#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TBP	6908	hgsc.bcm.edu	37	6	170871044	170871046	+	In_Frame_Del	DEL	CAA	CAA	-	rs369312237|rs62430309	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	CAA	CAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:170871044_170871046delCAA	ENST00000392092.2	+	3	499_501	c.220_222delCAA	c.(220-222)caadel	p.Q95del	TBP_ENST00000230354.6_In_Frame_Del_p.Q95del|TBP_ENST00000540980.1_In_Frame_Del_p.Q75del	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	95	Poly-Gln.		Missing. {ECO:0000269|PubMed:2374612}.	Missing (in Ref. 4; BAG65425). {ECO:0000305}.	cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		gcagcaacagcaacagcagcagc	0.567																																					p.73_74del		Atlas-Indel	.											TBP,NS,carcinoma,0,1	TBP	58	1	0			c.219_221del						PASS	.																																			SO:0001651	inframe_deletion	6908	exon3			.	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.220_222delCAA	6.37:g.170871044_170871046delCAA	ENSP00000375942:p.Gln95del	Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	22	14	0.636364	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	In_Frame_Del	DEL	ENST00000392092.2	37	CCDS5315.1																																																																																			.	.	none		0.567	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
SETD1B	23067	hgsc.bcm.edu	37	12	122242657	122242658	+	Frame_Shift_Ins	INS	-	-	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:122242657_122242658insC	ENST00000604567.1	+	2	82_83	c.14_15insC	c.(13-18)caccccfs	p.HP5fs	SETD1B_ENST00000267197.5_Frame_Shift_Ins_p.HP5fs|RHOF_ENST00000545544.1_5'Flank|RP11-347I19.8_ENST00000609067.1_lincRNA|SETD1B_ENST00000542440.1_Frame_Shift_Ins_p.HP5fs			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	5					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.H8fs*27(2)		NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						GAGAACAGTCACCCCCCCCACC	0.629																																					p.H5fs		Pindel,Atlas-Indel	.											.	SETD1B	105	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.14_15insC						PASS	.			9,1819		1,7,906						1.9	1.0			42	13,3745		3,7,1869	no	frameshift	SETD1B	NM_015048.1		4,14,2775	A1A1,A1R,RR		0.3459,0.4923,0.3938				22,5564				SO:0001589	frameshift_variant	23067	exon1			.	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.22dupC	12.37:g.122242665_122242665dupC	ENSP00000474253:p.His5fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	25	25	1.000	NM_015048	F6MFW1	Frame_Shift_Ins	INS	ENST00000604567.1	37																																																																																				.	.	none		0.629	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
HIST1H1E	3008	hgsc.bcm.edu	37	6	26156977	26156977	+	Frame_Shift_Del	DEL	C	C	-			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:26156977delC	ENST00000304218.3	+	1	419	c.359delC	c.(358-360)gctfs	p.A120fs	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	120					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						AAGCCTAAGGCTAAAAAGGCA	0.642																																					p.A120fs		Pindel,Atlas-Indel	.											.	HIST1H1E	69	.	0			c.358delG						PASS	.						21.0	28.0	26.0					6																	26156977		2203	4300	6503	SO:0001589	frameshift_variant	3008	exon1			.	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.359delC	6.37:g.26156977delC	ENSP00000307705:p.Ala120fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	11	11	1.000	NM_005321	Q4VB25	Frame_Shift_Del	DEL	ENST00000304218.3	37	CCDS4586.1																																																																																			.	.	none		0.642	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
KRT81	3887	hgsc.bcm.edu	37	12	52684932	52684934	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:52684932_52684934delCTC	ENST00000327741.5	-	1	384_386	c.316_318delGAG	c.(316-318)gagdel	p.E106del	KRT86_ENST00000423955.2_Intron|KRT86_ENST00000544024.1_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	106	Head.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		TCTGCTCCTTCTCCTCCTGCTTC	0.616																																					p.106_107del		Atlas-Indel	.											.	KRT81	46	.	0			c.317_319del						PASS	.																																			SO:0001651	inframe_deletion	3887	exon1			.	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.316_318delGAG	12.37:g.52684935_52684937delCTC	ENSP00000369349:p.Glu106del	Somatic	461	0	0		WXS	Illumina HiSeq	Phase_I	527	44	0.0834915	NM_002281	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	In_Frame_Del	DEL	ENST00000327741.5	37	CCDS31805.1																																																																																			.	.	none		0.616	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281	
ACADVL	37	hgsc.bcm.edu	37	17	7124102	7124103	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:7124102_7124103delAC	ENST00000356839.5	+	5	474_475	c.295_296delAC	c.(295-297)acafs	p.T99fs	ACADVL_ENST00000581562.1_3'UTR|MIR324_ENST00000362183.1_RNA|ACADVL_ENST00000350303.5_Frame_Shift_Del_p.T77fs|ACADVL_ENST00000543245.2_Frame_Shift_Del_p.T122fs|DLG4_ENST00000399510.2_5'Flank	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	99	Catalytic.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						CGAAGAGCAGACACAGTTTCTT	0.574																																					p.121_122del		Pindel,Atlas-Indel	.											ACADVL,NS,carcinoma,0,1	ACADVL	43	1	0			c.363_364del						PASS	.																																			SO:0001589	frameshift_variant	37	exon6			.	BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.295_296delAC	17.37:g.7124104_7124105delAC	ENSP00000349297:p.Thr99fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	13	13	1.000	NM_001270447	B4DEB6|F5H2A9|O76056|Q8WUL0	Frame_Shift_Del	DEL	ENST00000356839.5	37	CCDS11090.1																																																																																			.	.	none		0.574	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220001.5	NM_000018	
KRT86	3892	hgsc.bcm.edu	37	12	52696011	52696013	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	AGG	AGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:52696011_52696013delAGG	ENST00000423955.2	+	3	489_491	c.311_313delAGG	c.(310-315)caggag>cag	p.E106del	KRT86_ENST00000544024.1_In_Frame_Del_p.E106del|KRT86_ENST00000293525.5_In_Frame_Del_p.E106del			O43790	KRT86_HUMAN	keratin 86	106	Head.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGCGTGAAGCAGGAGGAGAAGGA	0.621																																					p.104_104del		Atlas-Indel	.											.	KRT86	33	.	0			c.310_312del						PASS	.																																			SO:0001651	inframe_deletion	3892	exon1			.	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.311_313delAGG	12.37:g.52696014_52696016delAGG	ENSP00000444533:p.Glu106del	Somatic	483	0	0		WXS	Illumina HiSeq	Phase_I	526	55	0.104563	NM_002284	P78387	In_Frame_Del	DEL	ENST00000423955.2	37	CCDS41785.1																																																																																			.	.	none		0.621	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404911.1	NM_002284	
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493792	77493794	+	In_Frame_Del	DEL	TGT	TGT	-	rs377151545|rs28718623|rs71125518	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	TGT	TGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr14:77493792_77493794delTGT	ENST00000238647.3	-	1	1240_1242	c.342_344delACA	c.(340-345)caacag>cag	p.114_115QQ>Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	114	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						ctgctgctgctgttgctgctgct	0.7																																					p.115_115del		Atlas-Indel	.											.	IRF2BPL	40	.	0			c.343_345del						PASS	.			1119,1147		390,339,404						-1.3	0.0			2	2585,1523		1057,471,526	no	coding	IRF2BPL	NM_024496.2		1447,810,930	A1A1,A1R,RR		37.074,49.3822,41.8889				3704,2670				SO:0001651	inframe_deletion	64207	exon1			.	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.342_344delACA	14.37:g.77493792_77493794delTGT	ENSP00000238647:p.Gln127del	Somatic	5	0	0		WXS	Illumina HiSeq	Phase_I	15	10	0.666667	NM_024496	Q8NDQ2|Q96JG2|Q9H3I7	In_Frame_Del	DEL	ENST00000238647.3	37	CCDS9854.1																																																																																			.	.	weak		0.700	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
OR6C75	390323	hgsc.bcm.edu	37	12	55759486	55759486	+	Frame_Shift_Del	DEL	T	T	-			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:55759486delT	ENST00000343399.3	+	1	592	c.592delT	c.(592-594)tttfs	p.F199fs		NM_001005497.1	NP_001005497.1	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C, member 75	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L200fs*1(1)		endometrium(2)|large_intestine(5)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)	25						ACTCATGGCATTTTTTTTAGC	0.393																																					p.A197fs		Pindel,Atlas-Indel	.											.	OR6C75	67	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.591delA						PASS	.						154.0	133.0	140.0					12																	55759486		2203	4300	6503	SO:0001589	frameshift_variant	390323	exon1			.		CCDS31820.1	12q13.2	2013-09-23			ENSG00000187857	ENSG00000187857		"""GPCR / Class A : Olfactory receptors"""	31304	protein-coding gene	gene with protein product							Standard	NM_001005497		Approved		uc010spk.2	A6NL08	OTTHUMG00000169886	ENST00000343399.3:c.592delT	12.37:g.55759486delT	ENSP00000368987:p.Phe199fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	25	25	1.000	NM_001005497		Frame_Shift_Del	DEL	ENST00000343399.3	37	CCDS31820.1																																																																																			.	.	none		0.393	OR6C75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406418.1		
SHKBP1	92799	hgsc.bcm.edu	37	19	41095087	41095112	+	Intron	DEL	GAGGACAGTCCTGTCCAACAGGGAGG	GAGGACAGTCCTGTCCAACAGGGAGG	-	rs528660073|rs547185289	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	GAGGACAGTCCTGTCCAACAGGGAGG	GAGGACAGTCCTGTCCAACAGGGAGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr19:41095087_41095112delGAGGACAGTCCTGTCCAACAGGGAGG	ENST00000291842.5	+	15	1638				SHKBP1_ENST00000600733.1_Intron|SHKBP1_ENST00000597649.1_Intron	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1						protein homooligomerization (GO:0051260)					breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGGCAGCGGTGAGGACAGTCCTGTCCAACAGGGAGGGAGGACAGTC	0.606														1576	0.314696	0.3275	0.3242	5008	,	,		11236	0.3155		0.3231	False		,,,				2504	0.2812				.		Atlas-Indel	.											.	SHKBP1	68	.	0			.						PASS	.																																			SO:0001627	intron_variant	92799	.			.	AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.1589+3GAGGACAGTCCTGTCCAACAGGGAGG>-	19.37:g.41095087_41095112delGAGGACAGTCCTGTCCAACAGGGAGG		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	31	10	0.322581	.	Q8N2I6|Q8WY93|Q96IB8	Splice_Site	DEL	ENST00000291842.5	37	CCDS12560.1																																																																																			.	.	none		0.606	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462613.2	NM_138392	
NPEPPS	9520	hgsc.bcm.edu	37	17	45669428	45669429	+	Splice_Site	INS	-	-	A	rs59875832	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:45669428_45669429insA	ENST00000322157.4	+	11	1602		c.e11+2		NPEPPS_ENST00000525037.1_Splice_Site|NPEPPS_ENST00000530173.1_Splice_Site|NPEPPS_ENST00000544660.1_Splice_Site	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						GGGGATAAGGTAAAAAAAAACT	0.337													AAAAAAAAAA|AAAAAAAAA|AAAAAAAAAA|deletion	2727	0.544529	0.3767	0.6527	5008	,	,		20630	0.6647		0.5358	False		,,,				2504	0.5798				.		Pindel	.											.	NPEPPS	59	.	0			c.1365+2->A						PASS	.			18,1379,2111		0,6,12,257,859,620						5.4	1.0		dbSNP_130	43	52,3927,3819		2,20,28,949,2009,891	no	intron	NPEPPS	NM_006310.3		2,26,40,1206,2868,1511	A1A1,A1A2,A1R,A2A2,A2R,RR		49.6409,39.8233,47.55				70,5306,5930				SO:0001630	splice_region_variant	9520	exon11			.	Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.1365+2->A	17.37:g.45669437_45669437dupA		Somatic	0	0	0		WXS	Illumina HiSeq	Phase_I	38	38	1.000	NM_006310	B7Z463|Q6P145|Q9NP16|Q9UEM2	Splice_Site	INS	ENST00000322157.4	37	CCDS45721.1																																																																																			A|0.500;AAA|0.500	0.500	strong		0.337	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1	NM_006310	Intron
DNAH12	201625	hgsc.bcm.edu	37	3	57509313	57509313	+	Frame_Shift_Del	DEL	T	T	-			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:57509313delT	ENST00000351747.2	-	4	456	c.276delA	c.(274-276)aaafs	p.K92fs	DNAH12_ENST00000311202.6_Frame_Shift_Del_p.K92fs|DNAH12_ENST00000389536.4_Frame_Shift_Del_p.K92fs	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	92	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G93fs*7(2)		breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						AACTCACTCCTTTTTTTTTCA	0.254																																					p.G93fs		Pindel	.											.	DNAH12	182	.	2	Deletion - Frameshift(2)	lung(2)	c.277delG						PASS	.		,	40,140,4046		0,0,40,1,138,1934	20.0	22.0	21.0		,	4.3	1.0	3	dbSNP_126	21	45,231,7912		0,0,45,1,229,3819	no	codingComplex,codingComplex	DNAH12	NM_198564.3,NM_178504.4	,	0,0,85,2,367,5753	A1A1,A1A2,A1R,A2A2,A2R,RR		3.3708,4.2593,3.6733	,	,	57509313	85,371,11958	2183	4274	6457	SO:0001589	frameshift_variant	201625	exon4			.	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.276delA	3.37:g.57509313delT	ENSP00000295937:p.Lys92fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	11	11	1.000	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Frame_Shift_Del	DEL	ENST00000351747.2	37																																																																																				.	.	none		0.254	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
VPS35	55737	hgsc.bcm.edu	37	16	46708575	46708575	+	Intron	DEL	A	A	-			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr16:46708575delA	ENST00000299138.7	-	9	973				VPS35_ENST00000568642.1_Intron	NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)						cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AAGCTAATCTAAAAAAAAAAA	0.343																																					.		Pindel	.											.	VPS35	49	.	0			c.915-2T>-						PASS	.						30.0	30.0	30.0					16																	46708575		2168	4291	6459	SO:0001627	intron_variant	55737	exon10			.	AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.915-3T>-	16.37:g.46708575delA		Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	10	10	1.000	NM_018206	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Splice_Site	DEL	ENST00000299138.7	37	CCDS10721.1																																																																																			.	.	none		0.343	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255742.3		
SLC25A5	292	hgsc.bcm.edu	37	X	118603681	118603681	+	Frame_Shift_Del	DEL	T	T	-			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chrX:118603681delT	ENST00000317881.8	+	2	285	c.169delT	c.(169-171)tgcfs	p.C57fs	SLC25A5_ENST00000460013.1_3'UTR|SLC25A5-AS1_ENST00000446986.1_RNA	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	57					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	CATTATAGACTGCGTGGTCCG	0.512																																					p.D56fs		Pindel	.											.	SLC25A5	33	.	0			c.168delC						PASS	.						211.0	203.0	206.0					X																	118603681		2203	4300	6503	SO:0001589	frameshift_variant	292	exon2			.	BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.169delT	X.37:g.118603681delT	ENSP00000360671:p.Cys57fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	24	24	1.000	NM_001152	B2RCV1|O43350	Frame_Shift_Del	DEL	ENST00000317881.8	37	CCDS14578.1																																																																																			.	.	none		0.512	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058952.2	NM_001152	
