#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TLL2	7093	hgsc.bcm.edu	37	10	98170201	98170201	+	Frame_Shift_Del	DEL	C	C	-			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr10:98170201delC	ENST00000357947.3	-	9	1304	c.1079delG	c.(1078-1080)ggafs	p.G360fs	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	360	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		AGAAAAGTTTCCCGTTGTGTC	0.582																																					p.G360fs		Atlas-Indel	.											TLL2,NS,malignant_melanoma,-2,1	TLL2	122	1	0			c.1080delA						PASS	.						96.0	85.0	88.0					10																	98170201		2203	4300	6503	SO:0001589	frameshift_variant	7093	exon9			.	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1079delG	10.37:g.98170201delC	ENSP00000350630:p.Gly360fs	Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	77	13	0.168831	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Frame_Shift_Del	DEL	ENST00000357947.3	37	CCDS7449.1																																																																																			.	.	none		0.582	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
UBE2Q2	92912	hgsc.bcm.edu	37	15	76161328	76161330	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr15:76161328_76161330delGAA	ENST00000267938.4	+	4	806_808	c.424_426delGAA	c.(424-426)gaadel	p.E146del	UBE2Q2_ENST00000561851.1_In_Frame_Del_p.E130del|UBE2Q2_ENST00000338677.4_In_Frame_Del_p.E146del|UBE2Q2_ENST00000569423.1_In_Frame_Del_p.E111del	NM_173469.2	NP_775740.1	Q8WVN8	UB2Q2_HUMAN	ubiquitin-conjugating enzyme E2Q family member 2	146	Glu-rich.				protein K48-linked ubiquitination (GO:0070936)	cytoplasm (GO:0005737)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	12						agaagaagaggaagaagaagaag	0.335																																					p.141_142del		Atlas-Indel	.											.	UBE2Q2	26	.	0			c.423_425del						PASS	.																																			SO:0001651	inframe_deletion	92912	exon4			.	BC017708	CCDS10286.1, CCDS45309.1, CCDS66839.1	15q24.2	2010-05-12	2008-05-02		ENSG00000140367	ENSG00000140367		"""Ubiquitin-conjugating enzymes E2"""	19248	protein-coding gene	gene with protein product		612501	"""ubiquitin-conjugating enzyme E2Q (putative) 2"""			16300736	Standard	NM_001145335		Approved	DKFZp762C143	uc002bbg.2	Q8WVN8	OTTHUMG00000142839	ENST00000267938.4:c.424_426delGAA	15.37:g.76161337_76161339delGAA	ENSP00000267938:p.Glu146del	Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	194	38	0.195876	NM_173469	B7Z3Q2|H3BRG2|Q8N4G6|Q96J08	In_Frame_Del	DEL	ENST00000267938.4	37	CCDS10286.1																																																																																			.	.	none		0.335	UBE2Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286475.1	NM_173469	
GLIPR1L2	144321	hgsc.bcm.edu	37	12	75816842	75816843	+	Intron	INS	-	-	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr12:75816842_75816843insT	ENST00000550916.1	+	4	717				GLIPR1L2_ENST00000435775.1_Intron|GLIPR1L2_ENST00000441218.1_Intron|GLIPR1L2_ENST00000320460.4_Frame_Shift_Ins_p.SF248fs|GLIPR1L2_ENST00000378692.3_Intron	NM_001270396.1	NP_001257325.1	Q4G1C9	GRPL2_HUMAN	GLI pathogenesis-related 1 like 2							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16						TTGAACACTAGTTTTTTATGGT	0.292																																					p.S248fs		Atlas-Indel	.											.	GLIPR1L2	54	.	0			c.743_744insT						PASS	.																																			SO:0001627	intron_variant	144321	exon4			.	BC029557	CCDS9010.1, CCDS58258.1	12q21.1	2014-06-03				ENSG00000180481			28592	protein-coding gene	gene with protein product		610394				12477932	Standard	NM_001270396		Approved	MGC39497	uc001sxr.2	Q4G1C9	OTTHUMG00000169756	ENST00000550916.1:c.670+73->T	12.37:g.75816848_75816848dupT		Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	88	11	0.125	NM_152436	Q6MZS1|Q8N6N0|Q8NA43	Frame_Shift_Ins	INS	ENST00000550916.1	37	CCDS58258.1																																																																																			.	.	none		0.292	GLIPR1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405718.1	NM_152436	
IGLL5	100423062	hgsc.bcm.edu	37	22	23237676	23237677	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr22:23237676_23237677insT	ENST00000526893.1	+	3	721_722	c.447_448insT	c.(448-450)tggfs	p.W150fs	IGLJ1_ENST00000390320.2_RNA|IGLL5_ENST00000532223.2_Frame_Shift_Ins_p.W151fs|IGLC1_ENST00000390321.2_RNA|IGLL5_ENST00000531372.1_3'UTR	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	150	C region (By similarity to lambda light- chain).|Ig-like C1-type.					extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						TGACAGTGGCCTGGAAGGCAGA	0.594																																					p.A149fs		Atlas-Indel	.											.	IGLL5	26	.	0			c.447_448insT						PASS	.																																			SO:0001589	frameshift_variant	100423062	exon3			.	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.448dupT	22.37:g.23237677_23237677dupT	ENSP00000431254:p.Trp150fs	Somatic	151	0	0		WXS	Illumina HiSeq	Phase_I	171	28	0.163743	NM_001178126		Frame_Shift_Ins	INS	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.594	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
FDXACB1	91893	hgsc.bcm.edu	37	11	111742146	111742146	+	IGR	DEL	G	G	-	rs10708475		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:111742146delG	ENST00000260257.4	-	0	2789				ALG9_ENST00000527377.1_5'UTR|ALG9_ENST00000531154.1_5'Flank|ALG9_ENST00000524880.1_Frame_Shift_Del_p.R254fs|ALG9_ENST00000398006.2_5'Flank|ALG9_ENST00000527228.1_5'UTR	NM_138378.2	NP_612387.1	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain containing 1						phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA processing (GO:0008033)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(3)	19						CAGCCGGGGCGCGTATCCCCA	0.706													-|G|-|insertion	5008	1.0	1.0	1.0	5008	,	,		10686	1.0		1.0	False		,,,				2504	1.0				p.A21fs		Pindel	.											.	ALG9	77	.	0			c.61delG						PASS	.		,	1444,2		722,0,1	1.0	1.0	1.0		,	1.0	0.1	11	dbSNP_119	1	3620,0		1810,0,0	no	frameshift,frameshift	ALG9	NM_024740.2,NM_001077690.1	,	2532,0,1	A1A1,A1R,RR		0.0,0.1383,0.0395	,	,	111742146	5064,2	138	312	450	SO:0001628	intergenic_variant	79796	exon2			.		CCDS44729.1	11q23.1	2011-04-15			ENSG00000255561	ENSG00000255561			25110	protein-coding gene	gene with protein product	"""hypothetical protein BC006136"""						Standard	NR_038364		Approved	LOC91893, hCG_2033039	uc001pmc.4	Q9BRP7	OTTHUMG00000166795		11.37:g.111742146delG		Somatic	5	.	.		WXS	Illumina HiSeq	Phase_I	13	12	0.923	NM_024740	A0PJW7|B4DUU2	Frame_Shift_Del	DEL	ENST00000260257.4	37	CCDS44729.1																																																																																			G|0.006;-|0.994	0.994	strong		0.706	FDXACB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391497.1	NM_138378	
FAS	355	hgsc.bcm.edu	37	10	90773975	90773975	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr10:90773975T>C	ENST00000355740.2	+	9	996	c.776T>C	c.(775-777)aTa>aCa	p.I259T	FAS_ENST00000355279.2_3'UTR|FAS_ENST00000352159.4_3'UTR|RP11-399O19.9_ENST00000562983.1_RNA|FAS_ENST00000357339.2_Missense_Mutation_p.I238T	NM_000043.4|NM_152871.2|NM_152872.2	NP_000034.1|NP_690610.1|NP_690611.1	P49327	FAS_HUMAN	Fas cell surface death receptor	0	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)	Cerulenin(DB01034)|Orlistat(DB01083)	GAAGCCAAAATAGATGAGATC	0.383																																					p.I259T		Atlas-SNP	.											.	FAS	47	.	0			c.T776C	GRCh37	CM033041|CM994522	FAS	M		PASS	.						121.0	114.0	116.0					10																	90773975		2203	4300	6503	SO:0001583	missense	355	exon9			CCAAAATAGATGA	M67454	CCDS7393.1, CCDS7394.1, CCDS7395.1	10q24.1	2014-09-17	2013-05-22	2005-01-07	ENSG00000026103	ENSG00000026103		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11920	protein-coding gene	gene with protein product	"""TNF receptor superfamily member 6"""	134637	"""tumor necrosis factor receptor superfamily, member 6"", ""Fas (TNF receptor superfamily, member 6)"""	FAS1, APT1, TNFRSF6		1385299, 1385309	Standard	NM_000043		Approved	CD95, APO-1	uc001kfr.3	P25445	OTTHUMG00000018701	ENST00000355740.2:c.776T>C	10.37:g.90773975T>C	ENSP00000347979:p.Ile259Thr	Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	66	15	0.227273	NM_000043	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000355740.2	37	CCDS7393.1	.	.	.	.	.	.	.	.	.	.	T	18.88	3.717060	0.68844	.	.	ENSG00000026103	ENST00000540197;ENST00000355740;ENST00000357339	D;D	0.97378	-4.36;-4.36	4.65	4.65	0.58169	Death (3);DEATH-like (2);	0.172999	0.47093	D	0.000242	D	0.98093	0.9371	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98611	1.0663	10	0.87932	D	0	-24.7594	11.0512	0.47893	0.0:0.0:0.0:1.0	.	238;259	P25445-6;P25445	.;TNR6_HUMAN	T	286;259;238	ENSP00000347979:I259T;ENSP00000349896:I238T	ENSP00000347979:I259T	I	+	2	0	FAS	90763955	0.993000	0.37304	0.956000	0.39512	0.989000	0.77384	3.843000	0.55865	2.042000	0.60477	0.528000	0.53228	ATA	.	.	none		0.383	FAS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049274.3		
MUC6	4588	hgsc.bcm.edu	37	11	1016770	1016770	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:1016770G>A	ENST00000421673.2	-	31	6081	c.6031C>T	c.(6031-6033)Cct>Tct	p.P2011S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2011	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.P2011S(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGGAGAAAGGTGGAACGTGA	0.532																																					p.P2011S		Atlas-SNP	.											MUC6_ENST00000421673,extremity,malignant_melanoma,0,1	MUC6	408	1	1	Substitution - Missense(1)	skin(1)	c.C6031T						scavenged	.																																			SO:0001583	missense	4588	exon31			AGAAAGGTGGAAC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6031C>T	11.37:g.1016770G>A	ENSP00000406861:p.Pro2011Ser	Somatic	430	3	0.00697674		WXS	Illumina HiSeq	Phase_I	447	11	0.0246085	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.638370	0.00799	.	.	ENSG00000184956	ENST00000421673	T	0.17370	2.28	2.4	-4.79	0.03200	.	.	.	.	.	T	0.06735	0.0172	N	0.21194	0.64	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39014	-0.9634	9	0.07990	T	0.79	.	1.1636	0.01810	0.3722:0.1007:0.2914:0.2356	.	2011	Q6W4X9	MUC6_HUMAN	S	2011	ENSP00000406861:P2011S	ENSP00000406861:P2011S	P	-	1	0	MUC6	1006770	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.781000	0.00773	-2.945000	0.00295	-0.671000	0.03813	CCT	.	.	none		0.532	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
ACKR4	51554	hgsc.bcm.edu	37	3	132319910	132319910	+	Silent	SNP	A	A	G			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:132319910A>G	ENST00000249887.2	+	2	765	c.669A>G	c.(667-669)acA>acG	p.T223T	ACAD11_ENST00000545291.1_Intron|ACAD11_ENST00000264990.6_Intron|ACAD11_ENST00000355458.3_Intron	NM_016557.2|NM_178445.2	NP_057641.1|NP_848540.1	Q9NPB9	ACKR4_HUMAN	atypical chemokine receptor 4	223					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)	p.T223T(1)									ACTTTATCACAGCAAGGACAC	0.388																																					p.T223T		Atlas-SNP	.											CCRL1,NS,carcinoma,0,1	CCRL1	30	1	1	Substitution - coding silent(1)	endometrium(1)	c.A669G						scavenged	.						82.0	81.0	81.0					3																	132319910		2203	4298	6501	SO:0001819	synonymous_variant	51554	exon1			TATCACAGCAAGG	AF110640	CCDS3075.1	3q22	2013-07-17	2013-07-16	2013-07-16	ENSG00000129048	ENSG00000129048		"""GPCR / Class A : Chemokine receptors : Atypical"""	1611	protein-coding gene	gene with protein product		606065	"""chemokine (C-C motif) receptor-like 1"""	CCRL1		10767544, 16148	Standard	NM_016557		Approved	CCR11, CCBP2, VSHK1, CCX-CKR, PPR1	uc003eow.3	Q9NPB9	OTTHUMG00000159768	ENST00000249887.2:c.669A>G	3.37:g.132319910A>G		Somatic	355	10	0.028169		WXS	Illumina HiSeq	Phase_I	506	20	0.0395257	NM_178445	B2R9U7	Silent	SNP	ENST00000249887.2	37	CCDS3075.1																																																																																			A|0.500;G|0.500	0.500	weak		0.388	ACKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357238.2	NM_016557	
MUC4	4585	hgsc.bcm.edu	37	3	195507077	195507077	+	Missense_Mutation	SNP	G	G	A	rs76343663	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:195507077G>A	ENST00000463781.3	-	2	11833	c.11374C>T	c.(11374-11376)Cct>Tct	p.P3792S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3792S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGGGGTGGTGTCA	0.597																																					p.P3792S		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,+1,1	MUC4	1505	1	0			c.C11374T						scavenged	.						7.0	7.0	7.0					3																	195507077		624	1491	2115	SO:0001583	missense	4585	exon2			GAAGAGGGGTGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11374C>T	3.37:g.195507077G>A	ENSP00000417498:p.Pro3792Ser	Somatic	129	8	0.0620155		WXS	Illumina HiSeq	Phase_I	129	14	0.108527	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	7.542	0.660889	0.14645	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.37058	1.43;1.22	.	.	.	.	0.555598	0.09973	N	0.732028	T	0.19485	0.0468	N	0.19112	0.55	0.19575	N	0.999969	B	0.15141	0.012	B	0.04013	0.001	T	0.27157	-1.0082	8	.	.	.	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	3664	E7ESK3	.	S	3792	ENSP00000417498:P3792S;ENSP00000420243:P3792S	.	P	-	1	0	MUC4	196991856	0.000000	0.05858	0.110000	0.21437	0.110000	0.19582	-0.857000	0.04286	0.064000	0.16427	0.064000	0.15345	CCT	G|0.991;A|0.009	0.009	strong		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
DNAH7	56171	hgsc.bcm.edu	37	2	196651835	196651835	+	Missense_Mutation	SNP	G	G	A	rs200008102	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr2:196651835G>A	ENST00000312428.6	-	58	10877	c.10777C>T	c.(10777-10779)Cgg>Tgg	p.R3593W	DNAH7_ENST00000409063.1_Missense_Mutation_p.R76W	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3593	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CCAAATTTCCGTCTTTCTTGT	0.413													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		18598	0.0		0.0	False		,,,				2504	0.0				p.R3593W		Atlas-SNP	.											.	DNAH7	512	.	0			c.C10777T						PASS	.						110.0	103.0	105.0					2																	196651835		1906	4145	6051	SO:0001583	missense	56171	exon58			ATTTCCGTCTTTC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.10777C>T	2.37:g.196651835G>A	ENSP00000311273:p.Arg3593Trp	Somatic	200	0	0		WXS	Illumina HiSeq	Phase_I	198	29	0.146465	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	19.54	3.846185	0.71603	.	.	ENSG00000118997	ENST00000312428;ENST00000409063	T;T	0.11604	2.76;2.76	4.34	3.43	0.39272	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.51873	0.1700	H	0.99565	4.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73369	-0.4004	10	0.87932	D	0	.	13.35	0.60597	0.0:0.0:0.8406:0.1594	.	3593	Q8WXX0	DYH7_HUMAN	W	3593;76	ENSP00000311273:R3593W;ENSP00000386912:R76W	ENSP00000311273:R3593W	R	-	1	2	DNAH7	196360080	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.696000	0.47052	1.120000	0.41904	0.555000	0.69702	CGG	G|1.000;A|0.000	0.000	strong		0.413	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
FAM66D	100132923	hgsc.bcm.edu	37	8	11990882	11990882	+	RNA	SNP	C	C	T	rs9720235	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr8:11990882C>T	ENST00000434078.2	+	0	608					NR_027425.1				family with sequence similarity 66, member D																		GTGTCTGAAACGCCGTGGCAG	0.498													t|||	2043	0.407947	0.2897	0.5187	5008	,	,		24947	0.4077		0.4513	False		,,,				2504	0.4448				p.V213I		Atlas-SNP	.											.	.	.	.	0			c.G637A						PASS	.																																					392197	exon1			CTGAAACGCCGTG			8p23.1	2013-07-05			ENSG00000255052	ENSG00000255052		"""Long non-coding RNAs"""	24159	non-coding RNA	RNA, long non-coding							Standard	NR_027425		Approved				OTTHUMG00000165269		8.37:g.11990882C>T		Somatic	3	0	0		WXS	Illumina HiSeq	Phase_I	10	9	0.9	NM_001256869		Missense_Mutation	SNP	ENST00000434078.2	37																																																																																				C|0.499;T|0.501	0.501	strong		0.498	FAM66D-201	KNOWN	basic	antisense	antisense		NR_027425	
PCNT	5116	hgsc.bcm.edu	37	21	47754488	47754488	+	Missense_Mutation	SNP	A	A	G	rs111737555		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr21:47754488A>G	ENST00000359568.5	+	3	552	c.445A>G	c.(445-447)Agt>Ggt	p.S149G	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	149					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GTTCACAGTCAGTGACCACCC	0.557																																					p.S149G		Atlas-SNP	.											PCNT,NS,carcinoma,0,1	PCNT	283	1	0			c.A445G						scavenged	.						192.0	121.0	145.0					21																	47754488		2203	4300	6503	SO:0001583	missense	5116	exon3			ACAGTCAGTGACC	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.445A>G	21.37:g.47754488A>G	ENSP00000352572:p.Ser149Gly	Somatic	64	3	0.046875		WXS	Illumina HiSeq	Phase_I	92	9	0.0978261	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	a	0.108	-1.142997	0.01728	.	.	ENSG00000160299	ENST00000359568	T	0.01705	4.68	0.428	0.428	0.16499	.	.	.	.	.	T	0.02380	0.0073	L	0.36672	1.1	0.21355	N	0.999717	P;B	0.46395	0.877;0.208	P;B	0.51866	0.682;0.016	T	0.25187	-1.0139	8	0.06625	T	0.88	.	.	.	.	.	31;149	O95613-2;O95613	.;PCNT_HUMAN	G	149	ENSP00000352572:S149G	ENSP00000352572:S149G	S	+	1	0	PCNT	46578916	0.150000	0.22732	0.070000	0.20053	0.032000	0.12392	1.190000	0.32126	0.380000	0.24823	0.172000	0.16884	AGT	A|0.999;T|0.001	.	alt		0.557	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
ZNF814	730051	hgsc.bcm.edu	37	19	58385790	58385790	+	Missense_Mutation	SNP	G	G	T	rs111727691		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr19:58385790G>T	ENST00000435989.2	-	3	1202	c.968C>A	c.(967-969)cCt>cAt	p.P323H	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	323					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACATTCATAAGGTCTTTTCCC	0.358																																					p.P323H		Atlas-SNP	.											.	ZNF814	93	.	0			c.C968A						PASS	.						15.0	12.0	13.0					19																	58385790		688	1563	2251	SO:0001583	missense	730051	exon3			TCATAAGGTCTTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.968C>A	19.37:g.58385790G>T	ENSP00000410545:p.Pro323His	Somatic	170	0	0		WXS	Illumina HiSeq	Phase_I	189	28	0.148148	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	8.139	0.784825	0.16189	.	.	ENSG00000204514	ENST00000435989	T	0.29397	1.57	2.27	1.18	0.20946	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57080	0.2029	M	0.90019	3.08	0.20764	N	0.999853	D	0.89917	1.0	D	0.67231	0.95	T	0.46247	-0.9205	9	0.66056	D	0.02	.	9.258	0.37595	0.0:0.0:0.7811:0.2189	.	323	B7Z6K7	ZN814_HUMAN	H	323	ENSP00000410545:P323H	ENSP00000410545:P323H	P	-	2	0	ZNF814	63077602	0.000000	0.05858	0.028000	0.17463	0.016000	0.09150	-0.439000	0.06897	0.330000	0.23485	-1.407000	0.01130	CCT	G|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
GPR113	165082	hgsc.bcm.edu	37	2	26534617	26534617	+	Missense_Mutation	SNP	C	C	T	rs201936475	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr2:26534617C>T	ENST00000311519.1	-	11	1978	c.1979G>A	c.(1978-1980)cGa>cAa	p.R660Q	GPR113_ENST00000333478.6_Missense_Mutation_p.R461Q|GPR113_ENST00000541401.1_Missense_Mutation_p.R263Q|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000421160.2_Missense_Mutation_p.R591Q	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	660					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCCAGTTTTCGCAGCACCAG	0.547													C|||	4	0.000798722	0.0	0.0043	5008	,	,		21134	0.0		0.0	False		,,,				2504	0.001				p.R660Q		Atlas-SNP	.											GPR113_ENST00000311519,NS,malignant_melanoma,0,5	GPR113	134	5	0			c.G1979A						PASS	.						49.0	49.0	49.0					2																	26534617		2203	4300	6503	SO:0001583	missense	165082	exon11			AGTTTTCGCAGCA	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.1979G>A	2.37:g.26534617C>T	ENSP00000307831:p.Arg660Gln	Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	41	12	0.292683	NM_001145168	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	ENST00000311519.1	37	CCDS46239.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	0.197	-1.048092	0.01981	.	.	ENSG00000173567	ENST00000541401;ENST00000333478;ENST00000421160;ENST00000311519	T;T;T;T	0.11604	2.76;2.76;2.76;2.76	5.84	-0.949	0.10376	Domain of unknown function DUF3497 (1);	.	.	.	.	T	0.02727	0.0082	N	0.00554	-1.385	0.09310	N	0.999999	B;B;B;B	0.18013	0.025;0.02;0.025;0.02	B;B;B;B	0.19148	0.01;0.024;0.019;0.006	T	0.47824	-0.9087	9	0.15499	T	0.54	-0.1341	10.2306	0.43253	0.0:0.4465:0.0:0.5535	.	591;461;660;263	E9PEV1;Q8IZF5-2;Q8IZF5;F5H1E4	.;.;GP113_HUMAN;.	Q	263;461;591;660	ENSP00000445729:R263Q;ENSP00000327396:R461Q;ENSP00000388537:R591Q;ENSP00000307831:R660Q	ENSP00000307831:R660Q	R	-	2	0	GPR113	26388121	0.000000	0.05858	0.032000	0.17829	0.051000	0.14879	-1.851000	0.01669	-0.127000	0.11661	-1.110000	0.02074	CGA	C|1.000;T|0.000	0.000	strong		0.547	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835	
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240794	39240794	+	Silent	SNP	C	C	A	rs9894106|rs553572799	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr17:39240794C>A	ENST00000391417.4	+	1	336	c.336C>A	c.(334-336)ccC>ccA	p.P112P		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	137	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.R111_C115delRPSCC(1)|p.P112P(1)|p.?(1)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						gctgccgccccagctgctgcc	0.667																																					p.P112P		Atlas-SNP	.											KRTAP4-7,NS,carcinoma,0,3	KRTAP4-7	49	3	3	Unknown(1)|Substitution - coding silent(1)|Deletion - In frame(1)	NS(2)|prostate(1)	c.C336A						scavenged	.						13.0	14.0	14.0					17																	39240794		691	1589	2280	SO:0001819	synonymous_variant	100132476	exon1			CCGCCCCAGCTGC	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.336C>A	17.37:g.39240794C>A		Somatic	22	0	0		WXS	Illumina HiSeq	Phase_I	9	6	0.666667	NM_033061	A0AVM6|A8MQ08|A8MTL4	Silent	SNP	ENST00000391417.4	37	CCDS45673.1																																																																																			.	.	weak		0.667	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
KRTAP11-1	337880	hgsc.bcm.edu	37	21	32253665	32253665	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr21:32253665C>A	ENST00000332378.4	-	1	209	c.179G>T	c.(178-180)tGc>tTc	p.C60F		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	60						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						GGGCTCACAGCAGGTCTCTTG	0.562																																					p.C60F		Atlas-SNP	.											KRTAP11-1,NS,carcinoma,+1,1	KRTAP11-1	46	1	0			c.G179T						PASS	.						74.0	69.0	71.0					21																	32253665		2203	4300	6503	SO:0001583	missense	337880	exon1			TCACAGCAGGTCT	AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.179G>T	21.37:g.32253665C>A	ENSP00000330720:p.Cys60Phe	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	74	27	0.364865	NM_175858	A1L4I8	Missense_Mutation	SNP	ENST00000332378.4	37	CCDS13608.1	.	.	.	.	.	.	.	.	.	.	C	6.705	0.498771	0.12762	.	.	ENSG00000182591	ENST00000332378	T	0.04015	3.73	5.4	0.0314	0.14171	.	1.043570	0.07461	N	0.900691	T	0.07143	0.0181	M	0.71581	2.175	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.41716	-0.9493	10	0.59425	D	0.04	3.1197	3.5867	0.07973	0.1227:0.3415:0.3867:0.1491	.	60	Q8IUC1	KR111_HUMAN	F	60	ENSP00000330720:C60F	ENSP00000330720:C60F	C	-	2	0	KRTAP11-1	31175536	0.064000	0.20934	0.001000	0.08648	0.538000	0.34931	-0.002000	0.12924	-0.184000	0.10567	0.650000	0.86243	TGC	.	.	none		0.562	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128225.1		
DOCK5	80005	hgsc.bcm.edu	37	8	25230091	25230091	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr8:25230091C>T	ENST00000276440.7	+	35	3585	c.3541C>T	c.(3541-3543)Cgg>Tgg	p.R1181W		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1181					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		AGAACATTGCCGGAAACACAA	0.552																																					p.R1181W	Pancreas(145;34 1887 3271 10937 30165)	Atlas-SNP	.											.	DOCK5	167	.	0			c.C3541T						PASS	.						68.0	65.0	66.0					8																	25230091		2203	4300	6503	SO:0001583	missense	80005	exon35			CATTGCCGGAAAC		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.3541C>T	8.37:g.25230091C>T	ENSP00000276440:p.Arg1181Trp	Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	64	9	0.140625	NM_024940	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	ENST00000276440.7	37	CCDS6047.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.987709|3.987709	0.74589|0.74589	.|.	.|.	ENSG00000147459|ENSG00000147459	ENST00000444569|ENST00000276440	.|T	.|0.67523	.|-0.27	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80025|0.80025	0.4548|0.4548	M|M	0.70595|0.70595	2.14|2.14	0.58432|0.58432	D|D	0.999995|0.999995	.|D;D;D	.|0.76494	.|0.999;0.999;0.999	.|D;P;D	.|0.65684	.|0.937;0.889;0.937	T|T	0.81722|0.81722	-0.0803|-0.0803	5|10	.|0.72032	.|D	.|0.01	.|.	15.8389|15.8389	0.78824|0.78824	0.1362:0.8638:0.0:0.0|0.1362:0.8638:0.0:0.0	.|.	.|1171;956;1181	.|D3DSS6;Q68DL4;Q9H7D0	.|.;.;DOCK5_HUMAN	L|W	952|1181	.|ENSP00000276440:R1181W	.|ENSP00000276440:R1181W	P|R	+|+	2|1	0|2	DOCK5|DOCK5	25286008|25286008	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.952000|1.952000	0.40343|0.40343	2.633000|2.633000	0.89246|0.89246	0.655000|0.655000	0.94253|0.94253	CCG|CGG	.	.	none		0.552	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	
NEFH	4744	hgsc.bcm.edu	37	22	29885567	29885567	+	Silent	SNP	A	A	C	rs147489453|rs75808076|rs59279731		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr22:29885567A>C	ENST00000310624.6	+	4	1971	c.1938A>C	c.(1936-1938)gcA>gcC	p.A646A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	652	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGAGGAAGCAAAGTCCCCTG	0.567																																					p.A646A		Atlas-SNP	.											NEFH,rectum,carcinoma,0,1	NEFH	178	1	0			c.A1938C						scavenged	.						78.0	77.0	77.0					22																	29885567		2133	4127	6260	SO:0001819	synonymous_variant	4744	exon4			GGAAGCAAAGTCC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1938A>C	22.37:g.29885567A>C		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	42	8	0.190476	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	weak		0.567	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
