G416A;ENSP00000424497:G416A	ENSP00000352028:G416A	G	+	2	0	SH3RF2	145408926	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.687000	0.98667	2.587000	0.87381	0.484000	0.47621	GGC	.	.	none		0.597	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372804.1	NM_152550	
TBCC	6903	hgsc.bcm.edu	37	6	42713452	42713452	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:42713452C>T	ENST00000372876.1	-	1	382	c.360G>A	c.(358-360)ctG>ctA	p.L120L	TBCC_ENST00000244625.2_Silent_p.L120L	NM_003192.2	NP_003183	Q15814	TBCC_HUMAN	tubulin folding cofactor C	120					'de novo' posttranslational protein folding (GO:0051084)|cell morphogenesis (GO:0000902)|cellular protein metabolic process (GO:0044267)|GTP catabolic process (GO:0006184)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)	chaperone binding (GO:0051087)|GTPase activity (GO:0003924)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(3)	14	Colorectal(47;0.196)		all cancers(41;0.00122)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.125)			AGGCCGCCTGCAGCCGCGCCA	0.627																																					p.L120L		Atlas-SNP	.											.	TBCC	31	.	0			c.G360A						PASS	.						18.0	24.0	22.0					6																	42713452		2172	4260	6432	SO:0001819	synonymous_variant	6903	exon1			CGCCTGCAGCCGC	U61234	CCDS4872.1	6p21.1	2008-02-05	2006-11-21		ENSG00000124659	ENSG00000124659			11580	protein-coding gene	gene with protein product		602971	"""tubulin-specific chaperone c"""			8706133, 11847227	Standard	NM_003192		Approved	CFC	uc003osl.3	Q15814	OTTHUMG00000014704	ENST00000372876.1:c.360G>A	6.37:g.42713452C>T		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	41	13	0.317073	NM_003192	Q53Y43|Q5T787	Silent	SNP	ENST00000372876.1	37	CCDS4872.1																																																																																			.	.	none		0.627	TBCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040559.1	NM_003192	
CD83	9308	hgsc.bcm.edu	37	6	14118269	14118269	+	Missense_Mutation	SNP	G	G	C	rs199841901		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:14118269G>C	ENST00000379153.3	+	2	297	c.126G>C	c.(124-126)caG>caC	p.Q42H		NM_001040280.1|NM_001251901.1|NM_004233.3	NP_001035370.1|NP_001238830.1|NP_004224.1	Q01151	CD83_HUMAN	CD83 molecule	42	Ig-like V-type.				defense response (GO:0006952)|humoral immune response (GO:0006959)|negative regulation of interleukin-4 production (GO:0032713)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|response to organic cyclic compound (GO:0014070)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	12	Breast(50;0.00245)|Ovarian(93;0.137)	all_hematologic(90;0.117)				GGGATCCGCAGGTTCCCTACA	0.617																																					p.Q42H		Atlas-SNP	.											CD83,NS,lymphoid_neoplasm,0,1	CD83	23	1	0			c.G126C						PASS	.						27.0	28.0	28.0					6																	14118269		2203	4300	6503	SO:0001583	missense	9308	exon2			TCCGCAGGTTCCC	Z11697	CCDS4532.1, CCDS75403.1	6p23	2013-01-11	2006-03-31		ENSG00000112149	ENSG00000112149		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1703	protein-coding gene	gene with protein product		604534	"""CD83 antigen (activated B lymphocytes, immunoglobulin superfamily)"", ""CD83 molecule """			1378080, 8422464	Standard	NM_001251901		Approved	HB15, BL11	uc003nbi.3	Q01151	OTTHUMG00000014283	ENST00000379153.3:c.126G>C	6.37:g.14118269G>C	ENSP00000368450:p.Gln42His	Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	25	7	0.28	NM_004233	Q5THX9	Missense_Mutation	SNP	ENST00000379153.3	37	CCDS4532.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	7.529	0.658198	0.14645	.	.	ENSG00000112149	ENST00000379153	T	0.66280	-0.2	4.56	2.7	0.31948	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.543413	0.18136	N	0.150580	T	0.32133	0.0819	L	0.58101	1.795	0.09310	N	1	B	0.18013	0.025	B	0.19946	0.027	T	0.25710	-1.0124	10	0.27082	T	0.32	-2.8511	6.4298	0.21790	0.103:0.1834:0.7136:0.0	.	42	Q01151	CD83_HUMAN	H	42	ENSP00000368450:Q42H	ENSP00000368450:Q42H	Q	+	3	2	CD83	14226248	0.001000	0.12720	0.010000	0.14722	0.232000	0.25224	-0.028000	0.12350	0.324000	0.23333	0.491000	0.48974	CAG	G|1.000;C|0.000	0.000	strong		0.617	CD83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039916.1		
UBE2J1	51465	hgsc.bcm.edu	37	6	90062277	90062277	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:90062277G>A	ENST00000435041.2	-	1	290	c.12C>T	c.(10-12)cgC>cgT	p.R4R		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	4					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		TCAGGTTGTAGCGGGTCTCCA	0.761																																					p.R4R		Atlas-SNP	.											.	UBE2J1	28	.	0			c.C12T						PASS	.						17.0	18.0	17.0					6																	90062277		2192	4280	6472	SO:0001819	synonymous_variant	51465	exon1			GTTGTAGCGGGTC	AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.12C>T	6.37:g.90062277G>A		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	48	16	0.333333	NM_016021	A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Silent	SNP	ENST00000435041.2	37	CCDS5021.1																																																																																			.	.	none		0.761	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043742.2	NM_016021	
ZFHX4	79776	hgsc.bcm.edu	37	8	77616687	77616687	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:77616687A>T	ENST00000521891.2	+	2	812	c.364A>T	c.(364-366)Agt>Tgt	p.S122C	ZFHX4_ENST00000455469.2_Missense_Mutation_p.S122C|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Missense_Mutation_p.S122C|ZFHX4_ENST00000518282.1_Missense_Mutation_p.S122C	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	122					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GTTAGAGGACAGTGACGTGGA	0.483										HNSCC(33;0.089)																											p.S122C		Atlas-SNP	.											ZFHX4,colon,carcinoma,-1,1	ZFHX4	878	1	0			c.A364T						PASS	.						139.0	134.0	135.0					8																	77616687		1975	4171	6146	SO:0001583	missense	79776	exon2			GAGGACAGTGACG		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.364A>T	8.37:g.77616687A>T	ENSP00000430497:p.Ser122Cys	Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	99	42	0.424242	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	18.06	3.538749	0.65085	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000520307;ENST00000517585;ENST00000523809;ENST00000518282	T;T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27;1.27	5.42	5.42	0.78866	.	0.000000	0.52532	U	0.000073	T	0.60157	0.2247	M	0.71581	2.175	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.998;0.998;0.998	T	0.63808	-0.6553	10	0.72032	D	0.01	.	15.6293	0.76888	1.0:0.0:0.0:0.0	.	122;122;122;122	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	C	122	ENSP00000430497:S122C;ENSP00000399605:S122C;ENSP00000050961:S122C;ENSP00000428525:S122C;ENSP00000427775:S122C;ENSP00000427739:S122C;ENSP00000430848:S122C	ENSP00000050961:S122C	S	+	1	0	ZFHX4	77779242	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.106000	0.94253	2.276000	0.75962	0.528000	0.53228	AGT	.	.	none		0.483	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
FASN	2194	hgsc.bcm.edu	37	17	80046669	80046669	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:80046669G>T	ENST00000306749.2	-	15	2606	c.2388C>A	c.(2386-2388)ttC>ttA	p.F796L		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	796	Acyl and malonyl transferases. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	TGCCGGCCAGGAAGAACTCCA	0.682																																					p.F796L	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.C2388A						PASS	.						41.0	43.0	42.0					17																	80046669		2202	4296	6498	SO:0001583	missense	2194	exon15			GGCCAGGAAGAAC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.2388C>A	17.37:g.80046669G>T	ENSP00000304592:p.Phe796Leu	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	51	19	0.372549	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.841118	0.51057	.	.	ENSG00000169710	ENST00000306749	T	0.47869	0.83	4.16	1.42	0.22433	Acyl transferase (1);	0.000000	0.85682	D	0.000000	T	0.45418	0.1341	N	0.21448	0.665	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.27054	-1.0085	10	0.17832	T	0.49	-23.5367	7.5118	0.27577	0.1229:0.1518:0.7253:0.0	.	796	P49327	FAS_HUMAN	L	796	ENSP00000304592:F796L	ENSP00000304592:F796L	F	-	3	2	FASN	77639958	1.000000	0.71417	0.958000	0.39756	0.212000	0.24457	4.590000	0.61013	0.100000	0.17581	0.462000	0.41574	TTC	.	.	none		0.682	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
CCNH	902	hgsc.bcm.edu	37	5	86708576	86708576	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:86708576G>A	ENST00000256897.4	-	1	260	c.36C>T	c.(34-36)acC>acT	p.T12T	CCNH_ENST00000508855.1_5'Flank|CCNH_ENST00000504878.1_5'UTR|CCNH_ENST00000513499.1_5'UTR	NM_001239.3	NP_001230.1	P51946	CCNH_HUMAN	cyclin H	12					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cyclin-dependent protein kinase activating kinase holoenzyme complex (GO:0019907)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|TFIIK complex (GO:0070985)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(2)	15		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		CGCTGGAGAAGGTCCAGTGCC	0.577								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																													p.T12T		Atlas-SNP	.											.	CCNH	40	.	0			c.C36T						PASS	.						96.0	74.0	82.0					5																	86708576		2203	4300	6503	SO:0001819	synonymous_variant	902	exon1			GGAGAAGGTCCAG	U12685	CCDS4064.1	5q13.3-q14	2014-03-28			ENSG00000134480	ENSG00000134480		"""General transcription factor IIH complex subunits"""	1594	protein-coding gene	gene with protein product	"""CDK-activating kinase complex subunit"", ""cyclin-dependent kinase-activating kinase complex subunit"", ""MO15-associated protein"", ""CAK complex subunit"""	601953				9465303	Standard	NM_001239		Approved	p34, p37, CycH	uc003kjb.3	P51946	OTTHUMG00000119077	ENST00000256897.4:c.36C>T	5.37:g.86708576G>A		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	64	26	0.40625	NM_001239	Q53X72|Q8TBL9	Silent	SNP	ENST00000256897.4	37	CCDS4064.1																																																																																			.	.	none		0.577	CCNH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239291.3	NM_001239	
SHANK1	50944	hgsc.bcm.edu	37	19	51169477	51169477	+	Missense_Mutation	SNP	C	C	T	rs549051295		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:51169477C>T	ENST00000293441.1	-	22	5758	c.5740G>A	c.(5740-5742)Gag>Aag	p.E1914K	SHANK1_ENST00000391813.1_Missense_Mutation_p.E1301K|SYT3_ENST00000544769.1_Intron|SHANK1_ENST00000359082.3_Missense_Mutation_p.E1905K|SHANK1_ENST00000391814.1_Missense_Mutation_p.E1922K	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1914					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GAGGTCCTCTCGGGGACATAG	0.687																																					p.E1914K		Atlas-SNP	.											SHANK1,caecum,carcinoma,0,1	SHANK1	210	1	0			c.G5740A						scavenged	.						14.0	12.0	13.0					19																	51169477		2197	4289	6486	SO:0001583	missense	50944	exon22			TCCTCTCGGGGAC	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.5740G>A	19.37:g.51169477C>T	ENSP00000293441:p.Glu1914Lys	Somatic	66	1	0.0151515		WXS	Illumina HiSeq	Phase_I	49	14	0.285714	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	37	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	C	9.758	1.169414	0.21621	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.39229	1.21;1.67;1.2;1.09	2.46	2.46	0.29980	.	0.963048	0.08427	U	0.947541	T	0.38746	0.1052	L	0.46157	1.445	0.35068	D	0.762213	D;D	0.67145	0.993;0.996	B;P	0.48030	0.361;0.564	T	0.42310	-0.9459	10	0.07175	T	0.84	.	10.6653	0.45726	0.0:1.0:0.0:0.0	.	1914;1301	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	K	1914;1301;1905;1922	ENSP00000293441:E1914K;ENSP00000375689:E1301K;ENSP00000351984:E1905K;ENSP00000375690:E1922K	ENSP00000293441:E1914K	E	-	1	0	SHANK1	55861289	0.997000	0.39634	0.872000	0.34217	0.521000	0.34408	4.778000	0.62368	1.682000	0.51000	0.195000	0.17529	GAG	.	.	none		0.687	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
VPS35	55737	hgsc.bcm.edu	37	16	46706252	46706252	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:46706252C>T	ENST00000299138.7	-	11	1351	c.1293G>A	c.(1291-1293)gaG>gaA	p.E431E	VPS35_ENST00000568642.1_5'Flank	NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	431					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TCTTTCTGGACTCGTAGTCAA	0.348																																					p.E431E		Atlas-SNP	.											VPS35,NS,carcinoma,-2,1	VPS35	49	1	0			c.G1293A						PASS	.						82.0	82.0	82.0					16																	46706252		2203	4300	6503	SO:0001819	synonymous_variant	55737	exon11			TCTGGACTCGTAG	AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.1293G>A	16.37:g.46706252C>T		Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	165	15	0.0909091	NM_018206	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Silent	SNP	ENST00000299138.7	37	CCDS10721.1																																																																																			.	.	none		0.348	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255742.3		
GALNT11	63917	hgsc.bcm.edu	37	7	151818708	151818708	+	Silent	SNP	C	C	T	rs368113531		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:151818708C>T	ENST00000434507.1	+	14	2210	c.1773C>T	c.(1771-1773)gtC>gtT	p.V591V	GALNT11_ENST00000430044.2_Silent_p.V591V|RP5-981O7.2_ENST00000424630.1_RNA|GALNT11_ENST00000452146.2_Silent_p.V510V|GALNT11_ENST00000320311.2_Silent_p.V591V			Q8NCW6	GLT11_HUMAN	polypeptide N-acetylgalactosaminyltransferase 11	591	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via threonine (GO:0018243)|regulation of Notch signaling pathway (GO:0008593)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|Notch binding (GO:0005112)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.V591V(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|prostate(5)|skin(2)	27	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		AGGGCTCTGTCGCCATGGCGA	0.532																																					p.V591V		Atlas-SNP	.											GALNT11,NS,carcinoma,0,1	GALNT11	59	1	2	Substitution - coding silent(2)	lung(2)	c.C1773T						PASS	.	T		1,4405	2.1+/-5.4	0,1,2202	126.0	101.0	110.0		1773	-10.4	0.0	7		110	0,8600		0,0,4300	no	coding-synonymous	GALNT11	NM_022087.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		591/609	151818708	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	63917	exon12			CTCTGTCGCCATG	AC006017	CCDS5930.1	7q36.1	2014-05-09	2014-05-09		ENSG00000178234	ENSG00000178234	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19875	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 11"""	615130	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)"""			11925450	Standard	NM_022087		Approved	GalNAc-T11	uc010lqg.1	Q8NCW6	OTTHUMG00000157251	ENST00000434507.1:c.1773C>T	7.37:g.151818708C>T		Somatic	216	0	0		WXS	Illumina HiSeq	Phase_I	165	49	0.29697	NM_022087	B3KWF4|Q6PCD1|Q9H6C2|Q9H6Z5|Q9UDR8	Silent	SNP	ENST00000434507.1	37	CCDS5930.1																																																																																			.	.	weak		0.532	GALNT11-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348184.1	NM_022087	
ST7L	54879	hgsc.bcm.edu	37	1	113126634	113126634	+	Missense_Mutation	SNP	C	C	A	rs200595897		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:113126634C>A	ENST00000358039.4	-	7	1120	c.816G>T	c.(814-816)caG>caT	p.Q272H	ST7L_ENST00000369668.2_Missense_Mutation_p.Q272H|ST7L_ENST00000538187.1_Missense_Mutation_p.Q216H|ST7L_ENST00000369669.1_Missense_Mutation_p.Q89H|ST7L_ENST00000463235.1_5'UTR|ST7L_ENST00000369666.1_Missense_Mutation_p.Q255H|ST7L_ENST00000360743.4_Missense_Mutation_p.Q272H|ST7L_ENST00000543570.1_Missense_Mutation_p.Q255H|ST7L_ENST00000544629.1_Missense_Mutation_p.Q207H|ST7L_ENST00000343210.7_Missense_Mutation_p.Q272H|ST7L_ENST00000490067.1_Missense_Mutation_p.Q255H	NM_017744.4|NM_138727.3	NP_060214.2|NP_620055.1	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7 like	272					negative regulation of cell growth (GO:0030308)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(3)|lung(1)|prostate(2)|stomach(1)|urinary_tract(3)	15	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCTGGCACTGCTGTGACTGCC	0.408																																					p.Q272H		Atlas-SNP	.											.	ST7L	31	.	0			c.G816T						PASS	.						179.0	160.0	166.0					1																	113126634		2203	4300	6503	SO:0001583	missense	54879	exon7			GCACTGCTGTGAC	AB081317	CCDS848.1, CCDS849.1, CCDS850.1, CCDS852.1	1p13.1	2008-06-06			ENSG00000007341	ENSG00000007341			18441	protein-coding gene	gene with protein product						12012006	Standard	NM_138729		Approved	FLJ20284, STLR, ST7R, FAM4B	uc001ecd.3	Q8TDW4	OTTHUMG00000011753	ENST00000358039.4:c.816G>T	1.37:g.113126634C>A	ENSP00000350734:p.Gln272His	Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	164	46	0.280488	NM_138729	A8K4S7|Q49AH6|Q5TEI4|Q5U5K6|Q6N067|Q7Z2Z0|Q7Z3C2|Q8N7P8|Q8TDW1|Q8TDW2|Q8TDW3|Q9NXF3	Missense_Mutation	SNP	ENST00000358039.4	37	CCDS848.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.90|14.90	2.673767|2.673767	0.47781|0.47781	.|.	.|.	ENSG00000007341|ENSG00000007341	ENST00000358039;ENST00000360743;ENST00000369673;ENST00000544629;ENST00000369669;ENST00000490067;ENST00000369668;ENST00000343210;ENST00000369666;ENST00000538187;ENST00000543570;ENST00000369665;ENST00000369664|ENST00000418497	T;T;T;T;T;T;T;T;T;T;T|.	0.75704|.	-0.96;2.18;-0.96;-0.96;2.18;2.18;2.18;2.18;2.18;-0.96;2.18|.	5.66|5.66	1.52|1.52	0.23074|0.23074	Tetratricopeptide-like helical (1);|.	0.475023|.	0.24191|.	N|.	0.040710|.	T|T	0.47507|0.47507	0.1449|0.1449	M|M	0.62723|0.62723	1.935|1.935	0.45946|0.45946	D|D	0.998775|0.998775	D;P;P;B;B;B;B;B|.	0.64830|.	0.994;0.882;0.593;0.14;0.14;0.14;0.14;0.169|.	P;P;B;B;B;B;B;B|.	0.62491|.	0.903;0.579;0.187;0.077;0.132;0.132;0.132;0.125|.	T|T	0.44159|0.44159	-0.9346|-0.9346	10|5	0.51188|.	T|.	0.08|.	-8.5894|-8.5894	9.5348|9.5348	0.39216|0.39216	0.0:0.6983:0.0:0.3017|0.0:0.6983:0.0:0.3017	.|.	255;216;207;272;255;255;272;272|.	B7Z8V6;B7Z7D4;F5H2P3;Q8TDW4-5;Q8TDW4-6;Q8TDW4-3;Q8TDW4-2;Q8TDW4|.	.;.;.;.;.;.;.;ST7L_HUMAN|.	H|I	272;272;150;207;89;255;272;272;255;216;255;150;216|144	ENSP00000350734:Q272H;ENSP00000353972:Q272H;ENSP00000445499:Q207H;ENSP00000358683:Q89H;ENSP00000417140:Q255H;ENSP00000358682:Q272H;ENSP00000345312:Q272H;ENSP00000358680:Q255H;ENSP00000444021:Q216H;ENSP00000444088:Q255H;ENSP00000358678:Q216H|.	ENSP00000345312:Q272H|.	Q|S	-|-	3|2	2|0	ST7L|ST7L	112928157|112928157	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	0.888000|0.888000	0.28268|0.28268	0.273000|0.273000	0.22049|0.22049	0.563000|0.563000	0.77884|0.77884	CAG|AGC	C|0.999;T|0.001	.	alt		0.408	ST7L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032504.3		
PCBD2	84105	hgsc.bcm.edu	37	5	134296332	134296332	+	Silent	SNP	G	G	A	rs144454290		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:134296332G>A	ENST00000512783.1	+	4	374	c.354G>A	c.(352-354)aaG>aaA	p.K118K	PCBD2_ENST00000254908.6_Silent_p.K118K			Q9H0N5	PHS2_HUMAN	pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2	118					positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein homotetramerization (GO:0051289)|tetrahydrobiopterin biosynthetic process (GO:0006729)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	4-alpha-hydroxytetrahydrobiopterin dehydratase activity (GO:0008124)|phenylalanine 4-monooxygenase activity (GO:0004505)			kidney(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AAGATGTGAAGCTGGCCAAGT	0.373													G|||	1	0.000199681	0.0	0.0	5008	,	,		19140	0.0		0.001	False		,,,				2504	0.0				p.K118K		Atlas-SNP	.											.	PCBD2	3	.	0			c.G354A						PASS	.	G		0,3672		0,0,1836	81.0	74.0	76.0		354	-4.9	0.7	5	dbSNP_134	76	2,8194		0,2,4096	no	coding-synonymous	PCBD2	NM_032151.4		0,2,5932	AA,AG,GG		0.0244,0.0,0.0169		118/131	134296332	2,11866	1836	4098	5934	SO:0001819	synonymous_variant	84105	exon4			TGTGAAGCTGGCC	AF499009	CCDS43364.1	5q31.1	2008-02-05	2006-01-10			ENSG00000132570			24474	protein-coding gene	gene with protein product		609836	"""6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2"""			15182178, 11980910	Standard	NM_032151		Approved	DCOHM, DCOH2	uc010jdz.3	Q9H0N5		ENST00000512783.1:c.354G>A	5.37:g.134296332G>A		Somatic	182	0	0		WXS	Illumina HiSeq	Phase_I	219	10	0.0456621	NM_032151	Q8TD40	Silent	SNP	ENST00000512783.1	37	CCDS43364.1																																																																																			G|1.000;A|0.000	0.000	strong		0.373	PCBD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371578.1	NM_032151	
NUP188	23511	hgsc.bcm.edu	37	9	131768932	131768932	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:131768932C>T	ENST00000372577.2	+	44	5246	c.5225C>T	c.(5224-5226)gCg>gTg	p.A1742V	RP11-167N5.5_ENST00000594418.1_lincRNA	NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1742					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						TTGGTGCAGGCGTTTGTCCGG	0.627											OREG0019528	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A1742V		Atlas-SNP	.											.	NUP188	140	.	0			c.C5225T						PASS	.						117.0	109.0	112.0					9																	131768932		2203	4300	6503	SO:0001583	missense	23511	exon44			TGCAGGCGTTTGT	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.5225C>T	9.37:g.131768932C>T	ENSP00000361658:p.Ala1742Val	Somatic	59	0	0	1590	WXS	Illumina HiSeq	Phase_I	51	14	0.27451	NM_015354	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.101219	0.76983	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.36340	1.26	5.22	5.22	0.72569	.	0.104805	0.64402	D	0.000004	T	0.56630	0.1998	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.58521	-0.7622	10	0.66056	D	0.02	-4.3736	17.7677	0.88483	0.0:1.0:0.0:0.0	.	1742	Q5SRE5	NU188_HUMAN	V	1631;1742	ENSP00000361658:A1742V	ENSP00000349125:A1631V	A	+	2	0	NUP188	130808753	1.000000	0.71417	1.000000	0.80357	0.157000	0.22087	7.263000	0.78421	2.423000	0.82170	0.561000	0.74099	GCG	.	.	none		0.627	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
PRRC2A	7916	hgsc.bcm.edu	37	6	31602134	31602134	+	Nonsense_Mutation	SNP	T	T	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:31602134T>G	ENST00000376033.2	+	19	5075	c.4841T>G	c.(4840-4842)tTa>tGa	p.L1614*	PRRC2A_ENST00000376007.4_Nonsense_Mutation_p.L1614*	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1614	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						TGGAACCGTTTACATACTGGT	0.522																																					p.L1614X		Atlas-SNP	.											.	PRRC2A	152	.	0			c.T4841G						PASS	.						156.0	182.0	173.0					6																	31602134		1511	2709	4220	SO:0001587	stop_gained	7916	exon19			ACCGTTTACATAC	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.4841T>G	6.37:g.31602134T>G	ENSP00000365201:p.Leu1614*	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	64	27	0.421875	NM_004638	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Nonsense_Mutation	SNP	ENST00000376033.2	37	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	T	47	13.600033	0.99752	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	.	.	.	5.31	5.31	0.75309	.	0.151859	0.30809	N	0.008826	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-0.4528	12.8775	0.57998	0.0:0.0:0.0:1.0	.	.	.	.	X	1608;1597;1614;1614;839	.	ENSP00000365175:L1614X	L	+	2	0	PRRC2A	31710113	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	3.955000	0.56715	2.234000	0.73211	0.459000	0.35465	TTA	.	.	none		0.522	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
C12orf66	144577	hgsc.bcm.edu	37	12	64587914	64587914	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:64587914A>T	ENST00000398055.3	-	3	1099	c.1046T>A	c.(1045-1047)gTa>gAa	p.V349E	C12orf66_ENST00000544871.1_Missense_Mutation_p.V296E|C12orf66_ENST00000311915.8_Missense_Mutation_p.V349E	NM_152440.4	NP_689653	Q96MD2	CL066_HUMAN	chromosome 12 open reading frame 66	349										central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)	5						CAGAGACACTACAGCTGGATA	0.522																																					p.V349E		Atlas-SNP	.											.	C12orf66	28	.	0			c.T1046A						PASS	.						83.0	81.0	81.0					12																	64587914		1984	4157	6141	SO:0001583	missense	144577	exon3			GACACTACAGCTG		CCDS41803.1, CCDS73490.1	12q14.2	2008-08-08			ENSG00000174206	ENSG00000174206			26517	protein-coding gene	gene with protein product						12477932	Standard	NM_152440		Approved	FLJ32549	uc001srw.4	Q96MD2	OTTHUMG00000168763	ENST00000398055.3:c.1046T>A	12.37:g.64587914A>T	ENSP00000381132:p.Val349Glu	Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	110	14	0.127273	NM_152440	C9JX54|Q8IYA0	Missense_Mutation	SNP	ENST00000398055.3	37	CCDS41803.1	.	.	.	.	.	.	.	.	.	.	A	16.72	3.200407	0.58126	.	.	ENSG00000174206	ENST00000311915;ENST00000544871;ENST00000398055	T;T;T	0.41065	1.01;1.01;1.01	6.07	6.07	0.98685	.	0.109673	0.64402	D	0.000006	T	0.56673	0.2001	M	0.63843	1.955	0.80722	D	1	P;P	0.49783	0.852;0.928	P;P	0.54965	0.555;0.765	T	0.54036	-0.8353	9	.	.	.	-18.644	16.6406	0.85098	1.0:0.0:0.0:0.0	.	296;349	F5H2Q3;Q96MD2	.;CL066_HUMAN	E	349;296;349	ENSP00000311486:V349E;ENSP00000445481:V296E;ENSP00000381132:V349E	.	V	-	2	0	C12orf66	62874181	1.000000	0.71417	0.996000	0.52242	0.011000	0.07611	9.262000	0.95591	2.326000	0.78906	0.533000	0.62120	GTA	.	.	none		0.522	C12orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400921.1	NM_152440	
EP400	57634	hgsc.bcm.edu	37	12	132498342	132498342	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:132498342G>A	ENST00000333577.4	+	20	4024	c.3915G>A	c.(3913-3915)ttG>ttA	p.L1305L	EP400_ENST00000389561.2_Silent_p.L1269L|EP400_ENST00000330386.6_Silent_p.L1269L|EP400_ENST00000389562.2_Silent_p.L1268L|EP400_ENST00000332482.4_Silent_p.L1232L			Q96L91	EP400_HUMAN	E1A binding protein p400	1305	Interactions with RUVBL1 and RUVBL2.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CATTTATTTTGAGGAGAACTA	0.363																																					p.L1269L		Atlas-SNP	.											.	EP400	370	.	0			c.G3807A						PASS	.						109.0	106.0	107.0					12																	132498342		2203	4300	6503	SO:0001819	synonymous_variant	57634	exon19			TATTTTGAGGAGA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.3915G>A	12.37:g.132498342G>A		Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	84	35	0.416667	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				.	.	none		0.363	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
CMYA5	202333	hgsc.bcm.edu	37	5	79028813	79028813	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:79028813G>T	ENST00000446378.2	+	2	4256	c.4225G>T	c.(4225-4227)Gaa>Taa	p.E1409*		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1409					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ATCTGCAGATGAACATTCAGT	0.418																																					p.E1409X		Atlas-SNP	.											CMYA5_ENST00000446378,colon,carcinoma,-1,2	CMYA5	643	2	0			c.G4225T						PASS	.						34.0	34.0	34.0					5																	79028813		1884	4105	5989	SO:0001587	stop_gained	202333	exon2			GCAGATGAACATT	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.4225G>T	5.37:g.79028813G>T	ENSP00000394770:p.Glu1409*	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	141	20	0.141844	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Nonsense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	39	7.514731	0.98332	.	.	ENSG00000164309	ENST00000446378	.	.	.	6.08	3.18	0.36537	.	0.675838	0.12870	N	0.432326	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	5.2941	0.15743	0.1919:0.165:0.6431:0.0	.	.	.	.	X	1409	.	ENSP00000394770:E1409X	E	+	1	0	CMYA5	79064569	0.126000	0.22350	0.005000	0.12908	0.228000	0.25075	1.662000	0.37418	0.364000	0.24374	0.650000	0.86243	GAA	.	.	none		0.418	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
KLHL1	57626	hgsc.bcm.edu	37	13	70681527	70681527	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr13:70681527C>G	ENST00000377844.4	-	1	1064	c.305G>C	c.(304-306)aGg>aCg	p.R102T	ATXN8OS_ENST00000414504.2_RNA|ATXN8OS_ENST00000424524.1_RNA|KLHL1_ENST00000545028.1_5'UTR	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	102					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TTGCTGCAGCCTCGTGGCAAC	0.592																																					p.R102T		Atlas-SNP	.											.	KLHL1	164	.	0			c.G305C						PASS	.						51.0	52.0	52.0					13																	70681527		2203	4300	6503	SO:0001583	missense	57626	exon1			TGCAGCCTCGTGG	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.305G>C	13.37:g.70681527C>G	ENSP00000367075:p.Arg102Thr	Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	90	14	0.155556	NM_020866	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	C	13.52	2.263076	0.39995	.	.	ENSG00000150361	ENST00000377844	T	0.74315	-0.83	5.45	4.6	0.57074	.	4.002300	0.00166	N	0.000008	T	0.68476	0.3005	L	0.36672	1.1	0.80722	D	1	B;B	0.32324	0.364;0.111	B;B	0.27170	0.077;0.026	T	0.32214	-0.9915	10	0.15952	T	0.53	.	13.6724	0.62434	0.1547:0.8452:0.0:0.0	.	102;102	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	T	102	ENSP00000367075:R102T	ENSP00000367075:R102T	R	-	2	0	KLHL1	69579528	0.999000	0.42202	0.901000	0.35422	0.991000	0.79684	3.513000	0.53414	1.279000	0.44446	0.655000	0.94253	AGG	.	.	none		0.592	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	
POTEH	23784	hgsc.bcm.edu	37	22	16287562	16287562	+	Missense_Mutation	SNP	G	G	C	rs202187764	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr22:16287562G>C	ENST00000343518.6	-	1	375	c.324C>G	c.(322-324)tgC>tgG	p.C108W		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	108										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TCCCCCTGCAGCAGGGGAAGC	0.587																																					p.C108W		Atlas-SNP	.											POTEH,NS,carcinoma,0,1	POTEH	114	1	0			c.C324G						scavenged	.						97.0	113.0	107.0					22																	16287562		2057	3890	5947	SO:0001583	missense	23784	exon1			CCTGCAGCAGGGG	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.324C>G	22.37:g.16287562G>C	ENSP00000340610:p.Cys108Trp	Somatic	166	23	0.138554		WXS	Illumina HiSeq	Phase_I	106	21	0.198113	NM_001136213	A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	ENST00000343518.6	37	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	.	4.136	0.023586	0.08006	.	.	ENSG00000198062	ENST00000343518;ENST00000355872	T	0.37411	1.2	.	.	.	.	.	.	.	.	T	0.40297	0.1111	L	0.53249	1.67	0.09310	N	1	P	0.46578	0.88	P	0.51615	0.675	T	0.21314	-1.0249	7	0.38643	T	0.18	.	.	.	.	.	108	Q6S545	POTEH_HUMAN	W	108	ENSP00000340610:C108W	ENSP00000340610:C108W	C	-	3	2	POTEH	14667562	0.075000	0.21258	0.021000	0.16686	0.022000	0.10575	0.263000	0.18478	0.269000	0.21961	0.274000	0.19336	TGC	G|0.975;C|0.025	0.025	strong		0.587	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
PTGS2	5743	hgsc.bcm.edu	37	1	186648465	186648465	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:186648465T>A	ENST00000367468.5	-	2	294	c.158A>T	c.(157-159)aAc>aTc	p.N53I	PTGS2_ENST00000490885.2_5'UTR|RP5-973M2.2_ENST00000608917.1_lincRNA	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	53	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	TGTTGAGCAGTTTTCTCCATA	0.433																																					p.N53I		Atlas-SNP	.											.	PTGS2	144	.	0			c.A158T						PASS	.						137.0	115.0	122.0					1																	186648465		2203	4300	6503	SO:0001583	missense	5743	exon2			GAGCAGTTTTCTC	D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.158A>T	1.37:g.186648465T>A	ENSP00000356438:p.Asn53Ile	Somatic	182	0	0		WXS	Illumina HiSeq	Phase_I	152	26	0.171053	NM_000963	A8K802|Q16876	Missense_Mutation	SNP	ENST00000367468.5	37	CCDS1371.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.006720	0.93287	.	.	ENSG00000073756	ENST00000367468	T	0.69306	-0.39	5.27	5.27	0.74061	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.80808	0.4694	M	0.75777	2.31	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	D	0.83543	0.0097	10	0.87932	D	0	-28.3851	14.879	0.70516	0.0:0.0:0.0:1.0	.	53	P35354	PGH2_HUMAN	I	53	ENSP00000356438:N53I	ENSP00000356438:N53I	N	-	2	0	PTGS2	184915088	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.807000	0.86032	1.979000	0.57680	0.533000	0.62120	AAC	.	.	none		0.433	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086157.2	NM_000963	
SFTPA1	653509	hgsc.bcm.edu	37	10	81373777	81373777	+	Missense_Mutation	SNP	C	C	T	rs4253527	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:81373777C>T	ENST00000398636.3	+	6	793	c.655C>T	c.(655-657)Cgg>Tgg	p.R219W	SFTPA1_ENST00000428376.2_Missense_Mutation_p.R219W|SFTPA1_ENST00000372308.3_Missense_Mutation_p.R219W|SFTPA1_ENST00000372313.5_Missense_Mutation_p.R160W|SFTPA1_ENST00000419470.2_Missense_Mutation_p.R234W	NM_001164644.1|NM_001164646.1|NM_005411.4	NP_001158116.1|NP_001158118.1|NP_005402.3	Q8IWL2	SFTA1_HUMAN	surfactant protein A1	219	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.		R -> W (associated with susceptibility to idiopathic pulmonary fibrosis in smokers; allele 6A(4) and allele 6A(5); dbSNP:rs4253527). {ECO:0000269|PubMed:13680361, ECO:0000269|PubMed:19100526, ECO:0000269|PubMed:20693318, ECO:0000269|Ref.5}.		lipid transport (GO:0006869)|respiratory gaseous exchange (GO:0007585)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|lipid transporter activity (GO:0005319)			endometrium(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			GCCCGCAGGTCGGGGAAAAGA	0.567													c|||	577	0.115216	0.0779	0.1052	5008	,	,		19579	0.244		0.0934	False		,,,				2504	0.0624				p.R234W		Atlas-SNP	.											.	SFTPA1	23	.	0			c.C700T	GRCh37	CM033026	SFTPA1	M	rs4253527	PASS	.	C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	353,4053		14,325,1864	182.0	177.0	179.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	700,655,553,508,655,655	1.9	0.0	10	dbSNP_111	179	746,7846		34,678,3584	no	missense,missense,missense,missense,missense,missense	SFTPA1	NM_001093770.2,NM_001164644.1,NM_001164645.1,NM_001164646.1,NM_001164647.1,NM_005411.4	101,101,101,101,101,101	48,1003,5448	TT,TC,CC		8.6825,8.0118,8.4551	benign,benign,benign,benign,benign,benign	234/264,219/249,185/215,170/200,219/249,219/249	81373777	1099,11899	2203	4296	6499	SO:0001583	missense	653509	exon6			GCAGGTCGGGGAA	BC026229	CCDS44444.1, CCDS44445.1, CCDS44444.2	10q22.3	2012-11-02	2008-08-26			ENSG00000122852		"""Collectins"""	10798	protein-coding gene	gene with protein product	"""surfactant, pulmonary-associated protein A1A"""	178630	"""surfactant, pulmonary-associated protein A1"""	SFTP1			Standard	NM_001093770		Approved	SP-A, SP-A1, COLEC4	uc009xry.3	Q8IWL2		ENST00000398636.3:c.655C>T	10.37:g.81373777C>T	ENSP00000381633:p.Arg219Trp	Somatic	420	0	0		WXS	Illumina HiSeq	Phase_I	328	45	0.137195	NM_001093770	A8K3T8|B7ZW50|E3VLD8|E3VLD9|E3VLE0|E3VLE1|G5E9J3|P07714|Q14DV4|Q5RIR5|Q5RIR7|Q6PIT0|Q8TC19	Missense_Mutation	SNP	ENST00000398636.3	37	CCDS44445.1	284	0.13003663003663005	33	0.06707317073170732	37	0.10220994475138122	140	0.24475524475524477	74	0.09762532981530343	.	1.011	-0.687855	0.03328	0.080118	0.086825	ENSG00000122852	ENST00000372308;ENST00000398636;ENST00000428376;ENST00000372313;ENST00000419470;ENST00000394569	T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14	2.89	1.94	0.25998	C-type lectin fold (2);C-type lectin-like (2);C-type lectin (6);	1.014370	0.07895	N	0.971754	T	0.00012	0.0000	L	0.52266	1.64	0.80722	P	0.0	B;B;B	0.18310	0.026;0.027;0.026	B;B;B	0.12156	0.007;0.006;0.007	T	0.25012	-1.0144	9	0.49607	T	0.09	-0.026	7.4659	0.27322	0.4692:0.5308:0.0:0.0	.	219;234;219	Q8IWL1;G5E9J3;Q8IWL2	SFPA2_HUMAN;.;SFTA1_HUMAN	W	219;219;219;160;234;219	ENSP00000361382:R219W;ENSP00000381633:R219W;ENSP00000411102:R219W;ENSP00000361387:R160W;ENSP00000397082:R234W	ENSP00000361382:R219W	R	+	1	2	SFTPA1	81043783	0.003000	0.15002	0.013000	0.15412	0.028000	0.11728	0.051000	0.14141	0.741000	0.32674	0.297000	0.19635	CGG	C|0.901;T|0.099	0.099	strong		0.567	SFTPA1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_005411	
STX16	8675	hgsc.bcm.edu	37	20	57227077	57227077	+	Silent	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:57227077T>C	ENST00000371141.4	+	1	739	c.15T>C	c.(13-15)cgT>cgC	p.R5R	STX16-NPEPL1_ENST00000530122.1_Silent_p.R5R|STX16_ENST00000361770.5_Silent_p.R5R|STX16_ENST00000371132.4_Silent_p.R5R|STX16_ENST00000358029.4_Silent_p.R5R|STX16_ENST00000496003.1_3'UTR|STX16_ENST00000361830.3_Silent_p.R5R|STX16_ENST00000359617.4_Intron|STX16_ENST00000355957.5_Silent_p.R5R	NM_001001433.2	NP_001001433.1	O14662	STX16_HUMAN	syntaxin 16	5					intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(1)	17	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			CCACCAGGCGTTTAACCGACG	0.542																																					p.R5R		Atlas-SNP	.											.	STX16	36	.	0			c.T15C						PASS	.						104.0	100.0	101.0					20																	57227077		2203	4300	6503	SO:0001819	synonymous_variant	8675	exon1			CAGGCGTTTAACC	AF038897	CCDS13468.1, CCDS13469.1, CCDS46619.1, CCDS46620.1, CCDS56199.1	20q13.32	2008-07-02			ENSG00000124222	ENSG00000124222			11431	protein-coding gene	gene with protein product		603666				9464276, 9587053, 15800843	Standard	NM_003763		Approved	hsyn16, SYN16	uc002xzi.3	O14662	OTTHUMG00000033084	ENST00000371141.4:c.15T>C	20.37:g.57227077T>C		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	42	10	0.238095	NM_001134772	A6NK32|A6NN69|A8MPP0|B7ZBN1|B7ZBN2|B7ZBN3|E1P5M0|E1P607|O14661|O14663|O60517|Q5W084|Q5W086|Q5W087|Q5XKI6|Q6GMS8|Q9H0Z0|Q9H1T7|Q9H1T8|Q9UIX5	Silent	SNP	ENST00000371141.4	37	CCDS13468.1																																																																																			.	.	none		0.542	STX16-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080517.2	NM_001001433	
DYRK1B	9149	hgsc.bcm.edu	37	19	40317311	40317311	+	Splice_Site	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:40317311C>T	ENST00000593685.1	-	9	1880		c.e9+1		DYRK1B_ENST00000597639.1_Splice_Site|DYRK1B_ENST00000430012.2_Splice_Site|DYRK1B_ENST00000323039.5_Splice_Site|DYRK1B_ENST00000348817.3_Splice_Site			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B						adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			TGGGCACCCACCAGAACTGGA	0.672																																					.		Atlas-SNP	.											.	DYRK1B	114	.	0			c.1291+1G>A						PASS	.						12.0	9.0	10.0					19																	40317311		2001	3978	5979	SO:0001630	splice_region_variant	9149	exon10			CACCCACCAGAAC	Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.1411+1G>A	19.37:g.40317311C>T		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	74	20	0.27027	NM_006483	O75258|O75788|O75789	Splice_Site	SNP	ENST00000593685.1	37	CCDS12543.1	.	.	.	.	.	.	.	.	.	.	C	19.00	3.742056	0.69418	.	.	ENSG00000105204	ENST00000323039;ENST00000348817;ENST00000430012	.	.	.	4.64	4.64	0.57946	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9869	0.71356	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DYRK1B	45009151	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.413000	0.80104	2.096000	0.63516	0.563000	0.77884	.	.	.	none		0.672	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462874.2	NM_004714	Intron
BCL11B	64919	hgsc.bcm.edu	37	14	99641876	99641876	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr14:99641876C>T	ENST00000357195.3	-	4	1306	c.1297G>A	c.(1297-1299)Ggc>Agc	p.G433S	BCL11B_ENST00000345514.2_Missense_Mutation_p.G362S|BCL11B_ENST00000443726.2_Missense_Mutation_p.G239S	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	433					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		AAGGTCTTGCCGCAGAACTCG	0.677			T	TLX3	T-ALL																																p.G433S		Atlas-SNP	.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	BCL11B,NS,carcinoma,+1,1	BCL11B	108	1	0			c.G1297A						PASS	.						24.0	26.0	26.0					14																	99641876		2201	4299	6500	SO:0001583	missense	64919	exon4			TCTTGCCGCAGAA	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1297G>A	14.37:g.99641876C>T	ENSP00000349723:p.Gly433Ser	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	40	19	0.475	NM_138576	Q9H162	Missense_Mutation	SNP	ENST00000357195.3	37	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502207	0.85176	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.01455	4.87;4.87;4.87	4.11	4.11	0.48088	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.075279	0.51477	D	0.000092	T	0.08670	0.0215	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.994	T	0.07233	-1.0783	10	0.87932	D	0	-14.2957	16.7085	0.85378	0.0:1.0:0.0:0.0	.	362;433	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	S	433;362;239	ENSP00000349723:G433S;ENSP00000280435:G362S;ENSP00000387419:G239S	ENSP00000280435:G362S	G	-	1	0	BCL11B	98711629	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.540000	0.82074	1.995000	0.58328	0.491000	0.48974	GGC	.	.	none		0.677	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
MME	4311	hgsc.bcm.edu	37	3	154860063	154860063	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:154860063G>A	ENST00000460393.1	+	12	1252	c.1132G>A	c.(1132-1134)Gat>Aat	p.D378N	MME_ENST00000360490.2_Missense_Mutation_p.D378N|MME_ENST00000462745.1_Missense_Mutation_p.D378N|MME_ENST00000493237.1_Missense_Mutation_p.D378N|MME_ENST00000492661.1_Missense_Mutation_p.D378N	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	378					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	ATTCATAATGGATCTTGTAAG	0.398																																					p.D378N		Atlas-SNP	.											.	MME	133	.	0			c.G1132A						PASS	.						85.0	90.0	88.0					3																	154860063		2203	4300	6503	SO:0001583	missense	4311	exon12			ATAATGGATCTTG		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1132G>A	3.37:g.154860063G>A	ENSP00000418525:p.Asp378Asn	Somatic	179	0	0		WXS	Illumina HiSeq	Phase_I	133	39	0.293233	NM_007287	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287676	0.59976	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81;-0.81	5.93	5.93	0.95920	Peptidase M13 (1);	0.217410	0.47455	D	0.000221	T	0.66954	0.2842	N	0.17564	0.495	0.45791	D	0.998674	B	0.23185	0.081	B	0.32928	0.155	T	0.60505	-0.7250	10	0.35671	T	0.21	-39.6187	20.3397	0.98756	0.0:0.0:1.0:0.0	.	378	P08473	NEP_HUMAN	N	378	ENSP00000420389:D378N;ENSP00000418525:D378N;ENSP00000419653:D378N;ENSP00000417079:D378N;ENSP00000353679:D378N	ENSP00000353679:D378N	D	+	1	0	MME	156342757	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.449000	0.73473	2.803000	0.96430	0.585000	0.79938	GAT	.	.	none		0.398	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
LY9	4063	hgsc.bcm.edu	37	1	160783595	160783595	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:160783595C>T	ENST00000263285.6	+	3	654	c.624C>T	c.(622-624)acC>acT	p.T208T	LY9_ENST00000368037.5_Silent_p.T208T|LY9_ENST00000368040.1_5'UTR|LY9_ENST00000368041.2_Silent_p.T168T|LY9_ENST00000341032.4_Silent_p.T208T|LY9_ENST00000392203.4_Silent_p.T208T|LY9_ENST00000471816.1_3'UTR			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	208	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CCATTCTTACCGTCTCCCGAA	0.562																																					p.T208T		Atlas-SNP	.											.	LY9	115	.	0			c.C624T						PASS	.						172.0	164.0	167.0					1																	160783595		2203	4300	6503	SO:0001819	synonymous_variant	4063	exon3			TCTTACCGTCTCC	L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.624C>T	1.37:g.160783595C>T		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	58	11	0.189655	NM_001261457	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Silent	SNP	ENST00000263285.6	37	CCDS30916.1																																																																																			.	.	none		0.562	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060457.3	NM_002348	
ZNF615	284370	hgsc.bcm.edu	37	19	52497677	52497677	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:52497677G>C	ENST00000602063.1	-	6	1001	c.652C>G	c.(652-654)Cag>Gag	p.Q218E	ZNF615_ENST00000391795.3_Missense_Mutation_p.Q223E|ZNF615_ENST00000594083.1_Missense_Mutation_p.Q229E|ZNF615_ENST00000376716.5_Missense_Mutation_p.Q218E|ZNF615_ENST00000598071.1_Missense_Mutation_p.Q229E			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	218					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TCAATAAACTGAGACAACTTG	0.408																																					p.Q229E		Atlas-SNP	.											.	ZNF615	111	.	0			c.C685G						PASS	.						190.0	183.0	185.0					19																	52497677		2203	4300	6503	SO:0001583	missense	284370	exon7			TAAACTGAGACAA	AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.652C>G	19.37:g.52497677G>C	ENSP00000473089:p.Gln218Glu	Somatic	257	0	0		WXS	Illumina HiSeq	Phase_I	252	66	0.261905	NM_001199324	B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Missense_Mutation	SNP	ENST00000602063.1	37	CCDS12846.1	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.511184	0.00984	.	.	ENSG00000197619	ENST00000376716;ENST00000354939;ENST00000391795;ENST00000391793	T;T	0.27720	1.65;1.65	3.2	-1.87	0.07737	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14442	0.0349	L	0.27053	0.805	0.09310	N	1	B;B;B;B	0.27732	0.118;0.187;0.187;0.118	B;B;B;B	0.24155	0.023;0.051;0.051;0.023	T	0.32824	-0.9892	9	0.08599	T	0.76	.	4.8415	0.13492	0.5616:0.1784:0.26:0.0	.	223;225;229;218	B4DH87;Q8N8J6-3;Q8N8J6-2;Q8N8J6	.;.;.;ZN615_HUMAN	E	218;228;223;228	ENSP00000365906:Q218E;ENSP00000375672:Q223E	ENSP00000347019:Q228E	Q	-	1	0	ZNF615	57189489	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.995000	0.01472	-0.067000	0.12976	0.655000	0.94253	CAG	.	.	none		0.408	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462391.1	NM_198480	
HOOK1	51361	hgsc.bcm.edu	37	1	60325900	60325900	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:60325900C>T	ENST00000371208.3	+	15	1689	c.1432C>T	c.(1432-1434)Cgc>Tgc	p.R478C	HOOK1_ENST00000395561.2_Missense_Mutation_p.R436C|HOOK1_ENST00000465876.1_3'UTR	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	478	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					TAAGATGCTTCGCTTACAGCA	0.353																																					p.R478C		Atlas-SNP	.											.	HOOK1	54	.	0			c.C1432T						PASS	.						108.0	112.0	111.0					1																	60325900		2203	4300	6503	SO:0001583	missense	51361	exon15			ATGCTTCGCTTAC	AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1432C>T	1.37:g.60325900C>T	ENSP00000360252:p.Arg478Cys	Somatic	258	0	0		WXS	Illumina HiSeq	Phase_I	169	42	0.248521	NM_015888	A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	ENST00000371208.3	37	CCDS612.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.220105	0.79464	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.23348	1.91;1.91	4.95	4.95	0.65309	.	0.171400	0.51477	D	0.000098	T	0.48259	0.1490	M	0.69823	2.125	0.80722	D	1	D	0.60575	0.988	P	0.58820	0.846	T	0.50242	-0.8851	10	0.72032	D	0.01	.	18.7375	0.91761	0.0:1.0:0.0:0.0	.	478	Q9UJC3	HOOK1_HUMAN	C	478;436	ENSP00000360252:R478C;ENSP00000378928:R436C	ENSP00000360252:R478C	R	+	1	0	HOOK1	60098488	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.167000	0.50793	2.733000	0.93635	0.655000	0.94253	CGC	.	.	none		0.353	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024934.1	NM_015888	
ITGA10	8515	hgsc.bcm.edu	37	1	145537774	145537774	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:145537774C>T	ENST00000369304.3	+	21	2787	c.2612C>T	c.(2611-2613)tCt>tTt	p.S871F	ITGA10_ENST00000539363.1_Missense_Mutation_p.S728F|ITGA10_ENST00000538811.1_Missense_Mutation_p.S740F	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	871					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCCGCCCCTTCTGCTCATGCC	0.592																																					p.S871F		Atlas-SNP	.											.	ITGA10	131	.	0			c.C2612T						PASS	.						62.0	65.0	64.0					1																	145537774		2203	4300	6503	SO:0001583	missense	8515	exon21			CCCCTTCTGCTCA	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.2612C>T	1.37:g.145537774C>T	ENSP00000358310:p.Ser871Phe	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	80	18	0.225	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	37	CCDS918.1	.	.	.	.	.	.	.	.	.	.	C	12.65	2.002323	0.35320	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.48201	0.82;0.82;0.82	5.71	4.8	0.61643	Integrin alpha-2 (1);	0.906824	0.09669	N	0.771322	T	0.33933	0.0880	L	0.29908	0.895	0.09310	N	1	P;P;P;P	0.44877	0.708;0.708;0.845;0.752	P;P;P;P	0.51266	0.664;0.567;0.664;0.595	T	0.35375	-0.9791	10	0.59425	D	0.04	.	12.2744	0.54726	0.0:0.9179:0.0:0.0821	.	837;740;728;871	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	F	871;837;728;740	ENSP00000358310:S871F;ENSP00000439894:S728F;ENSP00000440011:S740F	ENSP00000358310:S871F	S	+	2	0	ITGA10	144249131	0.018000	0.18449	0.006000	0.13384	0.468000	0.32798	2.425000	0.44723	1.423000	0.47198	0.655000	0.94253	TCT	.	.	none		0.592	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
TIGD1	200765	hgsc.bcm.edu	37	2	233413881	233413881	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:233413881T>A	ENST00000408957.3	-	1	1345	c.712A>T	c.(712-714)Att>Ttt	p.I238F	EIF4E2_ENST00000409167.3_5'Flank|MIR5001_ENST00000580185.1_RNA|EIF4E2_ENST00000409322.1_5'Flank|EIF4E2_ENST00000409514.1_5'Flank|EIF4E2_ENST00000258416.3_5'Flank|EIF4E2_ENST00000409098.1_5'Flank|EIF4E2_ENST00000409495.1_5'Flank|EIF4E2_ENST00000409394.1_5'Flank	NM_145702.1	NP_663748.1	Q96MW7	TIGD1_HUMAN	tigger transposable element derived 1	238	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|skin(1)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;2e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|LUSC - Lung squamous cell carcinoma(224;0.00746)|Lung(119;0.00842)|GBM - Glioblastoma multiforme(43;0.233)		gaatggtaaataagcattggc	0.438																																					p.I238F		Atlas-SNP	.											.	TIGD1	17	.	0			c.A712T						PASS	.						10.0	12.0	11.0					2																	233413881		1315	2303	3618	SO:0001583	missense	200765	exon1			GGTAAATAAGCAT		CCDS2495.1	2q37.1	2011-01-17			ENSG00000221944	ENSG00000221944			14523	protein-coding gene	gene with protein product		612972					Standard	NM_145702		Approved	EEYORE	uc002vsy.2	Q96MW7	OTTHUMG00000133260	ENST00000408957.3:c.712A>T	2.37:g.233413881T>A	ENSP00000386186:p.Ile238Phe	Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	59	12	0.20339	NM_145702	Q6P4D2|Q6PIF9	Missense_Mutation	SNP	ENST00000408957.3	37	CCDS2495.1	.	.	.	.	.	.	.	.	.	.	T	13.53	2.263713	0.39995	.	.	ENSG00000221944	ENST00000408957	T	0.61859	0.07	0.516	-0.827	0.10802	.	.	.	.	.	T	0.59569	0.2203	M	0.70108	2.13	0.21897	N	0.999486	P	0.38863	0.65	P	0.47102	0.537	T	0.55585	-0.8118	8	0.72032	D	0.01	.	.	.	.	.	238	Q96MW7	TIGD1_HUMAN	F	238	ENSP00000386186:I238F	ENSP00000386186:I238F	I	-	1	0	TIGD1	233122125	0.914000	0.31030	0.946000	0.38457	0.943000	0.58893	-0.387000	0.07361	-0.610000	0.05716	-0.700000	0.03674	ATT	.	.	none		0.438	TIGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257037.1	NM_145702	
ACADSB	36	hgsc.bcm.edu	37	10	124810591	124810591	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:124810591G>A	ENST00000358776.4	+	9	1031	c.1017G>A	c.(1015-1017)gtG>gtA	p.V339V	ACADSB_ENST00000368869.4_Silent_p.V237V	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	339					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	TGGCTCACGTGGCCACCCAGC	0.458																																					p.V339V		Atlas-SNP	.											.	ACADSB	45	.	0			c.G1017A						PASS	.						41.0	41.0	41.0					10																	124810591		2203	4300	6503	SO:0001819	synonymous_variant	36	exon9			TCACGTGGCCACC	U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.1017G>A	10.37:g.124810591G>A		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	75	27	0.36	NM_001609	B4DQ51|Q5SQN6|Q96CX7	Silent	SNP	ENST00000358776.4	37	CCDS7634.1																																																																																			.	.	none		0.458	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050843.1	NM_001609	