COPB1	1315	hgsc.bcm.edu	37	11	14501262	14501263	+	Splice_Site	INS	-	-	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:14501262_14501263insA	ENST00000249923.3	-	11	1513		c.e11-2		COPB1_ENST00000439561.2_Splice_Site|RNU7-49P_ENST00000516182.1_RNA	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1						COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						TTCCATTAACTAAAAGAAAAAA	0.307																																					.		Pindel	.											.	COPB1	81	.	0			c.1213-2->T						PASS	.																																			SO:0001630	splice_region_variant	1315	exon12			.	BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.1213-2->T	11.37:g.14501266_14501266dupA		Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	10	10	1.000	NM_001144062	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Splice_Site	INS	ENST00000249923.3	37	CCDS7815.1																																																																																			.	.	none		0.307	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1	NM_016451	Intron
CCDC144B	284047	hgsc.bcm.edu	37	17	18498497	18498498	+	RNA	INS	-	-	A	rs397961350|rs59933375|rs80104188	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:18498497_18498498insA	ENST00000442583.1	-	0	749							Q3MJ40	C144B_HUMAN	coiled-coil domain containing 144B (pseudogene)											NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(6)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	36						CTGCAGGCCTGAAAAAAAAAAA	0.243														2618	0.522764	0.528	0.4683	5008	,	,		15585	0.6756		0.4294	False		,,,				2504	0.4928				.		Pindel	.											.	CCDC144B	106	.	0			.						PASS	.																																					284047	.			.	AK093811		17p11.2	2012-11-19	2011-09-02		ENSG00000154874	ENSG00000154874			26704	pseudogene	pseudogene			"""coiled-coil domain containing 144B"""			11997339	Standard	NR_036647		Approved	FLJ36492	uc002guc.2	Q3MJ40	OTTHUMG00000059531		17.37:g.18498508_18498508dupA		Somatic	0	0	0		WXS	Illumina HiSeq	Phase_I	74	74	1.000	.	Q6P5Q3|Q8N200	RNA	INS	ENST00000442583.1	37																																																																																				.	.	weak		0.243	CCDC144B-006	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000132102.1	NM_182568	
USP3	9960	hgsc.bcm.edu	37	15	63829314	63829314	+	Missense_Mutation	SNP	G	G	T	rs567231691	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr15:63829314G>T	ENST00000380324.3	+	3	372	c.243G>T	c.(241-243)caG>caT	p.Q81H	USP3_ENST00000536001.1_Missense_Mutation_p.Q81H|USP3_ENST00000539772.1_Intron|USP3_ENST00000540797.1_Intron|USP3_ENST00000558285.1_Missense_Mutation_p.Q64H|USP3_ENST00000268049.7_Missense_Mutation_p.Q59H	NM_006537.3	NP_006528.2	Q9Y6I4	UBP3_HUMAN	ubiquitin specific peptidase 3	81					DNA repair (GO:0006281)|histone deubiquitination (GO:0016578)|mitotic cell cycle (GO:0000278)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear chromatin (GO:0000790)	histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(7)|lung(4)	14				GBM - Glioblastoma multiforme(80;0.0187)		ATAAAGTTCAGCACACAGTAT	0.368																																					p.Q81H		Atlas-SNP	.											.	USP3	37	.	0			c.G243T						PASS	.						121.0	93.0	102.0					15																	63829314		2203	4300	6503	SO:0001583	missense	9960	exon3			AGTTCAGCACACA	AF073344	CCDS32265.1, CCDS58370.1	15q22.3	2008-04-11	2005-08-08			ENSG00000140455		"""Ubiquitin-specific peptidases"""	12626	protein-coding gene	gene with protein product		604728	"""ubiquitin specific protease 3"""			12838346	Standard	NM_006537		Approved		uc002amf.4	Q9Y6I4		ENST00000380324.3:c.243G>T	15.37:g.63829314G>T	ENSP00000369681:p.Gln81His	Somatic	311	0	0		WXS	Illumina HiSeq	Phase_I	278	97	0.348921	NM_006537	B4DVU5|F5H1A6|Q8WVD0	Missense_Mutation	SNP	ENST00000380324.3	37	CCDS32265.1	.	.	.	.	.	.	.	.	.	.	G	11.91	1.780649	0.31502	.	.	ENSG00000140455	ENST00000380324;ENST00000268049;ENST00000536001	T;T;T	0.30448	1.53;1.53;1.53	5.73	2.82	0.32997	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, UBP-type (2);	0.051593	0.85682	D	0.000000	T	0.23965	0.0580	L	0.37507	1.11	0.80722	D	1	B;B	0.24258	0.026;0.1	B;B	0.23419	0.037;0.046	T	0.07065	-1.0792	10	0.51188	T	0.08	.	10.8979	0.47034	0.2634:0.0:0.7366:0.0	.	59;81	Q6JHV3;Q9Y6I4	.;UBP3_HUMAN	H	81;59;81	ENSP00000369681:Q81H;ENSP00000268049:Q59H;ENSP00000445615:Q81H	ENSP00000268049:Q59H	Q	+	3	2	USP3	61616367	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.505000	0.35736	0.891000	0.36235	-0.150000	0.13652	CAG	.	.	none		0.368	USP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417773.1		
TMEM229A	730130	hgsc.bcm.edu	37	7	123672769	123672769	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr7:123672769G>A	ENST00000455783.1	-	1	754	c.289C>T	c.(289-291)Cac>Tac	p.H97Y	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	97						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						GTGAGCGAGTGCAGCAGGCAG	0.667																																					p.H97Y		Atlas-SNP	.											.	TMEM229A	31	.	0			c.C289T						PASS	.						77.0	82.0	81.0					7																	123672769		692	1591	2283	SO:0001583	missense	730130	exon1			GCGAGTGCAGCAG	BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.289C>T	7.37:g.123672769G>A	ENSP00000395244:p.His97Tyr	Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	86	63	0.732558	NM_001136002	A4D0X6	Missense_Mutation	SNP	ENST00000455783.1	37	CCDS47694.1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.499918	0.44455	.	.	ENSG00000234224	ENST00000455783	.	.	.	3.88	3.88	0.44766	.	.	.	.	.	T	0.54806	0.1881	L	0.29908	0.895	0.35442	D	0.794983	D	0.69078	0.997	P	0.59288	0.855	T	0.66878	-0.5812	8	0.87932	D	0	.	11.3245	0.49440	0.0:0.0:1.0:0.0	.	97	B2RXF0	T229A_HUMAN	Y	97	.	ENSP00000395244:H97Y	H	-	1	0	TMEM229A	123460005	1.000000	0.71417	0.961000	0.40146	0.163000	0.22366	4.746000	0.62133	1.720000	0.51447	0.484000	0.47621	CAC	.	.	none		0.667	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336960.3	NM_001136002	
HIST1H2AE	3012	hgsc.bcm.edu	37	6	26217410	26217410	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:26217410G>A	ENST00000303910.2	+	1	246	c.208G>A	c.(208-210)Gcg>Acg	p.A70T	HIST1H2BG_ENST00000244601.3_5'Flank	NM_021052.2	NP_066390.1	P04908	H2A1B_HUMAN	histone cluster 1, H2ae	70						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	10		all_hematologic(11;0.196)				AGCTGGCAACGCGGCTCGCGA	0.592																																					p.A70T		Atlas-SNP	.											.	HIST1H2AE	25	.	0			c.G208A						PASS	.						60.0	61.0	61.0					6																	26217410		2203	4300	6503	SO:0001583	missense	3012	exon1			GGCAACGCGGCTC	M60752	CCDS4595.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000168274	ENSG00000277075		"""Histones / Replication-dependent"""	4724	protein-coding gene	gene with protein product		602786	"""H2A histone family, member A"", ""histone 1, H2ae"""	H2AFA		9119399, 1916825, 12408966	Standard	NM_021052		Approved	H2A/a, H2A.1	uc003nha.1	P04908	OTTHUMG00000014440	ENST00000303910.2:c.208G>A	6.37:g.26217410G>A	ENSP00000303373:p.Ala70Thr	Somatic	138	0	0		WXS	Illumina HiSeq	Phase_I	106	13	0.122642	NM_021052	P28001|Q76P63	Missense_Mutation	SNP	ENST00000303910.2	37	CCDS4595.1	.	.	.	.	.	.	.	.	.	.	.	19.05	3.751476	0.69533	.	.	ENSG00000168274	ENST00000303910	T	0.69685	-0.42	4.07	4.07	0.47477	.	0.000000	0.33732	U	0.004605	T	0.80670	0.4667	M	0.89658	3.05	0.52099	D	0.999946	.	.	.	.	.	.	D	0.85308	0.1077	8	0.72032	D	0.01	.	15.7762	0.78220	0.0:0.0:1.0:0.0	.	.	.	.	T	70	ENSP00000303373:A70T	ENSP00000303373:A70T	A	+	1	0	HIST1H2AE	26325389	1.000000	0.71417	1.000000	0.80357	0.577000	0.36160	7.549000	0.82163	2.263000	0.75096	0.650000	0.86243	GCG	.	.	none		0.592	HIST1H2AE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040103.1	NM_021052	
PRDM15	63977	hgsc.bcm.edu	37	21	43256244	43256244	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr21:43256244G>A	ENST00000269844.3	-	17	2464	c.2354C>T	c.(2353-2355)tCc>tTc	p.S785F	PRDM15_ENST00000398548.1_Missense_Mutation_p.S456F|PRDM15_ENST00000447207.2_Missense_Mutation_p.S419F|PRDM15_ENST00000538201.1_Missense_Mutation_p.S419F|PRDM15_ENST00000422911.1_Missense_Mutation_p.S456F	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	785					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						GTGCTTGTAGGAAACGTGCTG	0.488																																					p.S785F		Atlas-SNP	.											.	PRDM15	110	.	0			c.C2354T						PASS	.						254.0	186.0	209.0					21																	43256244		2203	4300	6503	SO:0001583	missense	63977	exon17			TTGTAGGAAACGT	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.2354C>T	21.37:g.43256244G>A	ENSP00000269844:p.Ser785Phe	Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	133	28	0.210526	NM_022115	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	37	CCDS13676.1	.	.	.	.	.	.	.	.	.	.	g	17.29	3.353248	0.61293	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844;ENST00000380489	T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;3.06	4.41	4.41	0.53225	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.86585	0.5968	M	0.69248	2.105	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.88273	0.2931	9	0.66056	D	0.02	-23.6982	15.9984	0.80268	0.0:0.0:1.0:0.0	.	785;456;456	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	F	456;456;419;419;785;419	ENSP00000408592:S456F;ENSP00000381556:S456F;ENSP00000444044:S419F;ENSP00000390245:S419F;ENSP00000269844:S785F	ENSP00000269844:S785F	S	-	2	0	PRDM15	42129313	1.000000	0.71417	0.737000	0.30932	0.077000	0.17291	9.586000	0.98226	1.998000	0.58463	0.651000	0.88453	TCC	.	.	none		0.488	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
NEB	4703	hgsc.bcm.edu	37	2	152420390	152420390	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr2:152420390C>T	ENST00000172853.10	-	90	13570	c.13423G>A	c.(13423-13425)Gag>Aag	p.E4475K	NEB_ENST00000603639.1_Missense_Mutation_p.E6176K|NEB_ENST00000397345.3_Missense_Mutation_p.E6176K|NEB_ENST00000409198.1_Missense_Mutation_p.E4475K|NEB_ENST00000604864.1_Missense_Mutation_p.E6176K|NEB_ENST00000427231.2_Missense_Mutation_p.E6176K			P20929	NEBU_HUMAN	nebulin	4475					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		ATGTAGCGCTCATCCAGGGTG	0.463																																					p.E6176K		Atlas-SNP	.											.	NEB	1697	.	0			c.G18526A						PASS	.						71.0	71.0	71.0					2																	152420390		1965	4171	6136	SO:0001583	missense	4703	exon118			AGCGCTCATCCAG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.13423G>A	2.37:g.152420390C>T	ENSP00000172853:p.Glu4475Lys	Somatic	163	0	0		WXS	Illumina HiSeq	Phase_I	129	23	0.178295	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	C	16.23	3.064033	0.55432	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.06528	3.4;3.39;3.39;3.29;3.4	5.67	5.67	0.87782	.	0.178823	0.50627	D	0.000102	T	0.06508	0.0167	N	0.25647	0.755	0.80722	D	1	B;P	0.37573	0.043;0.6	B;B	0.42625	0.179;0.393	T	0.29610	-1.0006	10	0.06625	T	0.88	.	14.9243	0.70866	0.0:0.7397:0.2603:0.0	.	4475;906	P20929;Q14215	NEBU_HUMAN;.	K	4475;6176;6176;524;906;4475	ENSP00000386259:E4475K;ENSP00000380505:E6176K;ENSP00000416578:E6176K;ENSP00000410961:E906K;ENSP00000172853:E4475K	ENSP00000172853:E4475K	E	-	1	0	NEB	152128636	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.020000	0.49643	2.834000	0.97654	0.650000	0.86243	GAG	.	.	none		0.463	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
CAST	831	hgsc.bcm.edu	37	5	96073629	96073629	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:96073629C>T	ENST00000341926.3	+	9	689	c.527C>T	c.(526-528)aCg>aTg	p.T176M	CAST_ENST00000511782.1_Missense_Mutation_p.T162M|CAST_ENST00000508830.1_Missense_Mutation_p.T259M|CAST_ENST00000359176.4_Missense_Mutation_p.T240M|CAST_ENST00000509903.1_Missense_Mutation_p.T154M|CAST_ENST00000395813.1_Missense_Mutation_p.T259M|CAST_ENST00000348386.3_3'UTR|CAST_ENST00000511049.1_Missense_Mutation_p.T162M|CAST_ENST00000504465.1_Missense_Mutation_p.T104M|CAST_ENST00000309190.5_Missense_Mutation_p.T154M|CAST_ENST00000510756.1_Missense_Mutation_p.T237M|CAST_ENST00000338252.3_Missense_Mutation_p.T176M|CAST_ENST00000508608.1_Missense_Mutation_p.T222M|CAST_ENST00000325674.7_Missense_Mutation_p.T237M|CAST_ENST00000395812.2_Missense_Mutation_p.T218M			P20810	ICAL_HUMAN	calpastatin	176					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)	p.T154M(1)		breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		GAAAATACAACGTATACTGGA	0.373																																					p.T218M		Atlas-SNP	.											CAST,NS,carcinoma,0,2	CAST	58	2	1	Substitution - Missense(1)	endometrium(1)	c.C653T						PASS	.						119.0	126.0	123.0					5																	96073629		2203	4300	6503	SO:0001583	missense	831	exon9			ATACAACGTATAC	AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000341926.3:c.527C>T	5.37:g.96073629C>T	ENSP00000339914:p.Thr176Met	Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	61	17	0.278689	NM_001042440	B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	Missense_Mutation	SNP	ENST00000341926.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.531|9.531	1.110739|1.110739	0.20714|0.20714	.|.	.|.	ENSG00000153113|ENSG00000153113	ENST00000512620|ENST00000505143;ENST00000338252;ENST00000508830;ENST00000511097;ENST00000395813;ENST00000359176;ENST00000325674;ENST00000395812;ENST00000421689;ENST00000510756;ENST00000508608;ENST00000341926;ENST00000511049;ENST00000309190;ENST00000510156;ENST00000504465;ENST00000509903;ENST00000511782;ENST00000508197	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.17370	.|2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28	5.4|5.4	2.27|2.27	0.28462|0.28462	.|.	.|1.563230	.|0.03377	.|N	.|0.199788	T|T	0.28034|0.28034	0.0691|0.0691	L|L	0.44542|0.44542	1.39|1.39	0.09310|0.09310	N|N	1|1	.|D;P;B;D;P;D;D;D;D;D;D;D;D;D	.|0.64830	.|0.988;0.905;0.04;0.994;0.942;0.99;0.988;0.971;0.988;0.989;0.994;0.985;0.98;0.982	.|P;P;B;P;P;P;P;P;P;P;P;P;P;P	.|0.58013	.|0.727;0.607;0.017;0.787;0.714;0.686;0.682;0.714;0.76;0.747;0.831;0.599;0.747;0.686	T|T	0.07233|0.07233	-1.0783|-1.0783	5|10	.|0.46703	.|T	.|0.11	1.6995|1.6995	4.6011|4.6011	0.12354|0.12354	0.1838:0.5991:0.1273:0.0898|0.1838:0.5991:0.1273:0.0898	.|.	.|104;24;154;222;154;154;135;176;237;218;240;237;259;176	.|E9PDE4;B7Z8S8;B7Z5T6;B7Z468;E9PCH5;G5E946;P20810-4;P20810;P20810-5;G5E9D3;P20810-7;E7ESM9;P20810-6;P20810-2	.|.;.;.;.;.;.;.;ICAL_HUMAN;.;.;.;.;.;.	C|M	193|254;176;259;237;259;240;237;218;240;237;222;176;162;154;176;104;154;162;127	.|ENSP00000422957:T254M;ENSP00000343421:T176M;ENSP00000425721:T259M;ENSP00000422951:T237M;ENSP00000379158:T259M;ENSP00000352098:T240M;ENSP00000320319:T237M;ENSP00000379157:T218M;ENSP00000396558:T240M;ENSP00000422176:T237M;ENSP00000422677:T222M;ENSP00000339914:T176M;ENSP00000421130:T162M;ENSP00000312523:T154M;ENSP00000422325:T176M;ENSP00000425670:T104M;ENSP00000426946:T154M;ENSP00000423638:T162M;ENSP00000422831:T127M	.|ENSP00000312523:T154M	R|T	+|+	1|2	0|0	CAST|CAST	96099385|96099385	0.000000|0.000000	0.05858|0.05858	0.037000|0.037000	0.18230|0.18230	0.049000|0.049000	0.14656|0.14656	-1.415000|-1.415000	0.02469|0.02469	0.641000|0.641000	0.30601|0.30601	0.655000|0.655000	0.94253|0.94253	CGT|ACG	.	.	none		0.373	CAST-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000250199.2	NM_173062	