GPR50	9248	hgsc.bcm.edu	37	X	150348455	150348455	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chrX:150348455C>T	ENST00000218316.3	+	2	469	c.400C>T	c.(400-402)Ctc>Ttc	p.L134F	AF003625.3_ENST00000602313.1_lincRNA|GPR50-AS1_ENST00000454196.1_RNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	134					cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					CTGCCACAGCCTCCAGTACGA	0.542																																					p.L134F		Atlas-SNP	.											.	GPR50	195	.	0			c.C400T						PASS	.						122.0	122.0	122.0					X																	150348455		2203	4300	6503	SO:0001583	missense	9248	exon2			CACAGCCTCCAGT	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.400C>T	X.37:g.150348455C>T	ENSP00000218316:p.Leu134Phe	Somatic	147	0	0		WXS	Illumina HiSeq	Phase_I	152	27	0.177632	NM_004224	Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	ENST00000218316.3	37	CCDS44012.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.318460	0.40996	.	.	ENSG00000102195	ENST00000535473;ENST00000218316	T	0.51071	0.72	4.21	4.21	0.49690	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.36276	0.0961	L	0.35249	1.045	0.45852	D	0.998714	B;P	0.37423	0.026;0.594	B;B	0.40940	0.064;0.344	T	0.11891	-1.0569	10	0.29301	T	0.29	-19.0452	7.6173	0.28165	0.0:0.8782:0.0:0.1218	.	87;134	F5H1S3;Q13585	.;MTR1L_HUMAN	F	87;134	ENSP00000218316:L134F	ENSP00000218316:L134F	L	+	1	0	GPR50	150099113	1.000000	0.71417	0.999000	0.59377	0.720000	0.41350	2.687000	0.46976	1.838000	0.53458	0.523000	0.50628	CTC	.	.	none		0.542	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224	
C1QTNF2	114898	hgsc.bcm.edu	37	5	159781844	159781844	+	Nonsense_Mutation	SNP	G	G	A	rs144600396		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr5:159781844G>A	ENST00000393975.3	-	2	313	c.310C>T	c.(310-312)Cga>Tga	p.R104*		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	59	Collagen-like.				activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAGCCCATTCGTCCCATCATT	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		9581	0.0		0.0	False		,,,				2504	0.001				p.R104X		Atlas-SNP	.											.	C1QTNF2	33	.	0			c.C310T						PASS	.	G	stop/ARG	0,4406		0,0,2203	28.0	25.0	26.0		310	2.6	1.0	5	dbSNP_134	26	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	C1QTNF2	NM_031908.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		104/331	159781844	1,13005	2203	4300	6503	SO:0001587	stop_gained	114898	exon2			CCATTCGTCCCAT	AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.310C>T	5.37:g.159781844G>A	ENSP00000377545:p.Arg104*	Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	68	10	0.147059	NM_031908		Nonsense_Mutation	SNP	ENST00000393975.3	37	CCDS4351.2	.	.	.	.	.	.	.	.	.	.	G	27.8	4.860499	0.91433	0.0	1.16E-4	ENSG00000145861	ENST00000393975	.	.	.	5.16	2.62	0.31277	.	0.300113	0.33515	N	0.004835	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.7246	0.46061	0.0:0.0:0.3199:0.6801	.	.	.	.	X	104	.	ENSP00000377545:R104X	R	-	1	2	C1QTNF2	159714422	0.998000	0.40836	1.000000	0.80357	0.961000	0.63080	1.207000	0.32333	0.802000	0.34089	0.313000	0.20887	CGA	G|1.000;A|0.000	0.000	strong		0.662	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252672.2		
FZD10	11211	hgsc.bcm.edu	37	12	130649024	130649024	+	Missense_Mutation	SNP	G	G	C	rs369465643		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr12:130649024G>C	ENST00000229030.4	+	1	2021	c.1537G>C	c.(1537-1539)Gtg>Ctg	p.V513L	FZD10-AS1_ENST00000505807.2_RNA|FZD10_ENST00000539839.1_3'UTR			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	513					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		TATGCTGCTGGTGGTGGGGAT	0.542																																					p.V513L		Atlas-SNP	.											.	FZD10	95	.	0			c.G1537C						PASS	.						42.0	43.0	42.0					12																	130649024		2203	4300	6503	SO:0001583	missense	11211	exon1			CTGCTGGTGGTGG	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.1537G>C	12.37:g.130649024G>C	ENSP00000229030:p.Val513Leu	Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	40	7	0.175	NM_007197		Missense_Mutation	SNP	ENST00000229030.4	37	CCDS9267.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.266811	0.40095	.	.	ENSG00000111432	ENST00000229030	D	0.82081	-1.57	4.87	3.97	0.46021	GPCR, family 2-like (1);	0.000000	0.64402	U	0.000002	T	0.75034	0.3795	L	0.28556	0.865	0.54753	D	0.999985	P	0.35107	0.484	B	0.38225	0.268	T	0.70066	-0.4974	10	0.25751	T	0.34	.	13.0162	0.58759	0.0787:0.0:0.9213:0.0	.	513	Q9ULW2	FZD10_HUMAN	L	513	ENSP00000229030:V513L	ENSP00000229030:V513L	V	+	1	0	FZD10	129214977	1.000000	0.71417	0.996000	0.52242	0.835000	0.47333	4.761000	0.62243	1.027000	0.39758	0.561000	0.74099	GTG	.	.	alt		0.542	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
BBS1	582	hgsc.bcm.edu	37	11	66299440	66299440	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:66299440G>A	ENST00000318312.7	+	17	1765	c.1714G>A	c.(1714-1716)Ggc>Agc	p.G572S	CTD-3074O7.11_ENST00000419755.3_Missense_Mutation_p.G609S|ZDHHC24_ENST00000526986.1_Intron|BBS1_ENST00000393994.2_3'UTR|BBS1_ENST00000455748.2_Missense_Mutation_p.G475S	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	572					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						GCTTCGAGAAGGCCAAAGTGC	0.642									Bardet-Biedl syndrome																												p.G572S	GBM(152;173 2612 9770 10137)	Atlas-SNP	.											.	BBS1	58	.	0			c.G1714A						PASS	.						45.0	39.0	41.0					11																	66299440		2196	4293	6489	SO:0001583	missense	582	exon17	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	CGAGAAGGCCAAA	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.1714G>A	11.37:g.66299440G>A	ENSP00000317469:p.Gly572Ser	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	46	10	0.217391	NM_024649	Q32MM9|Q32MN0|Q96SN4	Missense_Mutation	SNP	ENST00000318312.7	37	CCDS8142.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828530	0.90955	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000455748	D;D;D	0.96856	-4.08;-4.15;-3.97	5.14	5.14	0.70334	.	.	.	.	.	D	0.95671	0.8592	L	0.43152	1.355	0.80722	D	1	D;D;D	0.56521	0.976;0.976;0.976	P;P;P	0.54060	0.741;0.629;0.741	D	0.93872	0.7163	9	0.22109	T	0.4	.	16.1961	0.82025	0.0:0.0:1.0:0.0	.	475;572;609	E7EQH1;Q8NFJ9;Q8NFJ9-2	.;BBS1_HUMAN;.	S	609;572;475	ENSP00000398526:G609S;ENSP00000317469:G572S;ENSP00000405764:G475S	ENSP00000317469:G572S	G	+	1	0	BBS1;CTD-3074O7.11	66056016	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.211000	0.89754	2.682000	0.91365	0.585000	0.79938	GGC	.	.	none		0.642	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393235.2		
RSBN1L	222194	hgsc.bcm.edu	37	7	77378893	77378893	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr7:77378893G>A	ENST00000334955.8	+	3	883	c.856G>A	c.(856-858)Gat>Aat	p.D286N	RSBN1L_ENST00000445288.1_Missense_Mutation_p.D16N	NM_198467.2	NP_940869.2	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	286						nucleus (GO:0005634)				central_nervous_system(1)|endometrium(12)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						ATTGCTAACTGATGTTGAAGA	0.353																																					p.D286N		Atlas-SNP	.											.	RSBN1L	74	.	0			c.G856A						PASS	.						107.0	98.0	101.0					7																	77378893		1854	4109	5963	SO:0001583	missense	222194	exon3			CTAACTGATGTTG	AK124517	CCDS43607.1	7q21.11	2004-08-11			ENSG00000187257	ENSG00000187257			24765	protein-coding gene	gene with protein product						12477932	Standard	NM_198467		Approved	FLJ42526, FLJ45813, MGC71764	uc010ldt.1	Q6PCB5	OTTHUMG00000155517	ENST00000334955.8:c.856G>A	7.37:g.77378893G>A	ENSP00000334040:p.Asp286Asn	Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	87	16	0.183908	NM_198467	C9K0P1|Q6ZS58|Q6ZVI9|Q86X48	Missense_Mutation	SNP	ENST00000334955.8	37	CCDS43607.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147805	0.78001	.	.	ENSG00000187257	ENST00000334955;ENST00000445288	T	0.08193	3.12	5.58	5.58	0.84498	.	0.052712	0.85682	D	0.000000	T	0.20495	0.0493	L	0.43152	1.355	0.33216	D	0.554005	D	0.56968	0.978	D	0.63488	0.915	T	0.05273	-1.0895	10	0.18710	T	0.47	-19.8707	19.578	0.95452	0.0:0.0:1.0:0.0	.	286	Q6PCB5	RSBNL_HUMAN	N	286;16	ENSP00000334040:D286N	ENSP00000334040:D286N	D	+	1	0	RSBN1L	77216829	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.973000	0.76116	2.628000	0.89032	0.655000	0.94253	GAT	.	.	none		0.353	RSBN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340455.3	NM_198467	
MUC4	4585	hgsc.bcm.edu	37	3	195511237	195511237	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:195511237T>C	ENST00000463781.3	-	2	7673	c.7214A>G	c.(7213-7215)gAc>gGc	p.D2405G	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2405G|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGTGTCGGTGACAGG	0.587																																					p.D2405G		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-1,3	MUC4	1505	3	0			c.A7214G						scavenged	.																																			SO:0001583	missense	4585	exon2			GAAGTGTCGGTGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7214A>G	3.37:g.195511237T>C	ENSP00000417498:p.Asp2405Gly	Somatic	203	8	0.0394089		WXS	Illumina HiSeq	Phase_I	233	15	0.0643777	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	T	5.343	0.248518	0.10130	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32272	1.48;1.46	.	.	.	.	.	.	.	.	T	0.28732	0.0712	N	0.19112	0.55	0.09310	N	0.999999	P	0.52170	0.951	D	0.65443	0.935	T	0.12993	-1.0526	7	.	.	.	.	1.4125	0.02295	0.3443:0.3266:0.0:0.3291	.	2405	E7ESK3	.	G	2405	ENSP00000417498:D2405G;ENSP00000420243:D2405G	.	D	-	2	0	MUC4	196995632	0.000000	0.05858	0.003000	0.11579	0.080000	0.17528	-0.862000	0.04263	-0.437000	0.07243	0.000000	0.15137	GAC	.	.	none		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
OR2T4	127074	hgsc.bcm.edu	37	1	248525639	248525639	+	Missense_Mutation	SNP	A	A	T	rs34079073|rs76878172	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:248525639A>T	ENST00000366475.1	+	1	757	c.757A>T	c.(757-759)Atc>Ttc	p.I253F		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTATTTACTCATCCTCCTCAC	0.522																																					p.I253F		Atlas-SNP	.											OR2T4,brain,glioma,0,1	OR2T4	126	1	0			c.A757T						scavenged	.						94.0	74.0	81.0					1																	248525639		2024	3426	5450	SO:0001583	missense	127074	exon1			TTACTCATCCTCC	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.757A>T	1.37:g.248525639A>T	ENSP00000355431:p.Ile253Phe	Somatic	419	410	0.97852		WXS	Illumina HiSeq	Phase_I	454	437	0.962555	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	A	13.48	2.250012	0.39797	.	.	ENSG00000196944	ENST00000366475	T	0.00414	7.52	3.09	3.09	0.35607	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000219	T	0.01835	0.0058	H	0.96142	3.775	0.40727	D	0.98271	D	0.89917	1.0	D	0.85130	0.997	T	0.25117	-1.0141	10	0.87932	D	0	.	11.1471	0.48436	1.0:0.0:0.0:0.0	.	253	Q8NH00	OR2T4_HUMAN	F	253	ENSP00000355431:I253F	ENSP00000355431:I253F	I	+	1	0	OR2T4	246592262	1.000000	0.71417	0.050000	0.19076	0.010000	0.07245	7.329000	0.79170	1.264000	0.44198	0.477000	0.44152	ATC	.	.	alt		0.522	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
MRPL19	9801	hgsc.bcm.edu	37	2	75879766	75879766	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr2:75879766A>T	ENST00000393909.2	+	4	483	c.458A>T	c.(457-459)aAt>aTt	p.N153I	MRPL19_ENST00000358788.6_Missense_Mutation_p.N153I|MRPL19_ENST00000409374.1_Missense_Mutation_p.N153I	NM_014763.3	NP_055578.2	P49406	RM19_HUMAN	mitochondrial ribosomal protein L19	153					translation (GO:0006412)	mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(1)|lung(6)	8						ATCCTTAGGAATGTTATCGAA	0.388																																					p.N153I		Atlas-SNP	.											.	MRPL19	21	.	0			c.A458T						PASS	.						131.0	117.0	121.0					2																	75879766		1846	4091	5937	SO:0001583	missense	9801	exon4			TTAGGAATGTTAT	AB051621	CCDS1960.2	2p11.1-q11.2	2012-09-13			ENSG00000115364	ENSG00000115364		"""Mitochondrial ribosomal proteins / large subunits"""	14052	protein-coding gene	gene with protein product	"""39S ribosomal protein L19"""	611832				11543634, 17309879	Standard	XM_006712155		Approved	MRP-L15, RPML15, KIAA0104, RLX1	uc002snl.3	P49406	OTTHUMG00000129990	ENST00000393909.2:c.458A>T	2.37:g.75879766A>T	ENSP00000377486:p.Asn153Ile	Somatic	266	0	0		WXS	Illumina HiSeq	Phase_I	229	32	0.139738	NM_014763	Q53TX9|Q96Q52	Missense_Mutation	SNP	ENST00000393909.2	37	CCDS1960.2	.	.	.	.	.	.	.	.	.	.	A	16.85	3.237813	0.58886	.	.	ENSG00000115364	ENST00000393909;ENST00000409374	.	.	.	5.39	5.39	0.77823	Translation protein SH3-like (1);	0.000000	0.85682	D	0.000000	D	0.85265	0.5657	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88718	0.3227	9	0.87932	D	0	-33.2818	13.6754	0.62451	1.0:0.0:0.0:0.0	.	153	P49406	RM19_HUMAN	I	153	.	ENSP00000377486:N153I	N	+	2	0	MRPL19	75733274	1.000000	0.71417	1.000000	0.80357	0.267000	0.26476	8.779000	0.91792	2.187000	0.69744	0.528000	0.53228	AAT	.	.	none		0.388	MRPL19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252256.1	NM_014763	
POTEC	388468	hgsc.bcm.edu	37	18	14542891	14542891	+	Silent	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr18:14542891G>A	ENST00000358970.5	-	1	254	c.255C>T	c.(253-255)gaC>gaT	p.D85D	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	85										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						AGTTGTCATGGTCTCCAGAAG	0.592																																					p.D85D		Atlas-SNP	.											POTEC,NS,carcinoma,0,1	POTEC	129	1	0			c.C255T						PASS	.						48.0	53.0	52.0					18																	14542891		692	1591	2283	SO:0001819	synonymous_variant	388468	exon1			GTCATGGTCTCCA	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.255C>T	18.37:g.14542891G>A		Somatic	298	0	0		WXS	Illumina HiSeq	Phase_I	275	28	0.101818	NM_001137671		Silent	SNP	ENST00000358970.5	37	CCDS45835.1																																																																																			.	.	none		0.592	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
PAPPA	5069	hgsc.bcm.edu	37	9	119097144	119097144	+	Silent	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr9:119097144C>T	ENST00000328252.3	+	13	3771	c.3402C>T	c.(3400-3402)ctC>ctT	p.L1134L	PAPPA_ENST00000534838.1_Silent_p.L172L	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1134					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TGACAGGCCTCCATGTCCTGA	0.622																																					p.L1134L		Atlas-SNP	.											.	PAPPA	243	.	0			c.C3402T						PASS	.						51.0	45.0	47.0					9																	119097144		2203	4300	6503	SO:0001819	synonymous_variant	5069	exon13			AGGCCTCCATGTC		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3402C>T	9.37:g.119097144C>T		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	53	11	0.207547	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	ENST00000328252.3	37	CCDS6813.1																																																																																			.	.	none		0.622	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
LIMD1	8994	hgsc.bcm.edu	37	3	45636379	45636379	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:45636379A>T	ENST00000273317.4	+	1	29	c.8A>T	c.(7-9)aAg>aTg	p.K3M	AC099539.1_ENST00000516118.1_RNA|LIMD1_ENST00000440097.1_Missense_Mutation_p.K3M|LIMD1_ENST00000465039.1_Intron	NM_014240.2	NP_055055.1	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	3					cell migration (GO:0016477)|cytoplasmic mRNA processing body assembly (GO:0033962)|cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of hippo signaling (GO:0035331)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|phosphorylation (GO:0016310)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|RISC complex (GO:0016442)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		AGCATGGATAAGTATGACGAC	0.557																																					p.K3M		Atlas-SNP	.											.	LIMD1	34	.	0			c.A8T						PASS	.						68.0	71.0	70.0					3																	45636379		2203	4300	6503	SO:0001583	missense	8994	exon1			TGGATAAGTATGA	AJ132408	CCDS2729.1	3p21.31	2008-02-01			ENSG00000144791	ENSG00000144791			6612	protein-coding gene	gene with protein product		604543				10647888	Standard	NM_014240		Approved		uc003coq.3	Q9UGP4	OTTHUMG00000133453	ENST00000273317.4:c.8A>T	3.37:g.45636379A>T	ENSP00000273317:p.Lys3Met	Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	73	8	0.109589	NM_014240	Q17RQ1|Q9BQQ9|Q9NQ47	Missense_Mutation	SNP	ENST00000273317.4	37	CCDS2729.1	.	.	.	.	.	.	.	.	.	.	A	18.47	3.630201	0.67015	.	.	ENSG00000144791	ENST00000440097;ENST00000273317	T;T	0.71103	-0.54;-0.3	4.16	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.71074	0.3297	N	0.19112	0.55	0.43936	D	0.996592	D	0.71674	0.998	D	0.77557	0.99	T	0.74003	-0.3804	10	0.87932	D	0	.	9.5521	0.39317	0.8229:0.177:0.0:0.0	.	3	Q9UGP4	LIMD1_HUMAN	M	3	ENSP00000394537:K3M;ENSP00000273317:K3M	ENSP00000273317:K3M	K	+	2	0	LIMD1	45611383	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	6.879000	0.75572	1.520000	0.48965	0.379000	0.24179	AAG	.	.	none		0.557	LIMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257327.1	NM_014240	
HIST1H1B	3009	hgsc.bcm.edu	37	6	27835042	27835042	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr6:27835042C>T	ENST00000331442.3	-	1	317	c.266G>A	c.(265-267)aGc>aAc	p.S89N		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	89	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						GCTCACCAAGCTCTTGAGGCC	0.577																																					p.S89N		Atlas-SNP	.											.	HIST1H1B	54	.	0			c.G266A						PASS	.						130.0	141.0	138.0					6																	27835042		2203	4300	6503	SO:0001583	missense	3009	exon1			ACCAAGCTCTTGA	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.266G>A	6.37:g.27835042C>T	ENSP00000330074:p.Ser89Asn	Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	151	27	0.178808	NM_005322	Q14529|Q3MJ42	Missense_Mutation	SNP	ENST00000331442.3	37	CCDS4635.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.550368	0.65311	.	.	ENSG00000184357	ENST00000331442	T	0.09630	2.96	5.43	5.43	0.79202	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.352440	0.35615	N	0.003089	T	0.12518	0.0304	L	0.45422	1.42	0.37742	D	0.925646	P	0.38048	0.616	P	0.51355	0.667	T	0.00855	-1.1539	10	0.54805	T	0.06	-25.9517	14.2524	0.66028	0.0:0.8513:0.1487:0.0	.	89	P16401	H15_HUMAN	N	89	ENSP00000330074:S89N	ENSP00000330074:S89N	S	-	2	0	HIST1H1B	27943021	1.000000	0.71417	1.000000	0.80357	0.293000	0.27360	1.955000	0.40372	2.716000	0.92895	0.655000	0.94253	AGC	.	.	none		0.577	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	NM_005322	
OR52L1	338751	hgsc.bcm.edu	37	11	6007398	6007398	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:6007398C>T	ENST00000332249.4	-	1	817	c.763G>A	c.(763-765)Gcg>Acg	p.A255T		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTGCTAAACGCCTTAAGTCGG	0.512																																					p.A255T	Melanoma(121;653 1666 10547 22796 51255)	Atlas-SNP	.											.	OR52L1	100	.	0			c.G763A						PASS	.						160.0	156.0	157.0					11																	6007398		2072	4222	6294	SO:0001583	missense	338751	exon1			TAAACGCCTTAAG	AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.763G>A	11.37:g.6007398C>T	ENSP00000330338:p.Ala255Thr	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	77	13	0.168831	NM_001005173	B2RPA6|Q6IFK9	Missense_Mutation	SNP	ENST00000332249.4	37	CCDS44529.1	.	.	.	.	.	.	.	.	.	.	C	6.616	0.482107	0.12581	.	.	ENSG00000183313	ENST00000332249	T	0.00357	7.89	3.95	3.95	0.45737	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43579	D	0.000558	T	0.00412	0.0013	M	0.79123	2.44	0.31266	N	0.692361	P	0.34955	0.477	B	0.37888	0.26	T	0.25117	-1.0141	10	0.42905	T	0.14	.	14.9281	0.70896	0.0:1.0:0.0:0.0	.	255	Q8NGH7	O52L1_HUMAN	T	255	ENSP00000330338:A255T	ENSP00000330338:A255T	A	-	1	0	OR52L1	5963974	0.522000	0.26266	0.997000	0.53966	0.072000	0.16883	1.327000	0.33746	1.914000	0.55421	0.313000	0.20887	GCG	.	.	none		0.512	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383754.1	NM_001005173	
FAM117A	81558	hgsc.bcm.edu	37	17	47799869	47799869	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr17:47799869G>A	ENST00000240364.2	-	3	533	c.454C>T	c.(454-456)Cga>Tga	p.R152*	FAM117A_ENST00000514018.1_5'UTR|RP11-613C6.2_ENST00000512720.1_RNA|FAM117A_ENST00000513602.1_5'UTR	NM_030802.3	NP_110429.1	Q9C073	F117A_HUMAN	family with sequence similarity 117, member A	152										haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	17						ACCTCTTTTCGGTGGTCTGTG	0.582																																					p.R152X		Atlas-SNP	.											.	FAM117A	45	.	0			c.C454T						PASS	.						129.0	95.0	106.0					17																	47799869		2203	4300	6503	SO:0001587	stop_gained	81558	exon3			CTTTTCGGTGGTC	BC037572	CCDS11553.1	17q21.33	2006-04-26				ENSG00000121104			24179	protein-coding gene	gene with protein product	"""C/EBP induced protein"""					12477932	Standard	NM_030802		Approved		uc002ipk.3	Q9C073		ENST00000240364.2:c.454C>T	17.37:g.47799869G>A	ENSP00000240364:p.Arg152*	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	63	9	0.142857	NM_030802	B7Z7Q3	Nonsense_Mutation	SNP	ENST00000240364.2	37	CCDS11553.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870750	0.72065	.	.	ENSG00000121104	ENST00000240364;ENST00000511743	.	.	.	5.22	4.24	0.50183	.	0.096296	0.44688	D	0.000421	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-13.8172	13.1594	0.59537	0.0:0.0:0.8398:0.1602	.	.	.	.	X	152;42	.	ENSP00000240364:R152X	R	-	1	2	FAM117A	45154868	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.596000	0.61055	1.400000	0.46741	0.655000	0.94253	CGA	.	.	none		0.582	FAM117A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365736.1	NM_030802	
MST1R	4486	hgsc.bcm.edu	37	3	49940010	49940010	+	Missense_Mutation	SNP	C	C	T	rs367549694		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:49940010C>T	ENST00000296474.3	-	1	1060	c.1033G>A	c.(1033-1035)Gta>Ata	p.V345I	CTD-2330K9.2_ENST00000435478.1_RNA|MST1R_ENST00000344206.4_Missense_Mutation_p.V345I|CTD-2330K9.3_ENST00000419183.1_5'Flank	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	345	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		CCAAATAGTACTTCCTGGCCC	0.617																																					p.V345I		Atlas-SNP	.											.	MST1R	205	.	0			c.G1033A						PASS	.	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	146.0	143.0	144.0		1033	4.9	1.0	3		144	0,8600		0,0,4300	no	missense	MST1R	NM_002447.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	345/1401	49940010	1,13005	2203	4300	6503	SO:0001583	missense	4486	exon1			ATAGTACTTCCTG	X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.1033G>A	3.37:g.49940010C>T	ENSP00000296474:p.Val345Ile	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	112	18	0.160714	NM_001244937	B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	ENST00000296474.3	37	CCDS2807.1	.	.	.	.	.	.	.	.	.	.	C	15.44	2.834437	0.50951	2.27E-4	0.0	ENSG00000164078	ENST00000296474;ENST00000344206	T;T	0.13420	2.59;2.59	4.92	4.92	0.64577	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.057844	0.64402	D	0.000002	T	0.23410	0.0566	L	0.32530	0.975	0.43439	D	0.995613	P;D;P;P;D	0.76494	0.867;0.996;0.867;0.867;0.999	P;D;P;P;D	0.85130	0.47;0.99;0.47;0.673;0.997	T	0.01545	-1.1328	10	0.02654	T	1	-18.159	17.7272	0.88368	0.0:1.0:0.0:0.0	.	345;345;345;345;345	Q04912-3;Q04912-4;Q04912-6;Q04912-5;Q04912	.;.;.;.;RON_HUMAN	I	345	ENSP00000296474:V345I;ENSP00000341325:V345I	ENSP00000296474:V345I	V	-	1	0	MST1R	49915014	0.976000	0.34144	0.994000	0.49952	0.660000	0.38997	2.258000	0.43249	2.268000	0.75426	0.561000	0.74099	GTA	.	.	weak		0.617	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345403.1		
EPHA6	285220	hgsc.bcm.edu	37	3	96706499	96706499	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:96706499G>A	ENST00000389672.5	+	3	814	c.776G>A	c.(775-777)cGc>cAc	p.R259H	EPHA6_ENST00000470610.2_Missense_Mutation_p.R259H|EPHA6_ENST00000542517.1_Missense_Mutation_p.R165H	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	165						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						TTGGGTGATCGCATCCTCAAA	0.443																																					p.R259H		Atlas-SNP	.											EPHA6_ENST00000389672,colon,carcinoma,+1,9	EPHA6	439	9	0			c.G776A						PASS	.						203.0	209.0	207.0					3																	96706499		1900	4141	6041	SO:0001583	missense	285220	exon3			GTGATCGCATCCT	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.776G>A	3.37:g.96706499G>A	ENSP00000374323:p.Arg259His	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	155	28	0.180645	NM_001080448	D6RAL5	Missense_Mutation	SNP	ENST00000389672.5	37	CCDS46876.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.677321	0.88445	.	.	ENSG00000080224	ENST00000470610;ENST00000389672;ENST00000542517	T;T;T	0.03920	3.76;3.76;3.76	5.48	5.48	0.80851	.	0.000000	0.64402	U	0.000013	T	0.30665	0.0772	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.24476	-1.0159	10	0.87932	D	0	.	18.3424	0.90309	0.0:0.0:1.0:0.0	.	259;259	B3KS12;E7EU71	.;.	H	259;259;165	ENSP00000420598:R259H;ENSP00000374323:R259H;ENSP00000439758:R165H	ENSP00000374323:R259H	R	+	2	0	EPHA6	98189189	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.869000	0.99810	2.554000	0.86153	0.655000	0.94253	CGC	.	.	none		0.443	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448	