MUC15	143662	hgsc.bcm.edu	37	11	26584710	26584710	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:26584710G>A	ENST00000455601.2	-	3	915	c.797C>T	c.(796-798)aCg>aTg	p.T266M	ANO3_ENST00000531568.1_Intron|MUC15_ENST00000436318.2_Missense_Mutation_p.T293M|ANO3_ENST00000525139.1_Intron|ANO3_ENST00000537978.1_Intron|ANO3_ENST00000529242.1_3'UTR|MUC15_ENST00000529533.1_Missense_Mutation_p.T293M|MUC15_ENST00000527569.1_Intron|MUC15_ENST00000281268.8_Intron|ANO3_ENST00000256737.3_Intron	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	266					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						AAATGAATCCGTTTTCCTTTT	0.393																																					p.T293M		Atlas-SNP	.											MUC15,NS,carcinoma,0,1	MUC15	88	1	0			c.C878T						PASS	.						117.0	119.0	118.0					11																	26584710		2203	4300	6503	SO:0001583	missense	143662	exon4			GAATCCGTTTTCC	AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.797C>T	11.37:g.26584710G>A	ENSP00000397339:p.Thr266Met	Somatic	132	0	0		WXS	Illumina HiSeq	Phase_I	91	53	0.582418	NM_001135091	B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Missense_Mutation	SNP	ENST00000455601.2	37	CCDS7859.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.505843	0.44558	.	.	ENSG00000169550	ENST00000455601;ENST00000436318;ENST00000529533	T;T;T	0.26518	1.75;1.73;1.73	4.52	-0.183	0.13284	.	0.441624	0.19223	N	0.119636	T	0.11196	0.0273	L	0.27053	0.805	0.18873	N	0.999989	P;P	0.37398	0.593;0.593	B;B	0.24848	0.056;0.056	T	0.16988	-1.0384	10	0.66056	D	0.02	-1.4965	3.6308	0.08131	0.0809:0.2526:0.4092:0.2573	.	266;293	Q8N387;E9PII6	MUC15_HUMAN;.	M	266;293;293	ENSP00000397339:T266M;ENSP00000416753:T293M;ENSP00000431983:T293M	ENSP00000416753:T293M	T	-	2	0	MUC15	26541286	0.035000	0.19736	0.271000	0.24616	0.908000	0.53690	0.250000	0.18235	0.063000	0.16370	-0.898000	0.02899	ACG	.	.	none		0.393	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387866.1	NM_145650	
PPP1R27	116729	hgsc.bcm.edu	37	17	79791648	79791648	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:79791648T>C	ENST00000330261.4	-	3	501	c.422A>G	c.(421-423)tAc>tGc	p.Y141C	FAM195B_ENST00000573478.1_5'Flank|FAM195B_ENST00000576431.1_5'Flank|FAM195B_ENST00000575061.1_5'Flank|FAM195B_ENST00000572645.1_5'Flank|PPP1R27_ENST00000573182.1_5'UTR|PPP1R27_ENST00000570394.1_3'UTR|FAM195B_ENST00000538396.1_5'Flank|FAM195B_ENST00000455127.2_5'Flank	NM_001007533.3	NP_001007534.1	Q86WC6	PPR27_HUMAN	protein phosphatase 1, regulatory subunit 27	141					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										CAGCTCCTTGTAGTCCGGGTC	0.662																																					p.Y141C		Atlas-SNP	.											.	.	.	.	0			c.A422G						PASS	.						73.0	50.0	58.0					17																	79791648		2174	4259	6433	SO:0001583	missense	116729	exon3			TCCTTGTAGTCCG	AF434846	CCDS32767.1	17q25.3	2013-01-10	2011-10-11	2011-10-11	ENSG00000182676	ENSG00000182676		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	16813	protein-coding gene	gene with protein product			"""dysferlin-interacting protein 1 (toonin)"", ""dysferlin interacting protein 1 (toonin)"", ""dysferlin interacting protein 1"""	DYSFIP1			Standard	NM_001007533		Approved	toonin	uc002kbj.1	Q86WC6		ENST00000330261.4:c.422A>G	17.37:g.79791648T>C	ENSP00000331065:p.Tyr141Cys	Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	54	17	0.314815	NM_001007533		Missense_Mutation	SNP	ENST00000330261.4	37	CCDS32767.1	.	.	.	.	.	.	.	.	.	.	t	10.85	1.466188	0.26335	.	.	ENSG00000182676	ENST00000330261	T	0.61859	0.07	4.6	2.22	0.28083	.	0.335152	0.31601	N	0.007361	T	0.31606	0.0802	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04373	-1.0956	10	0.27785	T	0.31	.	7.7153	0.28700	0.4418:0.0:0.0:0.5582	.	141	Q86WC6	PPR27_HUMAN	C	141	ENSP00000331065:Y141C	ENSP00000331065:Y141C	Y	-	2	0	DYSFIP1	77384937	0.885000	0.30320	0.999000	0.59377	0.615000	0.37417	0.378000	0.20569	0.601000	0.29879	-0.425000	0.05940	TAC	.	.	none		0.662	PPP1R27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439692.1	NM_001007533	
NCR1	9437	hgsc.bcm.edu	37	19	55423582	55423582	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:55423582G>A	ENST00000291890.4	+	6	767	c.729G>A	c.(727-729)caG>caA	p.Q243Q	NCR1_ENST00000357397.5_Silent_p.Q136Q|NCR1_ENST00000338835.5_Intron|NCR1_ENST00000350790.5_Silent_p.Q148Q|NCR1_ENST00000447255.1_Silent_p.Q242Q|NCR1_ENST00000594765.1_Silent_p.Q242Q|NCR1_ENST00000598576.1_Silent_p.Q230Q	NM_004829.5	NP_004820.2	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	243					cellular defense response (GO:0006968)|intracellular signal transduction (GO:0035556)|natural killer cell activation (GO:0030101)|regulation of natural killer cell mediated cytotoxicity (GO:0042269)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|SWI/SNF complex (GO:0016514)	receptor signaling protein activity (GO:0005057)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(193;0.0449)		CGGGACTCCAGAAAGGTAAGT	0.512																																					p.Q243Q		Atlas-SNP	.											.	NCR1	60	.	0			c.G729A						PASS	.						118.0	110.0	113.0					19																	55423582		2203	4300	6503	SO:0001819	synonymous_variant	9437	exon6			ACTCCAGAAAGGT	AJ001383	CCDS12911.1, CCDS46181.1, CCDS46182.1, CCDS56103.1	19q13.42	2013-09-20	2002-11-13	2002-11-15	ENSG00000189430	ENSG00000189430		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6731	protein-coding gene	gene with protein product		604530	"""lymphocyte antigen 94 (mouse) homolog (activating NK-receptor; NK-p46)"""	LY94		9730896	Standard	NM_001145457		Approved	NK-p46, NKP46, CD335	uc002qib.2	O76036	OTTHUMG00000183212	ENST00000291890.4:c.729G>A	19.37:g.55423582G>A		Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	84	34	0.404762	NM_004829	B0V3L2|B0V3L3|B0V3L4|B0V3L5|B8JL03|O76016|O76017|O76018	Silent	SNP	ENST00000291890.4	37	CCDS12911.1																																																																																			.	.	none		0.512	NCR1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465680.1		
CYP27C1	339761	hgsc.bcm.edu	37	2	127957076	127957076	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:127957076T>A	ENST00000335247.7	-	4	558	c.428A>T	c.(427-429)tAc>tTc	p.Y143F	CYP27C1_ENST00000409327.1_Missense_Mutation_p.Y143F	NM_001001665.3	NP_001001665.3	Q4G0S4	C27C1_HUMAN	cytochrome P450, family 27, subfamily C, polypeptide 1	143						membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	16	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.071)		GTCCATTTGGTACTGTATGTC	0.483																																					p.Y143F		Atlas-SNP	.											.	CYP27C1	52	.	0			c.A428T						PASS	.						128.0	111.0	117.0					2																	127957076		2203	4300	6503	SO:0001583	missense	339761	exon4			ATTTGGTACTGTA	AC027142	CCDS33285.1	2q14.3	2008-05-14	2007-05-18		ENSG00000186684	ENSG00000186684		"""Cytochrome P450s"""	33480	protein-coding gene	gene with protein product							Standard	NM_001001665		Approved	FLJ16008	uc002tod.2	Q4G0S4	OTTHUMG00000153400	ENST00000335247.7:c.428A>T	2.37:g.127957076T>A	ENSP00000334128:p.Tyr143Phe	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	92	30	0.326087	NM_001001665	Q6ZNI7	Missense_Mutation	SNP	ENST00000335247.7	37	CCDS33285.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.652546	0.29336	.	.	ENSG00000186684	ENST00000335247;ENST00000409327	T;T	0.68624	-0.34;-0.34	4.27	1.04	0.20106	.	0.423021	0.24864	N	0.034983	T	0.40670	0.1126	N	0.08118	0	0.20403	N	0.9999	B	0.09022	0.002	B	0.10450	0.005	T	0.30090	-0.9990	10	0.59425	D	0.04	-25.285	5.7206	0.17985	0.0:0.2811:0.4352:0.2837	.	143	Q4G0S4	C27C1_HUMAN	F	143	ENSP00000334128:Y143F;ENSP00000387198:Y143F	ENSP00000334128:Y143F	Y	-	2	0	CYP27C1	127673546	1.000000	0.71417	0.865000	0.33974	0.468000	0.32798	1.167000	0.31847	0.201000	0.20466	0.460000	0.39030	TAC	.	.	none		0.483	CYP27C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331046.1	NM_001001665	
TNFAIP3	7128	hgsc.bcm.edu	37	6	138202395	138202395	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:138202395G>A	ENST00000237289.4	+	9	2378	c.2312G>A	c.(2311-2313)gGc>gAc	p.G771D		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	771	Interaction with TNIP1. {ECO:0000250}.|Required for lysosomal localization and for TRAF2 lysosomal degradation.|Sufficient for inhibitory activity of TNF-induced NF-kappa-B activity. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		GATCATTTTGGCAATGCCAAG	0.617			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																p.G771D	GBM(130;153 1739 22295 28918 47987)	Atlas-SNP	.		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	.	TNFAIP3	340	.	25	Whole gene deletion(25)	haematopoietic_and_lymphoid_tissue(25)	c.G2312A						PASS	.						71.0	78.0	76.0					6																	138202395		2202	4299	6501	SO:0001583	missense	7128	exon9			ATTTTGGCAATGC	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.2312G>A	6.37:g.138202395G>A	ENSP00000237289:p.Gly771Asp	Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	116	37	0.318966	NM_001270507	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	37	CCDS5187.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.684692	0.88639	.	.	ENSG00000118503	ENST00000237289	T	0.69175	-0.38	5.66	5.66	0.87406	Zinc finger, A20-type (3);	0.050625	0.85682	D	0.000000	T	0.76751	0.4031	M	0.61703	1.905	0.54753	D	0.999986	D	0.89917	1.0	D	0.79784	0.993	T	0.77370	-0.2613	10	0.59425	D	0.04	-15.7251	17.9235	0.88975	0.0:0.0:1.0:0.0	.	771	P21580	TNAP3_HUMAN	D	771	ENSP00000237289:G771D	ENSP00000237289:G771D	G	+	2	0	TNFAIP3	138244088	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.625000	0.74248	2.668000	0.90789	0.557000	0.71058	GGC	.	.	none		0.617	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1		
VCPIP1	80124	hgsc.bcm.edu	37	8	67577531	67577531	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:67577531T>C	ENST00000310421.4	-	1	1921	c.1663A>G	c.(1663-1665)Att>Gtt	p.I555V	C8orf44-SGK3_ENST00000519289.1_5'Flank|C8orf44_ENST00000519561.1_5'Flank|C8orf44_ENST00000521889.1_5'Flank	NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	555					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			AAATACACAATAGACCCATCT	0.433																																					p.I555V	NSCLC(179;265 2915 6144 43644)	Atlas-SNP	.											.	VCPIP1	110	.	0			c.A1663G						PASS	.						188.0	165.0	173.0					8																	67577531		2203	4300	6503	SO:0001583	missense	80124	exon1			ACACAATAGACCC	AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.1663A>G	8.37:g.67577531T>C	ENSP00000309031:p.Ile555Val	Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	158	76	0.481013	NM_025054	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	ENST00000310421.4	37	CCDS6192.1	.	.	.	.	.	.	.	.	.	.	T	0.020	-1.447137	0.01089	.	.	ENSG00000175073	ENST00000310421	T	0.28255	1.62	4.98	3.65	0.41850	.	0.057027	0.64402	D	0.000001	T	0.09992	0.0245	N	0.02391	-0.57	0.43390	D	0.995508	B	0.02656	0.0	B	0.01281	0.0	T	0.15665	-1.0429	10	0.17369	T	0.5	-12.0027	5.1154	0.14831	0.0:0.2193:0.0:0.7807	.	555	Q96JH7	VCIP1_HUMAN	V	555	ENSP00000309031:I555V	ENSP00000309031:I555V	I	-	1	0	VCPIP1	67740085	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	2.772000	0.47678	1.988000	0.58038	0.528000	0.53228	ATT	.	.	none		0.433	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379227.1		
PALB2	79728	hgsc.bcm.edu	37	16	23614908	23614908	+	Missense_Mutation	SNP	C	C	T	rs180177137		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:23614908C>T	ENST00000261584.4	-	13	3585	c.3433G>A	c.(3433-3435)Ggt>Agt	p.G1145S	CTD-2196E14.3_ENST00000561764.1_RNA	NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	1145	Interaction with RAD51, BRCA2 and POLH.|Required for interaction with POLH and POLH DNA synthesis stimulation.				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		GTACACTGACCGAGAAGTAAG	0.473			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																													p.G1145S		Atlas-SNP	.	yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	.	PALB2	108	.	0			c.G3433A						PASS	.						112.0	96.0	102.0					16																	23614908		2197	4300	6497	SO:0001583	missense	79728	exon13			ACTGACCGAGAAG		CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.3433G>A	16.37:g.23614908C>T	ENSP00000261584:p.Gly1145Ser	Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	94	18	0.191489	NM_024675	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	ENST00000261584.4	37	CCDS32406.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658675	0.67586	.	.	ENSG00000083093	ENST00000261584	T	0.34667	1.35	5.77	5.77	0.91146	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.134831	0.51477	D	0.000093	T	0.50360	0.1611	L	0.49126	1.545	0.41857	D	0.990202	D	0.89917	1.0	D	0.76575	0.988	T	0.38757	-0.9646	10	0.30854	T	0.27	-18.4454	10.8436	0.46730	0.0:0.9148:0.0:0.0852	.	1145	Q86YC2	PALB2_HUMAN	S	1145	ENSP00000261584:G1145S	ENSP00000261584:G1145S	G	-	1	0	PALB2	23522409	0.936000	0.31750	0.572000	0.28498	0.702000	0.40608	3.044000	0.49830	2.737000	0.93849	0.561000	0.74099	GGT	.	.	alt		0.473	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675	
FAM50A	9130	hgsc.bcm.edu	37	X	153674051	153674051	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chrX:153674051A>G	ENST00000393600.3	+	2	292	c.182A>G	c.(181-183)aAg>aGg	p.K61R		NM_004699.3	NP_004690.1	Q14320	FA50A_HUMAN	family with sequence similarity 50, member A	61					spermatogenesis (GO:0007283)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|lung(9)|ovary(2)|skin(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCAGAGCTCAAGTCCAGCACC	0.627																																					p.K61R		Atlas-SNP	.											.	FAM50A	32	.	0			c.A182G						PASS	.						67.0	53.0	57.0					X																	153674051		2203	4300	6503	SO:0001583	missense	9130	exon2			AGCTCAAGTCCAG	BC000028	CCDS14751.1	Xq28	2008-02-05			ENSG00000071859	ENSG00000071859			18786	protein-coding gene	gene with protein product	"""DNA segment on chromosome X (unique) 9928 expressed sequence"""	300453				9339379, 9039504	Standard	NM_004699		Approved	DXS9928E, XAP5, HXC-26, 9F	uc004fll.4	Q14320	OTTHUMG00000033292	ENST00000393600.3:c.182A>G	X.37:g.153674051A>G	ENSP00000377225:p.Lys61Arg	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	95	67	0.705263	NM_004699	A8KAQ4|B2R997|Q5HY37|Q6PJH5	Missense_Mutation	SNP	ENST00000393600.3	37	CCDS14751.1	.	.	.	.	.	.	.	.	.	.	A	19.06	3.754495	0.69648	.	.	ENSG00000071859	ENST00000393600;ENST00000158526	.	.	.	4.71	3.45	0.39498	.	0.000000	0.85682	D	0.000000	T	0.49115	0.1538	M	0.62154	1.92	0.51012	D	0.999904	B	0.31548	0.328	B	0.25506	0.061	T	0.51044	-0.8755	9	0.38643	T	0.18	-43.1027	9.473	0.38853	0.8403:0.0:0.0:0.1597	.	61	Q14320	FA50A_HUMAN	R	61;21	.	ENSP00000158526:K21R	K	+	2	0	FAM50A	153327245	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.688000	0.68227	1.658000	0.50742	0.430000	0.28490	AAG	.	.	none		0.627	FAM50A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081643.2	NM_004699	
PLEKHS1	79949	hgsc.bcm.edu	37	10	115531832	115531832	+	Missense_Mutation	SNP	G	G	A	rs267602368		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:115531832G>A	ENST00000369310.3	+	7	1200	c.638G>A	c.(637-639)cGa>cAa	p.R213Q	PLEKHS1_ENST00000369309.1_Missense_Mutation_p.R33Q|PLEKHS1_ENST00000361048.1_Missense_Mutation_p.R219Q|PLEKHS1_ENST00000354462.3_5'UTR|PLEKHS1_ENST00000369312.4_Missense_Mutation_p.R131Q	NM_182601.1	NP_872407.1	Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	213																	CTTACTCCTCGAAGTGTTCTT	0.368																																					p.R219Q		Atlas-SNP	.											C10orf81_ENST00000369312,colon,carcinoma,0,2	PLEKHS1	19	2	0			c.G656A						PASS	.						155.0	142.0	147.0					10																	115531832		2203	4300	6503	SO:0001583	missense	79949	exon8			CTCCTCGAAGTGT	AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000369310.3:c.638G>A	10.37:g.115531832G>A	ENSP00000358316:p.Arg213Gln	Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	99	29	0.292929	NM_024889	A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Missense_Mutation	SNP	ENST00000369310.3	37	CCDS53580.1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420531	0.62622	.	.	ENSG00000148735	ENST00000361048;ENST00000369312;ENST00000369310;ENST00000369309	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.63	4.73	0.59995	.	0.148213	0.42964	N	0.000628	T	0.26376	0.0644	L	0.39397	1.21	0.35931	D	0.832512	D;D;P;P	0.57571	0.974;0.98;0.862;0.945	B;B;B;B	0.43867	0.286;0.372;0.322;0.434	T	0.29731	-1.0002	10	0.36615	T	0.2	-34.6782	10.4632	0.44592	0.0895:0.0:0.9105:0.0	.	213;213;213;219	Q5SXH7;Q5SXH7-5;Q5SXH7-2;Q5SXH7-4	CJ081_HUMAN;.;.;.	Q	219;131;213;33	ENSP00000354332:R219Q;ENSP00000358318:R131Q;ENSP00000358316:R213Q;ENSP00000358315:R33Q	ENSP00000354332:R219Q	R	+	2	0	C10orf81	115521822	0.999000	0.42202	0.879000	0.34478	0.678000	0.39670	1.486000	0.35530	1.389000	0.46526	0.650000	0.86243	CGA	.	.	none		0.368	PLEKHS1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050432.1	NM_024889	
ERBB4	2066	hgsc.bcm.edu	37	2	213403208	213403208	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:213403208G>A	ENST00000342788.4	-	1	357	c.47C>T	c.(46-48)gCg>gTg	p.A16V	ERBB4_ENST00000436443.1_Missense_Mutation_p.A16V|ERBB4_ENST00000402597.1_Missense_Mutation_p.A16V	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	16					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GGTCCCCGCCGCCACGAGAAG	0.612										TSP Lung(8;0.080)																											p.A16V		Atlas-SNP	.											ERBB4,NS,carcinoma,0,1	ERBB4	480	1	0			c.C47T						PASS	.						65.0	80.0	75.0					2																	213403208		2203	4300	6503	SO:0001583	missense	2066	exon1			CCCGCCGCCACGA	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.47C>T	2.37:g.213403208G>A	ENSP00000342235:p.Ala16Val	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	100	47	0.47	NM_001042599	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.672|3.672	-0.067305|-0.067305	0.07273|0.07273	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597|ENST00000260943	T;T;T|.	0.74526|.	-0.85;-0.85;-0.84|.	5.87|5.87	3.77|3.77	0.43336|0.43336	.|.	0.200683|.	0.32593|.	N|.	0.005888|.	T|T	0.19565|0.19565	0.0470|0.0470	N|N	0.08118|0.08118	0|0	0.26490|0.26490	N|N	0.974959|0.974959	B;B;B;B|.	0.25850|.	0.009;0.136;0.009;0.005|.	B;B;B;B|.	0.19148|.	0.008;0.024;0.008;0.003|.	T|T	0.17289|0.17289	-1.0374|-1.0374	10|5	0.02654|.	T|.	1|.	.|.	9.3157|9.3157	0.37932|0.37932	0.1874:0.0:0.8126:0.0|0.1874:0.0:0.8126:0.0	.|.	16;16;16;16|.	Q15303-4;Q15303-2;Q15303-3;Q15303|.	.;.;.;ERBB4_HUMAN|.	V|W	16|16	ENSP00000342235:A16V;ENSP00000403204:A16V;ENSP00000385565:A16V|.	ENSP00000342235:A16V|.	A|R	-|-	2|1	0|2	ERBB4|ERBB4	213111453|213111453	0.904000|0.904000	0.30761|0.30761	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	0.897000|0.897000	0.28390|0.28390	1.510000|1.510000	0.48803|0.48803	-0.467000|-0.467000	0.05162|0.05162	GCG|CGG	.	.	none		0.612	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
ATP12A	479	hgsc.bcm.edu	37	13	25285537	25285537	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr13:25285537C>T	ENST00000381946.3	+	22	3248	c.3081C>T	c.(3079-3081)ctC>ctT	p.L1027L	ATP12A_ENST00000218548.6_Silent_p.L1033L			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	1027					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		TCATCAGGCTCTACCCTGGAA	0.498																																					p.L1033L	Pancreas(156;1582 1935 18898 22665 26498)	Atlas-SNP	.											.	ATP12A	172	.	0			c.C3099T						PASS	.						109.0	97.0	101.0					13																	25285537		2203	4300	6503	SO:0001819	synonymous_variant	479	exon22			CAGGCTCTACCCT	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.3081C>T	13.37:g.25285537C>T		Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	111	21	0.189189	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Silent	SNP	ENST00000381946.3	37	CCDS31948.1																																																																																			.	.	none		0.498	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
ZNF572	137209	hgsc.bcm.edu	37	8	125989683	125989683	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:125989683G>A	ENST00000319286.5	+	3	1327	c.1173G>A	c.(1171-1173)aaG>aaA	p.K391K		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	391					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			AATGTGGGAAGAGTTTTGGCC	0.403										HNSCC(60;0.17)																											p.K391K		Atlas-SNP	.											ZNF572,parotid,carcinoma,+2,1	ZNF572	82	1	0			c.G1173A						PASS	.						96.0	91.0	93.0					8																	125989683		2203	4300	6503	SO:0001819	synonymous_variant	137209	exon3			TGGGAAGAGTTTT	BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.1173G>A	8.37:g.125989683G>A		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	115	56	0.486957	NM_152412	A1L4F1|Q8N1Q0	Silent	SNP	ENST00000319286.5	37	CCDS6354.1																																																																																			.	.	none		0.403	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381359.1	NM_152412	
SLC16A13	201232	hgsc.bcm.edu	37	17	6941796	6941796	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:6941796C>T	ENST00000308027.6	+	3	977	c.669C>T	c.(667-669)ctC>ctT	p.L223L		NM_201566.2	NP_963860.1	Q7RTY0	MOT13_HUMAN	solute carrier family 16, member 13	223						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						CTGTTGCCCTCACCCTGATCA	0.612																																					p.L223L		Atlas-SNP	.											.	SLC16A13	28	.	0			c.C669T						PASS	.						159.0	139.0	146.0					17																	6941796		2203	4300	6503	SO:0001819	synonymous_variant	201232	exon3			TGCCCTCACCCTG	BN000145	CCDS11085.1	17p13.1	2013-07-18	2013-07-18		ENSG00000174327	ENSG00000174327		"""Solute carriers"""	31037	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 13"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 13"""				Standard	NM_201566		Approved	MCT13	uc002geh.3	Q7RTY0	OTTHUMG00000102089	ENST00000308027.6:c.669C>T	17.37:g.6941796C>T		Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	97	41	0.42268	NM_201566	A3KMG3|A5PKU5|Q2VP92	Silent	SNP	ENST00000308027.6	37	CCDS11085.1																																																																																			.	.	none		0.612	SLC16A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219923.2		
STAT6	6778	hgsc.bcm.edu	37	12	57492825	57492825	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:57492825G>A	ENST00000300134.3	-	17	2253	c.1928C>T	c.(1927-1929)cCa>cTa	p.P643L	STAT6_ENST00000537215.2_Missense_Mutation_p.P533L|STAT6_ENST00000454075.3_Missense_Mutation_p.P643L|STAT6_ENST00000543873.2_Missense_Mutation_p.P643L|STAT6_ENST00000556155.1_Missense_Mutation_p.P643L|STAT6_ENST00000538913.2_Missense_Mutation_p.P533L	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	643					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						GATGGTAGCTGGGACATAACC	0.537																																					p.P643L		Atlas-SNP	.											.	STAT6	69	.	0			c.C1928T						PASS	.						279.0	231.0	247.0					12																	57492825		2203	4300	6503	SO:0001583	missense	6778	exon17			GTAGCTGGGACAT	BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.1928C>T	12.37:g.57492825G>A	ENSP00000300134:p.Pro643Leu	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	71	18	0.253521	NM_001178079	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	ENST00000300134.3	37	CCDS8931.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.639707	0.87760	.	.	ENSG00000166888	ENST00000300134;ENST00000535201;ENST00000538913;ENST00000543873;ENST00000556155;ENST00000537215;ENST00000454075;ENST00000542721;ENST00000555318;ENST00000542516	D;D;D;D;D;D;D	0.96802	-4.13;-4.13;-4.13;-4.13;-4.13;-4.13;-4.13	5.77	5.77	0.91146	SH2 motif (1);	0.058012	0.64402	D	0.000002	D	0.95010	0.8385	N	0.24115	0.695	0.80722	D	1	P;P	0.52577	0.745;0.954	B;P	0.53450	0.351;0.726	D	0.95186	0.8304	10	0.56958	D	0.05	-3.6578	15.4962	0.75653	0.0:0.0:1.0:0.0	.	643;643	A8K4S9;P42226	.;STAT6_HUMAN	L	643;533;533;643;643;533;643;533;71;643	ENSP00000300134:P643L;ENSP00000445409:P533L;ENSP00000438451:P643L;ENSP00000451742:P643L;ENSP00000444530:P533L;ENSP00000401486:P643L;ENSP00000450428:P71L	ENSP00000300134:P643L	P	-	2	0	STAT6	55779092	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.807000	0.69157	2.744000	0.94065	0.561000	0.74099	CCA	.	.	none		0.537	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	NM_003153	
FAM227A	646851	hgsc.bcm.edu	37	22	38995862	38995862	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr22:38995862G>A	ENST00000535113.1	-	14	1889	c.1286C>T	c.(1285-1287)cCt>cTt	p.P429L	FAM227A_ENST00000540952.1_5'UTR|FAM227A_ENST00000355830.6_Missense_Mutation_p.P424L|FAM227A_ENST00000406767.2_Missense_Mutation_p.P424L	NM_001013647.1	NP_001013669.1	F5H4B4	F227A_HUMAN	family with sequence similarity 227, member A	429																	CACAATCAGAGGGCTCTTCCC	0.448																																					p.P429L		Atlas-SNP	.											.	.	.	.	0			c.C1286T						PASS	.						95.0	78.0	83.0					22																	38995862		692	1591	2283	SO:0001583	missense	646851	exon14			ATCAGAGGGCTCT			22q13.1	2012-07-04			ENSG00000184949	ENSG00000184949			44197	protein-coding gene	gene with protein product							Standard	NM_001013647		Approved		uc011anw.1	F5H4B4	OTTHUMG00000151133	ENST00000535113.1:c.1286C>T	22.37:g.38995862G>A	ENSP00000445093:p.Pro429Leu	Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	124	20	0.16129	NM_001013647	B0QY52|B7Z7C6|Q5TG08	Missense_Mutation	SNP	ENST00000535113.1	37		.	.	.	.	.	.	.	.	.	.	G	24.3	4.512795	0.85389	.	.	ENSG00000184949	ENST00000535113;ENST00000355830;ENST00000406767;ENST00000466655	D;D;D	0.82893	-1.66;-1.66;-1.66	5.08	5.08	0.68730	.	0.000000	0.53938	D	0.000059	D	0.89966	0.6868	M	0.70275	2.135	0.52501	D	0.99995	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90866	0.4742	10	0.87932	D	0	-15.1795	14.3193	0.66473	0.0:0.0:1.0:0.0	.	424;429	Q5TG08;F5H4B4	YV009_HUMAN;.	L	429;424;424;336	ENSP00000445093:P429L;ENSP00000348086:P424L;ENSP00000385758:P424L	ENSP00000348086:P424L	P	-	2	0	RP1-199H16.5	37325808	1.000000	0.71417	0.986000	0.45419	0.960000	0.62799	4.655000	0.61476	2.499000	0.84300	0.557000	0.71058	CCT	.	.	none		0.448	FAM227A-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001013647	
DOCK10	55619	hgsc.bcm.edu	37	2	225637895	225637895	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:225637895C>T	ENST00000258390.7	-	53	6250	c.6183G>A	c.(6181-6183)ctG>ctA	p.L2061L	DOCK10_ENST00000409592.3_Silent_p.L2055L	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	2061	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CACTTCCTTGCAGTTTGAGCT	0.458																																					p.L2061L		Atlas-SNP	.											.	DOCK10	308	.	0			c.G6183A						PASS	.						87.0	85.0	86.0					2																	225637895		2176	4280	6456	SO:0001819	synonymous_variant	55619	exon53			TCCTTGCAGTTTG	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.6183G>A	2.37:g.225637895C>T		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	94	10	0.106383	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Silent	SNP	ENST00000258390.7	37	CCDS46528.1																																																																																			.	.	none		0.458	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
PHF19	26147	hgsc.bcm.edu	37	9	123632173	123632173	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:123632173G>A	ENST00000373896.3	-	5	667	c.415C>T	c.(415-417)Ctg>Ttg	p.L139L	PHF19_ENST00000419155.1_5'Flank|PHF19_ENST00000487555.1_5'Flank|PHF19_ENST00000312189.6_Silent_p.L139L	NM_015651.1	NP_056466.1	Q5T6S3	PHF19_HUMAN	PHD finger protein 19	139					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GGTGTGAGCAGGGGCTGGTCA	0.652																																					p.L139L		Atlas-SNP	.											.	PHF19	47	.	0			c.C415T						PASS	.						36.0	30.0	32.0					9																	123632173		2199	4299	6498	SO:0001819	synonymous_variant	26147	exon5			TGAGCAGGGGCTG	BX640713	CCDS35116.1, CCDS35117.1, CCDS69648.1, CCDS75889.1	9q34.11	2013-01-28			ENSG00000119403	ENSG00000119403		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24566	protein-coding gene	gene with protein product	"""polycomb-like 3"", ""tudor domain containing 19B"""	609740				15563832	Standard	XM_005251906		Approved	DKFZP727G051, PCL3, MTF2L1, TDRD19B	uc004bks.1	Q5T6S3	OTTHUMG00000020577	ENST00000373896.3:c.415C>T	9.37:g.123632173G>A		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	57	9	0.157895	NM_015651	Q32NF2|Q5T6S4|Q6N038|Q8TBL6|Q9UFS9	Silent	SNP	ENST00000373896.3	37	CCDS35116.1																																																																																			.	.	none		0.652	PHF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053838.3	XM_045308	
AGPAT2	10555	hgsc.bcm.edu	37	9	139568309	139568309	+	Silent	SNP	G	G	A	rs200288462		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:139568309G>A	ENST00000371696.2	-	6	797	c.732C>T	c.(730-732)ctC>ctT	p.L244L	AGPAT2_ENST00000371694.3_Silent_p.L212L|AGPAT2_ENST00000538402.1_Silent_p.L244L	NM_006412.3	NP_006403.2	O15120	PLCB_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 2	244					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|epidermis development (GO:0008544)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			endometrium(1)|large_intestine(1)|lung(2)|prostate(2)	6	all_cancers(76;0.0893)|all_epithelial(76;0.231)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		AGGTGTCCACGAGCGCAGGGA	0.682																																					p.L244L		Atlas-SNP	.											.	AGPAT2	17	.	0			c.C732T						PASS	.	G	,	0,4388		0,0,2194	41.0	41.0	41.0		636,732	-6.7	0.0	9		41	3,8587		0,3,4292	no	coding-synonymous,coding-synonymous	AGPAT2	NM_001012727.1,NM_006412.3	,	0,3,6486	AA,AG,GG		0.0349,0.0,0.0231	,	212/247,244/279	139568309	3,12975	2194	4295	6489	SO:0001819	synonymous_variant	10555	exon6			GTCCACGAGCGCA	AF000237	CCDS7003.1, CCDS35181.1	9q34.3	2013-02-05	2013-02-05		ENSG00000169692	ENSG00000169692	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	325	protein-coding gene	gene with protein product	"""LPAAT-beta"", ""lysophosphatidic acid acyltransferase, beta"""	603100	"""Berardinelli-Seip congenital lipodystrophy"", ""1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)"""	BSCL		9242711, 9212163	Standard	NM_006412		Approved		uc004cii.1	O15120	OTTHUMG00000020936	ENST00000371696.2:c.732C>T	9.37:g.139568309G>A		Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	71	25	0.352113	NM_006412	O00516|O15106|Q5VUD3|Q5VUD4|Q9BSV7|Q9BWR7	Silent	SNP	ENST00000371696.2	37	CCDS7003.1																																																																																			G|0.997;A|0.003	0.003	weak		0.682	AGPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055090.1	NM_006412	
SOCS1	8651	hgsc.bcm.edu	37	16	11348920	11348920	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:11348920C>T	ENST00000332029.2	-	2	566	c.416G>A	c.(415-417)gGc>gAc	p.G139D	RMI2_ENST00000572173.1_Intron	NM_003745.1	NP_003736.1	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	139	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cellular response to amino acid stimulus (GO:0071230)|cytokine-mediated signaling pathway (GO:0019221)|fat cell differentiation (GO:0045444)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein phosphorylation (GO:0001932)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	insulin-like growth factor receptor binding (GO:0005159)|kinase inhibitor activity (GO:0019210)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.Y64fs*1(1)|p.R127_*212del(1)|p.0?(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(66)|lung(3)	71						CTCGCGGCTGCCATCCAGGTG	0.697			"""F, O"""		"""Hodgkin Lymphoma, PMBL"""																																p.G139D	Colon(177;456 3548 27231)	Atlas-SNP	.		Rec	yes		16	16p13.13	8651	suppressor of cytokine signaling 1		L	.	SOCS1	84	.	3	Whole gene deletion(1)|Deletion - In frame(1)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(3)	c.G416A						PASS	.						14.0	16.0	15.0					16																	11348920		2182	4284	6466	SO:0001583	missense	8651	exon2			CGGCTGCCATCCA	U88326	CCDS10546.1	16p13.13	2013-02-14			ENSG00000185338	ENSG00000185338		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19383	protein-coding gene	gene with protein product		603597				7796808, 9266833	Standard	NM_003745		Approved	SOCS-1, SSI-1, JAB, TIP3, Cish1	uc002dar.1	O15524	OTTHUMG00000129792	ENST00000332029.2:c.416G>A	16.37:g.11348920C>T	ENSP00000329418:p.Gly139Asp	Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	64	20	0.3125	NM_003745	O15097|Q9NSA7	Missense_Mutation	SNP	ENST00000332029.2	37	CCDS10546.1	.	.	.	.	.	.	.	.	.	.	C	17.18	3.324652	0.60634	.	.	ENSG00000185338	ENST00000332029	D	0.88277	-2.36	4.19	3.22	0.36961	SH2 motif (4);	0.109277	0.64402	D	0.000007	D	0.89336	0.6686	L	0.52905	1.665	0.80722	D	1	P	0.37548	0.599	P	0.48189	0.57	D	0.87457	0.2405	10	0.41790	T	0.15	-29.8658	12.3946	0.55378	0.1695:0.8305:0.0:0.0	.	139	O15524	SOCS1_HUMAN	D	139	ENSP00000329418:G139D	ENSP00000329418:G139D	G	-	2	0	SOCS1	11256421	1.000000	0.71417	1.000000	0.80357	0.615000	0.37417	1.156000	0.31712	0.963000	0.38082	-0.314000	0.08810	GGC	.	.	none		0.697	SOCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252018.1		
LINGO3	645191	hgsc.bcm.edu	37	19	2290848	2290848	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:2290848C>T	ENST00000585527.1	-	1	1175	c.928G>A	c.(928-930)Gag>Aag	p.E310K	LINGO3_ENST00000404279.1_Missense_Mutation_p.E310K			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	310						integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						GCCTGCGGCTCCACCACAGCC	0.682																																					p.E310K		Atlas-SNP	.											.	LINGO3	19	.	0			c.G928A						PASS	.						13.0	17.0	16.0					19																	2290848		1958	4125	6083	SO:0001583	missense	645191	exon2			GCGGCTCCACCAC	AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.928G>A	19.37:g.2290848C>T	ENSP00000467753:p.Glu310Lys	Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	128	39	0.304688	NM_001101391		Missense_Mutation	SNP	ENST00000585527.1	37	CCDS45905.1	.	.	.	.	.	.	.	.	.	.	c	25.3	4.624090	0.87560	.	.	ENSG00000220008	ENST00000404279	T	0.79940	-1.32	4.62	4.62	0.57501	.	.	.	.	.	D	0.86464	0.5939	L	0.54965	1.715	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	D	0.86507	0.1807	9	0.44086	T	0.13	.	16.0085	0.80380	0.0:1.0:0.0:0.0	.	310	P0C6S8	LIGO3_HUMAN	K	310	ENSP00000384979:E310K	ENSP00000384979:E310K	E	-	1	0	LINGO3	2241848	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.841000	0.55850	2.102000	0.63906	0.462000	0.41574	GAG	.	.	none		0.682	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451291.2	NM_001101391	
HIST1H2BJ	8970	hgsc.bcm.edu	37	6	27100437	27100437	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:27100437C>T	ENST00000607124.1	-	1	92	c.93G>A	c.(91-93)aaG>aaA	p.K31K	HIST1H2BJ_ENST00000541790.1_Silent_p.K31K|HIST1H2BJ_ENST00000339812.2_Silent_p.K31K|HIST1H2AG_ENST00000359193.2_5'Flank			P06899	H2B1J_HUMAN	histone cluster 1, H2bj	31				KRKRS -> SAAH (in Ref. 1; CAA24950). {ECO:0000305}.	antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(2)|lung(5)|ovary(1)|prostate(1)	10						TGCGGCTGCGCTTGCGCTTCT	0.557																																					p.K31K		Atlas-SNP	.											.	HIST1H2BJ	21	.	0			c.G93A						PASS	.						163.0	156.0	158.0					6																	27100437		2203	4300	6503	SO:0001819	synonymous_variant	8970	exon1			GCTGCGCTTGCGC	X00088	CCDS4618.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000124635	ENSG00000124635		"""Histones / Replication-dependent"""	4761	protein-coding gene	gene with protein product		615044	"""H2B histone family, member R"", ""histone 1, H2bj"""	H2BFR		6647026, 12408966	Standard	NM_021058		Approved	H2B/r	uc003niv.3	P06899	OTTHUMG00000014470	ENST00000607124.1:c.93G>A	6.37:g.27100437C>T		Somatic	182	0	0		WXS	Illumina HiSeq	Phase_I	129	13	0.100775	NM_021058	B2R4J4|O60816	Silent	SNP	ENST00000607124.1	37	CCDS4618.1																																																																																			.	.	none		0.557	HIST1H2BJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040138.2	NM_021058	
CNRIP1	25927	hgsc.bcm.edu	37	2	68521067	68521067	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:68521067G>A	ENST00000263655.3	-	3	1027	c.422C>T	c.(421-423)tCt>tTt	p.S141F	CNRIP1_ENST00000481714.1_5'UTR|CNRIP1_ENST00000409559.3_Intron	NM_015463.2	NP_056278.1	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1	141										kidney(1)|large_intestine(5)|liver(1)|lung(1)|skin(1)	9						CTCAATGACAGAGAAGGGGCT	0.507																																					p.S141F		Atlas-SNP	.											.	CNRIP1	45	.	0			c.C422T						PASS	.						145.0	117.0	126.0					2																	68521067		2203	4300	6503	SO:0001583	missense	25927	exon3			ATGACAGAGAAGG	AL110235	CCDS1886.1, CCDS46311.1	2p13	2008-02-05	2007-11-29	2007-11-29	ENSG00000119865	ENSG00000119865			24546	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 32"""	C2orf32		12477932	Standard	NM_015463		Approved	DKFZP566K1924, CRIP1, CRIP1a, CRIP1b	uc002sek.4	Q96F85	OTTHUMG00000129565	ENST00000263655.3:c.422C>T	2.37:g.68521067G>A	ENSP00000263655:p.Ser141Phe	Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	131	34	0.259542	NM_015463	B2R4D0|Q49AN4|Q9UFZ0	Missense_Mutation	SNP	ENST00000263655.3	37	CCDS1886.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.504342	0.44558	.	.	ENSG00000119865	ENST00000263655	.	.	.	5.42	5.42	0.78866	.	0.327702	0.34959	N	0.003560	T	0.48857	0.1523	N	0.24115	0.695	0.80722	D	1	B	0.24963	0.115	B	0.34138	0.176	T	0.50189	-0.8857	9	0.56958	D	0.05	-7.1396	13.8208	0.63320	0.0:0.2784:0.7216:0.0	.	141	Q96F85	CNRP1_HUMAN	F	141	.	ENSP00000263655:S141F	S	-	2	0	CNRIP1	68374571	0.945000	0.32115	0.978000	0.43139	0.959000	0.62525	1.594000	0.36697	2.538000	0.85594	0.650000	0.86243	TCT	.	.	none		0.507	CNRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251758.1	NM_015463	
INPPL1	3636	hgsc.bcm.edu	37	11	71949157	71949157	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:71949157C>T	ENST00000298229.2	+	27	3828	c.3624C>T	c.(3622-3624)atC>atT	p.I1208I	INPPL1_ENST00000541756.1_Silent_p.I966I|INPPL1_ENST00000538751.1_Silent_p.I966I|PHOX2A_ENST00000544057.1_5'Flank	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	1208	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TGCGGGCCATCGGCTTGGAGC	0.711											OREG0021191	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I1208I		Atlas-SNP	.											INPPL1,bladder,carcinoma,0,1	INPPL1	120	1	0			c.C3624T						scavenged	.						20.0	21.0	21.0					11																	71949157		2198	4289	6487	SO:0001819	synonymous_variant	3636	exon27			GGCCATCGGCTTG	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.3624C>T	11.37:g.71949157C>T		Somatic	121	1	0.00826446	1133	WXS	Illumina HiSeq	Phase_I	95	51	0.536842	NM_001567	B2RTX5|Q13577|Q13578	Silent	SNP	ENST00000298229.2	37	CCDS8213.1	.	.	.	.	.	.	.	.	.	.	c	10.16	1.273590	0.23221	.	.	ENSG00000165458	ENST00000320683	.	.	.	4.84	-0.416	0.12351	.	.	.	.	.	T	0.44456	0.1294	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29243	-1.0018	4	.	.	.	.	4.3982	0.11374	0.0:0.3624:0.171:0.4666	.	.	.	.	L	70	.	.	S	+	2	0	INPPL1	71626805	0.980000	0.34600	1.000000	0.80357	0.975000	0.68041	0.085000	0.14912	0.257000	0.21650	-0.218000	0.12543	TCG	.	.	none		0.711	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	
BCL2A1	597	hgsc.bcm.edu	37	15	80263370	80263370	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:80263370C>T	ENST00000267953.3	-	1	418	c.92G>A	c.(91-93)aGc>aAc	p.S31N	BCL2A1_ENST00000335661.6_Missense_Mutation_p.S31N	NM_004049.3	NP_004040.1	Q16548	B2LA1_HUMAN	BCL2-related protein A1	31	Ala/Pro-rich.				extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)	mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|pancreas(1)|upper_aerodigestive_tract(1)	12						GGACGTTTTGCTTGGACCTGA	0.438																																					p.S31N		Atlas-SNP	.											.	BCL2A1	28	.	0			c.G92A						PASS	.						126.0	115.0	118.0					15																	80263370		2203	4300	6503	SO:0001583	missense	597	exon1			GTTTTGCTTGGAC		CCDS10312.1, CCDS45322.1	15q24.3	2014-05-20			ENSG00000140379	ENSG00000140379			991	protein-coding gene	gene with protein product		601056		HBPA1		8589678, 12771180	Standard	NM_004049		Approved	GRS, BFL1, BCL2L5, ACC-1, ACC-2	uc002bfc.4	Q16548	OTTHUMG00000144173	ENST00000267953.3:c.92G>A	15.37:g.80263370C>T	ENSP00000267953:p.Ser31Asn	Somatic	222	0	0		WXS	Illumina HiSeq	Phase_I	212	35	0.165094	NM_001114735	Q6FGZ4|Q6FH19|Q86W13|Q99524	Missense_Mutation	SNP	ENST00000267953.3	37	CCDS10312.1	.	.	.	.	.	.	.	.	.	.	C	11.95	1.792023	0.31685	.	.	ENSG00000140379	ENST00000267953;ENST00000335661	T;T	0.19105	2.17;2.17	5.63	3.42	0.39159	.	0.384799	0.28016	N	0.016930	T	0.18045	0.0433	L	0.52364	1.645	0.09310	N	1	B;B	0.20261	0.019;0.043	B;B	0.11329	0.005;0.006	T	0.12785	-1.0534	10	0.40728	T	0.16	-9.7726	8.3084	0.32055	0.0:0.6889:0.1444:0.1667	.	31;31	Q86W13;Q16548	.;B2LA1_HUMAN	N	31	ENSP00000267953:S31N;ENSP00000335250:S31N	ENSP00000267953:S31N	S	-	2	0	BCL2A1	78050425	0.946000	0.32159	0.171000	0.22900	0.008000	0.06430	1.337000	0.33862	1.382000	0.46385	0.655000	0.94253	AGC	.	.	none		0.438	BCL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291372.1	NM_004049	
KCNAB3	9196	hgsc.bcm.edu	37	17	7832622	7832622	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:7832622C>T	ENST00000303790.2	-	1	131	c.132G>A	c.(130-132)ccG>ccA	p.P44P	CNTROB_ENST00000380255.3_5'Flank|CNTROB_ENST00000380262.3_5'Flank|CNTROB_ENST00000563694.1_5'Flank|RP11-1099M24.7_ENST00000573621.1_Intron	NM_004732.3	NP_004723.2	O43448	KCAB3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 3	44					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	8		Prostate(122;0.157)				CTCCACCCCCCGGAGGATTCC	0.761																																					p.P44P		Atlas-SNP	.											.	KCNAB3	30	.	0			c.G132A						PASS	.						3.0	5.0	4.0					17																	7832622		1903	3833	5736	SO:0001819	synonymous_variant	9196	exon1			ACCCCCCGGAGGA	AF016411	CCDS11124.1	17p13.1	2006-11-29			ENSG00000170049	ENSG00000170049		"""Potassium channels"", ""Aldo-keto reductases"""	6230	protein-coding gene	gene with protein product		604111				9857044	Standard	NM_004732		Approved	AKR6A9, KCNA3B	uc002gjm.2	O43448	OTTHUMG00000108170	ENST00000303790.2:c.132G>A	17.37:g.7832622C>T		Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	68	28	0.411765	NM_004732	Q4VAW0	Silent	SNP	ENST00000303790.2	37	CCDS11124.1																																																																																			.	.	none		0.761	KCNAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226974.1	NM_004732	
TAC3	6866	hgsc.bcm.edu	37	12	57407443	57407443	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:57407443G>A	ENST00000458521.2	-	3	286	c.127C>T	c.(127-129)Ctc>Ttc	p.L43F	TAC3_ENST00000415231.1_Missense_Mutation_p.L43F|TAC3_ENST00000441881.1_Missense_Mutation_p.L43F	NM_013251.3	NP_037383.1	Q9UHF0	TKNK_HUMAN	tachykinin 3	43					female pregnancy (GO:0007565)|neuropeptide signaling pathway (GO:0007218)|tachykinin receptor signaling pathway (GO:0007217)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7						AGCTGGTAGAGATCTGGATCC	0.567																																					p.L43F		Atlas-SNP	.											.	TAC3	11	.	0			c.C127T						PASS	.						40.0	42.0	41.0					12																	57407443		2203	4300	6503	SO:0001583	missense	6866	exon3			GGTAGAGATCTGG	AF186112	CCDS8928.1, CCDS53803.1	12q13-q21	2013-02-26	2008-07-31		ENSG00000166863	ENSG00000166863		"""Endogenous ligands"""	11521	protein-coding gene	gene with protein product	"""preprotachykinin-B"""	162330	"""neuromedin K"", ""neurokinin beta"""	NKNB		3479225, 10866201	Standard	NM_013251		Approved	ZNEUROK1, NKB	uc001smp.3	Q9UHF0	OTTHUMG00000156958	ENST00000458521.2:c.127C>T	12.37:g.57407443G>A	ENSP00000404056:p.Leu43Phe	Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	38	19	0.5	NM_013251	Q6IAG2|Q71BC6|Q71BC9	Missense_Mutation	SNP	ENST00000458521.2	37	CCDS8928.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686261	0.47991	.	.	ENSG00000166863	ENST00000458521;ENST00000441881;ENST00000415231	D;D;D	0.86297	-2.1;-1.95;-2.1	6.02	2.15	0.27550	.	0.345998	0.26528	N	0.023870	T	0.76314	0.3970	L	0.34521	1.04	0.09310	N	1	P;P	0.39326	0.668;0.617	B;B	0.36808	0.233;0.15	T	0.66143	-0.5997	10	0.44086	T	0.13	-0.3145	5.0391	0.14449	0.1546:0.0:0.5513:0.2942	.	43;43	Q9UHF0;Q9UHF0-3	TKNK_HUMAN;.	F	43	ENSP00000404056:L43F;ENSP00000408208:L43F;ENSP00000402995:L43F	ENSP00000300108:L43F	L	-	1	0	TAC3	55693710	0.002000	0.14202	0.000000	0.03702	0.016000	0.09150	0.337000	0.19841	0.130000	0.18549	-0.181000	0.13052	CTC	.	.	none		0.567	TAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346793.1	NM_001006667	
FAM104A	84923	hgsc.bcm.edu	37	17	71228291	71228291	+	Missense_Mutation	SNP	G	G	A	rs569512877		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:71228291G>A	ENST00000403627.3	-	1	215	c.155C>T	c.(154-156)tCt>tTt	p.S52F	C17orf80_ENST00000268942.8_5'Flank|C17orf80_ENST00000426147.2_5'Flank|FAM104A_ENST00000405159.3_Missense_Mutation_p.S52F|C17orf80_ENST00000359042.2_5'Flank|C17orf80_ENST00000577615.1_5'Flank|C17orf80_ENST00000535032.2_5'Flank|FAM104A_ENST00000583178.1_Intron|FAM104A_ENST00000583024.1_Missense_Mutation_p.S52F|FAM104A_ENST00000581110.1_Missense_Mutation_p.S52F|C17orf80_ENST00000582793.1_5'Flank|C17orf80_ENST00000255557.4_5'Flank	NM_032837.2	NP_116226.2	Q969W3	F104A_HUMAN	family with sequence similarity 104, member A	52										endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			LUSC - Lung squamous cell carcinoma(166;0.197)			TCCGCGAAGAGAGGGAACAGA	0.706																																					p.S52F		Atlas-SNP	.											.	FAM104A	15	.	0			c.C155T						PASS	.						18.0	22.0	20.0					17																	71228291		2200	4297	6497	SO:0001583	missense	84923	exon1			CGAAGAGAGGGAA	AK027681	CCDS11693.2, CCDS45766.1, CCDS74143.1, CCDS74144.1	17q25.1	2005-12-16			ENSG00000133193	ENSG00000133193			25918	protein-coding gene	gene with protein product							Standard	NM_032837		Approved	FLJ14775	uc002jjj.4	Q969W3	OTTHUMG00000150564	ENST00000403627.3:c.155C>T	17.37:g.71228291G>A	ENSP00000384648:p.Ser52Phe	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	93	29	0.311828	NM_032837	B4E339	Missense_Mutation	SNP	ENST00000403627.3	37	CCDS11693.2	.	.	.	.	.	.	.	.	.	.	G	12.53	1.965297	0.34659	.	.	ENSG00000133193	ENST00000403627;ENST00000405159	T;T	0.50813	0.76;0.73	4.75	1.61	0.23674	.	.	.	.	.	T	0.24928	0.0605	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.005	T	0.19484	-1.0304	9	0.62326	D	0.03	.	4.6392	0.12540	0.2012:0.1899:0.609:0.0	.	52;52	Q969W3-2;Q969W3	.;F104A_HUMAN	F	52	ENSP00000384648:S52F;ENSP00000384832:S52F	ENSP00000384648:S52F	S	-	2	0	FAM104A	68739886	0.671000	0.27521	0.000000	0.03702	0.019000	0.09904	2.392000	0.44433	0.209000	0.20645	0.655000	0.94253	TCT	.	.	none		0.706	FAM104A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318935.1	NM_032837	
PARD3B	117583	hgsc.bcm.edu	37	2	206041194	206041194	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:206041194C>T	ENST00000406610.2	+	13	2024	c.1817C>T	c.(1816-1818)tCc>tTc	p.S606F	PARD3B_ENST00000358768.2_Missense_Mutation_p.S544F|PARD3B_ENST00000351153.1_Missense_Mutation_p.S606F|PARD3B_ENST00000462231.1_Missense_Mutation_p.S606F|PARD3B_ENST00000349953.3_Missense_Mutation_p.S606F	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	606					cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)				breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		GGGGCATTTTCCAAGCCATGC	0.393																																					p.S606F		Atlas-SNP	.											.	PARD3B	314	.	0			c.C1817T						PASS	.						82.0	75.0	77.0					2																	206041194		1855	4099	5954	SO:0001583	missense	117583	exon13			CATTTTCCAAGCC	AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.1817C>T	2.37:g.206041194C>T	ENSP00000385848:p.Ser606Phe	Somatic	360	0	0		WXS	Illumina HiSeq	Phase_I	302	61	0.201987	NM_205863	E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	ENST00000406610.2	37		.	.	.	.	.	.	.	.	.	.	C	18.46	3.628482	0.67015	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	T;T;T;T	0.13089	2.85;2.62;2.85;2.85	6.03	5.11	0.69529	.	0.225498	0.32593	N	0.005900	T	0.24236	0.0587	L	0.44542	1.39	0.35016	D	0.757362	D;D;D;P;P	0.65815	0.995;0.991;0.967;0.941;0.941	P;P;P;P;P	0.59643	0.861;0.736;0.682;0.571;0.555	T	0.06643	-1.0815	10	0.59425	D	0.04	.	11.9098	0.52733	0.2451:0.7549:0.0:0.0	.	606;606;606;544;606	Q8TEW8-3;Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	.;PAR3L_HUMAN;.;.;.	F	606;544;606;606	ENSP00000385848:S606F;ENSP00000351618:S544F;ENSP00000317261:S606F;ENSP00000340280:S606F	ENSP00000340280:S606F	S	+	2	0	PARD3B	205749439	0.997000	0.39634	1.000000	0.80357	0.977000	0.68977	1.791000	0.38744	2.854000	0.98071	0.655000	0.94253	TCC	.	.	none		0.393	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177	
ZNF208	7757	hgsc.bcm.edu	37	19	22155873	22155873	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:22155873G>T	ENST00000397126.4	-	4	2111	c.1963C>A	c.(1963-1965)Cat>Aat	p.H655N	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	655					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATTGCCTTATGTGTAGTAAGG	0.383																																					p.H655N		Atlas-SNP	.											.	ZNF208	817	.	0			c.C1963A						PASS	.						84.0	90.0	88.0					19																	22155873		2099	4256	6355	SO:0001583	missense	7757	exon4			CCTTATGTGTAGT	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1963C>A	19.37:g.22155873G>T	ENSP00000380315:p.His655Asn	Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	120	29	0.241667	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	G	9.493	1.101239	0.20632	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	D	0.86865	-2.18	2.49	2.49	0.30216	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92299	0.7557	.	.	.	0.24812	N	0.992636	D	0.89917	1.0	D	0.91635	0.999	D	0.83937	0.0309	8	0.87932	D	0	.	11.6277	0.51156	0.0:0.0:1.0:0.0	.	555	O43345	ZN208_HUMAN	N	655;555	ENSP00000380315:H655N	ENSP00000380315:H655N	H	-	1	0	ZNF208	21947713	0.987000	0.35691	0.002000	0.10522	0.002000	0.02628	3.980000	0.56895	0.923000	0.37045	0.289000	0.19496	CAT	.	.	none		0.383	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
MLLT3	4300	hgsc.bcm.edu	37	9	20414346	20414346	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:20414346G>A	ENST00000380338.4	-	5	784	c.498C>T	c.(496-498)agC>agT	p.S166S	MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S163S|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	166	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S166S(4)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctactgctgctgctgc	0.527			T	MLL	ALL																																p.S166S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,NS,carcinoma,0,7	MLLT3	125	7	4	Substitution - coding silent(4)	urinary_tract(2)|lung(1)|prostate(1)	c.C498T						scavenged	.						8.0	15.0	13.0					9																	20414346		1434	3114	4548	SO:0001819	synonymous_variant	4300	exon5			GCTACTGCTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.498C>T	9.37:g.20414346G>A		Somatic	120	6	0.05		WXS	Illumina HiSeq	Phase_I	136	21	0.154412	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.	.	none		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