H1FOO	132243	hgsc.bcm.edu	37	3	129266464	129266464	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:129266464C>T	ENST00000324382.2	+	2	324	c.319C>T	c.(319-321)Cgt>Tgt	p.R107C	H1FOO_ENST00000503977.1_5'Flank	NM_153833.1	NP_722575.1	Q8IZA3	H1FOO_HUMAN	H1 histone family, member O, oocyte-specific	107	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				meiotic nuclear division (GO:0007126)|negative regulation of stem cell differentiation (GO:2000737)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of DNA methylation (GO:0044030)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|female germ cell nucleus (GO:0001674)|nucleosome (GO:0000786)|nucleus (GO:0005634)	nucleosomal DNA binding (GO:0031492)			endometrium(1)|lung(4)|skin(1)	6						TGGCATGCGCCGTGGCCTCCT	0.622																																					p.R107C		Atlas-SNP	.											.	H1FOO	20	.	0			c.C319T						PASS	.						12.0	8.0	9.0					3																	129266464		1984	3937	5921	SO:0001583	missense	132243	exon2			ATGCGCCGTGGCC	AY158091	CCDS3064.1	3q21.3	2011-01-27			ENSG00000178804	ENSG00000178804		"""Histones / Replication-independent"""	18463	protein-coding gene	gene with protein product						12408966	Standard	NM_153833		Approved		uc003emu.3	Q8IZA3	OTTHUMG00000159541	ENST00000324382.2:c.319C>T	3.37:g.129266464C>T	ENSP00000319799:p.Arg107Cys	Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	47	24	0.510638	NM_153833	Q86WT7	Missense_Mutation	SNP	ENST00000324382.2	37	CCDS3064.1	.	.	.	.	.	.	.	.	.	.	C	11.20	1.569113	0.28003	.	.	ENSG00000178804	ENST00000324382	T	0.22743	1.94	5.56	3.63	0.41609	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.569731	0.17640	N	0.167052	T	0.25382	0.0617	M	0.64404	1.975	0.09310	N	1	P	0.52061	0.95	P	0.47206	0.541	T	0.16482	-1.0401	10	0.87932	D	0	-3.2272	5.9767	0.19385	0.2261:0.5766:0.1234:0.074	.	107	Q8IZA3	H1FOO_HUMAN	C	107	ENSP00000319799:R107C	ENSP00000319799:R107C	R	+	1	0	H1FOO	130749154	0.000000	0.05858	0.015000	0.15790	0.063000	0.16089	0.176000	0.16782	1.323000	0.45263	0.655000	0.94253	CGT	.	.	none		0.622	H1FOO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356100.3	NM_153833	
XRN1	54464	hgsc.bcm.edu	37	3	142123761	142123761	+	Missense_Mutation	SNP	C	C	T	rs150688965		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:142123761C>T	ENST00000264951.4	-	16	1988	c.1871G>A	c.(1870-1872)cGa>cAa	p.R624Q	RNU6-1294P_ENST00000515995.1_RNA|XRN1_ENST00000392981.2_Missense_Mutation_p.R624Q	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	624					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TGTACAACATCGTTCTATGGC	0.418																																					p.R624Q		Atlas-SNP	.											.	XRN1	138	.	0			c.G1871A						PASS	.	C	GLN/ARG,GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	98.0	85.0	89.0		1871,1871	3.4	0.8	3	dbSNP_134	89	0,8600		0,0,4300	no	missense,missense	XRN1	NM_001042604.1,NM_019001.3	43,43	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign,benign	624/1694,624/1707	142123761	2,13004	2203	4300	6503	SO:0001583	missense	54464	exon16			CAACATCGTTCTA	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1871G>A	3.37:g.142123761C>T	ENSP00000264951:p.Arg624Gln	Somatic	146	0	0		WXS	Illumina HiSeq	Phase_I	157	32	0.203822	NM_001042604	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	C	14.45	2.538979	0.45176	4.54E-4	0.0	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.22945	1.93;1.93	5.53	3.41	0.39046	.	0.475762	0.20827	N	0.084957	T	0.19248	0.0462	L	0.39397	1.21	0.19945	N	0.999948	B;B;B	0.21905	0.021;0.062;0.037	B;B;B	0.19946	0.002;0.027;0.012	T	0.18587	-1.0332	10	0.13470	T	0.59	-1.414	11.6559	0.51318	0.0:0.7832:0.0:0.2168	.	485;624;624	B3KW17;Q8IZH2-2;Q8IZH2	.;.;XRN1_HUMAN	Q	624	ENSP00000264951:R624Q;ENSP00000376707:R624Q	ENSP00000264951:R624Q	R	-	2	0	XRN1	143606451	0.041000	0.20044	0.845000	0.33349	0.932000	0.56968	0.215000	0.17562	1.332000	0.45431	0.650000	0.86243	CGA	C|1.000;T|0.000	0.000	weak		0.418	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
TNFRSF6B	8771	hgsc.bcm.edu	37	20	62328311	62328311	+	Missense_Mutation	SNP	G	G	T	rs61760056		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr20:62328311G>T	ENST00000369996.1	+	1	291	c.191G>T	c.(190-192)cGa>cTa	p.R64L	ARFRP1_ENST00000485858.1_5'Flank|RTEL1-TNFRSF6B_ENST00000482936.1_Silent_p.P1366P|RTEL1_ENST00000318100.4_Silent_p.P1366P	NM_003823.3	NP_003814.1	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily, member 6b, decoy	64					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	extracellular space (GO:0005615)	receptor activity (GO:0004872)			central_nervous_system(1)|lung(2)|skin(1)	4	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)			CCGTGCCGCCGAGACAGCCCC	0.687																																					p.R64L		Atlas-SNP	.											.	TNFRSF6B	22	.	0			c.G191T						PASS	.						19.0	22.0	21.0					20																	62328311		2180	4277	6457	SO:0001583	missense	8771	exon1			GCCGCCGAGACAG	AF104419	CCDS13532.1	20q13.33	2012-06-27						"""Tumor necrosis factor receptor superfamily"""	11921	protein-coding gene	gene with protein product		603361				9872321, 10318773	Standard	NM_003823		Approved	DcR3, DCR3, TR6, M68	uc002yfz.3	O95407	OTTHUMG00000143724	ENST00000369996.1:c.191G>T	20.37:g.62328311G>T	ENSP00000359013:p.Arg64Leu	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	62	20	0.322581	NM_003823		Missense_Mutation	SNP	ENST00000369996.1	37	CCDS13532.1	.	.	.	.	.	.	.	.	.	.	G	8.280	0.815343	0.16607	.	.	ENSG00000243509	ENST00000370006;ENST00000369996;ENST00000342852	T	0.75704	-0.96	3.89	-1.07	0.09968	TNFR/CD27/30/40/95 cysteine-rich region (1);	.	.	.	.	T	0.56790	0.2009	L	0.38531	1.155	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.43877	-0.9364	9	0.40728	T	0.16	-8.2878	1.7996	0.03068	0.2662:0.2449:0.3654:0.1235	.	64	O95407	TNF6B_HUMAN	L	64	ENSP00000359013:R64L	ENSP00000342328:R64L	R	+	2	0	TNFRSF6B	61798755	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.243000	0.08915	0.132000	0.18615	0.561000	0.74099	CGA	.	.	alt		0.687	TNFRSF6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080182.1		
C8orf48	157773	hgsc.bcm.edu	37	8	13425042	13425042	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:13425042T>C	ENST00000297324.4	+	1	691	c.542T>C	c.(541-543)aTg>aCg	p.M181T	RP11-145O15.3_ENST00000529018.1_RNA	NM_001007090.2	NP_001007091	Q96LL4	CH048_HUMAN	chromosome 8 open reading frame 48	181										NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	5						TTTAAAAACATGAGGACAACG	0.438																																					p.M181T		Atlas-SNP	.											C8orf48,NS,carcinoma,-1,1	C8orf48	18	1	0			c.T542C						PASS	.						154.0	139.0	143.0					8																	13425042		692	1591	2283	SO:0001583	missense	157773	exon1			AAAACATGAGGAC	AK058131	CCDS47809.1	8p22	2012-04-13			ENSG00000164743	ENSG00000164743			26345	protein-coding gene	gene with protein product						12477932	Standard	NM_001007090		Approved	FLJ25402	uc003wwp.3	Q96LL4	OTTHUMG00000165482	ENST00000297324.4:c.542T>C	8.37:g.13425042T>C	ENSP00000297324:p.Met181Thr	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	65	16	0.246154	NM_001007090	Q96LJ9	Missense_Mutation	SNP	ENST00000297324.4	37	CCDS47809.1	.	.	.	.	.	.	.	.	.	.	T	6.685	0.494987	0.12702	.	.	ENSG00000164743	ENST00000297324	T	0.30182	1.54	5.22	-0.557	0.11800	.	1.330310	0.05344	N	0.530638	T	0.22322	0.0538	L	0.39020	1.185	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.24693	-1.0153	10	0.34782	T	0.22	0.2237	4.4298	0.11522	0.0:0.3545:0.1781:0.4674	.	181	Q96LL4	CH048_HUMAN	T	181	ENSP00000297324:M181T	ENSP00000297324:M181T	M	+	2	0	C8orf48	13469413	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	0.396000	0.20867	-0.138000	0.11434	0.533000	0.62120	ATG	.	.	none		0.438	C8orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384400.1	NM_001007090	
SLC7A13	157724	hgsc.bcm.edu	37	8	87235201	87235201	+	Splice_Site	SNP	C	C	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:87235201C>A	ENST00000297524.3	-	2	920	c.817G>T	c.(817-819)Gat>Tat	p.D273Y	SLC7A13_ENST00000419776.2_Splice_Site_p.D264Y|SLC7A13_ENST00000520624.1_5'UTR	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	273						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						GCATACAAACCTGAAGAGAGA	0.373																																					p.D273Y		Atlas-SNP	.											.	SLC7A13	97	.	0			c.G817T						PASS	.						114.0	117.0	116.0					8																	87235201		2203	4300	6503	SO:0001630	splice_region_variant	157724	exon2			ACAAACCTGAAGA	AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.817+1G>T	8.37:g.87235201C>A		Somatic	122	0	0		WXS	Illumina HiSeq	Phase_I	86	16	0.186047	NM_138817	Q05C37|Q08AH9|Q96N84	Missense_Mutation	SNP	ENST00000297524.3	37	CCDS34917.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.209895	0.58343	.	.	ENSG00000164893	ENST00000297524;ENST00000419776	D;D	0.90620	-2.7;-2.7	4.36	4.36	0.52297	Amino acid permease domain (1);	0.363429	0.26019	N	0.026835	D	0.95089	0.8409	M	0.83774	2.66	0.36861	D	0.888401	D;D	0.89917	0.989;1.0	D;D	0.79108	0.947;0.992	D	0.96707	0.9522	9	.	.	.	.	14.4409	0.67318	0.0:1.0:0.0:0.0	.	264;273	Q8TCU3-2;Q8TCU3	.;S7A13_HUMAN	Y	273;264	ENSP00000297524:D273Y;ENSP00000410982:D264Y	.	D	-	1	0	SLC7A13	87304317	1.000000	0.71417	0.998000	0.56505	0.714000	0.41099	3.140000	0.50585	2.266000	0.75297	0.650000	0.86243	GAT	.	.	none		0.373	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374704.1	NM_138817	Missense_Mutation
EXT1	2131	hgsc.bcm.edu	37	8	118830723	118830723	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:118830723C>G	ENST00000378204.2	-	7	2389	c.1583G>C	c.(1582-1584)cGc>cCc	p.R528P		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	528					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			GGCAGGCCAGCGGTGTTTGGC	0.512			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																												p.R528P		Atlas-SNP	.	yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	.	EXT1	98	.	0			c.G1583C						PASS	.						131.0	131.0	131.0					8																	118830723		2203	4300	6503	SO:0001583	missense	2131	exon7	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	GGCCAGCGGTGTT	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.1583G>C	8.37:g.118830723C>G	ENSP00000367446:p.Arg528Pro	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	56	15	0.267857	NM_000127	B2R7V2|Q9BVI9	Missense_Mutation	SNP	ENST00000378204.2	37	CCDS6324.1	.	.	.	.	.	.	.	.	.	.	c	32	5.188410	0.94923	.	.	ENSG00000182197	ENST00000378204	T	0.77750	-1.12	5.44	5.44	0.79542	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.88955	0.6578	M	0.82517	2.595	0.80722	D	1	D	0.62365	0.991	D	0.69479	0.964	D	0.88651	0.3182	10	0.48119	T	0.1	1.1966	19.6267	0.95680	0.0:1.0:0.0:0.0	.	528	Q16394	EXT1_HUMAN	P	528	ENSP00000367446:R528P	ENSP00000367446:R528P	R	-	2	0	EXT1	118899904	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.442000	0.80503	2.712000	0.92718	0.563000	0.77884	CGC	.	.	none		0.512	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132768.3	NM_000127	
OLFM1	10439	hgsc.bcm.edu	37	9	138011665	138011665	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr9:138011665G>A	ENST00000371793.3	+	6	1350	c.1099G>A	c.(1099-1101)Gtg>Atg	p.V367M	OLFM1_ENST00000252854.4_Missense_Mutation_p.V349M|OLFM1_ENST00000371796.3_Missense_Mutation_p.V340M	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	367	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		GCTGTGGGCCGTGTACGCCAC	0.627																																					p.V349M		Atlas-SNP	.											.	OLFM1	57	.	0			c.G1045A						PASS	.						77.0	60.0	66.0					9																	138011665		2203	4300	6503	SO:0001583	missense	10439	exon6			TGGGCCGTGTACG	AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371793.3:c.1099G>A	9.37:g.138011665G>A	ENSP00000360858:p.Val367Met	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	85	59	0.694118	NM_014279	Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Missense_Mutation	SNP	ENST00000371793.3	37		.	.	.	.	.	.	.	.	.	.	G	21.7	4.190584	0.78789	.	.	ENSG00000130558	ENST00000252854;ENST00000371796;ENST00000371793	D;D;D	0.90676	-2.71;-2.71;-2.71	5.07	5.07	0.68467	Olfactomedin-like (3);Quinonprotein alcohol dehydrogenase-like (1);	0.061993	0.64402	D	0.000004	D	0.95089	0.8409	M	0.75447	2.3	0.58432	D	0.999999	D;D	0.89917	0.989;1.0	P;D	0.74348	0.874;0.983	D	0.95612	0.8673	10	0.87932	D	0	.	18.4324	0.90630	0.0:0.0:1.0:0.0	.	367;349	Q99784;Q6IMJ8	NOE1_HUMAN;.	M	349;340;367	ENSP00000252854:V349M;ENSP00000360861:V340M;ENSP00000360858:V367M	ENSP00000252854:V349M	V	+	1	0	OLFM1	137151486	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	9.571000	0.98176	2.357000	0.79964	0.561000	0.74099	GTG	.	.	none		0.627	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000054974.1	NM_014279	
DDX24	57062	hgsc.bcm.edu	37	14	94545834	94545834	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr14:94545834C>T	ENST00000330836.5	-	2	386	c.255G>A	c.(253-255)gaG>gaA	p.E85E	IFI27L1_ENST00000556381.1_5'Flank|IFI27L1_ENST00000557218.1_5'Flank|DDX24_ENST00000555054.1_Silent_p.E42E|DDX24_ENST00000544005.1_Intron|IFI27L1_ENST00000554544.1_5'Flank|IFI27L1_ENST00000555523.1_5'Flank|IFI27L1_ENST00000557066.1_5'Flank|IFI27L1_ENST00000393115.3_5'Flank|IFI27L1_ENST00000553664.1_5'Flank	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	85	Poly-Glu.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		CCTCCTCCTCCTCTTCTTCTG	0.438																																					p.E85E		Atlas-SNP	.											DDX24,NS,carcinoma,-2,1	DDX24	82	1	0			c.G255A						scavenged	.						165.0	161.0	163.0					14																	94545834		2203	4300	6503	SO:0001819	synonymous_variant	57062	exon2			CTCCTCCTCTTCT	AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.255G>A	14.37:g.94545834C>T		Somatic	69	1	0.0144928		WXS	Illumina HiSeq	Phase_I	91	4	0.043956	NM_020414	E7EMJ4|Q4V9L5	Silent	SNP	ENST00000330836.5	37	CCDS9918.1																																																																																			.	.	none		0.438	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412861.1	NM_020414	
PCDHA7	56141	hgsc.bcm.edu	37	5	140216133	140216133	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:140216133G>T	ENST00000525929.1	+	1	2165	c.2165G>T	c.(2164-2166)cGg>cTg	p.R722L	PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.R722L|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	722					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGGCGTTGCGGTGCTCAGCG	0.617																																					p.R722L	NSCLC(160;258 2013 5070 22440 28951)	Atlas-SNP	.											PCDHA7_ENST00000525929,NS,carcinoma,+1,2	PCDHA7	367	2	0			c.G2165T						scavenged	.						98.0	83.0	88.0					5																	140216133		2203	4300	6503	SO:0001583	missense	56141	exon1			CGTTGCGGTGCTC	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.2165G>T	5.37:g.140216133G>T	ENSP00000436426:p.Arg722Leu	Somatic	118	0	0		WXS	Illumina HiSeq	Phase_I	94	3	0.0319149	NM_031852	O75282	Missense_Mutation	SNP	ENST00000525929.1	37	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.055633	0.55325	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.17213	2.29;2.29	3.57	3.57	0.40892	.	0.000000	0.29431	U	0.012169	T	0.45478	0.1344	M	0.93594	3.435	0.29044	N	0.884948	P;D	0.60160	0.906;0.987	P;P	0.60789	0.733;0.879	T	0.52953	-0.8506	10	0.87932	D	0	.	10.5413	0.45035	0.1008:0.0:0.8992:0.0	.	722;722	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	L	722	ENSP00000436426:R722L;ENSP00000367365:R722L	ENSP00000367365:R722L	R	+	2	0	PCDHA7	140196317	0.826000	0.29277	0.959000	0.39883	0.458000	0.32498	1.299000	0.33424	1.968000	0.57251	0.462000	0.41574	CGG	.	.	none		0.617	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