MUC4	4585	hgsc.bcm.edu	37	3	195506990	195506990	+	Missense_Mutation	SNP	C	C	G	rs200783894	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:195506990C>G	ENST00000463781.3	-	2	11920	c.11461G>C	c.(11461-11463)Gac>Cac	p.D3821H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D3821H|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGTGTCACCTGTGGAT	0.587													.|||	203	0.0405351	0.0537	0.0476	5008	,	,		9160	0.0188		0.0368	False		,,,				2504	0.044				p.D3821H		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	0			c.G11461C						scavenged	.						4.0	4.0	4.0					3																	195506990		522	1378	1900	SO:0001583	missense	4585	exon2			TGGTGTCACCTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11461G>C	3.37:g.195506990C>G	ENSP00000417498:p.Asp3821His	Somatic	78	3	0.0384615		WXS	Illumina HiSeq	Phase_I	112	11	0.0982143	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	3.752	-0.051387	0.07407	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35048	1.4;1.33	.	.	.	.	.	.	.	.	T	0.16727	0.0402	N	0.19112	0.55	0.09310	N	1	B	0.26876	0.162	B	0.09377	0.004	T	0.18935	-1.0321	7	.	.	.	.	2.6646	0.05037	0.0:0.5037:0.0:0.4962	rs3107751;rs28520424	3693	E7ESK3	.	H	3821	ENSP00000417498:D3821H;ENSP00000420243:D3821H	.	D	-	1	0	MUC4	196991769	0.001000	0.12720	0.109000	0.21407	0.109000	0.19521	-0.170000	0.09897	0.064000	0.16427	0.064000	0.15345	GAC	C|0.746;G|0.253	0.253	strong		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
COL9A1	1297	hgsc.bcm.edu	37	6	70991128	70991128	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr6:70991128C>A	ENST00000357250.6	-	8	999	c.841G>T	c.(841-843)Ggc>Tgc	p.G281C	COL9A1_ENST00000320755.7_Missense_Mutation_p.G38C|COL9A1_ENST00000370499.4_Missense_Mutation_p.G38C|COL9A1_ENST00000370496.3_Missense_Mutation_p.G281C|COL9A1_ENST00000489611.1_5'Flank	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	281	Collagen-like 1.|Triple-helical region (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						CCAGGGGGGCCCGGAGGCCCG	0.597																																					p.G281C		Atlas-SNP	.											COL9A1_ENST00000320755,NS,carcinoma,+1,2	COL9A1	228	2	0			c.G841T						PASS	.						22.0	26.0	25.0					6																	70991128		2203	4300	6503	SO:0001583	missense	1297	exon8			GGGGGCCCGGAGG		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.841G>T	6.37:g.70991128C>A	ENSP00000349790:p.Gly281Cys	Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	72	12	0.166667	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.923575	0.33908	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499;ENST00000370496	D;D;D;D	0.99369	-5.78;-5.78;-5.78;-5.78	5.74	5.74	0.90152	.	0.095514	0.64402	D	0.000001	D	0.99802	0.9915	H	0.99464	4.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96865	0.9635	10	0.87932	D	0	.	18.8993	0.92435	0.0:1.0:0.0:0.0	.	281;38	P20849;P20849-2	CO9A1_HUMAN;.	C	281;38;38;281	ENSP00000349790:G281C;ENSP00000315252:G38C;ENSP00000359530:G38C;ENSP00000359527:G281C	ENSP00000315252:G38C	G	-	1	0	COL9A1	71047849	0.997000	0.39634	0.196000	0.23383	0.014000	0.08584	5.631000	0.67812	2.722000	0.93159	0.591000	0.81541	GGC	.	.	none		0.597	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
TMEM70	54968	hgsc.bcm.edu	37	8	74893545	74893545	+	Silent	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr8:74893545C>T	ENST00000312184.5	+	3	545	c.472C>T	c.(472-474)Ctg>Ttg	p.L158L	TMEM70_ENST00000517439.1_3'UTR|Y_RNA_ENST00000365350.1_RNA	NM_001040613.2|NM_017866.5	NP_001035703.1|NP_060336.3	Q9BUB7	TMM70_HUMAN	transmembrane protein 70	158					mitochondrial proton-transporting ATP synthase complex assembly (GO:0033615)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)				breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8	Breast(64;0.0311)		Epithelial(68;0.0186)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0564)			CACCCCAGTGCTGCTTCACTT	0.393																																					p.L158L		Atlas-SNP	.											.	TMEM70	12	.	0			c.C472T						PASS	.						166.0	155.0	158.0					8																	74893545		2203	4300	6503	SO:0001819	synonymous_variant	54968	exon3			CCAGTGCTGCTTC	BC002748	CCDS6215.1, CCDS47876.1	8q21.11	2013-05-23				ENSG00000175606			26050	protein-coding gene	gene with protein product		612418				21945727, 22986587	Standard	NM_017866		Approved	FLJ20533	uc003yab.3	Q9BUB7		ENST00000312184.5:c.472C>T	8.37:g.74893545C>T		Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	180	19	0.105556	NM_017866	E9PDY9|Q9NWY5	Silent	SNP	ENST00000312184.5	37	CCDS6215.1																																																																																			.	.	none		0.393	TMEM70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379028.1	NM_017866	
ZFHX4	79776	hgsc.bcm.edu	37	8	77767750	77767750	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr8:77767750C>A	ENST00000521891.2	+	10	9041	c.8593C>A	c.(8593-8595)Ctc>Atc	p.L2865I	ZFHX4_ENST00000050961.6_Missense_Mutation_p.L2820I|ZFHX4_ENST00000455469.2_Missense_Mutation_p.L2820I|ZFHX4_ENST00000518282.1_Missense_Mutation_p.L2839I	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2820					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.L2849I(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGACAAATTTCTCTTTTCTCT	0.488										HNSCC(33;0.089)																											p.L2865I		Atlas-SNP	.											ZFHX4,caecum,carcinoma,0,2	ZFHX4	878	2	1	Substitution - Missense(1)	large_intestine(1)	c.C8593A						PASS	.						94.0	96.0	95.0					8																	77767750		1969	4146	6115	SO:0001583	missense	79776	exon10			AAATTTCTCTTTT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8593C>A	8.37:g.77767750C>A	ENSP00000430497:p.Leu2865Ile	Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	41	8	0.195122	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	7.948	0.744269	0.15710	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.49139	0.79;0.84;0.81;0.8	5.25	4.35	0.52113	.	0.000000	0.40144	U	0.001178	T	0.31734	0.0806	N	0.22421	0.69	0.25788	N	0.984655	B;B;B	0.22080	0.038;0.064;0.064	B;B;B	0.30251	0.032;0.07;0.113	T	0.20505	-1.0273	10	0.18276	T	0.48	.	8.0132	0.30365	0.2859:0.641:0.0:0.0731	.	2820;2820;2865	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	I	2865;2849;2820;2820;2839	ENSP00000430497:L2865I;ENSP00000399605:L2820I;ENSP00000050961:L2820I;ENSP00000430848:L2839I	ENSP00000050961:L2820I	L	+	1	0	ZFHX4	77930305	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	3.209000	0.51122	1.397000	0.46682	0.561000	0.74099	CTC	.	.	none		0.488	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
SPRR3	6707	hgsc.bcm.edu	37	1	152975715	152975715	+	Silent	SNP	C	C	T	rs28989168	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:152975715C>T	ENST00000295367.4	+	2	261	c.219C>T	c.(217-219)ggC>ggT	p.G73G	SPRR3_ENST00000542696.1_Silent_p.G73G|SPRR3_ENST00000331860.3_Silent_p.G73G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	73	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGCTGTACCAAGG	0.577													T|||	2	0.000399361	0.0015	0.0	5008	,	,		14904	0.0		0.0	False		,,,				2504	0.0				p.G73G		Atlas-SNP	.											SPRR3,colon,carcinoma,0,3	SPRR3	45	3	0			c.C219T						PASS	.						42.0	39.0	40.0					1																	152975715		2182	4268	6450	SO:0001819	synonymous_variant	6707	exon2			GCCAGGCTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.219C>T	1.37:g.152975715C>T		Somatic	35	0	0		WXS	Illumina HiSeq	Phase_I	46	23	0.5	NM_001097589	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			.	.	none		0.577	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
SSTR2	6752	hgsc.bcm.edu	37	17	71166537	71166537	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr17:71166537T>C	ENST00000357585.2	+	2	1448	c.1079T>C	c.(1078-1080)cTc>cCc	p.L360P	SSTR2_ENST00000315332.2_Intron|RP11-143K11.5_ENST00000580671.1_RNA	NM_001050.2	NP_001041.1	P30874	SSR2_HUMAN	somatostatin receptor 2	360					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|peristalsis (GO:0030432)|regulation of muscle contraction (GO:0006937)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|somatostatin receptor activity (GO:0004994)			endometrium(2)|large_intestine(5)|lung(2)|prostate(2)	11			LUSC - Lung squamous cell carcinoma(166;0.197)		Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	CAGAGGACCCTCCTCAATGGA	0.567																																					p.L360P		Atlas-SNP	.											.	SSTR2	27	.	0			c.T1079C						PASS	.						48.0	46.0	47.0					17																	71166537		2203	4300	6503	SO:0001583	missense	6752	exon2			GGACCCTCCTCAA		CCDS11691.1	17q24	2012-08-08				ENSG00000180616		"""GPCR / Class A : Somatostatin receptors"""	11331	protein-coding gene	gene with protein product		182452				8449518	Standard	NM_001050		Approved		uc002jje.3	P30874		ENST00000357585.2:c.1079T>C	17.37:g.71166537T>C	ENSP00000350198:p.Leu360Pro	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	49	12	0.244898	NM_001050	A8K3Y0|B2R9P7|Q4VBP0|Q96GE0|Q96TF2|Q9BWH1	Missense_Mutation	SNP	ENST00000357585.2	37	CCDS11691.1	.	.	.	.	.	.	.	.	.	.	T	12.50	1.956312	0.34565	.	.	ENSG00000180616	ENST00000357585	T	0.73575	-0.76	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000001	T	0.68007	0.2954	L	0.46157	1.445	0.80722	D	1	B	0.14012	0.009	B	0.13407	0.009	T	0.63287	-0.6671	10	0.27082	T	0.32	.	15.0092	0.71536	0.0:0.0:0.0:1.0	.	360	P30874	SSR2_HUMAN	P	360	ENSP00000350198:L360P	ENSP00000350198:L360P	L	+	2	0	SSTR2	68678132	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.940000	0.70187	2.084000	0.62774	0.533000	0.62120	CTC	.	.	none		0.567	SSTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441633.1		
ZNF814	730051	hgsc.bcm.edu	37	19	58385799	58385799	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr19:58385799C>T	ENST00000435989.2	-	3	1193	c.959G>A	c.(958-960)gGg>gAg	p.G320E	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	320					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G320E(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AGGTCTTTTCCCAGTGTGAAC	0.358																																					p.G320E		Atlas-SNP	.											ZNF814,brain,primitive_neuroectodermal_tumour-medulloblastoma,+1,2	ZNF814	93	2	1	Substitution - Missense(1)	central_nervous_system(1)	c.G959A						scavenged	.						14.0	11.0	12.0					19																	58385799		687	1560	2247	SO:0001583	missense	730051	exon3			CTTTTCCCAGTGT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.959G>A	19.37:g.58385799C>T	ENSP00000410545:p.Gly320Glu	Somatic	152	1	0.00657895		WXS	Illumina HiSeq	Phase_I	161	24	0.149068	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	7.488	0.650166	0.14516	.	.	ENSG00000204514	ENST00000435989	T	0.25749	1.78	2.37	-4.23	0.03789	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29389	0.0732	L	0.41824	1.3	0.09310	N	0.999992	D	0.76494	0.999	D	0.65573	0.936	T	0.23261	-1.0193	9	0.66056	D	0.02	.	2.112	0.03705	0.1507:0.4859:0.1487:0.2147	.	320	B7Z6K7	ZN814_HUMAN	E	320	ENSP00000410545:G320E	ENSP00000410545:G320E	G	-	2	0	ZNF814	63077611	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.267000	0.08619	-0.341000	0.08376	-3.844000	0.00018	GGG	.	.	none		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
POGK	57645	hgsc.bcm.edu	37	1	166818482	166818482	+	Silent	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:166818482G>A	ENST00000367875.1	+	5	1026	c.666G>A	c.(664-666)aaG>aaA	p.K222K	POGK_ENST00000367876.4_Silent_p.K222K|POGK_ENST00000537173.1_Silent_p.K104K|POGK_ENST00000536514.1_Silent_p.K137K			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	222					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						AGGCTGCCAAGCAGTTTGGAG	0.552																																					p.K222K	GBM(76;192 1530 30153 48742)	Atlas-SNP	.											.	POGK	54	.	0			c.G666A						PASS	.						49.0	51.0	50.0					1																	166818482		2203	4300	6503	SO:0001819	synonymous_variant	57645	exon5			TGCCAAGCAGTTT	AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.666G>A	1.37:g.166818482G>A		Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	95	9	0.0947368	NM_017542	Q5TIJ1|Q8TE07	Silent	SNP	ENST00000367875.1	37	CCDS1254.1																																																																																			.	.	none		0.552	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082888.1	NM_017542	
RP1	6101	hgsc.bcm.edu	37	8	55533908	55533908	+	Missense_Mutation	SNP	C	C	T	rs147116231	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr8:55533908C>T	ENST00000220676.1	+	2	530	c.382C>T	c.(382-384)Ctc>Ttc	p.L128F		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	128					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GCGGCCCTGGCTCAGCAGCCG	0.697																																					p.L128F	Colon(91;1014 1389 7634 14542 40420)	Atlas-SNP	.											.	RP1	429	.	0			c.C382T						PASS	.						26.0	33.0	30.0					8																	55533908		2194	4294	6488	SO:0001583	missense	6101	exon2			CCCTGGCTCAGCA	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.382C>T	8.37:g.55533908C>T	ENSP00000220676:p.Leu128Phe	Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	62	14	0.225806	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.211455	0.39102	.	.	ENSG00000104237	ENST00000220676	D	0.87650	-2.28	4.9	4.9	0.64082	Doublecortin domain (1);	0.532611	0.16143	N	0.227643	D	0.88518	0.6458	M	0.63428	1.95	0.42132	D	0.991472	P	0.49961	0.93	P	0.48030	0.564	D	0.86910	0.2060	10	0.27082	T	0.32	0.1336	18.0907	0.89475	0.0:1.0:0.0:0.0	.	128	P56715	RP1_HUMAN	F	128	ENSP00000220676:L128F	ENSP00000220676:L128F	L	+	1	0	RP1	55696461	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.568000	0.45965	2.273000	0.75805	0.650000	0.86243	CTC	C|0.998;A|0.002	.	alt		0.697	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
PPP4C	5531	hgsc.bcm.edu	37	16	30093814	30093814	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr16:30093814G>A	ENST00000279387.7	+	4	328	c.160G>A	c.(160-162)Gac>Aac	p.D54N	PPP4C_ENST00000561610.1_Missense_Mutation_p.D54N	NM_002720.1	NP_002711.1	P60510	PP4C_HUMAN	protein phosphatase 4, catalytic subunit	54					dephosphorylation (GO:0016311)|NIK/NF-kappaB signaling (GO:0038061)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase 4 complex (GO:0030289)	metal ion binding (GO:0046872)|NF-kappaB-inducing kinase activity (GO:0004704)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|lung(2)|pancreas(1)|skin(1)|urinary_tract(1)	9						GGTGTGCGGCGACATCCATGG	0.522																																					p.D54N		Atlas-SNP	.											.	PPP4C	25	.	0			c.G160A						PASS	.						104.0	89.0	94.0					16																	30093814		2197	4300	6497	SO:0001583	missense	5531	exon4			TGCGGCGACATCC		CCDS10669.1	16p11.2	2010-03-17	2010-03-05		ENSG00000149923	ENSG00000149923	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9319	protein-coding gene	gene with protein product	"""protein phosphatase X, catalytic subunit"""	602035	"""protein phosphatase 4 (formerly X), catalytic subunit"""			9177794	Standard	NM_002720		Approved	PP4, PPX	uc002dwf.3	P60510	OTTHUMG00000132113	ENST00000279387.7:c.160G>A	16.37:g.30093814G>A	ENSP00000279387:p.Asp54Asn	Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	60	8	0.133333	NM_002720	P33172	Missense_Mutation	SNP	ENST00000279387.7	37	CCDS10669.1	.	.	.	.	.	.	.	.	.	.	G	17.69	3.450968	0.63290	.	.	ENSG00000149923	ENST00000279387	D	0.99842	-7.1	5.88	4.93	0.64822	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.99837	0.9926	H	0.97783	4.075	0.80722	D	1	D	0.55385	0.971	P	0.51657	0.676	D	0.96754	0.9556	10	0.66056	D	0.02	-1.226	15.362	0.74483	0.0:0.0:0.8591:0.1409	.	54	P60510	PP4C_HUMAN	N	54	ENSP00000279387:D54N	ENSP00000279387:D54N	D	+	1	0	PPP4C	30001315	1.000000	0.71417	0.849000	0.33467	0.366000	0.29705	9.363000	0.97131	1.489000	0.48450	0.561000	0.74099	GAC	.	.	none		0.522	PPP4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255155.2	NM_002720	
AGA	175	hgsc.bcm.edu	37	4	178355570	178355570	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr4:178355570C>T	ENST00000264595.2	-	7	899	c.772G>A	c.(772-774)Ggg>Agg	p.G258R	AGA_ENST00000506853.1_5'UTR	NM_000027.3|NM_001171988.1	NP_000018.2|NP_001165459.1	P20933	ASPG_HUMAN	aspartylglucosaminidase	258	Substrate binding.				protein deglycosylation (GO:0006517)|protein maturation (GO:0051604)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity (GO:0003948)|peptidase activity (GO:0008233)			endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|skin(2)	16		all_lung(41;1.27e-09)|Lung NSC(41;1.1e-08)|Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Hepatocellular(41;0.148)|all_neural(102;0.164)|Colorectal(36;0.245)		all cancers(43;1.37e-22)|Epithelial(43;3.86e-20)|OV - Ovarian serous cystadenocarcinoma(60;3.8e-11)|Colorectal(24;6.98e-05)|GBM - Glioblastoma multiforme(59;0.000362)|COAD - Colon adenocarcinoma(29;0.000462)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0328)|READ - Rectum adenocarcinoma(43;0.163)		TCACCATTCCCAGTGGCTGCG	0.443																																					p.G258R		Atlas-SNP	.											.	AGA	39	.	0			c.G772A						PASS	.						118.0	116.0	117.0					4																	178355570		2203	4300	6503	SO:0001583	missense	175	exon7			CATTCCCAGTGGC	X55330	CCDS3829.1	4q34.3	2014-06-23			ENSG00000038002	ENSG00000038002	3.5.1.26		318	protein-coding gene	gene with protein product	"""glycosylasparaginase"", ""N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase"""	613228					Standard	NM_000027		Approved	ASRG	uc003iuu.2	P20933	OTTHUMG00000160723	ENST00000264595.2:c.772G>A	4.37:g.178355570C>T	ENSP00000264595:p.Gly258Arg	Somatic	259	0	0		WXS	Illumina HiSeq	Phase_I	213	18	0.084507	NM_000027	B2R7H2|D3DP47|Q4W5Q2|Q6FHN6|Q9UCK6|Q9UCK7|Q9UCK8	Missense_Mutation	SNP	ENST00000264595.2	37	CCDS3829.1	.	.	.	.	.	.	.	.	.	.	C	19.07	3.756271	0.69648	.	.	ENSG00000038002	ENST00000264595;ENST00000502310	D;D	0.98822	-5.16;-5.16	5.68	5.68	0.88126	.	0.048505	0.85682	D	0.000000	D	0.99603	0.9856	H	0.99156	4.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97590	1.0116	10	0.87932	D	0	-28.7267	19.3909	0.94583	0.0:1.0:0.0:0.0	.	258	P20933	ASPG_HUMAN	R	258;115	ENSP00000264595:G258R;ENSP00000423798:G115R	ENSP00000264595:G258R	G	-	1	0	AGA	178592564	1.000000	0.71417	0.483000	0.27378	0.099000	0.18886	7.350000	0.79385	2.695000	0.91970	0.650000	0.86243	GGG	.	.	none		0.443	AGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361916.1	NM_000027	
OR5H15	403274	hgsc.bcm.edu	37	3	97887970	97887970	+	Missense_Mutation	SNP	C	C	T	rs72933946	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:97887970C>T	ENST00000356526.2	+	1	427	c.427C>T	c.(427-429)Cgg>Tgg	p.R143W		NM_001005515.1	NP_001005515.1	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H, member 15	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(2)|stomach(1)	35						ACTGTGCATCCGGCTATTAAT	0.373																																					p.R143W		Atlas-SNP	.											OR5H15,NS,carcinoma,-2,1	OR5H15	70	1	0			c.C427T						scavenged	.						73.0	72.0	72.0					3																	97887970		2203	4297	6500	SO:0001583	missense	403274	exon1			TGCATCCGGCTAT		CCDS33799.1	3q11.2	2013-09-23			ENSG00000233412	ENSG00000233412		"""GPCR / Class A : Olfactory receptors"""	31287	protein-coding gene	gene with protein product							Standard	NM_001005515		Approved		uc011bgu.2	A6NDH6	OTTHUMG00000160076	ENST00000356526.2:c.427C>T	3.37:g.97887970C>T	ENSP00000373195:p.Arg143Trp	Somatic	392	2	0.00510204		WXS	Illumina HiSeq	Phase_I	543	8	0.014733	NM_001005515		Missense_Mutation	SNP	ENST00000356526.2	37	CCDS33799.1	.	.	.	.	.	.	.	.	.	.	-	4.344	0.063283	0.08388	.	.	ENSG00000233412	ENST00000356526;ENST00000454529	T	0.00130	8.69	2.48	-0.601	0.11638	GPCR, rhodopsin-like superfamily (1);	1.476590	0.04503	N	0.381661	T	0.00109	0.0003	L	0.34521	1.04	0.09310	N	1	B	0.18166	0.026	B	0.15870	0.014	T	0.19516	-1.0303	10	0.34782	T	0.22	.	3.5209	0.07741	0.0:0.4065:0.1978:0.3956	.	143	A6NDH6	O5H15_HUMAN	W	143	ENSP00000373195:R143W	ENSP00000373195:R143W	R	+	1	2	OR5H15	99370660	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.931000	0.01556	-0.339000	0.08401	-1.206000	0.01644	CGG	C|0.965;A|0.035	.	alt		0.373	OR5H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359109.1		
MID2	11043	hgsc.bcm.edu	37	X	107147248	107147248	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chrX:107147248A>G	ENST00000262843.6	+	4	1425	c.877A>G	c.(877-879)Atc>Gtc	p.I293V	MID2_ENST00000443968.2_Missense_Mutation_p.I293V|RP6-191P20.4_ENST00000430140.1_RNA|Y_RNA_ENST00000384633.1_RNA	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	293					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						GGTAGAGATCATCCAGCAGAG	0.413																																					p.I293V		Atlas-SNP	.											.	MID2	122	.	0			c.A877G						PASS	.						139.0	115.0	123.0					X																	107147248		2203	4300	6503	SO:0001583	missense	11043	exon4			GAGATCATCCAGC		CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.877A>G	X.37:g.107147248A>G	ENSP00000262843:p.Ile293Val	Somatic	194	0	0		WXS	Illumina HiSeq	Phase_I	240	39	0.1625	NM_012216	A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Missense_Mutation	SNP	ENST00000262843.6	37	CCDS14532.2	.	.	.	.	.	.	.	.	.	.	A	14.90	2.674540	0.47781	.	.	ENSG00000080561	ENST00000262843;ENST00000443968	T;T	0.60299	0.2;0.22	5.23	5.23	0.72850	B-box, C-terminal (1);	0.119673	0.56097	N	0.000025	T	0.45296	0.1335	L	0.31664	0.95	0.53688	D	0.999972	B;P	0.39480	0.303;0.675	B;B	0.37346	0.085;0.247	T	0.46665	-0.9175	10	0.46703	T	0.11	.	12.0069	0.53265	1.0:0.0:0.0:0.0	.	293;293	Q9UJV3;Q9UJV3-2	TRIM1_HUMAN;.	V	293	ENSP00000262843:I293V;ENSP00000413976:I293V	ENSP00000262843:I293V	I	+	1	0	MID2	107033904	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.700000	0.91322	1.738000	0.51689	0.486000	0.48141	ATC	.	.	none		0.413	MID2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057852.2	NM_012216	
SETD8	387893	hgsc.bcm.edu	37	12	123892235	123892235	+	Silent	SNP	G	G	A	rs61955128	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr12:123892235G>A	ENST00000402868.3	+	8	1470	c.1044G>A	c.(1042-1044)ccG>ccA	p.P348P	SETD8_ENST00000330479.4_Silent_p.P348P			Q9NQR1	SETD8_HUMAN	SET domain containing (lysine methyltransferase) 8	389	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone lysine methylation (GO:0034968)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|urinary_tract(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)		AAGCCCACCCGTGGCTGAAGC	0.562													G|||	26	0.00519169	0.0083	0.0014	5008	,	,		14479	0.003		0.003	False		,,,				2504	0.0082				p.P348P		Atlas-SNP	.											SETD8,NS,neuroblastoma,0,1	SETD8	35	1	0			c.G1044A						scavenged	.						15.0	15.0	15.0					12																	123892235		2194	4279	6473	SO:0001819	synonymous_variant	387893	exon8			CCACCCGTGGCTG	AY102937	CCDS9247.1	12q24.31	2011-07-01			ENSG00000183955	ENSG00000183955		"""Chromatin-modifying enzymes / K-methyltransferases"""	29489	protein-coding gene	gene with protein product		607240				15933070, 12086618, 12121615	Standard	NM_020382		Approved	SET8, SET07, PR-Set7, KMT5A	uc001uew.3	Q9NQR1	OTTHUMG00000150477	ENST00000402868.3:c.1044G>A	12.37:g.123892235G>A		Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	61	5	0.0819672	NM_020382	A8K9D0|Q86W83|Q8TD09	Silent	SNP	ENST00000402868.3	37	CCDS9247.1																																																																																			G|0.999;A|0.001	0.001	strong		0.562	SETD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318263.1	NM_020382	
ZNF814	730051	hgsc.bcm.edu	37	19	58385869	58385869	+	Nonsense_Mutation	SNP	C	C	A	rs199684163|rs10687775|rs55789144|rs66767659	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr19:58385869C>A	ENST00000435989.2	-	3	1123	c.889G>T	c.(889-891)Gaa>Taa	p.E297*	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	297					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TCTCCACATTCATGTTTTTTT	0.363																																					p.E297X		Atlas-SNP	.											ZNF814,NS,carcinoma,0,1	ZNF814	93	1	0			c.G889T						scavenged	.						5.0	4.0	5.0					19																	58385869		591	1308	1899	SO:0001587	stop_gained	730051	exon3			CACATTCATGTTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.889G>T	19.37:g.58385869C>A	ENSP00000410545:p.Glu297*	Somatic	57	2	0.0350877		WXS	Illumina HiSeq	Phase_I	79	23	0.291139	NM_001144989	A6NF35	Nonsense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	27.5	4.839119	0.91117	.	.	ENSG00000204514	ENST00000435989	.	.	.	1.93	-3.87	0.04218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	0.6944	0.00896	0.1754:0.2303:0.1739:0.4204	.	.	.	.	X	297	.	ENSP00000410545:E297X	E	-	1	0	ZNF814	63077681	0.000000	0.05858	0.000000	0.03702	0.378000	0.30076	-0.792000	0.04594	-0.856000	0.04120	0.121000	0.15741	GAA	.	.	weak		0.363	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
GGT1	2678	hgsc.bcm.edu	37	22	25007202	25007202	+	Missense_Mutation	SNP	A	A	G	rs2330838		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr22:25007202A>G	ENST00000400382.1	+	5	909	c.154A>G	c.(154-156)Aag>Gag	p.K52E	GGT1_ENST00000400383.1_Missense_Mutation_p.K52E|GGT1_ENST00000248923.4_Missense_Mutation_p.K52E|GGT1_ENST00000406383.2_Missense_Mutation_p.K52E|GGT1_ENST00000400380.1_Missense_Mutation_p.K52E			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	52			K -> E (in dbSNP:rs2330838).		arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.K52E(1)		breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	GCAGTGCTCGAAGAttgggag	0.607																																					p.K52E		Atlas-SNP	.											GGT1,NS,other,0,1	GGT1	68	1	1	Substitution - Missense(1)	pancreas(1)	c.A154G						scavenged	.																																			SO:0001583	missense	2678	exon5			TGCTCGAAGATTG	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.154A>G	22.37:g.25007202A>G	ENSP00000383232:p.Lys52Glu	Somatic	223	1	0.00448431		WXS	Illumina HiSeq	Phase_I	221	6	0.0271493	NM_013430	Q08247|Q14404|Q8TBS1|Q9UMK1	Missense_Mutation	SNP	ENST00000400382.1	37	CCDS42992.1	.	.	.	.	.	.	.	.	.	.	.	2.776	-0.254624	0.05829	.	.	ENSG00000100031	ENST00000248923;ENST00000411974;ENST00000412658;ENST00000445029;ENST00000419133;ENST00000400382;ENST00000452551;ENST00000400383;ENST00000412898;ENST00000400380;ENST00000455483;ENST00000430289;ENST00000447416;ENST00000432867;ENST00000451366;ENST00000406383;ENST00000428855	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.20463	3.25;3.25;3.25;2.07;3.25;3.25;3.25;3.25;2.07;3.25;3.25;3.25;3.25;3.25;3.25;3.25;3.25	3.5	3.5	0.40072	.	0.140255	0.46442	N	0.000281	T	0.05044	0.0135	N	0.00823	-1.155	0.21386	N	0.999705	B	0.02656	0.0	B	0.04013	0.001	T	0.40924	-0.9537	10	0.02654	T	1	-12.471	8.7769	0.34767	0.1139:0.0:0.8861:0.0	rs2330838	52	P19440	GGT1_HUMAN	E	52	ENSP00000248923:K52E;ENSP00000389935:K52E;ENSP00000393537:K52E;ENSP00000393135:K52E;ENSP00000395271:K52E;ENSP00000383232:K52E;ENSP00000415553:K52E;ENSP00000383233:K52E;ENSP00000408151:K52E;ENSP00000383231:K52E;ENSP00000415024:K52E;ENSP00000417044:K52E;ENSP00000400621:K52E;ENSP00000398589:K52E;ENSP00000387796:K52E;ENSP00000385975:K52E;ENSP00000415068:K52E	ENSP00000248923:K52E	K	+	1	0	GGT1	23337202	1.000000	0.71417	0.890000	0.34922	0.477000	0.33069	3.277000	0.51654	0.781000	0.33589	-0.128000	0.14901	AAG	A|1.000;|0.000	.	weak		0.607	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1	NM_013430	