TMEM30A	55754	hgsc.bcm.edu	37	6	75969173	75969173	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:75969173G>C	ENST00000230461.6	-	5	904	c.575C>G	c.(574-576)tCt>tGt	p.S192C	TMEM30A_ENST00000475111.2_Missense_Mutation_p.S156C|TMEM30A_ENST00000370050.5_Missense_Mutation_p.S73C	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	192					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TATAGGATAAGAATCATTGCC	0.353																																					p.S192C		Atlas-SNP	.											.	TMEM30A	40	.	0			c.C575G						PASS	.						81.0	81.0	81.0					6																	75969173		2203	4295	6498	SO:0001583	missense	55754	exon5			GGATAAGAATCAT	AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.575C>G	6.37:g.75969173G>C	ENSP00000230461:p.Ser192Cys	Somatic	348	0	0		WXS	Illumina HiSeq	Phase_I	262	59	0.225191	NM_018247	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Missense_Mutation	SNP	ENST00000230461.6	37	CCDS4983.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850681	0.71719	.	.	ENSG00000112697	ENST00000230461;ENST00000545449;ENST00000370050;ENST00000475111;ENST00000518161	.	.	.	5.31	5.31	0.75309	.	0.374161	0.30565	N	0.009358	T	0.74966	0.3786	M	0.83012	2.62	0.38661	D	0.952079	D;D	0.63046	0.982;0.992	P;P	0.58520	0.753;0.84	T	0.78409	-0.2215	9	0.59425	D	0.04	.	19.3389	0.94334	0.0:0.0:1.0:0.0	.	156;192	Q9NV96-2;Q9NV96	.;CC50A_HUMAN	C	192;176;73;156;73	.	ENSP00000230461:S192C	S	-	2	0	TMEM30A	76025893	0.987000	0.35691	0.954000	0.39281	0.425000	0.31504	3.458000	0.53014	2.650000	0.89964	0.655000	0.94253	TCT	.	.	none		0.353	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041248.2	NM_018247	
FAT1	2195	hgsc.bcm.edu	37	4	187542336	187542336	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:187542336C>G	ENST00000441802.2	-	10	5613	c.5404G>C	c.(5404-5406)Gac>Cac	p.D1802H		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1802	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GCATTTGAGTCTTTATCAGCA	0.398										HNSCC(5;0.00058)																											p.D1802H	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.G5404C						PASS	.						87.0	83.0	84.0					4																	187542336		1963	4160	6123	SO:0001583	missense	2195	exon10			TTGAGTCTTTATC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.5404G>C	4.37:g.187542336C>G	ENSP00000406229:p.Asp1802His	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	108	18	0.166667	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	9.774	1.173534	0.21704	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.52526	0.66	5.5	5.5	0.81552	Cadherin (4);Cadherin-like (1);	0.145249	0.64402	D	0.000010	T	0.46560	0.1399	L	0.42529	1.33	0.58432	D	0.999999	B	0.17667	0.023	B	0.21708	0.036	T	0.37430	-0.9706	10	0.62326	D	0.03	.	19.5916	0.95514	0.0:1.0:0.0:0.0	.	1802	Q14517	FAT1_HUMAN	H	1802;1804	ENSP00000406229:D1802H	ENSP00000260147:D1804H	D	-	1	0	FAT1	187779330	1.000000	0.71417	0.693000	0.30195	0.030000	0.12068	7.651000	0.83577	2.861000	0.98227	0.655000	0.94253	GAC	.	.	none		0.398	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
PXDN	7837	hgsc.bcm.edu	37	2	1653227	1653227	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:1653227G>A	ENST00000252804.4	-	17	2375	c.2325C>T	c.(2323-2325)ttC>ttT	p.F775F		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	775					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GAGGGGTGTTGAAGCCATTCT	0.652																																					p.F775F		Atlas-SNP	.											.	PXDN	255	.	0			c.C2325T						PASS	.						88.0	103.0	98.0					2																	1653227		2054	4195	6249	SO:0001819	synonymous_variant	7837	exon17			GGTGTTGAAGCCA	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2325C>T	2.37:g.1653227G>A		Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	101	25	0.247525	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	CCDS46221.1																																																																																			.	.	none		0.652	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
MCF2L	23263	hgsc.bcm.edu	37	13	113724398	113724398	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr13:113724398G>A	ENST00000375608.3	+	10	1055	c.997G>A	c.(997-999)Gag>Aag	p.E333K	MCF2L_ENST00000442652.2_Missense_Mutation_p.E333K|MCF2L_ENST00000375601.3_Missense_Mutation_p.E307K|MCF2L_ENST00000397030.1_Missense_Mutation_p.E336K|MCF2L_ENST00000375597.4_Missense_Mutation_p.E301K|MCF2L_ENST00000434480.2_Missense_Mutation_p.E309K|MCF2L_ENST00000423482.2_Missense_Mutation_p.E301K|MCF2L_ENST00000421756.1_Missense_Mutation_p.E307K|MCF2L_ENST00000375604.2_Missense_Mutation_p.E360K|MCF2L_ENST00000535094.2_Missense_Mutation_p.E303K			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	333					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				GAACGAAACCGAGGCTGCCTT	0.622																																					p.E303K		Atlas-SNP	.											.	MCF2L	182	.	0			c.G907A						PASS	.						122.0	97.0	106.0					13																	113724398		2203	4300	6503	SO:0001583	missense	23263	exon9			GAAACCGAGGCTG	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.997G>A	13.37:g.113724398G>A	ENSP00000364758:p.Glu333Lys	Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	31	12	0.387097	NM_001112732	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	ENST00000375608.3	37		.	.	.	.	.	.	.	.	.	.	G	24.6	4.551254	0.86127	.	.	ENSG00000126217	ENST00000375608;ENST00000442652;ENST00000375604;ENST00000397030;ENST00000535094;ENST00000421756;ENST00000375601;ENST00000434480;ENST00000423482;ENST00000375597;ENST00000440749	T;T;T;T;T;T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37;1.37;1.37;1.37;1.37;1.37	5.58	4.74	0.60224	.	0.053333	0.64402	N	0.000001	T	0.62816	0.2459	M	0.84511	2.7	0.47441	D	0.999425	D;D;D;D;D;D	0.76494	0.997;0.999;0.999;0.994;0.983;0.994	D;D;D;P;P;P	0.68943	0.916;0.961;0.916;0.711;0.78;0.827	T	0.70153	-0.4950	10	0.87932	D	0	.	14.1951	0.65664	0.0719:0.0:0.9281:0.0	.	301;303;360;265;301;333	E9PDN8;O15068-9;G5E9A1;E2QRA2;O15068-4;O15068	.;.;.;.;.;MCF2L_HUMAN	K	333;333;360;336;303;307;307;309;301;301;144	ENSP00000364758:E333K;ENSP00000401422:E333K;ENSP00000364754:E360K;ENSP00000380225:E336K;ENSP00000440374:E303K;ENSP00000397285:E307K;ENSP00000364751:E307K;ENSP00000407722:E309K;ENSP00000405639:E301K;ENSP00000364747:E301K	ENSP00000364747:E301K	E	+	1	0	MCF2L	112772399	1.000000	0.71417	0.871000	0.34182	0.522000	0.34438	9.180000	0.94867	1.356000	0.45884	0.655000	0.94253	GAG	.	.	none		0.622	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4		
ACTB	60	hgsc.bcm.edu	37	7	5569251	5569251	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:5569251C>G	ENST00000331789.5	-	2	229	c.38G>C	c.(37-39)gGc>gCc	p.G13A	ACTB_ENST00000464611.1_5'Flank|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	13					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		CATGCCGGAGCCGTTGTCGAC	0.706																																					p.G13A		Atlas-SNP	.											.	ACTB	45	.	0			c.G38C						PASS	.						19.0	22.0	21.0					7																	5569251		2164	4231	6395	SO:0001583	missense	60	exon2			CCGGAGCCGTTGT	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.38G>C	7.37:g.5569251C>G	ENSP00000349960:p.Gly13Ala	Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	56	7	0.125	NM_001101	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000331789.5	37	CCDS5341.1	.	.	.	.	.	.	.	.	.	.	C	18.56	3.650746	0.67472	.	.	ENSG00000075624	ENST00000331789;ENST00000445914;ENST00000400179;ENST00000432588;ENST00000443528;ENST00000417101;ENST00000414620	D;D;D;D;D	0.99905	-7.72;-7.72;-6.54;-6.54;-6.54	4.69	3.79	0.43588	.	0.000000	0.64402	D	0.000008	D	0.99928	0.9967	H	0.98388	4.22	0.45205	D	0.998217	P	0.48503	0.911	P	0.61477	0.889	D	0.95933	0.8940	10	0.87932	D	0	.	11.9093	0.52729	0.1757:0.8243:0.0:0.0	.	13	P60709	ACTB_HUMAN	A	13;13;13;13;13;16;13	ENSP00000349960:G13A;ENSP00000407473:G13A;ENSP00000393951:G13A;ENSP00000399487:G16A;ENSP00000401032:G13A	ENSP00000349960:G13A	G	-	2	0	ACTB	5535777	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	5.726000	0.68515	0.945000	0.37605	0.557000	0.71058	GGC	.	.	none		0.706	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059589.4	NM_001101	
ERBB2IP	55914	hgsc.bcm.edu	37	5	65374285	65374285	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:65374285G>A	ENST00000284037.5	+	26	4555	c.4166G>A	c.(4165-4167)gGa>gAa	p.G1389E	ERBB2IP_ENST00000380935.1_Missense_Mutation_p.G1279E|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.G1344E|ERBB2IP_ENST00000416865.2_Missense_Mutation_p.G587E|ERBB2IP_ENST00000508515.1_Missense_Mutation_p.G1279E|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.G1337E|ERBB2IP_ENST00000503913.1_3'UTR|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.G1323E|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.G1396E|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.G1348E|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.G1317E	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	1389	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		ATTGAACATGGACAAGCAGTG	0.348																																					p.G1396E		Atlas-SNP	.											.	ERBB2IP	120	.	0			c.G4187A						PASS	.						66.0	68.0	67.0					5																	65374285		2203	4300	6503	SO:0001583	missense	55914	exon26			AACATGGACAAGC		CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.4166G>A	5.37:g.65374285G>A	ENSP00000284037:p.Gly1389Glu	Somatic	341	1	0.00293255		WXS	Illumina HiSeq	Phase_I	376	162	0.430851	NM_001253699	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	ENST00000284037.5	37	CCDS58953.1	.	.	.	.	.	.	.	.	.	.	G	6.208	0.406620	0.11754	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000416865;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	T;T;T;T;T;T;T;T;T;T	0.35605	2.0;2.0;2.0;2.0;2.0;2.0;1.3;2.0;2.0;2.0	5.63	5.63	0.86233	PDZ/DHR/GLGF (4);	0.131866	0.49916	D	0.000133	T	0.28067	0.0692	N	0.01522	-0.82	0.25967	N	0.982556	P;D;D;D;D;D;D;D	0.89917	0.78;0.997;0.998;0.996;1.0;0.993;0.992;1.0	P;D;D;D;D;D;P;D	0.97110	0.533;0.951;0.971;0.971;1.0;0.939;0.9;1.0	T	0.35351	-0.9792	10	0.02654	T	1	.	15.2084	0.73198	0.0:0.1401:0.8599:0.0	.	587;1323;1396;1396;1344;1389;1279;1348	B4DIP2;Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-7;Q96RT1-2	.;.;.;.;.;LAP2_HUMAN;.;.	E	1389;1348;587;1337;1317;1279;1323;1344;1396;1279	ENSP00000284037:G1389E;ENSP00000370330:G1348E;ENSP00000397833:G587E;ENSP00000370326:G1337E;ENSP00000370323:G1317E;ENSP00000370322:G1279E;ENSP00000370325:G1323E;ENSP00000422766:G1344E;ENSP00000426632:G1396E;ENSP00000422015:G1279E	ENSP00000284037:G1389E	G	+	2	0	ERBB2IP	65410041	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.464000	0.66719	2.650000	0.89964	0.655000	0.94253	GGA	.	.	none		0.348	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215070.1	NM_018695	
CHD2	1106	hgsc.bcm.edu	37	15	93552523	93552523	+	Nonsense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:93552523C>G	ENST00000394196.4	+	35	5630	c.4562C>G	c.(4561-4563)tCa>tGa	p.S1521*	CHD2_ENST00000557381.1_Nonsense_Mutation_p.S1521*	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1521					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			AAAGCCTACTCAGATCAGGAG	0.502																																					p.S1521X		Atlas-SNP	.											.	CHD2	280	.	0			c.C4562G						PASS	.						80.0	68.0	72.0					15																	93552523		2197	4298	6495	SO:0001587	stop_gained	1106	exon35			CCTACTCAGATCA	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.4562C>G	15.37:g.93552523C>G	ENSP00000377747:p.Ser1521*	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	47	17	0.361702	NM_001271	C6G482|Q96IP5	Nonsense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	C	50	16.405875	0.99862	.	.	ENSG00000173575	ENST00000394196;ENST00000557381;ENST00000557759	.	.	.	5.69	5.69	0.88448	.	0.313373	0.17353	U	0.177306	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-8.3814	16.1069	0.81230	0.1342:0.8658:0.0:0.0	.	.	.	.	X	1521;1521;46	.	ENSP00000377747:S1521X	S	+	2	0	CHD2	91353527	0.930000	0.31532	1.000000	0.80357	0.996000	0.88848	1.336000	0.33850	2.678000	0.91216	0.655000	0.94253	TCA	.	.	none		0.502	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
PRDM16	63976	hgsc.bcm.edu	37	1	3321441	3321441	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:3321441C>G	ENST00000270722.5	+	7	1072	c.1023C>G	c.(1021-1023)aaC>aaG	p.N341K	PRDM16_ENST00000378391.2_Missense_Mutation_p.N341K|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378398.3_Missense_Mutation_p.N342K|PRDM16_ENST00000511072.1_Missense_Mutation_p.N342K|PRDM16_ENST00000442529.2_Missense_Mutation_p.N341K|PRDM16_ENST00000441472.2_Missense_Mutation_p.N341K|PRDM16_ENST00000514189.1_Missense_Mutation_p.N342K			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	341					brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		AATGTGAAAACTGCGTGAAGG	0.642			T	EVI1	"""MDS, AML"""																																p.N341K		Atlas-SNP	.		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	.	PRDM16	147	.	0			c.C1023G						PASS	.						61.0	66.0	64.0					1																	3321441		2145	4267	6412	SO:0001583	missense	63976	exon7			TGAAAACTGCGTG	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.1023C>G	1.37:g.3321441C>G	ENSP00000270722:p.Asn341Lys	Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	44	11	0.25	NM_022114	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	ENST00000270722.5	37	CCDS41236.2	.	.	.	.	.	.	.	.	.	.	C	19.09	3.759552	0.69763	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.07216	3.21;3.21;3.21;3.21;3.21;3.21;3.21;3.21;3.21	4.63	2.73	0.32206	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.988944	0.08186	U	0.984619	T	0.10551	0.0258	N	0.04655	-0.195	0.44194	D	0.997016	D;P;D;D	0.71674	0.998;0.952;0.996;0.988	D;P;D;P	0.69654	0.965;0.636;0.917;0.901	T	0.38993	-0.9635	10	0.52906	T	0.07	.	7.3185	0.26513	0.0:0.7186:0.0:0.2814	.	341;341;341;341	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	K	342;342;341;341;341;342;341;157;157;150	ENSP00000426975:N342K;ENSP00000367651:N342K;ENSP00000407968:N341K;ENSP00000405253:N341K;ENSP00000367643:N341K;ENSP00000421400:N342K;ENSP00000270722:N341K;ENSP00000422504:N157K;ENSP00000425796:N150K	ENSP00000270722:N341K	N	+	3	2	PRDM16	3311301	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	1.212000	0.32394	0.928000	0.37168	0.467000	0.42956	AAC	.	.	none		0.642	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114	
OR2M2	391194	hgsc.bcm.edu	37	1	248343746	248343746	+	Silent	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:248343746T>C	ENST00000359682.2	+	1	459	c.459T>C	c.(457-459)tcT>tcC	p.S153S		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCCTGGGCTCTACAGATGGAA	0.438																																					p.S153S		Atlas-SNP	.											.	OR2M2	149	.	0			c.T459C						PASS	.						183.0	187.0	185.0					1																	248343746		2203	4300	6503	SO:0001819	synonymous_variant	391194	exon1			GGGCTCTACAGAT	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.459T>C	1.37:g.248343746T>C		Somatic	376	0	0		WXS	Illumina HiSeq	Phase_I	258	71	0.275194	NM_001004688	A3KFT4	Silent	SNP	ENST00000359682.2	37	CCDS31106.1																																																																																			.	.	none		0.438	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688	
SYNPO2	171024	hgsc.bcm.edu	37	4	119978995	119978995	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:119978995C>T	ENST00000307142.4	+	5	3888	c.3692C>T	c.(3691-3693)gCa>gTa	p.A1231V	SYNPO2_ENST00000448416.2_3'UTR	NM_133477.2	NP_597734.2	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	0						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AATGATTCTGCAATCATGTCC	0.423																																					p.A1231V		Atlas-SNP	.											.	SYNPO2	353	.	0			c.C3692T						PASS	.						83.0	77.0	79.0					4																	119978995		2203	4300	6503	SO:0001583	missense	171024	exon5			ATTCTGCAATCAT	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000307142.4:c.3692C>T	4.37:g.119978995C>T	ENSP00000306015:p.Ala1231Val	Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	119	14	0.117647	NM_133477	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000307142.4	37	CCDS34054.1	.	.	.	.	.	.	.	.	.	.	A	13.81	2.349191	0.41599	.	.	ENSG00000172403	ENST00000307142	T	0.08370	3.1	5.76	1.99	0.26369	.	0.491893	0.17073	N	0.188101	T	0.03783	0.0107	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.06405	0.001;0.002	T	0.46857	-0.9161	9	.	.	.	-3.5532	7.5195	0.27620	0.6482:0.2283:0.1235:0.0	.	1231;1231	B9EG60;Q9UMS6-2	.;.	V	1231	ENSP00000306015:A1231V	.	A	+	2	0	SYNPO2	120198443	0.227000	0.23707	0.001000	0.08648	0.000000	0.00434	2.008000	0.40893	-0.094000	0.12374	-2.788000	0.00116	GCA	.	.	none		0.423	SYNPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364018.1		
UACA	55075	hgsc.bcm.edu	37	15	70961044	70961044	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:70961044G>A	ENST00000322954.6	-	16	2164	c.1979C>T	c.(1978-1980)tCa>tTa	p.S660L	UACA_ENST00000560441.1_Missense_Mutation_p.S645L|UACA_ENST00000379983.2_Missense_Mutation_p.S647L|UACA_ENST00000539319.1_Missense_Mutation_p.S551L	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	660					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TTCACTAAGTGATTTTTCATG	0.348																																					p.S660L		Atlas-SNP	.											.	UACA	235	.	0			c.C1979T						PASS	.						93.0	92.0	92.0					15																	70961044		2199	4297	6496	SO:0001583	missense	55075	exon16			CTAAGTGATTTTT	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.1979C>T	15.37:g.70961044G>A	ENSP00000314556:p.Ser660Leu	Somatic	460	0	0		WXS	Illumina HiSeq	Phase_I	358	100	0.27933	NM_018003	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	ENST00000322954.6	37	CCDS10235.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.335587	0.24253	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000539319	T;T;T	0.31247	1.5;1.52;2.0	5.61	4.68	0.58851	.	0.467858	0.18621	N	0.135860	T	0.18593	0.0446	L	0.27053	0.805	0.09310	N	1	B;B;B;B	0.13145	0.007;0.007;0.007;0.006	B;B;B;B	0.15484	0.013;0.004;0.004;0.009	T	0.13818	-1.0495	10	0.42905	T	0.14	-4.9607	3.2938	0.06958	0.1074:0.1691:0.5488:0.1747	.	551;660;660;647	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	L	660;647;551	ENSP00000314556:S660L;ENSP00000369319:S647L;ENSP00000438667:S551L	ENSP00000314556:S660L	S	-	2	0	UACA	68748098	0.998000	0.40836	0.023000	0.16930	0.955000	0.61496	5.638000	0.67861	1.334000	0.45468	0.491000	0.48974	TCA	.	.	none		0.348	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2		
GPM6A	2823	hgsc.bcm.edu	37	4	176923581	176923581	+	5'Flank	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:176923581G>A	ENST00000280187.7	-	0	0				GPM6A_ENST00000506894.1_5'UTR	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A						neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		TGACAGCCTCGCCCCTCCCAG	0.682																																					p.A54V		Atlas-SNP	.											.	GPM6A	70	.	0			c.C161T						PASS	.																																			SO:0001631	upstream_gene_variant	2823	exon1			AGCCTCGCCCCTC		CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674			4.37:g.176923581G>A	Exception_encountered	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	104	15	0.144231	NM_001261447	B7Z642|E9PHI5|Q92602	Missense_Mutation	SNP	ENST00000280187.7	37	CCDS3824.1																																																																																			.	.	none		0.682	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362163.1		
MITF	4286	hgsc.bcm.edu	37	3	69915452	69915452	+	Intron	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:69915452T>C	ENST00000448226.2	+	2	231				MITF_ENST00000314589.5_Missense_Mutation_p.L4P|MITF_ENST00000472437.1_Intron|MITF_ENST00000328528.6_Intron|MITF_ENST00000352241.4_Intron			O75030	MITF_HUMAN	microphthalmia-associated transcription factor						bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		ATGGAGGCGCTTAGAGTTCAG	0.453			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														p.L4P	Melanoma(29;269 969 31479 41502 42961)	Atlas-SNP	.		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	MITF	156	.	0			c.T11C						PASS	.						168.0	169.0	169.0					3																	69915452		1868	4113	5981	SO:0001627	intron_variant	4286	exon1			AGGCGCTTAGAGT		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.105-12833T>C	3.37:g.69915452T>C		Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	90	9	0.1	NM_198177	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Missense_Mutation	SNP	ENST00000448226.2	37		.	.	.	.	.	.	.	.	.	.	T	19.91	3.913765	0.72983	.	.	ENSG00000187098	ENST00000451708;ENST00000314589	T;T	0.27720	1.65;2.46	5.93	5.93	0.95920	.	.	.	.	.	T	0.37892	0.1020	N	0.14661	0.345	0.80722	D	1	D	0.69078	0.997	D	0.78314	0.991	T	0.25082	-1.0142	8	.	.	.	.	15.3592	0.74457	0.0:0.0:0.0:1.0	.	4	O75030-8	.	P	4	ENSP00000398639:L4P;ENSP00000324443:L4P	.	L	+	2	0	MITF	69998142	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.555000	0.67301	2.263000	0.75096	0.533000	0.62120	CTT	.	.	none		0.453	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
CCDC39	339829	hgsc.bcm.edu	37	3	180334082	180334082	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:180334082A>G	ENST00000442201.2	-	19	2775	c.2656T>C	c.(2656-2658)Tca>Cca	p.S886P	TTC14_ENST00000382584.4_Intron|CCDC39_ENST00000273654.4_3'UTR	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	886	Ser-rich.				axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GCTGATAGTGAAGTATGTGAA	0.428																																					p.S886P		Atlas-SNP	.											.	CCDC39	242	.	0			c.T2656C						PASS	.						124.0	114.0	117.0					3																	180334082		1901	4119	6020	SO:0001583	missense	339829	exon19			ATAGTGAAGTATG	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.2656T>C	3.37:g.180334082A>G	ENSP00000405708:p.Ser886Pro	Somatic	208	0	0		WXS	Illumina HiSeq	Phase_I	118	31	0.262712	NM_181426	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	A	10.62	1.401054	0.25291	.	.	ENSG00000145075	ENST00000489868;ENST00000442201	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	T	0.79100	0.4389	M	0.80616	2.505	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.79909	-0.1604	8	0.41790	T	0.15	.	14.2533	0.66035	1.0:0.0:0.0:0.0	.	886	Q9UFE4	CCD39_HUMAN	P	58;886	.	ENSP00000405708:S886P	S	-	1	0	CCDC39	181816776	0.998000	0.40836	0.868000	0.34077	0.145000	0.21501	3.682000	0.54656	2.101000	0.63845	0.374000	0.22700	TCA	.	.	none		0.428	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
CNTN5	53942	hgsc.bcm.edu	37	11	100211841	100211841	+	Silent	SNP	T	T	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:100211841T>A	ENST00000524871.1	+	23	3224	c.2934T>A	c.(2932-2934)ccT>ccA	p.P978P	CNTN5_ENST00000528682.1_Silent_p.P978P|CNTN5_ENST00000279463.3_Silent_p.P978P|CNTN5_ENST00000418526.2_Silent_p.P904P|CNTN5_ENST00000524560.1_3'UTR	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	978	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GTCAAGCACCTAGCAACCTCA	0.423																																					p.P978P		Atlas-SNP	.											.	CNTN5	324	.	0			c.T2934A						PASS	.						121.0	117.0	118.0					11																	100211841		1848	4097	5945	SO:0001819	synonymous_variant	53942	exon22			AGCACCTAGCAAC	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.2934T>A	11.37:g.100211841T>A		Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	130	12	0.0923077	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Silent	SNP	ENST00000524871.1	37	CCDS53696.1																																																																																			.	.	none		0.423	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
LRRN3	54674	hgsc.bcm.edu	37	7	110763595	110763595	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:110763595T>C	ENST00000422987.3	+	2	1598	c.767T>C	c.(766-768)cTt>cCt	p.L256P	IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000489381.1_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.L256P|LRRN3_ENST00000308478.5_Missense_Mutation_p.L256P|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000452895.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	256					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		CATGTTGCTCTTCAAAAAGTT	0.333																																					p.L256P		Atlas-SNP	.											.	LRRN3	132	.	0			c.T767C						PASS	.						44.0	49.0	47.0					7																	110763595		2203	4295	6498	SO:0001583	missense	54674	exon2			TTGCTCTTCAAAA	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.767T>C	7.37:g.110763595T>C	ENSP00000412417:p.Leu256Pro	Somatic	207	0	0		WXS	Illumina HiSeq	Phase_I	148	38	0.256757	NM_018334	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	37	CCDS5754.1	.	.	.	.	.	.	.	.	.	.	T	16.81	3.227203	0.58668	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987;ENST00000421101	T;T;T;T	0.62639	0.01;0.01;0.01;0.01	5.87	5.87	0.94306	.	0.000000	0.52532	D	0.000069	D	0.85927	0.5811	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90388	0.4393	10	0.87932	D	0	.	16.2662	0.82581	0.0:0.0:0.0:1.0	.	256	Q9H3W5	LRRN3_HUMAN	P	256	ENSP00000312001:L256P;ENSP00000397312:L256P;ENSP00000412417:L256P;ENSP00000407927:L256P	ENSP00000312001:L256P	L	+	2	0	LRRN3	110550831	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.247000	0.74100	0.528000	0.53228	CTT	.	.	none		0.333	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110535472	110535472	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:110535472T>C	ENST00000378402.5	+	76	12445	c.12341T>C	c.(12340-12342)gTa>gCa	p.V4114A		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	4114					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GGTAACTGTGTATCAGTTGGA	0.313										HNSCC(38;0.096)																											p.V4114A		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.T12341C						PASS	.						81.0	73.0	76.0					8																	110535472		1834	4082	5916	SO:0001583	missense	93035	exon76			ACTGTGTATCAGT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.12341T>C	8.37:g.110535472T>C	ENSP00000367655:p.Val4114Ala	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	80	17	0.2125	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	T	18.18	3.566189	0.65651	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.89617	-2.54;-2.4	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.93350	0.7880	M	0.76574	2.34	0.35150	D	0.769649	D	0.71674	0.998	D	0.66196	0.942	D	0.96101	0.9069	10	0.54805	T	0.06	.	13.8903	0.63736	0.0:0.0:0.0:1.0	.	4114	Q86WI1	PKHL1_HUMAN	A	4114;1042	ENSP00000367655:V4114A;ENSP00000437376:V1042A	ENSP00000367655:V4114A	V	+	2	0	PKHD1L1	110604648	1.000000	0.71417	0.997000	0.53966	0.533000	0.34776	6.141000	0.71744	2.167000	0.68274	0.528000	0.53228	GTA	.	.	none		0.313	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
FAM35A	54537	hgsc.bcm.edu	37	10	88939926	88939926	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:88939926T>G	ENST00000298784.1	+	7	2172	c.2058T>G	c.(2056-2058)agT>agG	p.S686R	FAM35A_ENST00000298786.4_Missense_Mutation_p.S755R	NM_019054.2	NP_061927.2	Q86V20	FA35A_HUMAN	family with sequence similarity 35, member A	686										endometrium(2)|kidney(2)|large_intestine(5)|lung(1)|ovary(2)|prostate(2)|skin(2)	16						CTCTGAAGAGTATTTTTTCTT	0.388																																					p.S686R	Ovarian(175;703 2004 25460 32514 43441)	Atlas-SNP	.											FAM35A,NS,carcinoma,+1,1	FAM35A	48	1	0			c.T2058G						scavenged	.						75.0	75.0	75.0					10																	88939926		2203	4300	6503	SO:0001583	missense	54537	exon7			GAAGAGTATTTTT	BC051863	CCDS7383.1	10q23.2	2010-06-02			ENSG00000122376	ENSG00000122376			28773	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_019054		Approved	MGC5560, bA163M19.1, FAM35A1	uc001kei.4	Q86V20	OTTHUMG00000018669	ENST00000298784.1:c.2058T>G	10.37:g.88939926T>G	ENSP00000298784:p.Ser686Arg	Somatic	454	2	0.00440529		WXS	Illumina HiSeq	Phase_I	406	112	0.275862	NM_019054	O95885|Q9H991	Missense_Mutation	SNP	ENST00000298784.1	37	CCDS7383.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	6.059|6.059	0.379258|0.379258	0.11466|0.11466	.|.	.|.	ENSG00000122376|ENSG00000122376	ENST00000298786;ENST00000298784;ENST00000358313|ENST00000342900	T;T;T|.	0.64085|.	-0.08;-0.08;-0.08|.	2.87|2.87	-2.2|-2.2	0.06994|0.06994	.|.	0.554910|.	0.20762|.	N|.	0.086141|.	T|T	0.37652|0.37652	0.1011|0.1011	L|L	0.59436|0.59436	1.845|1.845	0.09310|0.09310	N|N	1|1	B;P|.	0.48016|.	0.001;0.904|.	B;P|.	0.46718|.	0.001;0.525|.	T|T	0.37865|0.37865	-0.9687|-0.9687	10|5	0.29301|.	T|.	0.29|.	-0.2296|-0.2296	3.8924|3.8924	0.09125|0.09125	0.0:0.2922:0.1808:0.527|0.0:0.2922:0.1808:0.527	.|.	409;686|.	Q5VSZ0;Q86V20|.	.;FA35A_HUMAN|.	R|D	755;686;686|410	ENSP00000298786:S755R;ENSP00000298784:S686R;ENSP00000351064:S686R|.	ENSP00000298784:S686R|.	S|Y	+|+	3|1	2|0	FAM35A|FAM35A	88929906|88929906	0.002000|0.002000	0.14202|0.14202	0.009000|0.009000	0.14445|0.14445	0.937000|0.937000	0.57800|0.57800	-0.235000|-0.235000	0.09016|0.09016	-0.554000|-0.554000	0.06150|0.06150	0.352000|0.352000	0.21897|0.21897	AGT|TAT	.	.	none		0.388	FAM35A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049196.2	NM_019054	
HHIPL2	79802	hgsc.bcm.edu	37	1	222721252	222721252	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:222721252G>A	ENST00000343410.6	-	1	193	c.135C>T	c.(133-135)tgC>tgT	p.C45C		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	45					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		CGTAATCCAGGCACTGGGGGT	0.607																																					p.C45C		Atlas-SNP	.											.	HHIPL2	122	.	0			c.C135T						PASS	.						31.0	35.0	34.0					1																	222721252		1918	4130	6048	SO:0001819	synonymous_variant	79802	exon1			ATCCAGGCACTGG	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.135C>T	1.37:g.222721252G>A		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	69	22	0.318841	NM_024746	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Silent	SNP	ENST00000343410.6	37	CCDS1530.2																																																																																			.	.	none		0.607	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
IL12RB1	3594	hgsc.bcm.edu	37	19	18174694	18174694	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:18174694A>T	ENST00000600835.2	-	14	1908	c.1610T>A	c.(1609-1611)tTc>tAc	p.F537Y	IL12RB1_ENST00000593993.2_Missense_Mutation_p.F537Y			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	537	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						ACCGATGCTGAAGCGCTGGGG	0.612																																					p.F537Y		Atlas-SNP	.											.	IL12RB1	92	.	0			c.T1610A						PASS	.						28.0	32.0	31.0					19																	18174694		2091	4228	6319	SO:0001583	missense	3594	exon13			ATGCTGAAGCGCT	U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.1610T>A	19.37:g.18174694A>T	ENSP00000470788:p.Phe537Tyr	Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	43	12	0.27907	NM_005535	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Missense_Mutation	SNP	ENST00000600835.2	37	CCDS54232.1	.	.	.	.	.	.	.	.	.	.	A	17.05	3.291175	0.59976	.	.	ENSG00000096996	ENST00000430026	T	0.55930	0.49	3.21	3.21	0.36854	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.51477	D	0.000093	T	0.63977	0.2557	M	0.77103	2.36	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.81914	0.995;0.989	T	0.66027	-0.6025	10	0.07325	T	0.83	-29.046	8.1692	0.31245	1.0:0.0:0.0:0.0	.	537;537	P42701-2;P42701	.;I12R1_HUMAN	Y	537	ENSP00000403103:F537Y	ENSP00000403103:F537Y	F	-	2	0	IL12RB1	18035694	0.927000	0.31430	0.630000	0.29268	0.790000	0.44656	3.390000	0.52523	1.697000	0.51169	0.402000	0.26972	TTC	.	.	none		0.612	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466525.3		
KCNE1L	23630	hgsc.bcm.edu	37	X	108867913	108867913	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chrX:108867913C>T	ENST00000372101.2	-	1	480	c.337G>A	c.(337-339)Gcc>Acc	p.A113T		NM_012282.2	NP_036414.1	Q9UJ90	KCE1L_HUMAN	KCNE1-like	113					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						GCAGCCTCGGCGTCGGCGGTC	0.746																																					p.A113T		Atlas-SNP	.											.	KCNE1L	8	.	0			c.G337A						PASS	.						4.0	4.0	4.0					X																	108867913		1938	3803	5741	SO:0001583	missense	23630	exon1			CCTCGGCGTCGGC	AJ012743	CCDS14547.1	Xq22.3	2008-02-05	2004-06-09		ENSG00000176076	ENSG00000176076		"""Potassium channels"""	6241	protein-coding gene	gene with protein product		300328	"""potassium voltage-gated channel, Isk-related family, member 1-like"""			10493825	Standard	NM_012282		Approved		uc004eoh.3	Q9UJ90	OTTHUMG00000022189	ENST00000372101.2:c.337G>A	X.37:g.108867913C>T	ENSP00000361173:p.Ala113Thr	Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	50	36	0.72	NM_012282		Missense_Mutation	SNP	ENST00000372101.2	37	CCDS14547.1	.	.	.	.	.	.	.	.	.	.	c	9.703	1.154965	0.21371	.	.	ENSG00000176076	ENST00000372101	T	0.70399	-0.48	4.31	2.5	0.30297	.	0.407802	0.20787	N	0.085687	T	0.50667	0.1629	L	0.27053	0.805	0.20074	N	0.999935	B	0.31125	0.309	B	0.23852	0.049	T	0.42899	-0.9424	10	0.52906	T	0.07	-10.0695	5.8092	0.18457	0.0:0.651:0.1631:0.1859	.	113	Q9UJ90	KCE1L_HUMAN	T	113	ENSP00000361173:A113T	ENSP00000361173:A113T	A	-	1	0	KCNE1L	108754569	0.083000	0.21467	0.399000	0.26333	0.231000	0.25187	0.510000	0.22723	0.546000	0.28920	0.597000	0.82753	GCC	.	.	none		0.746	KCNE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057892.1	NM_012282	
FRMPD1	22844	hgsc.bcm.edu	37	9	37745741	37745741	+	Missense_Mutation	SNP	G	G	C	rs62640014	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:37745741G>C	ENST00000539465.1	+	16	4305	c.3712G>C	c.(3712-3714)Gat>Cat	p.D1238H	FRMPD1_ENST00000377765.3_Missense_Mutation_p.D1238H|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1238						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.D1238Y(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		GACAGGGCAAGATATAGCCCC	0.522																																					p.D1238H		Atlas-SNP	.											FRMPD1,colon,carcinoma,-1,3	FRMPD1	237	3	1	Substitution - Missense(1)	ovary(1)	c.G3712C						PASS	.						82.0	82.0	82.0					9																	37745741		2203	4300	6503	SO:0001583	missense	22844	exon16			GGGCAAGATATAG	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.3712G>C	9.37:g.37745741G>C	ENSP00000444411:p.Asp1238His	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	91	18	0.197802	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.068314	0.55539	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.09911	2.93;2.93	5.29	1.08	0.20341	.	0.978445	0.08425	N	0.947715	T	0.12518	0.0304	L	0.27053	0.805	0.09310	N	1	D	0.56968	0.978	P	0.54460	0.753	T	0.28681	-1.0036	10	0.48119	T	0.1	-1.2993	4.6247	0.12472	0.2747:0.1612:0.564:0.0	.	1238	Q5SYB0	FRPD1_HUMAN	H	1238	ENSP00000366995:D1238H;ENSP00000444411:D1238H	ENSP00000366995:D1238H	D	+	1	0	FRMPD1	37735741	0.091000	0.21658	0.001000	0.08648	0.113000	0.19764	1.983000	0.40648	0.641000	0.30601	0.556000	0.70494	GAT	G|0.998;T|0.002	.	alt		0.522	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
DYNC1H1	1778	hgsc.bcm.edu	37	14	102452967	102452967	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr14:102452967C>T	ENST00000360184.4	+	8	2569	c.2405C>T	c.(2404-2406)tCc>tTc	p.S802F		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	802	Interaction with DYNC1LI2. {ECO:0000250}.|Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						AACACCATTTCCCTTTTGGTG	0.527																																					p.S802F		Atlas-SNP	.											.	DYNC1H1	395	.	0			c.C2405T						PASS	.						140.0	130.0	134.0					14																	102452967		2203	4300	6503	SO:0001583	missense	1778	exon8			CCATTTCCCTTTT	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.2405C>T	14.37:g.102452967C>T	ENSP00000348965:p.Ser802Phe	Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	120	38	0.316667	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.298198	0.40694	.	.	ENSG00000197102	ENST00000360184	T	0.55052	0.54	5.52	5.52	0.82312	Dynein heavy chain, domain-1 (1);	0.059633	0.64402	D	0.000001	T	0.56934	0.2019	M	0.61703	1.905	0.58432	D	0.999999	P	0.38195	0.622	B	0.42422	0.387	T	0.59963	-0.7355	10	0.59425	D	0.04	.	15.3008	0.73949	0.0:0.8606:0.1394:0.0	.	802	Q14204	DYHC1_HUMAN	F	802	ENSP00000348965:S802F	ENSP00000348965:S802F	S	+	2	0	DYNC1H1	101522720	1.000000	0.71417	0.837000	0.33122	0.405000	0.30901	5.618000	0.67722	2.767000	0.95098	0.655000	0.94253	TCC	.	.	none		0.527	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
DBI	1622	hgsc.bcm.edu	37	2	120124666	120124666	+	Intron	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:120124666G>T	ENST00000355857.3	+	1	140				C2orf76_ENST00000498049.1_5'Flank|DBI_ENST00000542275.1_5'Flank|C2orf76_ENST00000334816.7_5'Flank|DBI_ENST00000409094.1_Intron|C2orf76_ENST00000409466.2_5'Flank|DBI_ENST00000535757.1_5'UTR|DBI_ENST00000460901.1_3'UTR|DBI_ENST00000393103.2_5'Flank|C2orf76_ENST00000409877.1_5'Flank|C2orf76_ENST00000409523.1_5'Flank|DBI_ENST00000535617.1_Intron|DBI_ENST00000311521.4_5'UTR	NM_001079862.1|NM_001178043.1	NP_001073331.1|NP_001171514.1	P07108	ACBP_HUMAN	diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)						hair follicle development (GO:0001942)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|transport (GO:0006810)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|perinuclear endoplasmic reticulum (GO:0097038)	benzodiazepine receptor binding (GO:0030156)|lipid binding (GO:0008289)|long-chain fatty acyl-CoA binding (GO:0036042)|protein dimerization activity (GO:0046983)			kidney(1)|lung(4)|skin(1)	6						AGGCTGCGAAGGTGCAGCGGG	0.662																																					p.K13N		Atlas-SNP	.											.	DBI	10	.	0			c.G39T						PASS	.						21.0	24.0	23.0					2																	120124666		2055	4193	6248	SO:0001627	intron_variant	1622	exon1			TGCGAAGGTGCAG	L76366	CCDS2126.1, CCDS42740.1, CCDS42741.1, CCDS74568.1	2q12-q21	2010-10-20	2010-04-30		ENSG00000155368	ENSG00000155368			2690	protein-coding gene	gene with protein product	"""endozepine"""	125950	"""diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein)"""			1440058	Standard	NM_001079863		Approved	ACBP, ACBD1	uc021vnj.1	P07108	OTTHUMG00000131403	ENST00000355857.3:c.9+30G>T	2.37:g.120124666G>T		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	102	43	0.421569	NM_001178043	B8ZWD2|B8ZWD6|B8ZWD7|P08869|Q4VWZ6|Q53SQ7|Q6IB48|Q9UCI8	Missense_Mutation	SNP	ENST00000355857.3	37	CCDS42740.1																																																																																			.	.	none		0.662	DBI-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330590.1	NM_020548	
PAK4	10298	hgsc.bcm.edu	37	19	39660292	39660292	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:39660292G>A	ENST00000593690.1	+	4	526	c.99G>A	c.(97-99)acG>acA	p.T33T	PAK4_ENST00000321944.4_Silent_p.T33T|PAK4_ENST00000358301.3_Silent_p.T33T|PAK4_ENST00000360442.3_Silent_p.T33T|PAK4_ENST00000435673.2_Silent_p.T33T|PAK4_ENST00000599386.1_Silent_p.T33T|PAK4_ENST00000599470.1_Silent_p.T33T	NM_001014831.2	NP_001014831.1	O96013	PAK4_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 4	33	Linker.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	13	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			AGAAGTTCACGGGGCTGCCCC	0.682																																					p.T33T		Atlas-SNP	.											.	PAK4	40	.	0			c.G99A						PASS	.						37.0	40.0	39.0					19																	39660292		2202	4300	6502	SO:0001819	synonymous_variant	10298	exon2			GTTCACGGGGCTG	AJ011855	CCDS12528.1, CCDS33019.1	19p11-q11	2008-06-17	2008-06-17						16059	protein-coding gene	gene with protein product		605451	"""p21(CDKN1A)-activated kinase 4"""			9822598, 10461188	Standard	NM_001014831		Approved		uc002okn.1	O96013		ENST00000593690.1:c.99G>A	19.37:g.39660292G>A		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	73	18	0.246575	NM_001014832	B4DGG6|Q8N4E1|Q8NCH5|Q8NDE3|Q9BU33|Q9ULS8	Silent	SNP	ENST00000593690.1	37	CCDS12528.1																																																																																			.	.	none		0.682	PAK4-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463823.1		
ENOX1	55068	hgsc.bcm.edu	37	13	43918835	43918835	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr13:43918835C>T	ENST00000261488.6	-	9	1452	c.875G>A	c.(874-876)cGa>cAa	p.R292Q	ENOX1_ENST00000540032.1_Missense_Mutation_p.R105Q|ENOX1_ENST00000412891.1_Missense_Mutation_p.R292Q	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	292					rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		CACTTCCCCTCGTTCAATCCA	0.478																																					p.R292Q		Atlas-SNP	.											ENOX1_ENST00000261488,NS,malignant_melanoma,0,2	ENOX1	158	2	0			c.G875A						PASS	.						120.0	110.0	113.0					13																	43918835		2203	4300	6503	SO:0001583	missense	55068	exon9			TCCCCTCGTTCAA	EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.875G>A	13.37:g.43918835C>T	ENSP00000261488:p.Arg292Gln	Somatic	210	0	0		WXS	Illumina HiSeq	Phase_I	128	42	0.328125	NM_017993	A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Missense_Mutation	SNP	ENST00000261488.6	37	CCDS9389.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.827798	0.90955	.	.	ENSG00000120658	ENST00000261488;ENST00000412891;ENST00000540032	T;T	0.61040	0.14;0.14	5.92	5.08	0.68730	.	0.129804	0.51477	D	0.000083	T	0.76278	0.3965	M	0.78637	2.42	0.52501	D	0.999951	D;P	0.89917	1.0;0.725	D;B	0.87578	0.998;0.116	T	0.79792	-0.1654	10	0.72032	D	0.01	0.0067	14.8382	0.70201	0.0:0.9314:0.0:0.0686	.	105;292	B7Z5K1;Q8TC92	.;ENOX1_HUMAN	Q	292;292;105	ENSP00000261488:R292Q;ENSP00000415054:R292Q	ENSP00000261488:R292Q	R	-	2	0	ENOX1	42816835	1.000000	0.71417	0.382000	0.26119	0.968000	0.65278	7.487000	0.81328	1.502000	0.48669	0.655000	0.94253	CGA	.	.	none		0.478	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044717.2	NM_017993	
MYO9A	4649	hgsc.bcm.edu	37	15	72338093	72338093	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:72338093A>C	ENST00000356056.5	-	2	1284	c.812T>G	c.(811-813)aTt>aGt	p.I271S	MYO9A_ENST00000564571.1_Missense_Mutation_p.I271S|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000424560.1_Missense_Mutation_p.I271S|RNU2-65P_ENST00000410162.1_RNA|MYO9A_ENST00000444904.1_Missense_Mutation_p.I271S|MYO9A_ENST00000566885.1_Intron	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	271	Myosin motor.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TCCAAGAATAATCTGTTCTAC	0.388																																					p.I271S		Atlas-SNP	.											.	MYO9A	203	.	0			c.T812G						PASS	.						69.0	68.0	69.0					15																	72338093		2199	4297	6496	SO:0001583	missense	4649	exon2			AGAATAATCTGTT	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.812T>G	15.37:g.72338093A>C	ENSP00000348349:p.Ile271Ser	Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	62	25	0.403226	NM_006901	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	A	18.08	3.544760	0.65198	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904;ENST00000261864;ENST00000446448	D;D;D	0.86497	-2.13;-2.13;-2.13	5.92	5.92	0.95590	Myosin head, motor domain (2);	.	.	.	.	D	0.89726	0.6798	L	0.45051	1.395	0.80722	D	1	P;P;P	0.45957	0.575;0.753;0.869	B;B;P	0.56865	0.205;0.406;0.808	D	0.89772	0.3955	9	0.51188	T	0.08	.	16.4074	0.83684	1.0:0.0:0.0:0.0	.	271;271;271	B2RTY4-3;B7WP69;B2RTY4	.;.;MYO9A_HUMAN	S	271	ENSP00000348349:I271S;ENSP00000399162:I271S;ENSP00000398250:I271S	ENSP00000261864:I271S	I	-	2	0	MYO9A	70125147	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.489000	0.81451	2.275000	0.75901	0.529000	0.55759	ATT	.	.	none		0.388	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
HLA-A	3105	hgsc.bcm.edu	37	6	29911109	29911109	+	Silent	SNP	G	G	A	rs61760917		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:29911109G>A	ENST00000396634.1	+	5	749	c.408G>A	c.(406-408)ggG>ggA	p.G136G	HLA-A_ENST00000376802.2_Silent_p.G136G|HLA-A_ENST00000376806.5_Silent_p.G136G|HLA-A_ENST00000376809.5_Silent_p.G136G			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	136	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						TCCTCCGCGGGTACCGGCAGG	0.667									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.G136G		Atlas-SNP	.											HLA-A,colon,carcinoma,+2,1	HLA-A	89	1	0			c.G408A						PASS	.						33.0	25.0	28.0					6																	29911109		1500	2695	4195	SO:0001819	synonymous_variant	3105	exon3	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	CCGCGGGTACCGG	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.408G>A	6.37:g.29911109G>A		Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	67	32	0.477612	NM_001242758	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Silent	SNP	ENST00000396634.1	37	CCDS34373.1																																																																																			.	.	weak		0.667	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
PHOX2B	8929	hgsc.bcm.edu	37	4	41747879	41747879	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:41747879G>A	ENST00000226382.2	-	3	1249	c.890C>T	c.(889-891)tCg>tTg	p.S297L	RP11-227F19.1_ENST00000508038.1_RNA	NM_003924.3	NP_003915.2	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	297					autonomic nervous system development (GO:0048483)|brainstem development (GO:0003360)|cell differentiation in hindbrain (GO:0021533)|cellular response to BMP stimulus (GO:0071773)|dopaminergic neuron differentiation (GO:0071542)|efferent axon development in a lateral line nerve (GO:0048894)|enteric nervous system development (GO:0048484)|glial cell differentiation (GO:0010001)|hindbrain tangential cell migration (GO:0021934)|inner ear development (GO:0048839)|medullary reticular formation development (GO:0021723)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron differentiation (GO:0003357)|parasympathetic nervous system development (GO:0048486)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression (GO:0010468)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory system development (GO:0060541)|retrotrapezoid nucleus neuron differentiation (GO:0061452)|skeletal muscle cell differentiation (GO:0035914)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			autonomic_ganglia(7)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	30						TCTTTGGAGCGAAGATAGGAC	0.682			"""Mis, F"""		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.S297L		Atlas-SNP	.	yes	Rec	yes	familial neuroblastoma	4	4p12	8929	paired-like homeobox 2b	yes	O	.	PHOX2B	53	.	0			c.C890T						PASS	.						24.0	34.0	31.0					4																	41747879		2203	4300	6503	SO:0001583	missense	8929	exon3	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	TGGAGCGAAGATA	D82344	CCDS3463.1	4p13	2014-09-17	2003-02-10	2003-02-14	ENSG00000109132	ENSG00000109132		"""Homeoboxes / PRD class"""	9143	protein-coding gene	gene with protein product		603851	"""paired mesoderm homeobox 2b"""	PMX2B		9039501, 10395798	Standard	NM_003924		Approved	Phox2b, NBPhox	uc003gwf.4	Q99453	OTTHUMG00000099379	ENST00000226382.2:c.890C>T	4.37:g.41747879G>A	ENSP00000226382:p.Ser297Leu	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	37	17	0.459459	NM_003924	Q6PJD9	Missense_Mutation	SNP	ENST00000226382.2	37	CCDS3463.1	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522757	0.64747	.	.	ENSG00000109132	ENST00000226382	D	0.91631	-2.88	3.93	3.93	0.45458	.	0.065830	0.64402	D	0.000006	D	0.91815	0.7410	N	0.19112	0.55	0.58432	D	0.999999	D	0.69078	0.997	D	0.67725	0.953	D	0.93125	0.6528	10	0.66056	D	0.02	.	14.8458	0.70259	0.0:0.0:1.0:0.0	.	297	Q99453	PHX2B_HUMAN	L	297	ENSP00000226382:S297L	ENSP00000226382:S297L	S	-	2	0	PHOX2B	41442636	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.197000	0.65141	2.019000	0.59389	0.313000	0.20887	TCG	.	.	none		0.682	PHOX2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216832.2		
OR2AK2	391191	hgsc.bcm.edu	37	1	248129487	248129487	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:248129487G>A	ENST00000366480.3	+	1	953	c.854G>A	c.(853-855)cGg>cAg	p.R285Q	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	285						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TCCCCTTCACGGGATAAGGCG	0.502																																					p.R285Q	Melanoma(45;390 1181 23848 28461 41504)	Atlas-SNP	.											.	OR2AK2	90	.	0			c.G854A						PASS	.						144.0	115.0	124.0					1																	248129487		2203	4300	6503	SO:0001583	missense	391191	exon1			CTTCACGGGATAA	BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.854G>A	1.37:g.248129487G>A	ENSP00000355436:p.Arg285Gln	Somatic	215	0	0		WXS	Illumina HiSeq	Phase_I	167	27	0.161677	NM_001004491	B2RND1|Q6IF05	Missense_Mutation	SNP	ENST00000366480.3	37	CCDS31102.1	.	.	.	.	.	.	.	.	.	.	.	0.037	-1.303766	0.01353	.	.	ENSG00000187080	ENST00000366480	T	0.00044	8.83	3.04	-1.76	0.08006	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.00446	-1.495	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.42616	-0.9441	9	0.02654	T	1	.	0.2301	0.00179	0.2893:0.1425:0.247:0.3211	.	285	Q8NG84	O2AK2_HUMAN	Q	285	ENSP00000355436:R285Q	ENSP00000355436:R285Q	R	+	2	0	OR2AK2	246196110	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.412000	0.01039	-0.016000	0.14127	-0.672000	0.03802	CGG	.	.	none		0.502	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096858.2	NM_001004491	
COL5A2	1290	hgsc.bcm.edu	37	2	189916123	189916123	+	Missense_Mutation	SNP	G	G	A	rs199530997	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:189916123G>A	ENST00000374866.3	-	42	3128	c.2854C>T	c.(2854-2856)Cgt>Tgt	p.R952C		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	952					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TCTCCCACACGCCCATGAGAG	0.617													G|||	3	0.000599042	0.0	0.0	5008	,	,		13494	0.003		0.0	False		,,,				2504	0.0				p.R952C		Atlas-SNP	.											.	COL5A2	230	.	0			c.C2854T						PASS	.						71.0	71.0	71.0					2																	189916123		2203	4300	6503	SO:0001583	missense	1290	exon42			CCACACGCCCATG	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.2854C>T	2.37:g.189916123G>A	ENSP00000364000:p.Arg952Cys	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	129	36	0.27907	NM_000393	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	18.93	3.728045	0.69074	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.93604	-3.25	5.83	4.95	0.65309	.	0.319446	0.22337	N	0.061388	D	0.94331	0.8178	M	0.66939	2.045	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	P;D	0.66084	0.818;0.941	D	0.93512	0.6854	9	.	.	.	.	16.5704	0.84611	0.0:0.0:0.8688:0.1312	.	592;952	Q5PR22;P05997	.;CO5A2_HUMAN	C	952;592	ENSP00000364000:R952C	.	R	-	1	0	COL5A2	189624368	1.000000	0.71417	0.983000	0.44433	0.987000	0.75469	3.115000	0.50391	1.454000	0.47793	0.644000	0.83932	CGT	G|0.999;A|0.001	0.001	strong		0.617	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