SLC5A12	159963	hgsc.bcm.edu	37	11	26743090	26743090	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:26743090T>C	ENST00000396005.3	-	1	481	c.172A>G	c.(172-174)Aca>Gca	p.T58A	SLC5A12_ENST00000280467.6_Missense_Mutation_p.T58A	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	58					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						AAGCTGGCTGTCAGAGACAAG	0.517																																					p.T58A		Atlas-SNP	.											.	SLC5A12	134	.	0			c.A172G						PASS	.						68.0	68.0	68.0					11																	26743090		2203	4299	6502	SO:0001583	missense	159963	exon1			TGGCTGTCAGAGA	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.172A>G	11.37:g.26743090T>C	ENSP00000379326:p.Thr58Ala	Somatic	207	1	0.00483092		WXS	Illumina HiSeq	Phase_I	218	107	0.490826	NM_178498	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	37	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	T	15.48	2.845233	0.51164	.	.	ENSG00000148942	ENST00000396005;ENST00000280467	D;D	0.86497	-2.13;-2.13	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.88115	0.6350	L	0.39514	1.22	0.58432	D	0.999997	B;P	0.43701	0.074;0.815	B;P	0.54706	0.043;0.759	D	0.85149	0.0985	10	0.19147	T	0.46	.	15.7638	0.78110	0.0:0.0:0.0:1.0	.	58;58	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	A	58	ENSP00000379326:T58A;ENSP00000280467:T58A	ENSP00000280467:T58A	T	-	1	0	SLC5A12	26699666	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.066000	0.64351	2.135000	0.66039	0.477000	0.44152	ACA	.	.	none		0.517	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
LRRC61	65999	hgsc.bcm.edu	37	7	150034703	150034703	+	Silent	SNP	G	G	A	rs149223172	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr7:150034703G>A	ENST00000359623.4	+	3	1341	c.753G>A	c.(751-753)gcG>gcA	p.A251A	LRRC61_ENST00000323078.7_Silent_p.A251A|LRRC61_ENST00000493307.1_Silent_p.A251A	NM_001142928.1	NP_001136400.1	Q9BV99	LRC61_HUMAN	leucine rich repeat containing 61	251										endometrium(2)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(82;0.011)			TCAGCTCTGCGGGCCCCACCT	0.682													G|||	12	0.00239617	0.0	0.0014	5008	,	,		17182	0.0		0.001	False		,,,				2504	0.0102				p.A251A		Atlas-SNP	.											.	LRRC61	17	.	0			c.G753A						PASS	.	G	,	0,4224		0,0,2112	15.0	15.0	15.0		753,753	-7.9	0.0	7	dbSNP_134	15	18,8284		0,18,4133	no	coding-synonymous,coding-synonymous	LRRC61	NM_001142928.1,NM_023942.2	,	0,18,6245	AA,AG,GG		0.2168,0.0,0.1437	,	251/260,251/260	150034703	18,12508	2112	4151	6263	SO:0001819	synonymous_variant	65999	exon2			CTCTGCGGGCCCC	BC001354	CCDS5901.1	7q31-q35	2006-02-07			ENSG00000127399	ENSG00000127399			21704	protein-coding gene	gene with protein product							Standard	NM_023942		Approved	MGC3036, FLJ31392, HSPC295	uc003wgv.4	Q9BV99	OTTHUMG00000158326	ENST00000359623.4:c.753G>A	7.37:g.150034703G>A		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	33	16	0.484848	NM_023942	B3KUW0|D3DWY8	Silent	SNP	ENST00000359623.4	37	CCDS5901.1																																																																																			G|0.998;A|0.002	0.002	strong		0.682	LRRC61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350696.1	NM_023942	
HIST1H2BM	8342	hgsc.bcm.edu	37	6	27782969	27782969	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:27782969C>T	ENST00000359465.4	+	1	148	c.148C>T	c.(148-150)Cac>Tac	p.H50Y	HIST1H2AJ_ENST00000333151.3_5'Flank	NM_003521.2	NP_003512.1	Q99879	H2B1M_HUMAN	histone cluster 1, H2bm	50					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.H50Y(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	12						GAAGCAGGTCCACCCCGACAC	0.542																																					p.H50Y		Atlas-SNP	.											HIST1H2BM,NS,malignant_melanoma,0,1	HIST1H2BM	36	1	1	Substitution - Missense(1)	NS(1)	c.C148T						PASS	.						198.0	187.0	191.0					6																	27782969		2203	4300	6503	SO:0001583	missense	8342	exon1			CAGGTCCACCCCG	Z83738	CCDS4629.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000196374	ENSG00000273703		"""Histones / Replication-dependent"""	4750	protein-coding gene	gene with protein product		602802	"""H2B histone family, member E"", ""histone 1, H2bm"""	H2BFE		9439656, 12408966	Standard	NM_003521		Approved	H2B/e, dJ160A22.3	uc003njo.3	Q99879	OTTHUMG00000014489	ENST00000359465.4:c.148C>T	6.37:g.27782969C>T	ENSP00000352442:p.His50Tyr	Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	65	17	0.261538	NM_003521	Q6NWQ3	Missense_Mutation	SNP	ENST00000359465.4	37	CCDS4629.1	.	.	.	.	.	.	.	.	.	.	.	5.665	0.307325	0.10733	.	.	ENSG00000196374	ENST00000359465	T	0.23754	1.89	4.29	2.43	0.29744	Histone-fold (2);Histone core (1);	0.000000	0.64402	U	0.000009	T	0.29850	0.0746	M	0.94021	3.485	0.51482	D	0.999929	P	0.36535	0.557	B	0.41917	0.37	T	0.23404	-1.0189	10	0.66056	D	0.02	.	10.2104	0.43136	0.1534:0.6988:0.1478:0.0	.	50	Q99879	H2B1M_HUMAN	Y	50	ENSP00000352442:H50Y	ENSP00000352442:H50Y	H	+	1	0	HIST1H2BM	27890948	1.000000	0.71417	0.954000	0.39281	0.007000	0.05969	5.538000	0.67193	0.512000	0.28257	-0.309000	0.09137	CAC	.	.	none		0.542	HIST1H2BM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040157.1	NM_003521	
CYTH4	27128	hgsc.bcm.edu	37	22	37707035	37707035	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr22:37707035G>T	ENST00000248901.6	+	10	1002	c.815G>T	c.(814-816)cGc>cTc	p.R272L		NM_013385.3	NP_037517.1	Q9UIA0	CYH4_HUMAN	cytohesin 4	272	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.|Phosphatidylinositol 3,4,5-trisphosphate binding. {ECO:0000250}.				positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(2)|stomach(1)	15						GCAGGGGGCCGCGTGAAGACG	0.617																																					p.R272L		Atlas-SNP	.											CYTH4,NS,carcinoma,+1,1	CYTH4	51	1	0			c.G815T						scavenged	.						150.0	124.0	133.0					22																	37707035		2203	4300	6503	SO:0001583	missense	27128	exon10			GGGGCCGCGTGAA	AF075458	CCDS13946.1	22q12.3-q13.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000100055	ENSG00000100055		"""Pleckstrin homology (PH) domain containing"""	9505	protein-coding gene	gene with protein product		606514	"""pleckstrin homology, Sec7 and coiled/coil domains 4"", ""pleckstrin homology, Sec7 and coiled-coil domains 4"""	PSCD4		10591208	Standard	NM_013385		Approved	CYT4, cytohesin-4	uc003arf.3	Q9UIA0	OTTHUMG00000150562	ENST00000248901.6:c.815G>T	22.37:g.37707035G>T	ENSP00000248901:p.Arg272Leu	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	63	2	0.031746	NM_013385	Q5R3F9|Q9UGT6	Missense_Mutation	SNP	ENST00000248901.6	37	CCDS13946.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117334	0.77323	.	.	ENSG00000100055	ENST00000248901	T	0.74002	-0.8	4.52	4.52	0.55395	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.74321	0.3701	L	0.60957	1.885	0.80722	D	1	B	0.28552	0.215	B	0.35510	0.204	T	0.74697	-0.3578	10	0.46703	T	0.11	.	16.3829	0.83481	0.0:0.0:1.0:0.0	.	272	Q9UIA0	CYH4_HUMAN	L	272	ENSP00000248901:R272L	ENSP00000248901:R272L	R	+	2	0	CYTH4	36036981	0.998000	0.40836	0.989000	0.46669	0.982000	0.71751	7.930000	0.87610	2.200000	0.70718	0.655000	0.94253	CGC	.	.	none		0.617	CYTH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318917.1		
PLEC	5339	hgsc.bcm.edu	37	8	144994192	144994192	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:144994192T>C	ENST00000322810.4	-	32	10377	c.10208A>G	c.(10207-10209)cAg>cGg	p.Q3403R	PLEC_ENST00000354958.2_Missense_Mutation_p.Q3244R|PLEC_ENST00000357649.2_Missense_Mutation_p.Q3270R|PLEC_ENST00000354589.3_Missense_Mutation_p.Q3266R|PLEC_ENST00000356346.3_Missense_Mutation_p.Q3252R|PLEC_ENST00000398774.2_Missense_Mutation_p.Q3234R|PLEC_ENST00000436759.2_Missense_Mutation_p.Q3293R|PLEC_ENST00000527096.1_Missense_Mutation_p.Q3289R|PLEC_ENST00000345136.3_Missense_Mutation_p.Q3266R	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3403	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTCCTGCCGCTGCTCCGCAGT	0.597																																					p.Q3403R		Atlas-SNP	.											.	PLEC	1144	.	0			c.A10208G						PASS	.						57.0	65.0	62.0					8																	144994192		2176	4269	6445	SO:0001583	missense	5339	exon32			TGCCGCTGCTCCG	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10208A>G	8.37:g.144994192T>C	ENSP00000323856:p.Gln3403Arg	Somatic	65	0	0		WXS	Illumina HiSeq	Phase_I	58	12	0.206897	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	T	7.769	0.707022	0.15239	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.76709	-1.01;-1.01;-1.04;-1.04;-1.02;-1.01;-1.01;-1.01;-1.01	4.76	1.01	0.19927	.	0.000000	0.64402	U	0.000010	T	0.63367	0.2505	L	0.41356	1.27	0.42614	D	0.993327	B;B;B;B;B;B;B;B	0.12630	0.005;0.005;0.005;0.006;0.005;0.005;0.005;0.005	B;B;B;B;B;B;B;B	0.09377	0.004;0.004;0.004;0.002;0.004;0.004;0.004;0.004	T	0.53851	-0.8380	10	0.48119	T	0.1	.	4.852	0.13542	0.1389:0.1579:0.0:0.7033	.	3293;3252;3244;3403;3234;3266;3270;3266	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	R	3266;3270;3266;3234;3403;3244;3252;3293;3289	ENSP00000344848:Q3266R;ENSP00000350277:Q3270R;ENSP00000346602:Q3266R;ENSP00000381756:Q3234R;ENSP00000323856:Q3403R;ENSP00000347044:Q3244R;ENSP00000348702:Q3252R;ENSP00000388180:Q3293R;ENSP00000434583:Q3289R	ENSP00000323856:Q3403R	Q	-	2	0	PLEC	145066180	1.000000	0.71417	0.988000	0.46212	0.551000	0.35334	4.721000	0.61951	0.252000	0.21531	0.368000	0.22195	CAG	.	.	none		0.597	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
LANCL3	347404	hgsc.bcm.edu	37	X	37431669	37431669	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chrX:37431669G>A	ENST00000378619.3	+	1	765	c.546G>A	c.(544-546)ctG>ctA	p.L182L	LANCL3_ENST00000378621.3_Silent_p.L182L|TM4SF2_ENST00000465127.1_Intron	NM_001170331.1	NP_001163802.1	Q6ZV70	LANC3_HUMAN	LanC lantibiotic synthetase component C-like 3 (bacterial)	182							catalytic activity (GO:0003824)			lung(4)|pancreas(1)	5						GTGCCGCGCTGGTGCTCAAGC	0.711																																					p.L182L		Atlas-SNP	.											.	LANCL3	42	.	0			c.G546A						PASS	.						4.0	5.0	5.0					X																	37431669		2102	4096	6198	SO:0001819	synonymous_variant	347404	exon1			CGCGCTGGTGCTC	AK124915	CCDS14240.1, CCDS55398.1	Xp21.1	2008-02-05			ENSG00000147036	ENSG00000147036			24767	protein-coding gene	gene with protein product							Standard	NM_198511		Approved	FLJ42925	uc011mkd.2	Q6ZV70	OTTHUMG00000033177	ENST00000378619.3:c.546G>A	X.37:g.37431669G>A		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	75	61	0.813333	NM_001170331	A6NHE3	Silent	SNP	ENST00000378619.3	37	CCDS55398.1																																																																																			.	.	none		0.711	LANCL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080885.1	NM_198511	
FAM104B	90736	hgsc.bcm.edu	37	X	55187411	55187411	+	Intron	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chrX:55187411C>T	ENST00000358460.4	-	1	174				FAM104B_ENST00000477847.2_Missense_Mutation_p.C3Y|FAM104B_ENST00000472571.2_Intron|FAM104B_ENST00000332132.4_Intron|FAM104B_ENST00000489298.1_5'UTR|FAM104B_ENST00000478918.1_5'Flank|FAM104B_ENST00000425133.2_Intron			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B											endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						CTGTCACCTGCAGGTCATGAG	0.592																																					p.C3Y		Atlas-SNP	.											.	FAM104B	28	.	0			c.G8A						PASS	.						44.0	44.0	44.0					X																	55187411		692	1591	2283	SO:0001627	intron_variant	90736	exon1			CACCTGCAGGTCA	BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.20+158G>A	X.37:g.55187411C>T		Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	32	25	0.78125	NM_001166702	A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Missense_Mutation	SNP	ENST00000358460.4	37	CCDS35305.2	.	.	.	.	.	.	.	.	.	.	c	6.691	0.496119	0.12762	.	.	ENSG00000182518	ENST00000477847	T	0.41400	1.0	1.76	-0.296	0.12824	.	.	.	.	.	T	0.19805	0.0476	N	0.08118	0	0.09310	N	0.999992	.	.	.	.	.	.	T	0.27706	-1.0066	6	.	.	.	.	7.3096	0.26467	0.0:0.4049:0.5951:0.0	.	.	.	.	Y	3	ENSP00000421161:C3Y	.	C	-	2	0	FAM104B	55204136	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.057000	0.01395	-0.167000	0.10871	0.292000	0.19580	TGC	.	.	none		0.592	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056851.1	NM_138362	
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643066	1643066	+	Silent	SNP	A	A	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:1643066A>G	ENST00000399682.1	-	1	302	c.258T>C	c.(256-258)ggT>ggC	p.G86G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G86G(1)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCCCCTTGGAACCCCCACAAG	0.667																																					p.G86G		Atlas-SNP	.											KRTAP5-4,NS,carcinoma,0,3	KRTAP5-4	78	3	1	Substitution - coding silent(1)	endometrium(1)	c.T258C						scavenged	.						9.0	15.0	13.0					11																	1643066		683	1577	2260	SO:0001819	synonymous_variant	387267	exon1			CTTGGAACCCCCA	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.258T>C	11.37:g.1643066A>G		Somatic	164	12	0.0731707		WXS	Illumina HiSeq	Phase_I	165	10	0.0606061	NM_001012709		Silent	SNP	ENST00000399682.1	37																																																																																				.	.	none		0.667	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
KIF4B	285643	hgsc.bcm.edu	37	5	154394117	154394117	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:154394117G>T	ENST00000435029.4	+	1	858	c.698G>T	c.(697-699)cGc>cTc	p.R233L		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	233	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.R233H(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGCAGCTTTCGCTCCAAGCTG	0.458																																					p.R233L		Atlas-SNP	.											KIF4B,NS,carcinoma,0,1	KIF4B	307	1	1	Substitution - Missense(1)	ovary(1)	c.G698T						scavenged	.						102.0	100.0	101.0					5																	154394117		2203	4300	6503	SO:0001583	missense	285643	exon1			GCTTTCGCTCCAA	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.698G>T	5.37:g.154394117G>T	ENSP00000387875:p.Arg233Leu	Somatic	285	0	0		WXS	Illumina HiSeq	Phase_I	269	4	0.0148699	NM_001099293		Missense_Mutation	SNP	ENST00000435029.4	37	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	g	6.664	0.491122	0.12702	.	.	ENSG00000226650	ENST00000435029	T	0.71934	-0.61	1.73	0.812	0.18744	Kinesin, motor domain (4);	.	.	.	.	T	0.55909	0.1950	L	0.41415	1.275	0.28492	N	0.914443	B	0.14012	0.009	B	0.23852	0.049	T	0.43589	-0.9382	9	0.14656	T	0.56	.	6.2361	0.20764	0.1823:0.0:0.8177:0.0	.	233	Q2VIQ3	KIF4B_HUMAN	L	233	ENSP00000387875:R233L	ENSP00000387875:R233L	R	+	2	0	KIF4B	154374310	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	1.239000	0.32719	0.293000	0.22520	0.655000	0.94253	CGC	.	.	none		0.458	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		
ZNF626	199777	hgsc.bcm.edu	37	19	20807610	20807610	+	Missense_Mutation	SNP	G	G	C	rs201684374		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr19:20807610G>C	ENST00000601440.1	-	4	1219	c.1073C>G	c.(1072-1074)aCa>aGa	p.T358R	CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001076675.2	NP_001070143.1	Q68DY1	ZN626_HUMAN	zinc finger protein 626	358					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|lung(3)|skin(1)	6						TCTCTTATGTGTAGTAAGGGT	0.383																																					p.T358R		Atlas-SNP	.											ZNF626_ENST00000392298,NS,carcinoma,-1,1	ZNF626	121	1	0			c.C1073G						scavenged	.						83.0	90.0	87.0					19																	20807610		2159	4278	6437	SO:0001583	missense	199777	exon4			TTATGTGTAGTAA	BC007116	CCDS32976.1, CCDS42535.1	19p13.11	2013-01-08				ENSG00000188171		"""Zinc fingers, C2H2-type"", ""-"""	30461	protein-coding gene	gene with protein product						12477932	Standard	NM_145297		Approved		uc002npb.1	Q68DY1		ENST00000601440.1:c.1073C>G	19.37:g.20807610G>C	ENSP00000469958:p.Thr358Arg	Somatic	30	0	0		WXS	Illumina HiSeq	Phase_I	26	3	0.115385	NM_001076675	Q8N8T4|Q96QM1	Missense_Mutation	SNP	ENST00000601440.1	37	CCDS42535.1	.	.	.	.	.	.	.	.	.	.	N	0.006	-2.108601	0.00353	.	.	ENSG00000188171	ENST00000392298;ENST00000453075;ENST00000305570	.	.	.	0.898	-1.8	0.07907	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09247	0.0228	N	0.02721	-0.515	0.09310	N	1	B	0.20887	0.049	B	0.19666	0.026	T	0.31668	-0.9935	8	0.10902	T	0.67	.	2.7962	0.05402	0.4716:0.2552:0.2732:0.0	.	358	Q68DY1	ZN626_HUMAN	R	358;282;358	.	ENSP00000445201:T358R	T	-	2	0	ZNF626	20599450	0.000000	0.05858	0.023000	0.16930	0.023000	0.10783	-12.371000	0.00002	-0.794000	0.04468	-0.795000	0.03280	ACA	.	.	weak		0.383	ZNF626-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447845.2	NM_145297	