ZNF814	730051	hgsc.bcm.edu	37	19	58385867	58385867	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr19:58385867T>A	ENST00000435989.2	-	3	1125	c.891A>T	c.(889-891)gaA>gaT	p.E297D	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	297					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ATTCTCCACATTCATGTTTTT	0.363																																					p.E297D		Atlas-SNP	.											ZNF814,NS,carcinoma,-2,1	ZNF814	93	1	0			c.A891T						scavenged	.						5.0	4.0	4.0					19																	58385867		510	1081	1591	SO:0001583	missense	730051	exon3			TCCACATTCATGT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.891A>T	19.37:g.58385867T>A	ENSP00000410545:p.Glu297Asp	Somatic	58	1	0.0172414		WXS	Illumina HiSeq	Phase_I	79	11	0.139241	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	11.15	1.554325	0.27739	.	.	ENSG00000204514	ENST00000435989	T	0.22134	1.97	1.93	-3.87	0.04218	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16214	0.0390	L	0.47078	1.49	0.09310	N	1	P	0.36048	0.534	B	0.39738	0.308	T	0.22208	-1.0223	9	0.40728	T	0.16	.	3.3223	0.07054	0.3234:0.181:0.0:0.4956	.	297	B7Z6K7	ZN814_HUMAN	D	297	ENSP00000410545:E297D	ENSP00000410545:E297D	E	-	3	2	ZNF814	63077679	0.000000	0.05858	0.000000	0.03702	0.378000	0.30076	-2.601000	0.00892	-0.795000	0.04462	0.102000	0.15555	GAA	.	.	none		0.363	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
DSG3	1830	hgsc.bcm.edu	37	18	29039873	29039873	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr18:29039873G>T	ENST00000257189.4	+	6	666	c.583G>T	c.(583-585)Gcc>Tcc	p.A195S		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	195	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTCTAAAATTGCCTTCAAAAT	0.418																																					p.A195S		Atlas-SNP	.											DSG3,colon,carcinoma,0,1	DSG3	172	1	0			c.G583T						scavenged	.						87.0	82.0	84.0					18																	29039873		2203	4300	6503	SO:0001583	missense	1830	exon6			AAAATTGCCTTCA	M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.583G>T	18.37:g.29039873G>T	ENSP00000257189:p.Ala195Ser	Somatic	60	2	0.0333333		WXS	Illumina HiSeq	Phase_I	90	12	0.133333	NM_001944	A8K2V2	Missense_Mutation	SNP	ENST00000257189.4	37	CCDS11898.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021035	0.54576	.	.	ENSG00000134757	ENST00000257189	T	0.49432	0.78	5.38	5.38	0.77491	Cadherin (4);Cadherin-like (1);	0.000000	0.46758	D	0.000263	T	0.54515	0.1863	L	0.37466	1.105	0.39402	D	0.966605	P	0.50710	0.938	P	0.61397	0.888	T	0.44236	-0.9341	10	0.20046	T	0.44	.	15.4834	0.75545	0.0:0.1389:0.8611:0.0	.	195	P32926	DSG3_HUMAN	S	195	ENSP00000257189:A195S	ENSP00000257189:A195S	A	+	1	0	DSG3	27293871	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	4.366000	0.59492	2.698000	0.92095	0.561000	0.74099	GCC	.	.	none		0.418	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944	
P4HA3	283208	hgsc.bcm.edu	37	11	73997431	73997431	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:73997431C>T	ENST00000331597.4	-	6	820	c.775G>A	c.(775-777)Gat>Aat	p.D259N	P4HA3_ENST00000427714.2_Missense_Mutation_p.D259N	NM_182904.3	NP_878907.1	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha polypeptide III	259						endoplasmic reticulum (GO:0005783)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			NS(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(1)	15	Breast(11;2.31e-05)					CTCTTATTATCTGGGCCTGGA	0.498																																					p.D259N		Atlas-SNP	.											.	P4HA3	43	.	0			c.G775A						PASS	.						83.0	90.0	88.0					11																	73997431		2200	4293	6493	SO:0001583	missense	283208	exon6			TATTATCTGGGCC	AY327887	CCDS8230.1, CCDS73347.1	11q13	2008-12-09	2008-12-09			ENSG00000149380			30135	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(III)"""	608987	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III"""			14500733	Standard	XM_005273924		Approved	C-P4Halpha(III)	uc001ouz.3	Q7Z4N8		ENST00000331597.4:c.775G>A	11.37:g.73997431C>T	ENSP00000332170:p.Asp259Asn	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	112	28	0.25	NM_182904	A0AV13|B4DUD3|Q5EBL3|Q5JPA9	Missense_Mutation	SNP	ENST00000331597.4	37	CCDS8230.1	.	.	.	.	.	.	.	.	.	.	C	11.45	1.642375	0.29246	.	.	ENSG00000149380	ENST00000331597;ENST00000427714	T;T	0.60920	0.15;0.15	5.56	3.67	0.42095	Tetratricopeptide-like helical (1);	0.972834	0.08531	N	0.932012	T	0.43366	0.1244	L	0.28344	0.845	0.30401	N	0.779985	B;B	0.10296	0.003;0.0	B;B	0.08055	0.003;0.001	T	0.33828	-0.9853	10	0.13108	T	0.6	-9.1567	10.8359	0.46688	0.0:0.842:0.0:0.158	.	259;259	B4DUD3;Q7Z4N8	.;P4HA3_HUMAN	N	259	ENSP00000332170:D259N;ENSP00000401749:D259N	ENSP00000332170:D259N	D	-	1	0	P4HA3	73675079	0.177000	0.23109	0.998000	0.56505	0.982000	0.71751	0.753000	0.26376	1.379000	0.46325	0.644000	0.83932	GAT	.	.	none		0.498	P4HA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382988.1	NM_182904	
PKD1	5310	hgsc.bcm.edu	37	16	2152129	2152129	+	Silent	SNP	A	A	G	rs144582212	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr16:2152129A>G	ENST00000262304.4	-	26	9538	c.9330T>C	c.(9328-9330)ccT>ccC	p.P3110P	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Silent_p.P3110P	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3110					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GCCCACAGAAAGGGATGGCGC	0.667													g|||	695	0.138778	0.3911	0.0994	5008	,	,		16303	0.0		0.0815	False		,,,				2504	0.0276				p.P3110P		Atlas-SNP	.											PKD1,NS,carcinoma,0,1	PKD1	184	1	0			c.T9330C						scavenged	.																																			SO:0001819	synonymous_variant	5310	exon26			ACAGAAAGGGATG	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.9330T>C	16.37:g.2152129A>G		Somatic	34	5	0.147059		WXS	Illumina HiSeq	Phase_I	39	10	0.25641	NM_000296	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			A|0.500;G|0.500	0.500	weak		0.667	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
NEFH	4744	hgsc.bcm.edu	37	22	29885564	29885564	+	Silent	SNP	A	A	G	rs202065964|rs371230849		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr22:29885564A>G	ENST00000310624.6	+	4	1968	c.1935A>G	c.(1933-1935)gaA>gaG	p.E645E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	645	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CGAAGGAGGAAGCAAAGTCCC	0.562																																					p.E645E		Atlas-SNP	.											NEFH,rectum,carcinoma,0,1	NEFH	178	1	0			c.A1935G						scavenged	.						83.0	89.0	87.0					22																	29885564		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GGAGGAAGCAAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1935A>G	22.37:g.29885564A>G		Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	40	6	0.15	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	weak		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
MUC6	4588	hgsc.bcm.edu	37	11	1017974	1017974	+	Missense_Mutation	SNP	C	C	G	rs200353019		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:1017974C>G	ENST00000421673.2	-	31	4877	c.4827G>C	c.(4825-4827)caG>caC	p.Q1609H		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1609	Approximate repeats.|Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.Q1609H(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GAAGTGTGGTCTGAGGGTGTG	0.547																																					p.Q1609H		Atlas-SNP	.											MUC6_ENST00000421673,colon,carcinoma,0,2	MUC6	408	2	2	Substitution - Missense(2)	large_intestine(2)	c.G4827C						scavenged	.						473.0	441.0	452.0					11																	1017974		2186	4282	6468	SO:0001583	missense	4588	exon31			TGTGGTCTGAGGG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4827G>C	11.37:g.1017974C>G	ENSP00000406861:p.Gln1609His	Somatic	257	6	0.0233463		WXS	Illumina HiSeq	Phase_I	252	7	0.0277778	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	5.277	0.236564	0.10023	.	.	ENSG00000184956	ENST00000421673	T	0.35421	1.31	2.39	0.333	0.15943	.	.	.	.	.	T	0.26702	0.0653	L	0.52011	1.625	0.09310	N	1	B	0.25486	0.127	B	0.27715	0.082	T	0.28681	-1.0036	9	0.22109	T	0.4	.	3.4702	0.07565	0.0:0.5042:0.2173:0.2785	.	1609	Q6W4X9	MUC6_HUMAN	H	1609	ENSP00000406861:Q1609H	ENSP00000406861:Q1609H	Q	-	3	2	MUC6	1007974	0.000000	0.05858	0.003000	0.11579	0.027000	0.11550	-2.394000	0.01054	-0.057000	0.13199	-0.710000	0.03640	CAG	.	.	weak		0.547	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
PTCHD2	57540	hgsc.bcm.edu	37	1	11595630	11595630	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:11595630G>A	ENST00000294484.6	+	20	3883	c.3745G>A	c.(3745-3747)Gtg>Atg	p.V1249M	PTCHD2_ENST00000389575.3_Missense_Mutation_p.V1249M|PTCHD2_ENST00000304391.6_Missense_Mutation_p.R135H	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1249					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TGGCTCCTCCGTGGATTACTG	0.647																																					p.V1249M		Atlas-SNP	.											PTCHD2,NS,carcinoma,-2,1	PTCHD2	193	1	0			c.G3745A						PASS	.						68.0	80.0	76.0					1																	11595630		2133	4230	6363	SO:0001583	missense	57540	exon20			TCCTCCGTGGATT	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3745G>A	1.37:g.11595630G>A	ENSP00000294484:p.Val1249Met	Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	48	5	0.104167	NM_020780	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	CCDS41247.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.12|18.12	3.552516|3.552516	0.65425|0.65425	.|.	.|.	ENSG00000204624|ENSG00000204624	ENST00000304391|ENST00000294484;ENST00000389575	.|D;D	.|0.94457	.|-3.43;-2.84	5.54|5.54	5.54|5.54	0.83059|0.83059	.|Membrane transport protein, MMPL type (1);	.|0.000000	.|0.64402	.|D	.|0.000003	D|D	0.97334|0.97334	0.9128|0.9128	M|M	0.81802|0.81802	2.56|2.56	0.48185|0.48185	D|D	0.999605|0.999605	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	D|D	0.97740|0.97740	1.0208|1.0208	6|10	0.87932|0.72032	D|D	0|0.01	-24.6787|-24.6787	18.4583|18.4583	0.90729|0.90729	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1249	.|Q9P2K9	.|PTHD2_HUMAN	H|M	135|1249	.|ENSP00000294484:V1249M;ENSP00000374226:V1249M	ENSP00000303400:R135H|ENSP00000294484:V1249M	R|V	+|+	2|1	0|0	PTCHD2|PTCHD2	11518217|11518217	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.766000|0.766000	0.43426|0.43426	7.578000|7.578000	0.82498|0.82498	2.604000|2.604000	0.88044|0.88044	0.655000|0.655000	0.94253|0.94253	CGT|GTG	.	.	none		0.647	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
POM121	9883	hgsc.bcm.edu	37	7	72413896	72413896	+	Missense_Mutation	SNP	A	A	G	rs201049716		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr7:72413896A>G	ENST00000434423.2	+	11	3364	c.3364A>G	c.(3364-3366)Acc>Gcc	p.T1122A	POM121_ENST00000358357.3_Missense_Mutation_p.T857A|POM121_ENST00000446813.1_Missense_Mutation_p.T857A|POM121_ENST00000257622.4_Missense_Mutation_p.T857A|POM121_ENST00000395270.1_Missense_Mutation_p.T857A			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	1122	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.T857A(8)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				AGGCTCCAGCACCACCACCGG	0.637																																					p.T857A		Atlas-SNP	.											POM121_ENST00000395270,NS,carcinoma,0,8	POM121	131	8	8	Substitution - Missense(8)	lung(4)|kidney(4)	c.A2569G						scavenged	.						32.0	30.0	30.0					7																	72413896		2201	4299	6500	SO:0001583	missense	9883	exon11			TCCAGCACCACCA	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.3364A>G	7.37:g.72413896A>G	ENSP00000405562:p.Thr1122Ala	Somatic	155	1	0.00645161		WXS	Illumina HiSeq	Phase_I	156	5	0.0320513	NM_172020	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000434423.2	37		56	0.02564102564102564	11	0.022357723577235773	14	0.03867403314917127	19	0.033216783216783216	12	0.0158311345646438	G	2.480	-0.319876	0.05386	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.05649	3.46;3.41;3.46;3.41;3.71	2.86	-2.18	0.07037	.	0.720175	0.11383	N	0.569582	T	0.00724	0.0024	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.42275	-0.9461	10	0.36615	T	0.2	.	4.8571	0.13564	0.1842:0.0:0.3666:0.4491	.	857;1122	A8MXF9;Q96HA1	.;P121A_HUMAN	A	857;857;857;857;1122	ENSP00000393020:T857A;ENSP00000257622:T857A;ENSP00000378687:T857A;ENSP00000351124:T857A;ENSP00000405562:T1122A	ENSP00000257622:T857A	T	+	1	0	POM121	72051832	0.360000	0.24964	0.406000	0.26421	0.004000	0.04260	0.000000	0.12993	-0.499000	0.06623	-2.511000	0.00188	ACC	A|0.500;G|0.500	0.500	weak		0.637	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		
MUC4	4585	hgsc.bcm.edu	37	3	195508070	195508070	+	Missense_Mutation	SNP	C	C	T	rs374027103	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:195508070C>T	ENST00000463781.3	-	2	10840	c.10381G>A	c.(10381-10383)Gac>Aac	p.D3461N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D3461N|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.587													.|||	22	0.00439297	0.0121	0.0014	5008	,	,		19547	0.0		0.0	False		,,,				2504	0.0051				p.D3461N		Atlas-SNP	.											MUC4_ENST00000463781,caecum,carcinoma,0,1	MUC4	1505	1	0			c.G10381A						scavenged	.						23.0	21.0	22.0					3																	195508070		671	1573	2244	SO:0001583	missense	4585	exon2			AAGTGTCGGTGAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10381G>A	3.37:g.195508070C>T	ENSP00000417498:p.Asp3461Asn	Somatic	118	7	0.059322		WXS	Illumina HiSeq	Phase_I	166	18	0.108434	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	3.067	-0.191963	0.06299	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33654	1.45;1.4	0.743	-1.49	0.08718	.	.	.	.	.	T	0.16599	0.0399	N	0.14661	0.345	0.09310	N	1	P	0.52577	0.954	B	0.41571	0.36	T	0.10428	-1.0630	8	.	.	.	.	2.5916	0.04844	0.0:0.4337:0.3048:0.2615	.	3333	E7ESK3	.	N	3461	ENSP00000417498:D3461N;ENSP00000420243:D3461N	.	D	-	1	0	MUC4	196992849	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	-2.225000	0.01212	-1.862000	0.01151	-1.862000	0.00560	GAC	.	.	weak		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CSNK1A1L	122011	hgsc.bcm.edu	37	13	37679015	37679015	+	Missense_Mutation	SNP	C	C	T	rs558439842		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr13:37679015C>T	ENST00000379800.3	-	1	788	c.379G>A	c.(379-381)Gtg>Atg	p.V127M		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	127	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		TTTGTATGCACGTATTCAATT	0.403																																					p.V127M		Atlas-SNP	.											.	CSNK1A1L	69	.	0			c.G379A						PASS	.						184.0	168.0	173.0					13																	37679015		2203	4300	6503	SO:0001583	missense	122011	exon1			TATGCACGTATTC	BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.379G>A	13.37:g.37679015C>T	ENSP00000369126:p.Val127Met	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	165	27	0.163636	NM_145203	Q5T2N2	Missense_Mutation	SNP	ENST00000379800.3	37	CCDS9363.1	.	.	.	.	.	.	.	.	.	.	C	10.50	1.368569	0.24771	.	.	ENSG00000180138	ENST00000379800	T	0.19105	2.17	1.01	1.01	0.19927	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.130073	0.51477	D	0.000098	T	0.19046	0.0457	L	0.37561	1.115	0.37424	D	0.913758	D	0.61080	0.989	P	0.50405	0.64	T	0.11518	-1.0584	10	0.27785	T	0.31	.	7.8591	0.29499	0.0:1.0:0.0:0.0	.	127	Q8N752	KC1AL_HUMAN	M	127	ENSP00000369126:V127M	ENSP00000369126:V127M	V	-	1	0	CSNK1A1L	36577015	1.000000	0.71417	0.490000	0.27465	0.493000	0.33554	1.450000	0.35134	0.825000	0.34637	0.561000	0.74099	GTG	.	.	none		0.403	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	NM_145203	
AHRR	57491	hgsc.bcm.edu	37	5	427978	427978	+	Silent	SNP	G	G	A	rs371473301		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr5:427978G>A	ENST00000505113.1	+	8	821	c.777G>A	c.(775-777)ccG>ccA	p.P259P	AHRR_ENST00000316418.5_Silent_p.P277P|AHRR_ENST00000512529.1_Silent_p.P105P|AHRR_ENST00000506456.1_Silent_p.P115P	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	259					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			AGAAGGCGCCGTCAGGAGCCA	0.557																																					p.P277P		Atlas-SNP	.											.	AHRR	67	.	0			c.G831A						PASS	.		,	0,3748		0,0,1874	25.0	29.0	27.0		777,831	-9.8	0.0	5		27	2,8210		0,2,4104	no	coding-synonymous,coding-synonymous	AHRR	NM_001242412.1,NM_020731.4	,	0,2,5978	AA,AG,GG		0.0244,0.0,0.0167	,	259/702,277/720	427978	2,11958	1874	4106	5980	SO:0001819	synonymous_variant	57491	exon9			GGCGCCGTCAGGA	AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.777G>A	5.37:g.427978G>A		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	93	22	0.236559	NM_020731	A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Silent	SNP	ENST00000505113.1	37	CCDS56355.1																																																																																			.	.	weak		0.557	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367720.1	NM_020731	
MST1L	11223	hgsc.bcm.edu	37	1	17085791	17085791	+	RNA	SNP	G	G	A	rs2297532		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:17085791G>A	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										TCTGTACAACGCCGGATCTGG	0.692																																					p.R344C		Atlas-SNP	.											Q13209_HUMAN,NS,carcinoma,0,4	.	.	4	0			c.C1030T						scavenged	.																																					11223	exon8			TACAACGCCGGAT	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085791G>A		Somatic	88	3	0.0340909		WXS	Illumina HiSeq	Phase_I	96	11	0.114583	NM_001271733	B7WPB1|Q13209	Missense_Mutation	SNP	ENST00000455405.2	37		124	0.056776556776556776	29	0.05894308943089431	16	0.04419889502762431	48	0.08391608391608392	31	0.040897097625329816	.	15.12	2.737865	0.49045	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	.	0.000000	0.42548	D	0.000696	T	0.09069	0.0224	.	.	.	.	.	.	D	0.89917	1.0	D	0.78314	0.991	T	0.53136	-0.8481	6	0.87932	D	0	.	5.8178	0.18506	0.001:0.0:0.999:0.0	rs2297532;rs3981961;rs3982167;rs9701622;rs57280630	344	Q2TV78-2	.	C	334;344;344	.	ENSP00000439273:R344C	R	-	1	0	MST1P9	16958378	1.000000	0.71417	0.000000	0.03702	0.000000	0.00434	6.473000	0.73572	-0.000000	0.14550	0.000000	0.15137	CGT	G|0.943;A|0.057	0.057	strong		0.692	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733	
ZSCAN5A	79149	hgsc.bcm.edu	37	19	56736100	56736100	+	Missense_Mutation	SNP	T	T	C	rs200493184		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr19:56736100T>C	ENST00000587340.1	-	4	1011	c.316A>G	c.(316-318)Atg>Gtg	p.M106V	ZSCAN5A_ENST00000587492.1_Intron|ZSCAN5A_ENST00000391713.1_Missense_Mutation_p.M106V|ZSCAN5A_ENST00000592355.1_Missense_Mutation_p.M106V|ZSCAN5A_ENST00000254165.3_Intron			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	106	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.M106V(2)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						ACACCGTTCATCATGACTAAG	0.547																																					p.M106V		Atlas-SNP	.											ZSCAN5A,trunk,malignant_melanoma,0,2	ZSCAN5A	118	2	2	Substitution - Missense(2)	skin(2)	c.A316G						scavenged	.						19.0	19.0	19.0					19																	56736100		2139	4211	6350	SO:0001583	missense	79149	exon2			CGTTCATCATGAC	AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.316A>G	19.37:g.56736100T>C	ENSP00000467631:p.Met106Val	Somatic	319	6	0.0188088		WXS	Illumina HiSeq	Phase_I	390	13	0.0333333	NM_024303	B4DX98|Q49A73|Q53F04|Q8N7B3	Missense_Mutation	SNP	ENST00000587340.1	37	CCDS12941.1	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.996233	0.00435	.	.	ENSG00000131848	ENST00000391713	T	0.04083	3.71	2.27	0.0345	0.14184	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.02119	0.0066	N	0.04508	-0.205	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.47142	-0.9140	9	0.29301	T	0.29	.	4.2945	0.10895	0.0:0.6121:0.0:0.3879	.	106	Q9BUG6	ZSA5A_HUMAN	V	106	ENSP00000375593:M106V	ENSP00000375593:M106V	M	-	1	0	ZSCAN5A	61427912	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.069000	0.14552	0.068000	0.16574	-0.415000	0.06103	ATG	.	.	weak		0.547	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458110.1	NM_024303	
NMBR	4829	hgsc.bcm.edu	37	6	142400028	142400028	+	Silent	SNP	G	G	T	rs147371910		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr6:142400028G>T	ENST00000258042.1	-	2	575	c.435C>A	c.(433-435)atC>atA	p.I145I	NMBR_ENST00000480652.1_5'Flank	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	145					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		TGGGGTTAACGATGGCTCTGT	0.458																																					p.I145I		Atlas-SNP	.											.	NMBR	62	.	0			c.C435A						PASS	.						51.0	43.0	46.0					6																	142400028		2203	4300	6503	SO:0001819	synonymous_variant	4829	exon2			GTTAACGATGGCT		CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.435C>A	6.37:g.142400028G>T		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	88	21	0.238636	NM_002511	E9KL38|Q5VUK8	Silent	SNP	ENST00000258042.1	37	CCDS5196.1																																																																																			G|1.000;A|0.000	.	alt		0.458	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1		
CELSR1	9620	hgsc.bcm.edu	37	22	46860090	46860090	+	Missense_Mutation	SNP	C	C	T	rs200980049		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr22:46860090C>T	ENST00000262738.3	-	2	3696	c.3697G>A	c.(3697-3699)Gcc>Acc	p.A1233T	CELSR1_ENST00000395964.1_Missense_Mutation_p.A1233T	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1233					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GACAGCACGGCGGCCACCCCC	0.612																																					p.A1233T		Atlas-SNP	.											CELSR1,NS,carcinoma,+2,1	CELSR1	242	1	0			c.G3697A						PASS	.	C	THR/ALA	0,4406		0,0,2203	72.0	65.0	67.0		3697	-2.1	0.9	22		67	1,8599	1.2+/-3.3	0,1,4299	yes	missense	CELSR1	NM_014246.1	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1233/3015	46860090	1,13005	2203	4300	6503	SO:0001583	missense	9620	exon2			GCACGGCGGCCAC	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.3697G>A	22.37:g.46860090C>T	ENSP00000262738:p.Ala1233Thr	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	58	8	0.137931	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.013015	0.35511	0.0	1.16E-4	ENSG00000075275	ENST00000262738;ENST00000395964	T;T	0.68025	-0.3;0.02	4.75	-2.12	0.07165	.	0.352176	0.25214	N	0.032288	T	0.50905	0.1643	L	0.47716	1.5	0.09310	N	1	B	0.27656	0.184	B	0.15870	0.014	T	0.36432	-0.9748	10	0.26408	T	0.33	.	11.2292	0.48901	0.0:0.4283:0.0:0.5717	.	1233	Q9NYQ6	CELR1_HUMAN	T	1233	ENSP00000262738:A1233T;ENSP00000379293:A1233T	ENSP00000262738:A1233T	A	-	1	0	CELSR1	45238754	0.657000	0.27393	0.930000	0.37139	0.954000	0.61252	0.849000	0.27723	-0.358000	0.08162	-0.302000	0.09304	GCC	.	.	weak		0.612	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
SPRR3	6707	hgsc.bcm.edu	37	1	152975739	152975739	+	Silent	SNP	T	T	A	rs17851565	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:152975739T>A	ENST00000295367.4	+	2	285	c.243T>A	c.(241-243)ggT>ggA	p.G81G	SPRR3_ENST00000542696.1_Silent_p.G81G|SPRR3_ENST00000331860.3_Silent_p.G81G	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	81	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)	p.G81G(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGCCAGGTTGTACCAAGG	0.592																																					p.G81G		Atlas-SNP	.											SPRR3,colon,carcinoma,0,4	SPRR3	45	4	1	Substitution - coding silent(1)	prostate(1)	c.T243A						PASS	.						61.0	52.0	55.0					1																	152975739		2203	4299	6502	SO:0001819	synonymous_variant	6707	exon2			GCCAGGTTGTACC	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.243T>A	1.37:g.152975739T>A		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	46	12	0.26087	NM_001097589	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	Silent	SNP	ENST00000295367.4	37	CCDS1033.1																																																																																			A|0.010;C|0.001;T|0.988	0.010	strong		0.592	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
PCDHB1	29930	hgsc.bcm.edu	37	5	140431538	140431538	+	Silent	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr5:140431538C>T	ENST00000306549.3	+	1	560	c.483C>T	c.(481-483)gaC>gaT	p.D161D		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	161	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGATCTGGACGTGGGCCTTA	0.547																																					p.D161D		Atlas-SNP	.											.	PCDHB1	148	.	0			c.C483T						PASS	.						47.0	49.0	48.0					5																	140431538		2203	4300	6503	SO:0001819	synonymous_variant	29930	exon1			TCTGGACGTGGGC	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.483C>T	5.37:g.140431538C>T		Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	96	18	0.1875	NM_013340	Q2M257	Silent	SNP	ENST00000306549.3	37	CCDS4243.1																																																																																			.	.	none		0.547	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