FBXL20	84961	hgsc.bcm.edu	37	17	37557627	37557627	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:37557627T>G	ENST00000264658.6	-	1	289	c.29A>C	c.(28-30)aAg>aCg	p.K10T	FBXL20_ENST00000583610.1_Missense_Mutation_p.K10T|FBXL20_ENST00000577399.1_Intron|FBXL20_ENST00000394294.3_Missense_Mutation_p.K10T|CTB-131K11.1_ENST00000582842.1_RNA	NM_032875.2	NP_116264.2	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	10					behavioral fear response (GO:0001662)	cytoplasm (GO:0005737)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22			LUAD - Lung adenocarcinoma(14;0.146)			AAACCTGCTCTTGGTCACTCC	0.726																																					p.K10T		Atlas-SNP	.											.	FBXL20	36	.	0			c.A29C						PASS	.						48.0	32.0	38.0					17																	37557627		2201	4297	6498	SO:0001583	missense	84961	exon1			CTGCTCTTGGTCA	BC007557	CCDS32640.1, CCDS54116.1	17q21.2	2011-06-09				ENSG00000108306		"""F-boxes / Leucine-rich repeats"""	24679	protein-coding gene	gene with protein product		609086				12477932	Standard	NM_032875		Approved	MGC15482, Fbl2, Fbl20	uc002hrt.3	Q96IG2		ENST00000264658.6:c.29A>C	17.37:g.37557627T>G	ENSP00000264658:p.Lys10Thr	Somatic	180	0	0		WXS	Illumina HiSeq	Phase_I	107	33	0.308411	NM_001184906	A8K729|Q38J52	Missense_Mutation	SNP	ENST00000264658.6	37	CCDS32640.1	.	.	.	.	.	.	.	.	.	.	T	14.84	2.655110	0.47467	.	.	ENSG00000108306	ENST00000264658;ENST00000394294	T;T	0.12147	2.72;2.71	3.8	3.8	0.43715	.	0.421938	0.23213	U	0.050657	T	0.09113	0.0225	L	0.34521	1.04	0.80722	D	1	B;B	0.13145	0.007;0.003	B;B	0.14023	0.01;0.004	T	0.15723	-1.0427	10	0.15066	T	0.55	.	7.424	0.27088	0.0:0.1063:0.0:0.8937	.	10;10	Q96IG2-2;Q96IG2	.;FXL20_HUMAN	T	10	ENSP00000264658:K10T;ENSP00000377832:K10T	ENSP00000264658:K10T	K	-	2	0	FBXL20	34811153	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.098000	0.41757	1.703000	0.51240	0.397000	0.26171	AAG	.	.	none		0.726	FBXL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444315.2	NM_032875	
ESPL1	9700	hgsc.bcm.edu	37	12	53683328	53683328	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:53683328C>T	ENST00000257934.4	+	22	5154	c.5063C>T	c.(5062-5064)cCc>cTc	p.P1688L	ESPL1_ENST00000552462.1_Missense_Mutation_p.P1688L	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1688					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GGCCACTTCCCCCAGCCTGAA	0.612																																					p.P1688L	Colon(53;1069 1201 2587 5382)	Atlas-SNP	.											.	ESPL1	158	.	0			c.C5063T						PASS	.						46.0	49.0	48.0					12																	53683328		2203	4300	6503	SO:0001583	missense	9700	exon22			ACTTCCCCCAGCC	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.5063C>T	12.37:g.53683328C>T	ENSP00000257934:p.Pro1688Leu	Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	58	25	0.431034	NM_012291		Missense_Mutation	SNP	ENST00000257934.4	37	CCDS8852.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.559608	0.65538	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.17370	2.28;2.28	5.26	5.26	0.73747	.	0.123552	0.53938	D	0.000041	T	0.30008	0.0751	L	0.34521	1.04	0.58432	D	0.999998	D	0.76494	0.999	D	0.68765	0.96	T	0.01143	-1.1438	10	0.87932	D	0	.	14.2504	0.66016	0.0:1.0:0.0:0.0	.	1688	Q14674	ESPL1_HUMAN	L	1688;1363;1688	ENSP00000257934:P1688L;ENSP00000449831:P1688L	ENSP00000257934:P1688L	P	+	2	0	ESPL1	51969595	0.950000	0.32346	1.000000	0.80357	0.345000	0.29048	1.549000	0.36212	2.735000	0.93741	0.563000	0.77884	CCC	.	.	none		0.612	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291	
IFI27L2	83982	hgsc.bcm.edu	37	14	94594298	94594298	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr14:94594298G>A	ENST00000238609.3	-	4	330	c.231C>T	c.(229-231)atC>atT	p.I77I	IFI27L2_ENST00000556727.1_Silent_p.I52I	NM_032036.2	NP_114425.1	Q9H2X8	I27L2_HUMAN	interferon, alpha-inducible protein 27-like 2	77						integral component of membrane (GO:0016021)				breast(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	8						AGGCCAGGAGGATGTTGGATG	0.582																																					p.I77I		Atlas-SNP	.											IFI27L2,NS,carcinoma,-2,1	IFI27L2	14	1	0			c.C231T						PASS	.						72.0	72.0	72.0					14																	94594298		2203	4300	6503	SO:0001819	synonymous_variant	83982	exon4			CAGGAGGATGTTG	AF208232	CCDS9920.1	14q32.13	2008-10-08	2008-10-08	2008-10-08		ENSG00000119632			19753	protein-coding gene	gene with protein product		611319	"""family with sequence similarity 14, member A"""	FAM14A			Standard	NM_032036		Approved	TLH29	uc001ycq.3	Q9H2X8		ENST00000238609.3:c.231C>T	14.37:g.94594298G>A		Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	110	17	0.154545	NM_032036	Q8TBD7|Q9NYL0	Silent	SNP	ENST00000238609.3	37	CCDS9920.1																																																																																			.	.	none		0.582	IFI27L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412935.1	NM_032036	
CNTNAP3B	728577	hgsc.bcm.edu	37	9	43709680	43709680	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:43709680T>G	ENST00000377564.3	+	2	509	c.116T>G	c.(115-117)tTg>tGg	p.L39W	CNTNAP3B_ENST00000276974.6_Missense_Mutation_p.L39W	NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	39	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						GCCTCTGCCTTGCCTAGGTCA	0.498																																					p.L39W		Atlas-SNP	.											.	CNTNAP3B	37	.	0			c.T116G						PASS	.																																			SO:0001583	missense	728577	exon2			CTGCCTTGCCTAG	BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.116T>G	9.37:g.43709680T>G	ENSP00000366787:p.Leu39Trp	Somatic	609	0	0		WXS	Illumina HiSeq	Phase_I	723	137	0.189488	NM_001201380	B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	ENST00000377564.3	37	CCDS55312.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.42|15.42	2.829182|2.829182	0.50845|0.50845	.|.	.|.	ENSG00000154529|ENSG00000154529	ENST00000377561|ENST00000377564;ENST00000276974;ENST00000341990;ENST00000403166	.|D;D	.|0.97642	.|-4.47;-4.47	2.33|2.33	2.33|2.33	0.28932|0.28932	.|.	.|.	.|.	.|.	.|.	D|D	0.97920|0.97920	0.9316|0.9316	M|M	0.92738|0.92738	3.34|3.34	0.31878|0.31878	N|N	0.618807|0.618807	.|.	.|.	.|.	.|.	.|.	.|.	D|D	0.97292|0.97292	0.9925|0.9925	5|7	.|0.87932	.|D	.|0	.|.	6.5146|6.5146	0.22240|0.22240	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	G|W	88|39	.|ENSP00000366787:L39W;ENSP00000276974:L39W	.|ENSP00000276974:L39W	C|L	+|+	1|2	0|0	CNTNAP3B|CNTNAP3B	43649676|43649676	1.000000|1.000000	0.71417|0.71417	0.195000|0.195000	0.23364|0.23364	0.085000|0.085000	0.17905|0.17905	5.020000|5.020000	0.64066|0.64066	1.063000|1.063000	0.40649|0.40649	0.433000|0.433000	0.28618|0.28618	TGC|TTG	.	.	none		0.498	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036930.3		
ITGA2	3673	hgsc.bcm.edu	37	5	52347391	52347391	+	Splice_Site	SNP	T	T	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:52347391T>A	ENST00000296585.5	+	7	922		c.e7+2			NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)						axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				ATATGCAAGGTAAGTTTTGGT	0.313																																					.		Atlas-SNP	.											.	ITGA2	211	.	0			c.779+2T>A						PASS	.						98.0	95.0	96.0					5																	52347391		2203	4300	6503	SO:0001630	splice_region_variant	3673	exon7			GCAAGGTAAGTTT		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.779+2T>A	5.37:g.52347391T>A		Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	154	18	0.116883	NM_002203	Q14595	Splice_Site	SNP	ENST00000296585.5	37	CCDS3957.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.482598	0.84747	.	.	ENSG00000164171	ENST00000296585	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0828	0.81017	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITGA2	52383148	1.000000	0.71417	0.999000	0.59377	0.875000	0.50365	7.642000	0.83385	2.199000	0.70637	0.528000	0.53228	.	.	.	none		0.313	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	Intron
CPEB4	80315	hgsc.bcm.edu	37	5	173317237	173317237	+	Silent	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:173317237T>C	ENST00000265085.5	+	1	1955	c.501T>C	c.(499-501)ggT>ggC	p.G167G	CPEB4_ENST00000519835.1_Silent_p.G167G|CPEB4_ENST00000334035.5_Silent_p.G167G|CPEB4_ENST00000522336.1_5'Flank|CPEB4_ENST00000517880.1_5'Flank|CPEB4_ENST00000520867.1_Silent_p.G167G	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	167					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CTCTTACTGGTTTCAGTAACT	0.493																																					p.G167G		Atlas-SNP	.											CPEB4,NS,carcinoma,+2,1	CPEB4	54	1	0			c.T501C						scavenged	.						89.0	93.0	92.0					5																	173317237		2203	4300	6503	SO:0001819	synonymous_variant	80315	exon1			TACTGGTTTCAGT	BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.501T>C	5.37:g.173317237T>C		Somatic	129	1	0.00775194		WXS	Illumina HiSeq	Phase_I	153	36	0.235294	NM_030627	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Silent	SNP	ENST00000265085.5	37	CCDS4390.1																																																																																			.	.	none		0.493	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252964.2	NM_030627	
RBBP4	5928	hgsc.bcm.edu	37	1	33116071	33116071	+	5'Flank	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:33116071G>A	ENST00000373493.5	+	0	0				RBBP4_ENST00000414241.3_5'Flank|ZBTB8OS_ENST00000341885.5_Silent_p.I32I|RBBP4_ENST00000544435.1_5'Flank|ZBTB8OS_ENST00000492007.1_5'UTR|RBBP4_ENST00000373485.1_5'Flank|ZBTB8OS_ENST00000373501.2_Silent_p.I20I|RBBP4_ENST00000458695.2_5'Flank|ZBTB8OS_ENST00000468695.1_Silent_p.I32I	NM_001135255.1|NM_005610.2	NP_001128727.1|NP_005601.1	Q09028	RBBP4_HUMAN	retinoblastoma binding protein 4						ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin assembly (GO:0031497)|chromatin remodeling (GO:0006338)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|nucleosome assembly (GO:0006334)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|NURF complex (GO:0016589)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				ACTTGGCCTTGATCGCCTTCT	0.488																																					p.I32I		Atlas-SNP	.											.	ZBTB8OS	9	.	0			c.C96T						PASS	.						225.0	170.0	189.0					1																	33116071		2203	4300	6503	SO:0001631	upstream_gene_variant	339487	exon1			GGCCTTGATCGCC	BC053904	CCDS366.1, CCDS44105.1, CCDS44106.1	1p35.1	2014-07-17	2001-11-28		ENSG00000162521	ENSG00000162521		"""WD repeat domain containing"""	9887	protein-coding gene	gene with protein product		602923	"""retinoblastoma-binding protein 4"""			8350924, 14609955, 17531812	Standard	NM_005610		Approved	RbAp48, NURF55, lin-53	uc001bvr.3	Q09028	OTTHUMG00000007998		1.37:g.33116071G>A	Exception_encountered	Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	123	46	0.373984	NM_178547	B2R6G9|B4DRH0|D3DPQ3|P31149|Q53H02|Q96BV9	Silent	SNP	ENST00000373493.5	37	CCDS366.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.819270	0.32145	.	.	ENSG00000176261	ENST00000436661	.	.	.	5.66	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.2676	10.2329	0.43266	0.0761:0.1463:0.7776:0.0	.	.	.	.	X	31	.	.	Q	-	1	0	ZBTB8OS	32888658	0.991000	0.36638	0.979000	0.43373	0.993000	0.82548	0.908000	0.28545	1.533000	0.49186	0.655000	0.94253	CAA	.	.	none		0.488	RBBP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021957.3	NM_005610	
STAT6	6778	hgsc.bcm.edu	37	12	57496658	57496658	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:57496658T>C	ENST00000300134.3	-	12	1584	c.1259A>G	c.(1258-1260)aAc>aGc	p.N420S	STAT6_ENST00000537215.2_Missense_Mutation_p.N310S|STAT6_ENST00000454075.3_Missense_Mutation_p.N420S|STAT6_ENST00000543873.2_Missense_Mutation_p.N420S|STAT6_ENST00000556155.1_Missense_Mutation_p.N420S|STAT6_ENST00000538913.2_Missense_Mutation_p.N310S	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	420					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						TTTGGCATTGTTGTCTTGGTT	0.507																																					p.N420S		Atlas-SNP	.											.	STAT6	69	.	0			c.A1259G						PASS	.						144.0	116.0	125.0					12																	57496658		2203	4300	6503	SO:0001583	missense	6778	exon12			GCATTGTTGTCTT	BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.1259A>G	12.37:g.57496658T>C	ENSP00000300134:p.Asn420Ser	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	84	11	0.130952	NM_001178079	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	ENST00000300134.3	37	CCDS8931.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.159974	0.78226	.	.	ENSG00000166888	ENST00000300134;ENST00000535201;ENST00000538913;ENST00000543873;ENST00000556155;ENST00000537215;ENST00000454075;ENST00000542721;ENST00000542516	D;D;D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17;-2.17;-2.17	5.44	5.44	0.79542	STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);EF-hand-like domain (1);	0.044809	0.85682	D	0.000000	D	0.87220	0.6123	N	0.17082	0.46	0.58432	D	0.999997	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.978	D	0.86277	0.1665	10	0.31617	T	0.26	-29.4754	13.4858	0.61364	0.0:0.0:0.0:1.0	.	420;420	A8K4S9;P42226	.;STAT6_HUMAN	S	420;310;310;420;420;310;420;310;420	ENSP00000300134:N420S;ENSP00000445409:N310S;ENSP00000438451:N420S;ENSP00000451742:N420S;ENSP00000444530:N310S;ENSP00000401486:N420S	ENSP00000300134:N420S	N	-	2	0	STAT6	55782925	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.728000	0.62000	2.285000	0.76669	0.528000	0.53228	AAC	.	.	none		0.507	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	NM_003153	
ATPAF1	64756	hgsc.bcm.edu	37	1	47110904	47110904	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:47110904C>T	ENST00000371937.4	-	7	717	c.613G>A	c.(613-615)Gaa>Aaa	p.E205K	ATPAF1_ENST00000542495.1_Missense_Mutation_p.E54K|ATPAF1_ENST00000576409.1_Missense_Mutation_p.E228K|ATPAF1_ENST00000532925.1_Missense_Mutation_p.E117K|ATPAF1_ENST00000574428.1_Intron|ATPAF1_ENST00000329231.4_Intron	NM_022745.4	NP_073582.3	Q5TC12	ATPF1_HUMAN	ATP synthase mitochondrial F1 complex assembly factor 1	205					protein complex assembly (GO:0006461)	mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	8	Acute lymphoblastic leukemia(166;0.155)					TCATAACCTTCCCTTCTTGGC	0.393																																					p.E228K	Melanoma(138;107 1777 21672 30337 52312)	Atlas-SNP	.											.	ATPAF1	19	.	0			c.G682A						PASS	.						158.0	150.0	153.0					1																	47110904		2203	4300	6503	SO:0001583	missense	64756	exon7			AACCTTCCCTTCT	AK026004	CCDS541.1, CCDS41327.1, CCDS541.2, CCDS41327.2, CCDS57997.1, CCDS57998.1	1p33-p32.3	2012-10-12			ENSG00000123472	ENSG00000123472		"""Mitochondrial respiratory chain complex assembly factors"""	18803	protein-coding gene	gene with protein product		608917				11410595	Standard	NM_022745		Approved	FLJ22351, Atp11p, ATP11	uc001cqh.4	Q5TC12	OTTHUMG00000007988	ENST00000371937.4:c.613G>A	1.37:g.47110904C>T	ENSP00000361005:p.Glu205Lys	Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	54	19	0.351852	NM_022745	B1AQW7|B7Z7D6|B7Z7I6|Q9H6E3	Missense_Mutation	SNP	ENST00000371937.4	37		.	.	.	.	.	.	.	.	.	.	C	20.8	4.052768	0.75960	.	.	ENSG00000123472	ENST00000371937;ENST00000492233;ENST00000542495;ENST00000532925	T	0.49139	0.79	5.81	4.9	0.64082	.	0.088508	0.85682	N	0.000000	T	0.47248	0.1435	L	0.50333	1.59	0.58432	D	0.999992	P;P	0.40578	0.505;0.722	B;B	0.42625	0.158;0.393	T	0.42189	-0.9466	10	0.36615	T	0.2	-8.6794	14.9549	0.71104	0.0:0.9317:0.0:0.0683	.	117;205	B7Z7I6;Q5TC12	.;ATPF1_HUMAN	K	205;9;54;117	ENSP00000361005:E205K	ENSP00000361005:E205K	E	-	1	0	ATPAF1	46883491	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.021000	0.76425	1.470000	0.48102	0.650000	0.86243	GAA	.	.	none		0.393	ATPAF1-201	KNOWN	basic	protein_coding	protein_coding		NM_022745	
BRD4	23476	hgsc.bcm.edu	37	19	15366921	15366921	+	Missense_Mutation	SNP	G	G	A	rs201937726		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:15366921G>A	ENST00000263377.2	-	9	1926	c.1705C>T	c.(1705-1707)Cct>Tct	p.P569S	BRD4_ENST00000371835.4_Missense_Mutation_p.P569S|BRD4_ENST00000360016.5_Missense_Mutation_p.P569S|BRD4_ENST00000602230.1_5'Flank	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	569	BID region.|Lys-rich.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			tttttaggaggaggttccttg	0.428			T	C15orf55	lethal midline carcinoma of young people																																p.P569S		Atlas-SNP	.		Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	BRD4_ENST00000263377,NS,carcinoma,+2,2	BRD4	172	2	0			c.C1705T						PASS	.						288.0	255.0	266.0					19																	15366921		2203	4300	6503	SO:0001583	missense	23476	exon9			TAGGAGGAGGTTC	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.1705C>T	19.37:g.15366921G>A	ENSP00000263377:p.Pro569Ser	Somatic	648	0	0		WXS	Illumina HiSeq	Phase_I	541	133	0.245841	NM_058243	O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	ENST00000263377.2	37	CCDS12328.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.375762	0.42105	.	.	ENSG00000141867	ENST00000263377;ENST00000371835;ENST00000360016	T;T;T	0.10477	2.87;4.39;4.39	5.05	3.98	0.46160	.	0.202174	0.35320	N	0.003284	T	0.13756	0.0333	M	0.75615	2.305	0.35607	D	0.808345	B;B;B	0.34103	0.437;0.16;0.267	B;B;B	0.30401	0.115;0.06;0.055	T	0.15321	-1.0441	10	0.16896	T	0.51	-8.0525	14.2679	0.66133	0.0:0.1503:0.8497:0.0	.	569;569;569	Q4G0X8;O60885-2;O60885	.;.;BRD4_HUMAN	S	569	ENSP00000263377:P569S;ENSP00000360901:P569S;ENSP00000353112:P569S	ENSP00000263377:P569S	P	-	1	0	BRD4	15227921	1.000000	0.71417	0.984000	0.44739	0.813000	0.45954	6.325000	0.72901	1.088000	0.41272	0.561000	0.74099	CCT	.	.	weak		0.428	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243	
ACACB	32	hgsc.bcm.edu	37	12	109616950	109616950	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:109616950C>T	ENST00000338432.7	+	10	1614	c.1495C>T	c.(1495-1497)Cgt>Tgt	p.R499C	ACACB_ENST00000377848.3_Missense_Mutation_p.R499C|ACACB_ENST00000543080.1_3'UTR|ACACB_ENST00000377854.5_Missense_Mutation_p.R499C			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	499	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	CCAGCACGCCCGTCACCTGGA	0.572																																					p.R499C		Atlas-SNP	.											.	ACACB	330	.	0			c.C1495T						PASS	.						63.0	52.0	55.0					12																	109616950		2203	4300	6503	SO:0001583	missense	32	exon9			CACGCCCGTCACC	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.1495C>T	12.37:g.109616950C>T	ENSP00000341044:p.Arg499Cys	Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	72	9	0.125	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.365697	0.82463	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	D;D;D	0.97941	-4.62;-4.62;-4.62	5.2	5.2	0.72013	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.106857	0.64402	D	0.000005	D	0.99369	0.9778	H	0.99650	4.68	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.98128	1.0429	10	0.87932	D	0	.	15.1597	0.72775	0.1415:0.8585:0.0:0.0	.	499	O00763	ACACB_HUMAN	C	499	ENSP00000341044:R499C;ENSP00000367079:R499C;ENSP00000367085:R499C	ENSP00000341044:R499C	R	+	1	0	ACACB	108101333	0.998000	0.40836	0.970000	0.41538	0.999000	0.98932	4.030000	0.57260	2.428000	0.82296	0.643000	0.83706	CGT	.	.	none		0.572	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
LRP1B	53353	hgsc.bcm.edu	37	2	141660530	141660530	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:141660530C>A	ENST00000389484.3	-	23	4696	c.3725G>T	c.(3724-3726)gGt>gTt	p.G1242V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1242	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAGCTTCCAACCTTCATAACA	0.358										TSP Lung(27;0.18)																											p.G1242V	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											LRP1B,NS,carcinoma,-1,1	LRP1B	1315	1	0			c.G3725T						PASS	.						156.0	144.0	148.0					2																	141660530		2203	4300	6503	SO:0001583	missense	53353	exon23			TTCCAACCTTCAT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3725G>T	2.37:g.141660530C>A	ENSP00000374135:p.Gly1242Val	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	158	43	0.272152	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	33	5.203252	0.95033	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.92752	-3.1;-3.1	5.44	5.44	0.79542	Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98121	0.9380	H	0.99197	4.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99368	1.0919	10	0.87932	D	0	.	19.6316	0.95708	0.0:1.0:0.0:0.0	.	425;1242	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	V	1242;1180;387	ENSP00000374135:G1242V;ENSP00000413239:G387V	ENSP00000374135:G1242V	G	-	2	0	LRP1B	141377000	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.729000	0.84864	2.708000	0.92522	0.585000	0.79938	GGT	.	.	none		0.358	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
HCN2	610	hgsc.bcm.edu	37	19	608077	608077	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:608077C>T	ENST00000251287.2	+	4	1385	c.1332C>T	c.(1330-1332)acC>acT	p.T444T		NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	444					cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTGGCTGACCATGCTCAGCA	0.622																																					p.T444T	Melanoma(145;1175 2427 8056 36306)	Atlas-SNP	.											HCN2,NS,carcinoma,+1,1	HCN2	36	1	0			c.C1332T						PASS	.						99.0	80.0	87.0					19																	608077		2203	4300	6503	SO:0001819	synonymous_variant	610	exon4			GCTGACCATGCTC	AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.1332C>T	19.37:g.608077C>T		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	49	16	0.326531	NM_001194	O60742|O60743|O75267|Q9UBS2	Silent	SNP	ENST00000251287.2	37	CCDS12035.1																																																																																			.	.	none		0.622	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452100.1	NM_001194	
CHST5	23563	hgsc.bcm.edu	37	16	75563924	75563924	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:75563924G>A	ENST00000336257.3	-	3	1753	c.359C>T	c.(358-360)tCt>tTt	p.S120F	RP11-77K12.7_ENST00000460606.1_3'UTR|CHST5_ENST00000541075.1_Missense_Mutation_p.S126F	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	120					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						CAAAAAGATAGAGCGCATCAG	0.612																																					p.S120F		Atlas-SNP	.											.	CHST5	47	.	0			c.C359T						PASS	.						70.0	61.0	64.0					16																	75563924		2198	4300	6498	SO:0001583	missense	23563	exon3			AAGATAGAGCGCA	AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.359C>T	16.37:g.75563924G>A	ENSP00000338783:p.Ser120Phe	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	78	32	0.410256	NM_024533	B2RV23|Q7LCN3|Q9UBY3	Missense_Mutation	SNP	ENST00000336257.3	37	CCDS10919.1	.	.	.	.	.	.	.	.	.	.	G	11.79	1.743665	0.30865	.	.	ENSG00000135702	ENST00000336257;ENST00000541075	T;T	0.81078	-1.45;-1.45	2.73	2.73	0.32206	Sulfotransferase domain (1);	0.115412	0.64402	D	0.000017	D	0.88239	0.6383	M	0.79123	2.44	0.51233	D	0.999917	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.89413	0.3704	10	0.72032	D	0.01	.	12.3965	0.55389	0.0:0.0:1.0:0.0	.	126;120	Q9GZS9-2;Q9GZS9	.;CHST5_HUMAN	F	120;126	ENSP00000338783:S120F;ENSP00000441220:S126F	ENSP00000338783:S120F	S	-	2	0	CHST5	74121425	1.000000	0.71417	0.769000	0.31535	0.031000	0.12232	6.803000	0.75180	1.514000	0.48869	0.313000	0.20887	TCT	.	.	none		0.612	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269025.2	NM_012126	
OGFR	11054	hgsc.bcm.edu	37	20	61443664	61443664	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:61443664G>A	ENST00000290291.6	+	7	722	c.697G>A	c.(697-699)Gtc>Atc	p.V233I	OGFR_ENST00000370461.1_Missense_Mutation_p.V181I	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	233					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					GGCGCCGCTGGTCCGCTTCTT	0.672																																					p.V233I		Atlas-SNP	.											.	OGFR	63	.	0			c.G697A						PASS	.						20.0	17.0	18.0					20																	61443664		2123	4194	6317	SO:0001583	missense	11054	exon7			CCGCTGGTCCGCT	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.697G>A	20.37:g.61443664G>A	ENSP00000290291:p.Val233Ile	Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	73	22	0.30137	NM_007346	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.272510	0.40194	.	.	ENSG00000060491	ENST00000290291;ENST00000370468;ENST00000357163;ENST00000370469;ENST00000370461	T;T;T	0.53857	1.49;0.6;1.18	4.72	3.53	0.40419	Opioid growth factor receptor (OGFr) conserved domain (1);	0.250853	0.38778	N	0.001574	T	0.46946	0.1419	L	0.37750	1.13	0.28516	N	0.913283	P;B;B	0.42908	0.793;0.029;0.029	P;B;B	0.45449	0.481;0.037;0.037	T	0.41734	-0.9492	10	0.29301	T	0.29	-15.2161	13.7306	0.62785	0.0901:0.0:0.9099:0.0	.	233;216;233	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	I	233;233;233;88;181	ENSP00000290291:V233I;ENSP00000359499:V233I;ENSP00000359491:V181I	ENSP00000290291:V233I	V	+	1	0	OGFR	60914109	1.000000	0.71417	0.308000	0.25141	0.523000	0.34469	7.454000	0.80714	2.129000	0.65627	0.561000	0.74099	GTC	.	.	none		0.672	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
ZNF836	162962	hgsc.bcm.edu	37	19	52659320	52659320	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:52659320G>A	ENST00000322146.8	-	5	2137	c.1616C>T	c.(1615-1617)tCa>tTa	p.S539L	ZNF836_ENST00000597252.1_Missense_Mutation_p.S539L|CTC-471J1.8_ENST00000594362.1_RNA	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	539					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TACAAGGCATGAATTTTCACT	0.383																																					p.S539L		Atlas-SNP	.											.	ZNF836	158	.	0			c.C1616T						PASS	.						116.0	127.0	123.0					19																	52659320		2080	4245	6325	SO:0001583	missense	162962	exon5			AGGCATGAATTTT	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.1616C>T	19.37:g.52659320G>A	ENSP00000325038:p.Ser539Leu	Somatic	215	0	0		WXS	Illumina HiSeq	Phase_I	164	55	0.335366	NM_001102657		Missense_Mutation	SNP	ENST00000322146.8	37	CCDS46162.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.270902	0.40194	.	.	ENSG00000196267	ENST00000322146	T	0.07444	3.19	2.09	-0.172	0.13327	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17152	0.0412	L	0.54863	1.705	0.09310	N	1	D	0.63880	0.993	D	0.72338	0.977	T	0.14337	-1.0476	9	0.66056	D	0.02	.	2.8352	0.05512	0.4341:0.2455:0.3204:0.0	.	539	Q6ZNA1	ZN836_HUMAN	L	539	ENSP00000325038:S539L	ENSP00000325038:S539L	S	-	2	0	ZNF836	57351132	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.484000	0.06528	0.207000	0.20607	0.484000	0.47621	TCA	.	.	none		0.383	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657	
TMEM2	23670	hgsc.bcm.edu	37	9	74361164	74361164	+	Missense_Mutation	SNP	C	C	T	rs200303233		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:74361164C>T	ENST00000377044.4	-	3	964	c.425G>A	c.(424-426)cGt>cAt	p.R142H	TMEM2_ENST00000377066.5_Missense_Mutation_p.R142H	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	142	G8. {ECO:0000255|PROSITE- ProRule:PRU00817}.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TGAGGTCAGACGGAGCATATC	0.463																																					p.R142H		Atlas-SNP	.											.	TMEM2	112	.	0			c.G425A						PASS	.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	157.0	143.0	148.0		425,425	4.5	1.0	9		148	0,8600		0,0,4300	no	missense,missense	TMEM2	NM_001135820.1,NM_013390.2	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	142/1321,142/1384	74361164	1,13005	2203	4300	6503	SO:0001583	missense	23670	exon3			GTCAGACGGAGCA		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.425G>A	9.37:g.74361164C>T	ENSP00000366243:p.Arg142His	Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	207	16	0.0772947	NM_001135820	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.994358	0.74703	2.27E-4	0.0	ENSG00000135048	ENST00000377044;ENST00000377066	D;D	0.89050	-2.46;-2.46	5.4	4.5	0.54988	G8 domain (2);	0.097616	0.64402	D	0.000001	D	0.92506	0.7620	L	0.59912	1.85	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.69479	0.964;0.884	D	0.92993	0.6416	10	0.72032	D	0.01	.	14.0641	0.64817	0.0:0.9271:0.0:0.0729	.	142;142	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	H	142	ENSP00000366243:R142H;ENSP00000366266:R142H	ENSP00000366243:R142H	R	-	2	0	TMEM2	73550984	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.481000	0.66826	1.288000	0.44600	-0.142000	0.14014	CGT	C|0.999;T|0.001	0.001	weak		0.463	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
LRWD1	222229	hgsc.bcm.edu	37	7	102113388	102113388	+	Silent	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:102113388C>A	ENST00000292616.5	+	15	1988	c.1836C>A	c.(1834-1836)ggC>ggA	p.G612G	MIR4467_ENST00000578629.1_RNA	NM_152892.1	NP_690852.1	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain containing 1	612					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA replication initiation (GO:0006270)|establishment of protein localization to chromatin (GO:0071169)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|telomeric heterochromatin (GO:0031933)	chromatin binding (GO:0003682)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|stomach(2)	20						GGGCCCTTGGCCAGGTGGTGA	0.642																																					p.G612G		Atlas-SNP	.											.	LRWD1	41	.	0			c.C1836A						PASS	.						79.0	70.0	73.0					7																	102113388		2203	4300	6503	SO:0001819	synonymous_variant	222229	exon15			CCTTGGCCAGGTG	AL133057	CCDS34715.1	7q22.1	2013-01-10			ENSG00000161036	ENSG00000161036		"""WD repeat domain containing"""	21769	protein-coding gene	gene with protein product	"""origin recognition complex associated"", ""centromere protein 33"""	615167				20932478, 20850016, 20180869	Standard	NM_152892		Approved	DKFZp434K1815, ORCA, CENP-33	uc003uzn.3	Q9UFC0	OTTHUMG00000157718	ENST00000292616.5:c.1836C>A	7.37:g.102113388C>A		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	66	20	0.30303	NM_152892	A8K4K2|B2R9G2|Q8N0T9|Q8WV43|Q96GJ2	Silent	SNP	ENST00000292616.5	37	CCDS34715.1	.	.	.	.	.	.	.	.	.	.	C	1.736	-0.493029	0.04322	.	.	ENSG00000161036	ENST00000468175	.	.	.	5.41	0.334	0.15948	.	.	.	.	.	T	0.39009	0.1062	.	.	.	0.23221	N	0.998094	.	.	.	.	.	.	T	0.33111	-0.9881	4	.	.	.	-17.3779	12.6444	0.56725	0.0:0.3065:0.6198:0.0737	.	.	.	.	D	207	.	.	A	+	2	0	LRWD1	101900393	0.697000	0.27767	0.046000	0.18839	0.325000	0.28411	-0.137000	0.10389	-0.100000	0.12241	0.561000	0.74099	GCC	.	.	none		0.642	LRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349493.1	NM_152892	
FGF16	8823	hgsc.bcm.edu	37	X	76709750	76709750	+	Splice_Site	SNP	C	C	T	rs376876932		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chrX:76709750C>T	ENST00000439435.1	+	1	103	c.103C>T	c.(103-105)Cga>Tga	p.R35*				O43320	FGF16_HUMAN	fibroblast growth factor 16	0					cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of brown fat cell proliferation (GO:0070349)|response to temperature stimulus (GO:0009266)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)			NS(1)|breast(1)|lung(2)	4						CTCTATGGGTCGGTAAGTTTA	0.393																																					p.S35L		Atlas-SNP	.											.	FGF16	16	.	0			c.C104T						PASS	.	C	LEU/SER	0,3122		0,0,1276,570	72.0	61.0	64.0		106	4.3	1.0	X		64	1,6376		0,1,2302,1771	no	missense-near-splice	FGF16	NM_003868.1	145	0,1,3578,2341	TT,TC,CC,C		0.0157,0.0,0.0105	probably-damaging	126/208	76709750	1,9498	1846	4074	5920	SO:0001630	splice_region_variant	8823	exon1			ATGGGTCGGTAAG	AB009391	CCDS75996.1	Xq21.1	2014-01-31			ENSG00000196468	ENSG00000196468			3672	protein-coding gene	gene with protein product		300827	"""metacarpal 4-5 fusion"""	MF4		9473496, 11474196, 23709756	Standard	NM_003868		Approved		uc011mqp.2	O43320	OTTHUMG00000013133	ENST00000439435.1:c.104+1C>T	X.37:g.76709750C>T		Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	130	81	0.623077	NM_003868		Missense_Mutation	SNP	ENST00000439435.1	37		.	.	.	.	.	.	.	.	.	.	C	26.3	4.727957	0.89390	0.0	1.57E-4	ENSG00000196468	ENST00000439435	.	.	.	4.3	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3197	0.82945	0.0:1.0:0.0:0.0	.	.	.	.	X	35	.	.	R	+	1	2	FGF16	76596406	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.567000	0.82357	2.107000	0.64212	0.600000	0.82982	CGA	.	.	weak		0.393	FGF16-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000036814.1	NM_003868	Nonsense_Mutation
HIST1H1E	3008	hgsc.bcm.edu	37	6	26156900	26156900	+	Silent	SNP	G	G	A	rs549787183		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:26156900G>A	ENST00000304218.3	+	1	342	c.282G>A	c.(280-282)gtG>gtA	p.V94V	HIST1H2BD_ENST00000289316.2_5'Flank|HIST1H2BD_ENST00000377777.4_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	94	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						GCACCCTGGTGCAGACCAAGG	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		15327	0.0		0.001	False		,,,				2504	0.0				p.V94V		Atlas-SNP	.											HIST1H1E,NS,carcinoma,+2,1	HIST1H1E	69	1	0			c.G282A						PASS	.						51.0	55.0	53.0					6																	26156900		2203	4300	6503	SO:0001819	synonymous_variant	3008	exon1			CCTGGTGCAGACC	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.282G>A	6.37:g.26156900G>A		Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	91	22	0.241758	NM_005321	Q4VB25	Silent	SNP	ENST00000304218.3	37	CCDS4586.1																																																																																			.	.	none		0.607	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
NACA	4666	hgsc.bcm.edu	37	12	57118252	57118252	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:57118252C>T	ENST00000454682.1	-	2	335	c.54G>A	c.(52-54)caG>caA	p.Q18Q	NACA_ENST00000546392.1_Silent_p.Q18Q|NACA_ENST00000552540.1_Silent_p.Q18Q|NACA_ENST00000551793.1_5'UTR|NACA_ENST00000356769.3_Silent_p.Q18Q|NACA_ENST00000548563.1_5'UTR|NACA_ENST00000393891.4_Silent_p.Q18Q|NACA_ENST00000550952.1_Silent_p.Q18Q	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	18					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						CAGCCTGGGGCTGCGGCAACT	0.488			T	BCL6	NHL																																p.Q18Q		Atlas-SNP	.		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	NACA_ENST00000454682,NS,carcinoma,-1,2	NACA	131	2	0			c.G54A						PASS	.						34.0	31.0	32.0					12																	57118252		2203	4300	6503	SO:0001819	synonymous_variant	4666	exon2			CTGGGGCTGCGGC	X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.54G>A	12.37:g.57118252C>T		Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	68	31	0.455882	NM_001113202		Silent	SNP	ENST00000454682.1	37																																																																																				.	.	none		0.488	NACA-201	KNOWN	basic	protein_coding	protein_coding		NM_005594	
SLC22A9	114571	hgsc.bcm.edu	37	11	63137598	63137598	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:63137598C>A	ENST00000279178.3	+	1	319	c.70C>A	c.(70-72)Ctc>Atc	p.L24I	SLC22A9_ENST00000310969.4_Missense_Mutation_p.L24I	NM_080866.2	NP_543142.2	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion transporter), member 9	24					hormone transport (GO:0009914)|short-chain fatty acid import (GO:0015913)|sodium-independent organic anion transport (GO:0043252)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	anion:anion antiporter activity (GO:0015301)|short-chain fatty acid uptake transporter activity (GO:0015636)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	18						GACTGTTTTTCTCTCAATCTT	0.483																																					p.L24I		Atlas-SNP	.											SLC22A9,NS,carcinoma,0,1	SLC22A9	77	1	0			c.C70A						PASS	.						165.0	164.0	164.0					11																	63137598		2201	4298	6499	SO:0001583	missense	114571	exon1			GTTTTTCTCTCAA	AP001880	CCDS8043.1	11q12.3	2014-05-20	2008-01-11		ENSG00000149742	ENSG00000149742		"""Solute carriers"""	16261	protein-coding gene	gene with protein product		607579				11327718, 17393504	Standard	NM_080866		Approved	OAT4, FLJ23666, UST3, OAT7	uc001nww.3	Q8IVM8	OTTHUMG00000167805	ENST00000279178.3:c.70C>A	11.37:g.63137598C>A	ENSP00000279178:p.Leu24Ile	Somatic	259	0	0		WXS	Illumina HiSeq	Phase_I	223	112	0.502242	NM_080866	A0AVB7|A4PB24|Q8TCC8|Q8TEC0|Q8WYN7	Missense_Mutation	SNP	ENST00000279178.3	37	CCDS8043.1	.	.	.	.	.	.	.	.	.	.	C	10.22	1.291568	0.23564	.	.	ENSG00000149742	ENST00000310969;ENST00000279178	T;T	0.38240	1.15;1.15	3.48	-3.73	0.04398	.	0.525769	0.17727	N	0.164008	T	0.22085	0.0532	L	0.41236	1.265	0.09310	N	1	B	0.14012	0.009	B	0.12837	0.008	T	0.11131	-1.0600	10	0.40728	T	0.16	.	6.0315	0.19683	0.0:0.3744:0.1409:0.4847	.	24	Q8IVM8	S22A9_HUMAN	I	24	ENSP00000311527:L24I;ENSP00000279178:L24I	ENSP00000279178:L24I	L	+	1	0	SLC22A9	62894174	0.000000	0.05858	0.000000	0.03702	0.196000	0.23810	-2.654000	0.00855	-0.613000	0.05694	0.134000	0.15878	CTC	.	.	none		0.483	SLC22A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396371.1	NM_080866	
SPRY2	10253	hgsc.bcm.edu	37	13	80911241	80911241	+	Silent	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr13:80911241G>T	ENST00000377102.1	-	2	1577	c.600C>A	c.(598-600)atC>atA	p.I200I	SPRY2_ENST00000377104.3_Silent_p.I200I|SPRY2_ENST00000540649.1_Silent_p.I200I			O43597	SPY2_HUMAN	sprouty homolog 2 (Drosophila)	200	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of mitotic spindle orientation (GO:0000132)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inner ear morphogenesis (GO:0042472)|lung growth (GO:0060437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|sensory perception of sound (GO:0007605)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase inhibitor activity (GO:0030291)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		GCTTGTCGCAGATCCAGTCTG	0.512																																					p.I200I		Atlas-SNP	.											.	SPRY2	28	.	0			c.C600A						PASS	.						111.0	95.0	100.0					13																	80911241		2203	4300	6503	SO:0001819	synonymous_variant	10253	exon2			GTCGCAGATCCAG	AF039843	CCDS9463.1	13q31.1	2008-05-14	2001-11-28		ENSG00000136158	ENSG00000136158			11270	protein-coding gene	gene with protein product		602466	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005842		Approved	hSPRY2	uc001vlj.3	O43597	OTTHUMG00000017140	ENST00000377102.1:c.600C>A	13.37:g.80911241G>T		Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	65	12	0.184615	NM_005842	B2R9J9|Q5T6Z7	Silent	SNP	ENST00000377102.1	37	CCDS9463.1																																																																																			.	.	none		0.512	SPRY2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045387.1		
ZNF649	65251	hgsc.bcm.edu	37	19	52394595	52394595	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:52394595C>G	ENST00000354957.3	-	5	1078	c.794G>C	c.(793-795)aGt>aCt	p.S265T	ZNF649_ENST00000600738.1_Missense_Mutation_p.S237T|CTC-429C10.2_ENST00000600329.1_RNA	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		CCCACATTCACTGCACCCGTA	0.502																																					p.S265T		Atlas-SNP	.											.	ZNF649	72	.	0			c.G794C						PASS	.						116.0	117.0	116.0					19																	52394595		2203	4300	6503	SO:0001583	missense	65251	exon5			CATTCACTGCACC	BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.794G>C	19.37:g.52394595C>G	ENSP00000347043:p.Ser265Thr	Somatic	316	0	0		WXS	Illumina HiSeq	Phase_I	273	76	0.278388	NM_023074	A8MYJ5|B2RDC4|Q9H9N2	Missense_Mutation	SNP	ENST00000354957.3	37	CCDS12843.1	.	.	.	.	.	.	.	.	.	.	C	2.723	-0.266213	0.05754	.	.	ENSG00000198093	ENST00000354957	T	0.07567	3.18	2.25	-4.49	0.03504	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03915	0.0110	N	0.20845	0.615	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.42515	-0.9447	9	0.33141	T	0.24	.	1.7035	0.02877	0.2242:0.4224:0.1926:0.1609	.	265	Q9BS31	ZN649_HUMAN	T	265	ENSP00000347043:S265T	ENSP00000347043:S265T	S	-	2	0	ZNF649	57086407	0.000000	0.05858	0.002000	0.10522	0.009000	0.06853	-12.841000	0.00001	-0.804000	0.04410	-0.714000	0.03626	AGT	.	.	none		0.502	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461097.1	NM_023074	
CDK12	51755	hgsc.bcm.edu	37	17	37627743	37627743	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:37627743C>T	ENST00000447079.4	+	2	1691	c.1658C>T	c.(1657-1659)cCt>cTt	p.P553L	CDK12_ENST00000430627.2_Missense_Mutation_p.P553L	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	553					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						CCTTTGCCACCTTTGCCTCCA	0.547			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																											p.P553L		Atlas-SNP	.		Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	.	CDK12	161	.	0			c.C1658T						PASS	.						211.0	198.0	203.0					17																	37627743		2203	4300	6503	SO:0001583	missense	51755	exon2			TGCCACCTTTGCC	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.1658C>T	17.37:g.37627743C>T	ENSP00000398880:p.Pro553Leu	Somatic	212	0	0		WXS	Illumina HiSeq	Phase_I	166	60	0.361446	NM_016507	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.013687	0.54468	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.72615	-0.64;-0.67	5.89	5.89	0.94794	.	0.000000	0.48767	D	0.000165	T	0.72779	0.3503	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.997;0.999	T	0.63906	-0.6531	10	0.02654	T	1	-10.7187	19.2499	0.93919	0.0:1.0:0.0:0.0	.	552;553;553	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	L	553	ENSP00000407720:P553L;ENSP00000398880:P553L	ENSP00000407720:P553L	P	+	2	0	CDK12	34881269	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.871000	0.69628	2.793000	0.96121	0.655000	0.94253	CCT	.	.	none		0.547	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507	
SLC26A4	5172	hgsc.bcm.edu	37	7	107330631	107330631	+	Silent	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:107330631C>A	ENST00000265715.3	+	10	1436	c.1212C>A	c.(1210-1212)acC>acA	p.T404T	SLC26A4_ENST00000544569.1_5'Flank|SLC26A4_ENST00000541474.1_5'Flank	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	404					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TTGTGGCCACCACTGCTCTTT	0.478									Pendred syndrome																												p.T404T		Atlas-SNP	.											.	SLC26A4	117	.	0			c.C1212A						PASS	.						165.0	149.0	155.0					7																	107330631		2203	4300	6503	SO:0001819	synonymous_variant	5172	exon10	Familial Cancer Database	Goiter-Deafness syndrome	GGCCACCACTGCT	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.1212C>A	7.37:g.107330631C>A		Somatic	258	0	0		WXS	Illumina HiSeq	Phase_I	244	22	0.0901639	NM_000441	B7Z266|O43170	Silent	SNP	ENST00000265715.3	37	CCDS5746.1																																																																																			.	.	none		0.478	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441	
HSPG2	3339	hgsc.bcm.edu	37	1	22183832	22183832	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:22183832G>A	ENST00000374695.3	-	43	5419	c.5340C>T	c.(5338-5340)agC>agT	p.S1780S	HSPG2_ENST00000430507.1_5'Flank	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1780	Ig-like C2-type 3.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GCACGCTCTGGCTCCGCTGCT	0.647																																					p.S1780S		Atlas-SNP	.											.	HSPG2	311	.	0			c.C5340T						PASS	.						89.0	89.0	89.0					1																	22183832		2203	4300	6503	SO:0001819	synonymous_variant	3339	exon43			GCTCTGGCTCCGC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.5340C>T	1.37:g.22183832G>A		Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	60	18	0.3	NM_005529	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	ENST00000374695.3	37	CCDS30625.1																																																																																			.	.	none		0.647	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
FAM86A	196483	hgsc.bcm.edu	37	16	5141837	5141837	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:5141837C>T	ENST00000427587.4	-	4	368	c.300G>A	c.(298-300)ctG>ctA	p.L100L	FAM86A_ENST00000587133.1_Intron|FAM86A_ENST00000458008.4_Intron	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	100						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						CCTTGGCCATCAGGGTCTCCG	0.587																																					p.L100L		Atlas-SNP	.											.	FAM86A	32	.	0			c.G300A						PASS	.						38.0	37.0	37.0					16																	5141837		2197	4300	6497	SO:0001819	synonymous_variant	196483	exon4			GGCCATCAGGGTC	BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.300G>A	16.37:g.5141837C>T		Somatic	201	0	0		WXS	Illumina HiSeq	Phase_I	156	54	0.346154	NM_201400	D3DUF0|Q96S85	Silent	SNP	ENST00000427587.4	37	CCDS10529.1																																																																																			.	.	none		0.587	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251713.1	NM_201400	
KRT23	25984	hgsc.bcm.edu	37	17	39092714	39092714	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:39092714T>C	ENST00000209718.3	-	2	566	c.142A>G	c.(142-144)Acc>Gcc	p.T48A	KRT23_ENST00000436344.3_Intron|AC004231.2_ENST00000418393.1_RNA|KRT23_ENST00000582283.1_5'Flank	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	48	Head.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				CTCCGCGTGGTGAAGGACAGG	0.677																																					p.T48A		Atlas-SNP	.											.	KRT23	59	.	0			c.A142G						PASS	.						42.0	48.0	46.0					17																	39092714		2203	4300	6503	SO:0001583	missense	25984	exon2			GCGTGGTGAAGGA	AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.142A>G	17.37:g.39092714T>C	ENSP00000209718:p.Thr48Ala	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	69	9	0.130435	NM_015515	A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Missense_Mutation	SNP	ENST00000209718.3	37	CCDS11380.1	.	.	.	.	.	.	.	.	.	.	T	4.039	0.004794	0.07866	.	.	ENSG00000108244	ENST00000209718	D	0.81579	-1.51	5.73	0.828	0.18841	.	0.380192	0.22341	N	0.061323	T	0.53916	0.1826	N	0.08118	0	0.37959	D	0.932911	B	0.06786	0.001	B	0.04013	0.001	T	0.22626	-1.0211	10	0.14252	T	0.57	.	3.9587	0.09401	0.3632:0.2514:0.0:0.3854	.	48	Q9C075	K1C23_HUMAN	A	48	ENSP00000209718:T48A	ENSP00000209718:T48A	T	-	1	0	KRT23	36346240	0.023000	0.18921	0.806000	0.32338	0.292000	0.27327	-0.784000	0.04633	-0.152000	0.11156	0.455000	0.32223	ACC	.	.	none		0.677	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257223.1		
SCN9A	6335	hgsc.bcm.edu	37	2	167145040	167145040	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:167145040T>G	ENST00000409435.1	-	9	1220	c.1221A>C	c.(1219-1221)gaA>gaC	p.E407D	SCN9A_ENST00000375387.4_Missense_Mutation_p.E408D|SCN9A_ENST00000303354.6_Missense_Mutation_p.E408D|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Missense_Mutation_p.E407D			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	407					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCTGGTTCTGTTCTTCATATG	0.393																																					p.E407D		Atlas-SNP	.											SCN9A,colon,carcinoma,-2,1	SCN9A	296	1	0			c.A1221C						PASS	.						127.0	127.0	127.0					2																	167145040		1853	4113	5966	SO:0001583	missense	6335	exon10			GTTCTGTTCTTCA	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.1221A>C	2.37:g.167145040T>G	ENSP00000386330:p.Glu407Asp	Somatic	242	0	0		WXS	Illumina HiSeq	Phase_I	199	44	0.221106	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.964450	0.74131	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435;ENST00000454569;ENST00000452182	D;D;D;D;D;D	0.98012	-4.66;-4.66;-4.66;-4.66;-4.66;-4.66	5.74	4.6	0.57074	.	0.087668	0.49305	N	0.000141	D	0.98492	0.9497	M	0.87971	2.92	0.45515	D	0.998479	D;D;D	0.89917	1.0;1.0;0.976	D;D;P	0.91635	0.989;0.999;0.881	D	0.98776	1.0730	10	0.62326	D	0.03	.	8.4814	0.33045	0.0:0.1451:0.0:0.8549	.	407;407;408	E7EUN6;Q15858;E9PF08	.;SCN9A_HUMAN;.	D	407;408;408;407;272;272	ENSP00000386306:E407D;ENSP00000364536:E408D;ENSP00000304748:E408D;ENSP00000386330:E407D;ENSP00000413212:E272D;ENSP00000393141:E272D	ENSP00000304748:E408D	E	-	3	2	SCN9A	166853286	0.997000	0.39634	1.000000	0.80357	0.995000	0.86356	0.437000	0.21543	2.190000	0.69967	0.528000	0.53228	GAA	.	.	none		0.393	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
STAT1	6772	hgsc.bcm.edu	37	2	191873810	191873810	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:191873810G>A	ENST00000361099.3	-	4	539	c.152C>T	c.(151-153)tCa>tTa	p.S51L	STAT1_ENST00000392322.3_Missense_Mutation_p.S51L|STAT1_ENST00000392323.2_Missense_Mutation_p.S53L|STAT1_ENST00000540176.1_Missense_Mutation_p.S51L|STAT1_ENST00000409465.1_Missense_Mutation_p.S51L	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	51					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			GGTGGCAAATGAAACATCATT	0.378																																					p.S51L		Atlas-SNP	.											.	STAT1	93	.	0			c.C152T						PASS	.						113.0	106.0	108.0					2																	191873810		2203	4300	6503	SO:0001583	missense	6772	exon4			GCAAATGAAACAT		CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.152C>T	2.37:g.191873810G>A	ENSP00000354394:p.Ser51Leu	Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	118	22	0.186441	NM_007315	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	37	CCDS2309.1	.	.	.	.	.	.	.	.	.	.	G	35	5.469238	0.96274	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000540176;ENST00000392322;ENST00000392323;ENST00000424722;ENST00000454414;ENST00000432058	T;T;T;T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5	5.52	5.52	0.82312	STAT transcription factor, protein interaction (4);	0.000000	0.85682	D	0.000000	T	0.76004	0.3927	M	0.82630	2.6	0.80722	D	1	D;P	0.89917	1.0;0.883	D;P	0.91635	0.999;0.771	T	0.78934	-0.2008	10	0.66056	D	0.02	-14.2715	18.4444	0.90678	0.0:0.0:1.0:0.0	.	51;51	P42224-2;P42224	.;STAT1_HUMAN	L	51;51;51;51;53;51;51;51	ENSP00000354394:S51L;ENSP00000386244:S51L;ENSP00000438703:S51L;ENSP00000376136:S51L;ENSP00000376137:S53L;ENSP00000402548:S51L;ENSP00000411398:S51L;ENSP00000416019:S51L	ENSP00000354394:S51L	S	-	2	0	STAT1	191582055	1.000000	0.71417	0.909000	0.35828	0.913000	0.54294	9.869000	0.99810	2.602000	0.87976	0.557000	0.71058	TCA	.	.	none		0.378	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3	NM_007315	
PAPPA	5069	hgsc.bcm.edu	37	9	119097230	119097230	+	Missense_Mutation	SNP	G	G	A	rs138956040	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:119097230G>A	ENST00000328252.3	+	13	3857	c.3488G>A	c.(3487-3489)cGt>cAt	p.R1163H	PAPPA_ENST00000534838.1_Missense_Mutation_p.R201H	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1163					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CAGGCGGTACGTGTGAGCTTC	0.622													G|||	4	0.000798722	0.0	0.0	5008	,	,		16541	0.004		0.0	False		,,,				2504	0.0				p.R1163H		Atlas-SNP	.											.	PAPPA	243	.	0			c.G3488A						PASS	.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	114.0	93.0	100.0		3488	1.6	1.0	9	dbSNP_134	100	0,8600		0,0,4300	yes	missense	PAPPA	NM_002581.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	1163/1628	119097230	1,13005	2203	4300	6503	SO:0001583	missense	5069	exon13			CGGTACGTGTGAG		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3488G>A	9.37:g.119097230G>A	ENSP00000330658:p.Arg1163His	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	90	11	0.122222	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.610298	0.46527	2.27E-4	0.0	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.03717	4.62;3.83	5.86	1.59	0.23543	.	0.220749	0.48767	N	0.000178	T	0.02304	0.0071	N	0.19112	0.55	0.27531	N	0.951088	B;B	0.09022	0.001;0.002	B;B	0.04013	0.001;0.001	T	0.40156	-0.9578	10	0.37606	T	0.19	-8.6133	4.3967	0.11367	0.2709:0.0:0.4076:0.3215	.	201;1163	F5GZ19;Q13219	.;PAPP1_HUMAN	H	1163;201	ENSP00000330658:R1163H;ENSP00000441461:R201H	ENSP00000330658:R1163H	R	+	2	0	PAPPA	118137051	1.000000	0.71417	0.981000	0.43875	0.984000	0.73092	4.471000	0.60182	0.385000	0.24970	-0.137000	0.14449	CGT	G|1.000;A|0.000	0.000	weak		0.622	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