FAM157A	728262	hgsc.bcm.edu	37	3	197894668	197894668	+	lincRNA	SNP	G	G	A	rs200450190		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:197894668G>A	ENST00000437428.2	+	0	829							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A									p.R337K(1)		NS(1)|skin(1)	2						TTCCCGCTGAGGTGCCAGAAG	0.607											OREG0016022	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R337K		Atlas-SNP	.											FAM157A,NS,malignant_melanoma,0,1	FAM157A	4	1	1	Substitution - Missense(1)	NS(1)	c.G1010A						scavenged	.						33.0	31.0	31.0					3																	197894668		689	1588	2277			728262	exon5			CGCTGAGGTGCCA			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197894668G>A		Somatic	384	3	0.0078125	2094	WXS	Illumina HiSeq	Phase_I	457	11	0.02407	NM_001145248		Missense_Mutation	SNP	ENST00000437428.2	37		.	.	.	.	.	.	.	.	.	.	.	4.173	0.030697	0.08101	.	.	ENSG00000236438	ENST00000431569	.	.	.	0.467	0.467	0.16721	.	.	.	.	.	T	0.17365	0.0417	N	0.08118	0	0.09310	N	1	B	0.28667	0.219	B	0.32090	0.14	T	0.31888	-0.9927	6	.	.	.	.	.	.	.	.	337	C9JC47	F157A_HUMAN	K	337	.	.	R	+	2	0	FAM157A	199379065	0.074000	0.21230	0.015000	0.15790	0.049000	0.14656	0.293000	0.19029	0.539000	0.28788	0.388000	0.25769	AGG	.	.	weak		0.607	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651442	1651442	+	Silent	SNP	G	G	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:1651442G>C	ENST00000399676.2	+	1	410	c.372G>C	c.(370-372)ggG>ggC	p.G124G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	124	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G124G(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCTGTGGGGGGTCCAAGGGGG	0.692																																					p.G124G		Atlas-SNP	.											KRTAP5-5,bladder,carcinoma,0,4	KRTAP5-5	86	4	2	Substitution - coding silent(2)	prostate(2)	c.G372C						scavenged	.																																			SO:0001819	synonymous_variant	439915	exon1			TGGGGGGTCCAAG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.372G>C	11.37:g.1651442G>C		Somatic	38	3	0.0789474		WXS	Illumina HiSeq	Phase_I	41	6	0.146341	NM_001001480	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																			.	.	none		0.692	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
BPIFC	254240	hgsc.bcm.edu	37	22	32841910	32841910	+	Missense_Mutation	SNP	C	C	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr22:32841910C>A	ENST00000397452.1	-	5	558	c.448G>T	c.(448-450)Gac>Tac	p.D150Y	BPIFC_ENST00000534972.1_Intron|BPIFC_ENST00000300399.3_Missense_Mutation_p.D150Y|BPIFC_ENST00000432451.2_5'UTR			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	150						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)										TGACCAAAGTCATTTCGGGTT	0.498																																					p.D150Y		Atlas-SNP	.											BPIL2,NS,carcinoma,0,1	.	.	1	0			c.G448T						PASS	.						88.0	91.0	90.0					22																	32841910		2203	4300	6503	SO:0001583	missense	254240	exon4			CAAAGTCATTTCG	AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.448G>T	22.37:g.32841910C>A	ENSP00000380594:p.Asp150Tyr	Somatic	108	0	0		WXS	Illumina HiSeq	Phase_I	113	15	0.132743	NM_174932	A2RRF1	Missense_Mutation	SNP	ENST00000397452.1	37	CCDS13906.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.013664	0.35511	.	.	ENSG00000184459	ENST00000397452;ENST00000300399	T;T	0.05855	3.38;3.38	5.71	2.48	0.30137	.	0.908340	0.09747	N	0.761146	T	0.13670	0.0331	M	0.75447	2.3	0.09310	N	0.999999	P	0.48589	0.912	P	0.47528	0.549	T	0.14924	-1.0455	10	0.66056	D	0.02	-2.0646	8.4699	0.32980	0.0:0.7511:0.0:0.2489	.	150	Q8NFQ6	BPIFC_HUMAN	Y	150	ENSP00000380594:D150Y;ENSP00000300399:D150Y	ENSP00000300399:D150Y	D	-	1	0	BPIFC	31171910	0.000000	0.05858	0.506000	0.27664	0.169000	0.22640	-0.863000	0.04259	0.792000	0.33850	0.650000	0.86243	GAC	.	.	none		0.498	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129029.2	NM_174932	
P2RY1	5028	hgsc.bcm.edu	37	3	152553954	152553954	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:152553954G>A	ENST00000305097.3	+	1	1219	c.383G>A	c.(382-384)aGg>aAg	p.R128K		NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	128					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			AAACTGCAGAGGTTCATCTTT	0.517																																					p.R128K		Atlas-SNP	.											.	P2RY1	49	.	0			c.G383A						PASS	.						80.0	78.0	78.0					3																	152553954		2203	4300	6503	SO:0001583	missense	5028	exon1			TGCAGAGGTTCAT	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.383G>A	3.37:g.152553954G>A	ENSP00000304767:p.Arg128Lys	Somatic	72	0	0		WXS	Illumina HiSeq	Phase_I	83	37	0.445783	NM_002563		Missense_Mutation	SNP	ENST00000305097.3	37	CCDS3169.1	.	.	.	.	.	.	.	.	.	.	G	35	5.443803	0.96187	.	.	ENSG00000169860	ENST00000305097	T	0.37058	1.22	5.76	5.76	0.90799	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.61615	0.2361	M	0.78801	2.425	0.58432	D	0.999999	D	0.63046	0.992	D	0.77004	0.989	T	0.55036	-0.8203	10	0.21014	T	0.42	.	18.9739	0.92728	0.0:0.0:1.0:0.0	.	128	P47900	P2RY1_HUMAN	K	128	ENSP00000304767:R128K	ENSP00000304767:R128K	R	+	2	0	P2RY1	154036644	1.000000	0.71417	0.878000	0.34440	0.992000	0.81027	7.731000	0.84895	2.706000	0.92434	0.655000	0.94253	AGG	.	.	none		0.517	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563	
MUC4	4585	hgsc.bcm.edu	37	3	195506627	195506627	+	Missense_Mutation	SNP	T	T	G	rs145875920	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:195506627T>G	ENST00000463781.3	-	2	12283	c.11824A>C	c.(11824-11826)Act>Cct	p.T3942P	MUC4_ENST00000475231.1_Missense_Mutation_p.T3942P|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3942P(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGTGCTGGTGACA	0.582													.|||	144	0.028754	0.0658	0.0115	5008	,	,		10596	0.0179		0.0189	False		,,,				2504	0.0123				p.T3942P		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,3	MUC4	1505	3	2	Substitution - Missense(2)	kidney(2)	c.A11824C						scavenged	.						16.0	15.0	15.0					3																	195506627		575	1239	1814	SO:0001583	missense	4585	exon2			AGGAAGTGCTGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11824A>C	3.37:g.195506627T>G	ENSP00000417498:p.Thr3942Pro	Somatic	10	4	0.4		WXS	Illumina HiSeq	Phase_I	16	8	0.5	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	418	0.19139194139194138	95	0.19308943089430894	73	0.20165745856353592	134	0.23426573426573427	116	0.15303430079155672	N	5.184	0.219525	0.09863	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35048	1.33;1.42	.	.	.	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.19945	N	0.999946	B	0.25521	0.128	B	0.28638	0.092	T	0.36456	-0.9747	7	.	.	.	.	2.6735	0.05075	0.0:0.409:0.0:0.591	.	3814	E7ESK3	.	P	3942	ENSP00000417498:T3942P;ENSP00000420243:T3942P	.	T	-	1	0	MUC4	196991406	0.000000	0.05858	0.044000	0.18714	0.027000	0.11550	-2.555000	0.00925	0.348000	0.23949	0.055000	0.15244	ACT	T|0.808;G|0.192	0.192	strong		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MAML2	84441	hgsc.bcm.edu	37	11	95825260	95825260	+	Silent	SNP	T	T	C	rs537179849	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:95825260T>C	ENST00000524717.1	-	2	3219	c.1935A>G	c.(1933-1935)caA>caG	p.Q645Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	645					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q645Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgttgttgctgctgct	0.517			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q645Q		Atlas-SNP	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,colon,carcinoma,0,1	MAML2	94	1	1	Substitution - coding silent(1)	large_intestine(1)	c.A1935G						scavenged	.						39.0	43.0	42.0					11																	95825260		2089	4107	6196	SO:0001819	synonymous_variant	84441	exon2			CTGTTGTTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1935A>G	11.37:g.95825260T>C		Somatic	62	3	0.0483871		WXS	Illumina HiSeq	Phase_I	62	3	0.0483871	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.	.	none		0.517	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
MLLT3	4300	hgsc.bcm.edu	37	9	20414376	20414376	+	Silent	SNP	A	A	G	rs1761445|rs373338988	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr9:20414376A>G	ENST00000380338.4	-	5	754	c.468T>C	c.(466-468)agT>agC	p.S156S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S153S|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	156	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.527			T	MLL	ALL								A|||	608	0.121406	0.1354	0.1037	5008	,	,		12979	0.0774		0.1282	False		,,,				2504	0.1534				p.S156S		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,colon,carcinoma,0,3	MLLT3	125	3	0			c.T468C						scavenged	.						9.0	14.0	13.0					9																	20414376		1854	3811	5665	SO:0001819	synonymous_variant	4300	exon5			GCTGCTACTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.468T>C	9.37:g.20414376A>G		Somatic	29	1	0.0344828		WXS	Illumina HiSeq	Phase_I	31	3	0.0967742	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			A|0.906;G|0.094	0.094	strong		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
TPTE2	93492	hgsc.bcm.edu	37	13	20056679	20056679	+	Missense_Mutation	SNP	T	T	G	rs200244531		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr13:20056679T>G	ENST00000400230.2	-	4	172	c.128A>C	c.(127-129)gAa>gCa	p.E43A	TPTE2_ENST00000382975.4_Missense_Mutation_p.E43A|TPTE2_ENST00000382977.4_Missense_Mutation_p.E43A|TPTE2_ENST00000457266.2_Missense_Mutation_p.E43A|TPTE2_ENST00000400103.2_Missense_Mutation_p.E43A|TPTE2_ENST00000382978.1_Missense_Mutation_p.E43A|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000390680.2_Intron			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	43					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.E43A(1)		NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		GGAAAGTCGTTCTAACATACT	0.313																																					p.E43A		Atlas-SNP	.											TPTE2_ENST00000400230,NS,carcinoma,0,1	TPTE2	225	1	1	Substitution - Missense(1)	kidney(1)	c.A128C						scavenged	.						52.0	51.0	51.0					13																	20056679		2201	4299	6500	SO:0001583	missense	93492	exon5			AGTCGTTCTAACA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.128A>C	13.37:g.20056679T>G	ENSP00000383089:p.Glu43Ala	Somatic	708	8	0.0112994		WXS	Illumina HiSeq	Phase_I	675	12	0.0177778	NM_199254	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	T	2.387	-0.340821	0.05243	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.94931	-3.56;-3.53;-3.47;-3.47;-3.56;-3.53	2.06	0.858	0.19030	.	0.878504	0.09602	U	0.780065	D	0.86159	0.5866	N	0.21448	0.665	0.09310	N	1	B;B	0.28850	0.225;0.0	B;B	0.19946	0.027;0.0	T	0.74598	-0.3612	9	.	.	.	-0.5937	3.8365	0.08896	0.0:0.192:0.0:0.808	.	43;43	A8MX64;Q6XPS3	.;TPTE2_HUMAN	A	43	ENSP00000372438:E43A;ENSP00000382974:E43A;ENSP00000383089:E43A;ENSP00000372437:E43A;ENSP00000372435:E43A;ENSP00000442218:E43A	.	E	-	2	0	TPTE2	18954679	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.422000	0.21296	0.241000	0.21283	0.383000	0.25322	GAA	.	.	weak		0.313	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
GOLGA8A	23015	hgsc.bcm.edu	37	15	34676192	34676192	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr15:34676192C>T	ENST00000359187.4	-	8	688	c.624G>A	c.(622-624)gaG>gaA	p.E208E	GOLGA8A_ENST00000432566.2_Silent_p.E238E|GOLGA8A_ENST00000360553.3_Silent_p.E208E|GOLGA8A_ENST00000543376.1_Silent_p.E65E|MIR1233-1_ENST00000408722.1_RNA	NM_181077.3	NP_851422.1	A7E2F4	GOG8A_HUMAN	golgin A8 family, member A	236						Golgi apparatus (GO:0005794)|membrane (GO:0016020)							all_lung(180;2.78e-08)		all cancers(64;8.27e-19)|GBM - Glioblastoma multiforme(113;6.98e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		GCAGTATCTGCTCCCGTATGG	0.562																																					p.E208E		Atlas-SNP	.											GOLGA8A,NS,carcinoma,0,1	GOLGA8A	8	1	0			c.G624A						scavenged	.						1.0	1.0	1.0					15																	34676192		819	2154	2973	SO:0001819	synonymous_variant	23015	exon8			TATCTGCTCCCGT	BX648160	CCDS10038.1	15q14	2011-10-25	2010-02-12		ENSG00000175265	ENSG00000175265			31972	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 8A"""			10660574, 10677249	Standard	NM_181077		Approved	GM88, GOLGIN-67	uc001zii.3	A7E2F4	OTTHUMG00000129447	ENST00000359187.4:c.624G>A	15.37:g.34676192C>T		Somatic	183	51	0.278689		WXS	Illumina HiSeq	Phase_I	179	41	0.22905	NM_181077	A7MCY9|B7ZMK5|O94937|Q52M46|Q68DK6|Q9NZG8|Q9NZW0|Q9NZW3	Silent	SNP	ENST00000359187.4	37	CCDS10038.1																																																																																			.	.	none		0.562	GOLGA8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251830.2	NM_181076	
AMZ1	155185	hgsc.bcm.edu	37	7	2748854	2748854	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr7:2748854C>T	ENST00000312371.4	+	5	1115	c.747C>T	c.(745-747)gcC>gcT	p.A249A	AMZ1_ENST00000407112.1_Intron|AMZ1_ENST00000489665.1_Intron	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	249							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		GCTTCAGTGCCCTGGGGATGG	0.682																																					p.A249A		Atlas-SNP	.											.	AMZ1	41	.	0			c.C747T						PASS	.						16.0	20.0	18.0					7																	2748854		2196	4292	6488	SO:0001819	synonymous_variant	155185	exon5			CAGTGCCCTGGGG	AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.747C>T	7.37:g.2748854C>T		Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	37	9	0.243243	NM_133463	B3KRS0|Q8TF51	Silent	SNP	ENST00000312371.4	37	CCDS34589.1																																																																																			.	.	none		0.682	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325244.1	NM_133463	
TIE1	7075	hgsc.bcm.edu	37	1	43779453	43779453	+	Silent	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:43779453G>T	ENST00000372476.3	+	14	2302	c.2223G>T	c.(2221-2223)ctG>ctT	p.L741L	TIE1_ENST00000433781.2_Silent_p.L386L|TIE1_ENST00000473014.1_3'UTR	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	741					angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GTCCAGGGCTGCAGGCTGAGG	0.637																																					p.L741L		Atlas-SNP	.											.	TIE1	132	.	0			c.G2223T						PASS	.						22.0	25.0	24.0					1																	43779453		2203	4300	6503	SO:0001819	synonymous_variant	7075	exon14			AGGGCTGCAGGCT	BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.2223G>T	1.37:g.43779453G>T		Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	49	31	0.632653	NM_005424	B5A949|B5A950	Silent	SNP	ENST00000372476.3	37	CCDS482.1																																																																																			.	.	none		0.637	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1	NM_005424	