TJP2	9414	hgsc.bcm.edu	37	9	71836110	71836110	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr9:71836110G>A	ENST00000377245.4	+	5	858	c.650G>A	c.(649-651)cGt>cAt	p.R217H	TJP2_ENST00000265384.7_Missense_Mutation_p.R217H|TJP2_ENST00000535702.1_Missense_Mutation_p.R221H|TJP2_ENST00000348208.4_Missense_Mutation_p.R217H|TJP2_ENST00000539225.1_Missense_Mutation_p.R248H|TJP2_ENST00000453658.2_Missense_Mutation_p.R194H	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	217					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						GACCGCAGCCGTGGCCGGAGC	0.751																																					p.R248H		Atlas-SNP	.											.	TJP2	120	.	0			c.G743A						PASS	.						10.0	16.0	14.0					9																	71836110		2154	4213	6367	SO:0001583	missense	9414	exon5			GCAGCCGTGGCCG	L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.650G>A	9.37:g.71836110G>A	ENSP00000366453:p.Arg217His	Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	59	9	0.152542	NM_001170416	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	ENST00000377245.4	37	CCDS6627.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.249862	0.80024	.	.	ENSG00000119139	ENST00000453658;ENST00000377245;ENST00000348208;ENST00000265384;ENST00000535702;ENST00000539225	T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57	5.11	4.19	0.49359	.	0.100863	0.64402	D	0.000005	T	0.68128	0.2967	M	0.72894	2.215	0.51482	D	0.99992	D;D;D;D;D	0.89917	0.997;1.0;0.988;1.0;0.989	P;D;P;P;P	0.64877	0.892;0.93;0.742;0.891;0.682	T	0.69487	-0.5132	9	.	.	.	.	14.4752	0.67541	0.075:0.0:0.925:0.0	.	248;221;217;217;217	F5H301;F5H886;Q9UDY2-2;Q9UDY2;Q9UDY2-5	.;.;.;ZO2_HUMAN;.	H	194;217;217;217;221;248	ENSP00000392178:R194H;ENSP00000366453:R217H;ENSP00000345893:R217H;ENSP00000265384:R217H;ENSP00000442090:R221H;ENSP00000438262:R248H	.	R	+	2	0	TJP2	71025930	0.885000	0.30320	0.508000	0.27688	0.547000	0.35210	2.779000	0.47734	2.531000	0.85337	0.591000	0.81541	CGT	.	.	none		0.751	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052572.2	NM_201629	
PATE4	399968	hgsc.bcm.edu	37	11	125708273	125708273	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:125708273T>C	ENST00000457514.2	+	3	292	c.248T>C	c.(247-249)cTg>cCg	p.L83P	PATE4_ENST00000534411.1_Missense_Mutation_p.L44P	NM_001144874.1	NP_001138346.1	P0C8F1	PATE4_HUMAN	prostate and testis expressed 4	83					regulation of synaptic transmission (GO:0050804)|response to wounding (GO:0009611)	acrosomal vesicle (GO:0001669)|extracellular space (GO:0005615)				breast(1)	1						AAAAGAGGCCTGTTGAGAGTG	0.413																																					p.L83P		Atlas-SNP	.											.	PATE4	10	.	0			c.T248C						PASS	.						124.0	109.0	113.0					11																	125708273		692	1591	2283	SO:0001583	missense	399968	exon3			GAGGCCTGTTGAG	AK123042	CCDS44765.1	11q24.2	2010-07-14			ENSG00000237353	ENSG00000237353		"""PATE family"""	35427	protein-coding gene	gene with protein product						18390568	Standard	NM_001144874		Approved	FLJ41047, PATE-B	uc001qcv.3	P0C8F1	OTTHUMG00000165235	ENST00000457514.2:c.248T>C	11.37:g.125708273T>C	ENSP00000411439:p.Leu83Pro	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	52	9	0.173077	NM_001144874		Missense_Mutation	SNP	ENST00000457514.2	37	CCDS44765.1	.	.	.	.	.	.	.	.	.	.	T	4.541	0.100403	0.08731	.	.	ENSG00000237353	ENST00000534411;ENST00000457514	D	0.89485	-2.52	1.11	-2.22	0.06952	.	.	.	.	.	T	0.80602	0.4654	.	.	.	0.09310	N	1	D	0.53462	0.96	B	0.41332	0.354	T	0.70568	-0.4836	8	0.45353	T	0.12	.	3.9428	0.09334	0.5034:0.0:0.0:0.4966	.	83	P0C8F1	PATE4_HUMAN	P	44;83	ENSP00000411439:L83P	ENSP00000411439:L83P	L	+	2	0	PATE4	125213483	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-0.759000	0.04761	-0.901000	0.03891	0.383000	0.25322	CTG	.	.	none		0.413	PATE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382865.1	NM_001144874	
KIAA1644	85352	hgsc.bcm.edu	37	22	44681413	44681413	+	Missense_Mutation	SNP	G	G	A	rs372785890		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr22:44681413G>A	ENST00000381176.4	-	4	626	c.494C>T	c.(493-495)cCg>cTg	p.P165L		NM_001099294.1	NP_001092764.1	Q3SXP7	K1644_HUMAN	KIAA1644	165						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				GGGAGGCTGCGGCTGTGGGGC	0.701													G|||	1	0.000199681	0.0	0.0014	5008	,	,		11290	0.0		0.0	False		,,,				2504	0.0				p.P165L		Atlas-SNP	.											.	KIAA1644	39	.	0			c.C494T						PASS	.	G	LEU/PRO	0,3994		0,0,1997	34.0	40.0	38.0		494	5.1	1.0	22		38	1,8323		0,1,4161	no	missense	KIAA1644	NM_001099294.1	98	0,1,6158	AA,AG,GG		0.012,0.0,0.0081	benign	165/200	44681413	1,12317	1997	4162	6159	SO:0001583	missense	85352	exon4			GGCTGCGGCTGTG	AB051431	CCDS43025.1	22q13	2009-02-06	2009-02-06		ENSG00000138944	ENSG00000138944			29335	protein-coding gene	gene with protein product						11258795	Standard	NM_001099294		Approved		uc003bet.2	Q3SXP7	OTTHUMG00000030991	ENST00000381176.4:c.494C>T	22.37:g.44681413G>A	ENSP00000370568:p.Pro165Leu	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	81	11	0.135802	NM_001099294	A6NHP0|A9Z1Z0|Q3SXP8|Q5JZ71|Q9BYB5	Missense_Mutation	SNP	ENST00000381176.4	37	CCDS43025.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.223504	0.58668	0.0	1.2E-4	ENSG00000138944	ENST00000381176	.	.	.	5.06	5.06	0.68205	.	0.127367	0.53938	D	0.000058	T	0.39172	0.1068	N	0.19112	0.55	0.30929	N	0.727169	B	0.26708	0.157	B	0.22386	0.039	T	0.50759	-0.8790	8	0.46703	T	0.11	-21.0547	15.5806	0.76432	0.0:0.0:1.0:0.0	.	165	Q3SXP7	K1644_HUMAN	L	165	.	ENSP00000370568:P165L	P	-	2	0	KIAA1644	43012746	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	3.558000	0.53749	2.345000	0.79718	0.561000	0.74099	CCG	.	.	weak		0.701	KIAA1644-006	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075879.2	NM_001099294	
OR2T4	127074	hgsc.bcm.edu	37	1	248525060	248525060	+	Missense_Mutation	SNP	T	T	A	rs28491677	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:248525060T>A	ENST00000366475.1	+	1	178	c.178T>A	c.(178-180)Tgt>Agt	p.C60S		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGCACTACTTTGTGTGGTCAT	0.488													t|||	1477	0.294928	0.2421	0.2709	5008	,	,		20455	0.4276		0.1809	False		,,,				2504	0.364				p.C60S		Atlas-SNP	.											OR2T4,NS,carcinoma,-1,1	OR2T4	126	1	0			c.T178A						scavenged	.						176.0	175.0	175.0					1																	248525060		2203	4300	6503	SO:0001583	missense	127074	exon1			CTACTTTGTGTGG	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.178T>A	1.37:g.248525060T>A	ENSP00000355431:p.Cys60Ser	Somatic	479	4	0.00835073		WXS	Illumina HiSeq	Phase_I	489	9	0.0184049	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	CCDS31113.1	500	0.22893772893772893	101	0.20528455284552846	72	0.19889502762430938	210	0.36713286713286714	117	0.15435356200527706	t	9.676	1.147970	0.21288	.	.	ENSG00000196944	ENST00000366475	T	0.02944	4.1	3.48	2.33	0.28932	.	0.441217	0.19340	N	0.116665	T	0.00012	0.0000	N	0.00746	-1.225	0.80722	P	0.0	B	0.09022	0.002	B	0.11329	0.006	T	0.41574	-0.9501	9	0.59425	D	0.04	.	8.6683	0.34134	0.1713:0.0:0.0:0.8287	rs28491677;rs58960769	60	Q8NH00	OR2T4_HUMAN	S	60	ENSP00000355431:C60S	ENSP00000355431:C60S	C	+	1	0	OR2T4	246591683	0.044000	0.20184	0.001000	0.08648	0.025000	0.11179	2.832000	0.48152	0.248000	0.21435	-0.510000	0.04470	TGT	T|0.787;A|0.213	0.213	strong		0.488	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128863470	128863470	+	Silent	SNP	G	G	C			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr5:128863470G>C	ENST00000274487.4	+	5	1243	c.1098G>C	c.(1096-1098)ctG>ctC	p.L366L	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	366	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		ACAAGAGTCTGAGTGTGCAGG	0.308																																					p.L366L		Atlas-SNP	.											ADAMTS19,NS,carcinoma,+2,1	ADAMTS19	216	1	0			c.G1098C						PASS	.						86.0	91.0	89.0					5																	128863470		2203	4300	6503	SO:0001819	synonymous_variant	171019	exon5			GAGTCTGAGTGTG	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1098G>C	5.37:g.128863470G>C		Somatic	369	0	0		WXS	Illumina HiSeq	Phase_I	399	18	0.0451128	NM_133638		Silent	SNP	ENST00000274487.4	37	CCDS4146.1																																																																																			.	.	none		0.308	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
ABCF1	23	hgsc.bcm.edu	37	6	30553108	30553108	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr6:30553108T>A	ENST00000326195.8	+	15	1575	c.1463T>A	c.(1462-1464)aTc>aAc	p.I488N	MIR877_ENST00000401282.1_RNA|ABCF1_ENST00000376545.3_Missense_Mutation_p.I450N|ABCF1_ENST00000396515.4_Intron	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	488	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						AACGCTGTCATCTGGCTTAAT	0.557																																					p.I488N		Atlas-SNP	.											.	ABCF1	61	.	0			c.T1463A						PASS	.						210.0	153.0	173.0					6																	30553108		1511	2709	4220	SO:0001583	missense	23	exon15			CTGTCATCTGGCT	AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.1463T>A	6.37:g.30553108T>A	ENSP00000313603:p.Ile488Asn	Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	109	24	0.220183	NM_001025091	A2BF75|O14897|Q69YP6	Missense_Mutation	SNP	ENST00000326195.8	37	CCDS34380.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.337644	0.81911	.	.	ENSG00000204574	ENST00000326195;ENST00000376545	D;D	0.90620	-2.5;-2.7	5.01	5.01	0.66863	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.053150	0.85682	D	0.000000	D	0.90748	0.7096	L	0.36672	1.1	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.74674	0.984;0.961;0.961	D	0.92519	0.6023	10	0.87932	D	0	-18.381	13.843	0.63451	0.0:0.0:0.0:1.0	.	450;488;488	Q2L6I2;Q8NE71;A2BF75	.;ABCF1_HUMAN;.	N	488;450	ENSP00000313603:I488N;ENSP00000365728:I450N	ENSP00000313603:I488N	I	+	2	0	ABCF1	30661087	1.000000	0.71417	0.994000	0.49952	0.886000	0.51366	7.367000	0.79558	2.107000	0.64212	0.379000	0.24179	ATC	.	.	none		0.557	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076137.3		
POTEG	404785	hgsc.bcm.edu	37	14	19571357	19571357	+	Missense_Mutation	SNP	T	T	C	rs200944601	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr14:19571357T>C	ENST00000409832.3	+	7	1188	c.1136T>C	c.(1135-1137)tTa>tCa	p.L379S		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	379				L -> S (in Ref. 3; AAI27624). {ECO:0000305}.						cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						GAACAAGACTTAAAGCTGACA	0.318																																					p.L379S		Atlas-SNP	.											POTEG,NS,carcinoma,0,3	POTEG	118	3	0			c.T1136C						scavenged	.						16.0	18.0	18.0					14																	19571357		1852	3837	5689	SO:0001583	missense	404785	exon7			AAGACTTAAAGCT		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.1136T>C	14.37:g.19571357T>C	ENSP00000386971:p.Leu379Ser	Somatic	99	30	0.30303		WXS	Illumina HiSeq	Phase_I	95	24	0.252632	NM_001005356	A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	CCDS32018.1	466	0.21336996336996336	89	0.18089430894308944	79	0.21823204419889503	119	0.20804195804195805	179	0.23614775725593667	t	11.66	1.704521	0.30232	.	.	ENSG00000222036	ENST00000409832	T	0.18174	2.23	1.18	1.18	0.20946	.	.	.	.	.	T	0.00012	0.0000	N	0.11560	0.145	0.09310	N	1	D	0.65815	0.995	P	0.56398	0.797	T	0.17410	-1.0370	9	0.06891	T	0.86	.	4.5755	0.12232	0.0:0.0:0.0:1.0	.	379	Q6S5H5	POTEG_HUMAN	S	379	ENSP00000386971:L379S	ENSP00000386971:L379S	L	+	2	0	POTEG	18641357	0.001000	0.12720	0.014000	0.15608	0.428000	0.31595	0.664000	0.25068	0.792000	0.33850	0.155000	0.16302	TTA	T|0.500;C|0.500	0.500	strong		0.318	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356	
PLCL2	23228	hgsc.bcm.edu	37	3	17051505	17051505	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:17051505G>A	ENST00000418129.2	+	2	754	c.289G>A	c.(289-291)Gga>Aga	p.G97R	PLCL2_ENST00000432376.1_Missense_Mutation_p.G97R|PLCL2_ENST00000460467.1_3'UTR|PLCL2_ENST00000396755.2_Missense_Mutation_p.G97R	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	223					B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						CGTCATATATGGAGAGAATTA	0.418																																					p.G97R		Atlas-SNP	.											.	PLCL2	145	.	0			c.G289A						PASS	.						123.0	123.0	123.0					3																	17051505		2203	4300	6503	SO:0001583	missense	23228	exon2			ATATATGGAGAGA	AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.289G>A	3.37:g.17051505G>A	ENSP00000409637:p.Gly97Arg	Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	107	11	0.102804	NM_015184	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Missense_Mutation	SNP	ENST00000418129.2	37	CCDS33713.1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.283509	0.59867	.	.	ENSG00000154822	ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376	T;T;T	0.66099	-0.19;-0.19;-0.19	5.33	4.45	0.53987	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.045302	0.85682	D	0.000000	T	0.79782	0.4505	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.82520	-0.0416	9	0.59425	D	0.04	.	15.4192	0.74997	0.0:0.0:0.8598:0.1402	.	223;97	Q9UPR0;Q9UPR0-2	PLCL2_HUMAN;.	R	97;224;97;97	ENSP00000409637:G97R;ENSP00000379979:G97R;ENSP00000412836:G97R	ENSP00000285094:G224R	G	+	1	0	PLCL2	17026509	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	9.869000	0.99810	1.240000	0.43803	0.561000	0.74099	GGA	.	.	none		0.418	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340250.3		
ZNF814	730051	hgsc.bcm.edu	37	19	58385798	58385798	+	Silent	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr19:58385798C>T	ENST00000435989.2	-	3	1194	c.960G>A	c.(958-960)ggG>ggA	p.G320G	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	320					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G320G(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AAGGTCTTTTCCCAGTGTGAA	0.353																																					p.G320G		Atlas-SNP	.											ZNF814,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,2	ZNF814	93	2	1	Substitution - coding silent(1)	central_nervous_system(1)	c.G960A						PASS	.						14.0	11.0	12.0					19																	58385798		687	1560	2247	SO:0001819	synonymous_variant	730051	exon3			TCTTTTCCCAGTG		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.960G>A	19.37:g.58385798C>T		Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	163	24	0.147239	NM_001144989	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.	.	none		0.353	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
PABPC3	5042	hgsc.bcm.edu	37	13	25671795	25671795	+	Missense_Mutation	SNP	C	C	T	rs113416318	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr13:25671795C>T	ENST00000281589.3	+	1	1496	c.1459C>T	c.(1459-1461)Cgt>Tgt	p.R487C		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	487					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AGTGGGTCCACGTCctgcagc	0.522													c|||	175	0.0349441	0.0537	0.0403	5008	,	,		21647	0.0119		0.0159	False		,,,				2504	0.0491				p.R487C		Atlas-SNP	.											PABPC3,rectum,carcinoma,0,1	PABPC3	129	1	0			c.C1459T						scavenged	.																																			SO:0001583	missense	5042	exon1			GGTCCACGTCCTG	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1459C>T	13.37:g.25671795C>T	ENSP00000281589:p.Arg487Cys	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	69	6	0.0869565	NM_030979	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.862076	0.51482	.	.	ENSG00000151846	ENST00000281589	T	0.31247	1.5	0.875	0.875	0.19130	.	0.135300	0.32190	U	0.006459	T	0.29556	0.0737	L	0.59436	1.845	0.58432	D	0.999997	D	0.58970	0.984	P	0.45660	0.489	T	0.12630	-1.0540	10	0.72032	D	0.01	.	7.5489	0.27783	0.0:1.0:0.0:0.0	.	487	Q9H361	PABP3_HUMAN	C	487	ENSP00000281589:R487C	ENSP00000281589:R487C	R	+	1	0	PABPC3	24569795	1.000000	0.71417	0.944000	0.38274	0.640000	0.38277	4.773000	0.62331	0.759000	0.33084	0.313000	0.20887	CGT	C|0.988;T|0.012	0.012	strong		0.522	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
CEP85	64793	hgsc.bcm.edu	37	1	26584680	26584680	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:26584680G>A	ENST00000252992.4	+	6	1215	c.1084G>A	c.(1084-1086)Gaa>Aaa	p.E362K	CEP85_ENST00000451429.2_Missense_Mutation_p.E311K	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa	362						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						GCGAGAGAGCGAACTGCAAGT	0.547																																					p.E362K		Atlas-SNP	.											.	CEP85	61	.	0			c.G1084A						PASS	.						127.0	114.0	118.0					1																	26584680		2203	4300	6503	SO:0001583	missense	64793	exon6			GAGAGCGAACTGC	AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.1084G>A	1.37:g.26584680G>A	ENSP00000252992:p.Glu362Lys	Somatic	73	0	0		WXS	Illumina HiSeq	Phase_I	85	17	0.2	NM_022778	B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	Missense_Mutation	SNP	ENST00000252992.4	37	CCDS277.1	.	.	.	.	.	.	.	.	.	.	G	36	5.790414	0.96945	.	.	ENSG00000130695	ENST00000451429;ENST00000252992	T;T	0.11604	2.76;2.76	6.04	6.04	0.98038	.	0.047882	0.85682	D	0.000000	T	0.34542	0.0901	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	0.981;0.991;1.0	P;P;D	0.77557	0.572;0.653;0.99	T	0.00166	-1.1965	10	0.44086	T	0.13	-16.1413	20.5948	0.99439	0.0:0.0:1.0:0.0	.	311;362;362	F8W7K4;Q6P2H3;Q6P2H3-2	.;CEP85_HUMAN;.	K	311;362	ENSP00000417002:E311K;ENSP00000252992:E362K	ENSP00000252992:E362K	E	+	1	0	CEP85	26457267	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	9.476000	0.97823	2.873000	0.98535	0.563000	0.77884	GAA	.	.	none		0.547	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009492.2	NM_022778	
SACS	26278	hgsc.bcm.edu	37	13	23908091	23908091	+	Silent	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr13:23908091G>A	ENST00000382292.3	-	9	10197	c.9924C>T	c.(9922-9924)caC>caT	p.H3308H	SACS_ENST00000402364.1_Silent_p.H2558H|SACS_ENST00000382298.3_Silent_p.H3308H			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3308					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AAACTGCAATGTGCATAAGGC	0.418																																					p.H3308H		Atlas-SNP	.											.	SACS	871	.	0			c.C9924T						PASS	.						79.0	71.0	74.0					13																	23908091		2203	4299	6502	SO:0001819	synonymous_variant	26278	exon10			TGCAATGTGCATA	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.9924C>T	13.37:g.23908091G>A		Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	107	20	0.186916	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	ENST00000382292.3	37	CCDS9300.2																																																																																			.	.	none		0.418	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
KMT2C	58508	hgsc.bcm.edu	37	7	151932991	151932991	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr7:151932991G>A	ENST00000262189.6	-	16	2898	c.2680C>T	c.(2680-2682)Cgg>Tgg	p.R894W	KMT2C_ENST00000355193.2_Missense_Mutation_p.R894W	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	894					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CGAGGTCTCCGCTTTCCTGGA	0.507																																					p.R894W		Atlas-SNP	.											MLL3_ENST00000355193,NS,malignant_melanoma,+2,4	MLL3	1564	4	0			c.C2680T						scavenged	.						32.0	34.0	33.0					7																	151932991		2203	4295	6498	SO:0001583	missense	58508	exon16			GTCTCCGCTTTCC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2680C>T	7.37:g.151932991G>A	ENSP00000262189:p.Arg894Trp	Somatic	129	5	0.0387597		WXS	Illumina HiSeq	Phase_I	145	8	0.0551724	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.65|15.65	2.896744|2.896744	0.52121|0.52121	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000418673|ENST00000262189;ENST00000355193	.|D;D	.|0.89875	.|-2.57;-2.58	5.1|5.1	2.1|2.1	0.27182|0.27182	.|.	.|0.000000	.|0.42294	.|D	.|0.000721	D|D	0.91952|0.91952	0.7451|0.7451	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.79784	.|0.993	D|D	0.91065|0.91065	0.4888|0.4888	5|10	.|0.87932	.|D	.|0	.|.	9.9957|9.9957	0.41898|0.41898	0.0:0.1323:0.5941:0.2736|0.0:0.1323:0.5941:0.2736	.|.	.|894	.|Q8NEZ4	.|MLL3_HUMAN	V|W	49|894	.|ENSP00000262189:R894W;ENSP00000347325:R894W	.|ENSP00000262189:R894W	A|R	-|-	2|1	0|2	MLL3|MLL3	151563924|151563924	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.946000|0.946000	0.59487|0.59487	2.043000|2.043000	0.41231|0.41231	0.653000|0.653000	0.30826|0.30826	-0.885000|-0.885000	0.02943|0.02943	GCG|CGG	.	.	none		0.507	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
PCNXL3	399909	hgsc.bcm.edu	37	11	65388334	65388334	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:65388334C>T	ENST00000355703.3	+	10	2671	c.2132C>T	c.(2131-2133)tCg>tTg	p.S711L		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	711						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						AGCTTCCACTCGGCTGATGTC	0.682																																					p.S711L		Atlas-SNP	.											.	PCNXL3	140	.	0			c.C2132T						PASS	.						16.0	20.0	18.0					11																	65388334		2029	4170	6199	SO:0001583	missense	399909	exon10			TCCACTCGGCTGA	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.2132C>T	11.37:g.65388334C>T	ENSP00000347931:p.Ser711Leu	Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	66	12	0.181818	NM_032223	Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	37	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576123	0.65878	.	.	ENSG00000197136	ENST00000355703	T	0.27557	1.66	5.41	4.49	0.54785	.	.	.	.	.	T	0.29524	0.0736	M	0.64404	1.975	0.38704	D	0.953055	B	0.18310	0.027	B	0.06405	0.002	T	0.10405	-1.0631	9	0.31617	T	0.26	.	10.5747	0.45221	0.0:0.9076:0.0:0.0924	.	711	Q9H6A9	PCX3_HUMAN	L	711	ENSP00000347931:S711L	ENSP00000347931:S711L	S	+	2	0	PCNXL3	65144910	1.000000	0.71417	0.952000	0.39060	0.988000	0.76386	6.243000	0.72384	2.536000	0.85505	0.555000	0.69702	TCG	.	.	none		0.682	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223	
SEC61G	23480	hgsc.bcm.edu	37	7	54823513	54823513	+	Silent	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr7:54823513G>A	ENST00000415949.1	-	4	522	c.156C>T	c.(154-156)ttC>ttT	p.F52F	SEC61G_ENST00000395535.3_Silent_p.F52F|SEC61G_ENST00000450622.1_Silent_p.F52F|SEC61G_ENST00000352861.4_Silent_p.F52F			P60059	SC61G_HUMAN	Sec61 gamma subunit	52					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|protein targeting to ER (GO:0045047)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)|protein transporter activity (GO:0008565)			kidney(1)|lung(5)	6	Esophageal squamous(2;7.55e-08)|Breast(14;0.0654)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)			ATTTCACAAAGAAGCCAATGA	0.313																																					p.F52F		Atlas-SNP	.											.	SEC61G	10	.	0			c.C156T						PASS	.						98.0	97.0	98.0					7																	54823513		2203	4300	6503	SO:0001819	synonymous_variant	23480	exon3			CACAAAGAAGCCA	AF086539	CCDS5513.1	7p11.2	2014-05-19			ENSG00000132432	ENSG00000132432			18277	protein-coding gene	gene with protein product		609215				8107851, 10212142	Standard	NM_014302		Approved	SSS1	uc003tqg.3	P60059	OTTHUMG00000023430	ENST00000415949.1:c.156C>T	7.37:g.54823513G>A		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	80	9	0.1125	NM_001012456	B2R4J0|P38384|Q6IB25	Silent	SNP	ENST00000415949.1	37	CCDS5513.1																																																																																			.	.	none		0.313	SEC61G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251384.2	NM_014302	
OR4A15	81328	hgsc.bcm.edu	37	11	55135959	55135959	+	Silent	SNP	T	T	C			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:55135959T>C	ENST00000314706.3	+	1	600	c.600T>C	c.(598-600)aaT>aaC	p.N200N		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						GTGGACCCAATGTCATTGACA	0.433																																					p.N200N		Atlas-SNP	.											.	OR4A15	161	.	0			c.T600C						PASS	.						139.0	128.0	132.0					11																	55135959		2200	4276	6476	SO:0001819	synonymous_variant	81328	exon1			ACCCAATGTCATT	AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.600T>C	11.37:g.55135959T>C		Somatic	315	0	0		WXS	Illumina HiSeq	Phase_I	314	49	0.156051	NM_001005275	Q6IFL4|Q96R65	Silent	SNP	ENST00000314706.3	37	CCDS31500.1																																																																																			.	.	none		0.433	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275	
ZSCAN5A	79149	hgsc.bcm.edu	37	19	56736102	56736102	+	Missense_Mutation	SNP	A	A	T	rs201600248		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr19:56736102A>T	ENST00000587340.1	-	4	1009	c.314T>A	c.(313-315)aTg>aAg	p.M105K	ZSCAN5A_ENST00000587492.1_Intron|ZSCAN5A_ENST00000391713.1_Missense_Mutation_p.M105K|ZSCAN5A_ENST00000592355.1_Missense_Mutation_p.M105K|ZSCAN5A_ENST00000254165.3_Intron			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	105	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.M105K(2)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						ACCGTTCATCATGACTAAGAC	0.552																																					p.M105K		Atlas-SNP	.											ZSCAN5A,trunk,malignant_melanoma,0,2	ZSCAN5A	118	2	2	Substitution - Missense(2)	skin(2)	c.T314A						scavenged	.						19.0	19.0	19.0					19																	56736102		2141	4214	6355	SO:0001583	missense	79149	exon2			TTCATCATGACTA	AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.314T>A	19.37:g.56736102A>T	ENSP00000467631:p.Met105Lys	Somatic	322	5	0.015528		WXS	Illumina HiSeq	Phase_I	395	12	0.0303797	NM_024303	B4DX98|Q49A73|Q53F04|Q8N7B3	Missense_Mutation	SNP	ENST00000587340.1	37	CCDS12941.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.262023	0.00262	.	.	ENSG00000131848	ENST00000391713	T	0.03745	3.82	2.27	-1.24	0.09435	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.00637	0.0021	N	0.00086	-2.195	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.44817	-0.9303	9	0.02654	T	1	.	2.254	0.04051	0.2591:0.3296:0.0:0.4112	.	105	Q9BUG6	ZSA5A_HUMAN	K	105	ENSP00000375593:M105K	ENSP00000375593:M105K	M	-	2	0	ZSCAN5A	61427914	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-2.751000	0.00792	-0.413000	0.07507	-0.669000	0.03829	ATG	.	.	weak		0.552	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458110.1	NM_024303	
CDK5RAP3	80279	hgsc.bcm.edu	37	17	46053334	46053334	+	Silent	SNP	A	A	G	rs202125432	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr17:46053334A>G	ENST00000338399.4	+	8	859	c.753A>G	c.(751-753)gaA>gaG	p.E251E	CDK5RAP3_ENST00000536708.2_Silent_p.E276E|RP11-6N17.9_ENST00000582262.1_RNA	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	251					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)	p.E251E(1)		NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						CTGTGGTGGAACGACCCCACC	0.602																																					p.E251E		Atlas-SNP	.											CDK5RAP3,NS,carcinoma,0,2	CDK5RAP3	38	2	1	Substitution - coding silent(1)	prostate(1)	c.A753G						scavenged	.																																			SO:0001819	synonymous_variant	80279	exon8			GGTGGAACGACCC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.753A>G	17.37:g.46053334A>G		Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	41	7	0.170732	NM_176096	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Silent	SNP	ENST00000338399.4	37	CCDS42356.1																																																																																			A|0.949;G|0.051	0.051	strong		0.602	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442913.1	NM_176096	