HMHA1	23526	hgsc.bcm.edu	37	19	1081892	1081892	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:1081892G>A	ENST00000313093.2	+	19	2680	c.2449G>A	c.(2449-2451)Gag>Aag	p.E817K	HMHA1_ENST00000590214.1_Missense_Mutation_p.E844K|HMHA1_ENST00000536472.1_Missense_Mutation_p.E685K|HMHA1_ENST00000586866.1_Missense_Mutation_p.E821K|HMHA1_ENST00000590577.1_Missense_Mutation_p.E452K|HMHA1_ENST00000539243.2_Missense_Mutation_p.E833K|HMHA1_ENST00000543365.1_Missense_Mutation_p.E700K	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	817	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAACGGCAAGGAGCTGGTCGA	0.662																																					p.E833K		Atlas-SNP	.											.	HMHA1	78	.	0			c.G2497A						PASS	.						74.0	54.0	61.0					19																	1081892		2203	4300	6503	SO:0001583	missense	23526	exon19			GGCAAGGAGCTGG	D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.2449G>A	19.37:g.1081892G>A	ENSP00000316772:p.Glu817Lys	Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	29	9	0.310345	NM_001258328	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	ENST00000313093.2	37	CCDS32863.1	.	.	.	.	.	.	.	.	.	.	g	35	5.582067	0.96578	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000536472;ENST00000412039;ENST00000543365	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	4.73	4.73	0.59995	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.41834	0.1176	L	0.50993	1.605	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;0.974;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.932;0.998;0.999	T	0.28396	-1.0045	10	0.56958	D	0.05	-33.2846	16.7261	0.85422	0.0:0.0:1.0:0.0	.	685;833;452;700;817	F5H4A3;F6QP70;B3KVA9;F5H1R4;Q92619	.;.;.;.;HMHA1_HUMAN	K	833;817;817;685;811;700	ENSP00000439601:E833K;ENSP00000316772:E817K;ENSP00000445109:E685K;ENSP00000438979:E700K	ENSP00000316772:E817K	E	+	1	0	HMHA1	1032892	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	9.247000	0.95444	2.175000	0.68902	0.550000	0.68814	GAG	.	.	none		0.662	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1		
HDAC9	9734	hgsc.bcm.edu	37	7	18674253	18674253	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:18674253C>T	ENST00000432645.2	+	7	791	c.791C>T	c.(790-792)tCc>tTc	p.S264F	HDAC9_ENST00000456174.2_Missense_Mutation_p.S236F|HDAC9_ENST00000405010.3_Missense_Mutation_p.S264F|HDAC9_ENST00000401921.1_Missense_Mutation_p.S223F|HDAC9_ENST00000406072.1_Missense_Mutation_p.S251F|HDAC9_ENST00000406451.4_Missense_Mutation_p.S264F|HDAC9_ENST00000428307.2_Missense_Mutation_p.S220F|HDAC9_ENST00000524023.1_Missense_Mutation_p.S187F|HDAC9_ENST00000441542.2_Missense_Mutation_p.S267F|HDAC9_ENST00000417496.2_Missense_Mutation_p.S262F	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	264	Interaction with MAPK10. {ECO:0000250}.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	TTTTCAGAATCCTCAGTCAGT	0.418																																					p.S267F		Atlas-SNP	.											.	HDAC9	560	.	0			c.C800T						PASS	.						75.0	70.0	71.0					7																	18674253		1872	4103	5975	SO:0001583	missense	9734	exon7			CAGAATCCTCAGT	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.791C>T	7.37:g.18674253C>T	ENSP00000410337:p.Ser264Phe	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	116	33	0.284483	NM_178425	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.712624	0.89112	.	.	ENSG00000048052	ENST00000417496;ENST00000262069;ENST00000405010;ENST00000406451;ENST00000428307;ENST00000406072;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000456174;ENST00000524023;ENST00000341009	T;T;T;T;T;T;T;T;T;T	0.68765	0.17;0.55;0.04;0.21;0.18;-0.35;0.04;0.04;0.55;0.22	5.51	5.51	0.81932	.	0.112732	0.40302	N	0.001132	D	0.82375	0.5023	M	0.82323	2.585	0.80722	D	1	D;D;D;P;D;D;P;D;D;D;P;D;D;D	0.71674	0.971;0.989;0.982;0.948;0.971;0.99;0.94;0.99;0.983;0.998;0.94;0.983;0.993;0.97	B;P;P;B;P;D;P;P;P;D;P;P;P;P	0.63488	0.446;0.768;0.875;0.446;0.548;0.912;0.641;0.875;0.735;0.915;0.641;0.735;0.884;0.754	D	0.84982	0.0889	10	0.87932	D	0	-29.5288	17.5956	0.88011	0.0:1.0:0.0:0.0	.	187;236;264;251;262;264;267;223;267;264;236;264;264;242	E7EX34;C9JS87;Q9UKV0-4;B5MCF1;B7Z917;Q9UKV0-2;Q68D71;Q9UKV0-6;Q9UKV0-7;Q9UKV0;B7Z928;Q9UKV0-5;Q9UKV0-3;Q8N879	.;.;.;.;.;.;.;.;.;HDAC9_HUMAN;.;.;.;.	F	262;265;264;264;220;251;223;264;267;236;187;264	ENSP00000401669:S262F;ENSP00000384382:S264F;ENSP00000384657:S264F;ENSP00000395655:S220F;ENSP00000384017:S251F;ENSP00000383912:S223F;ENSP00000410337:S264F;ENSP00000408617:S267F;ENSP00000388568:S236F;ENSP00000430036:S187F	ENSP00000262069:S265F	S	+	2	0	HDAC9	18640778	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.790000	0.75115	2.600000	0.87896	0.650000	0.86243	TCC	.	.	none		0.418	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
OR4N4	283694	hgsc.bcm.edu	37	15	22382649	22382649	+	Silent	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:22382649C>G	ENST00000328795.4	+	1	268	c.177C>G	c.(175-177)ctC>ctG	p.L59L	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CAGCCCCCCTCTATTTATTTC	0.453																																					p.L59L		Atlas-SNP	.											.	OR4N4	108	.	0			c.C177G						PASS	.						132.0	137.0	135.0					15																	22382649		2200	4292	6492	SO:0001819	synonymous_variant	283694	exon1			CCCCCTCTATTTA	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.177C>G	15.37:g.22382649C>G		Somatic	447	0	0		WXS	Illumina HiSeq	Phase_I	409	59	0.144254	NM_001005241	Q6IEY3|Q6IF56	Silent	SNP	ENST00000328795.4	37	CCDS32173.1																																																																																			.	.	none		0.453	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1		
RHBDD3	25807	hgsc.bcm.edu	37	22	29660104	29660104	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr22:29660104C>T	ENST00000216085.7	-	4	676	c.252G>A	c.(250-252)ctG>ctA	p.L84L	CTA-984G1.5_ENST00000433125.1_RNA	NM_012265.1	NP_036397.1	Q9Y3P4	RHBD3_HUMAN	rhomboid domain containing 3	84					liver development (GO:0001889)|MAPK cascade (GO:0000165)|negative regulation of natural killer cell activation (GO:0032815)|positive regulation of protein catabolic process (GO:0045732)|regulation of acute inflammatory response (GO:0002673)|regulation of protein secretion (GO:0050708)|response to xenobiotic stimulus (GO:0009410)	integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			lung(1)|ovary(1)	2						TCAGCGTGCCCAGGTGGCACT	0.697																																					p.L84L		Atlas-SNP	.											.	RHBDD3	17	.	0			c.G252A						PASS	.						10.0	10.0	10.0					22																	29660104		2180	4269	6449	SO:0001819	synonymous_variant	25807	exon4			CGTGCCCAGGTGG	AL050346	CCDS13850.1	22q12.2	2006-02-22	2006-02-22	2006-02-22	ENSG00000100263	ENSG00000100263			1308	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 3"""	C22orf3		10591208, 15105437	Standard	NM_012265		Approved	PTAG	uc003aeq.1	Q9Y3P4	OTTHUMG00000151032	ENST00000216085.7:c.252G>A	22.37:g.29660104C>T		Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	73	27	0.369863	NM_012265	Q6I9X3|Q9UGQ7	Silent	SNP	ENST00000216085.7	37	CCDS13850.1																																																																																			.	.	none		0.697	RHBDD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321085.1	NM_012265	
CNTNAP5	129684	hgsc.bcm.edu	37	2	125530582	125530582	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:125530582C>A	ENST00000431078.1	+	17	3101	c.2737C>A	c.(2737-2739)Cag>Aag	p.Q913K		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	913	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GCTGAACAGCCAGTTGTTTGT	0.507																																					p.Q913K		Atlas-SNP	.											.	CNTNAP5	405	.	0			c.C2737A						PASS	.						100.0	95.0	97.0					2																	125530582		1909	4127	6036	SO:0001583	missense	129684	exon17			AACAGCCAGTTGT	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2737C>A	2.37:g.125530582C>A	ENSP00000399013:p.Gln913Lys	Somatic	250	0	0		WXS	Illumina HiSeq	Phase_I	230	49	0.213043	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	c	31	5.067704	0.93950	.	.	ENSG00000155052	ENST00000431078	T	0.48836	0.8	5.63	5.63	0.86233	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.151491	0.29868	N	0.010984	T	0.72922	0.3521	M	0.88842	2.985	0.58432	D	0.999999	D	0.69078	0.997	D	0.67231	0.95	T	0.72924	-0.4144	10	0.31617	T	0.26	.	18.7016	0.91621	0.0:1.0:0.0:0.0	.	913	Q8WYK1	CNTP5_HUMAN	K	913	ENSP00000399013:Q913K	ENSP00000399013:Q913K	Q	+	1	0	CNTNAP5	125247052	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.686000	0.84128	2.664000	0.90586	0.645000	0.84053	CAG	.	.	none		0.507	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
CSNK1G3	1456	hgsc.bcm.edu	37	5	122881389	122881389	+	Nonsense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:122881389C>G	ENST00000361991.2	+	1	62	c.32C>G	c.(31-33)tCa>tGa	p.S11*	CSNK1G3_ENST00000360683.2_Nonsense_Mutation_p.S11*|CSNK1G3_ENST00000510842.2_Nonsense_Mutation_p.S11*|CSNK1G3_ENST00000521364.1_Nonsense_Mutation_p.S11*|CSNK1G3_ENST00000512718.3_Intron|CSNK1G3_ENST00000395412.1_Nonsense_Mutation_p.S11*|CSNK1G3_ENST00000508708.1_3'UTR|CSNK1G3_ENST00000395411.1_Nonsense_Mutation_p.S11*|CSNK1G3_ENST00000345990.4_Nonsense_Mutation_p.S11*|CSNK1G3_ENST00000511130.2_Intron			Q9Y6M4	KC1G3_HUMAN	casein kinase 1, gamma 3	11					cellular protein modification process (GO:0006464)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(1)	15		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)		AAGGACAAATCAGATGATAGA	0.408																																					p.S11X	Pancreas(187;2868 2964 4353 6297)	Atlas-SNP	.											CSNK1G3,bladder,carcinoma,0,1	CSNK1G3	42	1	0			c.C32G						PASS	.						120.0	102.0	108.0					5																	122881389		2203	4300	6503	SO:0001587	stop_gained	1456	exon1			ACAAATCAGATGA	AF049090	CCDS4135.1, CCDS34218.1, CCDS43355.1, CCDS59491.1, CCDS59492.1, CCDS59493.1	5q23	2013-01-17			ENSG00000151292	ENSG00000151292			2456	protein-coding gene	gene with protein product		604253				9925945	Standard	NM_004384		Approved		uc031skv.1	Q9Y6M4	OTTHUMG00000128923	ENST00000361991.2:c.32C>G	5.37:g.122881389C>G	ENSP00000354942:p.Ser11*	Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	184	30	0.163043	NM_001270572	A8K040|B4DSH2|B7Z9Q4|E7EVD0|Q86WZ7|Q9Y6M3	Nonsense_Mutation	SNP	ENST00000361991.2	37	CCDS4135.1	.	.	.	.	.	.	.	.	.	.	C	37	6.255040	0.97417	.	.	ENSG00000151292	ENST00000395412;ENST00000395411;ENST00000345990;ENST00000521364;ENST00000510842;ENST00000361991;ENST00000360683	.	.	.	5.2	4.32	0.51571	.	2.335320	0.01492	N	0.017111	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	13.6746	0.62447	0.0:0.9229:0.0:0.0771	.	.	.	.	X	11	.	ENSP00000334735:S11X	S	+	2	0	CSNK1G3	122909288	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	2.943000	0.49026	2.805000	0.96524	0.655000	0.94253	TCA	.	.	none		0.408	CSNK1G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250900.1	NM_004384	
OR6S1	341799	hgsc.bcm.edu	37	14	21109391	21109391	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr14:21109391C>T	ENST00000320704.3	-	1	459	c.460G>A	c.(460-462)Gga>Aga	p.G154R		NM_001001968.1	NP_001001968.1	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S, member 1	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		GGGACGAGTCCCCCCACCCAG	0.607																																					p.G154R		Atlas-SNP	.											.	OR6S1	49	.	0			c.G460A						PASS	.						84.0	68.0	73.0					14																	21109391		2203	4300	6503	SO:0001583	missense	341799	exon1			CGAGTCCCCCCAC	AL163636	CCDS32038.1	14q11.2	2013-09-24			ENSG00000181803	ENSG00000181803		"""GPCR / Class A : Olfactory receptors"""	15363	protein-coding gene	gene with protein product							Standard	NM_001001968		Approved	OR6S1Q	uc001vxv.1	Q8NH40	OTTHUMG00000171010	ENST00000320704.3:c.460G>A	14.37:g.21109391C>T	ENSP00000313110:p.Gly154Arg	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	53	15	0.283019	NM_001001968	Q6IFJ9	Missense_Mutation	SNP	ENST00000320704.3	37	CCDS32038.1	.	.	.	.	.	.	.	.	.	.	C	14.50	2.554076	0.45487	.	.	ENSG00000181803	ENST00000320704	T	0.40476	1.03	5.76	4.87	0.63330	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000186	T	0.71031	0.3292	M	0.92268	3.29	0.35185	D	0.772818	D	0.89917	1.0	D	0.87578	0.998	D	0.83841	0.0257	10	0.87932	D	0	-6.6133	12.5635	0.56295	0.0:0.9197:0.0:0.0803	.	154	Q8NH40	OR6S1_HUMAN	R	154	ENSP00000313110:G154R	ENSP00000313110:G154R	G	-	1	0	OR6S1	20179231	0.032000	0.19561	0.995000	0.50966	0.276000	0.26787	1.890000	0.39728	1.443000	0.47586	-0.136000	0.14681	GGA	.	.	none		0.607	OR6S1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411227.1		
WDR24	84219	hgsc.bcm.edu	37	16	735417	735417	+	Nonsense_Mutation	SNP	G	G	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:735417G>C	ENST00000248142.6	-	11	2248	c.2249C>G	c.(2248-2250)tCa>tGa	p.S750*	JMJD8_ENST00000609261.1_5'Flank|WDR24_ENST00000293883.4_Nonsense_Mutation_p.S620*|JMJD8_ENST00000293882.4_5'Flank|JMJD8_ENST00000412368.2_5'Flank|JMJD8_ENST00000562824.1_5'Flank|JMJD8_ENST00000562111.1_5'Flank|JMJD8_ENST00000454700.1_5'Flank			Q96S15	WDR24_HUMAN	WD repeat domain 24	750										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				GAGCGCGTGTGAGACAGACAG	0.677																																					p.S620X		Atlas-SNP	.											.	WDR24	111	.	0			c.C1859G						PASS	.						36.0	46.0	43.0					16																	735417		2200	4298	6498	SO:0001587	stop_gained	84219	exon7			GCGTGTGAGACAG	AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.2249C>G	16.37:g.735417G>C	ENSP00000248142:p.Ser750*	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	48	9	0.1875	NM_032259	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Nonsense_Mutation	SNP	ENST00000248142.6	37		.	.	.	.	.	.	.	.	.	.	G	44	10.866820	0.99480	.	.	ENSG00000127580	ENST00000248142;ENST00000293883	.	.	.	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-11.9116	16.9554	0.86258	0.0:0.0:1.0:0.0	.	.	.	.	X	750;620	.	ENSP00000248142:S750X	S	-	2	0	WDR24	675418	1.000000	0.71417	0.067000	0.19924	0.526000	0.34562	9.182000	0.94881	2.484000	0.83849	0.511000	0.50034	TCA	.	.	none		0.677	WDR24-201	KNOWN	basic	protein_coding	protein_coding		NM_032259	
PPP1R36	145376	hgsc.bcm.edu	37	14	65016722	65016722	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr14:65016722C>T	ENST00000298705.1	+	1	103	c.7C>T	c.(7-9)Cgg>Tgg	p.R3W	RP11-973N13.3_ENST00000554454.1_RNA|RP11-973N13.3_ENST00000556634.1_RNA	NM_172365.1	NP_758953.1	Q96LQ0	PPR36_HUMAN	protein phosphatase 1, regulatory subunit 36	3					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										GGCCATGTACCGGGTGCCCGA	0.692																																					p.R3W		Atlas-SNP	.											C14orf50,NS,malignant_melanoma,0,1	.	.	1	0			c.C7T						PASS	.						36.0	27.0	30.0					14																	65016722		2185	4278	6463	SO:0001583	missense	145376	exon1			ATGTACCGGGTGC		CCDS9767.1	14q23.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000165807	ENSG00000165807		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20097	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 50"""	C14orf50			Standard	NM_172365		Approved		uc001xhl.1	Q96LQ0	OTTHUMG00000141316	ENST00000298705.1:c.7C>T	14.37:g.65016722C>T	ENSP00000298705:p.Arg3Trp	Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	51	8	0.156863	NM_172365	Q6NTH6	Missense_Mutation	SNP	ENST00000298705.1	37	CCDS9767.1	.	.	.	.	.	.	.	.	.	.	C	11.03	1.517625	0.27123	.	.	ENSG00000165807	ENST00000298705	T	0.32753	1.44	3.21	-0.892	0.10570	.	4.411120	0.00859	N	0.001907	T	0.15349	0.0370	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.23119	-1.0197	10	0.66056	D	0.02	5.66	0.6167	0.00771	0.1968:0.3735:0.192:0.2377	.	3	Q96LQ0	PPR36_HUMAN	W	3	ENSP00000298705:R3W	ENSP00000298705:R3W	R	+	1	2	C14orf50	64086475	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.007000	0.12810	-0.198000	0.10333	-0.136000	0.14681	CGG	.	.	none		0.692	PPP1R36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280667.1	NM_172365	
ZNF425	155054	hgsc.bcm.edu	37	7	148801312	148801312	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:148801312C>T	ENST00000378061.2	-	4	1783	c.1651G>A	c.(1651-1653)Gag>Aag	p.E551K		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	551					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			AAGGGCTCCTCGCCACTGTGA	0.632																																					p.E551K		Atlas-SNP	.											.	ZNF425	99	.	0			c.G1651A						PASS	.						33.0	33.0	33.0					7																	148801312		2202	4296	6498	SO:0001583	missense	155054	exon4			GCTCCTCGCCACT	AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.1651G>A	7.37:g.148801312C>T	ENSP00000367300:p.Glu551Lys	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	65	22	0.338462	NM_001001661	B3KPM1|Q08AG3	Missense_Mutation	SNP	ENST00000378061.2	37	CCDS34773.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.870096	0.33069	.	.	ENSG00000204947	ENST00000378061	T	0.24350	1.86	3.15	3.15	0.36227	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41305	0.1153	M	0.62266	1.93	0.30830	N	0.736807	D	0.63880	0.993	P	0.61397	0.888	T	0.40831	-0.9542	9	0.87932	D	0	.	8.417	0.32676	0.0:0.7575:0.2424:0.0	.	551	Q6IV72	ZN425_HUMAN	K	551	ENSP00000367300:E551K	ENSP00000367300:E551K	E	-	1	0	ZNF425	148432245	0.027000	0.19231	0.073000	0.20177	0.298000	0.27526	1.318000	0.33643	1.770000	0.52166	0.655000	0.94253	GAG	.	.	none		0.632	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352726.1	XM_088140	
SOCS1	8651	hgsc.bcm.edu	37	16	11348807	11348807	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:11348807G>A	ENST00000332029.2	-	2	679	c.529C>T	c.(529-531)Ctg>Ttg	p.L177L	RMI2_ENST00000572173.1_Intron	NM_003745.1	NP_003736.1	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	177	Interaction with Elongin BC complex. {ECO:0000250}.|SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				cellular response to amino acid stimulus (GO:0071230)|cytokine-mediated signaling pathway (GO:0019221)|fat cell differentiation (GO:0045444)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein phosphorylation (GO:0001932)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	insulin-like growth factor receptor binding (GO:0005159)|kinase inhibitor activity (GO:0019210)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.E176fs*35(3)|p.Y64fs*1(1)|p.R127_*212del(1)|p.V171_R179del(1)|p.0?(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(66)|lung(3)	71						TGGCGGCACAGCTCCTGCAGC	0.726			"""F, O"""		"""Hodgkin Lymphoma, PMBL"""																																p.L177L	Colon(177;456 3548 27231)	Atlas-SNP	.		Rec	yes		16	16p13.13	8651	suppressor of cytokine signaling 1		L	.	SOCS1	84	.	7	Deletion - Frameshift(4)|Deletion - In frame(2)|Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(7)	c.C529T						PASS	.						7.0	7.0	7.0					16																	11348807		2133	4196	6329	SO:0001819	synonymous_variant	8651	exon2			GGCACAGCTCCTG	U88326	CCDS10546.1	16p13.13	2013-02-14			ENSG00000185338	ENSG00000185338		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19383	protein-coding gene	gene with protein product		603597				7796808, 9266833	Standard	NM_003745		Approved	SOCS-1, SSI-1, JAB, TIP3, Cish1	uc002dar.1	O15524	OTTHUMG00000129792	ENST00000332029.2:c.529C>T	16.37:g.11348807G>A		Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	59	18	0.305085	NM_003745	O15097|Q9NSA7	Silent	SNP	ENST00000332029.2	37	CCDS10546.1																																																																																			.	.	none		0.726	SOCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252018.1		
OXR1	55074	hgsc.bcm.edu	37	8	107695483	107695483	+	Silent	SNP	C	C	T	rs537961089		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:107695483C>T	ENST00000442977.2	+	4	462	c.363C>T	c.(361-363)aaC>aaT	p.N121N	OXR1_ENST00000531443.1_Silent_p.N120N|OXR1_ENST00000497705.1_Silent_p.N53N|OXR1_ENST00000445937.1_Silent_p.N120N|OXR1_ENST00000312046.6_Silent_p.N113N|OXR1_ENST00000452423.2_5'UTR|OXR1_ENST00000517566.2_Silent_p.N120N	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	121					adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			CAACACCTAACGAACTTGTTC	0.299																																					p.N121N		Atlas-SNP	.											.	OXR1	190	.	0			c.C363T						PASS	.						80.0	82.0	81.0					8																	107695483		2203	4293	6496	SO:0001819	synonymous_variant	55074	exon4			ACCTAACGAACTT	AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.363C>T	8.37:g.107695483C>T		Somatic	185	0	0		WXS	Illumina HiSeq	Phase_I	186	41	0.22043	NM_001198532	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Silent	SNP	ENST00000442977.2	37	CCDS56548.1	.	.	.	.	.	.	.	.	.	.	C	9.200	1.028124	0.19512	.	.	ENSG00000164830	ENST00000517455	.	.	.	5.4	-4.2	0.03823	.	.	.	.	.	T	0.62539	0.2436	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61466	-0.7057	4	.	.	.	-10.1915	13.5748	0.61868	0.0:0.472:0.0:0.528	.	.	.	.	M	37	.	.	T	+	2	0	OXR1	107764659	0.752000	0.28338	0.927000	0.36925	0.971000	0.66376	-0.143000	0.10296	-0.951000	0.03654	-0.350000	0.07774	ACG	.	.	none		0.299	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354	
STAC	6769	hgsc.bcm.edu	37	3	36422176	36422176	+	Missense_Mutation	SNP	G	G	A	rs143848363	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:36422176G>A	ENST00000273183.3	+	1	341	c.41G>A	c.(40-42)gGg>gAg	p.G14E	STAC_ENST00000457375.2_Missense_Mutation_p.G14E|STAC_ENST00000476388.1_3'UTR	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	14					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						GGCGTGGACGGGCTGCCCAAG	0.692													G|||	7	0.00139776	0.0	0.0043	5008	,	,		13727	0.0		0.004	False		,,,				2504	0.0				p.G14E		Atlas-SNP	.											.	STAC	78	.	0			c.G41A						PASS	.	G	GLU/GLY	0,4384		0,0,2192	17.0	15.0	16.0		41	4.1	1.0	3	dbSNP_134	16	6,8552		0,6,4273	no	missense	STAC	NM_003149.1	98	0,6,6465	AA,AG,GG		0.0701,0.0,0.0464	possibly-damaging	14/403	36422176	6,12936	2192	4279	6471	SO:0001583	missense	6769	exon1			TGGACGGGCTGCC	D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.41G>A	3.37:g.36422176G>A	ENSP00000273183:p.Gly14Glu	Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	42	9	0.214286	NM_003149	B2R8S8	Missense_Mutation	SNP	ENST00000273183.3	37	CCDS2662.1	5	0.0022893772893772895	0	0.0	1	0.0027624309392265192	0	0.0	4	0.005277044854881266	G	18.22	3.574826	0.65878	0.0	7.01E-4	ENSG00000144681	ENST00000273183;ENST00000457375;ENST00000434649	T;T;T	0.77877	-1.13;0.62;0.32	4.96	4.08	0.47627	.	0.202960	0.40064	N	0.001190	T	0.69806	0.3152	L	0.44542	1.39	0.35585	D	0.806587	B;D	0.59767	0.006;0.986	B;P	0.50860	0.008;0.652	T	0.80973	-0.1143	10	0.72032	D	0.01	.	11.0518	0.47894	0.0898:0.0:0.9102:0.0	.	14;14	E9PEA7;Q99469	.;STAC_HUMAN	E	14	ENSP00000273183:G14E;ENSP00000393713:G14E;ENSP00000398403:G14E	ENSP00000273183:G14E	G	+	2	0	STAC	36397180	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.713000	0.47194	1.400000	0.46741	0.650000	0.86243	GGG	G|0.999;A|0.001	0.001	strong		0.692	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253338.2	NM_003149	
FLT1	2321	hgsc.bcm.edu	37	13	28886173	28886173	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr13:28886173A>C	ENST00000282397.4	-	26	3700	c.3449T>G	c.(3448-3450)cTt>cGt	p.L1150R	FLT1_ENST00000543394.1_Missense_Mutation_p.L173R|FLT1_ENST00000540678.1_Missense_Mutation_p.L368R	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	1150	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TTTTTCCACAAGTTCTGCAAA	0.413																																					p.L1150R		Atlas-SNP	.											.	FLT1	393	.	0			c.T3449G						PASS	.						109.0	106.0	107.0					13																	28886173		2203	4300	6503	SO:0001583	missense	2321	exon26			TCCACAAGTTCTG	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.3449T>G	13.37:g.28886173A>C	ENSP00000282397:p.Leu1150Arg	Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	65	15	0.230769	NM_002019	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.607815	0.87258	.	.	ENSG00000102755	ENST00000282397;ENST00000543394;ENST00000540678	D;D;D	0.91124	-2.79;-2.79;-2.79	5.93	5.93	0.95920	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.96355	0.8811	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97128	0.9816	10	0.87932	D	0	.	16.3797	0.83452	1.0:0.0:0.0:0.0	.	1150	P17948	VGFR1_HUMAN	R	1150;173;368	ENSP00000282397:L1150R;ENSP00000437841:L173R;ENSP00000443311:L368R	ENSP00000282397:L1150R	L	-	2	0	FLT1	27784173	1.000000	0.71417	0.994000	0.49952	0.924000	0.55760	9.310000	0.96267	2.271000	0.75665	0.533000	0.62120	CTT	.	.	none		0.413	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
HMCN1	83872	hgsc.bcm.edu	37	1	186077619	186077619	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:186077619G>A	ENST00000271588.4	+	71	11108	c.10879G>A	c.(10879-10881)Gag>Aag	p.E3627K	HMCN1_ENST00000367492.2_Missense_Mutation_p.E3627K	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3627	Ig-like C2-type 35.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TGGAACTGATGAGCCCCGGGA	0.423																																					p.E3627K		Atlas-SNP	.											.	HMCN1	797	.	0			c.G10879A						PASS	.						117.0	107.0	110.0					1																	186077619		2203	4300	6503	SO:0001583	missense	83872	exon71			ACTGATGAGCCCC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.10879G>A	1.37:g.186077619G>A	ENSP00000271588:p.Glu3627Lys	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	55	10	0.181818	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.654284	0.47467	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.65364	-0.15;-0.15	5.87	5.87	0.94306	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.398703	0.29508	N	0.011949	T	0.53786	0.1818	L	0.31752	0.955	0.09310	N	1	P	0.36837	0.571	P	0.44860	0.462	T	0.46247	-0.9205	10	0.05620	T	0.96	.	14.7159	0.69269	0.069:0.0:0.931:0.0	.	3627	Q96RW7	HMCN1_HUMAN	K	3627	ENSP00000271588:E3627K;ENSP00000356462:E3627K	ENSP00000271588:E3627K	E	+	1	0	HMCN1	184344242	1.000000	0.71417	0.787000	0.31911	0.930000	0.56654	4.165000	0.58196	2.941000	0.99782	0.655000	0.94253	GAG	.	.	none		0.423	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
POLR2B	5431	hgsc.bcm.edu	37	4	57871515	57871515	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:57871515G>T	ENST00000381227.1	+	9	1417	c.1004G>T	c.(1003-1005)aGa>aTa	p.R335I	POLR2B_ENST00000314595.5_Missense_Mutation_p.R335I|POLR2B_ENST00000441246.2_Missense_Mutation_p.R328I|RNU6-998P_ENST00000515894.1_RNA|POLR2B_ENST00000431623.2_Missense_Mutation_p.R260I			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	335					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)	p.R335I(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					AAAGAGAAAAGAATTAAATAT	0.363																																					p.R335I		Atlas-SNP	.											POLR2B,NS,carcinoma,0,1	POLR2B	108	1	1	Substitution - Missense(1)	lung(1)	c.G1004T						PASS	.						93.0	95.0	94.0					4																	57871515		2203	4299	6502	SO:0001583	missense	5431	exon8			AGAAAAGAATTAA		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.1004G>T	4.37:g.57871515G>T	ENSP00000370625:p.Arg335Ile	Somatic	474	0	0		WXS	Illumina HiSeq	Phase_I	326	155	0.47546	NM_000938	A8K1A8|Q8IZ61	Missense_Mutation	SNP	ENST00000381227.1	37	CCDS3511.1	.	.	.	.	.	.	.	.	.	.	G	34	5.294439	0.95546	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.77	5.77	0.91146	RNA polymerase, beta subunit, protrusion (1);RNA polymerase Rpb2, domain 2 (1);	0.000000	0.85682	D	0.000000	D	0.88811	0.6538	H	0.96777	3.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90815	0.4704	10	0.54805	T	0.06	.	20.3472	0.98799	0.0:0.0:1.0:0.0	.	260;335	C9J4M6;P30876	.;RPB2_HUMAN	I	335;260;328;335	ENSP00000370625:R335I;ENSP00000391096:R260I;ENSP00000391452:R328I;ENSP00000312735:R335I	ENSP00000312735:R335I	R	+	2	0	POLR2B	57566272	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.831000	0.86748	2.890000	0.99128	0.650000	0.86243	AGA	.	.	none		0.363	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
NEFH	4744	hgsc.bcm.edu	37	22	29885567	29885567	+	Silent	SNP	A	A	C	rs147489453|rs75808076|rs59279731		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr22:29885567A>C	ENST00000310624.6	+	4	1971	c.1938A>C	c.(1936-1938)gcA>gcC	p.A646A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	652	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGAGGAAGCAAAGTCCCCTG	0.567																																					p.A646A		Atlas-SNP	.											NEFH,rectum,carcinoma,0,1	NEFH	178	1	0			c.A1938C						scavenged	.						78.0	77.0	77.0					22																	29885567		2133	4127	6260	SO:0001819	synonymous_variant	4744	exon4			GGAAGCAAAGTCC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1938A>C	22.37:g.29885567A>C		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	48	5	0.104167	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	weak		0.567	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
HGS	9146	hgsc.bcm.edu	37	17	79663744	79663744	+	Silent	SNP	G	G	A	rs190451033	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:79663744G>A	ENST00000329138.4	+	17	1809	c.1674G>A	c.(1672-1674)gcG>gcA	p.A558A		NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	558	Gln-rich.|Interaction with NF2.|Interaction with STAM1. {ECO:0000250}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			AGATGCGCGCGCAGATGCCCG	0.662													G|||	2	0.000399361	0.0	0.0	5008	,	,		14915	0.0		0.001	False		,,,				2504	0.001				p.A558A		Atlas-SNP	.											.	HGS	54	.	0			c.G1674A						PASS	.	G		0,4406		0,0,2203	44.0	55.0	51.0		1674	-2.9	0.9	17		51	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	HGS	NM_004712.4		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		558/778	79663744	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	9146	exon17			GCGCGCGCAGATG	D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		ENST00000329138.4:c.1674G>A	17.37:g.79663744G>A		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	40	14	0.35	NM_004712	Q9NR36	Silent	SNP	ENST00000329138.4	37	CCDS11784.1																																																																																			G|1.000;A|0.000	0.000	strong		0.662	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440541.1	NM_004712	
MUC16	94025	hgsc.bcm.edu	37	19	9006370	9006370	+	Silent	SNP	A	A	G	rs79341062	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:9006370A>G	ENST00000397910.4	-	45	39851	c.39648T>C	c.(39646-39648)taT>taC	p.Y13216Y	MUC16_ENST00000380951.5_5'Flank	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13218	SEA 8. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGCAGCCAGAATACAGAGGGC	0.522																																					p.Y13216Y		Atlas-SNP	.											MUC16_ENST00000397910,NS,carcinoma,-2,2	MUC16	4315	2	0			c.T39648C						scavenged	.						104.0	85.0	91.0					19																	9006370		2007	4178	6185	SO:0001819	synonymous_variant	94025	exon45			GCCAGAATACAGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39648T>C	19.37:g.9006370A>G		Somatic	36	2	0.0555556		WXS	Illumina HiSeq	Phase_I	31	5	0.16129	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	2.163	-0.391777	0.04932	.	.	ENSG00000181143	ENST00000542240	.	.	.	2.73	-2.09	0.07232	.	.	.	.	.	T	0.36799	0.0980	.	.	.	.	.	.	.	.	.	.	.	.	T	0.44544	-0.9321	3	.	.	.	-18.4462	7.5909	0.28021	0.6138:0.0:0.3862:0.0	.	.	.	.	T	56	.	.	I	-	2	0	MUC16	8867370	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-2.632000	0.00870	-0.715000	0.04968	-2.373000	0.00235	ATT	A|0.500;G|0.500	0.500	strong		0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
FNDC7	163479	hgsc.bcm.edu	37	1	109265194	109265194	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:109265194C>T	ENST00000370017.3	+	5	1113	c.836C>T	c.(835-837)tCa>tTa	p.S279L	FNDC7_ENST00000271311.2_Missense_Mutation_p.S280L	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	279	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		AAATCATCTTCAGCAATGACC	0.448																																					p.S279L		Atlas-SNP	.											.	FNDC7	113	.	0			c.C836T						PASS	.						72.0	63.0	66.0					1																	109265194		2203	4300	6503	SO:0001583	missense	163479	exon5			CATCTTCAGCAAT		CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.836C>T	1.37:g.109265194C>T	ENSP00000359034:p.Ser279Leu	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	113	33	0.292035	NM_001144937	A1L468|E9PAZ5|Q6PF16|Q8NA51	Missense_Mutation	SNP	ENST00000370017.3	37	CCDS44185.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.277637	0.40294	.	.	ENSG00000143107	ENST00000370017;ENST00000271311	T;T	0.22134	1.97;1.97	5.91	4.94	0.65067	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.688360	0.15255	N	0.272122	T	0.06508	0.0167	L	0.44542	1.39	0.09310	N	1	B;P	0.40000	0.349;0.698	B;B	0.27380	0.079;0.079	T	0.16364	-1.0405	10	0.25751	T	0.34	-6.6208	12.3366	0.55071	0.3228:0.6772:0.0:0.0	.	280;279	Q5VTL7;E9PAZ5	FNDC7_HUMAN;.	L	279;280	ENSP00000359034:S279L;ENSP00000271311:S280L	ENSP00000271311:S280L	S	+	2	0	FNDC7	109066717	0.798000	0.28890	0.279000	0.24732	0.776000	0.43924	3.242000	0.51384	2.807000	0.96579	0.555000	0.69702	TCA	.	.	none		0.448	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030589.4	NM_173532	
CNTNAP4	85445	hgsc.bcm.edu	37	16	76389398	76389398	+	Missense_Mutation	SNP	A	A	C	rs139740249		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:76389398A>C	ENST00000476707.1	+	2	528	c.389A>C	c.(388-390)gAc>gCc	p.D130A	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.D102A|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.D126A|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.D126A			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	127	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CGCCAAGAGGACAGCATCTGG	0.438																																					p.D102A		Atlas-SNP	.											.	CNTNAP4	600	.	0			c.A305C						PASS	.						86.0	82.0	84.0					16																	76389398		2198	4300	6498	SO:0001583	missense	85445	exon3			AAGAGGACAGCAT	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.389A>C	16.37:g.76389398A>C	ENSP00000417628:p.Asp130Ala	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	83	24	0.289157	NM_138994	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	A	17.37	3.373308	0.61624	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	D;D;D;D	0.97328	-4.34;-4.34;-4.34;-4.34	4.8	4.8	0.61643	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.335067	0.21454	N	0.074283	D	0.97860	0.9297	.	.	.	0.37784	D	0.927109	D;D;P;P	0.56521	0.976;0.961;0.767;0.88	P;P;P;P	0.62560	0.904;0.85;0.752;0.685	D	0.99632	1.0986	9	0.54805	T	0.06	.	12.6038	0.56511	1.0:0.0:0.0:0.0	.	102;130;102;127	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	A	126;126;102;130	ENSP00000306893:D126A;ENSP00000439733:D126A;ENSP00000418741:D102A;ENSP00000417628:D130A	ENSP00000306893:D126A	D	+	2	0	CNTNAP4	74946899	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.028000	0.70889	2.145000	0.66743	0.482000	0.46254	GAC	A|1.000;G|0.000	.	alt		0.438	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
HAO1	54363	hgsc.bcm.edu	37	20	7920952	7920952	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:7920952T>G	ENST00000378789.3	-	1	169	c.118A>C	c.(118-120)Aat>Cat	p.N40H		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	40	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						GCTGCAATATTATCAGCCAAA	0.303																																					p.N40H		Atlas-SNP	.											.	HAO1	71	.	0			c.A118C						PASS	.						58.0	56.0	57.0					20																	7920952		2203	4300	6503	SO:0001583	missense	54363	exon1			CAATATTATCAGC	AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.118A>C	20.37:g.7920952T>G	ENSP00000368066:p.Asn40His	Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	87	14	0.16092	NM_017545	Q14CQ0|Q9UPZ0|Q9Y3I7	Missense_Mutation	SNP	ENST00000378789.3	37	CCDS13100.1	.	.	.	.	.	.	.	.	.	.	T	17.53	3.412595	0.62511	.	.	ENSG00000101323	ENST00000378789	T	0.51574	0.7	5.16	5.16	0.70880	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.043429	0.85682	D	0.000000	T	0.79393	0.4438	H	0.97707	4.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86768	0.1971	10	0.87932	D	0	0.3185	14.2604	0.66080	0.0:0.0:0.0:1.0	.	40;40	A8K058;Q9UJM8	.;HAOX1_HUMAN	H	40	ENSP00000368066:N40H	ENSP00000368066:N40H	N	-	1	0	HAO1	7868952	1.000000	0.71417	0.992000	0.48379	0.745000	0.42441	6.312000	0.72840	2.060000	0.61445	0.459000	0.35465	AAT	.	.	none		0.303	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2		
TSC2	7249	hgsc.bcm.edu	37	16	2094643	2094643	+	5'Flank	SNP	G	G	A	rs140211154		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:2094643G>A	ENST00000219476.3	+	0	0				NTHL1_ENST00000219066.1_Silent_p.V179V|NTHL1_ENST00000562951.1_5'Flank	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2						acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				TCCAGAAACCGACGGGGTAGA	0.682			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.V179V		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	NTHL1	24	.	0			c.C537T						PASS	.	G		0,4396		0,0,2198	53.0	47.0	49.0		537	-5.8	0.9	16	dbSNP_134	49	2,8596	2.2+/-6.3	0,2,4297	no	coding-synonymous	NTHL1	NM_002528.5		0,2,6495	AA,AG,GG		0.0233,0.0,0.0154		179/313	2094643	2,12992	2198	4299	6497	SO:0001631	upstream_gene_variant	4913	exon3	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	GAAACCGACGGGG	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745		16.37:g.2094643G>A	Exception_encountered	Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	39	14	0.358974	NM_002528	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Silent	SNP	ENST00000219476.3	37	CCDS10458.1																																																																																			G|1.000;A|0.000	0.000	weak		0.682	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
OSTM1	28962	hgsc.bcm.edu	37	6	108370472	108370472	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:108370472G>A	ENST00000193322.3	-	5	1019	c.934C>T	c.(934-936)Cgc>Tgc	p.R312C		NM_014028.3	NP_054747.2	Q86WC4	OSTM1_HUMAN	osteopetrosis associated transmembrane protein 1	312					ion transmembrane transport (GO:0034220)|osteoclast differentiation (GO:0030316)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0131)|Epithelial(106;0.0438)|OV - Ovarian serous cystadenocarcinoma(136;0.0571)|all cancers(137;0.0581)		ATGAGTTTGCGTTTCTTTTGC	0.338																																					p.R312C	Melanoma(162;1427 1909 3096 17430 21396)	Atlas-SNP	.											.	OSTM1	22	.	0			c.C934T						PASS	.						58.0	54.0	56.0					6																	108370472		2203	4300	6503	SO:0001583	missense	28962	exon5			GTTTGCGTTTCTT	AF533891	CCDS5062.1	6q21	2014-06-17			ENSG00000081087	ENSG00000081087			21652	protein-coding gene	gene with protein product	"""CLCN7 accessory beta subunit"""	607649				12627228, 21527911	Standard	NM_014028		Approved	HSPC019, GL	uc003psd.3	Q86WC4	OTTHUMG00000015317	ENST00000193322.3:c.934C>T	6.37:g.108370472G>A	ENSP00000193322:p.Arg312Cys	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	130	20	0.153846	NM_014028	E1P5E3|Q5R391|Q6PCA7|Q7RTW6|Q8NC29|Q8TC82|Q9Y2S9	Missense_Mutation	SNP	ENST00000193322.3	37	CCDS5062.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.899649	0.72754	.	.	ENSG00000081087	ENST00000193322;ENST00000440575	T	0.55234	0.53	5.59	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.69984	0.3172	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74466	-0.3656	10	0.87932	D	0	-10.502	17.1745	0.86838	0.0:0.0:0.8652:0.1348	.	312	Q86WC4	OSTM1_HUMAN	C	312;165	ENSP00000193322:R312C	ENSP00000193322:R312C	R	-	1	0	OSTM1	108477165	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.544000	0.82117	2.635000	0.89317	0.650000	0.86243	CGC	.	.	none		0.338	OSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041709.3	NM_014028	
GOPC	57120	hgsc.bcm.edu	37	6	117894665	117894665	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:117894665C>A	ENST00000368498.2	-	5	856	c.781G>T	c.(781-783)Gac>Tac	p.D261Y	GOPC_ENST00000052569.6_Missense_Mutation_p.D253Y|GOPC_ENST00000535237.1_Missense_Mutation_p.D261Y|GOPC_ENST00000467125.1_5'UTR	NM_020399.3	NP_065132.1	Q9HD26	GOPC_HUMAN	golgi-associated PDZ and coiled-coil motif containing	261					apical protein localization (GO:0045176)|cytoplasmic sequestering of CFTR protein (GO:0043004)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi to plasma membrane transport (GO:0006893)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|spermatid nucleus differentiation (GO:0007289)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|trans-Golgi network transport vesicle (GO:0030140)	ion channel binding (GO:0044325)|small GTPase regulator activity (GO:0005083)		GOPC/ROS1(14)	endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)		CGTTTCAAGTCATTACGTCCT	0.448			O	ROS1	glioblastoma																																p.D261Y		Atlas-SNP	.		Dom	yes		6	6q21	57120	golgi associated PDZ and coiled-coil motif containing		O	.	GOPC	29	.	0			c.G781T						PASS	.						273.0	209.0	231.0					6																	117894665		2203	4300	6503	SO:0001583	missense	57120	exon5			TCAAGTCATTACG	AF287894	CCDS5117.1, CCDS34523.1	6q21	2010-02-12	2010-02-12		ENSG00000047932	ENSG00000047932			17643	protein-coding gene	gene with protein product		606845				11162552, 11520064	Standard	NM_020399		Approved	dJ94G16.2, PIST, FIG, GOPC1, CAL		Q9HD26	OTTHUMG00000015457	ENST00000368498.2:c.781G>T	6.37:g.117894665C>A	ENSP00000357484:p.Asp261Tyr	Somatic	209	0	0		WXS	Illumina HiSeq	Phase_I	164	50	0.304878	NM_020399	A6NM30|Q59FS4|Q969U8	Missense_Mutation	SNP	ENST00000368498.2	37	CCDS5117.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.998376	0.93227	.	.	ENSG00000047932	ENST00000052569;ENST00000368498;ENST00000535237	T;T;T	0.17691	2.26;2.27;2.27	6.06	6.06	0.98353	PDZ/DHR/GLGF (1);	0.098800	0.64402	D	0.000002	T	0.27663	0.0680	L	0.50333	1.59	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.993	P;P;P	0.59221	0.846;0.854;0.747	T	0.00494	-1.1706	10	0.72032	D	0.01	-13.5307	20.6208	0.99490	0.0:1.0:0.0:0.0	.	253;261;261	Q9HD26-2;Q9HD26;F5H1Y4	.;GOPC_HUMAN;.	Y	253;261;261	ENSP00000052569:D253Y;ENSP00000357484:D261Y;ENSP00000445690:D261Y	ENSP00000052569:D253Y	D	-	1	0	GOPC	118001358	1.000000	0.71417	0.995000	0.50966	0.986000	0.74619	6.089000	0.71384	2.882000	0.98803	0.655000	0.94253	GAC	.	.	none		0.448	GOPC-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041988.1	NM_020399	
ACTB	60	hgsc.bcm.edu	37	7	5569295	5569295	+	Splice_Site	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:5569295C>T	ENST00000331789.5	-	2	186		c.e2-1		ACTB_ENST00000464611.1_5'Flank|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta						adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		CCATGGTGAGCTGCGAGAATA	0.736																																					.		Atlas-SNP	.											.	ACTB	45	.	0			.						PASS	.						18.0	21.0	20.0					7																	5569295		2183	4243	6426	SO:0001630	splice_region_variant	60	.			GGTGAGCTGCGAG	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.6-1G>A	7.37:g.5569295C>T		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	49	11	0.22449	.	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Splice_Site	SNP	ENST00000331789.5	37	CCDS5341.1	.	.	.	.	.	.	.	.	.	.	C	6.081	0.383180	0.11524	.	.	ENSG00000075624	ENST00000417101	.	.	.	4.48	2.54	0.30619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.9851	0.35988	0.1665:0.6725:0.161:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ACTB	5535821	1.000000	0.71417	0.114000	0.21550	0.022000	0.10575	3.194000	0.51005	0.853000	0.35312	0.557000	0.71058	.	.	.	none		0.736	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059589.4	NM_001101	Intron
OR13C9	286362	hgsc.bcm.edu	37	9	107380179	107380179	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:107380179G>A	ENST00000259362.1	-	1	306	c.307C>T	c.(307-309)Ctt>Ttt	p.L103F		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						GCCAAGCCAAGGAACATCTGC	0.502																																					p.L103F		Atlas-SNP	.											.	OR13C9	42	.	0			c.C307T						PASS	.						118.0	136.0	130.0					9																	107380179		2203	4300	6503	SO:0001583	missense	286362	exon1			AGCCAAGGAACAT		CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.307C>T	9.37:g.107380179G>A	ENSP00000259362:p.Leu103Phe	Somatic	319	0	0		WXS	Illumina HiSeq	Phase_I	361	168	0.465374	NM_001001956	Q6IFL2	Missense_Mutation	SNP	ENST00000259362.1	37	CCDS35093.1	.	.	.	.	.	.	.	.	.	.	G	6.495	0.459517	0.12342	.	.	ENSG00000136839	ENST00000259362	T	0.00307	8.17	4.64	1.65	0.23941	GPCR, rhodopsin-like superfamily (1);	0.338611	0.21256	N	0.077542	T	0.00073	0.0002	N	0.03967	-0.31	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.12837	-1.0532	10	0.25106	T	0.35	.	4.164	0.10298	0.1843:0.0:0.5256:0.2901	.	103	Q8NGT0	O13C9_HUMAN	F	103	ENSP00000259362:L103F	ENSP00000259362:L103F	L	-	1	0	OR13C9	106420000	0.000000	0.05858	0.964000	0.40570	0.797000	0.45037	0.461000	0.21940	0.575000	0.29434	0.637000	0.83480	CTT	.	.	none		0.502	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053490.1		
SETD1A	9739	hgsc.bcm.edu	37	16	30976634	30976634	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:30976634G>C	ENST00000262519.8	+	7	2257	c.1571G>C	c.(1570-1572)aGa>aCa	p.R524T		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	524	Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CTTGGGGCCAGAGATACAGGG	0.602																																					p.R524T		Atlas-SNP	.											.	SETD1A	143	.	0			c.G1571C						PASS	.						58.0	62.0	61.0					16																	30976634		2197	4300	6497	SO:0001583	missense	9739	exon7			GGGCCAGAGATAC	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.1571G>C	16.37:g.30976634G>C	ENSP00000262519:p.Arg524Thr	Somatic	68	0	0		WXS	Illumina HiSeq	Phase_I	64	27	0.421875	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	37	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	G	7.516	0.655738	0.14580	.	.	ENSG00000099381	ENST00000262519	D	0.94457	-3.43	5.69	4.73	0.59995	.	0.299822	0.30060	N	0.010511	D	0.88005	0.6321	L	0.29908	0.895	0.31246	N	0.694563	P	0.35433	0.501	B	0.22386	0.039	D	0.87028	0.2133	10	0.32370	T	0.25	.	12.9443	0.58364	0.081:0.0:0.919:0.0	.	524	O15047	SET1A_HUMAN	T	524	ENSP00000262519:R524T	ENSP00000262519:R524T	R	+	2	0	SETD1A	30884135	1.000000	0.71417	0.974000	0.42286	0.082000	0.17680	3.760000	0.55235	2.681000	0.91329	0.561000	0.74099	AGA	.	.	none		0.602	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
PRB2	653247	hgsc.bcm.edu	37	12	11546314	11546314	+	Missense_Mutation	SNP	T	T	C	rs34305575	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:11546314T>C	ENST00000389362.4	-	3	733	c.698A>G	c.(697-699)cAa>cGa	p.Q233R	PRB1_ENST00000546254.1_Intron|PRB2_ENST00000545829.1_5'Flank	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	233	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].		Q -> R (in dbSNP:rs34305575).			extracellular region (GO:0005576)		p.Q233R(1)|p.Q212R(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TCGGGCACTTTGGGACTTGTT	0.602													t|||	1065	0.21266	0.525	0.1513	5008	,	,		19415	0.0942		0.0298	False		,,,				2504	0.1442				p.Q233R		Atlas-SNP	.											PRB2_ENST00000389362,NS,carcinoma,0,2	PRB2	168	2	2	Substitution - Missense(2)	prostate(2)	c.A698G						scavenged	.	C	ARG/GLN	2053,2353		493,1067,643	246.0	269.0	261.0		698	-1.2	0.0	12	dbSNP_126	261	255,8339		12,231,4054	no	missense	PRB2	NM_006248.3	43	505,1298,4697	CC,CT,TT		2.9672,46.5956,17.7538	benign	233/417	11546314	2308,10692	2203	4297	6500	SO:0001583	missense	653247	exon3			GCACTTTGGGACT	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.698A>G	12.37:g.11546314T>C	ENSP00000374013:p.Gln233Arg	Somatic	921	10	0.0108578		WXS	Illumina HiSeq	Phase_I	935	22	0.0235294	NM_006248	O00599|P02811|P04281	Missense_Mutation	SNP	ENST00000389362.4	37	CCDS41757.2	336	0.15384615384615385	207	0.42073170731707316	55	0.15193370165745856	57	0.09965034965034965	17	0.022427440633245383	.	1.619	-0.522010	0.04171	0.465956	0.029672	ENSG00000121335	ENST00000389362	T	0.04083	3.71	1.17	-1.25	0.09405	.	.	.	.	.	T	0.00012	0.0000	L	0.40543	1.245	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41179	-0.9523	8	0.14252	T	0.57	.	5.1581	0.15046	0.0:0.2047:0.0:0.7953	rs34305575	233	P02812	PRB2_HUMAN	R	233	ENSP00000374013:Q233R	ENSP00000374013:Q233R	Q	-	2	0	PRB2	11437581	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-2.671000	0.00843	-0.886000	0.03966	-1.635000	0.00777	CAA	T|0.891;C|0.109	0.109	strong		0.602	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
STRIP2	57464	hgsc.bcm.edu	37	7	129104487	129104487	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:129104487G>A	ENST00000249344.2	+	16	1724	c.1684G>A	c.(1684-1686)Gat>Aat	p.D562N	STRIP2_ENST00000435494.2_Missense_Mutation_p.D562N	NM_020704.2	NP_065755.1	Q9ULQ0	STRP2_HUMAN	striatin interacting protein 2	562					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)											GCTGGGCATCGATGTGAACAG	0.483																																					p.D562N		Atlas-SNP	.											.	.	.	.	0			c.G1684A						PASS	.						155.0	145.0	149.0					7																	129104487		2203	4300	6503	SO:0001583	missense	57464	exon16			GGCATCGATGTGA	AB032996	CCDS34752.1, CCDS47709.1	7q32.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000128578	ENSG00000128578			22209	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog B (yeast)"""		"""family with sequence similarity 40, member B"""	FAM40B		22782902, 22298706, 18782753	Standard	NM_020704		Approved	KIAA1170, FAR11B	uc011koy.2	Q9ULQ0	OTTHUMG00000157695	ENST00000249344.2:c.1684G>A	7.37:g.129104487G>A	ENSP00000249344:p.Asp562Asn	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	93	27	0.290323	NM_020704	Q8WUZ4	Missense_Mutation	SNP	ENST00000249344.2	37	CCDS34752.1	.	.	.	.	.	.	.	.	.	.	G	36	5.625599	0.96671	.	.	ENSG00000128578	ENST00000249344;ENST00000435494	T;T	0.68331	-0.32;-0.32	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.86543	0.5958	M	0.92738	3.34	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.996;1.0	D	0.89283	0.3613	10	0.87932	D	0	-20.2128	18.6487	0.91421	0.0:0.0:1.0:0.0	.	562;562	Q9ULQ0;Q9ULQ0-2	FA40B_HUMAN;.	N	562	ENSP00000249344:D562N;ENSP00000392393:D562N	ENSP00000249344:D562N	D	+	1	0	FAM40B	128891723	1.000000	0.71417	0.972000	0.41901	0.994000	0.84299	9.869000	0.99810	2.736000	0.93811	0.655000	0.94253	GAT	.	.	none		0.483	STRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349418.1	NM_001134336	
ATP6V0A1	535	hgsc.bcm.edu	37	17	40666448	40666448	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:40666448C>T	ENST00000343619.4	+	21	2513	c.2390C>T	c.(2389-2391)tCg>tTg	p.S797L	ATP6V0A1_ENST00000537728.1_Missense_Mutation_p.S748L|ATP6V0A1_ENST00000393829.2_Missense_Mutation_p.S791L|ATP6V0A1_ENST00000585525.1_Missense_Mutation_p.S754L|ATP6V0A1_ENST00000264649.6_Missense_Mutation_p.S798L|MIR5010_ENST00000582846.1_RNA|ATP6V0A1_ENST00000546249.1_Missense_Mutation_p.S797L|ATP6V0A1_ENST00000544137.1_Missense_Mutation_p.S443L|RP11-400F19.18_ENST00000591237.1_RNA	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	797					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		GAGGGCCTCTCGGCCTTTCTC	0.612																																					p.S798L		Atlas-SNP	.											.	ATP6V0A1	67	.	0			c.C2393T						PASS	.						143.0	121.0	128.0					17																	40666448		2203	4300	6503	SO:0001583	missense	535	exon20			GCCTCTCGGCCTT	U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.2390C>T	17.37:g.40666448C>T	ENSP00000342951:p.Ser797Leu	Somatic	170	0	0		WXS	Illumina HiSeq	Phase_I	80	11	0.1375	NM_001130020	B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	ENST00000343619.4	37	CCDS45684.1	.	.	.	.	.	.	.	.	.	.	C	34	5.303011	0.95601	.	.	ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000264649;ENST00000537728;ENST00000544137	D;D;D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72;-2.72;-2.72	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	D	0.97275	0.9109	H	0.97829	4.085	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;0.999;0.998;0.999;1.0	D	0.99013	1.0815	10	0.87932	D	0	-9.722	17.5259	0.87800	0.0:1.0:0.0:0.0	.	748;754;798;797;791	B7Z641;B7Z2A9;B7Z3B7;Q93050;Q93050-1	.;.;.;VPP1_HUMAN;.	L	797;797;791;798;748;443	ENSP00000342951:S797L;ENSP00000444676:S797L;ENSP00000377415:S791L;ENSP00000264649:S798L;ENSP00000443991:S748L;ENSP00000446377:S443L	ENSP00000264649:S798L	S	+	2	0	ATP6V0A1	37919974	1.000000	0.71417	0.953000	0.39169	0.939000	0.58152	7.643000	0.83403	2.390000	0.81377	0.561000	0.74099	TCG	.	.	none		0.612	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450364.1	NM_001130020	