MUC4	4585	hgsc.bcm.edu	37	3	195508982	195508982	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:195508982C>T	ENST00000463781.3	-	2	9928	c.9469G>A	c.(9469-9471)Gac>Aac	p.D3157N	MUC4_ENST00000475231.1_Missense_Mutation_p.D3157N|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.D3157N(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.592																																					p.D3157N		Atlas-SNP	.											MUC4_ENST00000463781,NS,malignant_melanoma,0,2	MUC4	1505	2	2	Substitution - Missense(2)	NS(2)	c.G9469A						scavenged	.						5.0	4.0	4.0					3																	195508982		544	1292	1836	SO:0001583	missense	4585	exon2			AAGTGTCGGTGAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9469G>A	3.37:g.195508982C>T	ENSP00000417498:p.Asp3157Asn	Somatic	67	1	0.0149254		WXS	Illumina HiSeq	Phase_I	81	7	0.0864198	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	7.037	0.561794	0.13498	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33216	1.51;1.42	.	.	.	.	.	.	.	.	T	0.12220	0.0297	N	0.19112	0.55	0.09310	N	1	D	0.52996	0.957	B	0.29077	0.098	T	0.19484	-1.0304	7	.	.	.	.	6.8901	0.24224	0.0:0.9999:0.0:1.0E-4	.	3029	E7ESK3	.	N	3157	ENSP00000417498:D3157N;ENSP00000420243:D3157N	.	D	-	1	0	MUC4	196993761	0.000000	0.05858	0.028000	0.17463	0.028000	0.11728	-0.476000	0.06591	0.073000	0.16731	0.074000	0.15403	GAC	.	.	none		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MAP2K4	6416	hgsc.bcm.edu	37	17	12044515	12044515	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:12044515T>C	ENST00000353533.5	+	11	1201	c.1138T>C	c.(1138-1140)Tat>Cat	p.Y380H	MAP2K4_ENST00000415385.3_Missense_Mutation_p.Y391H	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	380	DVD domain.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(2)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		GGTCGCATGCTATGTTTGTAA	0.408			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																p.Y380H		Atlas-SNP	.		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	.	MAP2K4	176	.	12	Whole gene deletion(10)|Unknown(2)	ovary(4)|breast(4)|pancreas(2)|biliary_tract(1)|lung(1)	c.T1138C						PASS	.						151.0	131.0	138.0					17																	12044515		2203	4300	6503	SO:0001583	missense	6416	exon11			GCATGCTATGTTT	L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.1138T>C	17.37:g.12044515T>C	ENSP00000262445:p.Tyr380His	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	78	4	0.0512821	NM_003010	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Missense_Mutation	SNP	ENST00000353533.5	37	CCDS11162.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.467476	0.84533	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	T;T	0.20200	2.09;2.09	5.53	5.53	0.82687	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.45196	0.1330	M	0.67953	2.075	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.997	D;D;D	0.76071	0.909;0.987;0.971	T	0.41395	-0.9511	10	0.87932	D	0	.	14.7836	0.69784	0.0:0.0:0.0:1.0	.	252;391;380	B7ZA62;P45985-2;P45985	.;.;MP2K4_HUMAN	H	380;391;357;252	ENSP00000262445:Y380H;ENSP00000410402:Y391H	ENSP00000262445:Y380H	Y	+	1	0	MAP2K4	11985240	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.864000	0.87037	2.322000	0.78497	0.528000	0.53228	TAT	.	.	none		0.408	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441226.1		
GABRA1	2554	hgsc.bcm.edu	37	5	161300240	161300240	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:161300240G>A	ENST00000428797.2	+	6	728	c.373G>A	c.(373-375)Gac>Aac	p.D125N	GABRA1_ENST00000444819.1_Missense_Mutation_p.D125N|GABRA1_ENST00000023897.6_Missense_Mutation_p.D125N|GABRA1_ENST00000437025.2_Missense_Mutation_p.D125N|GABRA1_ENST00000393943.4_Missense_Mutation_p.D125N|GABRA1_ENST00000420560.1_Missense_Mutation_p.D125N	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	125					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTGGACTCCGGACACATTTTT	0.443																																					p.D125N		Atlas-SNP	.											.	GABRA1	132	.	0			c.G373A						PASS	.						74.0	71.0	72.0					5																	161300240		2203	4300	6503	SO:0001583	missense	2554	exon6			ACTCCGGACACAT		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.373G>A	5.37:g.161300240G>A	ENSP00000393097:p.Asp125Asn	Somatic	163	0	0		WXS	Illumina HiSeq	Phase_I	139	25	0.179856	NM_001127643	D3DQK6|Q8N629	Missense_Mutation	SNP	ENST00000428797.2	37	CCDS4357.1	.	.	.	.	.	.	.	.	.	.	G	36	5.667549	0.96745	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000420560;ENST00000444819	D;D;D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84;-1.84;-1.84	5.85	5.85	0.93711	Neurotransmitter-gated ion-channel ligand-binding (3);	0.107767	0.64402	D	0.000006	D	0.94735	0.8301	M	0.93939	3.475	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	D	0.95296	0.8399	10	0.87932	D	0	.	20.1663	0.98152	0.0:0.0:1.0:0.0	.	125	P14867	GBRA1_HUMAN	N	125	ENSP00000023897:D125N;ENSP00000393097:D125N;ENSP00000377517:D125N;ENSP00000415441:D125N;ENSP00000408041:D125N;ENSP00000414232:D125N	ENSP00000023897:D125N	D	+	1	0	GABRA1	161232818	1.000000	0.71417	0.947000	0.38551	0.873000	0.50193	9.751000	0.98889	2.773000	0.95371	0.585000	0.79938	GAC	.	.	none		0.443	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5	
GC	2638	hgsc.bcm.edu	37	4	72620785	72620785	+	Missense_Mutation	SNP	T	T	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:72620785T>G	ENST00000273951.8	-	9	1417	c.1074A>C	c.(1072-1074)gaA>gaC	p.E358D	GC_ENST00000513476.1_Missense_Mutation_p.E358D|GC_ENST00000504199.1_Missense_Mutation_p.E377D|GC_ENST00000503472.1_5'UTR	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	358	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	TGAGGAATACTTCCGGAAGAT	0.348																																					p.E377D		Atlas-SNP	.											.	GC	132	.	0			c.A1131C						PASS	.						123.0	115.0	118.0					4																	72620785		2203	4300	6503	SO:0001583	missense	2638	exon10			GAATACTTCCGGA	L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.1074A>C	4.37:g.72620785T>G	ENSP00000273951:p.Glu358Asp	Somatic	314	0	0		WXS	Illumina HiSeq	Phase_I	279	93	0.333333	NM_001204307	B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Missense_Mutation	SNP	ENST00000273951.8	37	CCDS3550.1	.	.	.	.	.	.	.	.	.	.	T	9.556	1.117265	0.20795	.	.	ENSG00000145321	ENST00000273951;ENST00000504199;ENST00000513476	T;T;T	0.73152	-0.72;-0.72;-0.72	4.81	3.65	0.41850	.	0.246243	0.36066	N	0.002815	T	0.64659	0.2618	L	0.61036	1.89	0.31742	N	0.635658	P;P	0.40476	0.718;0.513	B;B	0.42771	0.255;0.397	T	0.63994	-0.6511	10	0.20519	T	0.43	.	5.9139	0.19043	0.0:0.13:0.0:0.87	.	377;358	D6RAK8;D6RF35	.;.	D	358;377;358	ENSP00000273951:E358D;ENSP00000421725:E377D;ENSP00000426683:E358D	ENSP00000273951:E358D	E	-	3	2	GC	72839649	1.000000	0.71417	1.000000	0.80357	0.357000	0.29423	0.421000	0.21280	0.953000	0.37825	0.459000	0.35465	GAA	.	.	none		0.348	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252167.2		
SPZ1	84654	hgsc.bcm.edu	37	5	79616605	79616605	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:79616605C>G	ENST00000296739.4	+	1	816	c.571C>G	c.(571-573)Cag>Gag	p.Q191E		NM_032567.3	NP_115956.3	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	191	Basic motif. {ECO:0000255}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(5)|large_intestine(4)|lung(12)|ovary(1)|skin(2)	26		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)		AAAGAAACAGCAGATGATAAT	0.353																																					p.Q191E		Atlas-SNP	.											SPZ1,NS,carcinoma,0,2	SPZ1	60	2	0			c.C571G						scavenged	.						80.0	73.0	75.0					5																	79616605		1823	4086	5909	SO:0001583	missense	84654	exon1			AAACAGCAGATGA		CCDS43336.1	5q14.1	2014-06-13				ENSG00000164299			30721	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 148"""					11165476, 12778315, 15226296, 15829580, 15899793	Standard	NM_032567		Approved	NYD-TSP1, FLJ25709, PPP1R148	uc003kgn.3	Q9BXG8		ENST00000296739.4:c.571C>G	5.37:g.79616605C>G	ENSP00000369611:p.Gln191Glu	Somatic	387	1	0.00258398		WXS	Illumina HiSeq	Phase_I	340	4	0.0117647	NM_032567	B2RA21|Q8N4P1|Q8N7E9	Missense_Mutation	SNP	ENST00000296739.4	37	CCDS43336.1	.	.	.	.	.	.	.	.	.	.	G	0.445	-0.896756	0.02472	.	.	ENSG00000164299	ENST00000511881;ENST00000296739	T;T	0.37235	1.21;1.75	3.72	1.88	0.25563	.	0.620126	0.14328	N	0.326540	T	0.09862	0.0242	N	0.01493	-0.835	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.35276	-0.9795	10	0.02654	T	1	-1.396	4.8081	0.13329	0.2072:0.3907:0.4021:0.0	.	191	Q9BXG8	SPZ1_HUMAN	E	191	ENSP00000426530:Q191E;ENSP00000369611:Q191E	ENSP00000369611:Q191E	Q	+	1	0	SPZ1	79652361	0.003000	0.15002	0.011000	0.14972	0.387000	0.30353	0.012000	0.13287	0.186000	0.20125	-0.319000	0.08680	CAG	.	.	none		0.353	SPZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369322.1	NM_032567	
GLYATL1	92292	hgsc.bcm.edu	37	11	58722739	58722739	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:58722739C>T	ENST00000317391.4	+	7	744	c.404C>T	c.(403-405)aCg>aTg	p.T135M	RP11-142C4.6_ENST00000525714.1_RNA|GLYATL1_ENST00000300079.5_Missense_Mutation_p.T166M|RP11-142C4.6_ENST00000533954.1_RNA	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	135						mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)			NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	CTCTTGGTTACGGAAGATATT	0.443																																					p.T166M		Atlas-SNP	.											GLYATL1_ENST00000317391,colon,carcinoma,0,2	GLYATL1	89	2	0			c.C497T						scavenged	.						93.0	90.0	91.0					11																	58722739		2201	4295	6496	SO:0001583	missense	92292	exon6			TGGTTACGGAAGA	AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.404C>T	11.37:g.58722739C>T	ENSP00000322223:p.Thr135Met	Somatic	278	0	0		WXS	Illumina HiSeq	Phase_I	277	4	0.0144404	NM_080661	A6NDT0|Q7Z510|Q8NAW8	Missense_Mutation	SNP	ENST00000317391.4	37	CCDS55768.1	.	.	.	.	.	.	.	.	.	.	.	3.196	-0.164779	0.06502	.	.	ENSG00000166840	ENST00000526351;ENST00000444580;ENST00000317391;ENST00000300079	T;T;T	0.18338	2.22;2.22;2.22	1.78	-0.476	0.12100	Acyl-CoA N-acyltransferase (1);Glycine N-acyltransferase, N-terminal (1);	2.418270	0.02861	N	0.130319	T	0.10380	0.0254	N	0.20986	0.625	0.09310	N	1	B;B	0.31241	0.315;0.237	B;B	0.24701	0.048;0.055	T	0.20338	-1.0278	10	0.25751	T	0.34	.	4.3613	0.11203	0.0:0.5649:0.0:0.4351	.	166;135	Q969I3-2;Q969I3	.;GLYL1_HUMAN	M	158;112;135;166	ENSP00000434652:T158M;ENSP00000322223:T135M;ENSP00000300079:T166M	ENSP00000300079:T166M	T	+	2	0	GLYATL1	58479315	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.860000	0.04272	-0.032000	0.13758	0.411000	0.27672	ACG	.	.	none		0.443	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393783.1	NM_080661	
FAT4	79633	hgsc.bcm.edu	37	4	126384754	126384754	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:126384754G>A	ENST00000394329.3	+	10	11844	c.11831G>A	c.(11830-11832)tGc>tAc	p.C3944Y	FAT4_ENST00000335110.5_Intron	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3944	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TACTGTGAATGCAACCCCTGC	0.308																																					p.C3944Y		Atlas-SNP	.											.	FAT4	1752	.	0			c.G11831A						PASS	.						142.0	121.0	127.0					4																	126384754		1568	3582	5150	SO:0001583	missense	79633	exon10			GTGAATGCAACCC	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.11831G>A	4.37:g.126384754G>A	ENSP00000377862:p.Cys3944Tyr	Somatic	243	0	0		WXS	Illumina HiSeq	Phase_I	189	57	0.301587	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	20.1	3.933600	0.73442	.	.	ENSG00000196159	ENST00000394329	T	0.74002	-0.8	5.34	5.34	0.76211	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.37857	U	0.001912	T	0.71617	0.3361	N	0.04746	-0.17	0.80722	D	1	D;D	0.67145	0.996;0.987	P;P	0.59703	0.862;0.773	T	0.78708	-0.2099	10	0.56958	D	0.05	.	19.0682	0.93122	0.0:0.0:1.0:0.0	.	3944;3944	Q6V0I7;Q6V0I7-3	FAT4_HUMAN;.	Y	3944	ENSP00000377862:C3944Y	ENSP00000377862:C3944Y	C	+	2	0	FAT4	126604204	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.460000	0.80816	2.489000	0.83994	0.650000	0.86243	TGC	.	.	none		0.308	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
IRF4	3662	hgsc.bcm.edu	37	6	393159	393159	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:393159C>G	ENST00000380956.4	+	2	133	c.7C>G	c.(7-9)Ctg>Gtg	p.L3V	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	3					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		GGGCATGAACCTGGAGGGCGG	0.721			T	IGH@	MM																																p.L3V		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65	.	0			c.C7G						PASS	.						13.0	17.0	16.0					6																	393159		2057	4045	6102	SO:0001583	missense	3662	exon2			ATGAACCTGGAGG	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.7C>G	6.37:g.393159C>G	ENSP00000370343:p.Leu3Val	Somatic	62	0	0		WXS	Illumina HiSeq	Phase_I	74	17	0.22973	NM_001195286	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	37	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.903550	0.52333	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.97430	-4.38	5.0	-4.42	0.03579	.	2.154200	0.02356	N	0.076424	D	0.90212	0.6940	L	0.36672	1.1	0.42989	D	0.994487	P;P;P	0.40731	0.608;0.728;0.608	B;B;B	0.38500	0.142;0.275;0.142	T	0.81324	-0.0984	10	0.51188	T	0.08	-13.6896	8.239	0.31650	0.0:0.1841:0.1273:0.6886	.	3;3;3	F2Z3D5;Q15306-2;Q15306	.;.;IRF4_HUMAN	V	3;33	ENSP00000370343:L3V	ENSP00000370343:L3V	L	+	1	2	IRF4	338159	0.419000	0.25449	0.985000	0.45067	0.673000	0.39480	-0.471000	0.06631	-0.533000	0.06323	-0.683000	0.03753	CTG	.	.	none		0.721	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
ACACB	32	hgsc.bcm.edu	37	12	109625822	109625822	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:109625822G>A	ENST00000338432.7	+	13	2118	c.1999G>A	c.(1999-2001)Ggg>Agg	p.G667R	ACACB_ENST00000377848.3_Missense_Mutation_p.G667R|ACACB_ENST00000377854.5_Missense_Mutation_p.G667R			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	667	Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GCCGAGCTCCGGGACTGTCCA	0.493																																					p.G667R		Atlas-SNP	.											.	ACACB	330	.	0			c.G1999A						PASS	.						76.0	78.0	77.0					12																	109625822		2203	4300	6503	SO:0001583	missense	32	exon12			AGCTCCGGGACTG	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.1999G>A	12.37:g.109625822G>A	ENSP00000341044:p.Gly667Arg	Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	135	17	0.125926	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	g	20.5	3.997239	0.74818	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	D;D;D	0.81499	-1.5;-1.5;-1.5	5.27	5.27	0.74061	Rudiment single hybrid motif (1);ATP-grasp fold, subdomain 2 (1);Biotin carboxylation domain (1);Biotin carboxylase, C-terminal (2);	0.049617	0.85682	D	0.000000	D	0.88862	0.6552	H	0.95043	3.615	0.80722	D	1	P	0.45672	0.864	P	0.44696	0.458	D	0.92298	0.5847	10	0.87932	D	0	.	18.6174	0.91308	0.0:0.0:1.0:0.0	.	667	O00763	ACACB_HUMAN	R	667	ENSP00000341044:G667R;ENSP00000367079:G667R;ENSP00000367085:G667R	ENSP00000341044:G667R	G	+	1	0	ACACB	108110205	1.000000	0.71417	0.448000	0.26945	0.454000	0.32378	9.778000	0.99011	2.509000	0.84616	0.531000	0.56144	GGG	.	.	none		0.493	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