OR5L1	219437	hgsc.bcm.edu	37	11	55579056	55579056	+	Silent	SNP	G	G	A	rs147224918		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:55579056G>A	ENST00000333973.2	+	1	203	c.114G>A	c.(112-114)acG>acA	p.T38T		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T38T(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				ATGGAGTCACGTTGTTAGCCA	0.502													N|||	1	0.000199681	0.0008	0.0	5008	,	,		18448	0.0		0.0	False		,,,				2504	0.0				p.T38T		Atlas-SNP	.											OR5L1,colon,carcinoma,+2,2	OR5L1	145	2	1	Substitution - coding silent(1)	ovary(1)	c.G114A						scavenged	.	G		1,4399	2.1+/-5.4	0,1,2199	304.0	268.0	280.0		114	-8.6	0.0	11	dbSNP_134	280	4,8588	3.7+/-12.6	0,4,4292	no	coding-synonymous	OR5L1	NM_001004738.1		0,5,6491	AA,AG,GG		0.0466,0.0227,0.0385		38/312	55579056	5,12987	2200	4296	6496	SO:0001819	synonymous_variant	219437	exon1			AGTCACGTTGTTA	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.114G>A	11.37:g.55579056G>A		Somatic	136	1	0.00735294		WXS	Illumina HiSeq	Phase_I	155	28	0.180645	NM_001004738	B2RNK6|Q6IFD0	Silent	SNP	ENST00000333973.2	37	CCDS31509.1																																																																																			G|1.000;A|0.000	0.000	weak		0.502	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738	
CARD17	440068	hgsc.bcm.edu	37	11	104970112	104970112	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:104970112G>A	ENST00000375707.1	-	3	327	c.311C>T	c.(310-312)tCt>tTt	p.S104F	CASP1_ENST00000415981.2_Intron|CASP1_ENST00000594519.1_Intron|CARD16_ENST00000525374.1_Intron|CASP1_ENST00000598974.1_Intron|CASP1_ENST00000593315.1_Intron	NM_001007232.1	NP_001007233.1	Q5XLA6	CAR17_HUMAN	caspase recruitment domain family, member 17	104					regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	6						TACTATTTGAGAATCTTGTGT	0.383																																					p.S104F		Atlas-SNP	.											.	CARD17	15	.	0			c.C311T						PASS	.						124.0	119.0	121.0					11																	104970112		2202	4299	6501	SO:0001583	missense	440068	exon3			ATTTGAGAATCTT		CCDS31662.1	11q22.3	2009-01-13				ENSG00000255221			33827	protein-coding gene	gene with protein product	"""Inhibitory CARD"""	609490				15383541	Standard	NM_001007232		Approved	INCA	uc001pir.1	Q5XLA6		ENST00000375707.1:c.311C>T	11.37:g.104970112G>A	ENSP00000364859:p.Ser104Phe	Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	34	8	0.235294	NM_001007232		Missense_Mutation	SNP	ENST00000375707.1	37	CCDS31662.1	.	.	.	.	.	.	.	.	.	.	.	2.868	-0.234690	0.05983	.	.	ENSG00000255221	ENST00000375707	T	0.19394	2.15	1.6	0.655	0.17839	.	.	.	.	.	T	0.16128	0.0388	M	0.64567	1.98	0.09310	N	1	B	0.19706	0.038	B	0.14023	0.01	T	0.39099	-0.9630	9	0.10111	T	0.7	.	3.8812	0.09079	0.2387:0.0:0.7613:0.0	.	104	Q5XLA6	CAR17_HUMAN	F	104	ENSP00000364859:S104F	ENSP00000364859:S104F	S	-	2	0	CARD17	104475322	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.215000	0.17562	0.225000	0.20959	0.430000	0.28490	TCT	.	.	none		0.383	CARD17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388181.1	NM_001007232	
VMA21	203547	hgsc.bcm.edu	37	X	150573426	150573426	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chrX:150573426G>A	ENST00000330374.6	+	3	307	c.202G>A	c.(202-204)Gct>Act	p.A68T	VMA21_ENST00000370361.1_Missense_Mutation_p.A123T|VMA21_ENST00000477649.1_3'UTR	NM_001017980.3	NP_001017980.1			VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)									p.A68T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)	7						CTATTTTTACGCTGCTATTGT	0.448																																					p.A68T		Atlas-SNP	.											.	VMA21	17	.	1	Substitution - Missense(1)	endometrium(1)	c.G202A						PASS	.						143.0	114.0	124.0					X																	150573426		2203	4300	6503	SO:0001583	missense	203547	exon3			TTTTACGCTGCTA	AK096835	CCDS35430.1	Xq28	2014-09-17			ENSG00000160131	ENSG00000160131			22082	protein-coding gene	gene with protein product		300913	"""myopathy with excessive autophagy"""	MEAX		2892402, 10757644, 19379691	Standard	NM_001017980		Approved	XMEA	uc004feu.3	Q3ZAQ7	OTTHUMG00000024168	ENST00000330374.6:c.202G>A	X.37:g.150573426G>A	ENSP00000333255:p.Ala68Thr	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	146	35	0.239726	NM_001017980		Missense_Mutation	SNP	ENST00000330374.6	37	CCDS35430.1	.	.	.	.	.	.	.	.	.	.	.	35	5.500966	0.96371	.	.	ENSG00000160131	ENST00000370361;ENST00000330374	.	.	.	5.8	5.8	0.92144	Vacuolar ATPase assembly integral membrane protein VMA21-like domain (1);	0.000000	0.85682	D	0.000000	D	0.83585	0.5286	M	0.85630	2.765	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.86029	0.1512	9	0.72032	D	0.01	-6.2343	16.2228	0.82267	0.0:0.0:1.0:0.0	.	68	Q3ZAQ7	VMA21_HUMAN	T	123;68	.	ENSP00000333255:A68T	A	+	1	0	VMA21	150324084	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.823000	0.99369	2.434000	0.82447	0.600000	0.82982	GCT	.	.	none		0.448	VMA21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060876.1	NM_001017980	
KMT2C	58508	hgsc.bcm.edu	37	7	151970877	151970877	+	Missense_Mutation	SNP	G	G	A	rs138627563		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr7:151970877G>A	ENST00000262189.6	-	7	1143	c.925C>T	c.(925-927)Cct>Tct	p.P309S	KMT2C_ENST00000355193.2_Missense_Mutation_p.P309S	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	309					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GCAGCACAAGGATAATGATAC	0.443																																					p.P309S		Atlas-SNP	.											MLL3_ENST00000355193,NS,carcinoma,+1,6	MLL3	1564	6	0			c.C925T						scavenged	.						204.0	190.0	195.0					7																	151970877		2203	4300	6503	SO:0001583	missense	58508	exon7			CACAAGGATAATG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.925C>T	7.37:g.151970877G>A	ENSP00000262189:p.Pro309Ser	Somatic	251	3	0.0119522		WXS	Illumina HiSeq	Phase_I	257	9	0.0350195	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.790455	0.70337	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	T;T	0.70045	-0.45;-0.45	4.87	4.87	0.63330	Zinc finger, PHD-type (1);	0.000000	0.44483	D	0.000455	D	0.83403	0.5247	M	0.83692	2.655	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85377	0.1117	10	0.54805	T	0.06	.	18.3751	0.90433	0.0:0.0:1.0:0.0	.	309	Q8NEZ4	MLL3_HUMAN	S	309	ENSP00000262189:P309S;ENSP00000347325:P309S	ENSP00000262189:P309S	P	-	1	0	MLL3	151601810	1.000000	0.71417	0.804000	0.32291	0.996000	0.88848	9.781000	0.99029	2.423000	0.82170	0.650000	0.86243	CCT	.	.	weak		0.443	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MUC4	4585	hgsc.bcm.edu	37	3	195511447	195511447	+	Missense_Mutation	SNP	G	G	A	rs577730605	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:195511447G>A	ENST00000463781.3	-	2	7463	c.7004C>T	c.(7003-7005)aCg>aTg	p.T2335M	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T2335M|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T2335M(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGAGGCGTGGTGTCACC	0.597													.|||	23	0.00459265	0.0159	0.0	5008	,	,		17550	0.0		0.001	False		,,,				2504	0.001				p.T2335M		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,3	MUC4	1505	3	1	Substitution - Missense(1)	endometrium(1)	c.C7004T						scavenged	.						5.0	6.0	6.0					3																	195511447		581	1479	2060	SO:0001583	missense	4585	exon2			AGAGGCGTGGTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7004C>T	3.37:g.195511447G>A	ENSP00000417498:p.Thr2335Met	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	100	6	0.06	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	G	3.781	-0.045698	0.07452	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.36699	1.24;1.28	.	.	.	.	1.329500	0.07018	U	0.826373	T	0.30978	0.0782	N	0.19112	0.55	0.09310	N	1	D	0.64830	0.994	P	0.52909	0.713	T	0.26677	-1.0096	8	.	.	.	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	2335	E7ESK3	.	M	2335	ENSP00000417498:T2335M;ENSP00000420243:T2335M	.	T	-	2	0	MUC4	196995842	0.000000	0.05858	0.018000	0.16275	0.025000	0.11179	-0.545000	0.06069	0.064000	0.16427	0.064000	0.15345	ACG	.	.	none		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PIP5K1A	8394	hgsc.bcm.edu	37	1	151206713	151206713	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:151206713A>G	ENST00000368888.4	+	8	1102	c.680A>G	c.(679-681)tAt>tGt	p.Y227C	PIP5K1A_ENST00000414290.2_5'Flank|PIP5K1A_ENST00000368890.4_Missense_Mutation_p.Y214C|PIP5K1A_ENST00000464105.1_3'UTR|PIP5K1A_ENST00000409426.1_Missense_Mutation_p.Y215C|PIP5K1A_ENST00000441902.2_Missense_Mutation_p.Y215C	NM_001135638.1	NP_001129110.1	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, alpha	227	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton reorganization (GO:0031532)|activation of Rac GTPase activity (GO:0032863)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|fibroblast migration (GO:0010761)|focal adhesion assembly (GO:0048041)|glycerophospholipid metabolic process (GO:0006650)|keratinocyte differentiation (GO:0030216)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|protein targeting to plasma membrane (GO:0072661)|ruffle assembly (GO:0097178)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|kinase binding (GO:0019900)			breast(1)|central_nervous_system(1)|ovary(1)|skin(1)|stomach(1)	5	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			CCTAAATTCTATGGACTGTAC	0.418																																					p.Y227C	Pancreas(80;36 1443 2325 16095 21302)	Atlas-SNP	.											.	PIP5K1A	61	.	0			c.A680G						PASS	.						108.0	99.0	102.0					1																	151206713		2203	4300	6503	SO:0001583	missense	8394	exon8			AATTCTATGGACT	U78575	CCDS990.1, CCDS44219.1, CCDS44220.1, CCDS44221.1	1q21.3	2010-04-08			ENSG00000143398	ENSG00000143398			8994	protein-coding gene	gene with protein product		603275				8955136, 10828584	Standard	NM_003557		Approved		uc001exj.3	Q99755	OTTHUMG00000012351	ENST00000368888.4:c.680A>G	1.37:g.151206713A>G	ENSP00000357883:p.Tyr227Cys	Somatic	193	0	0		WXS	Illumina HiSeq	Phase_I	218	70	0.321101	NM_001135638	A8K4Q0|B4DIN0|Q99754|Q99756	Missense_Mutation	SNP	ENST00000368888.4	37	CCDS44219.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.358986	0.82353	.	.	ENSG00000143398	ENST00000349792;ENST00000409426;ENST00000441902;ENST00000368890;ENST00000368888	T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07	4.88	4.88	0.63580	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	M	0.84773	2.715	0.80722	D	1	B;D;P;D	0.89917	0.152;1.0;0.881;1.0	P;D;P;D	0.71414	0.511;0.957;0.745;0.973	T	0.68834	-0.5304	10	0.87932	D	0	.	14.6488	0.68780	1.0:0.0:0.0:0.0	.	215;214;227;214	Q99755-4;Q99755-2;Q99755;Q99755-3	.;.;PI51A_HUMAN;.	C	214;215;215;214;227	ENSP00000271663:Y214C;ENSP00000386432:Y215C;ENSP00000415648:Y215C;ENSP00000357885:Y214C;ENSP00000357883:Y227C	ENSP00000271663:Y214C	Y	+	2	0	PIP5K1A	149473337	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.051000	0.93849	2.196000	0.70406	0.473000	0.43528	TAT	.	.	none		0.418	PIP5K1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034425.2	NM_003557	
PSG1	5669	hgsc.bcm.edu	37	19	43382402	43382402	+	Silent	SNP	G	G	A	rs17423717	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr19:43382402G>A	ENST00000436291.2	-	2	209	c.93C>T	c.(91-93)ccC>ccT	p.P31P	PSG1_ENST00000595356.1_Silent_p.P31P|PSG1_ENST00000403380.3_Silent_p.P31P|PSG1_ENST00000601073.1_5'UTR|PSG1_ENST00000595124.1_Silent_p.P31P|PSG1_ENST00000244296.2_Silent_p.P31P|PSG1_ENST00000312439.6_Silent_p.P31P	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	31					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				GGGCAGTGGTGGGCAGGTTCC	0.493													.|||	52	0.0103834	0.0212	0.0072	5008	,	,		19198	0.005		0.002	False		,,,				2504	0.0123				p.P31P		Atlas-SNP	.											PSG1_ENST00000312439,NS,carcinoma,-1,4	PSG1	196	4	0			c.C93T						scavenged	.						142.0	154.0	150.0					19																	43382402		2203	4299	6502	SO:0001819	synonymous_variant	5669	exon2			AGTGGTGGGCAGG		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.93C>T	19.37:g.43382402G>A		Somatic	118	1	0.00847458		WXS	Illumina HiSeq	Phase_I	112	5	0.0446429	NM_001184826	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Silent	SNP	ENST00000436291.2	37	CCDS54275.1																																																																																			G|0.996;A|0.004	0.004	strong		0.493	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1		
SHANK1	50944	hgsc.bcm.edu	37	19	51165532	51165532	+	Missense_Mutation	SNP	G	G	A	rs571797572		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr19:51165532G>A	ENST00000293441.1	-	23	6194	c.6176C>T	c.(6175-6177)cCg>cTg	p.P2059L	SHANK1_ENST00000483981.2_5'Flank|SHANK1_ENST00000391814.1_Missense_Mutation_p.P2067L|SYT3_ENST00000544769.1_Intron|SHANK1_ENST00000359082.3_Missense_Mutation_p.P2050L|SHANK1_ENST00000391813.1_Missense_Mutation_p.P1446L	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	2059					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GGATATCCCCGGGTGTGGCGG	0.701													g|||	1	0.000199681	0.0	0.0	5008	,	,		12621	0.001		0.0	False		,,,				2504	0.0				p.P2059L		Atlas-SNP	.											.	SHANK1	210	.	0			c.C6176T						PASS	.																																			SO:0001583	missense	50944	exon23			ATCCCCGGGTGTG	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.6176C>T	19.37:g.51165532G>A	ENSP00000293441:p.Pro2059Leu	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	68	15	0.220588	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	37	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	g	9.125	1.010036	0.19277	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.37584	1.31;1.76;1.3;1.19	3.55	2.5	0.30297	.	0.169189	0.38436	U	0.001681	T	0.28366	0.0701	L	0.52573	1.65	0.43485	D	0.995716	B;B	0.23490	0.052;0.086	B;B	0.10450	0.002;0.005	T	0.10660	-1.0620	10	0.52906	T	0.07	.	7.0697	0.25171	0.1295:0.0:0.8705:0.0	.	2059;1446	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	L	2059;1446;2050;2067	ENSP00000293441:P2059L;ENSP00000375689:P1446L;ENSP00000351984:P2050L;ENSP00000375690:P2067L	ENSP00000293441:P2059L	P	-	2	0	SHANK1	55857344	0.985000	0.35326	0.735000	0.30896	0.825000	0.46686	0.923000	0.28757	0.845000	0.35118	0.450000	0.29827	CCG	.	.	none		0.701	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
GYPB	2994	hgsc.bcm.edu	37	4	145041720	145041720	+	Intron	SNP	A	A	G	rs7682260	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr4:145041720A>G	ENST00000283126.7	-	1	93				GYPA_ENST00000360771.4_Missense_Mutation_p.L20S|GYPA_ENST00000512789.1_Intron|GYPA_ENST00000503627.1_Missense_Mutation_p.L20S|GYPA_ENST00000535709.1_5'UTR|GYPA_ENST00000512064.1_Missense_Mutation_p.L20S|RP11-673E1.4_ENST00000506982.1_RNA|GYPA_ENST00000324022.10_Intron|GYPA_ENST00000504786.1_Missense_Mutation_p.L20S			P06028	GLPB_HUMAN	glycophorin B (MNS blood group)							integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|skin(1)	4	all_hematologic(180;0.158)					AGTGGTACTTAATGCTGATAT	0.353													G|||	1428	0.285144	0.1944	0.3545	5008	,	,		12360	0.3125		0.2813	False		,,,				2504	0.3344				p.L20S		Atlas-SNP	.											GYPA,NS,carcinoma,0,1	GYPA	27	1	0			c.T59C						scavenged	.	G	SER/LEU	737,3513		243,251,1631	57.0	30.0	39.0		59	-3.4	0.0	4	dbSNP_116	39	1997,6329		706,585,2872	no	missense	GYPA	NM_002099.6	145	949,836,4503	GG,GA,AA		23.9851,17.3412,21.7398	benign	20/151	145041720	2734,9842	2125	4163	6288	SO:0001627	intron_variant	2993	exon2			GTACTTAATGCTG		CCDS54809.1	4q31.21	2014-09-17	2006-02-23			ENSG00000250361		"""CD molecules"", ""Blood group antigens"""	4703	protein-coding gene	gene with protein product		111740	"""glycophorin B (includes Ss blood group)"", ""glycophorin B (Ss blood group)"""	MNS			Standard	NM_002100		Approved	GPB, SS, CD235b		P06028		ENST00000283126.7:c.37+20031T>C	4.37:g.145041720A>G		Somatic	50	49	0.98		WXS	Illumina HiSeq	Phase_I	72	70	0.972222	NM_002099	B8Q174|E2QBW7|Q0VAF4|Q58HE9|Q58HF0|Q58HF1|Q9UCH7	Missense_Mutation	SNP	ENST00000283126.7	37		.	.	.	.	.	.	.	.	.	.	G	2.787	-0.252207	0.05829	0.173412	0.239851	ENSG00000170180	ENST00000360771;ENST00000512064;ENST00000504786;ENST00000503627;ENST00000394119	T;T;T;T	0.04809	4.59;4.61;4.54;3.55	1.71	-3.42	0.04825	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	1.0000000000287557E-6	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.46555	-0.9183	7	0.52906	T	0.07	.	0.8306	0.01129	0.3297:0.3169:0.194:0.1595	rs7682260;rs17845377;rs17858231	20;20;20	E9PD10;E7EQF3;Q16336	.;.;.	S	20	ENSP00000354003:L20S;ENSP00000426130:L20S;ENSP00000425549:L20S;ENSP00000421243:L20S	ENSP00000354003:L20S	L	-	2	0	GYPA	145261170	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.801000	0.04550	-2.458000	0.00538	-2.395000	0.00226	TTA	A|0.519;G|0.481	0.481	strong		0.353	GYPB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_002100	
PAK2	5062	hgsc.bcm.edu	37	3	196530022	196530022	+	Silent	SNP	C	C	T	rs115224945	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:196530022C>T	ENST00000327134.3	+	4	745	c.423C>T	c.(421-423)agC>agT	p.S141S		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	141					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		AATATCTGAGCTTTACTCCTC	0.418																																					p.S141S		Atlas-SNP	.											PAK2_ENST00000327134,rectum,carcinoma,0,2	PAK2	113	2	0			c.C423T						scavenged	.						85.0	79.0	81.0					3																	196530022		2203	4300	6503	SO:0001819	synonymous_variant	5062	exon4			TCTGAGCTTTACT	U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.423C>T	3.37:g.196530022C>T		Somatic	32	1	0.03125		WXS	Illumina HiSeq	Phase_I	68	5	0.0735294	NM_002577	Q13154|Q6ISC3	Silent	SNP	ENST00000327134.3	37	CCDS3321.1																																																																																			C|0.986;T|0.015	0.015	strong		0.418	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
SPOCD1	90853	hgsc.bcm.edu	37	1	32258931	32258931	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:32258931C>T	ENST00000360482.2	-	13	2762	c.2633G>A	c.(2632-2634)cGg>cAg	p.R878Q	SPOCD1_ENST00000373648.2_3'UTR|SPOCD1_ENST00000257100.3_Missense_Mutation_p.R371Q|RP11-84A19.3_ENST00000527035.1_RNA|SPOCD1_ENST00000533231.1_Missense_Mutation_p.R878Q	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	878	SPOC.				negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		GGCCCGGAACCGCTTGATGGA	0.647																																					p.R878Q		Atlas-SNP	.											.	SPOCD1	109	.	0			c.G2633A						PASS	.						33.0	29.0	30.0					1																	32258931		2199	4298	6497	SO:0001583	missense	90853	exon13			CGGAACCGCTTGA	AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.2633G>A	1.37:g.32258931C>T	ENSP00000353670:p.Arg878Gln	Somatic	124	0	0		WXS	Illumina HiSeq	Phase_I	150	28	0.186667	NM_144569	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	ENST00000360482.2	37	CCDS347.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.45|15.45	2.837206|2.837206	0.50951|0.50951	.|.	.|.	ENSG00000134668|ENSG00000134668	ENST00000528579|ENST00000257100;ENST00000360482;ENST00000294514;ENST00000452755;ENST00000533231	.|T;T;T;T	.|0.43688	.|0.94;1.94;0.95;1.95	5.73|5.73	-0.674|-0.674	0.11369|0.11369	.|Spen paralogue and orthologue SPOC, C-terminal (1);	.|.	.|.	.|.	.|.	T|T	0.22003|0.22003	0.0530|0.0530	L|L	0.39633|0.39633	1.23|1.23	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.40398	.|0.669;0.515;0.716	.|B;B;B	.|0.25405	.|0.053;0.06;0.06	T|T	0.05767|0.05767	-1.0865|-1.0865	5|9	.|0.37606	.|T	.|0.19	-11.3723|-11.3723	5.2404|5.2404	0.15469|0.15469	0.0:0.4735:0.1415:0.385|0.0:0.4735:0.1415:0.385	.|.	.|878;314;878	.|Q6ZMY3-2;E9PPM7;Q6ZMY3	.|.;.;SPOC1_HUMAN	S|Q	252|371;878;238;314;878	.|ENSP00000257100:R371Q;ENSP00000353670:R878Q;ENSP00000399778:R314Q;ENSP00000435851:R878Q	.|ENSP00000257100:R371Q	G|R	-|-	1|2	0|0	SPOCD1|SPOCD1	32031518|32031518	0.006000|0.006000	0.16342|0.16342	0.935000|0.935000	0.37517|0.37517	0.999000|0.999000	0.98932|0.98932	-0.937000|-0.937000	0.03942|0.03942	-0.063000|-0.063000	0.13065|0.13065	0.655000|0.655000	0.94253|0.94253	GGT|CGG	.	.	none		0.647	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569	
MUC6	4588	hgsc.bcm.edu	37	11	1017068	1017068	+	Silent	SNP	C	C	T	rs78992004		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:1017068C>T	ENST00000421673.2	-	31	5783	c.5733G>A	c.(5731-5733)acG>acA	p.T1911T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1911	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AAGTTTTGGCCGTGCTAAATG	0.552																																					p.T1911T		Atlas-SNP	.											MUC6,NS,carcinoma,-1,1	MUC6	408	1	0			c.G5733A						scavenged	.																																			SO:0001819	synonymous_variant	4588	exon31			TTTGGCCGTGCTA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5733G>A	11.37:g.1017068C>T		Somatic	405	53	0.130864		WXS	Illumina HiSeq	Phase_I	433	57	0.13164	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																			C|0.500;T|0.500	0.500	weak		0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
ZNF814	730051	hgsc.bcm.edu	37	19	58385793	58385793	+	Missense_Mutation	SNP	C	C	T	rs113623532		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr19:58385793C>T	ENST00000435989.2	-	3	1199	c.965G>A	c.(964-966)aGa>aAa	p.R322K	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	322					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTCATAAGGTCTTTTCCCAGT	0.358																																					p.R322K		Atlas-SNP	.											.	ZNF814	93	.	0			c.G965A						PASS	.						15.0	12.0	13.0					19																	58385793		687	1562	2249	SO:0001583	missense	730051	exon3			TAAGGTCTTTTCC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.965G>A	19.37:g.58385793C>T	ENSP00000410545:p.Arg322Lys	Somatic	161	0	0		WXS	Illumina HiSeq	Phase_I	179	25	0.139665	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.395361	0.01175	.	.	ENSG00000204514	ENST00000435989	T	0.12361	2.69	2.27	9.47E-4	0.14044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.02225	-0.63	0.09310	N	0.999999	B	0.29301	0.241	B	0.28916	0.096	T	0.40534	-0.9558	9	0.02654	T	1	.	4.6969	0.12808	0.0:0.4166:0.0:0.5834	.	322	B7Z6K7	ZN814_HUMAN	K	322	ENSP00000410545:R322K	ENSP00000410545:R322K	R	-	2	0	ZNF814	63077605	0.000000	0.05858	0.024000	0.17045	0.009000	0.06853	-1.883000	0.01623	0.331000	0.23511	-1.381000	0.01174	AGA	C|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZC4H2	55906	hgsc.bcm.edu	37	X	64141833	64141833	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chrX:64141833C>T	ENST00000374839.3	-	2	195	c.89G>A	c.(88-90)cGt>cAt	p.R30H	ZC4H2_ENST00000545618.1_Missense_Mutation_p.R25H|ZC4H2_ENST00000447788.2_Missense_Mutation_p.R30H|ZC4H2_ENST00000488608.1_5'UTR|ZC4H2_ENST00000337990.2_Missense_Mutation_p.R7H	NM_018684.3	NP_061154.1	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing	30					nervous system development (GO:0007399)|neuromuscular junction development (GO:0007528)|spinal cord motor neuron differentiation (GO:0021522)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	metal ion binding (GO:0046872)			endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						AGCCTTCAAACGAGCCTTGAT	0.488													C|||	1	0.000264901	0.0	0.0	3775	,	,		14356	0.001		0.0	False		,,,				2504	0.0				p.R30H		Atlas-SNP	.											.	ZC4H2	64	.	0			c.G89A						PASS	.						129.0	94.0	106.0					X																	64141833		2203	4300	6503	SO:0001583	missense	55906	exon2			TTCAAACGAGCCT	AF270491	CCDS14380.1, CCDS55431.1, CCDS55432.1	Xq11.1	2013-07-23	2008-10-01	2008-10-01	ENSG00000126970	ENSG00000126970		"""Zinc fingers"""	24931	protein-coding gene	gene with protein product		300897	"""KIAA1166"", ""Wieacker-Wolff syndrome"""	KIAA1166, WWS		10574461, 12097419, 23623388	Standard	NM_018684		Approved	HCA127	uc004dvu.3	Q9NQZ6	OTTHUMG00000021712	ENST00000374839.3:c.89G>A	X.37:g.64141833C>T	ENSP00000363972:p.Arg30His	Somatic	382	0	0		WXS	Illumina HiSeq	Phase_I	438	76	0.173516	NM_018684	B2RDC2|B3KVZ5|B4DED0|E7EM74|G3V1L3|Q53H73|Q5JTF9|Q9H9C3|Q9H9H7|Q9ULQ4	Missense_Mutation	SNP	ENST00000374839.3	37	CCDS14380.1	.	.	.	.	.	.	.	.	.	.	C	32	5.151734	0.94645	.	.	ENSG00000126970	ENST00000447788;ENST00000545618;ENST00000374839;ENST00000337990	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.76884	0.4050	L	0.61218	1.895	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.85130	0.997;0.856	T	0.79047	-0.1963	9	0.72032	D	0.01	.	15.669	0.77258	0.0:1.0:0.0:0.0	.	30;30	B4DED0;Q9NQZ6	.;ZC4H2_HUMAN	H	30;25;30;7	.	ENSP00000338650:R7H	R	-	2	0	ZC4H2	64058558	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.555000	0.82223	2.384000	0.81235	0.529000	0.55759	CGT	.	.	none		0.488	ZC4H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056958.1	NM_018684	
RGPD3	653489	hgsc.bcm.edu	37	2	107049681	107049681	+	Missense_Mutation	SNP	T	T	C	rs369310197		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr2:107049681T>C	ENST00000409886.3	-	16	2353	c.2266A>G	c.(2266-2268)Aac>Gac	p.N756D	RGPD3_ENST00000304514.7_Missense_Mutation_p.N756D	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	756					protein targeting to Golgi (GO:0000042)			p.N756D(6)		breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TCACTATAGTTTTCGAGTTCC	0.373																																					p.N756D		Atlas-SNP	.											RGPD3_ENST00000304514,NS,carcinoma,0,6	RGPD3	316	6	6	Substitution - Missense(6)	endometrium(6)	c.A2266G						scavenged	.						164.0	133.0	142.0					2																	107049681		692	1590	2282	SO:0001583	missense	653489	exon16			TATAGTTTTCGAG		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2266A>G	2.37:g.107049681T>C	ENSP00000386588:p.Asn756Asp	Somatic	693	5	0.00721501		WXS	Illumina HiSeq	Phase_I	683	9	0.0131772	NM_001144013	B8ZZM4	Missense_Mutation	SNP	ENST00000409886.3	37	CCDS46379.1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.481585	0.00163	.	.	ENSG00000153165	ENST00000409886;ENST00000452099;ENST00000304514	T;T	0.23754	1.89;1.89	2.34	2.34	0.29019	.	.	.	.	.	T	0.07638	0.0192	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37979	-0.9682	9	0.02654	T	1	-2.2547	7.1228	0.25454	0.0:0.8499:0.0:0.1501	.	756	A6NKT7	RGPD3_HUMAN	D	756;514;756	ENSP00000386588:N756D;ENSP00000303659:N756D	ENSP00000303659:N756D	N	-	1	0	RGPD3	106416113	0.974000	0.33945	0.242000	0.24170	0.003000	0.03518	4.107000	0.57811	0.325000	0.23359	-1.206000	0.01644	AAC	.	.	weak		0.373	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