ABHD17B	51104	hgsc.bcm.edu	37	9	74489813	74489813	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:74489813C>G	ENST00000333421.6	-	2	295	c.184G>C	c.(184-186)Gaa>Caa	p.E62Q	ABHD17B_ENST00000377041.2_Missense_Mutation_p.E62Q	NM_001025780.1	NP_001020951.1	Q5VST6	AB17B_HUMAN	abhydrolase domain containing 17B	62						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										GCATCTTTTTCTCTAGAAGAA	0.413																																					p.E62Q		Atlas-SNP	.											.	FAM108B1	24	.	0			c.G184C						PASS	.						154.0	142.0	146.0					9																	74489813		2203	4300	6503	SO:0001583	missense	51104	exon2			CTTTTTCTCTAGA	AF151825	CCDS35042.1, CCDS35043.1	9q21.2	2013-03-15	2013-03-15	2013-03-15	ENSG00000107362	ENSG00000107362		"""Abhydrolase domain containing"""	24278	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 77"", ""family with sequence similarity 108, member B1"""	C9orf77, FAM108B1		10810093	Standard	XM_006717134		Approved	CGI-67	uc004ail.3	Q5VST6	OTTHUMG00000020001	ENST00000333421.6:c.184G>C	9.37:g.74489813C>G	ENSP00000330222:p.Glu62Gln	Somatic	175	0	0		WXS	Illumina HiSeq	Phase_I	222	45	0.202703	NM_016014	A8KAJ5|Q5VST7|Q86YB6|Q8IY03|Q9Y377	Missense_Mutation	SNP	ENST00000333421.6	37	CCDS35043.1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.612627	0.66672	.	.	ENSG00000107362	ENST00000377041;ENST00000333421	T;T	0.43294	0.95;0.95	6.17	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.64305	0.2586	M	0.77103	2.36	0.80722	D	1	B;D	0.55800	0.312;0.973	B;P	0.61275	0.175;0.886	T	0.67515	-0.5651	10	0.48119	T	0.1	6.6998	17.7372	0.88397	0.0:0.8776:0.1223:0.0	.	62;62	Q5VST6;Q5VST6-2	F108B_HUMAN;.	Q	62	ENSP00000366240:E62Q;ENSP00000330222:E62Q	ENSP00000330222:E62Q	E	-	1	0	FAM108B1	73679633	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.959000	0.70339	1.611000	0.50210	0.655000	0.94253	GAA	.	.	none		0.413	ABHD17B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052625.1	NM_016014	
RAB22A	57403	hgsc.bcm.edu	37	20	56929269	56929269	+	Silent	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:56929269A>G	ENST00000244040.3	+	6	716	c.435A>G	c.(433-435)gtA>gtG	p.V145V		NM_020673.2	NP_065724.1	Q9UL26	RB22A_HUMAN	RAB22A, member RAS oncogene family	145					endocytosis (GO:0006897)|endosome organization (GO:0007032)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(1)|large_intestine(2)|pancreas(1)	6	all_epithelial(3;5.09e-14)|Lung NSC(12;0.000122)|all_lung(29;0.00042)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;4.73e-08)|all cancers(14;4.83e-07)			CAATTTTTGTAGAGACCAGCG	0.393																																					p.V145V		Atlas-SNP	.											.	RAB22A	15	.	0			c.A435G						PASS	.						93.0	92.0	93.0					20																	56929269		2203	4300	6503	SO:0001819	synonymous_variant	57403	exon6			TTTTGTAGAGACC	AF091034	CCDS33497.1	20q13	2008-07-03			ENSG00000124209	ENSG00000124209		"""RAB, member RAS oncogene"""	9764	protein-coding gene	gene with protein product		612966					Standard	NM_020673		Approved		uc002xyz.3	Q9UL26	OTTHUMG00000032844	ENST00000244040.3:c.435A>G	20.37:g.56929269A>G		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	73	14	0.191781	NM_020673	B3KR86|E1P605|Q8TF12|Q9H4E6	Silent	SNP	ENST00000244040.3	37	CCDS33497.1																																																																																			.	.	none		0.393	RAB22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079880.2		
GH1	2688	hgsc.bcm.edu	37	17	61995272	61995272	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:61995272G>A	ENST00000323322.5	-	4	346	c.304C>T	c.(304-306)Ctc>Ttc	p.L102F	GH1_ENST00000342364.4_Intron|GH1_ENST00000458650.2_Missense_Mutation_p.L87F|CSHL1_ENST00000392824.4_Intron|GH1_ENST00000351388.4_Missense_Mutation_p.L62F	NM_000515.3	NP_000506.2	P01241	SOMA_HUMAN	growth hormone 1	102					bone maturation (GO:0070977)|glucose transport (GO:0015758)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|growth hormone receptor binding (GO:0005131)|metal ion binding (GO:0046872)|prolactin receptor binding (GO:0005148)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	19						GAGATGCGGAGCAGCTCTAGG	0.642																																					p.L102F		Atlas-SNP	.											.	GH1	39	.	0			c.C304T						PASS	.						71.0	73.0	72.0					17																	61995272		2203	4300	6503	SO:0001583	missense	2688	exon4			TGCGGAGCAGCTC	M13438	CCDS11653.1, CCDS11654.1, CCDS45760.1	17q22-q24	2014-01-30				ENSG00000259384		"""Endogenous ligands"""	4261	protein-coding gene	gene with protein product	"""pituitary growth hormone"", ""somatotropin"""	139250				6306568	Standard	XM_005257218		Approved	GH-N, GHN, GH, hGH-N	uc002jdj.3	P01241		ENST00000323322.5:c.304C>T	17.37:g.61995272G>A	ENSP00000312673:p.Leu102Phe	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	75	20	0.266667	NM_000515	A6NEF6|Q14405|Q16631|Q5EB53|Q9HBZ1|Q9UMJ7|Q9UNL5	Missense_Mutation	SNP	ENST00000323322.5	37	CCDS11653.1	.	.	.	.	.	.	.	.	.	.	g	13.50	2.255074	0.39896	.	.	ENSG00000204414	ENST00000323322;ENST00000458650;ENST00000351388	D;D;D	0.92752	-3.1;-3.1;-3.1	2.86	2.86	0.33363	Somatotropin hormone, conserved site (1);Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.000000	0.64402	D	0.000001	D	0.96466	0.8847	H	0.95850	3.73	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;1.0;1.0	D	0.95291	0.8395	10	0.87932	D	0	.	5.8888	0.18896	0.151:0.0:0.849:0.0	.	102;62;102;87	C9JYZ1;A6NEF6;P01241;B1A4G7	.;.;SOMA_HUMAN;.	F	102;87;62	ENSP00000312673:L102F;ENSP00000408486:L87F;ENSP00000343791:L62F	ENSP00000312673:L102F	L	-	1	0	GH1	59349004	1.000000	0.71417	0.991000	0.47740	0.430000	0.31655	4.851000	0.62896	1.594000	0.50039	0.298000	0.19748	CTC	.	.	none		0.642	GH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417708.1	NM_000515	
DVL1	1855	hgsc.bcm.edu	37	1	1273785	1273785	+	Silent	SNP	G	G	A	rs151161721		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:1273785G>A	ENST00000378888.5	-	13	1655	c.1371C>T	c.(1369-1371)caC>caT	p.H457H	DVL1_ENST00000378891.5_Silent_p.H432H			O14640	DVL1_HUMAN	dishevelled segment polarity protein 1	457	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|collateral sprouting (GO:0048668)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|cytoplasmic microtubule organization (GO:0031122)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|neural tube development (GO:0021915)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prepulse inhibition (GO:0060134)|protein localization to microtubule (GO:0035372)|protein localization to nucleus (GO:0034504)|receptor clustering (GO:0043113)|regulation of neurotransmitter levels (GO:0001505)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|social behavior (GO:0035176)|synapse organization (GO:0050808)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	axon (GO:0030424)|cell cortex (GO:0005938)|clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|growth cone (GO:0030426)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	enzyme binding (GO:0019899)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|Rac GTPase binding (GO:0048365)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		AGCCCTCCACGTGTGTGTACA	0.682																																					p.H432H		Atlas-SNP	.											.	DVL1	36	.	0			c.C1296T						PASS	.	G		0,4404		0,0,2202	35.0	34.0	34.0		1296	-1.9	0.9	1	dbSNP_134	34	2,8586	2.2+/-6.3	0,2,4292	no	coding-synonymous	DVL1	NM_004421.2		0,2,6494	AA,AG,GG		0.0233,0.0,0.0154		432/671	1273785	2,12990	2202	4294	6496	SO:0001819	synonymous_variant	1855	exon13			CTCCACGTGTGTG	AF006011	CCDS22.1	1p36	2013-05-22	2013-05-22		ENSG00000107404	ENSG00000107404		"""Dishevelled homologs"""	3084	protein-coding gene	gene with protein product		601365	"""dishevelled 1 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 1 (Drosophila)"""			8817329	Standard	NM_004421		Approved		uc001aer.4	O14640	OTTHUMG00000003069	ENST00000378888.5:c.1371C>T	1.37:g.1273785G>A		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	64	21	0.328125	NM_004421	Q5TA33|Q5TA35	Silent	SNP	ENST00000378888.5	37																																																																																				G|1.000;A|0.000	0.000	weak		0.682	DVL1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000008490.1	NM_004421	
BACH2	60468	hgsc.bcm.edu	37	6	90660815	90660815	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:90660815G>A	ENST00000257749.4	-	7	1717	c.1010C>T	c.(1009-1011)tCg>tTg	p.S337L	BACH2_ENST00000343122.3_Missense_Mutation_p.S337L|RP3-512E2.2_ENST00000413986.1_RNA|BACH2_ENST00000537989.1_Missense_Mutation_p.S337L|RP3-512E2.2_ENST00000445838.1_RNA	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	337						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		GCAGGAGGGCGAGGCCACGCT	0.642																																					p.S337L		Atlas-SNP	.											.	BACH2	224	.	0			c.C1010T						PASS	.						40.0	44.0	43.0					6																	90660815		2203	4299	6502	SO:0001583	missense	60468	exon5			GAGGGCGAGGCCA	AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.1010C>T	6.37:g.90660815G>A	ENSP00000257749:p.Ser337Leu	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	77	21	0.272727	NM_001170794	E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	SNP	ENST00000257749.4	37	CCDS5026.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870621	0.72065	.	.	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	T;T;T	0.55930	0.49;0.49;0.49	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.56366	0.1980	L	0.27053	0.805	0.51233	D	0.999915	D	0.89917	1.0	D	0.80764	0.994	T	0.62343	-0.6874	10	0.87932	D	0	-0.1721	19.5375	0.95260	0.0:0.0:1.0:0.0	.	337	Q9BYV9	BACH2_HUMAN	L	337	ENSP00000257749:S337L;ENSP00000437473:S337L;ENSP00000345642:S337L	ENSP00000257749:S337L	S	-	2	0	BACH2	90717536	1.000000	0.71417	0.921000	0.36526	0.606000	0.37113	9.230000	0.95299	2.620000	0.88729	0.655000	0.94253	TCG	.	.	none		0.642	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
RPS6KA5	9252	hgsc.bcm.edu	37	14	91367011	91367011	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr14:91367011G>A	ENST00000261991.3	-	10	1362	c.1189C>T	c.(1189-1191)Cac>Tac	p.H397Y	RPS6KA5_ENST00000536315.2_Missense_Mutation_p.H318Y|RPS6KA5_ENST00000418736.2_Missense_Mutation_p.H397Y	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	397					axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		ACTCCCATGTGAAACTGAAGA	0.388																																					p.H397Y		Atlas-SNP	.											.	RPS6KA5	135	.	0			c.C1189T						PASS	.						80.0	75.0	77.0					14																	91367011		2203	4300	6503	SO:0001583	missense	9252	exon10			CCATGTGAAACTG	AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.1189C>T	14.37:g.91367011G>A	ENSP00000261991:p.His397Tyr	Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	42	13	0.309524	NM_182398	O95316|Q96AF7	Missense_Mutation	SNP	ENST00000261991.3	37	CCDS9893.1	.	.	.	.	.	.	.	.	.	.	G	5.167	0.216402	0.09810	.	.	ENSG00000100784	ENST00000261991;ENST00000536315;ENST00000418736	T;T;T	0.23754	1.89;1.89;1.89	4.9	4.9	0.64082	.	0.160682	0.64402	D	0.000020	T	0.12902	0.0313	N	0.12182	0.205	0.34711	D	0.727707	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.0	T	0.20840	-1.0263	10	0.15066	T	0.55	.	9.8505	0.41055	0.1294:0.0:0.8706:0.0	.	397;397	O75582-2;O75582	.;KS6A5_HUMAN	Y	397;318;397	ENSP00000261991:H397Y;ENSP00000442803:H318Y;ENSP00000402787:H397Y	ENSP00000261991:H397Y	H	-	1	0	RPS6KA5	90436764	0.982000	0.34865	0.518000	0.27811	0.650000	0.38633	3.427000	0.52785	2.424000	0.82194	0.655000	0.94253	CAC	.	.	none		0.388	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411442.2	NM_004755	
CORO1A	11151	hgsc.bcm.edu	37	16	30199792	30199792	+	Silent	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:30199792C>G	ENST00000219150.5	+	10	1481	c.1176C>G	c.(1174-1176)ctC>ctG	p.L392L	CORO1A_ENST00000565497.1_Intron|CORO1A_ENST00000570045.1_Silent_p.L392L	NM_001193333.2|NM_007074.3	NP_001180262.1|NP_009005.1	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A	392					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|calcium ion transport (GO:0006816)|cell-substrate adhesion (GO:0031589)|cellular component movement (GO:0006928)|cellular response to interleukin-4 (GO:0071353)|homeostasis of number of cells within a tissue (GO:0048873)|innate immune response (GO:0045087)|leukocyte chemotaxis (GO:0030595)|negative regulation of actin nucleation (GO:0051126)|phagocytosis (GO:0006909)|phagolysosome assembly (GO:0001845)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of T cell proliferation (GO:0042102)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|T cell homeostasis (GO:0043029)|uropod organization (GO:0032796)	actin filament (GO:0005884)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|phosphatidylinositol 3-kinase binding (GO:0043548)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	9						TCATCTCCCTCAAGGATGGCT	0.697																																					p.L392L		Atlas-SNP	.											.	CORO1A	36	.	0			c.C1176G						PASS	.						32.0	36.0	34.0					16																	30199792		2197	4299	6496	SO:0001819	synonymous_variant	11151	exon10			CTCCCTCAAGGAT	X89109	CCDS10673.1	16p11.2	2014-09-17	2001-11-28		ENSG00000102879	ENSG00000102879		"""Coronins"", ""WD repeat domain containing"""	2252	protein-coding gene	gene with protein product	"""Clabp TACO"""	605000	"""coronin, actin-binding protein, 1A"""			9778037	Standard	NM_007074		Approved	HCORO1, p57, coronin-1	uc002dww.3	P31146	OTTHUMG00000132148	ENST00000219150.5:c.1176C>G	16.37:g.30199792C>G		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	80	32	0.4	NM_007074	B2RBL1|Q2YD73	Silent	SNP	ENST00000219150.5	37	CCDS10673.1																																																																																			.	.	none		0.697	CORO1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255195.2	NM_007074	
SEMA7A	8482	hgsc.bcm.edu	37	15	74708989	74708989	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:74708989A>T	ENST00000261918.4	-	7	1276	c.728T>A	c.(727-729)tTc>tAc	p.F243Y	SEMA7A_ENST00000543145.2_Missense_Mutation_p.F229Y|SEMA7A_ENST00000542748.1_Missense_Mutation_p.F78Y	NM_003612.3	NP_003603.1	O75326	SEM7A_HUMAN	semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group)	243	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|immune response (GO:0006955)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|olfactory lobe development (GO:0021988)|osteoblast differentiation (GO:0001649)|positive regulation of axon extension (GO:0045773)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of protein phosphorylation (GO:0001934)|regulation of inflammatory response (GO:0050727)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	30						CTCTCGGAAGAAGTAGTAGAT	0.577																																					p.F243Y		Atlas-SNP	.											.	SEMA7A	58	.	0			c.T728A						PASS	.						327.0	280.0	295.0					15																	74708989		2197	4296	6493	SO:0001583	missense	8482	exon7			CGGAAGAAGTAGT	AF069493	CCDS10262.1, CCDS53958.1, CCDS53959.1	15q22.3-q23	2014-07-18	2006-02-23		ENSG00000138623	ENSG00000138623		"""Semaphorins"", ""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10741	protein-coding gene	gene with protein product	"""John Milton Hagen blood group"", ""H-Sema K1"""	607961	"""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A"", ""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A (JMH blood group)"""	SEMAL		9721204	Standard	NM_003612		Approved	H-Sema-L, CD108	uc002axv.3	O75326	OTTHUMG00000139000	ENST00000261918.4:c.728T>A	15.37:g.74708989A>T	ENSP00000261918:p.Phe243Tyr	Somatic	176	0	0		WXS	Illumina HiSeq	Phase_I	163	44	0.269939	NM_003612	B4DDP7|F5H1S0|Q1XE81|Q1XE82|Q1XE83|Q1XE84|Q3MIY5	Missense_Mutation	SNP	ENST00000261918.4	37	CCDS10262.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.985194	0.93044	.	.	ENSG00000138623	ENST00000261918;ENST00000543145;ENST00000542748	T;T;T	0.36157	1.27;1.27;1.27	5.39	5.39	0.77823	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.65637	0.2710	M	0.89030	3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.73084	-0.4094	10	0.87932	D	0	-28.8004	13.6573	0.62346	1.0:0.0:0.0:0.0	.	229;243	F5H1S0;O75326	.;SEM7A_HUMAN	Y	243;229;78	ENSP00000261918:F243Y;ENSP00000438966:F229Y;ENSP00000441493:F78Y	ENSP00000261918:F243Y	F	-	2	0	SEMA7A	72496042	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.167000	0.77562	2.043000	0.60533	0.533000	0.62120	TTC	.	.	none		0.577	SEMA7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272904.3	NM_003612	
LRP2	4036	hgsc.bcm.edu	37	2	170101220	170101220	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:170101220G>A	ENST00000263816.3	-	22	3698	c.3413C>T	c.(3412-3414)tCt>tTt	p.S1138F	LRP2_ENST00000443831.1_Missense_Mutation_p.S1001F	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1138	LDL-receptor class A 10. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CTTTTCATCAGATCCATCCCC	0.453																																					p.S1138F		Atlas-SNP	.											.	LRP2	751	.	0			c.C3413T						PASS	.						158.0	147.0	151.0					2																	170101220		2203	4300	6503	SO:0001583	missense	4036	exon22			TCATCAGATCCAT		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.3413C>T	2.37:g.170101220G>A	ENSP00000263816:p.Ser1138Phe	Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	137	44	0.321168	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	31	5.062054	0.93846	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.97870	-4.58;-4.58	5.93	5.93	0.95920	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99318	0.9761	H	0.97707	4.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98640	1.0675	10	0.87932	D	0	.	20.3368	0.98748	0.0:0.0:1.0:0.0	.	1001;1138	E9PC35;P98164	.;LRP2_HUMAN	F	1138;1001	ENSP00000263816:S1138F;ENSP00000409813:S1001F	ENSP00000263816:S1138F	S	-	2	0	LRP2	169809466	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.793000	0.99091	2.805000	0.96524	0.655000	0.94253	TCT	.	.	none		0.453	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
PTPRO	5800	hgsc.bcm.edu	37	12	15677869	15677869	+	Silent	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:15677869T>C	ENST00000281171.4	+	11	2343	c.2013T>C	c.(2011-2013)gtT>gtC	p.V671V	PTPRO_ENST00000348962.2_Silent_p.V671V	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	671	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				GGATGGTGGTTGCAGAAGGAA	0.353																																					p.V671V		Atlas-SNP	.											.	PTPRO	148	.	0			c.T2013C						PASS	.						84.0	85.0	84.0					12																	15677869		2203	4300	6503	SO:0001819	synonymous_variant	5800	exon11			GGTGGTTGCAGAA	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.2013T>C	12.37:g.15677869T>C		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	83	32	0.385542	NM_002848	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Silent	SNP	ENST00000281171.4	37	CCDS8675.1																																																																																			.	.	none		0.353	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1		
MAP7D2	256714	hgsc.bcm.edu	37	X	20074801	20074801	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chrX:20074801C>T	ENST00000379651.3	-	4	499	c.481G>A	c.(481-483)Gat>Aat	p.D161N	MAP7D2_ENST00000379643.5_Missense_Mutation_p.D161N|MAP7D2_ENST00000452324.3_Missense_Mutation_p.D117N|MAP7D2_ENST00000543767.1_Missense_Mutation_p.D32N|MAP7D2_ENST00000443379.3_Missense_Mutation_p.D161N	NM_152780.3	NP_689993.2	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	161					microtubule cytoskeleton organization (GO:0000226)	microtubule (GO:0005874)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	37						CACTCACCATCATGTCCTCCG	0.587																																					p.D161N		Atlas-SNP	.											.	MAP7D2	165	.	0			c.G481A						PASS	.						115.0	74.0	88.0					X																	20074801		2203	4300	6503	SO:0001583	missense	256714	exon4			CACCATCATGTCC	BC089400	CCDS14195.1, CCDS55384.1, CCDS55385.1, CCDS55386.1	Xp22.12	2008-02-05			ENSG00000184368	ENSG00000184368			25899	protein-coding gene	gene with protein product						12477932	Standard	NM_152780		Approved	FLJ14503	uc010nfo.2	Q96T17	OTTHUMG00000021228	ENST00000379651.3:c.481G>A	X.37:g.20074801C>T	ENSP00000368972:p.Asp161Asn	Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	44	30	0.681818	NM_001168466	B7Z2J8|B7Z3S7|B9EGC7|C9JMA4|C9JYW0|Q5EBN1|Q5JPS7|Q6PIC7|Q8N792	Missense_Mutation	SNP	ENST00000379651.3	37	CCDS14195.1	.	.	.	.	.	.	.	.	.	.	C	13.63	2.295847	0.40594	.	.	ENSG00000184368	ENST00000379651;ENST00000379643;ENST00000543767;ENST00000443379;ENST00000452324;ENST00000330274	T;T;T;T;T	0.11930	2.73;2.73;2.73;2.73;2.73	5.03	5.03	0.67393	.	0.081663	0.49916	D	0.000125	T	0.16685	0.0401	L	0.32530	0.975	0.42193	D	0.991732	P;P;P;P;P;P	0.51351	0.906;0.835;0.944;0.734;0.906;0.9	B;P;P;P;B;P	0.47645	0.444;0.553;0.553;0.549;0.351;0.553	T	0.03025	-1.1081	10	0.29301	T	0.29	.	17.726	0.88365	0.0:1.0:0.0:0.0	.	161;117;161;161;161;32	B7Z3S7;C9JYW0;Q96T17-2;B5ME62;Q96T17;F5GYC2	.;.;.;.;MA7D2_HUMAN;.	N	161;161;32;161;117;161	ENSP00000368972:D161N;ENSP00000368964:D161N;ENSP00000440691:D32N;ENSP00000388239:D161N;ENSP00000413301:D117N	ENSP00000332677:D161N	D	-	1	0	MAP7D2	19984722	0.992000	0.36948	0.623000	0.29173	0.295000	0.27426	3.135000	0.50546	2.204000	0.70986	0.506000	0.49869	GAT	.	.	none		0.587	MAP7D2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056001.1	NM_152780	
SNTG1	54212	hgsc.bcm.edu	37	8	51705325	51705325	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:51705325A>T	ENST00000522124.1	+	19	2151	c.1490A>T	c.(1489-1491)aAt>aTt	p.N497I	SNTG1_ENST00000517473.1_Missense_Mutation_p.N460I|SNTG1_ENST00000518864.1_Missense_Mutation_p.N497I|SNTG1_ENST00000276467.5_Missense_Mutation_p.N460I	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	497					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TTTTTAGGCAATCAAGCTACT	0.418																																					p.N497I		Atlas-SNP	.											SNTG1_ENST00000518864,NS,carcinoma,-1,2	SNTG1	304	2	0			c.A1490T						scavenged	.						180.0	167.0	172.0					8																	51705325		2203	4300	6503	SO:0001583	missense	54212	exon19			TAGGCAATCAAGC	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.1490A>T	8.37:g.51705325A>T	ENSP00000429842:p.Asn497Ile	Somatic	306	1	0.00326797		WXS	Illumina HiSeq	Phase_I	366	6	0.0163934	NM_018967	Q2M3Q0|Q9NY98	Missense_Mutation	SNP	ENST00000522124.1	37	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	A	14.53	2.562069	0.45590	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.28895	1.59;1.59;2.26;2.26	5.56	-8.56	0.00904	.	0.246709	0.53938	D	0.000053	T	0.27384	0.0672	L	0.29908	0.895	0.27046	N	0.963887	P;B	0.39535	0.677;0.01	P;B	0.44518	0.452;0.026	T	0.35871	-0.9771	10	0.87932	D	0	-1.7108	23.2356	0.99981	0.1296:0.0:0.8704:0.0	.	460;497	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	I	497;497;460;460	ENSP00000429276:N497I;ENSP00000429842:N497I;ENSP00000431123:N460I;ENSP00000276467:N460I	ENSP00000276467:N460I	N	+	2	0	SNTG1	51867878	1.000000	0.71417	0.008000	0.14137	0.476000	0.33039	1.180000	0.32005	-1.754000	0.01321	-0.276000	0.10085	AAT	.	.	none		0.418	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1		
ADAMTS9	56999	hgsc.bcm.edu	37	3	64606792	64606792	+	Silent	SNP	C	C	T	rs373590492		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:64606792C>T	ENST00000498707.1	-	19	3153	c.2811G>A	c.(2809-2811)ctG>ctA	p.L937L	ADAMTS9_ENST00000295903.4_Silent_p.L909L	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	937					glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TGGCCCACCTCAGGTCACAGT	0.512																																					p.L937L		Atlas-SNP	.											.	ADAMTS9	206	.	0			c.G2811A						PASS	.	C		0,4406		0,0,2203	74.0	75.0	75.0		2811	-0.9	1.0	3		75	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ADAMTS9	NM_182920.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		937/1936	64606792	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	56999	exon19			CCACCTCAGGTCA	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.2811G>A	3.37:g.64606792C>T		Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	68	10	0.147059	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Silent	SNP	ENST00000498707.1	37	CCDS2903.1																																																																																			.	.	weak		0.512	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
PCDHA4	56144	hgsc.bcm.edu	37	5	140186916	140186916	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:140186916C>T	ENST00000530339.1	+	1	144	c.144C>T	c.(142-144)atC>atT	p.I48I	PCDHA4_ENST00000356878.4_Silent_p.I48I|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Silent_p.I48I|PCDHA2_ENST00000526136.1_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	48	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGGCCGCATCGCGCAGGACC	0.652																																					p.I48I		Atlas-SNP	.											.	PCDHA4	419	.	0			c.C144T						PASS	.						54.0	61.0	58.0					5																	140186916		2203	4300	6503	SO:0001819	synonymous_variant	56144	exon1			CCGCATCGCGCAG	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.144C>T	5.37:g.140186916C>T		Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	117	41	0.350427	NM_031500	O75285|Q2M253	Silent	SNP	ENST00000530339.1	37	CCDS54916.1																																																																																			.	.	none		0.652	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907	
LRRC30	339291	hgsc.bcm.edu	37	18	7231257	7231257	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr18:7231257C>T	ENST00000383467.2	+	1	135	c.121C>T	c.(121-123)Cgg>Tgg	p.R41W		NM_001105581.1	NP_001099051.1	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	41										central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						AAGGGACCCGCGGTCCCTGCT	0.617																																					p.R41W		Atlas-SNP	.											.	LRRC30	68	.	0			c.C121T						PASS	.						69.0	74.0	72.0					18																	7231257		1973	4153	6126	SO:0001583	missense	339291	exon1			GACCCGCGGTCCC		CCDS42409.1	18p11.23	2005-01-06				ENSG00000206422			30219	protein-coding gene	gene with protein product							Standard	NM_001105581		Approved		uc010wzk.2	A6NM36		ENST00000383467.2:c.121C>T	18.37:g.7231257C>T	ENSP00000372959:p.Arg41Trp	Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	39	10	0.25641	NM_001105581		Missense_Mutation	SNP	ENST00000383467.2	37	CCDS42409.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.678390	0.47886	.	.	ENSG00000206422	ENST00000383467	T	0.47528	0.84	5.65	0.876	0.19138	.	0.050447	0.64402	D	0.000001	T	0.50735	0.1633	L	0.29908	0.895	0.09310	N	1	D	0.76494	0.999	P	0.61722	0.893	T	0.52087	-0.8622	10	0.66056	D	0.02	.	13.9302	0.63991	0.7158:0.2841:0.0:0.0	.	41	A6NM36	LRC30_HUMAN	W	41	ENSP00000372959:R41W	ENSP00000372959:R41W	R	+	1	2	LRRC30	7221257	0.337000	0.24766	0.022000	0.16811	0.671000	0.39405	0.831000	0.27476	0.343000	0.23821	0.650000	0.86243	CGG	.	.	none		0.617	LRRC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442140.1	XM_292678	
AGFG1	3267	hgsc.bcm.edu	37	2	228401669	228401669	+	Silent	SNP	T	T	C	rs144069697	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:228401669T>C	ENST00000310078.8	+	10	1598	c.1338T>C	c.(1336-1338)tcT>tcC	p.S446S	AGFG1_ENST00000409315.1_Silent_p.S425S|AGFG1_ENST00000409171.1_Silent_p.S446S|AGFG1_ENST00000409979.2_Silent_p.S470S|AGFG1_ENST00000373671.3_Silent_p.S406S	NM_001135188.1|NM_001135189.1|NM_004504.4	NP_001128660.1|NP_001128661.1|NP_004495.2	P52594	AGFG1_HUMAN	ArfGAP with FG repeats 1	446					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of ARF GTPase activity (GO:0032312)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)	ARF GTPase activator activity (GO:0008060)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(2)|ovary(1)|prostate(1)|skin(4)|stomach(1)	18						CTGTGGCATCTTCTACAAACC	0.373																																					p.S470S		Atlas-SNP	.											.	AGFG1	80	.	0			c.T1410C						PASS	.						94.0	96.0	96.0					2																	228401669		2203	4300	6503	SO:0001819	synonymous_variant	3267	exon11			GGCATCTTCTACA		CCDS2467.1, CCDS46533.1, CCDS46534.1, CCDS46535.1	2q36	2009-11-30	2008-09-22	2008-09-22	ENSG00000173744	ENSG00000173744		"""ADP-ribosylation factor GTPase activating proteins"""	5175	protein-coding gene	gene with protein product		600862	"""HIV-1 Rev binding protein"""	HRB		7637788	Standard	NM_004504		Approved	RIP, RAB	uc002vpd.2	P52594	OTTHUMG00000133186	ENST00000310078.8:c.1338T>C	2.37:g.228401669T>C		Somatic	286	0	0		WXS	Illumina HiSeq	Phase_I	257	60	0.233463	NM_001135187	B3KUL1|E9PHX7|Q15277|Q4VAS0|Q4VAS1|Q4VAS3|Q53QT8|Q53R11	Silent	SNP	ENST00000310078.8	37	CCDS2467.1																																																																																			T|1.000;G|0.000	.	alt		0.373	AGFG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256895.2	NM_004504	
DNAH9	1770	hgsc.bcm.edu	37	17	11608409	11608409	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:11608409A>C	ENST00000262442.4	+	26	5527	c.5459A>C	c.(5458-5460)cAc>cCc	p.H1820P	DNAH9_ENST00000454412.2_Missense_Mutation_p.H1820P	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1820	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GAGGTCAAACACTGCTTTGCC	0.502																																					p.H1820P		Atlas-SNP	.											.	DNAH9	695	.	0			c.A5459C						PASS	.						222.0	171.0	188.0					17																	11608409		2203	4300	6503	SO:0001583	missense	1770	exon26			TCAAACACTGCTT	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.5459A>C	17.37:g.11608409A>C	ENSP00000262442:p.His1820Pro	Somatic	246	0	0		WXS	Illumina HiSeq	Phase_I	172	45	0.261628	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.413784	0.83449	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.26373	1.78;1.74	5.73	5.73	0.89815	.	0.817102	0.11759	N	0.532278	T	0.58264	0.2110	M	0.89840	3.065	0.80722	D	1	D	0.59357	0.985	P	0.61070	0.883	T	0.61584	-0.7033	10	0.59425	D	0.04	.	16.0174	0.80450	1.0:0.0:0.0:0.0	.	1820	Q9NYC9	DYH9_HUMAN	P	1820;1820;402	ENSP00000262442:H1820P;ENSP00000414874:H1820P	ENSP00000262442:H1820P	H	+	2	0	DNAH9	11549134	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.287000	0.95975	2.186000	0.69663	0.533000	0.62120	CAC	.	.	none		0.502	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
GGPS1	9453	hgsc.bcm.edu	37	1	235505867	235505867	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:235505867C>G	ENST00000282841.5	+	4	915	c.683C>G	c.(682-684)aCc>aGc	p.T228S	GGPS1_ENST00000391855.2_Missense_Mutation_p.T174S|GGPS1_ENST00000476121.1_Missense_Mutation_p.T228S|GGPS1_ENST00000358966.2_Missense_Mutation_p.T228S|GGPS1_ENST00000488594.1_Missense_Mutation_p.T228S			O95749	GGPPS_HUMAN	geranylgeranyl diphosphate synthase 1	228					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|geranylgeranyl diphosphate biosynthetic process (GO:0033386)|isoprenoid metabolic process (GO:0006720)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	dimethylallyltranstransferase activity (GO:0004161)|farnesyltranstransferase activity (GO:0004311)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	8	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;1.39e-05)		Zoledronate(DB00399)	CCTGAAAGCACCCAGGTGCAG	0.363																																					p.T228S		Atlas-SNP	.											.	GGPS1	23	.	0			c.C683G						PASS	.						70.0	74.0	73.0					1																	235505867		2203	4300	6503	SO:0001583	missense	9453	exon4			AAAGCACCCAGGT	AB016043	CCDS1604.1	1q43	2010-04-27			ENSG00000152904	ENSG00000152904	2.5.1.1, 2.5.1.10, 2.5.1.29		4249	protein-coding gene	gene with protein product		606982				9741684, 10101267	Standard	NR_036605		Approved	GGPPS1	uc001hwv.3	O95749	OTTHUMG00000037963	ENST00000282841.5:c.683C>G	1.37:g.235505867C>G	ENSP00000282841:p.Thr228Ser	Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	106	34	0.320755	NM_001037277	A8MVQ8|Q5T2C8|Q6NW19	Missense_Mutation	SNP	ENST00000282841.5	37	CCDS1604.1	.	.	.	.	.	.	.	.	.	.	C	9.734	1.163108	0.21538	.	.	ENSG00000152904	ENST00000488594;ENST00000471812;ENST00000358966;ENST00000282841;ENST00000391855;ENST00000476121;ENST00000497327	T;T;T;T;T;T;T	0.76316	0.06;0.02;0.06;0.06;0.06;0.06;-1.01	6.17	6.17	0.99709	Terpenoid synthase (2);	0.000000	0.85682	D	0.000000	T	0.65238	0.2672	N	0.16098	0.37	0.80722	D	1	B	0.18741	0.03	B	0.23275	0.045	T	0.60591	-0.7233	10	0.09084	T	0.74	-11.438	20.8794	0.99867	0.0:1.0:0.0:0.0	.	228	O95749	GGPPS_HUMAN	S	228;228;228;228;174;228;228	ENSP00000418690:T228S;ENSP00000417772:T228S;ENSP00000351852:T228S;ENSP00000282841:T228S;ENSP00000375728:T174S;ENSP00000420183:T228S;ENSP00000417865:T228S	ENSP00000282841:T228S	T	+	2	0	GGPS1	233572490	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.932000	0.63476	2.941000	0.99782	0.655000	0.94253	ACC	.	.	none		0.363	GGPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092656.1	NM_004837	
AIM1	202	hgsc.bcm.edu	37	6	106968516	106968516	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:106968516G>A	ENST00000369066.3	+	2	2696	c.2209G>A	c.(2209-2211)Gaa>Aaa	p.E737K		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TCCTATTCACGAAGACCATTT	0.433																																					p.E737K		Atlas-SNP	.											.	AIM1	161	.	0			c.G2209A						PASS	.						62.0	66.0	64.0					6																	106968516		2203	4300	6503	SO:0001583	missense	202	exon2			ATTCACGAAGACC	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.2209G>A	6.37:g.106968516G>A	ENSP00000358062:p.Glu737Lys	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	81	17	0.209877	NM_001624	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970040	0.92855	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	D	0.83992	-1.79	6.16	6.16	0.99307	.	0.329901	0.30374	N	0.009768	D	0.91002	0.7170	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.90292	0.4323	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	737	Q9Y4K1	AIM1_HUMAN	K	1145;737	ENSP00000358062:E737K	ENSP00000285105:E1145K	E	+	1	0	AIM1	107075209	1.000000	0.71417	0.992000	0.48379	0.704000	0.40688	7.927000	0.87577	2.937000	0.99478	0.650000	0.86243	GAA	.	.	none		0.433	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
ATRIP	84126	hgsc.bcm.edu	37	3	48501189	48501189	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:48501189C>T	ENST00000320211.3	+	7	1042	c.929C>T	c.(928-930)tCc>tTc	p.S310F	ATRIP_ENST00000412052.1_Missense_Mutation_p.S217F|ATRIP_ENST00000346691.4_Missense_Mutation_p.S310F|ATRIP_ENST00000357105.6_Missense_Mutation_p.S183F	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	310					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TCTGCAGGTTCCATTTTGATA	0.483								Other conserved DNA damage response genes																													p.S310F		Atlas-SNP	.											ATRIP,upper_leg,malignant_melanoma,0,1	ATRIP	41	1	0			c.C929T						PASS	.						129.0	139.0	136.0					3																	48501189		2203	4300	6503	SO:0001583	missense	84126	exon7			CAGGTTCCATTTT	AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.929C>T	3.37:g.48501189C>T	ENSP00000323099:p.Ser310Phe	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	67	24	0.358209	NM_130384	A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Missense_Mutation	SNP	ENST00000320211.3	37	CCDS2768.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466426	0.63625	.	.	ENSG00000164053	ENST00000320211;ENST00000346691;ENST00000357105;ENST00000412052	T;T;T;T	0.54866	1.12;1.09;0.55;1.12	5.75	5.75	0.90469	.	0.221381	0.48286	D	0.000200	T	0.71779	0.3380	M	0.70275	2.135	0.47819	D	0.999525	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.73959	-0.3818	10	0.87932	D	0	-17.7002	15.4526	0.75285	0.0:1.0:0.0:0.0	.	310;310	Q8WXE1-2;Q8WXE1	.;ATRIP_HUMAN	F	310;310;183;217	ENSP00000323099:S310F;ENSP00000302338:S310F;ENSP00000349620:S183F;ENSP00000400930:S217F	ENSP00000323099:S310F	S	+	2	0	ATRIP	48476193	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	2.600000	0.46240	2.719000	0.93026	0.655000	0.94253	TCC	.	.	none		0.483	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2	NM_130384	
PLXNC1	10154	hgsc.bcm.edu	37	12	94702622	94702622	+	IGR	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:94702622T>C	ENST00000258526.4	+	0	7346				CCDC41_ENST00000339839.5_Silent_p.K691K|CCDC41_ENST00000397809.5_Silent_p.K691K	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)	p.K691K(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CCTCTAGTTGTTTTCTTTGTG	0.388																																					p.K691K		Atlas-SNP	.											CCDC41,NS,carcinoma,0,1	CCDC41	59	1	1	Substitution - coding silent(1)	kidney(1)	c.A2073G						PASS	.						218.0	195.0	202.0					12																	94702622		1864	4101	5965	SO:0001628	intergenic_variant	51134	exon17			TAGTTGTTTTCTT	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235		12.37:g.94702622T>C		Somatic	349	0	0		WXS	Illumina HiSeq	Phase_I	370	49	0.132432	NM_016122	Q59H25	Silent	SNP	ENST00000258526.4	37	CCDS9049.1																																																																																			.	.	none		0.388	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2		
C6orf62	81688	hgsc.bcm.edu	37	6	24718818	24718818	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:24718818C>T	ENST00000378119.4	-	1	2246	c.79G>A	c.(79-81)Gct>Act	p.A27T	C6orf62_ENST00000540769.1_Intron|C6orf62_ENST00000378102.3_Intron	NM_030939.4	NP_112201.1	Q9GZU0	CF062_HUMAN	chromosome 6 open reading frame 62	27						intracellular (GO:0005622)				endometrium(2)|kidney(3)|large_intestine(2)|lung(3)	10						AACTGGTCAGCTAGAGATTCT	0.373																																					p.A27T		Atlas-SNP	.											.	C6orf62	18	.	0			c.G79A						PASS	.						95.0	95.0	95.0					6																	24718818		2203	4300	6503	SO:0001583	missense	81688	exon1			GGTCAGCTAGAGA	AL136632	CCDS4559.1	6p22.1	2011-12-13			ENSG00000112308	ENSG00000112308			20998	protein-coding gene	gene with protein product	"""HBV X-transactivated protein 12"""					11230166	Standard	NM_030939		Approved	FLJ12619, DKFZP564G182, XTP12	uc003nel.3	Q9GZU0	OTTHUMG00000014361	ENST00000378119.4:c.79G>A	6.37:g.24718818C>T	ENSP00000367359:p.Ala27Thr	Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	165	17	0.10303	NM_030939	Q3LIB6|Q5JVZ2|Q5JVZ3|Q6IA63|Q9H1Z2	Missense_Mutation	SNP	ENST00000378119.4	37	CCDS4559.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.037187	0.93630	.	.	ENSG00000112308	ENST00000378119	T	0.39592	1.07	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.23572	0.0570	N	0.24115	0.695	0.80722	D	1	P	0.40731	0.728	B	0.37888	0.26	T	0.13229	-1.0517	10	0.87932	D	0	-10.7654	19.8215	0.96599	0.0:1.0:0.0:0.0	.	27	Q9GZU0	CF062_HUMAN	T	27	ENSP00000367359:A27T	ENSP00000367359:A27T	A	-	1	0	C6orf62	24826797	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.251000	0.78297	2.679000	0.91253	0.650000	0.86243	GCT	.	.	none		0.373	C6orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040017.1	NM_030939	
CCDC129	223075	hgsc.bcm.edu	37	7	31614238	31614238	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:31614238C>T	ENST00000407970.3	+	7	518	c.480C>T	c.(478-480)atC>atT	p.I160I	CCDC129_ENST00000451887.2_Silent_p.I186I|CCDC129_ENST00000409210.1_Silent_p.I68I|CCDC129_ENST00000319386.3_Silent_p.I160I	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	160										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						AGCCAGACATCTGCATGCAAA	0.463																																					p.I186I		Atlas-SNP	.											.	CCDC129	127	.	0			c.C558T						PASS	.						130.0	136.0	134.0					7																	31614238		2203	4300	6503	SO:0001819	synonymous_variant	223075	exon7			AGACATCTGCATG	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.480C>T	7.37:g.31614238C>T		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	120	38	0.316667	NM_001257968	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Silent	SNP	ENST00000407970.3	37	CCDS5435.2																																																																																			.	.	none		0.463	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
ZNF454	285676	hgsc.bcm.edu	37	5	178373943	178373943	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:178373943G>A	ENST00000320129.3	+	4	509	c.206G>A	c.(205-207)aGg>aAg	p.R69K	ZNF454_ENST00000519564.1_Missense_Mutation_p.R69K	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	69	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		CTAGAAAAAAGGGAAGTGTGG	0.483																																					p.R69K		Atlas-SNP	.											.	ZNF454	99	.	0			c.G206A						PASS	.						123.0	123.0	123.0					5																	178373943		2203	4300	6503	SO:0001583	missense	285676	exon4			AAAAAAGGGAAGT	AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.206G>A	5.37:g.178373943G>A	ENSP00000326249:p.Arg69Lys	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	136	58	0.426471	NM_001178089	Q2M1P2|Q2M323	Missense_Mutation	SNP	ENST00000320129.3	37	CCDS4441.1	.	.	.	.	.	.	.	.	.	.	G	2.179	-0.387938	0.04932	.	.	ENSG00000178187	ENST00000320129;ENST00000519564	T;T	0.00801	5.68;5.68	4.15	1.23	0.21249	Krueppel-associated box (3);	0.848058	0.09606	U	0.779552	T	0.00784	0.0026	L	0.27975	0.815	0.09310	N	1	B	0.13594	0.008	B	0.12156	0.007	T	0.48625	-0.9019	10	0.21540	T	0.41	.	3.4847	0.07615	0.2209:0.0:0.5716:0.2075	.	69	Q8N9F8	ZN454_HUMAN	K	69	ENSP00000326249:R69K;ENSP00000430354:R69K	ENSP00000326249:R69K	R	+	2	0	ZNF454	178306549	0.016000	0.18221	0.003000	0.11579	0.013000	0.08279	0.214000	0.17541	0.128000	0.18479	0.563000	0.77884	AGG	.	.	none		0.483	ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253476.2	XM_209718	
ARID5B	84159	hgsc.bcm.edu	37	10	63662068	63662068	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:63662068C>T	ENST00000279873.7	+	2	582	c.172C>T	c.(172-174)Cag>Tag	p.Q58*		NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	58					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					AGCGGAGCTCCAGCTGTTGTG	0.473																																					p.Q58X		Atlas-SNP	.											.	ARID5B	125	.	0			c.C172T						PASS	.						70.0	75.0	73.0					10																	63662068		2203	4300	6503	SO:0001587	stop_gained	84159	exon2			GAGCTCCAGCTGT	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.172C>T	10.37:g.63662068C>T	ENSP00000279873:p.Gln58*	Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	117	18	0.153846	NM_032199	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Nonsense_Mutation	SNP	ENST00000279873.7	37	CCDS31208.1	.	.	.	.	.	.	.	.	.	.	C	41	8.590846	0.98877	.	.	ENSG00000150347	ENST00000279873	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-9.6758	18.7313	0.91736	0.0:1.0:0.0:0.0	.	.	.	.	X	58	.	ENSP00000279873:Q58X	Q	+	1	0	ARID5B	63332074	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.006000	0.63978	2.716000	0.92895	0.655000	0.94253	CAG	.	.	none		0.473	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482	
KCNJ8	3764	hgsc.bcm.edu	37	12	21926491	21926491	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:21926491C>G	ENST00000240662.2	-	2	405	c.60G>C	c.(58-60)gaG>gaC	p.E20D		NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	20					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	TGCGCAGGTTCTCTGCGGCGA	0.617											OREG0021704	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E20D		Atlas-SNP	.											.	KCNJ8	59	.	0			c.G60C						PASS	.						74.0	76.0	76.0					12																	21926491		2203	4299	6502	SO:0001583	missense	3764	exon2			CAGGTTCTCTGCG	BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.60G>C	12.37:g.21926491C>G	ENSP00000240662:p.Glu20Asp	Somatic	72	0	0	752	WXS	Illumina HiSeq	Phase_I	73	15	0.205479	NM_004982	O00657	Missense_Mutation	SNP	ENST00000240662.2	37	CCDS8692.1	.	.	.	.	.	.	.	.	.	.	C	11.03	1.518644	0.27211	.	.	ENSG00000121361	ENST00000240662;ENST00000539350;ENST00000537950	D;D	0.91792	-2.39;-2.91	4.88	3.98	0.46160	.	0.202455	0.43919	D	0.000516	D	0.86326	0.5906	L	0.46157	1.445	0.33357	D	0.571788	B	0.06786	0.001	B	0.04013	0.001	T	0.80688	-0.1271	10	0.11485	T	0.65	.	9.2742	0.37690	0.0:0.7776:0.1447:0.0777	.	20	Q15842	IRK8_HUMAN	D	20	ENSP00000240662:E20D;ENSP00000440012:E20D	ENSP00000240662:E20D	E	-	3	2	KCNJ8	21817758	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	1.560000	0.36331	1.253000	0.44018	0.591000	0.81541	GAG	.	.	none		0.617	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402226.1	NM_004982	
SLC30A4	7782	hgsc.bcm.edu	37	15	45814228	45814228	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:45814228T>C	ENST00000261867.4	-	2	639	c.325A>G	c.(325-327)Aag>Gag	p.K109E	SLC30A4_ENST00000559667.1_5'UTR|HMGN2P46_ENST00000409454.1_RNA	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	109					regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		GCTTTCACCTTTCTCTGCTTC	0.463																																					p.K109E		Atlas-SNP	.											.	SLC30A4	25	.	0			c.A325G						PASS	.						211.0	178.0	189.0					15																	45814228		2198	4298	6496	SO:0001583	missense	7782	exon2			TCACCTTTCTCTG		CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.325A>G	15.37:g.45814228T>C	ENSP00000261867:p.Lys109Glu	Somatic	163	0	0		WXS	Illumina HiSeq	Phase_I	153	32	0.20915	NM_013309	Q8TC39	Missense_Mutation	SNP	ENST00000261867.4	37	CCDS10125.1	.	.	.	.	.	.	.	.	.	.	T	17.03	3.283621	0.59867	.	.	ENSG00000104154	ENST00000261867	T	0.63417	-0.04	5.34	4.19	0.49359	.	0.239529	0.38005	N	0.001851	T	0.44993	0.1320	L	0.27053	0.805	0.40913	D	0.984245	P	0.42871	0.792	B	0.35182	0.197	T	0.43015	-0.9417	10	0.45353	T	0.12	-3.2851	11.2473	0.49004	0.0:0.0:0.1537:0.8463	.	109	O14863	ZNT4_HUMAN	E	109	ENSP00000261867:K109E	ENSP00000261867:K109E	K	-	1	0	SLC30A4	43601520	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.716000	0.54904	0.838000	0.34948	0.533000	0.62120	AAG	.	.	none		0.463	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254236.1		
C9orf24	84688	hgsc.bcm.edu	37	9	34379662	34379662	+	Silent	SNP	T	T	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:34379662T>A	ENST00000297623.2	-	6	969	c.771A>T	c.(769-771)ctA>ctT	p.L257L	KIAA1161_ENST00000297625.7_5'Flank|C9orf24_ENST00000481295.1_5'UTR|C9orf24_ENST00000379133.3_Silent_p.L122L|C9orf24_ENST00000379124.1_Missense_Mutation_p.Y124F|C9orf24_ENST00000379126.3_Missense_Mutation_p.Y71F|C9orf24_ENST00000379127.1_Missense_Mutation_p.Y124F	NM_032596.3	NP_115985.2	Q8NCR6	SMRP1_HUMAN	chromosome 9 open reading frame 24	257					cell differentiation (GO:0030154)|cellular protein complex assembly (GO:0043623)|spermatogenesis (GO:0007283)	manchette (GO:0002177)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.123)		CGGATATGGGTAGTATGACGG	0.587											OREG0019150	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y124F		Atlas-SNP	.											.	C9orf24	15	.	0			c.A371T						PASS	.						134.0	125.0	128.0					9																	34379662		2203	4300	6503	SO:0001819	synonymous_variant	84688	exon4			TATGGGTAGTATG	BC029484	CCDS6553.1, CCDS6554.1, CCDS6555.1, CCDS59121.1	9p11.2	2013-01-11			ENSG00000164972	ENSG00000164972			19919	protein-coding gene	gene with protein product	"""ciliated bronchial epithelium 1"", ""spermatid-specific manchette-related protein 1"""					12029067	Standard	NM_147168		Approved	bA573M23.4, NYD-SP22, MGC32921, MGC33614, CBE1, SMRP1	uc003zuh.1	Q8NCR6	OTTHUMG00000000437	ENST00000297623.2:c.771A>T	9.37:g.34379662T>A		Somatic	96	0	0	847	WXS	Illumina HiSeq	Phase_I	128	30	0.234375	NM_001252195	Q5T598|Q5T599|Q5T5A0|Q8N9G4|Q96KD1|Q96LN1	Missense_Mutation	SNP	ENST00000297623.2	37	CCDS6554.1	.	.	.	.	.	.	.	.	.	.	T	15.41	2.826730	0.50739	.	.	ENSG00000164972	ENST00000379126;ENST00000379127;ENST00000379112;ENST00000379124	T;T	0.52057	0.68;0.68	4.73	0.955	0.19602	.	.	.	.	.	T	0.27731	0.0682	.	.	.	0.20403	N	0.999906	B	0.11235	0.004	B	0.12837	0.008	T	0.19614	-1.0300	8	0.25106	T	0.35	-7.9938	3.6798	0.08306	0.1602:0.1789:0.0:0.661	.	71	Q8NCR6-3	.	F	71;124;54;124	ENSP00000368422:Y124F;ENSP00000368419:Y124F	ENSP00000368407:Y54F	Y	-	2	0	C9orf24	34369662	0.975000	0.34042	0.730000	0.30809	0.465000	0.32709	-0.176000	0.09811	0.060000	0.16281	-0.411000	0.06167	TAC	.	.	none		0.587	C9orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001098.3	NM_147169	
MESDC2	23184	hgsc.bcm.edu	37	15	81271791	81271791	+	Silent	SNP	G	G	A	rs372944817		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr15:81271791G>A	ENST00000261758.4	-	3	560	c.474C>T	c.(472-474)atC>atT	p.I158I	MESDC2_ENST00000560244.1_5'Flank	NM_015154.1	NP_055969.1	Q14696	MESD_HUMAN	mesoderm development candidate 2	158	Chaperone domain. {ECO:0000250}.				mesoderm development (GO:0007498)|protein folding (GO:0006457)|protein localization to cell surface (GO:0034394)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(5)|ovary(1)|urinary_tract(1)	8						GAAGCATGAAGATAGCACGGT	0.537																																					p.I158I		Atlas-SNP	.											.	MESDC2	23	.	0			c.C474T						PASS	.						71.0	67.0	69.0					15																	81271791		2203	4300	6503	SO:0001819	synonymous_variant	23184	exon3			CATGAAGATAGCA	D42039	CCDS32308.1	15q13	2008-07-18							13520	protein-coding gene	gene with protein product		607783				7788527, 11247670	Standard	NM_015154		Approved	KIAA0081, BOCA, MESD	uc002bfy.1	Q14696		ENST00000261758.4:c.474C>T	15.37:g.81271791G>A		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	42	12	0.285714	NM_015154	B4DW84|D3DW96|Q969U1	Silent	SNP	ENST00000261758.4	37	CCDS32308.1																																																																																			.	.	weak		0.537	MESDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417673.2	NM_015154	
HPSE2	60495	hgsc.bcm.edu	37	10	100249925	100249925	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:100249925C>T	ENST00000370552.3	-	10	1408	c.1349G>A	c.(1348-1350)cGc>cAc	p.R450H	HPSE2_ENST00000404542.1_Missense_Mutation_p.R338H|HPSE2_ENST00000370549.1_Missense_Mutation_p.R392H|HPSE2_ENST00000370546.1_Missense_Mutation_p.R450H	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	450					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		GCCGATCAGGCGCTTGTAGAG	0.557																																					p.R450H		Atlas-SNP	.											.	HPSE2	203	.	0			c.G1349A						PASS	.						81.0	82.0	82.0					10																	100249925		2203	4300	6503	SO:0001583	missense	60495	exon10			ATCAGGCGCTTGT	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.1349G>A	10.37:g.100249925C>T	ENSP00000359583:p.Arg450His	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	85	26	0.305882	NM_001166246	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	ENST00000370552.3	37	CCDS7477.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.332532	0.60853	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000370546;ENST00000404542	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	5.82	5.82	0.92795	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.065719	0.64402	D	0.000012	T	0.32102	0.0818	L	0.48935	1.535	0.42422	D	0.992648	B;B;B;B	0.28667	0.01;0.219;0.054;0.032	B;B;B;B	0.21360	0.005;0.034;0.017;0.007	T	0.09618	-1.0666	10	0.56958	D	0.05	-8.8517	13.3123	0.60386	0.0:0.9279:0.0:0.0721	.	338;450;392;450	Q8WWQ2-4;Q8WWQ2-2;Q8WWQ2-3;Q8WWQ2	.;.;.;HPSE2_HUMAN	H	450;392;450;338	ENSP00000359583:R450H;ENSP00000359580:R392H;ENSP00000359577:R450H;ENSP00000384384:R338H	ENSP00000359577:R450H	R	-	2	0	HPSE2	100239915	0.998000	0.40836	1.000000	0.80357	0.979000	0.70002	3.720000	0.54933	2.755000	0.94549	0.591000	0.81541	CGC	.	.	none		0.557	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828	