PCMTD1	115294	hgsc.bcm.edu	37	8	52733214	52733214	+	Missense_Mutation	SNP	A	A	C	rs200377849		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:52733214A>C	ENST00000360540.5	-	7	1177	c.771T>G	c.(769-771)aaT>aaG	p.N257K	PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000544451.1_Missense_Mutation_p.N181K|PCMTD1_ENST00000522514.1_Missense_Mutation_p.N257K	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	257						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)	p.N257K(1)		NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CATTTATGAAATTTCTAAGTG	0.388																																					p.N257K		Atlas-SNP	.											PCMTD1,trunk,malignant_melanoma,0,1	PCMTD1	73	1	1	Substitution - Missense(1)	skin(1)	c.T771G						scavenged	.						78.0	81.0	80.0					8																	52733214		2203	4300	6503	SO:0001583	missense	115294	exon6			TATGAAATTTCTA		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.771T>G	8.37:g.52733214A>C	ENSP00000353739:p.Asn257Lys	Somatic	221	2	0.00904977		WXS	Illumina HiSeq	Phase_I	180	5	0.0277778	NM_052937	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.991059	0.35131	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.47528	0.84;0.84;0.84	5.56	-0.996	0.10218	.	0.046341	0.85682	D	0.000000	T	0.38983	0.1061	N	0.20530	0.585	0.53005	D	0.999961	P;D;B	0.65815	0.651;0.995;0.002	B;P;B	0.60886	0.122;0.88;0.002	T	0.41556	-0.9502	10	0.02654	T	1	-22.28	11.477	0.50304	0.3747:0.0:0.6253:0.0	.	127;181;257	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	K	257;181;257	ENSP00000353739:N257K;ENSP00000444026:N181K;ENSP00000428099:N257K	ENSP00000353739:N257K	N	-	3	2	PCMTD1	52895767	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	3.249000	0.51437	-0.122000	0.11766	-0.250000	0.11733	AAT	.	.	weak		0.388	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
MARCH11	441061	hgsc.bcm.edu	37	5	16091041	16091041	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:16091041C>T	ENST00000332432.8	-	3	1042	c.843G>A	c.(841-843)caG>caA	p.Q281Q	MARCH11_ENST00000505509.1_5'UTR	NM_001102562.1	NP_001096032.1	A6NNE9	MARHB_HUMAN	membrane-associated ring finger (C3HC4) 11	281					protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)|urinary_tract(1)	20						CATAGCAGATCTGAAAAAGGA	0.448																																					p.Q281Q		Atlas-SNP	.											.	MARCH11	50	.	0			c.G843A						PASS	.						99.0	97.0	98.0					5																	16091041		2004	4181	6185	SO:0001819	synonymous_variant	441061	exon3			GCAGATCTGAAAA	BC150513	CCDS47192.1	5p15.1	2013-01-09			ENSG00000183654	ENSG00000183654		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	33609	protein-coding gene	gene with protein product		613338				17604280	Standard	NM_001102562		Approved	MARCH-XI	uc003jfo.2	A6NNE9	OTTHUMG00000161789	ENST00000332432.8:c.843G>A	5.37:g.16091041C>T		Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	95	10	0.105263	NM_001102562	A7E2S6	Silent	SNP	ENST00000332432.8	37	CCDS47192.1																																																																																			.	.	none		0.448	MARCH11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000366096.2	NM_001102562	
SRRM1	10250	hgsc.bcm.edu	37	1	24993386	24993386	+	Missense_Mutation	SNP	G	G	T	rs78787676		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:24993386G>T	ENST00000323848.9	+	13	2024	c.1709G>T	c.(1708-1710)cGc>cTc	p.R570L	snoU13_ENST00000459464.1_RNA|SRRM1_ENST00000374389.4_Missense_Mutation_p.R579L|SRRM1_ENST00000537199.1_3'UTR|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000447431.2_Missense_Mutation_p.R582L	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	570	Arg-rich.|Necessary for speckles and matrix localization.|Pro-rich.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R570L(2)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CCTCGACGGCGCAGGACTCCC	0.557																																					p.R570L	Ovarian(68;897 1494 3282 17478)	Atlas-SNP	.											SRRM1,bladder,carcinoma,0,2	SRRM1	81	2	2	Substitution - Missense(2)	urinary_tract(1)|central_nervous_system(1)	c.G1709T						scavenged	.						54.0	45.0	48.0					1																	24993386		2203	4300	6503	SO:0001583	missense	10250	exon13			GACGGCGCAGGAC	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.1709G>T	1.37:g.24993386G>T	ENSP00000326261:p.Arg570Leu	Somatic	311	2	0.00643087		WXS	Illumina HiSeq	Phase_I	239	4	0.0167364	NM_005839	O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	37	CCDS255.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693027	0.88735	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	T;T;T	0.34667	1.35;1.35;1.35	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000007	T	0.58104	0.2099	L	0.54323	1.7	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.76575	0.988;0.972	T	0.57318	-0.7832	10	0.62326	D	0.03	-1.2563	19.3453	0.94361	0.0:0.0:1.0:0.0	.	582;570	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	L	570;582;579	ENSP00000326261:R570L;ENSP00000391430:R582L;ENSP00000363510:R579L	ENSP00000326261:R570L	R	+	2	0	SRRM1	24865973	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.773000	0.85462	2.654000	0.90174	0.650000	0.86243	CGC	G|0.999;A|0.001	.	alt		0.557	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230328	23230328	+	Missense_Mutation	SNP	C	C	T	rs545109780	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr22:23230328C>T	ENST00000526893.1	+	1	369	c.95C>T	c.(94-96)gCc>gTc	p.A32V	hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Missense_Mutation_p.A32V|IGLL5_ENST00000532223.2_Missense_Mutation_p.A32V	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	32						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CTGGGTCTGGCCATGGTCGCC	0.672													C|||	3	0.000599042	0.0015	0.0014	5008	,	,		12180	0.0		0.0	False		,,,				2504	0.0				p.A32V		Atlas-SNP	.											.	IGLL5	26	.	0			c.C95T						PASS	.																																			SO:0001583	missense	100423062	exon1			GTCTGGCCATGGT	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.95C>T	22.37:g.23230328C>T	ENSP00000431254:p.Ala32Val	Somatic	176	0	0		WXS	Illumina HiSeq	Phase_I	134	30	0.223881	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.463570	0.26248	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00569	6.52;6.52	3.92	-1.21	0.09524	.	.	.	.	.	T	0.00271	0.0008	N	0.08118	0	0.09310	N	1	B	0.25235	0.121	B	0.17722	0.019	T	0.42155	-0.9468	9	0.46703	T	0.11	.	0.7979	0.01069	0.1873:0.383:0.2094:0.2203	.	32	B9A064	IGLL5_HUMAN	V	32	ENSP00000436353:A32V;ENSP00000431254:A32V	ENSP00000431254:A32V	A	+	2	0	IGLL5	21560328	0.000000	0.05858	0.004000	0.12327	0.013000	0.08279	-0.047000	0.11963	-0.086000	0.12550	0.643000	0.83706	GCC	.	.	none		0.672	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
PCNX	22990	hgsc.bcm.edu	37	14	71500228	71500228	+	Missense_Mutation	SNP	G	G	A	rs201430424		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr14:71500228G>A	ENST00000304743.2	+	17	4087	c.3641G>A	c.(3640-3642)cGa>cAa	p.R1214Q	PCNX_ENST00000439984.3_Missense_Mutation_p.R1103Q|PCNX_ENST00000238570.5_Missense_Mutation_p.R1214Q	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1214						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CATCTCAGCCGACAAAGCAGT	0.348													G|||	1	0.000199681	0.0	0.0	5008	,	,		15772	0.001		0.0	False		,,,				2504	0.0				p.R1214Q		Atlas-SNP	.											.	PCNX	198	.	0			c.G3641A						PASS	.						149.0	132.0	138.0					14																	71500228		2203	4300	6503	SO:0001583	missense	22990	exon17			TCAGCCGACAAAG	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.3641G>A	14.37:g.71500228G>A	ENSP00000304192:p.Arg1214Gln	Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	154	38	0.246753	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	37	CCDS9806.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0017482517482517483|0.0017482517482517483	0|0	0.0|0.0	G|G	34|34	5.349420|5.349420	0.95830|0.95830	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000554691|ENST00000304743;ENST00000238570;ENST00000439984	.|T;T;T	.|0.21361	.|2.3;2.18;2.01	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	.|0.057498	.|0.64402	.|D	.|0.000001	T|T	0.55146|0.55146	0.1902|0.1902	M|M	0.86502|0.86502	2.82|2.82	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.998;0.987;0.999	.|D;P;D	.|0.75484	.|0.986;0.746;0.978	T|T	0.60747|0.60747	-0.7202|-0.7202	5|10	.|0.72032	.|D	.|0.01	.|.	19.8731|19.8731	0.96858|0.96858	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1214;1103;1214	.|Q96RV3-3;B2RTR6;Q96RV3	.|.;.;PCX1_HUMAN	N|Q	273|1214;1214;1103	.|ENSP00000304192:R1214Q;ENSP00000238570:R1214Q;ENSP00000396617:R1103Q	.|ENSP00000238570:R1214Q	D|R	+|+	1|2	0|0	PCNX|PCNX	70569981|70569981	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.148000|9.148000	0.94652|0.94652	2.707000|2.707000	0.92482|0.92482	0.650000|0.650000	0.86243|0.86243	GAC|CGA	G|1.000;A|0.000	0.000	strong		0.348	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
KLRC4	8302	hgsc.bcm.edu	37	12	10560927	10560927	+	Splice_Site	SNP	C	C	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:10560927C>G	ENST00000309384.1	-	3	522		c.e3+1		KLRC4-KLRK1_ENST00000539300.1_Splice_Site	NM_013431.2	NP_038459.1	O43908	NKG2F_HUMAN	killer cell lectin-like receptor subfamily C, member 4						cellular defense response (GO:0006968)	integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	5						TCATAATGTACCTTTCTGCAT	0.279																																					.		Atlas-SNP	.											.	KLRC4	23	.	0			c.340+1G>C						PASS	.						71.0	68.0	69.0					12																	10560927		2200	4280	6480	SO:0001630	splice_region_variant	8302	exon4			AATGTACCTTTCT	U96846	CCDS8624.1	12p13.2-p12.3	2008-08-05			ENSG00000183542	ENSG00000183542		"""Killer cell lectin-like receptors"""	6377	protein-coding gene	gene with protein product		602893				9598306	Standard	NM_013431		Approved	NKG2-F	uc001qye.3	O43908	OTTHUMG00000168575	ENST00000309384.1:c.340+1G>C	12.37:g.10560927C>G		Somatic	239	0	0		WXS	Illumina HiSeq	Phase_I	189	53	0.280423	NM_013431	O60851	Splice_Site	SNP	ENST00000309384.1	37	CCDS8624.1	.	.	.	.	.	.	.	.	.	.	C	4.834	0.155014	0.09236	.	.	ENSG00000183542	ENST00000309384	.	.	.	3.2	2.28	0.28536	.	.	.	.	.	.	.	.	.	.	.	0.25354	N	0.988846	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.5561	0.27824	0.2554:0.7445:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KLRC4	10452194	0.098000	0.21812	0.116000	0.21606	0.016000	0.09150	1.254000	0.32897	0.878000	0.35920	0.585000	0.79938	.	.	.	none		0.279	KLRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400108.1	NM_013431	Intron
MUC16	94025	hgsc.bcm.edu	37	19	9070331	9070331	+	Silent	SNP	C	C	T	rs186109841	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr19:9070331C>T	ENST00000397910.4	-	3	17318	c.17115G>A	c.(17113-17115)gcG>gcA	p.A5705A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5707	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTTCTGTGTGCGCAGTGTCTT	0.507													a|||	2	0.000399361	0.0008	0.0	5008	,	,		21807	0.001		0.0	False		,,,				2504	0.0				p.A5705A		Atlas-SNP	.											.	MUC16	4315	.	0			c.G17115A						PASS	.	C		5,4193		0,5,2094	166.0	161.0	163.0		17115	-3.1	0.0	19		163	7,8421		0,7,4207	no	coding-synonymous	MUC16	NM_024690.2		0,12,6301	TT,TC,CC		0.0831,0.1191,0.095		5705/14508	9070331	12,12614	2099	4214	6313	SO:0001819	synonymous_variant	94025	exon3			TGTGTGCGCAGTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.17115G>A	19.37:g.9070331C>T		Somatic	168	0	0		WXS	Illumina HiSeq	Phase_I	136	82	0.602941	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			C|1.000;T|0.000	0.000	strong		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC4	4585	hgsc.bcm.edu	37	3	195506482	195506482	+	Missense_Mutation	SNP	G	G	T	rs113936020	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:195506482G>T	ENST00000463781.3	-	2	12428	c.11969C>A	c.(11968-11970)aCt>aAt	p.T3990N	MUC4_ENST00000475231.1_Missense_Mutation_p.T3990N|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAGTGTCGGTGAC	0.592																																					p.T3990N		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-1,1	MUC4	1505	1	0			c.C11969A						scavenged	.						10.0	7.0	8.0					3																	195506482		623	1357	1980	SO:0001583	missense	4585	exon2			GAGGAAGTGTCGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11969C>A	3.37:g.195506482G>T	ENSP00000417498:p.Thr3990Asn	Somatic	7	2	0.285714		WXS	Illumina HiSeq	Phase_I	18	12	0.666667	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	0.405	-0.916416	0.02415	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.37;1.46	0.481	0.481	0.16809	.	0.562686	0.09843	U	0.748557	T	0.35913	0.0948	N	0.14661	0.345	0.09310	N	1	D	0.57257	0.979	D	0.68192	0.956	T	0.29852	-0.9998	9	.	.	.	.	6.8687	0.24108	1.0E-4:0.0:0.9999:0.0	.	3862	E7ESK3	.	N	3990	ENSP00000417498:T3990N;ENSP00000420243:T3990N	.	T	-	2	0	MUC4	196991261	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	-0.001000	0.12947	0.537000	0.28751	0.064000	0.15345	ACT	.	.	weak		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PCDH9	5101	hgsc.bcm.edu	37	13	67205459	67205459	+	Missense_Mutation	SNP	C	C	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr13:67205459C>A	ENST00000377865.2	-	3	3357	c.3223G>T	c.(3223-3225)Ggt>Tgt	p.G1075C	PCDH9_ENST00000456367.1_Missense_Mutation_p.G1041C|PCDH9_ENST00000328454.5_Missense_Mutation_p.G1041C|RNU7-87P_ENST00000459343.1_RNA|PCDH9_ENST00000544246.1_Missense_Mutation_p.G1075C			Q9HC56	PCDH9_HUMAN	protocadherin 9	1075					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GTTCCACTACCCACCGGCTCA	0.552																																					p.G1075C		Atlas-SNP	.											PCDH9,NS,carcinoma,+1,1	PCDH9	252	1	0			c.G3223T						PASS	.						129.0	111.0	117.0					13																	67205459		2203	4300	6503	SO:0001583	missense	5101	exon4			CACTACCCACCGG	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3223G>T	13.37:g.67205459C>A	ENSP00000367096:p.Gly1075Cys	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	70	25	0.357143	NM_203487	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.857443	0.91433	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.56776	0.54;0.54;0.44;0.44	5.63	5.63	0.86233	.	0.175226	0.28403	N	0.015463	T	0.68293	0.2985	L	0.47190	1.495	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.71656	0.974;0.947	T	0.69277	-0.5187	10	0.72032	D	0.01	.	19.6801	0.95958	0.0:1.0:0.0:0.0	.	1041;1075	Q9HC56-2;Q9HC56	.;PCDH9_HUMAN	C	1075;1075;1041;1041	ENSP00000442186:G1075C;ENSP00000367096:G1075C;ENSP00000401699:G1041C;ENSP00000332060:G1041C	ENSP00000332060:G1041C	G	-	1	0	PCDH9	66103460	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.259000	0.78381	2.652000	0.90054	0.655000	0.94253	GGT	.	.	none		0.552	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
WISP1	8840	hgsc.bcm.edu	37	8	134225357	134225357	+	Missense_Mutation	SNP	G	G	A	rs536884015		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:134225357G>A	ENST00000250160.6	+	2	426	c.320G>A	c.(319-321)cGc>cAc	p.R107H	WISP1_ENST00000517423.1_Missense_Mutation_p.R107H|WISP1_ENST00000519433.1_Intron|WISP1_ENST00000377863.2_Intron|WISP1_ENST00000220856.6_Missense_Mutation_p.R107H	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	107	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			AGCGGGGACCGCCCGAGGTAC	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		15051	0.0		0.0	False		,,,				2504	0.001				p.R107H		Atlas-SNP	.											.	WISP1	64	.	0			c.G320A						PASS	.						63.0	62.0	62.0					8																	134225357		2203	4300	6503	SO:0001583	missense	8840	exon2			GGGACCGCCCGAG	AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.320G>A	8.37:g.134225357G>A	ENSP00000250160:p.Arg107His	Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	104	18	0.173077	NM_003882	A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Missense_Mutation	SNP	ENST00000250160.6	37	CCDS6371.1	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886789	0.51908	.	.	ENSG00000104415	ENST00000250160;ENST00000517423;ENST00000220856	T;T;T	0.63417	-0.04;-0.04;-0.04	5.27	3.36	0.38483	Insulin-like growth factor-binding protein, IGFBP (2);	0.480222	0.24615	N	0.037015	T	0.71333	0.3327	L	0.59436	1.845	0.80722	D	1	B;D;B	0.89917	0.01;1.0;0.018	B;D;B	0.71870	0.003;0.975;0.002	T	0.70004	-0.4991	10	0.44086	T	0.13	-31.2725	9.5448	0.39273	0.0784:0.1429:0.7787:0.0	.	107;107;107	E7EMM5;O95388-2;O95388	.;.;WISP1_HUMAN	H	107	ENSP00000250160:R107H;ENSP00000427744:R107H;ENSP00000220856:R107H	ENSP00000220856:R107H	R	+	2	0	WISP1	134294539	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.732000	0.62029	1.221000	0.43506	0.542000	0.68232	CGC	.	.	none		0.617	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378794.2	NM_003882	