USP9X	8239	hgsc.bcm.edu	37	X	41075218	41075218	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chrX:41075218T>G	ENST00000324545.8	+	35	6031	c.5398T>G	c.(5398-5400)Ttt>Gtt	p.F1800V	USP9X_ENST00000378308.2_Missense_Mutation_p.F1800V	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	1800	USP.				axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						ACTAAAGCGATTTGACTATGA	0.383																																					p.F1800V	Ovarian(172;1807 2695 35459 49286)	Atlas-SNP	.											.	USP9X	385	.	0			c.T5398G						PASS	.						82.0	78.0	79.0					X																	41075218		2067	4244	6311	SO:0001583	missense	8239	exon35			AAGCGATTTGACT	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.5398T>G	X.37:g.41075218T>G	ENSP00000316357:p.Phe1800Val	Somatic	357	0	0		WXS	Illumina HiSeq	Phase_I	289	62	0.214533	NM_001039591	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	ENST00000324545.8	37	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.129933	0.77549	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.41400	1.0;1.0	5.67	5.67	0.87782	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.71609	0.3360	M	0.92923	3.36	0.80722	D	1	D;D	0.69078	0.989;0.997	P;D	0.69479	0.818;0.964	T	0.79804	-0.1649	10	0.87932	D	0	.	14.935	0.70948	0.0:0.0:0.0:1.0	.	1800;1800	Q93008-1;Q93008	.;USP9X_HUMAN	V	1800	ENSP00000367558:F1800V;ENSP00000316357:F1800V	ENSP00000316357:F1800V	F	+	1	0	USP9X	40960162	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.651000	0.83577	1.909000	0.55274	0.486000	0.48141	TTT	.	.	none		0.383	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
POF1B	79983	hgsc.bcm.edu	37	X	84586065	84586065	+	Silent	SNP	G	G	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chrX:84586065G>T	ENST00000262753.4	-	7	889	c.744C>A	c.(742-744)ggC>ggA	p.G248G	POF1B_ENST00000373145.3_Silent_p.G248G	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	248						tight junction (GO:0005923)				central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						ATTTTTCAGGGCCATCATCCT	0.353																																					p.G248G		Atlas-SNP	.											.	POF1B	77	.	0			c.C744A						PASS	.						92.0	77.0	82.0					X																	84586065		2203	4300	6503	SO:0001819	synonymous_variant	79983	exon7			TTCAGGGCCATCA	BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.744C>A	X.37:g.84586065G>T		Somatic	287	0	0		WXS	Illumina HiSeq	Phase_I	357	58	0.162465	NM_024921	A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Silent	SNP	ENST00000262753.4	37	CCDS14452.1																																																																																			.	.	none		0.353	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057391.2	NM_024921	
FLG	2312	hgsc.bcm.edu	37	1	152284823	152284823	+	Missense_Mutation	SNP	A	A	G	rs74129459	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:152284823A>G	ENST00000368799.1	-	3	2574	c.2539T>C	c.(2539-2541)Tca>Cca	p.S847P	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	847	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTCTGCTTGACCCCGGGTGT	0.582									Ichthyosis																												p.S847P		Atlas-SNP	.											FLG,NS,carcinoma,0,1	FLG	900	1	0			c.T2539C						scavenged	.						322.0	322.0	322.0					1																	152284823		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TGCTTGACCCCGG	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2539T>C	1.37:g.152284823A>G	ENSP00000357789:p.Ser847Pro	Somatic	135	4	0.0296296		WXS	Illumina HiSeq	Phase_I	170	5	0.0294118	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	7.279	0.608792	0.14066	.	.	ENSG00000143631	ENST00000368799	T	0.03772	3.81	3.63	2.44	0.29823	.	.	.	.	.	T	0.05731	0.0150	L	0.58428	1.81	0.09310	N	1	D	0.76494	0.999	D	0.68765	0.96	T	0.31530	-0.9940	9	0.34782	T	0.22	.	6.6957	0.23197	0.7566:0.2434:0.0:0.0	.	847	P20930	FILA_HUMAN	P	847	ENSP00000357789:S847P	ENSP00000357789:S847P	S	-	1	0	FLG	150551447	0.001000	0.12720	0.003000	0.11579	0.020000	0.10135	0.252000	0.18278	0.443000	0.26582	0.392000	0.25879	TCA	A|0.984;T|0.016	.	alt		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
MUC21	394263	hgsc.bcm.edu	37	6	30954414	30954414	+	Missense_Mutation	SNP	C	C	G	rs138015704	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr6:30954414C>G	ENST00000376296.3	+	2	703	c.462C>G	c.(460-462)gaC>gaG	p.D154E	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	154	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D154E(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAACTCTGACTCCAGCACAA	0.612																																					p.D154E		Atlas-SNP	.											MUC21,NS,carcinoma,0,2	MUC21	98	2	1	Substitution - Missense(1)	prostate(1)	c.C462G						scavenged	.						150.0	141.0	144.0					6																	30954414		2203	4300	6503	SO:0001583	missense	394263	exon2			CTCTGACTCCAGC	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.462C>G	6.37:g.30954414C>G	ENSP00000365473:p.Asp154Glu	Somatic	28	1	0.0357143		WXS	Illumina HiSeq	Phase_I	28	5	0.178571	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.859428	0.00552	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.01572	4.76	3.52	-7.04	0.01578	.	.	.	.	.	T	0.00178	0.0005	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35276	-0.9795	8	.	.	.	2.0437	7.1844	0.25791	0.108:0.4767:0.3341:0.0812	.	154	Q5SSG8	MUC21_HUMAN	E	154	ENSP00000365473:D154E	.	D	+	3	2	MUC21	31062393	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.637000	0.00407	-4.956000	0.00026	-2.421000	0.00218	GAC	C|0.993;G|0.007	0.007	strong		0.612	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
APEH	327	hgsc.bcm.edu	37	3	49723296	49723296	+	IGR	SNP	G	G	A	rs2087733	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:49723296G>A	ENST00000296456.5	+	0	3220				MST1_ENST00000383728.3_3'UTR|MST1_ENST00000494828.2_5'Flank|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000449682.2_Missense_Mutation_p.P416L	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.P402L(4)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GACTCACTGCGGCTTGTGCGG	0.677													G|||	3	0.000599042	0.0	0.0	5008	,	,		23747	0.0		0.003	False		,,,				2504	0.0				p.P416L		Atlas-SNP	.											MST1,trunk,malignant_melanoma,0,3	MST1	84	3	4	Substitution - Missense(4)	NS(2)|lung(1)|skin(1)	c.C1247T						scavenged	.						67.0	64.0	65.0					3																	49723296		2197	4282	6479	SO:0001628	intergenic_variant	4485	exon10			CACTGCGGCTTGT	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723296G>A		Somatic	61	1	0.0163934		WXS	Illumina HiSeq	Phase_I	78	3	0.0384615	NM_020998	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117796	0.37339	.	.	ENSG00000173531	ENST00000449682	T	0.66280	-0.2	5.1	5.1	0.69264	.	0.000000	0.42053	D	0.000772	T	0.52980	0.1768	L	0.33137	0.985	0.80722	D	1	B	0.18013	0.025	B	0.17979	0.02	T	0.48969	-0.8987	10	0.38643	T	0.18	.	16.2918	0.82756	0.0:0.0:1.0:0.0	rs2087733	416	G3XAK1	.	L	416	ENSP00000414287:P416L	ENSP00000414287:P416L	P	-	2	0	MST1	49698300	1.000000	0.71417	0.996000	0.52242	0.047000	0.14425	8.980000	0.93460	2.373000	0.80994	0.561000	0.74099	CCG	G|0.375;A|0.625	0.625	strong		0.677	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
PCDHA2	56146	hgsc.bcm.edu	37	5	140174824	140174824	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr5:140174824G>A	ENST00000526136.1	+	1	275	c.275G>A	c.(274-276)cGg>cAg	p.R92Q	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.R92Q|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Missense_Mutation_p.R92Q	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	92	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGATCGACCGGGAGGAGCTG	0.587																																					p.R92Q		Atlas-SNP	.											.	PCDHA2	404	.	0			c.G275A						PASS	.						103.0	119.0	114.0					5																	140174824		2203	4300	6503	SO:0001583	missense	56146	exon1			TCGACCGGGAGGA	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.275G>A	5.37:g.140174824G>A	ENSP00000431748:p.Arg92Gln	Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	86	13	0.151163	NM_031495	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	g	26.6	4.752294	0.89753	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.53206	0.63;0.63;0.63	3.98	3.02	0.34903	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	0.000000	0.38381	U	0.001708	T	0.81716	0.4881	H	0.99740	4.74	0.32371	N	0.555858	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.89310	0.3632	10	0.87932	D	0	.	14.2561	0.66053	0.0:0.1501:0.8499:0.0	.	92;92;92	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	Q	92	ENSP00000430584:R92Q;ENSP00000367372:R92Q;ENSP00000431748:R92Q	ENSP00000367372:R92Q	R	+	2	0	PCDHA2	140155008	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	7.604000	0.82830	2.234000	0.73211	0.644000	0.83932	CGG	.	.	none		0.587	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
PCDHA10	56139	hgsc.bcm.edu	37	5	140236219	140236219	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr5:140236219C>T	ENST00000307360.5	+	1	586	c.586C>T	c.(586-588)Cgg>Tgg	p.R196W	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000506939.2_Missense_Mutation_p.R196W	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	196	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTTGTTCTGCGGAAGCTGCT	0.393																																					p.R196W		Atlas-SNP	.											.	PCDHA10	358	.	0			c.C586T						PASS	.						88.0	90.0	90.0					5																	140236219		2196	4267	6463	SO:0001583	missense	56139	exon1			GTTCTGCGGAAGC	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.586C>T	5.37:g.140236219C>T	ENSP00000304234:p.Arg196Trp	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	171	26	0.152047	NM_031859	A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	ENST00000307360.5	37	CCDS54921.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.465536	0.26335	.	.	ENSG00000250120	ENST00000506939;ENST00000307360	T;T	0.21031	2.03;2.03	4.45	-3.91	0.04168	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.25938	0.0632	M	0.85197	2.74	0.09310	N	1	B;B;B	0.33919	0.432;0.137;0.111	B;B;B	0.31290	0.127;0.015;0.03	T	0.34825	-0.9813	9	0.72032	D	0.01	.	10.9471	0.47306	0.6677:0.1603:0.1719:0.0	.	196;196;196	Q9Y5I2-3;Q9Y5I2;Q9Y5I2-2	.;PCDAA_HUMAN;.	W	196	ENSP00000421030:R196W;ENSP00000304234:R196W	ENSP00000304234:R196W	R	+	1	2	PCDHA10	140216403	0.000000	0.05858	0.336000	0.25522	0.972000	0.66771	-1.579000	0.02123	-0.500000	0.06614	0.561000	0.74099	CGG	.	.	none		0.393	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
MUC4	4585	hgsc.bcm.edu	37	3	195507817	195507817	+	Missense_Mutation	SNP	A	A	G	rs200993341		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:195507817A>G	ENST00000463781.3	-	2	11093	c.10634T>C	c.(10633-10635)gTa>gCa	p.V3545A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V3545A|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAAG	0.602																																					p.V3545A		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	0			c.T10634C						scavenged	.						23.0	22.0	23.0					3																	195507817		682	1577	2259	SO:0001583	missense	4585	exon2			GTGGATACTGAGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10634T>C	3.37:g.195507817A>G	ENSP00000417498:p.Val3545Ala	Somatic	320	13	0.040625		WXS	Illumina HiSeq	Phase_I	416	16	0.0384615	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	1.383	-0.582833	0.03827	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.49432	0.98;0.78	0.743	-1.49	0.08718	.	0.435754	0.11199	U	0.589055	T	0.16041	0.0386	N	0.02539	-0.55	0.09310	N	1	B	0.26512	0.151	B	0.14023	0.01	T	0.11867	-1.0570	9	.	.	.	.	4.1685	0.10318	0.735:0.0:0.265:0.0	.	3417	E7ESK3	.	A	3545	ENSP00000417498:V3545A;ENSP00000420243:V3545A	.	V	-	2	0	MUC4	196992596	0.000000	0.05858	0.007000	0.13788	0.007000	0.05969	-2.247000	0.01190	-1.995000	0.00971	-2.001000	0.00444	GTA	G|0.994;T|0.006	0.994	weak		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PRB1	5542	hgsc.bcm.edu	37	12	11506837	11506837	+	Missense_Mutation	SNP	T	T	C	rs200080540		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr12:11506837T>C	ENST00000500254.2	-	3	237	c.200A>G	c.(199-201)aAa>aGa	p.K67R	PRB1_ENST00000546254.1_Missense_Mutation_p.K67R|PRB1_ENST00000545626.1_Missense_Mutation_p.K67R	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1	0	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-[PAQ]-Q-[GE]-[GD]- [NKS]-[KSQRN]-[PRQS]-[QS] [GPS]-[PQAR]- [PSR].					extracellular region (GO:0005576)		p.K67R(5)		NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			ACCTTGAGGTTTGTTGCCTCC	0.607																																					p.K67R		Atlas-SNP	.											PRB1,NS,carcinoma,-1,6	PRB1	33	6	5	Substitution - Missense(5)	kidney(4)|skin(1)	c.A200G						scavenged	.						117.0	147.0	137.0					12																	11506837		2154	4254	6408	SO:0001583	missense	5542	exon3			TGAGGTTTGTTGC		CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.200A>G	12.37:g.11506837T>C	ENSP00000420826:p.Lys67Arg	Somatic	287	4	0.0139373		WXS	Illumina HiSeq	Phase_I	347	7	0.0201729	NM_199353	Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Missense_Mutation	SNP	ENST00000500254.2	37	CCDS8642.1	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.147353	0.00328	.	.	ENSG00000251655	ENST00000545626;ENST00000500254;ENST00000546254	T;T;T	0.04194	3.68;3.68;3.68	1.44	-2.87	0.05700	.	.	.	.	.	T	0.03220	0.0094	L	0.45228	1.405	0.09310	N	1	B;B;B	0.31174	0.311;0.311;0.311	B;B;B	0.24394	0.036;0.053;0.053	T	0.46693	-0.9173	9	0.05959	T	0.93	.	7.8249	0.29309	0.0:0.0:0.6974:0.3026	.	74;67;67	Q86YA1;G3V1R1;G3V1M9	.;.;.	R	67	ENSP00000444249:K67R;ENSP00000420826:K67R;ENSP00000442127:K67R	ENSP00000420826:K67R	K	-	2	0	PRB1	11398104	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.162000	0.10012	-1.259000	0.02468	-0.662000	0.03851	AAA	.	.	weak		0.607	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1	NM_005039	
PXDNL	137902	hgsc.bcm.edu	37	8	52252217	52252217	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr8:52252217T>A	ENST00000356297.4	-	21	4213	c.4113A>T	c.(4111-4113)gaA>gaT	p.E1371D	PXDNL_ENST00000543296.1_Intron	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1371					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TTTCCTGAATTTCCGCTGCAA	0.373																																					p.E1371D		Atlas-SNP	.											.	PXDNL	414	.	0			c.A4113T						PASS	.						139.0	136.0	137.0					8																	52252217		1879	4103	5982	SO:0001583	missense	137902	exon21			CTGAATTTCCGCT		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.4113A>T	8.37:g.52252217T>A	ENSP00000348645:p.Glu1371Asp	Somatic	150	0	0		WXS	Illumina HiSeq	Phase_I	138	19	0.137681	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.130|8.130	0.782774|0.782774	0.16189|0.16189	.|.	.|.	ENSG00000147485|ENSG00000147485	ENST00000356297|ENST00000522933	T|.	0.64803|.	-0.12|.	5.0|5.0	2.54|2.54	0.30619|0.30619	.|.	.|.	.|.	.|.	.|.	T|T	0.35068|0.35068	0.0919|0.0919	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	B|.	0.06786|.	0.001|.	B|.	0.08055|.	0.003|.	T|T	0.05517|0.05517	-1.0880|-1.0880	9|5	0.45353|.	T|.	0.12|.	.|.	4.3388|4.3388	0.11099|0.11099	0.174:0.0969:0.0:0.7291|0.174:0.0969:0.0:0.7291	.|.	1371|.	A1KZ92|.	PXDNL_HUMAN|.	D|I	1371|445	ENSP00000348645:E1371D|.	ENSP00000348645:E1371D|.	E|K	-|-	3|2	2|0	PXDNL|PXDNL	52414770|52414770	0.998000|0.998000	0.40836|0.40836	0.935000|0.935000	0.37517|0.37517	0.044000|0.044000	0.14063|0.14063	1.971000|1.971000	0.40530|0.40530	0.224000|0.224000	0.20940|0.20940	0.482000|0.482000	0.46254|0.46254	GAA|AAA	.	.	none		0.373	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
GABRG3	2567	hgsc.bcm.edu	37	15	27772692	27772692	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr15:27772692G>A	ENST00000333743.6	+	8	1233	c.979G>A	c.(979-981)Gtc>Atc	p.V327I	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	327					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTTCCTGTTTGTCTTCGCCGC	0.547																																					p.V327I	NSCLC(114;800 1656 7410 37729 45293)	Atlas-SNP	.											.	GABRG3	115	.	0			c.G979A						PASS	.						130.0	119.0	123.0					15																	27772692		2165	4275	6440	SO:0001583	missense	2567	exon8			CTGTTTGTCTTCG		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.979G>A	15.37:g.27772692G>A	ENSP00000331912:p.Val327Ile	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	74	8	0.108108	NM_033223	G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738335	0.89573	.	.	ENSG00000182256	ENST00000333743	D	0.88354	-2.37	5.48	4.57	0.56435	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.90431	0.7004	L	0.39020	1.185	0.80722	D	1	D	0.55385	0.971	D	0.63033	0.91	D	0.91243	0.5023	10	0.87932	D	0	.	13.4198	0.60989	0.0754:0.0:0.9246:0.0	.	327	Q99928	GBRG3_HUMAN	I	327	ENSP00000331912:V327I	ENSP00000331912:V327I	V	+	1	0	GABRG3	25446287	1.000000	0.71417	0.977000	0.42913	0.838000	0.47535	9.402000	0.97298	1.312000	0.45043	0.563000	0.77884	GTC	.	.	none		0.547	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
THBD	7056	hgsc.bcm.edu	37	20	23028813	23028813	+	Silent	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr20:23028813G>A	ENST00000377103.2	-	1	1565	c.1329C>T	c.(1327-1329)gaC>gaT	p.D443D		NM_000361.2	NP_000352.1	P07204	TRBM_HUMAN	thrombomodulin	443	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|female pregnancy (GO:0007565)|leukocyte migration (GO:0050900)|negative regulation of blood coagulation (GO:0030195)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|response to cAMP (GO:0051591)|response to lipopolysaccharide (GO:0032496)|response to X-ray (GO:0010165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|large_intestine(3)|ovary(1)|skin(1)	7	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)				Drotrecogin alfa(DB00055)|Ibuprofen(DB01050)	TTTCGCACTCGTCGATGTCCG	0.637																																					p.D443D		Atlas-SNP	.											.	THBD	26	.	0			c.C1329T						PASS	.						51.0	47.0	49.0					20																	23028813		2203	4300	6503	SO:0001819	synonymous_variant	7056	exon1			GCACTCGTCGATG		CCDS13148.1	20p11.21	2014-09-17			ENSG00000178726	ENSG00000178726		"""CD molecules"""	11784	protein-coding gene	gene with protein product		188040					Standard	NM_000361		Approved	CD141	uc002wss.3	P07204	OTTHUMG00000032053	ENST00000377103.2:c.1329C>T	20.37:g.23028813G>A		Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	72	9	0.125	NM_000361	Q8IV29|Q9UC32	Silent	SNP	ENST00000377103.2	37	CCDS13148.1																																																																																			.	.	none		0.637	THBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078307.2		
PLEKHH2	130271	hgsc.bcm.edu	37	2	43919728	43919728	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr2:43919728T>C	ENST00000282406.4	+	4	372	c.262T>C	c.(262-264)Tgt>Cgt	p.C88R		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	88					negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ATATAATAAGTGTCAAGATCT	0.313																																					p.C88R		Atlas-SNP	.											.	PLEKHH2	156	.	0			c.T262C						PASS	.						82.0	88.0	86.0					2																	43919728		2203	4300	6503	SO:0001583	missense	130271	exon4			AATAAGTGTCAAG	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.262T>C	2.37:g.43919728T>C	ENSP00000282406:p.Cys88Arg	Somatic	180	0	0		WXS	Illumina HiSeq	Phase_I	217	41	0.18894	NM_172069	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	37	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	T	7.732	0.699411	0.15106	.	.	ENSG00000152527	ENST00000282406	T	0.28895	1.59	5.48	5.48	0.80851	.	0.053195	0.85682	D	0.000000	T	0.38081	0.1027	L	0.48642	1.525	0.80722	D	1	B;P	0.48640	0.437;0.913	B;P	0.53593	0.201;0.73	T	0.08046	-1.0741	10	0.31617	T	0.26	-15.4001	10.7541	0.46225	0.1418:0.0:0.0:0.8582	.	88;88	Q8IVE3;Q8IVE3-3	PKHH2_HUMAN;.	R	88	ENSP00000282406:C88R	ENSP00000282406:C88R	C	+	1	0	PLEKHH2	43773232	1.000000	0.71417	1.000000	0.80357	0.502000	0.33828	4.392000	0.59659	2.077000	0.62373	0.460000	0.39030	TGT	.	.	none		0.313	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
ERICH3	127254	hgsc.bcm.edu	37	1	75038599	75038599	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:75038599T>C	ENST00000326665.5	-	14	3013	c.2795A>G	c.(2794-2796)gAg>gGg	p.E932G	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		932	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						ACCCTCAGCCTCTCCCTCCTC	0.542																																					p.E932G		Atlas-SNP	.											.	C1orf173	380	.	0			c.A2795G						PASS	.						133.0	136.0	135.0					1																	75038599		2203	4300	6503	SO:0001583	missense	127254	exon14			TCAGCCTCTCCCT																												ENST00000326665.5:c.2795A>G	1.37:g.75038599T>C	ENSP00000322609:p.Glu932Gly	Somatic	84	0	0		WXS	Illumina HiSeq	Phase_I	79	16	0.202532	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	T	15.28	2.786245	0.49997	.	.	ENSG00000178965	ENST00000326665	T	0.18174	2.23	4.73	0.749	0.18381	.	.	.	.	.	T	0.03695	0.0105	L	0.36672	1.1	0.09310	N	1	B	0.21225	0.053	B	0.21917	0.037	T	0.42241	-0.9463	9	0.44086	T	0.13	-6.2511	2.33	0.04233	0.1433:0.085:0.2952:0.4765	.	932	Q5RHP9	CA173_HUMAN	G	932	ENSP00000322609:E932G	ENSP00000322609:E932G	E	-	2	0	C1orf173	74811187	0.000000	0.05858	0.063000	0.19743	0.011000	0.07611	0.421000	0.21280	0.174000	0.19809	-0.460000	0.05396	GAG	.	.	none		0.542	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
OR2T4	127074	hgsc.bcm.edu	37	1	248525640	248525640	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:248525640T>C	ENST00000366475.1	+	1	758	c.758T>C	c.(757-759)aTc>aCc	p.I253T		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TATTTACTCATCCTCCTCACC	0.517																																					p.I253T		Atlas-SNP	.											OR2T4,brain,glioma,+1,1	OR2T4	126	1	0			c.T758C						PASS	.						135.0	130.0	132.0					1																	248525640		2203	4300	6503	SO:0001583	missense	127074	exon1			TACTCATCCTCCT	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.758T>C	1.37:g.248525640T>C	ENSP00000355431:p.Ile253Thr	Somatic	13	0	0		WXS	Illumina HiSeq	Phase_I	47	24	0.510638	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	T	10.31	1.315398	0.23908	.	.	ENSG00000196944	ENST00000366475	T	0.00402	7.56	3.09	1.94	0.25998	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000219	T	0.01523	0.0049	H	0.95151	3.63	0.33277	D	0.561816	D	0.89917	1.0	D	0.85130	0.997	T	0.11299	-1.0593	10	0.87932	D	0	.	7.6506	0.28346	0.0:0.1075:0.0:0.8925	.	253	Q8NH00	OR2T4_HUMAN	T	253	ENSP00000355431:I253T	ENSP00000355431:I253T	I	+	2	0	OR2T4	246592263	1.000000	0.71417	0.061000	0.19648	0.014000	0.08584	4.666000	0.61554	0.295000	0.22570	-0.361000	0.07541	ATC	.	.	none		0.517	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
FAM171B	165215	hgsc.bcm.edu	37	2	187559047	187559047	+	Silent	SNP	G	G	A	rs73979342|rs144403657|rs71017336	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr2:187559047G>A	ENST00000304698.5	+	1	350	c.147G>A	c.(145-147)caG>caA	p.Q49Q	AC017101.10_ENST00000453665.1_RNA	NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	49	Gln-rich.					integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						agcagcagcagcaacaacaac	0.632																																					p.Q49Q		Atlas-SNP	.											FAM171B,NS,carcinoma,0,1	FAM171B	146	1	0			c.G147A						PASS	.						23.0	26.0	25.0					2																	187559047		2202	4300	6502	SO:0001819	synonymous_variant	165215	exon1			GCAGCAGCAACAA	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.147G>A	2.37:g.187559047G>A		Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	48	14	0.291667	NM_177454	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Silent	SNP	ENST00000304698.5	37	CCDS33347.1																																																																																			G|0.500;A|0.500	0.500	weak		0.632	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
MUC4	4585	hgsc.bcm.edu	37	3	195515304	195515304	+	Silent	SNP	T	T	A	rs202019266		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:195515304T>A	ENST00000463781.3	-	2	3606	c.3147A>T	c.(3145-3147)gcA>gcT	p.A1049A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.A1049A|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	479					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A1049A(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CACCTGTGGATGCTGAGGAAA	0.562																																					p.A1049A		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	2	Substitution - coding silent(2)	kidney(1)|endometrium(1)	c.A3147T						scavenged	.																																			SO:0001819	synonymous_variant	4585	exon2			TGTGGATGCTGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3147A>T	3.37:g.195515304T>A		Somatic	88	1	0.0113636		WXS	Illumina HiSeq	Phase_I	94	6	0.0638298	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	weak		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SLC16A12	387700	hgsc.bcm.edu	37	10	91195994	91195994	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr10:91195994G>A	ENST00000341233.4	-	7	1411	c.1021C>T	c.(1021-1023)Caa>Taa	p.Q341*	SLC16A12_ENST00000371790.4_Nonsense_Mutation_p.Q371*	NM_213606.3	NP_998771.3	Q6ZSM3	MOT12_HUMAN	solute carrier family 16, member 12	341						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|skin(1)|stomach(1)	14						GGGAGACTTTGAAGCATTGGG	0.478																																					p.Q371X		Atlas-SNP	.											.	SLC16A12	40	.	0			c.C1111T						PASS	.						134.0	112.0	119.0					10																	91195994		2203	4300	6503	SO:0001587	stop_gained	387700	exon7			GACTTTGAAGCAT		CCDS7404.1, CCDS7404.2	10q23.32	2013-07-18	2013-07-18		ENSG00000152779	ENSG00000152779		"""Solute carriers"""	23094	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 12"""	611910	"""solute carrier family 16 (monocarboxylic acid transporters), member 12"", ""solute carrier family 16, member 12 (monocarboxylic acid transporter 12)"""				Standard	NM_213606		Approved	MCT12	uc001kgm.3	Q6ZSM3	OTTHUMG00000018714	ENST00000341233.4:c.1021C>T	10.37:g.91195994G>A	ENSP00000343022:p.Gln341*	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	69	12	0.173913	NM_213606	Q5M9M9|Q5T7J2|Q6ZV76	Nonsense_Mutation	SNP	ENST00000341233.4	37		.	.	.	.	.	.	.	.	.	.	G	39	7.589363	0.98374	.	.	ENSG00000152779	ENST00000341233;ENST00000371790	.	.	.	5.91	5.91	0.95273	.	0.434509	0.27362	N	0.019717	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	19.2867	0.94077	0.0:0.0:1.0:0.0	.	.	.	.	X	341;371	.	ENSP00000343022:Q341X	Q	-	1	0	SLC16A12	91185974	0.979000	0.34478	0.987000	0.45799	0.729000	0.41735	3.908000	0.56355	2.793000	0.96121	0.655000	0.94253	CAA	.	.	none		0.478	SLC16A12-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_213606	