TGIF2	60436	hgsc.bcm.edu	37	20	35219312	35219312	+	Splice_Site	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:35219312G>T	ENST00000373874.2	+	3	391		c.e3-1		TGIF2-C20orf24_ENST00000558530.1_Intron|RP5-977B1.11_ENST00000561134.1_RNA|TGIF2_ENST00000373872.4_Splice_Site	NM_001199514.1|NM_001199515.1	NP_001186443.1|NP_001186444.1	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2						gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway (GO:0038092)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				ATTCATTCCAGATATGTAACT	0.502																																					.		Atlas-SNP	.											.	TGIF2	26	.	0			c.193-1G>T						PASS	.						137.0	153.0	148.0					20																	35219312		2203	4300	6503	SO:0001630	splice_region_variant	60436	exon3			ATTCCAGATATGT	AB042646	CCDS13278.1	20q11.23	2012-12-12	2007-02-07		ENSG00000118707	ENSG00000118707		"""Homeoboxes / TALE class"""	15764	protein-coding gene	gene with protein product		607294	"""TGFB-induced factor 2 (TALE family homeobox)"""			11006116	Standard	NM_021809		Approved		uc021wcv.1	Q9GZN2	OTTHUMG00000172332	ENST00000373874.2:c.193-1G>T	20.37:g.35219312G>T		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	84	19	0.22619	NM_001199513	B2R9U3|E1P5T9|H0YNI0	Splice_Site	SNP	ENST00000373874.2	37	CCDS13278.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.736257	0.69189	.	.	ENSG00000118707	ENST00000373874;ENST00000373872	.	.	.	5.61	4.66	0.58398	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3415	0.60547	0.0756:0.0:0.9244:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TGIF2	34652726	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.414000	0.97362	1.366000	0.46076	0.561000	0.74099	.	.	.	none		0.502	TGIF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079004.2	NM_021809	Intron
BRD2	6046	hgsc.bcm.edu	37	6	32948431	32948431	+	Nonsense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:32948431C>G	ENST00000374825.4	+	13	4043	c.2342C>G	c.(2341-2343)tCa>tGa	p.S781*	BRD2_ENST00000374831.4_Nonsense_Mutation_p.S781*|BRD2_ENST00000395289.2_Nonsense_Mutation_p.S816*|BRD2_ENST00000449085.2_Nonsense_Mutation_p.S734*|BRD2_ENST00000395287.1_Nonsense_Mutation_p.S816*|BRD2_ENST00000443797.2_Nonsense_Mutation_p.S661*	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	781	Poly-Ser.|Ser-rich.				chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						AGCTCCAGCTCAGATTCCAGC	0.537																																					p.S816X		Atlas-SNP	.											.	BRD2	70	.	0			c.C2447G						PASS	.						110.0	90.0	97.0					6																	32948431		1511	2709	4220	SO:0001587	stop_gained	6046	exon13			CCAGCTCAGATTC	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.2342C>G	6.37:g.32948431C>G	ENSP00000363958:p.Ser781*	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	56	17	0.303571	NM_001199455	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Nonsense_Mutation	SNP	ENST00000374825.4	37	CCDS4762.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	52|52	19.565009|19.565009	0.99921|0.99921	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000449025|ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085	.|.	.|.	.|.	6.15|6.15	6.15|6.15	0.99193|0.99193	.|.	.|0.000000	.|0.42420	.|D	.|0.000718	T|.	0.68824|.	0.3043|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.64347|.	-0.6429|.	4|.	.|0.38643	.|T	.|0.18	-12.1118|-12.1118	18.3325|18.3325	0.90274|0.90274	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	E|X	787|781;781;816;661;816;734	.|.	.|ENSP00000363958:S781X	Q|S	+|+	1|2	0|0	BRD2|BRD2	33056409|33056409	1.000000|1.000000	0.71417|0.71417	0.978000|0.978000	0.43139|0.43139	0.967000|0.967000	0.64934|0.64934	6.781000|6.781000	0.75068|0.75068	2.932000|2.932000	0.99384|0.99384	0.643000|0.643000	0.83706|0.83706	CAG|TCA	.	.	none		0.537	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		
ARHGEF17	9828	hgsc.bcm.edu	37	11	73073580	73073580	+	Silent	SNP	C	C	T	rs76764824	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:73073580C>T	ENST00000263674.3	+	14	5147	c.4797C>T	c.(4795-4797)ctC>ctT	p.L1599L		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1599					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CCGCGACGCTCGCGGAGCCGG	0.731													C|||	239	0.0477236	0.0272	0.0403	5008	,	,		12983	0.0099		0.0895	False		,,,				2504	0.0767				p.L1599L		Atlas-SNP	.											ARHGEF17,bladder,carcinoma,+2,1	ARHGEF17	117	1	0			c.C4797T						PASS	.	C		151,4157		0,151,2003	10.0	15.0	14.0		4797	-1.5	0.0	11	dbSNP_132	14	789,7685		40,709,3488	no	coding-synonymous	ARHGEF17	NM_014786.3		40,860,5491	TT,TC,CC		9.3108,3.5051,7.3541		1599/2064	73073580	940,11842	2154	4237	6391	SO:0001819	synonymous_variant	9828	exon14			GACGCTCGCGGAG	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.4797C>T	11.37:g.73073580C>T		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	47	27	0.574468	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Silent	SNP	ENST00000263674.3	37	CCDS8221.1																																																																																			C|0.953;T|0.047	0.047	strong		0.731	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
EPPK1	83481	hgsc.bcm.edu	37	8	144942991	144942991	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:144942991G>A	ENST00000525985.1	-	2	4502	c.4431C>T	c.(4429-4431)taC>taT	p.Y1477Y				P58107	EPIPL_HUMAN	epiplakin 1	1477						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CAGCGCCAACGTATTCGGAGA	0.662																																					p.Y1477Y		Atlas-SNP	.											.	EPPK1	199	.	0			c.C4431T						PASS	.						29.0	33.0	32.0					8																	144942991		2189	4283	6472	SO:0001819	synonymous_variant	83481	exon1			GCCAACGTATTCG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.4431C>T	8.37:g.144942991G>A		Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	37	20	0.540541	NM_031308	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																				.	.	none		0.662	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
RIN2	54453	hgsc.bcm.edu	37	20	19977369	19977369	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:19977369G>T	ENST00000255006.6	+	11	2543	c.2394G>T	c.(2392-2394)aaG>aaT	p.K798N	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Missense_Mutation_p.K316N	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	749	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						CTCTGATAAAGAATTTCCAAG	0.532																																					p.K798N		Atlas-SNP	.											.	RIN2	126	.	0			c.G2394T						PASS	.						72.0	77.0	75.0					20																	19977369		1969	4164	6133	SO:0001583	missense	54453	exon11			GATAAAGAATTTC	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.2394G>T	20.37:g.19977369G>T	ENSP00000255006:p.Lys798Asn	Somatic	155	0	0		WXS	Illumina HiSeq	Phase_I	118	34	0.288136	NM_001242581	Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	ENST00000255006.6	37	CCDS56182.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.677559	0.88445	.	.	ENSG00000132669	ENST00000255006;ENST00000440354	T;T	0.32515	1.45;1.45	5.69	5.69	0.88448	Vacuolar sorting protein 9, subgroup (1);Vacuolar sorting protein 9 (2);	0.052451	0.85682	D	0.000000	T	0.60248	0.2254	M	0.80508	2.5	0.80722	D	1	P;D	0.89917	0.883;1.0	B;D	0.79784	0.444;0.993	T	0.60301	-0.7290	9	.	.	.	-35.8035	19.4007	0.94629	0.0:0.0:1.0:0.0	.	316;749	E7EPJ1;Q8WYP3	.;RIN2_HUMAN	N	798;316	ENSP00000255006:K798N;ENSP00000391239:K316N	.	K	+	3	2	RIN2	19925369	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.072000	0.57563	2.682000	0.91365	0.655000	0.94253	AAG	.	.	none		0.532	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078212.1		
C19orf26	255057	hgsc.bcm.edu	37	19	1235089	1235089	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:1235089G>T	ENST00000382477.2	-	5	622	c.348C>A	c.(346-348)ttC>ttA	p.F116L	C19orf26_ENST00000590083.1_Missense_Mutation_p.F122L|C19orf26_ENST00000215376.6_Missense_Mutation_p.F116L			Q8N350	DOS_HUMAN	chromosome 19 open reading frame 26	116						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGTGGACAGGAAGCGTTCGG	0.706										HNSCC(14;0.022)																											p.F122L		Atlas-SNP	.											.	C19orf26	31	.	0			c.C366A						PASS	.						25.0	27.0	26.0					19																	1235089		2197	4294	6491	SO:0001583	missense	255057	exon5			GGACAGGAAGCGT	BC028156	CCDS12057.1, CCDS12057.2	19p13.3	2012-10-24			ENSG00000099625	ENSG00000099625			28617	protein-coding gene	gene with protein product	"""downstream of STK11"""					12477932	Standard	NM_152769		Approved	MGC40084, DOS	uc002lrm.3	Q8N350	OTTHUMG00000180141	ENST00000382477.2:c.348C>A	19.37:g.1235089G>T	ENSP00000371917:p.Phe116Leu	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	91	21	0.230769	NM_152769	O43385	Missense_Mutation	SNP	ENST00000382477.2	37		.	.	.	.	.	.	.	.	.	.	G	13.90	2.373884	0.42105	.	.	ENSG00000099625	ENST00000382477;ENST00000215376	.	.	.	3.64	3.64	0.41730	.	0.062767	0.64402	D	0.000004	T	0.64316	0.2587	L	0.29908	0.895	0.58432	D	0.999994	D	0.67145	0.996	D	0.77557	0.99	T	0.68591	-0.5368	9	0.62326	D	0.03	.	14.4186	0.67168	0.0:0.0:1.0:0.0	.	116	Q8N350-2	.	L	116	.	ENSP00000215376:F116L	F	-	3	2	C19orf26	1186089	1.000000	0.71417	1.000000	0.80357	0.118000	0.20060	4.074000	0.57577	2.026000	0.59711	0.561000	0.74099	TTC	.	.	none		0.706	C19orf26-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_152769	
SLC37A3	84255	hgsc.bcm.edu	37	7	140045717	140045717	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:140045717G>A	ENST00000326232.9	-	11	1281	c.1078C>T	c.(1078-1080)Ctt>Ttt	p.L360F	SLC37A3_ENST00000447932.2_Missense_Mutation_p.L360F|SLC37A3_ENST00000340308.3_Intron	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	360					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					CTCAGGGCAAGAACCGGCGCT	0.463																																					p.L360F	Esophageal Squamous(133;211 1716 4665 11387 37873)	Atlas-SNP	.											.	SLC37A3	80	.	0			c.C1078T						PASS	.						105.0	110.0	108.0					7																	140045717		2203	4300	6503	SO:0001583	missense	84255	exon11			GGGCAAGAACCGG	AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.1078C>T	7.37:g.140045717G>A	ENSP00000321498:p.Leu360Phe	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	106	29	0.273585	NM_207113	Q6PIU7|Q86SS4|Q9BQG7	Missense_Mutation	SNP	ENST00000326232.9	37	CCDS5859.1	.	.	.	.	.	.	.	.	.	.	G	11.05	1.526203	0.27299	.	.	ENSG00000157800	ENST00000447932;ENST00000326232	T;T	0.62498	0.02;0.25	4.98	-2.26	0.06867	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.160257	0.38164	N	0.001783	T	0.66187	0.2764	L	0.43923	1.385	0.80722	D	1	P;D	0.57257	0.951;0.979	P;D	0.65573	0.802;0.936	T	0.65240	-0.6216	10	0.52906	T	0.07	-20.8561	12.608	0.56535	0.4046:0.0:0.5954:0.0	.	360;360	Q8NCC5-2;Q8NCC5	.;SPX3_HUMAN	F	360	ENSP00000397481:L360F;ENSP00000321498:L360F	ENSP00000321498:L360F	L	-	1	0	SLC37A3	139692186	0.004000	0.15560	0.064000	0.19789	0.046000	0.14306	-0.181000	0.09740	-0.309000	0.08779	-0.471000	0.05019	CTT	.	.	none		0.463	SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348492.1	NM_032295	
ZNF708	7562	hgsc.bcm.edu	37	19	21477477	21477477	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:21477477T>G	ENST00000356929.3	-	4	488	c.291A>C	c.(289-291)caA>caC	p.Q97H		NM_021269.2	NP_067092.2	P17019	ZN708_HUMAN	zinc finger protein 708	33					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(2)|stomach(1)	32						TCAGTATCACTTGTTGGAAAG	0.353																																					p.Q97H		Atlas-SNP	.											.	ZNF708	66	.	0			c.A291C						PASS	.						80.0	80.0	80.0					19																	21477477		2203	4299	6502	SO:0001583	missense	7562	exon4			TATCACTTGTTGG	X52339	CCDS32980.1	19p12	2014-02-14	2006-08-22	2005-08-16	ENSG00000182141	ENSG00000182141		"""Zinc fingers, C2H2-type"", ""-"""	12945	protein-coding gene	gene with protein product			"""zinc finger protein 15-like 1 (KOX 8)"", ""zinc finger protein 708"", ""zinc finger protein 708 (KOX8)"""	ZNF15, ZNF15L1		2014798	Standard	NM_021269		Approved	KOX8	uc002npq.1	P17019	OTTHUMG00000182841	ENST00000356929.3:c.291A>C	19.37:g.21477477T>G	ENSP00000349401:p.Gln97His	Somatic	215	0	0		WXS	Illumina HiSeq	Phase_I	182	42	0.230769	NM_021269	Q6ZMR0	Missense_Mutation	SNP	ENST00000356929.3	37	CCDS32980.1	.	.	.	.	.	.	.	.	.	.	.	5.752	0.323255	0.10900	.	.	ENSG00000182141	ENST00000356929	T	0.06528	3.29	0.449	-0.676	0.11361	.	.	.	.	.	T	0.09113	0.0225	L	0.43152	1.355	0.09310	N	1	B	0.27351	0.176	B	0.42738	0.396	T	0.48399	-0.9039	8	0.54805	T	0.06	.	.	.	.	.	97	P17019	ZN708_HUMAN	H	97	ENSP00000349401:Q97H	ENSP00000349401:Q97H	Q	-	3	2	ZNF708	21269317	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.386000	0.07370	-0.428000	0.07339	-0.436000	0.05848	CAA	.	.	none		0.353	ZNF708-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463953.1	NM_021269	
ASH2L	9070	hgsc.bcm.edu	37	8	37963905	37963905	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr8:37963905C>G	ENST00000343823.6	+	2	507	c.198C>G	c.(196-198)aaC>aaG	p.N66K	ASH2L_ENST00000545394.1_5'UTR|ASH2L_ENST00000521652.1_5'UTR|ASH2L_ENST00000428278.2_5'UTR|ASH2L_ENST00000250635.7_5'UTR	NM_004674.4	NP_004665.2	Q9UBL3	ASH2L_HUMAN	ash2 (absent, small, or homeotic)-like (Drosophila)	66					cellular response to DNA damage stimulus (GO:0006974)|hemopoiesis (GO:0030097)|histone H3-K4 methylation (GO:0051568)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)	19	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				GGGAGGCAAACTTGGTCGATG	0.368																																					p.N66K		Atlas-SNP	.											.	ASH2L	62	.	0			c.C198G						PASS	.						170.0	173.0	172.0					8																	37963905		2203	4300	6503	SO:0001583	missense	9070	exon2			GGCAAACTTGGTC	AF056717	CCDS6101.1, CCDS47840.1, CCDS59100.1, CCDS64872.1	8p11.2	2013-01-28	2001-11-28		ENSG00000129691	ENSG00000129691		"""Zinc fingers, PHD-type"""	744	protein-coding gene	gene with protein product		604782	"""ash2 (absent, small, or homeotic, Drosophila, homolog)-like"""	ASH2L1		10393421	Standard	NM_004674		Approved	ASH2L2, ASH2, Bre2	uc003xkt.5	Q9UBL3	OTTHUMG00000164016	ENST00000343823.6:c.198C>G	8.37:g.37963905C>G	ENSP00000340896:p.Asn66Lys	Somatic	213	0	0		WXS	Illumina HiSeq	Phase_I	130	16	0.123077	NM_004674	A8K7C3|D3DSW9|O60659|O60660|Q96B62	Missense_Mutation	SNP	ENST00000343823.6	37	CCDS6101.1	.	.	.	.	.	.	.	.	.	.	C	13.73	2.325738	0.41197	.	.	ENSG00000129691	ENST00000343823	T	0.18174	2.23	5.99	2.1	0.27182	.	0.338836	0.35013	N	0.003507	T	0.07908	0.0198	N	0.08118	0	0.58432	D	0.999999	B	0.12013	0.005	B	0.08055	0.003	T	0.22452	-1.0216	10	0.38643	T	0.18	.	8.2691	0.31833	0.0:0.588:0.0:0.412	.	66	Q9UBL3	ASH2L_HUMAN	K	66	ENSP00000340896:N66K	ENSP00000340896:N66K	N	+	3	2	ASH2L	38083062	0.003000	0.15002	0.906000	0.35671	0.074000	0.17049	-0.047000	0.11963	0.389000	0.25086	0.655000	0.94253	AAC	.	.	none		0.368	ASH2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376749.4	NM_004674	
TRANK1	9881	hgsc.bcm.edu	37	3	36896835	36896835	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:36896835T>A	ENST00000429976.2	-	12	4493	c.4246A>T	c.(4246-4248)Atg>Ttg	p.M1416L	TRANK1_ENST00000428977.2_Missense_Mutation_p.M866L|TRANK1_ENST00000301807.6_Missense_Mutation_p.M866L	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	1416							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						GTGAGGAACATAGAGTTGGGG	0.552																																					p.M1416L		Atlas-SNP	.											.	TRANK1	398	.	0			c.A4246T						PASS	.						134.0	131.0	132.0					3																	36896835		2076	4222	6298	SO:0001583	missense	9881	exon12			GGAACATAGAGTT	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.4246A>T	3.37:g.36896835T>A	ENSP00000416168:p.Met1416Leu	Somatic	164	0	0		WXS	Illumina HiSeq	Phase_I	111	43	0.387387	NM_014831	Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	T	12.18	1.861750	0.32884	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.76968	-1.06;-1.06;-1.06	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000001	T	0.65154	0.2664	N	0.03177	-0.4	0.46203	D	0.99892	B	0.28178	0.202	B	0.40285	0.325	T	0.64833	-0.6314	10	0.27785	T	0.31	.	15.7204	0.77705	0.0:0.0:0.0:1.0	.	1416	O15050	TRNK1_HUMAN	L	866;1416;866	ENSP00000416826:M866L;ENSP00000416168:M1416L;ENSP00000301807:M866L	ENSP00000301807:M866L	M	-	1	0	TRANK1	36871839	1.000000	0.71417	1.000000	0.80357	0.389000	0.30415	6.193000	0.72075	2.180000	0.69256	0.459000	0.35465	ATG	.	.	none		0.552	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
ZNF234	10780	hgsc.bcm.edu	37	19	44661323	44661323	+	Missense_Mutation	SNP	C	C	T	rs191045580		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:44661323C>T	ENST00000426739.2	+	6	1412	c.1154C>T	c.(1153-1155)tCa>tTa	p.S385L	ZNF234_ENST00000592437.1_Missense_Mutation_p.S385L	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				ATTTACAGTTCAAGTTTTCAG	0.428																																					p.S385L		Atlas-SNP	.											.	ZNF234	132	.	0			c.C1154T						PASS	.						59.0	62.0	61.0					19																	44661323		2149	4280	6429	SO:0001583	missense	10780	exon6			ACAGTTCAAGTTT	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1154C>T	19.37:g.44661323C>T	ENSP00000400878:p.Ser385Leu	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	119	27	0.226891	NM_006630	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Missense_Mutation	SNP	ENST00000426739.2	37	CCDS46101.1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.990174	0.54041	.	.	ENSG00000167380	ENST00000426739	T	0.36520	1.25	3.93	3.93	0.45458	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.55417	0.1919	M	0.62088	1.915	0.09310	N	1	D	0.63880	0.993	D	0.72338	0.977	T	0.41945	-0.9480	9	0.72032	D	0.01	.	11.8477	0.52393	0.0:0.8215:0.1785:0.0	.	385	Q14588	ZN234_HUMAN	L	385	ENSP00000400878:S385L	ENSP00000400878:S385L	S	+	2	0	ZNF226	49353163	0.000000	0.05858	0.125000	0.21846	0.988000	0.76386	0.053000	0.14184	2.175000	0.68902	0.591000	0.81541	TCA	C|0.999;A|0.001	.	alt		0.428	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460586.2		
PRR23A	729627	hgsc.bcm.edu	37	3	138724565	138724565	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:138724565G>A	ENST00000383163.2	-	1	545	c.546C>T	c.(544-546)tcC>tcT	p.S182S	MRPS22_ENST00000495075.1_5'Flank	NM_001134659.1	NP_001128131.1	A6NEV1	PR23A_HUMAN	proline rich 23A	182										endometrium(3)|kidney(1)|lung(7)	11						TACTTCTGGCGGAGGAGTAGA	0.667																																					p.S182S		Atlas-SNP	.											.	PRR23A	35	.	0			c.C546T						PASS	.						21.0	27.0	25.0					3																	138724565		692	1591	2283	SO:0001819	synonymous_variant	729627	exon1			TCTGGCGGAGGAG		CCDS46923.1	3q22.3	2014-06-03				ENSG00000206260			37172	protein-coding gene	gene with protein product							Standard	NM_001134659		Approved		uc011bms.2	A6NEV1		ENST00000383163.2:c.546C>T	3.37:g.138724565G>A		Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	130	17	0.130769	NM_001134659		Silent	SNP	ENST00000383163.2	37	CCDS46923.1																																																																																			.	.	none		0.667	PRR23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361503.1	NM_001134659	
SI	6476	hgsc.bcm.edu	37	3	164733862	164733862	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:164733862G>T	ENST00000264382.3	-	32	3828	c.3766C>A	c.(3766-3768)Cag>Aag	p.Q1256K		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1256	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.Q1256E(2)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TCTGTGTACTGAACATCCTGA	0.333										HNSCC(35;0.089)																											p.Q1256K		Atlas-SNP	.											SI,NS,carcinoma,0,1	SI	500	1	2	Substitution - Missense(2)	lung(2)	c.C3766A						PASS	.						149.0	160.0	156.0					3																	164733862		2203	4300	6503	SO:0001583	missense	6476	exon32			TGTACTGAACATC	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3766C>A	3.37:g.164733862G>T	ENSP00000264382:p.Gln1256Lys	Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	95	26	0.273684	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279792	0.80692	.	.	ENSG00000090402	ENST00000264382	D	0.92752	-3.1	4.93	4.93	0.64822	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.97151	0.9069	M	0.94021	3.485	0.58432	D	0.999996	D	0.89917	1.0	D	0.80764	0.994	D	0.98111	1.0420	10	0.87932	D	0	.	18.3199	0.90234	0.0:0.0:1.0:0.0	.	1256	P14410	SUIS_HUMAN	K	1256	ENSP00000264382:Q1256K	ENSP00000264382:Q1256K	Q	-	1	0	SI	166216556	1.000000	0.71417	0.981000	0.43875	0.730000	0.41778	7.112000	0.77086	2.557000	0.86248	0.585000	0.79938	CAG	.	.	none		0.333	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
LRRTM1	347730	hgsc.bcm.edu	37	2	80529910	80529910	+	Silent	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:80529910C>A	ENST00000295057.3	-	2	1691	c.1035G>T	c.(1033-1035)ccG>ccT	p.P345P	CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000402739.4_Intron|LRRTM1_ENST00000409148.1_Silent_p.P345P|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000540488.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	345	LRRCT.				exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						GTGCGTACTCCGGGCTGGCGC	0.677										HNSCC(69;0.2)																											p.P345P		Atlas-SNP	.											.	LRRTM1	251	.	0			c.G1035T						PASS	.						23.0	22.0	22.0					2																	80529910		2203	4299	6502	SO:0001819	synonymous_variant	347730	exon2			GTACTCCGGGCTG	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1035G>T	2.37:g.80529910C>A		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	60	21	0.35	NM_178839	A8K397|D6W5K1|Q96DN1	Silent	SNP	ENST00000295057.3	37	CCDS1966.1																																																																																			.	.	none		0.677	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839	
SHMT1	6470	hgsc.bcm.edu	37	17	18259246	18259246	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:18259246G>A	ENST00000316694.3	-	2	184	c.50C>T	c.(49-51)tCa>tTa	p.S17L	SHMT1_ENST00000539052.1_5'UTR|SHMT1_ENST00000354098.3_Missense_Mutation_p.S17L|SHMT1_ENST00000352886.6_Missense_Mutation_p.S17L	NM_004169.3	NP_004160.3	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	17					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|folic acid metabolic process (GO:0046655)|glycine biosynthetic process from serine (GO:0019264)|L-serine catabolic process (GO:0006565)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase biosynthetic process (GO:0009113)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	amino acid binding (GO:0016597)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)	13					Glycine(DB00145)|Mimosine(DB01055)|Tetrahydrofolic acid(DB00116)	CTTGTCATGTGAGGACCACAG	0.463																																					p.S17L		Atlas-SNP	.											.	SHMT1	36	.	0			c.C50T						PASS	.						104.0	88.0	94.0					17																	18259246		2203	4300	6503	SO:0001583	missense	6470	exon2			TCATGTGAGGACC		CCDS11196.1, CCDS11197.1, CCDS62112.1	17p11.2	2010-04-23			ENSG00000176974	ENSG00000176974	2.1.2.1		10850	protein-coding gene	gene with protein product	"""cytoplasmic serine hydroxymethyltransferase"", ""14 kDa protein"""	182144				8505317	Standard	NM_004169		Approved	CSHMT, SHMT, MGC15229, MGC24556	uc002gta.3	P34896	OTTHUMG00000059094	ENST00000316694.3:c.50C>T	17.37:g.18259246G>A	ENSP00000318868:p.Ser17Leu	Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	70	10	0.142857	NM_148918	B4DPM9|D3DXD0|Q96HY0|Q9UMD1|Q9UMD2	Missense_Mutation	SNP	ENST00000316694.3	37	CCDS11196.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738814	0.49045	.	.	ENSG00000176974	ENST00000316694;ENST00000352886;ENST00000354098;ENST00000395685;ENST00000395682	T;T;T	0.28454	1.61;1.61;1.61	5.13	4.15	0.48705	Pyridoxal phosphate-dependent transferase, major domain (1);	0.055757	0.64402	N	0.000001	T	0.31638	0.0803	L	0.57536	1.79	0.80722	D	1	B;B;B;B	0.10296	0.003;0.001;0.002;0.001	B;B;B;B	0.15052	0.002;0.002;0.012;0.001	T	0.12604	-1.0541	10	0.54805	T	0.06	-34.6932	13.0663	0.59036	0.0785:0.0:0.9215:0.0	.	17;17;17;17	B4DZB5;A8MYA6;P34896-2;P34896	.;.;.;GLYC_HUMAN	L	17	ENSP00000318868:S17L;ENSP00000345881:S17L;ENSP00000318805:S17L	ENSP00000318868:S17L	S	-	2	0	SHMT1	18199971	1.000000	0.71417	0.735000	0.30896	0.974000	0.67602	3.637000	0.54324	1.288000	0.44600	0.650000	0.86243	TCA	.	.	none		0.463	SHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130831.2	NM_004169	
C16orf58	64755	hgsc.bcm.edu	37	16	31502228	31502228	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:31502228G>A	ENST00000327237.2	-	13	1374	c.1335C>T	c.(1333-1335)acC>acT	p.T445T	AC026471.6_ENST00000565137.1_RNA|C16orf58_ENST00000567994.1_Silent_p.T400T|C16orf58_ENST00000570164.1_Silent_p.T443T			Q96GQ5	RUS1_HUMAN	chromosome 16 open reading frame 58	445						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)	14						GGTGCTTCTCGGTCTTCCAGC	0.622																																					p.G445G		Atlas-SNP	.											C16orf58,NS,carcinoma,0,1	C16orf58	28	1	0			c.G1335T						scavenged	.						79.0	67.0	71.0					16																	31502228		2197	4300	6497	SO:0001819	synonymous_variant	64755	exon13			CTTCTCGGTCTTC	AK023930	CCDS10715.1	16p11.2	2013-03-04			ENSG00000140688	ENSG00000140688			25848	protein-coding gene	gene with protein product							Standard	NM_022744		Approved	FLJ13868	uc002eci.3	Q96GQ5	OTTHUMG00000132466	ENST00000327237.2:c.1335C>T	16.37:g.31502228G>A		Somatic	64	1	0.015625		WXS	Illumina HiSeq	Phase_I	55	15	0.272727	NM_022744	Q53GL8|Q8NAJ4|Q9BVY3|Q9H887	Silent	SNP	ENST00000327237.2	37	CCDS10715.1																																																																																			.	.	none		0.622	C16orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255629.2	NM_022744	
IRF8	3394	hgsc.bcm.edu	37	16	85942692	85942692	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:85942692G>A	ENST00000268638.5	+	3	693	c.271G>A	c.(271-273)Gat>Aat	p.D91N	IRF8_ENST00000563180.1_Missense_Mutation_p.D91N	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	91					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				TAAGAGCCCAGATTTTGAGGA	0.458																																					p.D91N		Atlas-SNP	.											.	IRF8	65	.	0			c.G271A						PASS	.						75.0	74.0	74.0					16																	85942692		2198	4300	6498	SO:0001583	missense	3394	exon3			AGCCCAGATTTTG	M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.271G>A	16.37:g.85942692G>A	ENSP00000268638:p.Asp91Asn	Somatic	113	0	0		WXS	Illumina HiSeq	Phase_I	90	33	0.366667	NM_002163	A0AV82	Missense_Mutation	SNP	ENST00000268638.5	37	CCDS10956.1	.	.	.	.	.	.	.	.	.	.	G	34	5.339716	0.95783	.	.	ENSG00000140968	ENST00000268638	D	0.98090	-4.71	4.88	4.88	0.63580	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.98419	0.9474	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.996	D	0.98988	1.0807	10	0.49607	T	0.09	-19.2746	18.3888	0.90475	0.0:0.0:1.0:0.0	.	91;91	B2R8V7;Q02556	.;IRF8_HUMAN	N	91	ENSP00000268638:D91N	ENSP00000268638:D91N	D	+	1	0	IRF8	84500193	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.282000	0.95840	2.438000	0.82558	0.484000	0.47621	GAT	.	.	none		0.458	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	NM_002163	
HERC4	26091	hgsc.bcm.edu	37	10	69695935	69695935	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:69695935C>G	ENST00000395198.3	-	23	2900	c.2653G>C	c.(2653-2655)Gac>Cac	p.D885H	HERC4_ENST00000277817.6_Missense_Mutation_p.D775H|HERC4_ENST00000373700.4_Missense_Mutation_p.D877H|HERC4_ENST00000395187.2_3'UTR|HERC4_ENST00000412272.2_Missense_Mutation_p.D807H	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	885	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						ACAGCTGTGTCTGCACCATTT	0.338																																					p.D885H		Atlas-SNP	.											.	HERC4	78	.	0			c.G2653C						PASS	.						181.0	169.0	173.0					10																	69695935		2203	4299	6502	SO:0001583	missense	26091	exon23			CTGTGTCTGCACC	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.2653G>C	10.37:g.69695935C>G	ENSP00000378624:p.Asp885His	Somatic	267	0	0		WXS	Illumina HiSeq	Phase_I	188	49	0.260638	NM_022079	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	37	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506093	0.44558	.	.	ENSG00000148634	ENST00000277817;ENST00000412272;ENST00000395198;ENST00000373700	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.2	5.2	0.72013	HECT (4);	0.293542	0.41097	D	0.000954	T	0.48003	0.1476	L	0.39514	1.22	0.80722	D	1	B;B;B;B;B	0.24963	0.115;0.005;0.007;0.003;0.007	B;B;B;B;B	0.34779	0.189;0.008;0.021;0.012;0.021	T	0.43893	-0.9363	10	0.46703	T	0.11	.	19.1052	0.93291	0.0:1.0:0.0:0.0	.	807;775;735;877;885	Q5GLZ8-3;Q5GLZ8-6;Q5VXS9;Q5GLZ8-2;Q5GLZ8	.;.;.;.;HERC4_HUMAN	H	775;807;885;877	ENSP00000277817:D775H;ENSP00000416504:D807H;ENSP00000378624:D885H;ENSP00000362804:D877H	ENSP00000277817:D775H	D	-	1	0	HERC4	69365941	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.779000	0.47734	2.568000	0.86640	0.460000	0.39030	GAC	.	.	none		0.338	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601	
SMARCA4	6597	hgsc.bcm.edu	37	19	11134230	11134230	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:11134230C>T	ENST00000429416.3	+	21	3177	c.2896C>T	c.(2896-2898)Cgg>Tgg	p.R966W	SMARCA4_ENST00000413806.3_Missense_Mutation_p.R966W|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R966W|SMARCA4_ENST00000358026.2_Missense_Mutation_p.R966W|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R966W|SMARCA4_ENST00000590574.1_Missense_Mutation_p.R966W|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R966W|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R966W|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R966W	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	966					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.R966W(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TCTCATCATCCGGCGTCTCCA	0.567			"""F, N, Mis"""		NSCLC																																p.R966W		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	SMARCA4_ENST00000358026,caecum,carcinoma,-1,7	SMARCA4	502	7	2	Substitution - Missense(1)|Unknown(1)	ovary(1)|lung(1)	c.C2896T						PASS	.						68.0	61.0	63.0					19																	11134230		2203	4300	6503	SO:0001583	missense	6597	exon20			ATCATCCGGCGTC	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2896C>T	19.37:g.11134230C>T	ENSP00000395654:p.Arg966Trp	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	50	10	0.2	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.649626	0.87958	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22	4.9	4.9	0.64082	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.97145	0.9067	M	0.88906	2.99	0.58432	D	0.999998	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.994;0.965;0.999;0.999	D	0.97864	1.0282	10	0.87932	D	0	-18.8931	16.9975	0.86372	0.0:1.0:0.0:0.0	.	966;966;966;966;966;186;966;966	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	W	966;966;1030;966;966;966;966;966	ENSP00000395654:R966W;ENSP00000350720:R966W;ENSP00000343896:R966W;ENSP00000445036:R966W;ENSP00000392837:R966W;ENSP00000397783:R966W;ENSP00000414727:R966W	ENSP00000343896:R966W	R	+	1	2	SMARCA4	10995230	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	4.576000	0.60915	2.542000	0.85734	0.655000	0.94253	CGG	.	.	none		0.567	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
NCAM2	4685	hgsc.bcm.edu	37	21	22710786	22710786	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr21:22710786G>A	ENST00000400546.1	+	8	1225	c.976G>A	c.(976-978)Ggg>Agg	p.G326R	NCAM2_ENST00000535285.1_Missense_Mutation_p.G351R|NCAM2_ENST00000284894.7_Missense_Mutation_p.G184R	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	326	Ig-like C2-type 4.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TGATGCGGAAGGGGAGCCTAT	0.388																																					p.G326R		Atlas-SNP	.											.	NCAM2	220	.	0			c.G976A						PASS	.						69.0	66.0	67.0					21																	22710786		1894	4116	6010	SO:0001583	missense	4685	exon8			GCGGAAGGGGAGC		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.976G>A	21.37:g.22710786G>A	ENSP00000383392:p.Gly326Arg	Somatic	163	0	0		WXS	Illumina HiSeq	Phase_I	156	39	0.25	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852909	0.91355	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	T;T;T	0.79940	-1.32;-1.32;-1.32	5.8	5.8	0.92144	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.046370	0.85682	D	0.000000	D	0.93835	0.8028	H	0.97635	4.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95498	0.8575	10	0.87932	D	0	-16.7196	18.6141	0.91296	0.0:0.0:1.0:0.0	.	351;184;326	B7Z841;B7Z5K2;O15394	.;.;NCAM2_HUMAN	R	326;184;351	ENSP00000383392:G326R;ENSP00000284894:G184R;ENSP00000441887:G351R	ENSP00000284894:G184R	G	+	1	0	NCAM2	21632657	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	6.717000	0.74707	2.736000	0.93811	0.591000	0.81541	GGG	.	.	none		0.388	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
TPO	7173	hgsc.bcm.edu	37	2	1440080	1440080	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:1440080T>C	ENST00000345913.4	+	5	497	c.406T>C	c.(406-408)Tac>Cac	p.Y136H	TPO_ENST00000382198.1_Missense_Mutation_p.Y136H|TPO_ENST00000349624.3_Missense_Mutation_p.Y136H|TPO_ENST00000539820.1_Missense_Mutation_p.Y136H|TPO_ENST00000329066.4_Missense_Mutation_p.Y136H|TPO_ENST00000382269.3_Missense_Mutation_p.Y136H|TPO_ENST00000337415.3_Missense_Mutation_p.Y136H|TPO_ENST00000346956.3_Missense_Mutation_p.Y136H|TPO_ENST00000497517.2_Intron|TPO_ENST00000382201.3_Missense_Mutation_p.Y136H	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	136					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	ATGTCTCCCTTACATGCTGCC	0.428																																					p.Y136H		Atlas-SNP	.											.	TPO	224	.	0			c.T406C						PASS	.						148.0	139.0	142.0					2																	1440080		2203	4300	6503	SO:0001583	missense	7173	exon5			CTCCCTTACATGC		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.406T>C	2.37:g.1440080T>C	ENSP00000318820:p.Tyr136His	Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	107	34	0.317757	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	T	0.627	-0.818619	0.02776	.	.	ENSG00000115705	ENST00000382269;ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000539820;ENST00000329066;ENST00000382201;ENST00000423320;ENST00000382198;ENST00000422464	T;T;T;T;T;T;T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44	5.35	1.28	0.21552	.	1.077190	0.06972	N	0.818284	T	0.28267	0.0698	N	0.04018	-0.295	0.09310	N	1	B;B;B;B;B	0.16166	0.007;0.002;0.016;0.007;0.004	B;B;B;B;B	0.16722	0.009;0.004;0.016;0.005;0.002	T	0.22836	-1.0205	10	0.15952	T	0.53	-12.0061	7.5539	0.27812	0.0:0.2707:0.0:0.7293	.	136;136;136;136;136	P07202-4;P07202-5;E9PFM6;P07202-2;P07202	.;.;.;.;PERT_HUMAN	H	136;136;136;136;136;136;136;136;136;136;65	ENSP00000371704:Y136H;ENSP00000337263:Y136H;ENSP00000318820:Y136H;ENSP00000263886:Y136H;ENSP00000332044:Y136H;ENSP00000444840:Y136H;ENSP00000329869:Y136H;ENSP00000371636:Y136H;ENSP00000390994:Y136H;ENSP00000371633:Y136H;ENSP00000405788:Y65H	ENSP00000329869:Y136H	Y	+	1	0	TPO	1419087	0.007000	0.16637	0.078000	0.20375	0.040000	0.13550	-0.165000	0.09968	-0.013000	0.14199	0.260000	0.18958	TAC	.	.	none		0.428	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
NFATC2	4773	hgsc.bcm.edu	37	20	50048903	50048903	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:50048903G>A	ENST00000396009.3	-	9	2642	c.2423C>T	c.(2422-2424)tCg>tTg	p.S808L	NFATC2_ENST00000371564.3_Missense_Mutation_p.S808L|NFATC2_ENST00000610033.1_Missense_Mutation_p.S589L|NFATC2_ENST00000414705.1_Missense_Mutation_p.S788L|NFATC2_ENST00000609943.1_Missense_Mutation_p.S788L|NFATC2_ENST00000609507.1_Missense_Mutation_p.S589L	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	808					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S808L(2)	EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GATCACAGGCGAGGCCTGCTG	0.647																																					p.S808L		Atlas-SNP	.											NFATC2,NS,carcinoma,0,2	NFATC2	112	2	2	Substitution - Missense(2)	lung(2)	c.C2423T						PASS	.						47.0	50.0	49.0					20																	50048903		2203	4300	6503	SO:0001583	missense	4773	exon9			ACAGGCGAGGCCT	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.2423C>T	20.37:g.50048903G>A	ENSP00000379330:p.Ser808Leu	Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	65	22	0.338462	NM_012340	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780159	0.49891	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.18960	2.19;2.18;2.21	5.45	5.45	0.79879	.	0.135690	0.50627	D	0.000108	T	0.15003	0.0362	L	0.36672	1.1	0.48901	D	0.999727	P;P;D;P	0.54601	0.931;0.913;0.967;0.931	B;B;B;B	0.34489	0.081;0.17;0.173;0.184	T	0.12400	-1.0549	10	0.11794	T	0.64	-4.4372	19.296	0.94122	0.0:0.0:1.0:0.0	.	788;788;808;808	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	L	808;808;788	ENSP00000360619:S808L;ENSP00000379330:S808L;ENSP00000396471:S788L	ENSP00000360619:S808L	S	-	2	0	NFATC2	49482310	1.000000	0.71417	0.903000	0.35520	0.152000	0.21847	9.452000	0.97615	2.563000	0.86464	0.650000	0.86243	TCG	.	.	none		0.647	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
MIB2	142678	hgsc.bcm.edu	37	1	1565043	1565043	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:1565043G>A	ENST00000357210.4	+	19	2978	c.2762G>A	c.(2761-2763)tGc>tAc	p.C921Y	MMP23B_ENST00000378675.3_5'Flank|MIB2_ENST00000360522.4_Missense_Mutation_p.C886Y|MIB2_ENST00000355826.5_Missense_Mutation_p.C964Y|MIB2_ENST00000505820.2_Missense_Mutation_p.C978Y|MIB2_ENST00000378712.1_Silent_p.V737V|MIB2_ENST00000378708.1_Missense_Mutation_p.C827Y|MMP23B_ENST00000356026.5_5'Flank|MIB2_ENST00000518681.1_Missense_Mutation_p.C913Y|MIB2_ENST00000520777.1_Missense_Mutation_p.C974Y|MIB2_ENST00000378710.3_Missense_Mutation_p.C885Y|MIB2_ENST00000504599.1_Missense_Mutation_p.C877Y	NM_080875.2	NP_543151.2	Q96AX9	MIB2_HUMAN	mindbomb E3 ubiquitin protein ligase 2	921					Notch signaling pathway (GO:0007219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	early endosome (GO:0005769)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|lung(7)|prostate(4)|upper_aerodigestive_tract(1)	18	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ATGAAGAAGTGCATCAGGTGC	0.701																																					p.C978Y		Atlas-SNP	.											MIB2,NS,carcinoma,-1,1	MIB2	62	1	0			c.G2933A						PASS	.						34.0	41.0	39.0					1																	1565043		2090	4210	6300	SO:0001583	missense	142678	exon19			AGAAGTGCATCAG	AK097106	CCDS41224.1, CCDS41224.2, CCDS53261.1, CCDS53262.1, CCDS53263.1, CCDS53264.1	1p36.33	2013-01-10	2012-02-23	2005-04-01	ENSG00000197530	ENSG00000197530		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	30577	protein-coding gene	gene with protein product		611141	"""zinc finger, ZZ type with ankyrin repeat domain 1"", ""mindbomb homolog 2 (Drosophila)"""	ZZANK1		12761501	Standard	NM_080875		Approved	skeletrophin, ZZZ5, FLJ39787	uc001agg.3	Q96AX9	OTTHUMG00000074647	ENST00000357210.4:c.2762G>A	1.37:g.1565043G>A	ENSP00000349741:p.Cys921Tyr	Somatic	148	0	0		WXS	Illumina HiSeq	Phase_I	139	16	0.115108	NM_080875	A2AGM5|A2AGM6|B3KV93|B3KVF4|B3KXY1|B4DZ57|E9PGU1|E9PHQ1|F8WA73|J3KNZ7|Q7Z437|Q8IY62|Q8N786|Q8N897|Q8N8R2|Q8N911|Q8NB36|Q8NCY1|Q8NG59|Q8NG60|Q8NG61|Q8NI59|Q8WYN1	Missense_Mutation	SNP	ENST00000357210.4	37		.	.	.	.	.	.	.	.	.	.	g	20.5	3.999930	0.74818	.	.	ENSG00000197530	ENST00000520777;ENST00000357210;ENST00000360522;ENST00000378710;ENST00000355826;ENST00000518681;ENST00000505820;ENST00000504599;ENST00000378708	D;D;D;D;D;D;D;D;D	0.99656	-6.31;-6.31;-6.31;-6.31;-6.31;-6.31;-6.31;-6.31;-6.31	3.25	3.25	0.37280	Zinc finger, RING-type (2);	0.051571	0.85682	U	0.000000	D	0.99704	0.9887	H	0.95712	3.71	0.80722	D	1	D;D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.976;0.999;1.0;0.999;0.999;1.0	D	0.97157	0.9835	10	0.87932	D	0	-6.0944	13.9945	0.64388	0.0:0.0:1.0:0.0	.	886;827;913;974;907;921	Q96AX9-5;F2Z2L2;E9PHQ1;E9PGU1;Q96AX9-2;Q96AX9	.;.;.;.;.;MIB2_HUMAN	Y	974;921;886;885;964;913;978;877;827	ENSP00000428660:C974Y;ENSP00000349741:C921Y;ENSP00000353713:C886Y;ENSP00000367982:C885Y;ENSP00000348081:C964Y;ENSP00000428264:C913Y;ENSP00000426103:C978Y;ENSP00000426128:C877Y;ENSP00000367980:C827Y	ENSP00000348081:C964Y	C	+	2	0	MIB2	1554906	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	8.562000	0.90719	1.802000	0.52723	0.450000	0.29827	TGC	.	.	none		0.701	MIB2-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_080875	
ASCC3	10973	hgsc.bcm.edu	37	6	101037846	101037846	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:101037846G>A	ENST00000369162.2	-	35	5737	c.5393C>T	c.(5392-5394)tCc>tTc	p.S1798F		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1798					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		AATACAGTAGGAAAGTTCCAA	0.358																																					p.S1798F		Atlas-SNP	.											.	ASCC3	205	.	0			c.C5393T						PASS	.						82.0	80.0	81.0					6																	101037846		2203	4300	6503	SO:0001583	missense	10973	exon35			CAGTAGGAAAGTT	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.5393C>T	6.37:g.101037846G>A	ENSP00000358159:p.Ser1798Phe	Somatic	255	0	0		WXS	Illumina HiSeq	Phase_I	171	31	0.181287	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.581274	0.86748	.	.	ENSG00000112249	ENST00000369162	T	0.42513	0.97	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.65709	0.2717	M	0.86502	2.82	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.72327	-0.4327	10	0.87932	D	0	.	19.2468	0.93905	0.0:0.0:1.0:0.0	.	1798	Q8N3C0	HELC1_HUMAN	F	1798	ENSP00000358159:S1798F	ENSP00000358159:S1798F	S	-	2	0	ASCC3	101144567	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.802000	0.91910	2.558000	0.86282	0.579000	0.79373	TCC	.	.	none		0.358	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
ALPPL2	251	hgsc.bcm.edu	37	2	233272600	233272600	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:233272600C>T	ENST00000295453.3	+	5	573	c.521C>T	c.(520-522)tCg>tTg	p.S174L		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	174					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	CAGCATGCCTCGCCAGCCGGC	0.647																																					p.S174L		Atlas-SNP	.											.	ALPPL2	36	.	0			c.C521T						PASS	.						61.0	64.0	63.0					2																	233272600		2203	4300	6503	SO:0001583	missense	251	exon5			ATGCCTCGCCAGC	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.521C>T	2.37:g.233272600C>T	ENSP00000295453:p.Ser174Leu	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	87	24	0.275862	NM_031313	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	37	CCDS2491.1	.	.	.	.	.	.	.	.	.	.	c	15.41	2.826270	0.50739	.	.	ENSG00000163286	ENST00000295453	D	0.96685	-4.09	2.71	2.71	0.32032	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.98520	0.9506	H	0.96208	3.785	0.58432	D	0.999998	D	0.76494	0.999	D	0.69824	0.966	D	0.99323	1.0907	10	0.87932	D	0	.	13.8099	0.63256	0.0:1.0:0.0:0.0	.	174	P10696	PPBN_HUMAN	L	174	ENSP00000295453:S174L	ENSP00000295453:S174L	S	+	2	0	ALPPL2	232980844	0.997000	0.39634	0.221000	0.23827	0.012000	0.07955	7.137000	0.77295	1.499000	0.48617	0.205000	0.17691	TCG	.	.	none		0.647	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2	NM_031313	
TNFAIP3	7128	hgsc.bcm.edu	37	6	138200319	138200319	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:138200319C>A	ENST00000237289.4	+	7	1803	c.1737C>A	c.(1735-1737)tgC>tgA	p.C579*		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	579	Interaction with TNIP1. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		CGCATTCTTGCCACAGAGCTG	0.657			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																p.C579X	GBM(130;153 1739 22295 28918 47987)	Atlas-SNP	.		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	.	TNFAIP3	340	.	25	Whole gene deletion(25)	haematopoietic_and_lymphoid_tissue(25)	c.C1737A						PASS	.						48.0	54.0	52.0					6																	138200319		2203	4300	6503	SO:0001587	stop_gained	7128	exon7			TTCTTGCCACAGA	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1737C>A	6.37:g.138200319C>A	ENSP00000237289:p.Cys579*	Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	40	11	0.275	NM_001270507	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Nonsense_Mutation	SNP	ENST00000237289.4	37	CCDS5187.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062660	0.76187	.	.	ENSG00000118503	ENST00000237289;ENST00000535574;ENST00000544646	.	.	.	5.58	3.81	0.43845	.	0.307688	0.37053	N	0.002263	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.4105	10.5766	0.45231	0.0:0.8502:0.0:0.1498	.	.	.	.	X	579	.	ENSP00000237289:C579X	C	+	3	2	TNFAIP3	138242012	0.641000	0.27251	1.000000	0.80357	0.025000	0.11179	0.166000	0.16583	0.733000	0.32492	-0.254000	0.11334	TGC	.	.	none		0.657	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1		
CNOT2	4848	hgsc.bcm.edu	37	12	70724111	70724111	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr12:70724111A>G	ENST00000418359.3	+	7	882	c.431A>G	c.(430-432)cAg>cGg	p.Q144R	CNOT2_ENST00000229195.3_Missense_Mutation_p.Q144R|CNOT2_ENST00000548230.1_3'UTR	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	144					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			AACCACTCCCAGGTTGGTCAG	0.418																																					p.Q144R		Atlas-SNP	.											CNOT2,colon,carcinoma,-1,1	CNOT2	53	1	0			c.A431G						PASS	.						112.0	106.0	108.0					12																	70724111		2203	4300	6503	SO:0001583	missense	4848	exon7			ACTCCCAGGTTGG	AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		ENST00000418359.3:c.431A>G	12.37:g.70724111A>G	ENSP00000412091:p.Gln144Arg	Somatic	168	0	0		WXS	Illumina HiSeq	Phase_I	163	64	0.392638	NM_001199302	Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Missense_Mutation	SNP	ENST00000418359.3	37	CCDS31857.1	.	.	.	.	.	.	.	.	.	.	A	17.42	3.385262	0.61956	.	.	ENSG00000111596	ENST00000552231;ENST00000229195;ENST00000418359;ENST00000550641;ENST00000548159;ENST00000549750;ENST00000551043;ENST00000551873;ENST00000550194	T;T;T;T	0.46063	0.88;0.88;0.89;0.88	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.44746	0.1308	L	0.32530	0.975	0.80722	D	1	D	0.58268	0.982	P	0.54270	0.747	T	0.17868	-1.0355	10	0.16896	T	0.51	-2.8571	15.9985	0.80270	1.0:0.0:0.0:0.0	.	144	Q9NZN8	CNOT2_HUMAN	R	144;144;144;124;135;144;144;59;144	ENSP00000229195:Q144R;ENSP00000412091:Q144R;ENSP00000449659:Q135R;ENSP00000449260:Q144R	ENSP00000229195:Q144R	Q	+	2	0	CNOT2	69010378	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.287000	0.95975	2.233000	0.73108	0.455000	0.32223	CAG	.	.	none		0.418	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404260.1		
NCKAP1	10787	hgsc.bcm.edu	37	2	183866768	183866768	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:183866768G>A	ENST00000361354.4	-	6	888	c.516C>T	c.(514-516)gaC>gaT	p.D172D	NCKAP1_ENST00000360982.2_Silent_p.D178D	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	172					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			GGTATTCTCTGTCACTTAAAA	0.368																																					p.D178D		Atlas-SNP	.											.	NCKAP1	105	.	0			c.C534T						PASS	.						142.0	142.0	142.0					2																	183866768		2203	4300	6503	SO:0001819	synonymous_variant	10787	exon7			TTCTCTGTCACTT	AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.516C>T	2.37:g.183866768G>A		Somatic	238	0	0		WXS	Illumina HiSeq	Phase_I	237	51	0.21519	NM_205842	O60329|Q53QN5|Q53S94|Q53Y35	Silent	SNP	ENST00000361354.4	37	CCDS2287.1																																																																																			.	.	none		0.368	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842	
FSIP2	401024	hgsc.bcm.edu	37	2	186671505	186671505	+	Silent	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:186671505C>G	ENST00000424728.1	+	17	17472	c.17472C>G	c.(17470-17472)ctC>ctG	p.L5824L	FSIP2_ENST00000343098.5_Silent_p.L5913L			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5824				L -> P (in Ref. 2; CAI46017). {ECO:0000305}.						NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AAGCCAAACTCTATGACACTG	0.358																																					p.L5913L		Atlas-SNP	.											FSIP2_ENST00000343098,NS,carcinoma,+2,2	FSIP2	251	2	0			c.C17739G						PASS	.						89.0	83.0	85.0					2																	186671505		1854	4092	5946	SO:0001819	synonymous_variant	401024	exon17			CAAACTCTATGAC	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.17472C>G	2.37:g.186671505C>G		Somatic	249	0	0		WXS	Illumina HiSeq	Phase_I	201	57	0.283582	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Silent	SNP	ENST00000424728.1	37																																																																																				.	.	none		0.358	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
TBC1D9	23158	hgsc.bcm.edu	37	4	141560570	141560570	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:141560570T>G	ENST00000442267.2	-	14	2424	c.2350A>C	c.(2350-2352)Atc>Ctc	p.I784L		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	784							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TCTGCCCGGATAGTTCCGAAT	0.433																																					p.I784L		Atlas-SNP	.											.	TBC1D9	198	.	0			c.A2350C						PASS	.						60.0	58.0	59.0					4																	141560570		1893	4113	6006	SO:0001583	missense	23158	exon14			CCCGGATAGTTCC	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.2350A>C	4.37:g.141560570T>G	ENSP00000411197:p.Ile784Leu	Somatic	116	0	0		WXS	Illumina HiSeq	Phase_I	114	45	0.394737	NM_015130	A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	ENST00000442267.2	37	CCDS47136.1	.	.	.	.	.	.	.	.	.	.	T	11.45	1.641600	0.29157	.	.	ENSG00000109436	ENST00000442267	T	0.08896	3.04	5.12	5.12	0.69794	Rab-GAP/TBC domain (1);	0.000000	0.85682	D	0.000000	T	0.05227	0.0139	N	0.05592	-0.015	0.80722	D	1	B	0.11235	0.004	B	0.11329	0.006	T	0.45145	-0.9281	10	0.20519	T	0.43	-10.5614	15.2296	0.73378	0.0:0.0:0.0:1.0	.	784	Q6ZT07	TBCD9_HUMAN	L	784	ENSP00000411197:I784L	ENSP00000411197:I784L	I	-	1	0	TBC1D9	141780020	1.000000	0.71417	0.964000	0.40570	0.998000	0.95712	7.897000	0.87356	2.052000	0.61016	0.533000	0.62120	ATC	.	.	none		0.433	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
SOCS1	8651	hgsc.bcm.edu	37	16	11348889	11348889	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:11348889C>G	ENST00000332029.2	-	2	597	c.447G>C	c.(445-447)gaG>gaC	p.E149D	RMI2_ENST00000572173.1_Intron	NM_003745.1	NP_003736.1	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	149	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cellular response to amino acid stimulus (GO:0071230)|cytokine-mediated signaling pathway (GO:0019221)|fat cell differentiation (GO:0045444)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein phosphorylation (GO:0001932)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	insulin-like growth factor receptor binding (GO:0005159)|kinase inhibitor activity (GO:0019210)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.F144fs*34(1)|p.D145_L150>EV(1)|p.Y64fs*1(1)|p.R127_*212del(1)|p.0?(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(66)|lung(3)	71						GCTCCAGCAGCTCGAAGAGGC	0.721			"""F, O"""		"""Hodgkin Lymphoma, PMBL"""																																p.E149D	Colon(177;456 3548 27231)	Atlas-SNP	.		Rec	yes		16	16p13.13	8651	suppressor of cytokine signaling 1		L	.	SOCS1	84	.	5	Deletion - Frameshift(2)|Whole gene deletion(1)|Complex - deletion inframe(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(5)	c.G447C						PASS	.						11.0	13.0	12.0					16																	11348889		2160	4263	6423	SO:0001583	missense	8651	exon2			CAGCAGCTCGAAG	U88326	CCDS10546.1	16p13.13	2013-02-14			ENSG00000185338	ENSG00000185338		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19383	protein-coding gene	gene with protein product		603597				7796808, 9266833	Standard	NM_003745		Approved	SOCS-1, SSI-1, JAB, TIP3, Cish1	uc002dar.1	O15524	OTTHUMG00000129792	ENST00000332029.2:c.447G>C	16.37:g.11348889C>G	ENSP00000329418:p.Glu149Asp	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	67	20	0.298507	NM_003745	O15097|Q9NSA7	Missense_Mutation	SNP	ENST00000332029.2	37	CCDS10546.1	.	.	.	.	.	.	.	.	.	.	C	9.253	1.041146	0.19669	.	.	ENSG00000185338	ENST00000332029	D	0.89050	-2.46	4.06	3.11	0.35812	SH2 motif (4);	0.549051	0.19105	U	0.122583	T	0.78175	0.4242	N	0.16862	0.45	0.28270	N	0.924431	B	0.21821	0.061	B	0.22152	0.038	T	0.63152	-0.6701	10	0.14252	T	0.57	-16.6032	11.0722	0.48010	0.0:0.9084:0.0:0.0916	.	149	O15524	SOCS1_HUMAN	D	149	ENSP00000329418:E149D	ENSP00000329418:E149D	E	-	3	2	SOCS1	11256390	0.998000	0.40836	1.000000	0.80357	0.838000	0.47535	1.217000	0.32455	0.930000	0.37217	-0.448000	0.05591	GAG	.	.	none		0.721	SOCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252018.1		
BRCA1	672	hgsc.bcm.edu	37	17	41245531	41245531	+	Missense_Mutation	SNP	C	C	T	rs80357638|rs80357391		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:41245531C>T	ENST00000357654.3	-	10	2135	c.2017G>A	c.(2017-2019)Gaa>Aaa	p.E673K	BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_Missense_Mutation_p.E377K|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000346315.3_Missense_Mutation_p.E673K|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000471181.2_Missense_Mutation_p.E673K|BRCA1_ENST00000493795.1_Missense_Mutation_p.E626K|BRCA1_ENST00000354071.3_Missense_Mutation_p.E673K|BRCA1_ENST00000468300.1_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	673					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GTTGCAGGTTCTTTACCTTCC	0.408			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.E673K		Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	BRCA1,NS,carcinoma,0,1	BRCA1	304	1	0			c.G2017A						PASS	.						111.0	98.0	103.0					17																	41245531		2202	4300	6502	SO:0001583	missense	672	exon10	Familial Cancer Database		CAGGTTCTTTACC	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.2017G>A	17.37:g.41245531C>T	ENSP00000350283:p.Glu673Lys	Somatic	323	0	0		WXS	Illumina HiSeq	Phase_I	223	40	0.179372	NM_007300	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	37	CCDS11453.1	.	.	.	.	.	.	.	.	.	.	C	15.75	2.925121	0.52759	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000309486;ENST00000471181;ENST00000493795	D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	4.95	4.95	0.65309	.	0.000000	0.56097	D	0.000028	D	0.93054	0.7789	M	0.92555	3.32	0.36954	D	0.893016	D;D;D;P;P;P	0.89917	1.0;1.0;0.987;0.877;0.707;0.851	D;D;D;P;P;P	0.97110	1.0;1.0;0.963;0.627;0.838;0.55	D	0.95953	0.8956	10	0.87932	D	0	.	16.5462	0.84446	0.0:1.0:0.0:0.0	.	673;632;673;673;673;673	E7EMP0;E7ERL4;Q5YLB2;E9PFC7;P38398;P38398-2	.;.;.;.;BRCA1_HUMAN;.	K	673;673;673;673;377;673;626	ENSP00000350283:E673K;ENSP00000326002:E673K;ENSP00000246907:E673K;ENSP00000310938:E377K;ENSP00000418960:E673K;ENSP00000418775:E626K	ENSP00000310938:E377K	E	-	1	0	BRCA1	38499057	0.991000	0.36638	0.596000	0.28811	0.097000	0.18754	3.270000	0.51600	2.581000	0.87130	0.561000	0.74099	GAA	.	.	alt		0.408	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
PCDH15	65217	hgsc.bcm.edu	37	10	55943228	55943228	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:55943228C>T	ENST00000320301.6	-	13	1960	c.1566G>A	c.(1564-1566)atG>atA	p.M522I	PCDH15_ENST00000395432.2_Missense_Mutation_p.M485I|PCDH15_ENST00000395446.1_Missense_Mutation_p.M522I|PCDH15_ENST00000395430.1_Missense_Mutation_p.M522I|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000409834.1_Missense_Mutation_p.M133I|PCDH15_ENST00000373957.3_Missense_Mutation_p.M500I|PCDH15_ENST00000395445.1_Missense_Mutation_p.M529I|PCDH15_ENST00000361849.3_Missense_Mutation_p.M522I|PCDH15_ENST00000414778.1_Missense_Mutation_p.M527I|PCDH15_ENST00000373965.2_Missense_Mutation_p.M529I|PCDH15_ENST00000437009.1_Missense_Mutation_p.M522I|PCDH15_ENST00000373955.1_Missense_Mutation_p.M522I|PCDH15_ENST00000395438.1_Missense_Mutation_p.M522I|PCDH15_ENST00000395433.1_Missense_Mutation_p.M500I	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	522	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CCCCAGGTCTCATGTCTGTAT	0.378										HNSCC(58;0.16)																											p.M527I		Atlas-SNP	.											.	PCDH15	1715	.	0			c.G1581A						PASS	.						225.0	197.0	207.0					10																	55943228		2203	4300	6503	SO:0001583	missense	65217	exon14			AGGTCTCATGTCT	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1566G>A	10.37:g.55943228C>T	ENSP00000322604:p.Met522Ile	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	128	32	0.25	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.727702	0.30593	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395446;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75	5.12	5.12	0.69794	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.45196	0.1330	L	0.31476	0.935	0.80722	D	1	P;B;B;B;P;P;P;B;B;B;B;B;B;B;B	0.43024	0.771;0.333;0.392;0.392;0.798;0.592;0.771;0.099;0.182;0.182;0.044;0.099;0.028;0.094;0.333	P;B;B;B;B;B;P;B;B;B;B;B;B;B;B	0.48334	0.574;0.241;0.173;0.348;0.326;0.241;0.574;0.085;0.241;0.173;0.101;0.058;0.03;0.05;0.241	T	0.42582	-0.9443	9	0.56958	D	0.05	.	12.7668	0.57396	0.1643:0.8357:0.0:0.0	.	500;522;522;527;522;485;522;522;529;529;522;527;522;500;522	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	I	529;527;522;522;133;529;522;485;522;500;500;522;522;527;522;522	ENSP00000363076:M529I;ENSP00000410304:M527I;ENSP00000378826:M522I;ENSP00000386693:M133I;ENSP00000378832:M529I;ENSP00000378833:M522I;ENSP00000378820:M485I;ENSP00000354950:M522I;ENSP00000378821:M500I;ENSP00000363068:M500I;ENSP00000322604:M522I;ENSP00000378818:M522I;ENSP00000412628:M522I;ENSP00000363066:M522I	ENSP00000322604:M522I	M	-	3	0	PCDH15	55613234	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	5.624000	0.67764	2.546000	0.85860	0.655000	0.94253	ATG	.	.	none		0.378	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
ATR	545	hgsc.bcm.edu	37	3	142286975	142286975	+	Missense_Mutation	SNP	A	A	T	rs545455583		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:142286975A>T	ENST00000350721.4	-	2	202	c.81T>A	c.(79-81)aaT>aaA	p.N27K	ATR_ENST00000383101.3_Missense_Mutation_p.N27K	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	27					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						GTACAACTGTATTATATTCCT	0.299								Other conserved DNA damage response genes																													p.N27K		Atlas-SNP	.											ATR,NS,carcinoma,-1,1	ATR	285	1	0			c.T81A						PASS	.						68.0	71.0	70.0					3																	142286975		2203	4293	6496	SO:0001583	missense	545	exon2			AACTGTATTATAT	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.81T>A	3.37:g.142286975A>T	ENSP00000343741:p.Asn27Lys	Somatic	639	0	0		WXS	Illumina HiSeq	Phase_I	452	49	0.108407	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	A	17.80	3.477270	0.63849	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.35048	1.33;1.33	4.94	-1.9	0.07665	.	0.051950	0.85682	D	0.000000	T	0.39759	0.1090	L	0.57536	1.79	0.24160	N	0.995664	D	0.58268	0.982	P	0.50109	0.631	T	0.47898	-0.9081	10	0.59425	D	0.04	-16.858	13.1989	0.59756	0.4646:0.0:0.5354:0.0	.	27	Q13535	ATR_HUMAN	K	27	ENSP00000343741:N27K;ENSP00000372581:N27K	ENSP00000343741:N27K	N	-	3	2	ATR	143769665	1.000000	0.71417	0.920000	0.36463	0.854000	0.48673	1.322000	0.33689	-0.230000	0.09840	0.383000	0.25322	AAT	.	.	none		0.299	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
C1QTNF1	114897	hgsc.bcm.edu	37	17	77043849	77043849	+	Silent	SNP	C	C	T	rs566729160		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr17:77043849C>T	ENST00000339142.2	+	5	1080	c.525C>T	c.(523-525)taC>taT	p.Y175Y	C1QTNF1_ENST00000582625.1_3'UTR|C1QTNF1_ENST00000311661.4_Silent_p.Y93Y|C1QTNF1_ENST00000354124.3_Silent_p.Y185Y|C1QTNF1_ENST00000583904.1_Silent_p.Y175Y|C1QTNF1_ENST00000580454.1_Silent_p.Y175Y|C1QTNF1_ENST00000581774.1_Silent_p.Y175Y|C1QTNF1_ENST00000392445.2_Silent_p.Y175Y|C1QTNF1_ENST00000579760.1_Silent_p.Y175Y|C1QTNF1_ENST00000578229.1_Silent_p.Y93Y|C1QTNF1_ENST00000580474.1_Silent_p.Y175Y	NM_198593.3	NP_940995.1	Q9BXJ1	C1QT1_HUMAN	C1q and tumor necrosis factor related protein 1	175	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase B signaling (GO:0051897)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|regulation of glucose metabolic process (GO:0010906)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(2)	14			BRCA - Breast invasive adenocarcinoma(99;0.0294)|OV - Ovarian serous cystadenocarcinoma(97;0.201)			TGAACCTCTACGACCACTTCA	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		19992	0.0		0.001	False		,,,				2504	0.0				p.Y175Y		Atlas-SNP	.											.	C1QTNF1	62	.	0			c.C525T						PASS	.						161.0	146.0	151.0					17																	77043849		2203	4300	6503	SO:0001819	synonymous_variant	114897	exon4			CCTCTACGACCAC	AF329840	CCDS11761.1, CCDS11762.1	17q25	2012-07-02			ENSG00000173918	ENSG00000173918			14324	protein-coding gene	gene with protein product	"""G protein coupled receptor interacting protein"""	610365				12409230	Standard	NM_198593		Approved	CTRP1, ZSIG37, GIP, FLJ90694	uc002jwp.4	Q9BXJ1	OTTHUMG00000177533	ENST00000339142.2:c.525C>T	17.37:g.77043849C>T		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	60	24	0.4	NM_030968	Q6ZMH6|Q96NF2|Q9GZR4	Silent	SNP	ENST00000339142.2	37	CCDS11761.1																																																																																			.	.	none		0.562	C1QTNF1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437388.2	NM_030968	
NPR2	4882	hgsc.bcm.edu	37	9	35792654	35792654	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:35792654C>A	ENST00000342694.2	+	1	504	c.249C>A	c.(247-249)agC>agA	p.S83R		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	83					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CACCGCTGAGCGCTGTGGACC	0.657																																					p.S83R		Atlas-SNP	.											.	NPR2	162	.	0			c.C249A						PASS	.						104.0	96.0	98.0					9																	35792654		2203	4300	6503	SO:0001583	missense	4882	exon1			GCTGAGCGCTGTG	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.249C>A	9.37:g.35792654C>A	ENSP00000341083:p.Ser83Arg	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	134	36	0.268657	NM_003995	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	37	CCDS6590.1	.	.	.	.	.	.	.	.	.	.	C	6.986	0.551947	0.13374	.	.	ENSG00000159899	ENST00000342694	D	0.83914	-1.78	3.93	1.05	0.20165	Extracellular ligand-binding receptor (1);	0.669254	0.13196	N	0.406396	T	0.65943	0.2740	N	0.24115	0.695	0.23972	N	0.996303	B;B	0.06786	0.0;0.001	B;B	0.11329	0.001;0.006	T	0.47169	-0.9138	10	0.13470	T	0.59	.	4.9576	0.14050	0.0:0.5488:0.1602:0.291	.	83;83	P20594-2;P20594	.;ANPRB_HUMAN	R	83	ENSP00000341083:S83R	ENSP00000341083:S83R	S	+	3	2	NPR2	35782654	0.011000	0.17503	1.000000	0.80357	0.976000	0.68499	-0.047000	0.11963	0.432000	0.26286	0.563000	0.77884	AGC	.	.	none		0.657	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
ZKSCAN7	55888	hgsc.bcm.edu	37	3	44612048	44612048	+	Silent	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr3:44612048C>G	ENST00000273320.3	+	6	1875	c.1446C>G	c.(1444-1446)ctC>ctG	p.L482L	ZKSCAN7_ENST00000426540.1_Silent_p.L482L|ZKSCAN7_ENST00000341840.3_Intron|RP11-944L7.5_ENST00000419137.1_Intron|ZKSCAN7_ENST00000431636.1_Intron|RP11-944L7.4_ENST00000457331.1_RNA	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	482					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GTTCCCGACTCACTGACCACC	0.468																																					p.L482L		Atlas-SNP	.											.	.	.	.	0			c.C1446G						PASS	.						94.0	96.0	95.0					3																	44612048		2203	4300	6503	SO:0001819	synonymous_variant	55888	exon6			CCGACTCACTGAC	L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1446C>G	3.37:g.44612048C>G		Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	88	23	0.261364	NM_018651	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Silent	SNP	ENST00000273320.3	37	CCDS2715.1																																																																																			.	.	none		0.468	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256752.4	NM_018651	
BCL9L	283149	hgsc.bcm.edu	37	11	118780644	118780644	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:118780644C>T	ENST00000334801.3	-	1	969	c.5G>A	c.(4-6)aGg>aAg	p.R2K	BCL9L_ENST00000526143.1_Intron|MIR4492_ENST00000581627.1_RNA	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	2					canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		AGCCAGGATCCTCATGGCTCC	0.637																																					p.R2K		Atlas-SNP	.											.	BCL9L	254	.	0			c.G5A						PASS	.						213.0	128.0	157.0					11																	118780644		2200	4295	6495	SO:0001583	missense	283149	exon1			AGGATCCTCATGG	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.5G>A	11.37:g.118780644C>T	ENSP00000335320:p.Arg2Lys	Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	63	29	0.460317	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	37	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.648175	0.67358	.	.	ENSG00000186174	ENST00000334801;ENST00000392849;ENST00000431085;ENST00000532899	T	0.65916	-0.18	4.35	4.35	0.52113	.	0.000000	0.41712	D	0.000826	T	0.41604	0.1166	N	0.08118	0	0.26380	N	0.976745	B;B	0.24651	0.108;0.066	B;B	0.19391	0.025;0.011	T	0.46541	-0.9184	10	0.87932	D	0	-23.7519	12.56	0.56275	0.0:1.0:0.0:0.0	.	2;2	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	K	2	ENSP00000335320:R2K	ENSP00000335320:R2K	R	-	2	0	BCL9L	118285854	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.249000	0.32839	2.415000	0.81967	0.555000	0.69702	AGG	.	.	none		0.637	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
PDHA1	5160	hgsc.bcm.edu	37	X	19369482	19369482	+	Silent	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chrX:19369482C>T	ENST00000422285.2	+	4	480	c.375C>T	c.(373-375)ttC>ttT	p.F125F	PDHA1_ENST00000379805.3_Silent_p.F125F|PDHA1_ENST00000540249.1_Silent_p.F125F|PDHA1_ENST00000545074.1_Silent_p.F132F|PDHA1_ENST00000379806.5_Silent_p.F163F			P08559	ODPA_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 1	125					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)	18	Hepatocellular(33;0.183)					GCTTTACTTTCACCCGGGGCC	0.502																																					p.F163F		Atlas-SNP	.											.	PDHA1	85	.	0			c.C489T						PASS	.						104.0	97.0	99.0					X																	19369482		2203	4300	6503	SO:0001819	synonymous_variant	5160	exon5			TACTTTCACCCGG		CCDS14192.1, CCDS55380.1, CCDS55381.1, CCDS55382.1	Xp22.1	2008-02-05			ENSG00000131828	ENSG00000131828	1.2.4.1		8806	protein-coding gene	gene with protein product		300502		PDHA			Standard	NM_001173454		Approved		uc004czh.4	P08559	OTTHUMG00000021224	ENST00000422285.2:c.375C>T	X.37:g.19369482C>T		Somatic	245	0	0		WXS	Illumina HiSeq	Phase_I	273	181	0.663004	NM_001173454	A5YVE9|B2R5P7|B7Z3T7|B7Z3X5|Q53H41|Q5JPT8|Q9NP12|Q9UBJ8|Q9UBU0|Q9UNG4|Q9UNG5	Silent	SNP	ENST00000422285.2	37	CCDS14192.1																																																																																			.	.	none		0.502	PDHA1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055977.1		
HIST1H2AK	8330	hgsc.bcm.edu	37	6	27805994	27805994	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr6:27805994C>A	ENST00000330180.2	-	1	123	c.124G>T	c.(124-126)Gag>Tag	p.E42*	HIST1H2BN_ENST00000606613.1_5'Flank|HIST1H2BN_ENST00000396980.3_5'Flank	NM_003510.2	NP_003501.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ak	42						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			breast(2)|endometrium(2)|kidney(1)|lung(3)|upper_aerodigestive_tract(2)	10						CCGACCCGCTCAGCGTAGTTG	0.657																																					p.E42X		Atlas-SNP	.											HIST1H2AK,bladder,carcinoma,0,1	HIST1H2AK	28	1	0			c.G124T						PASS	.						39.0	42.0	41.0					6																	27805994		2203	4300	6503	SO:0001587	stop_gained	8330	exon1			CCCGCTCAGCGTA	Z83739	CCDS4632.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000184348	ENSG00000275221		"""Histones / Replication-dependent"""	4726	protein-coding gene	gene with protein product		602788	"""H2A histone family, member D"", ""histone 1, H2ak"""	H2AFD		9439656, 12408966	Standard	NM_003510		Approved	H2A/d	uc003njs.3	P0C0S8	OTTHUMG00000016382	ENST00000330180.2:c.124G>T	6.37:g.27805994C>A	ENSP00000330307:p.Glu42*	Somatic	114	0	0		WXS	Illumina HiSeq	Phase_I	120	38	0.316667	NM_003510	P02261|Q2M1R2|Q76PA6	Nonsense_Mutation	SNP	ENST00000330180.2	37	CCDS4632.1	.	.	.	.	.	.	.	.	.	.	.	14.23	2.474898	0.43942	.	.	ENSG00000184348	ENST00000330180	.	.	.	4.42	3.54	0.40534	.	0.000000	0.31381	U	0.007755	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	7.5482	0.27778	0.0:0.737:0.1708:0.0922	.	.	.	.	X	42	.	ENSP00000330307:E42X	E	-	1	0	HIST1H2AK	27913973	0.693000	0.27728	0.921000	0.36526	0.242000	0.25591	1.349000	0.33998	2.369000	0.80426	0.655000	0.94253	GAG	.	.	none		0.657	HIST1H2AK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043814.1	NM_003510	
CHRM3	1131	hgsc.bcm.edu	37	1	240071401	240071401	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:240071401C>A	ENST00000255380.4	+	5	1429	c.650C>A	c.(649-651)cCt>cAt	p.P217H		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	217					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	AGAACTGTGCCTCCGGGAGAG	0.483																																					p.P217H		Atlas-SNP	.											CHRM3,NS,malignant_melanoma,0,2	CHRM3	118	2	0			c.C650A						PASS	.						156.0	161.0	160.0					1																	240071401		2203	4300	6503	SO:0001583	missense	1131	exon5			CTGTGCCTCCGGG	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.650C>A	1.37:g.240071401C>A	ENSP00000255380:p.Pro217His	Somatic	208	0	0		WXS	Illumina HiSeq	Phase_I	160	22	0.1375	NM_000740	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	ENST00000255380.4	37	CCDS1616.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704655	0.68615	.	.	ENSG00000133019	ENST00000255380	T	0.38560	1.13	5.79	5.79	0.91817	GPCR, rhodopsin-like superfamily (1);	0.182925	0.47852	D	0.000212	T	0.57829	0.2080	L	0.56280	1.765	0.80722	D	1	D	0.64830	0.994	P	0.62491	0.903	T	0.58272	-0.7665	10	0.72032	D	0.01	-22.6919	15.6263	0.76859	0.1379:0.8621:0.0:0.0	.	217	P20309	ACM3_HUMAN	H	217	ENSP00000255380:P217H	ENSP00000255380:P217H	P	+	2	0	CHRM3	238138024	1.000000	0.71417	0.977000	0.42913	0.912000	0.54170	4.831000	0.62752	2.731000	0.93534	0.650000	0.86243	CCT	.	.	none		0.483	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740	
NSDHL	50814	hgsc.bcm.edu	37	X	152034408	152034408	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chrX:152034408G>A	ENST00000370274.3	+	6	783	c.589G>A	c.(589-591)Gcc>Acc	p.A197T	NSDHL_ENST00000440023.1_Missense_Mutation_p.A197T	NM_015922.2	NP_057006.1	Q15738	NSDHL_HUMAN	NAD(P) dependent steroid dehydrogenase-like	197					cholesterol biosynthetic process (GO:0006695)|hair follicle development (GO:0001942)|labyrinthine layer blood vessel development (GO:0060716)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|sterol-4-alpha-carboxylate 3-dehydrogenase (decarboxylating) activity (GO:0047012)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(5)	15	Acute lymphoblastic leukemia(192;6.56e-05)					CTTAACCACAGCCATCCGCCC	0.567																																					p.A197T		Atlas-SNP	.											.	NSDHL	33	.	0			c.G589A						PASS	.						123.0	112.0	116.0					X																	152034408		2203	4300	6503	SO:0001583	missense	50814	exon6			ACCACAGCCATCC	X96621	CCDS14717.1	Xq28	2011-09-14			ENSG00000147383	ENSG00000147383	1.1.1.170	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	13398	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 31E, member 1"""	300275				10710235, 12837764, 19027726	Standard	NM_015922		Approved	XAP104, H105e3, SDR31E1	uc004fgs.1	Q15738	OTTHUMG00000024185	ENST00000370274.3:c.589G>A	X.37:g.152034408G>A	ENSP00000359297:p.Ala197Thr	Somatic	25	0	0		WXS	Illumina HiSeq	Phase_I	43	27	0.627907	NM_015922	D3DWT6|O00344	Missense_Mutation	SNP	ENST00000370274.3	37	CCDS14717.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711312	0.89112	.	.	ENSG00000147383	ENST00000370274;ENST00000440023;ENST00000432467	D;D;D	0.90955	-2.76;-2.76;-2.76	5.89	5.02	0.67125	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95027	0.8390	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.95132	0.8256	10	0.66056	D	0.02	-0.1274	13.7626	0.62975	0.0:0.1506:0.8494:0.0	.	197	Q15738	NSDHL_HUMAN	T	197	ENSP00000359297:A197T;ENSP00000391854:A197T;ENSP00000396266:A197T	ENSP00000359297:A197T	A	+	1	0	NSDHL	151785064	1.000000	0.71417	0.832000	0.32986	0.674000	0.39518	9.869000	0.99810	1.239000	0.43787	0.529000	0.55759	GCC	.	.	none		0.567	NSDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060927.1	NM_015922	
CCDC88B	283234	hgsc.bcm.edu	37	11	64121559	64121559	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:64121559G>A	ENST00000356786.5	+	24	4060	c.4016G>A	c.(4015-4017)gGg>gAg	p.G1339E	CCDC88B_ENST00000301897.4_Intron|CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000359902.2_Intron	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	1339						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						ctgcgcctgggggccgATGGG	0.741																																					p.G1339E		Atlas-SNP	.											.	CCDC88B	89	.	0			c.G4016A						PASS	.						5.0	6.0	6.0					11																	64121559		1975	3971	5946	SO:0001583	missense	283234	exon24			GCCTGGGGGCCGA	AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.4016G>A	11.37:g.64121559G>A	ENSP00000349238:p.Gly1339Glu	Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	73	38	0.520548	NM_032251	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	ENST00000356786.5	37	CCDS8072.2	.	.	.	.	.	.	.	.	.	.	g	17.82	3.482314	0.63962	.	.	ENSG00000168071	ENST00000377638;ENST00000356786	T	0.22945	1.93	2.87	2.87	0.33458	.	.	.	.	.	T	0.33177	0.0854	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.963;0.999	T	0.05435	-1.0885	9	0.12766	T	0.61	.	9.3241	0.37982	0.0:0.0:1.0:0.0	.	1339;1221;1339	B2RTU8;A6NC98-4;A6NC98	.;.;CC88B_HUMAN	E	1221;1339	ENSP00000349238:G1339E	ENSP00000349238:G1339E	G	+	2	0	CCDC88B	63878135	0.997000	0.39634	1.000000	0.80357	0.986000	0.74619	0.486000	0.22340	1.582000	0.49881	0.457000	0.33378	GGG	.	.	none		0.741	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1	NM_032251	
PHLPP2	23035	hgsc.bcm.edu	37	16	71683436	71683436	+	Nonsense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:71683436A>T	ENST00000568954.1	-	19	3707	c.3329T>A	c.(3328-3330)tTg>tAg	p.L1110*	PHLPP2_ENST00000356272.3_Nonsense_Mutation_p.L1110*|PHLPP2_ENST00000393524.2_Nonsense_Mutation_p.L1043*|PHLPP2_ENST00000540628.1_Intron|PHLPP2_ENST00000360429.3_Intron|PHLPP2_ENST00000567016.1_Nonsense_Mutation_p.L1145*			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	1110					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						CCTCGGAAGCAAGGCAGTGTC	0.592																																					p.L1110X		Atlas-SNP	.											.	PHLPP2	96	.	0			c.T3329A						PASS	.						55.0	56.0	55.0					16																	71683436		2198	4300	6498	SO:0001587	stop_gained	23035	exon18			GGAAGCAAGGCAG	BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.3329T>A	16.37:g.71683436A>T	ENSP00000457991:p.Leu1110*	Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	64	15	0.234375	NM_015020	A1L374|Q9NV17|Q9Y2E3	Nonsense_Mutation	SNP	ENST00000568954.1	37	CCDS32479.1	.	.	.	.	.	.	.	.	.	.	A	38	6.724567	0.97792	.	.	ENSG00000040199	ENST00000356272;ENST00000393524	.	.	.	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-7.6795	15.7393	0.77876	1.0:0.0:0.0:0.0	.	.	.	.	X	1110;1043	.	ENSP00000348611:L1110X	L	-	2	0	PHLPP2	70240937	0.999000	0.42202	0.996000	0.52242	0.565000	0.35776	3.591000	0.53986	2.308000	0.77769	0.533000	0.62120	TTG	.	.	none		0.592	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434139.1	NM_015020	
FAT1	2195	hgsc.bcm.edu	37	4	187524408	187524408	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr4:187524408C>T	ENST00000441802.2	-	19	11481	c.11272G>A	c.(11272-11274)Gtg>Atg	p.V3758M		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3758					actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GTTGACATCACACTTTCATCC	0.502										HNSCC(5;0.00058)																											p.V3758M	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.G11272A						PASS	.						69.0	66.0	67.0					4																	187524408		2030	4189	6219	SO:0001583	missense	2195	exon19			ACATCACACTTTC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.11272G>A	4.37:g.187524408C>T	ENSP00000406229:p.Val3758Met	Somatic	176	0	0		WXS	Illumina HiSeq	Phase_I	151	66	0.437086	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.822774	0.32237	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.30182	1.54	3.98	3.11	0.35812	.	0.268968	0.35805	N	0.002973	T	0.27349	0.0671	L	0.46157	1.445	0.28142	N	0.929741	P	0.36354	0.549	B	0.38880	0.284	T	0.11567	-1.0582	10	0.42905	T	0.14	.	9.5639	0.39387	0.0:0.8051:0.0:0.1949	.	3758	Q14517	FAT1_HUMAN	M	3758;3760	ENSP00000406229:V3758M	ENSP00000260147:V3760M	V	-	1	0	FAT1	187761402	0.035000	0.19736	0.009000	0.14445	0.913000	0.54294	0.593000	0.23999	0.992000	0.38840	0.557000	0.71058	GTG	.	.	none		0.502	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
CSRP2BP	57325	hgsc.bcm.edu	37	20	18131517	18131517	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr20:18131517G>C	ENST00000435364.3	+	3	772	c.431G>C	c.(430-432)gGt>gCt	p.G144A	CSRP2BP_ENST00000489634.2_Missense_Mutation_p.G16A|CSRP2BP_ENST00000377681.3_Missense_Mutation_p.G144A	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	144					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						GGACGTCAAGGTTATTTCAGG	0.378																																					p.G144A		Atlas-SNP	.											.	CSRP2BP	80	.	0			c.G431C						PASS	.						250.0	233.0	239.0					20																	18131517		2203	4300	6503	SO:0001583	missense	57325	exon3			GTCAAGGTTATTT	AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.431G>C	20.37:g.18131517G>C	ENSP00000392318:p.Gly144Ala	Somatic	209	0	0		WXS	Illumina HiSeq	Phase_I	186	55	0.295699	NM_020536	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738635	0.89573	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.20069	2.38;2.37;2.38;2.1	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.46308	0.1386	M	0.64997	1.995	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.995	T	0.38887	-0.9640	10	0.56958	D	0.05	-8.237	18.8794	0.92351	0.0:0.0:1.0:0.0	.	16;144	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	A	144;144;144;16	ENSP00000278816:G144A;ENSP00000366909:G144A;ENSP00000392318:G144A;ENSP00000425909:G16A	ENSP00000278816:G144A	G	+	2	0	CSRP2BP	18079517	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	9.052000	0.93855	2.527000	0.85204	0.557000	0.71058	GGT	.	.	none		0.378	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536	
EBNA1BP2	10969	hgsc.bcm.edu	37	1	43637173	43637173	+	Silent	SNP	G	G	A	rs367548162		TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr1:43637173G>A	ENST00000236051.2	-	3	441	c.300C>T	c.(298-300)gaC>gaT	p.D100D	WDR65_ENST00000372492.4_5'Flank|WDR65_ENST00000528956.1_5'Flank|EBNA1BP2_ENST00000472982.1_5'UTR|EBNA1BP2_ENST00000431635.2_Silent_p.D155D	NM_006824.2	NP_006815.2	Q99848	EBP2_HUMAN	EBNA1 binding protein 2	100					ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)	16	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GCTGGAAGTCGTCTTCTGGAT	0.493													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19764	0.0		0.0	False		,,,				2504	0.0				p.D155D		Atlas-SNP	.											.	EBNA1BP2	37	.	0			c.C465T						PASS	.	G	,	1,4405	2.1+/-5.4	0,1,2202	135.0	130.0	132.0		465,300	-1.7	1.0	1		132	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	EBNA1BP2	NM_001159936.1,NM_006824.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	155/362,100/307	43637173	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10969	exon4			GAAGTCGTCTTCT	U86602	CCDS478.1, CCDS53308.1	1p35-p33	2011-02-10	2001-11-28		ENSG00000117395	ENSG00000117395			15531	protein-coding gene	gene with protein product		614443	"""EBNA1-binding protein 2"""			10074103, 11438656	Standard	NM_001159936		Approved	NOBP, EBP2, P40	uc010ojx.2	Q99848	OTTHUMG00000007284	ENST00000236051.2:c.300C>T	1.37:g.43637173G>A		Somatic	145	0	0		WXS	Illumina HiSeq	Phase_I	125	37	0.296	NM_001159936	Q96A66	Silent	SNP	ENST00000236051.2	37	CCDS478.1																																																																																			.	.	none		0.493	EBNA1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019015.1		
TBC1D10C	374403	hgsc.bcm.edu	37	11	67176563	67176563	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:67176563A>G	ENST00000542590.1	+	8	966	c.952A>G	c.(952-954)Atc>Gtc	p.I318V	TBC1D10C_ENST00000312390.5_Missense_Mutation_p.I318V|TBC1D10C_ENST00000526387.1_Missense_Mutation_p.H253R			Q8IV04	TB10C_HUMAN	TBC1 domain family, member 10C	318					retrograde transport, endosome to Golgi (GO:0042147)	filopodium membrane (GO:0031527)|membrane (GO:0016020)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			CCTTCGAGCCATCCCCCCCGC	0.687																																					p.I318V		Atlas-SNP	.											.	TBC1D10C	42	.	0			c.A952G						PASS	.						19.0	20.0	20.0					11																	67176563		2194	4291	6485	SO:0001583	missense	374403	exon9			CGAGCCATCCCCC	BC035630	CCDS8162.1, CCDS58150.1	11q13.1	2013-07-09			ENSG00000175463	ENSG00000175463			24702	protein-coding gene	gene with protein product		610831				17230191, 20404108	Standard	NM_001256508		Approved	FLJ00332, Carabin, EPI64C	uc001ola.4	Q8IV04	OTTHUMG00000167139	ENST00000542590.1:c.952A>G	11.37:g.67176563A>G	ENSP00000443654:p.Ile318Val	Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	149	68	0.456376	NM_198517	G3V1D6	Missense_Mutation	SNP	ENST00000542590.1	37	CCDS8162.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.51|11.51	1.660112|1.660112	0.29515|0.29515	.|.	.|.	ENSG00000175463|ENSG00000175463	ENST00000526387|ENST00000312390;ENST00000542590	.|T;T	.|0.07114	.|3.22;3.22	4.94|4.94	3.69|3.69	0.42338|0.42338	.|Rab-GAP/TBC domain (1);	.|0.145274	.|0.31660	.|N	.|0.007262	T|T	0.07999|0.07999	0.0200|0.0200	L|L	0.55481|0.55481	1.735|1.735	0.31201|0.31201	N|N	0.69976|0.69976	B|B	0.21071|0.18610	0.051|0.029	B|B	0.16722|0.20184	0.016|0.028	T|T	0.12091|0.12091	-1.0561|-1.0561	8|10	0.87932|0.27785	D|T	0|0.31	.|.	4.707|4.707	0.12855|0.12855	0.6934:0.1811:0.1254:0.0|0.6934:0.1811:0.1254:0.0	.|.	253|318	G3V1D6|Q8IV04	.|TB10C_HUMAN	R|V	253|318	.|ENSP00000310193:I318V;ENSP00000443654:I318V	ENSP00000435543:H253R|ENSP00000310193:I318V	H|I	+|+	2|1	0|0	TBC1D10C|TBC1D10C	66933139|66933139	0.978000|0.978000	0.34361|0.34361	0.794000|0.794000	0.32065|0.32065	0.508000|0.508000	0.34012|0.34012	2.081000|2.081000	0.41596|0.41596	0.785000|0.785000	0.33685|0.33685	0.459000|0.459000	0.35465|0.35465	CAT|ATC	.	.	none		0.687	TBC1D10C-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395492.2	NM_198517	
ZIM3	114026	hgsc.bcm.edu	37	19	57646662	57646662	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:57646662G>C	ENST00000269834.1	-	5	1428	c.1043C>G	c.(1042-1044)tCc>tGc	p.S348C	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	348					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GATGACATTGGATTTCTGGGA	0.388																																					p.S348C		Atlas-SNP	.											.	ZIM3	107	.	0			c.C1043G						PASS	.						168.0	164.0	165.0					19																	57646662		2203	4300	6503	SO:0001583	missense	114026	exon5			ACATTGGATTTCT	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.1043C>G	19.37:g.57646662G>C	ENSP00000269834:p.Ser348Cys	Somatic	322	0	0		WXS	Illumina HiSeq	Phase_I	285	79	0.277193	NM_052882	Q14CA6	Missense_Mutation	SNP	ENST00000269834.1	37	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	G	9.453	1.090990	0.20471	.	.	ENSG00000141946	ENST00000269834	T	0.08008	3.14	2.29	2.29	0.28610	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25158	0.0611	M	0.71206	2.165	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.02144	-1.1206	9	0.87932	D	0	.	10.2276	0.43236	0.0:0.0:1.0:0.0	.	348	Q96PE6	ZIM3_HUMAN	C	348	ENSP00000269834:S348C	ENSP00000269834:S348C	S	-	2	0	ZIM3	62338474	0.000000	0.05858	0.774000	0.31636	0.297000	0.27493	-1.288000	0.02783	1.266000	0.44231	0.313000	0.20887	TCC	.	.	none		0.388	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1		
PLCL1	5334	hgsc.bcm.edu	37	2	198950643	198950643	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr2:198950643A>T	ENST00000428675.1	+	2	2800	c.2402A>T	c.(2401-2403)gAt>gTt	p.D801V	PLCL1_ENST00000437704.2_Missense_Mutation_p.D703V	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	801	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	GTTCTGGATGATGACTACATT	0.418																																					p.D801V		Atlas-SNP	.											.	PLCL1	358	.	0			c.A2402T						PASS	.						181.0	168.0	173.0					2																	198950643		2203	4300	6503	SO:0001583	missense	5334	exon2			TGGATGATGACTA	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2402A>T	2.37:g.198950643A>T	ENSP00000402861:p.Asp801Val	Somatic	301	0	0		WXS	Illumina HiSeq	Phase_I	306	78	0.254902	NM_006226	Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	37	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	A	17.06	3.292444	0.59976	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.70164	-0.46;-0.46	5.5	5.5	0.81552	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000003	D	0.83362	0.5238	M	0.85099	2.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85396	0.1128	9	.	.	.	.	15.7759	0.78214	1.0:0.0:0.0:0.0	.	801;727	Q15111;B4DYZ4	PLCL1_HUMAN;.	V	801;703	ENSP00000402861:D801V;ENSP00000414138:D703V	.	D	+	2	0	PLCL1	198658888	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.127000	0.94417	2.308000	0.77769	0.533000	0.62120	GAT	.	.	none		0.418	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226	
CD79A	973	hgsc.bcm.edu	37	19	42381447	42381447	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr19:42381447T>A	ENST00000221972.3	+	1	258	c.73T>A	c.(73-75)Tac>Aac	p.Y25N	CD79A_ENST00000444740.2_Missense_Mutation_p.Y25N	NM_001783.3|NM_021601.3	NP_001774.1|NP_067612.1	P11912	CD79A_HUMAN	CD79a molecule, immunoglobulin-associated alpha	25					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)	B cell receptor complex (GO:0019815)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	11						GTCTGCTGTCTACCTGGGTAT	0.612			"""O, S"""		DLBCL																																p.Y25N		Atlas-SNP	.		Dom	yes		19	19q13.2	973	"""CD79a molecule, immunoglobulin-associated alpha"""		L	.	CD79A	25	.	0			c.T73A						PASS	.						145.0	109.0	121.0					19																	42381447		2203	4300	6503	SO:0001583	missense	973	exon1			GCTGTCTACCTGG	M80462	CCDS12589.1, CCDS46088.1	19q13.2	2014-09-17	2006-03-28					"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1698	protein-coding gene	gene with protein product		112205	"""CD79A antigen (immunoglobulin-associated alpha)"""	IGA		1538135	Standard	NM_001783		Approved	MB-1	uc002orv.3	P11912		ENST00000221972.3:c.73T>A	19.37:g.42381447T>A	ENSP00000221972:p.Tyr25Asn	Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	87	19	0.218391	NM_021601	A0N775|Q53FB8	Missense_Mutation	SNP	ENST00000221972.3	37	CCDS12589.1	.	.	.	.	.	.	.	.	.	.	T	5.787	0.329487	0.10956	.	.	ENSG00000105369	ENST00000221972;ENST00000444740	T	0.76186	-1.0	3.61	-1.13	0.09775	.	0.545236	0.15449	N	0.261790	T	0.45875	0.1364	N	0.08118	0	0.09310	N	1	B;B	0.27068	0.003;0.167	B;B	0.20767	0.002;0.031	T	0.27157	-1.0082	10	0.27785	T	0.31	-1.8651	5.5865	0.17277	0.1758:0.0:0.596:0.2282	.	25;25	P11912;A0N775	CD79A_HUMAN;.	N	25	ENSP00000221972:Y25N	ENSP00000221972:Y25N	Y	+	1	0	CD79A	47073287	0.002000	0.14202	0.008000	0.14137	0.816000	0.46133	0.755000	0.26405	-0.168000	0.10853	0.449000	0.29647	TAC	.	.	none		0.612	CD79A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463058.1		
ZNF189	7743	hgsc.bcm.edu	37	9	104170419	104170419	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr9:104170419G>A	ENST00000339664.2	+	3	498	c.369G>A	c.(367-369)ttG>ttA	p.L123L	ZNF189_ENST00000374861.3_Silent_p.L109L|ZNF189_ENST00000259395.4_Silent_p.L81L	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	123					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				GGGAATCTTTGACCCAGGAAC	0.383																																					p.L123L		Atlas-SNP	.											.	ZNF189	79	.	0			c.G369A						PASS	.						67.0	65.0	66.0					9																	104170419		2203	4300	6503	SO:0001819	synonymous_variant	7743	exon3			ATCTTTGACCCAG	AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.369G>A	9.37:g.104170419G>A		Somatic	178	0	0		WXS	Illumina HiSeq	Phase_I	165	12	0.0727273	NM_003452	O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Silent	SNP	ENST00000339664.2	37	CCDS6754.1																																																																																			.	.	none		0.383	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053447.1	NM_003452	
SORCS1	114815	hgsc.bcm.edu	37	10	108389123	108389123	+	Silent	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:108389123G>A	ENST00000263054.6	-	19	2506	c.2499C>T	c.(2497-2499)atC>atT	p.I833I	SORCS1_ENST00000344440.6_Silent_p.I833I|SORCS1_ENST00000369698.1_Silent_p.I368I	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	833	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AGTCCACTTGGATGAGTGTCC	0.507																																					p.I833I		Atlas-SNP	.											.	SORCS1	534	.	0			c.C2499T						PASS	.						132.0	96.0	108.0					10																	108389123		2203	4300	6503	SO:0001819	synonymous_variant	114815	exon19			CACTTGGATGAGT	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2499C>T	10.37:g.108389123G>A		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	63	18	0.285714	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Silent	SNP	ENST00000263054.6	37	CCDS7559.1																																																																																			.	.	none		0.507	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
OXCT1	5019	hgsc.bcm.edu	37	5	41870421	41870421	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:41870421A>G	ENST00000196371.5	-	1	200	c.40T>C	c.(40-42)Tgc>Cgc	p.C14R	OXCT1-AS1_ENST00000508458.1_RNA	NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	14					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	GCAGAGGCGCAGAGCCGAAGC	0.652																																					p.C14R		Atlas-SNP	.											.	OXCT1	54	.	0			c.T40C						PASS	.						58.0	53.0	54.0					5																	41870421		2203	4300	6503	SO:0001583	missense	5019	exon1			AGGCGCAGAGCCG	U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.40T>C	5.37:g.41870421A>G	ENSP00000196371:p.Cys14Arg	Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	85	21	0.247059	NM_000436	B2R5V2|B7Z528	Missense_Mutation	SNP	ENST00000196371.5	37	CCDS3937.1	.	.	.	.	.	.	.	.	.	.	A	14.14	2.447431	0.43429	.	.	ENSG00000083720	ENST00000196371	D	0.84298	-1.83	4.71	-1.41	0.08941	.	0.617047	0.17164	N	0.184532	T	0.61173	0.2326	N	0.08118	0	0.39676	D	0.970823	B	0.02656	0.0	B	0.01281	0.0	T	0.36720	-0.9736	10	0.23302	T	0.38	2.3307	1.5265	0.02526	0.411:0.3174:0.0974:0.1742	.	14	P55809	SCOT1_HUMAN	R	14	ENSP00000196371:C14R	ENSP00000196371:C14R	C	-	1	0	OXCT1	41906178	0.941000	0.31946	0.426000	0.26672	0.821000	0.46438	0.003000	0.13083	-0.023000	0.13963	0.533000	0.62120	TGC	.	.	none		0.652	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436	
NEURL1B	54492	hgsc.bcm.edu	37	5	172113904	172113904	+	Silent	SNP	C	C	T	rs568049488	byFrequency	TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr5:172113904C>T	ENST00000369800.5	+	5	1785	c.1644C>T	c.(1642-1644)gaC>gaT	p.D548D	NEURL1B_ENST00000522853.1_Silent_p.D366D|NEURL1B_ENST00000520919.1_Silent_p.D308D	NM_001142651.1	NP_001136123.1	A8MQ27	NEU1B_HUMAN	neuralized E3 ubiquitin protein ligase 1B	548					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(2)	2						CCATCAAGGACGTCATTAAGA	0.647													C|||	5	0.000998403	0.0038	0.0	5008	,	,		14629	0.0		0.0	False		,,,				2504	0.0				p.D548D		Atlas-SNP	.											.	NEURL1B	22	.	0			c.C1644T						PASS	.						17.0	19.0	18.0					5																	172113904		691	1591	2282	SO:0001819	synonymous_variant	54492	exon5			CAAGGACGTCATT		CCDS47342.1	5q35.1	2013-10-24	2013-10-24		ENSG00000214357	ENSG00000214357			35422	protein-coding gene	gene with protein product		615893	"""neuralized homolog 1B (Drosophila)"""			17003037	Standard	NM_001142651		Approved	DKFZP761M1511, Neur2	uc003mbt.3	A8MQ27	OTTHUMG00000163281	ENST00000369800.5:c.1644C>T	5.37:g.172113904C>T		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	80	29	0.3625	NM_001142651	C9DQJ5|C9DQJ6|C9DQJ7	Silent	SNP	ENST00000369800.5	37	CCDS47342.1																																																																																			.	.	none		0.647	NEURL1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372453.2		
CUBN	8029	hgsc.bcm.edu	37	10	16967409	16967409	+	Silent	SNP	A	A	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr10:16967409A>G	ENST00000377833.4	-	43	6542	c.6477T>C	c.(6475-6477)ccT>ccC	p.P2159P		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2159	CUB 15. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AACAGATATCAGGACCATTTC	0.408																																					p.P2159P		Atlas-SNP	.											CUBN,NS,carcinoma,0,1	CUBN	515	1	0			c.T6477C						scavenged	.						46.0	47.0	47.0					10																	16967409		2203	4300	6503	SO:0001819	synonymous_variant	8029	exon43			GATATCAGGACCA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6477T>C	10.37:g.16967409A>G		Somatic	245	1	0.00408163		WXS	Illumina HiSeq	Phase_I	193	26	0.134715	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	37	CCDS7113.1																																																																																			.	.	none		0.408	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
SLC25A13	10165	hgsc.bcm.edu	37	7	95864216	95864216	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr7:95864216G>A	ENST00000265631.5	-	4	362	c.226C>T	c.(226-228)Caa>Taa	p.Q76*	SLC25A13_ENST00000416240.2_Nonsense_Mutation_p.Q76*|SLC25A13_ENST00000542654.1_Intron			Q9UJS0	CMC2_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 13	76	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				aspartate transport (GO:0015810)|ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular respiration (GO:0045333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|transporter activity (GO:0005215)			breast(4)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|prostate(1)|skin(4)	42	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	ACAAATTCTTGAAAAGATATT	0.363																																					p.Q76X		Atlas-SNP	.											.	SLC25A13	131	.	0			c.C226T						PASS	.						74.0	70.0	71.0					7																	95864216		2203	4300	6503	SO:0001587	stop_gained	10165	exon4			ATTCTTGAAAAGA	AF118838	CCDS5645.1, CCDS55130.1	7q21.3	2013-05-22	2012-03-29		ENSG00000004864	ENSG00000004864		"""Solute carriers"", ""EF-hand domain containing"""	10983	protein-coding gene	gene with protein product	"""mitochondrial aspartate glutamate carrier 2"""	603859	"""solute carrier family 25, member 13 (citrin)"""	CTLN2		10369257	Standard	NM_014251		Approved	CITRIN, ARALAR2	uc003uog.4	Q9UJS0	OTTHUMG00000023074	ENST00000265631.5:c.226C>T	7.37:g.95864216G>A	ENSP00000265631:p.Gln76*	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	52	15	0.288462	NM_001160210	O14566|O14575|Q546F9|Q9NZW1|Q9UNI7	Nonsense_Mutation	SNP	ENST00000265631.5	37	CCDS5645.1	.	.	.	.	.	.	.	.	.	.	G	37	6.087648	0.97271	.	.	ENSG00000004864	ENST00000265631;ENST00000416240	.	.	.	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-11.302	19.1939	0.93679	0.0:0.0:1.0:0.0	.	.	.	.	X	76	.	ENSP00000265631:Q76X	Q	-	1	0	SLC25A13	95702152	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.657000	0.98554	2.846000	0.97976	0.650000	0.86243	CAA	.	.	none		0.363	SLC25A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059395.2	NM_014251	
CHST6	4166	hgsc.bcm.edu	37	16	75512714	75512714	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr16:75512714G>A	ENST00000332272.4	-	3	1192	c.1013C>T	c.(1012-1014)cCc>cTc	p.P338L	CHST6_ENST00000390664.2_Missense_Mutation_p.P338L|RP11-77K12.4_ENST00000530512.3_RNA	NM_021615.4	NP_067628.1	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6	338					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						CTTGGCAAAGGGCAGCGCATG	0.652																																					p.P338L		Atlas-SNP	.											.	CHST6	57	.	0			c.C1013T						PASS	.						61.0	56.0	58.0					16																	75512714		2198	4300	6498	SO:0001583	missense	4166	exon3			GCAAAGGGCAGCG	AF280086	CCDS10918.1	16q22	2008-02-05			ENSG00000183196	ENSG00000183196		"""Sulfotransferases, membrane-bound"""	6938	protein-coding gene	gene with protein product		605294		MCDC1		8644739, 11017086	Standard	NM_021615		Approved		uc002fef.3	Q9GZX3	OTTHUMG00000137612	ENST00000332272.4:c.1013C>T	16.37:g.75512714G>A	ENSP00000328983:p.Pro338Leu	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	72	25	0.347222	NM_021615	D3DUK3	Missense_Mutation	SNP	ENST00000332272.4	37	CCDS10918.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.064439	0.76187	.	.	ENSG00000183196	ENST00000332272;ENST00000390664	D;D	0.99766	-6.69;-6.69	4.9	4.9	0.64082	Sulfotransferase domain (1);	0.182083	0.49305	D	0.000151	D	0.99694	0.9884	M	0.83953	2.67	0.53005	D	0.999964	P	0.50710	0.938	P	0.62491	0.903	D	0.97282	0.9918	10	0.56958	D	0.05	.	15.563	0.76266	0.0:0.0:1.0:0.0	.	338	Q9GZX3	CHST6_HUMAN	L	338	ENSP00000328983:P338L;ENSP00000375079:P338L	ENSP00000328983:P338L	P	-	2	0	CHST6	74070215	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.425000	0.73370	2.278000	0.76064	0.591000	0.81541	CCC	.	.	none		0.652	CHST6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435478.1	NM_021615	
YLPM1	56252	hgsc.bcm.edu	37	14	75248627	75248627	+	Splice_Site	SNP	T	T	C			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr14:75248627T>C	ENST00000238571.3	+	4	1420	c.1296T>C	c.(1294-1296)acT>acC	p.T432T	YLPM1_ENST00000552421.1_Silent_p.A627A|YLPM1_ENST00000325680.7_Silent_p.A627A			P49750	YLPM1_HUMAN	YLP motif containing 1	432					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TGTCTTCAGCTACACCTCCTC	0.577																																					p.A627A		Atlas-SNP	.											.	YLPM1	298	.	0			c.T1881C						PASS	.						93.0	97.0	96.0					14																	75248627		2023	4188	6211	SO:0001630	splice_region_variant	56252	exon4			TTCAGCTACACCT	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000238571.3:c.1295-1T>C	14.37:g.75248627T>C		Somatic	191	0	0		WXS	Illumina HiSeq	Phase_I	144	24	0.166667	NM_019589	P49752|Q96I64|Q9P1V7	Silent	SNP	ENST00000238571.3	37																																																																																				.	.	none		0.577	YLPM1-201	KNOWN	basic	protein_coding	protein_coding		NM_019589	Silent
EIF3F	8665	hgsc.bcm.edu	37	11	8016899	8016899	+	Silent	SNP	C	C	G			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chr11:8016899C>G	ENST00000533626.1	+	9	1607	c.981C>G	c.(979-981)ctC>ctG	p.L327L	EIF3F_ENST00000449102.2_Silent_p.L178L|EIF3F_ENST00000537635.1_Silent_p.L342L|EIF3F_ENST00000309828.4_Silent_p.L327L					eukaryotic translation initiation factor 3, subunit F											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|skin(1)	13				Epithelial(150;1.44e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGACCATGCTCAACAGCAACA	0.498																																					p.L327L		Atlas-SNP	.											.	EIF3F	23	.	0			c.C981G						PASS	.						174.0	164.0	168.0					11																	8016899		2201	4296	6497	SO:0001819	synonymous_variant	8665	exon7			CATGCTCAACAGC	U94855, AK093511	CCDS7785.1	11p15.4	2010-03-10	2007-07-27	2007-07-27	ENSG00000175390	ENSG00000175390			3275	protein-coding gene	gene with protein product		603914	"""eukaryotic translation initiation factor 3, subunit 5 epsilon, 47kDa"""	EIF3S5		9341143	Standard	NM_003754		Approved	eIF3-epsilon, eIF3-p47, eIF3f	uc001mfw.3	O00303		ENST00000533626.1:c.981C>G	11.37:g.8016899C>G		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	81	45	0.555556	NM_003754		Silent	SNP	ENST00000533626.1	37	CCDS7785.1																																																																																			.	.	none		0.498	EIF3F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385713.2	NM_003754	
DDX3X	1654	hgsc.bcm.edu	37	X	41206603	41206603	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TZ-01A-11D-A38X-10	TCGA-GS-A9TZ-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93217755-b79d-4e32-8e97-76bcd262bae8	96fefcbd-9bc5-4473-be47-0f4c19aa6e57	g.chrX:41206603G>A	ENST00000399959.2	+	16	2663	c.1808G>A	c.(1807-1809)cGa>cAa	p.R603Q	DDX3X_ENST00000478993.1_3'UTR|DDX3X_ENST00000441189.2_Intron|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000457138.2_Missense_Mutation_p.R587Q	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	603	Gly/Ser-rich.|Interaction with GSK3B.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						AGAGACTACCGACAAagtagc	0.502										HNSCC(61;0.18)																											p.R603Q		Atlas-SNP	.											.	DDX3X	138	.	0			c.G1808A						PASS	.						66.0	73.0	70.0					X																	41206603		2188	4289	6477	SO:0001583	missense	1654	exon16			ACTACCGACAAAG	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1808G>A	X.37:g.41206603G>A	ENSP00000382840:p.Arg603Gln	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	126	83	0.65873	NM_001356	A8K538|B4E3E8|O15536	Missense_Mutation	SNP	ENST00000399959.2	37	CCDS43931.1	.	.	.	.	.	.	.	.	.	.	g	24.2	4.505398	0.85282	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	T;T	0.24538	1.85;1.87	5.48	5.48	0.80851	.	0.055112	0.85682	D	0.000000	T	0.58906	0.2155	M	0.91717	3.235	0.80722	D	1	D;D;D;D	0.64830	0.994;0.994;0.994;0.994	P;P;P;P	0.61201	0.885;0.885;0.885;0.885	T	0.70055	-0.4977	10	0.87932	D	0	-29.9248	18.4946	0.90860	0.0:0.0:1.0:0.0	.	473;587;615;603	B4DLU5;B4E3E8;Q59GX6;O00571	.;.;.;DDX3X_HUMAN	Q	603;587	ENSP00000382840:R603Q;ENSP00000392494:R587Q	ENSP00000382840:R603Q	R	+	2	0	DDX3X	41091547	1.000000	0.71417	0.978000	0.43139	0.970000	0.65996	9.431000	0.97494	2.309000	0.77851	0.591000	0.81541	CGA	.	.	none		0.502	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056253.1	NM_024005	