PAK2	5062	hgsc.bcm.edu	37	3	196529982	196529982	+	Missense_Mutation	SNP	A	A	G	rs78043821	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr3:196529982A>G	ENST00000327134.3	+	4	705	c.383A>G	c.(382-384)aAg>aGg	p.K128R		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	128	Autoregulatory region. {ECO:0000250}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		GATGTCCTAAAGTTCTACGAC	0.463																																					p.K128R		Atlas-SNP	.											PAK2_ENST00000327134,NS,lymphoid_neoplasm,0,2	PAK2	113	2	0			c.A383G						PASS	.						107.0	95.0	99.0					3																	196529982		2203	4300	6503	SO:0001583	missense	5062	exon4			TCCTAAAGTTCTA	U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.383A>G	3.37:g.196529982A>G	ENSP00000314067:p.Lys128Arg	Somatic	56	0	0		WXS	Illumina HiSeq	Phase_I	84	5	0.0595238	NM_002577	Q13154|Q6ISC3	Missense_Mutation	SNP	ENST00000327134.3	37	CCDS3321.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.176399	0.78564	.	.	ENSG00000180370	ENST00000327134	D	0.86230	-2.09	5.27	5.27	0.74061	PAK-box/P21-Rho-binding (1);	0.000000	0.85682	D	0.000000	D	0.86990	0.6066	L	0.55743	1.74	0.80722	D	1	P	0.37015	0.578	B	0.43155	0.41	D	0.86926	0.2070	10	0.48119	T	0.1	.	14.3609	0.66771	1.0:0.0:0.0:0.0	.	128	Q13177	PAK2_HUMAN	R	128	ENSP00000314067:K128R	ENSP00000314067:K128R	K	+	2	0	PAK2	198014379	1.000000	0.71417	0.990000	0.47175	0.859000	0.49053	6.986000	0.76200	2.002000	0.58637	0.460000	0.39030	AAG	A|0.915;G|0.084	0.084	strong		0.463	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
LY9	4063	hgsc.bcm.edu	37	1	160794028	160794028	+	Missense_Mutation	SNP	C	C	T	rs374075565		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr1:160794028C>T	ENST00000263285.6	+	9	1918	c.1888C>T	c.(1888-1890)Cgg>Tgg	p.R630W	LY9_ENST00000368037.5_Missense_Mutation_p.R616W|LY9_ENST00000392203.4_Missense_Mutation_p.R540W|LY9_ENST00000341032.4_Missense_Mutation_p.R496W|LY9_ENST00000368040.1_Intron|LY9_ENST00000368041.2_Missense_Mutation_p.R500W			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	630					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CTGCTCCATACGGAAACCTCA	0.488																																					p.R630W		Atlas-SNP	.											.	LY9	115	.	0			c.C1888T						PASS	.	C	TRP/ARG	0,4406		0,0,2203	168.0	161.0	163.0		1888	1.7	0.0	1		163	1,8599	1.2+/-3.3	0,1,4299	no	missense	LY9	NM_002348.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	630/656	160794028	1,13005	2203	4300	6503	SO:0001583	missense	4063	exon9			TCCATACGGAAAC	L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.1888C>T	1.37:g.160794028C>T	ENSP00000263285:p.Arg630Trp	Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	84	26	0.309524	NM_002348	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Missense_Mutation	SNP	ENST00000263285.6	37	CCDS30916.1	.	.	.	.	.	.	.	.	.	.	C	8.482	0.859951	0.17178	0.0	1.16E-4	ENSG00000122224	ENST00000368041;ENST00000341032;ENST00000263285;ENST00000392203;ENST00000368037;ENST00000368036	T;T	0.35973	1.34;1.28	3.57	1.66	0.24008	.	1.958810	0.03098	N	0.160758	T	0.13072	0.0317	N	0.08118	0	0.09310	N	1	B;D;D	0.65815	0.0;0.995;0.991	B;P;B	0.50708	0.0;0.648;0.446	T	0.15350	-1.0440	10	0.87932	D	0	-6.4141	5.0343	0.14426	0.0:0.6336:0.2444:0.122	.	496;616;630	E7EME5;Q9HBG7-2;Q9HBG7	.;.;LY9_HUMAN	W	630;496;630;500;576;398	ENSP00000342921:R496W;ENSP00000263285:R630W	ENSP00000263285:R630W	R	+	1	2	LY9	159060652	0.013000	0.17824	0.011000	0.14972	0.006000	0.05464	0.283000	0.18846	0.467000	0.27218	-0.214000	0.12660	CGG	.	.	none		0.488	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060457.3	NM_002348	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29699033	29699033	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr19:29699033T>C	ENST00000304863.4	-	2	669	c.247A>G	c.(247-249)Atc>Gtc	p.I83V		NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	83					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)	p.I83V(4)		endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			GGCACCTTGATGTCTGTGTGG	0.423																																					p.I83V		Atlas-SNP	.											UQCRFS1,NS,carcinoma,0,4	UQCRFS1	23	4	4	Substitution - Missense(4)	endometrium(2)|kidney(2)	c.A247G						scavenged	.						53.0	59.0	57.0					19																	29699033		2203	4299	6502	SO:0001583	missense	7386	exon2			CCTTGATGTCTGT	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.247A>G	19.37:g.29699033T>C	ENSP00000306397:p.Ile83Val	Somatic	35	2	0.0571429		WXS	Illumina HiSeq	Phase_I	51	12	0.235294	NM_006003	A8K519|Q6NVX5|Q9UPH2	Missense_Mutation	SNP	ENST00000304863.4	37	CCDS12415.1	.	.	.	.	.	.	.	.	.	.	t	0.014	-1.596233	0.00857	.	.	ENSG00000169021	ENST00000304863	T	0.42131	0.98	5.42	-4.98	0.03019	Ubiquinol cytochrome reductase, transmembrane domain (3);	0.618499	0.17385	N	0.176150	T	0.22360	0.0539	N	0.16862	0.45	0.20764	N	0.999851	B	0.02656	0.0	B	0.14578	0.011	T	0.23976	-1.0173	10	0.08837	T	0.75	.	17.2071	0.86921	0.0:0.6778:0.0:0.3222	.	83	P47985	UCRI_HUMAN	V	83	ENSP00000306397:I83V	ENSP00000306397:I83V	I	-	1	0	UQCRFS1	34390873	0.987000	0.35691	0.084000	0.20598	0.009000	0.06853	0.184000	0.16939	-1.243000	0.02519	-3.117000	0.00062	ATC	.	.	none		0.423	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
CHM	1121	hgsc.bcm.edu	37	X	85119697	85119697	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chrX:85119697C>A	ENST00000357749.2	-	15	1929	c.1900G>T	c.(1900-1902)Gct>Tct	p.A634S	CHM_ENST00000537751.1_Missense_Mutation_p.A486S|CHM_ENST00000467744.2_Intron	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	634					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				TCCGAGTTAGCCTCTGGTATG	0.443																																					p.A634S		Atlas-SNP	.											.	CHM	57	.	0			c.G1900T						PASS	.						79.0	66.0	71.0					X																	85119697		2203	4300	6503	SO:0001583	missense	1121	exon15			AGTTAGCCTCTGG	X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.1900G>T	X.37:g.85119697C>A	ENSP00000350386:p.Ala634Ser	Somatic	184	0	0		WXS	Illumina HiSeq	Phase_I	210	16	0.0761905	NM_000390	A1L4D2|O43732	Missense_Mutation	SNP	ENST00000357749.2	37	CCDS14454.1	.	.	.	.	.	.	.	.	.	.	C	2.408	-0.336006	0.05278	.	.	ENSG00000188419	ENST00000357749;ENST00000537751	D;D	0.88509	-2.39;-2.07	4.13	-3.43	0.04810	.	1.119830	0.06565	N	0.747470	T	0.80003	0.4544	L	0.42245	1.32	0.09310	N	1	B	0.18166	0.026	B	0.18263	0.021	T	0.60510	-0.7249	10	0.20519	T	0.43	0.7097	2.0276	0.03523	0.1101:0.2218:0.3252:0.3429	.	634	P24386	RAE1_HUMAN	S	634;486	ENSP00000350386:A634S;ENSP00000441728:A486S	ENSP00000350386:A634S	A	-	1	0	CHM	85006353	0.000000	0.05858	0.005000	0.12908	0.230000	0.25150	-0.820000	0.04457	-0.680000	0.05211	-0.366000	0.07423	GCT	.	.	none		0.443	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057396.3	NM_000390	
CNNM2	54805	hgsc.bcm.edu	37	10	104679785	104679785	+	Silent	SNP	A	A	G			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr10:104679785A>G	ENST00000369878.4	+	1	1736	c.1548A>G	c.(1546-1548)aaA>aaG	p.K516K	CNNM2_ENST00000433628.2_Silent_p.K516K|CNNM2_ENST00000369875.3_Silent_p.K516K	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	516					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CCATCACCAAATTTTATAACC	0.453																																					p.K516K		Atlas-SNP	.											.	CNNM2	119	.	0			c.A1548G						PASS	.						121.0	131.0	128.0					10																	104679785		2203	4300	6503	SO:0001819	synonymous_variant	54805	exon1			CACCAAATTTTAT	AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1548A>G	10.37:g.104679785A>G		Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	167	9	0.0538922	NM_199076	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Silent	SNP	ENST00000369878.4	37	CCDS44474.1																																																																																			.	.	none		0.453	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3	NM_017649	
HTR2A	3356	hgsc.bcm.edu	37	13	47409701	47409701	+	Silent	SNP	G	G	T	rs141413930		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr13:47409701G>T	ENST00000378688.4	-	3	818	c.687C>A	c.(685-687)ctC>ctA	p.L229L	HTR2A_ENST00000543956.1_Silent_p.L145L|HTR2A_ENST00000542664.1_Silent_p.L229L			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	229					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TATCATCGGCGAGTAAGCAAC	0.428																																					p.L229L		Atlas-SNP	.											.	HTR2A	98	.	0			c.C687A						PASS	.						76.0	74.0	75.0					13																	47409701		2203	4300	6503	SO:0001819	synonymous_variant	3356	exon4			ATCGGCGAGTAAG	X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.687C>A	13.37:g.47409701G>T		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	85	22	0.258824	NM_000621	B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Silent	SNP	ENST00000378688.4	37	CCDS9405.1																																																																																			G|0.999;A|0.001	.	alt		0.428	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	NM_000621	
MUC21	394263	hgsc.bcm.edu	37	6	30955179	30955179	+	Missense_Mutation	SNP	G	G	C	rs76175261	byFrequency	TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr6:30955179G>C	ENST00000376296.3	+	2	1468	c.1227G>C	c.(1225-1227)gaG>gaC	p.E409D	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	409	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E409D(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAACTCTGAGTCCAGCACAG	0.617																																					p.E409D		Atlas-SNP	.											MUC21,NS,carcinoma,0,1	MUC21	98	1	1	Substitution - Missense(1)	large_intestine(1)	c.G1227C						scavenged	.	G	ASP/GLU	24,4382	23.3+/-48.9	0,24,2179	145.0	141.0	142.0		1227	-7.8	0.0	6	dbSNP_131	142	34,8566	17.3+/-56.4	0,34,4266	yes	missense	MUC21	NM_001010909.2	45	0,58,6445	CC,CG,GG		0.3953,0.5447,0.4459	benign	409/567	30955179	58,12948	2203	4300	6503	SO:0001583	missense	394263	exon2			CTCTGAGTCCAGC	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1227G>C	6.37:g.30955179G>C	ENSP00000365473:p.Glu409Asp	Somatic	35	1	0.0285714		WXS	Illumina HiSeq	Phase_I	54	4	0.0740741	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	g	5.671	0.308357	0.10733	0.005447	0.003953	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.01787	4.64	3.89	-7.77	0.01227	.	.	.	.	.	T	0.00300	0.0009	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.48614	-0.9020	9	0.14656	T	0.56	1.7177	2.0947	0.03665	0.2245:0.4065:0.2353:0.1336	.	409	Q5SSG8	MUC21_HUMAN	D	259;409	ENSP00000365473:E409D	ENSP00000365473:E409D	E	+	3	2	MUC21	31063158	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.695000	0.00828	-2.045000	0.00910	-0.224000	0.12420	GAG	G|0.976;C|0.024	0.024	strong		0.617	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
CYP2D6	1565	hgsc.bcm.edu	37	22	42523558	42523558	+	Missense_Mutation	SNP	T	T	C	rs202102799		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr22:42523558T>C	ENST00000360608.5	-	7	1178	c.1064A>G	c.(1063-1065)tAc>tGc	p.Y355C	NDUFA6-AS1_ENST00000439129.1_RNA|NDUFA6-AS1_ENST00000417327.1_RNA|NDUFA6-AS1_ENST00000451451.1_RNA|NDUFA6-AS1_ENST00000434834.1_RNA|NDUFA6-AS1_ENST00000610250.1_RNA|NDUFA6-AS1_ENST00000600968.1_RNA|CYP2D6_ENST00000389970.3_Missense_Mutation_p.Y355C|NDUFA6-AS1_ENST00000536447.2_RNA|CYP2D6_ENST00000359033.4_Missense_Mutation_p.Y304C|NDUFA6-AS1_ENST00000595777.1_RNA|NDUFA6-AS1_ENST00000416037.2_RNA	NM_000106.5	NP_000097	P10635	CP2D6_HUMAN	cytochrome P450, family 2, subfamily D, polypeptide 6	355					alkaloid catabolic process (GO:0009822)|alkaloid metabolic process (GO:0009820)|coumarin metabolic process (GO:0009804)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|heterocycle metabolic process (GO:0046483)|isoquinoline alkaloid metabolic process (GO:0033076)|monoterpenoid metabolic process (GO:0016098)|negative regulation of binding (GO:0051100)|negative regulation of cellular organofluorine metabolic process (GO:0090350)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(4)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21					Abiraterone(DB05812)|Acebutolol(DB01193)|Acetaminophen(DB00316)|Ajmaline(DB01426)|Almotriptan(DB00918)|Alogliptin(DB06203)|Alprenolol(DB00866)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amoxapine(DB00543)|Amphetamine(DB00182)|Amprenavir(DB00701)|Amsacrine(DB00276)|Antipyrine(DB01435)|Aprindine(DB01429)|Arformoterol(DB01274)|Aripiprazole(DB01238)|Artemether(DB06697)|Asenapine(DB06216)|Astemizole(DB00637)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzatropine(DB00245)|Benzyl alcohol(DB06770)|Bepridil(DB01244)|Betaxolol(DB00195)|Bicalutamide(DB01128)|Biperiden(DB00810)|Bisoprolol(DB00612)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Buspirone(DB00490)|Caffeine(DB00201)|Captopril(DB01197)|Carbinoxamine(DB00748)|Carteolol(DB00521)|Carvedilol(DB01136)|Celecoxib(DB00482)|Cephalexin(DB00567)|Cevimeline(DB00185)|Chlordiazepoxide(DB00475)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Cinnarizine(DB00568)|Cisapride(DB00604)|Citalopram(DB00215)|Clemastine(DB00283)|Clevidipine(DB04920)|Clomipramine(DB01242)|Clonidine(DB00575)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Codeine(DB00318)|Cyclobenzaprine(DB00924)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Darifenacin(DB00496)|Debrisoquin(DB04840)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dihydrocodeine(DB01551)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Diphenhydramine(DB01075)|Dolasetron(DB00757)|Domperidone(DB01184)|Donepezil(DB00843)|Dopamine(DB00988)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronedarone(DB04855)|Duloxetine(DB00476)|Efavirenz(DB00625)|Eletriptan(DB00216)|Encainide(DB01228)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erlotinib(DB00530)|Escitalopram(DB01175)|Ethylmorphine(DB01466)|Etoricoxib(DB01628)|Felodipine(DB01023)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fingolimod(DB08868)|Flecainide(DB01195)|Flunarizine(DB04841)|Fluoxetine(DB00472)|Fluphenazine(DB00623)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Galantamine(DB00674)|Gefitinib(DB00317)|Glutethimide(DB01437)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Halothane(DB01159)|Histamine Phosphate(DB00667)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Hydroxychloroquine(DB01611)|Hydroxyurea(DB01005)|Hydroxyzine(DB00557)|Idarubicin(DB01177)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Ipratropium bromide(DB00332)|Irbesartan(DB01029)|Isoniazid(DB00951)|Itraconazole(DB01167)|Ketoconazole(DB01026)|L-DOPA(DB01235)|Labetalol(DB00598)|Lansoprazole(DB00448)|Lercanidipine(DB00528)|Levomilnacipran(DB08918)|Lidocaine(DB00281)|Lisuride(DB00589)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Lovastatin(DB00227)|Lumefantrine(DB06708)|Maprotiline(DB00934)|Mefloquine(DB00358)|Mepyramine(DB06691)|Mequitazine(DB01071)|Mesoridazine(DB00933)|Methadone(DB00333)|Methamphetamine(DB01577)|Methazolamide(DB00703)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxyflurane(DB01028)|Methylnaltrexone(DB06800)|Methylphenidate(DB00422)|Methyprylon(DB01107)|Metoclopramide(DB01233)|Metoprolol(DB00264)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midodrine(DB00211)|Mifepristone(DB00834)|Minaprine(DB00805)|Mirabegron(DB08893)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Morphine(DB00295)|Nateglinide(DB00731)|Nebivolol(DB04861)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Niacin(DB00627)|Nicardipine(DB00622)|Nicergoline(DB00699)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitrofural(DB00336)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Oxamniquine(DB01096)|Oxprenolol(DB01580)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Paliperidone(DB01267)|Palonosetron(DB00377)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Pergolide(DB01186)|Perhexiline(DB01074)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenformin(DB00914)|Phentermine(DB00191)|Pimozide(DB01100)|Pindolol(DB00960)|Pioglitazone(DB01132)|Piperazine(DB00592)|Pipotiazine(DB01621)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Primaquine(DB01087)|Procainamide(DB01035)|Prochlorperazine(DB00433)|Progesterone(DB00396)|Proguanil(DB01131)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Pyrimethamine(DB00205)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ranolazine(DB00243)|Reboxetine(DB00234)|Remoxipride(DB00409)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivastigmine(DB00989)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosiglitazone(DB00412)|Rotigotine(DB05271)|Saquinavir(DB01232)|Selegiline(DB01037)|Sertindole(DB06144)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tamsulosin(DB00706)|Tapentadol(DB06204)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Terbinafine(DB00857)|Tetrabenazine(DB04844)|Theophylline(DB00277)|Thioridazine(DB00679)|Thiothixene(DB01623)|Ticlopidine(DB00208)|Timolol(DB00373)|Tiotropium(DB01409)|Tipranavir(DB00932)|Tolterodine(DB01036)|Trabectedin(DB05109)|Tramadol(DB00193)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Trimipramine(DB00726)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Trospium(DB00209)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)|Vinblastine(DB00570)|Vinorelbine(DB00361)|Yohimbine(DB01392)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Ziprasidone(DB00246)|Zolpidem(DB00425)	GGCAGTGGTGTAGGGCATGTG	0.607																																					p.Y355C		Atlas-SNP	.											CYP2D6_ENST00000360608,NS,carcinoma,0,2	CYP2D6	104	2	0			c.A1064G						scavenged	.						106.0	82.0	90.0					22																	42523558		2202	4300	6502	SO:0001583	missense	1565	exon7			GTGGTGTAGGGCA	M20403	CCDS33657.1, CCDS46721.1	22q13.1	2014-09-17	2003-01-14		ENSG00000100197	ENSG00000100197		"""Cytochrome P450s"""	2625	protein-coding gene	gene with protein product		124030	"""cytochrome P450, subfamily IID (debrisoquine, sparteine, etc., -metabolizing), polypeptide 6"", ""cytochrome P450, family 2, subfamily D, polypeptide 7 pseudogene 2"", ""cytochrome P450, subfamily II (debrisoquine, sparteine, etc., -metabolising), polypeptide 7 pseudogene 2"", ""cytochrome P450, family 2, subfamily D, polypeptide 8 pseudogene 2"", ""cytochrome P450, subfamily IID (debrisoquine, sparteine, etc., -metabolising), polypeptide 8 pseudogene 2"""	CYP2DL1, CYP2D7P2, CYP2D7BP, CYP2D8P2, CYP2D7AP		8449513	Standard	NM_000106		Approved	CPD6, P450-DB1, CYP2D, P450C2D	uc003bce.3	P10635	OTTHUMG00000150918	ENST00000360608.5:c.1064A>G	22.37:g.42523558T>C	ENSP00000353820:p.Tyr355Cys	Somatic	82	1	0.0121951		WXS	Illumina HiSeq	Phase_I	89	4	0.0449438	NM_000106	Q16752|Q2XND6|Q2XND7|Q2XNE0|Q6B012|Q6NXU8	Missense_Mutation	SNP	ENST00000360608.5	37	CCDS46721.1	.	.	.	.	.	.	.	.	.	.	T	15.61	2.884011	0.51908	.	.	ENSG00000100197	ENST00000360608;ENST00000389970;ENST00000413640;ENST00000359033;ENST00000542856	T;T;T	0.76186	-1.0;-1.0;-1.0	4.93	-8.43	0.00953	.	0.656947	0.15234	N	0.273223	D	0.88265	0.6390	H	0.96518	3.835	0.58432	D	0.999998	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.81914	0.995;0.976;0.995	D	0.91542	0.5250	10	0.87932	D	0	.	18.217	0.89889	0.1595:0.0:0.0:0.8405	.	355;304;355	C1ID54;Q6NXU8;Q6NWU0	.;.;.	C	355;355;301;304;304	ENSP00000353820:Y355C;ENSP00000374620:Y355C;ENSP00000351927:Y304C	ENSP00000351927:Y304C	Y	-	2	0	CYP2D6	40853502	0.995000	0.38212	0.872000	0.34217	0.407000	0.30961	0.270000	0.18607	-1.565000	0.01676	-0.509000	0.04479	TAC	T|0.999;C|0.001	0.001	weak		0.607	CYP2D6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320525.1		
MUC2	4583	hgsc.bcm.edu	37	11	1092978	1092978	+	Silent	SNP	C	C	T	rs111170567		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:1092978C>T	ENST00000441003.2	+	30	4824	c.4797C>T	c.(4795-4797)acC>acT	p.T1599T	MUC2_ENST00000359061.5_Intron|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caacacccaccggcacacaga	0.632																																					p.T1599T		Atlas-SNP	.											.	MUC2	614	.	0			c.C4797T						PASS	.						43.0	80.0	67.0					11																	1092978		1784	3257	5041	SO:0001819	synonymous_variant	4583	exon30			ACCCACCGGCACA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4797C>T	11.37:g.1092978C>T		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	16	6	0.375	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.	.	weak		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
RBMXL2	27288	hgsc.bcm.edu	37	11	7111164	7111164	+	Silent	SNP	G	G	A	rs138708788		TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr11:7111164G>A	ENST00000306904.5	+	1	1000	c.813G>A	c.(811-813)ggG>ggA	p.G271G		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	271	Arg/Gly/Pro-rich.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GTGACTACGGGGATCATCTGA	0.657																																					p.G271G		Atlas-SNP	.											.	RBMXL2	47	.	0			c.G813A						PASS	.	G		2,4390		0,2,2194	26.0	30.0	29.0		813	-1.5	0.0	11	dbSNP_134	29	0,8582		0,0,4291	no	coding-synonymous	RBMXL2	NM_014469.4		0,2,6485	AA,AG,GG		0.0,0.0455,0.0154		271/393	7111164	2,12972	2196	4291	6487	SO:0001819	synonymous_variant	27288	exon1			CTACGGGGATCAT	AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.813G>A	11.37:g.7111164G>A		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	68	14	0.205882	NM_014469	Q6PEZ2|Q9NQU0	Silent	SNP	ENST00000306904.5	37	CCDS7777.1																																																																																			G|1.000;A|0.000	0.000	weak		0.657	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384552.1	NM_014469	
TNS1	7145	hgsc.bcm.edu	37	2	218712997	218712997	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr2:218712997G>A	ENST00000171887.4	-	17	2320	c.1868C>T	c.(1867-1869)tCg>tTg	p.S623L	TNS1_ENST00000480665.1_5'Flank|TNS1_ENST00000419504.1_Missense_Mutation_p.S623L|TNS1_ENST00000430930.1_Missense_Mutation_p.S623L	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	623					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TTCAGCTTCCGAAAAGGATTG	0.652																																					p.S623L		Atlas-SNP	.											.	TNS1	251	.	0			c.C1868T						PASS	.						53.0	45.0	47.0					2																	218712997		2202	4300	6502	SO:0001583	missense	7145	exon17			GCTTCCGAAAAGG	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1868C>T	2.37:g.218712997G>A	ENSP00000171887:p.Ser623Leu	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	61	9	0.147541	NM_022648	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.053240	0.36181	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903	D;D;D;D	0.93859	-2.81;-2.82;-2.82;-3.3	4.57	4.57	0.56435	.	0.441217	0.24465	N	0.038288	D	0.86070	0.5845	N	0.08118	0	0.80722	D	1	B;B;B;B;B	0.23891	0.036;0.0;0.093;0.059;0.059	B;B;B;B;B	0.15870	0.009;0.001;0.014;0.01;0.006	T	0.82955	-0.0200	10	0.48119	T	0.1	.	17.539	0.87842	0.0:0.0:1.0:0.0	.	623;677;623;623;623	B2RU35;A1L0S7;Q9HBL0;E9PGF5;E9PF55	.;.;TENS1_HUMAN;.;.	L	623;623;623;748	ENSP00000171887:S623L;ENSP00000408724:S623L;ENSP00000406016:S623L;ENSP00000405460:S748L	ENSP00000171887:S623L	S	-	2	0	TNS1	218421242	0.980000	0.34600	0.937000	0.37676	0.979000	0.70002	1.802000	0.38853	2.370000	0.80446	0.561000	0.74099	TCG	.	.	none		0.652	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
ANKRD50	57182	hgsc.bcm.edu	37	4	125590963	125590963	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U3-01A-11D-A38X-10	TCGA-GS-A9U3-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	50af794e-c494-4546-be75-32392cfe1183	112ae0ce-a64e-4c94-92bc-27be6b47b249	g.chr4:125590963G>A	ENST00000504087.1	-	4	4506	c.3469C>T	c.(3469-3471)Cct>Tct	p.P1157S	ANKRD50_ENST00000515641.1_Missense_Mutation_p.P978S	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1157	Ser-rich.									NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						GCATGAGTAGGCCCATTAGGT	0.403																																					p.P1157S		Atlas-SNP	.											.	ANKRD50	136	.	0			c.C3469T						PASS	.						128.0	125.0	126.0					4																	125590963		2203	4300	6503	SO:0001583	missense	57182	exon4			GAGTAGGCCCATT	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.3469C>T	4.37:g.125590963G>A	ENSP00000425658:p.Pro1157Ser	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	72	11	0.152778	NM_020337	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.425738	0.43020	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.66638	-0.22;-0.2	5.19	5.19	0.71726	.	0.052846	0.85682	D	0.000000	T	0.69833	0.3155	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.61192	-0.7112	10	0.06757	T	0.87	.	18.8923	0.92410	0.0:0.0:1.0:0.0	.	1157	Q9ULJ7	ANR50_HUMAN	S	1157;978	ENSP00000425658:P1157S;ENSP00000425355:P978S	ENSP00000425658:P1157S	P	-	1	0	ANKRD50	125810413	1.000000	0.71417	0.987000	0.45799	0.947000	0.59692	9.060000	0.93907	2.698000	0.92095	0.561000	0.74099	CCT	.	.	none		0.403	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337	