CCDC40	55036	hgsc.bcm.edu	37	17	78064015	78064015	+	Intron	SNP	G	G	C	rs4889953|rs375858249	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:78064015G>C	ENST00000397545.4	+	17	2859				CCDC40_ENST00000374877.3_Missense_Mutation_p.K970N|CCDC40_ENST00000573903.1_Intron	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40						axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.K970N(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			cgtgcacgaagaacacgggac	0.607													C|||	3368	0.672524	0.7095	0.5389	5008	,	,		13699	0.6052		0.6968	False		,,,				2504	0.7618				p.K970N		Atlas-SNP	.											CCDC40_ENST00000374877,NS,other,0,1	CCDC40	198	1	1	Substitution - Missense(1)	pancreas(1)	c.G2910C						scavenged	.																																			SO:0001627	intron_variant	55036	exon18			CACGAAGAACACG	AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.2832+332G>C	17.37:g.78064015G>C		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	3	3	1	NM_001243342	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	ENST00000397545.4	37	CCDS42395.1	1314	0.6016483516483516	336	0.6829268292682927	169	0.46685082872928174	339	0.5926573426573427	470	0.6200527704485488	C	1.785	-0.481066	0.04383	.	.	ENSG00000141519	ENST00000374877	T	0.47869	0.83	.	.	.	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.43540	-0.9385	3	0.17369	T	0.5	.	.	.	.	rs4889953	.	.	.	N	970	ENSP00000364011:K970N	ENSP00000364011:K970N	K	+	3	2	CCDC40	75678610	0.003000	0.15002	0.003000	0.11579	0.003000	0.03518	-2.000000	0.01466	-1.966000	0.01009	-1.954000	0.00483	AAG	G|0.396;C|0.604	0.604	strong		0.607	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082	
ECEL1	9427	hgsc.bcm.edu	37	2	233348784	233348784	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr2:233348784G>T	ENST00000304546.1	-	7	1544	c.1334C>A	c.(1333-1335)gCc>gAc	p.A445D	ECEL1_ENST00000409941.1_Missense_Mutation_p.A445D	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	445					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		GTGGCGATTGGCCTGGCCCAA	0.622																																					p.A445D		Atlas-SNP	.											ECEL1,right_upper_lobe,carcinoma,-1,2	ECEL1	73	2	0			c.C1334A						scavenged	.						76.0	80.0	79.0					2																	233348784		2203	4300	6503	SO:0001583	missense	9427	exon7			CGATTGGCCTGGC	Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.1334C>A	2.37:g.233348784G>T	ENSP00000302051:p.Ala445Asp	Somatic	193	17	0.0880829		WXS	Illumina HiSeq	Phase_I	152	19	0.125	NM_004826	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Missense_Mutation	SNP	ENST00000304546.1	37	CCDS2493.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.771640	0.90108	.	.	ENSG00000171551	ENST00000304546;ENST00000409941	T;T	0.74526	-0.85;-0.85	5.33	5.33	0.75918	Peptidase M13 (1);Metallopeptidase, catalytic domain (1);	0.061073	0.64402	D	0.000002	D	0.83115	0.5184	L	0.55481	1.735	0.80722	D	1	D;D	0.63046	0.966;0.992	P;D	0.63283	0.571;0.913	D	0.84714	0.0736	10	0.87932	D	0	-0.9223	19.0163	0.92896	0.0:0.0:1.0:0.0	.	445;445	O95672-2;O95672	.;ECEL1_HUMAN	D	445	ENSP00000302051:A445D;ENSP00000386333:A445D	ENSP00000302051:A445D	A	-	2	0	ECEL1	233057028	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	8.005000	0.88553	2.503000	0.84419	0.557000	0.71058	GCC	.	.	none		0.622	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257039.2	NM_004826	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230409	23230409	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr22:23230409G>A	ENST00000526893.1	+	1	450	c.176G>A	c.(175-177)aGc>aAc	p.S59N	hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Missense_Mutation_p.S59N|IGLL5_ENST00000532223.2_Missense_Mutation_p.S59N	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	59						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GTTGGAAGCAGCCGATCCAGC	0.657																																					p.S59N		Atlas-SNP	.											.	IGLL5	26	.	0			c.G176A						PASS	.																																			SO:0001583	missense	100423062	exon1			GAAGCAGCCGATC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.176G>A	22.37:g.23230409G>A	ENSP00000431254:p.Ser59Asn	Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	98	36	0.367347	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	10.14	1.267343	0.23136	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00583	6.41;6.41	3.92	-0.797	0.10909	.	.	.	.	.	T	0.00440	0.0014	N	0.19112	0.55	0.09310	N	1	B	0.21821	0.061	B	0.17098	0.017	T	0.45056	-0.9287	9	0.59425	D	0.04	.	3.0635	0.06207	0.2132:0.0:0.4153:0.3715	.	59	B9A064	IGLL5_HUMAN	N	59	ENSP00000436353:S59N;ENSP00000431254:S59N	ENSP00000431254:S59N	S	+	2	0	IGLL5	21560409	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.100000	0.10990	-0.036000	0.13669	-0.196000	0.12772	AGC	.	.	none		0.657	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
MUC4	4585	hgsc.bcm.edu	37	3	195505762	195505762	+	Missense_Mutation	SNP	A	A	G	rs566782506	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:195505762A>G	ENST00000463781.3	-	2	13148	c.12689T>C	c.(12688-12690)cTt>cCt	p.L4230P	MUC4_ENST00000475231.1_Missense_Mutation_p.L4230P|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	987					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAAGGCTGGTGAC	0.577													.|||	339	0.0676917	0.034	0.0576	5008	,	,		15843	0.1062		0.0646	False		,,,				2504	0.0838				p.L4230P		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-1,4	MUC4	1505	4	0			c.T12689C						scavenged	.						42.0	42.0	42.0					3																	195505762		2092	4200	6292	SO:0001583	missense	4585	exon2			GAGGAAAGGCTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12689T>C	3.37:g.195505762A>G	ENSP00000417498:p.Leu4230Pro	Somatic	106	6	0.0566038		WXS	Illumina HiSeq	Phase_I	86	12	0.139535	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.071	-1.202607	0.01581	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31769	1.48;1.49	.	.	.	.	.	.	.	.	T	0.08044	0.0201	N	0.04959	-0.14	0.09310	N	0.999998	P	0.35139	0.486	B	0.19946	0.027	T	0.18524	-1.0334	6	.	.	.	.	.	.	.	.	4102	E7ESK3	.	P	4230	ENSP00000417498:L4230P;ENSP00000420243:L4230P	.	L	-	2	0	MUC4	196990541	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.148000	0.16224	-1.986000	0.00983	-1.973000	0.00462	CTT	.	.	none		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
KIAA1244	57221	hgsc.bcm.edu	37	6	138645253	138645253	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:138645253G>A	ENST00000251691.4	+	31	5129	c.4963G>A	c.(4963-4965)Gag>Aag	p.E1655K		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CCCAAGTGCCGAGGCCGAGTA	0.647																																					p.E1655K		Atlas-SNP	.											.	KIAA1244	236	.	0			c.G4963A						PASS	.						37.0	42.0	40.0					6																	138645253		2203	4299	6502	SO:0001583	missense	57221	exon31			AGTGCCGAGGCCG	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.4963G>A	6.37:g.138645253G>A	ENSP00000251691:p.Glu1655Lys	Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	43	7	0.162791	NM_020340		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	G	28.2	4.898200	0.91962	.	.	ENSG00000112379	ENST00000251691	T	0.19669	2.13	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.36468	0.0968	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.07233	-1.0783	10	0.66056	D	0.02	-15.4417	19.6229	0.95667	0.0:0.0:1.0:0.0	.	1655	Q5TH69	BIG3_HUMAN	K	1655	ENSP00000251691:E1655K	ENSP00000251691:E1655K	E	+	1	0	KIAA1244	138686946	1.000000	0.71417	0.993000	0.49108	0.985000	0.73830	9.388000	0.97237	2.708000	0.92522	0.650000	0.86243	GAG	.	.	none		0.647	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
KIR2DL3	3804	hgsc.bcm.edu	37	19	55255378	55255378	+	Missense_Mutation	SNP	G	G	C	rs199625806	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr19:55255378G>C	ENST00000342376.3	+	4	537	c.506G>C	c.(505-507)cGt>cCt	p.R169P	KIR3DL1_ENST00000541392.1_Intron|KIR2DL3_ENST00000434419.2_Missense_Mutation_p.R169P|KIR3DL1_ENST00000538269.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron	NM_015868.2	NP_056952.2	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3	169	Ig-like C2-type 2.				immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		GCCCATGAACGTAGGTTCTCT	0.607													.|||	66	0.0131789	0.0	0.085	5008	,	,		10870	0.0069		0.0	False		,,,				2504	0.0				p.R169P		Atlas-SNP	.											KIR2DL3,NS,carcinoma,+1,1	KIR2DL3	68	1	0			c.G506C						scavenged	.	G	PRO/ARG	1,2109		0,1,1054	15.0	17.0	16.0		506	-1.4	0.0	19		16	1,4355		0,1,2177	no	missense	KIR2DL3	NM_015868.2	103	0,2,3231	CC,CG,GG		0.023,0.0474,0.0309		169/342	55255378	2,6464	1055	2178	3233	SO:0001583	missense	3804	exon4			ATGAACGTAGGTT	L41268	CCDS33107.1	19q13.4	2013-01-29				ENSG00000243772		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6331	protein-coding gene	gene with protein product		604938				7749980, 8662091	Standard	XM_006725426		Approved	cl-6, nkat2, nkat2a, nkat2b, p58, CD158B2		P43628	OTTHUMG00000065887	ENST00000342376.3:c.506G>C	19.37:g.55255378G>C	ENSP00000342215:p.Arg169Pro	Somatic	26	9	0.346154		WXS	Illumina HiSeq	Phase_I	27	26	0.962963	NM_015868	O43472|P78402|Q14944|Q14945|Q9UM51|Q9UQ70	Missense_Mutation	SNP	ENST00000342376.3	37	CCDS33107.1	.	.	.	.	.	.	.	.	.	.	g	0.236	-1.017638	0.02078	4.74E-4	2.3E-4	ENSG00000243772	ENST00000342376;ENST00000434419	T;T	0.00678	5.87;5.87	0.682	-1.36	0.09085	Immunoglobulin subtype (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00524	0.0017	N	0.11870	0.19	0.09310	N	1	B;B;B	0.19817	0.039;0.004;0.004	B;B;B	0.20184	0.028;0.009;0.009	T	0.51180	-0.8738	8	0.72032	D	0.01	.	.	.	.	.	169;169;169	E3NZD7;P43628;E3NZD8	.;KI2L3_HUMAN;.	P	169	ENSP00000342215:R169P;ENSP00000415758:R169P	ENSP00000342215:R169P	R	+	2	0	KIR2DL3	59947190	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.580000	0.02121	-2.644000	0.00427	-3.498000	0.00033	CGT	.	.	weak		0.607	KIR2DL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000141150.1		
WHAMM	123720	hgsc.bcm.edu	37	15	83499809	83499809	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr15:83499809C>T	ENST00000286760.4	+	9	2199	c.2100C>T	c.(2098-2100)tcC>tcT	p.S700S		NM_001080435.1	NP_001073904.1	Q8TF30	WHAMM_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules	700	Mediates actin nucleation. {ECO:0000269|PubMed:18614018}.				actin filament organization (GO:0007015)|actin filament reorganization (GO:0090527)|ER to Golgi vesicle-mediated transport (GO:0006888)|focal adhesion assembly (GO:0048041)|lamellipodium assembly (GO:0030032)|membrane tubulation (GO:0097320)|positive regulation of actin nucleation (GO:0051127)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|Golgi membrane (GO:0000139)	Arp2/3 complex binding (GO:0071933)|GTP-Rho binding (GO:0017049)|microtubule binding (GO:0008017)			endometrium(6)|large_intestine(5)|lung(1)|prostate(1)	13						CACGTGACTCCTTGGAAAGTT	0.498																																					p.S700S		Atlas-SNP	.											.	WHAMM	63	.	0			c.C2100T						PASS	.						113.0	119.0	117.0					15																	83499809		2165	4279	6444	SO:0001819	synonymous_variant	123720	exon9			TGACTCCTTGGAA	AK126887	CCDS45333.1	15q25.2	2009-02-18	2009-02-18	2009-02-18	ENSG00000156232	ENSG00000156232			30493	protein-coding gene	gene with protein product		612393	"""WAS protein homology region 2 domain containing 1"""	WHDC1		11853319, 18226259, 18614018, 18812086	Standard	XM_005272422		Approved	KIAA1971	uc002bje.3	Q8TF30		ENST00000286760.4:c.2100C>T	15.37:g.83499809C>T		Somatic	8	0	0		WXS	Illumina HiSeq	Phase_I	17	7	0.411765	NM_001080435	Q8N1J9	Silent	SNP	ENST00000286760.4	37	CCDS45333.1																																																																																			.	.	none		0.498	WHAMM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418463.1		
COL6A3	1293	hgsc.bcm.edu	37	2	238253001	238253001	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr2:238253001C>T	ENST00000295550.4	-	36	8112	c.7660G>A	c.(7660-7662)Gct>Act	p.A2554T	COL6A3_ENST00000347401.3_Missense_Mutation_p.A2353T|COL6A3_ENST00000409809.1_Missense_Mutation_p.A2348T|COL6A3_ENST00000353578.4_Missense_Mutation_p.A2348T|COL6A3_ENST00000472056.1_Missense_Mutation_p.A1947T|COL6A3_ENST00000346358.4_Missense_Mutation_p.A2354T	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2554	Nonhelical region.|VWFA 11. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		ACCTGCAAAGCGTTGATGAGC	0.557																																					p.A2554T		Atlas-SNP	.											COL6A3,NS,carcinoma,0,1	COL6A3	608	1	0			c.G7660A						PASS	.						151.0	155.0	154.0					2																	238253001		2203	4300	6503	SO:0001583	missense	1293	exon36			GCAAAGCGTTGAT	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7660G>A	2.37:g.238253001C>T	ENSP00000295550:p.Ala2554Thr	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	47	7	0.148936	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.881687	0.51908	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67;-1.67	5.08	5.08	0.68730	von Willebrand factor, type A (3);	0.000000	0.52532	D	0.000069	D	0.90335	0.6976	M	0.71581	2.175	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.998;0.999	D	0.88468	0.3060	10	0.30854	T	0.27	.	18.8647	0.92287	0.0:1.0:0.0:0.0	.	1947;1947;2348;2554	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	T	2554;2353;2348;1947;2348;2354	ENSP00000295550:A2554T;ENSP00000315609:A2353T;ENSP00000315873:A2348T;ENSP00000418285:A1947T;ENSP00000386844:A2348T;ENSP00000295546:A2354T	ENSP00000295550:A2554T	A	-	1	0	COL6A3	237917740	1.000000	0.71417	0.210000	0.23637	0.878000	0.50629	7.308000	0.78929	2.507000	0.84556	0.655000	0.94253	GCT	.	.	none		0.557	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
TMEM59	9528	hgsc.bcm.edu	37	1	54509073	54509073	+	Silent	SNP	G	G	T	rs202004864	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:54509073G>T	ENST00000234831.5	-	4	765	c.516C>A	c.(514-516)gcC>gcA	p.A172A	TMEM59_ENST00000371348.1_Silent_p.A41A|TMEM59_ENST00000371341.1_Silent_p.A41A|TMEM59_ENST00000371344.1_Silent_p.A41A	NM_004872.3	NP_004863.2	Q9BXS4	TMM59_HUMAN	transmembrane protein 59	172					autophagy (GO:0006914)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of protein glycosylation in Golgi (GO:0090285)|negative regulation of protein processing (GO:0010955)|positive regulation of autophagy (GO:0010508)	extracellular vesicular exosome (GO:0070062)|Golgi cis cisterna (GO:0000137)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			kidney(3)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7						TTCCGTCATCGGCTTGAAGAT	0.388																																					p.A172A		Atlas-SNP	.											TMEM59,NS,carcinoma,0,1	TMEM59	28	1	0			c.C516A						scavenged	.						80.0	83.0	82.0					1																	54509073		2203	4300	6503	SO:0001819	synonymous_variant	9528	exon4			GTCATCGGCTTGA	AF047439	CCDS586.1	1p32.3	2008-05-14	2005-07-22	2005-07-22	ENSG00000116209	ENSG00000116209			1239	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 8"""	C1orf8		9653160	Standard	NM_004872		Approved	HSPC001	uc001cwp.3	Q9BXS4	OTTHUMG00000008437	ENST00000234831.5:c.516C>A	1.37:g.54509073G>T		Somatic	257	0	0		WXS	Illumina HiSeq	Phase_I	192	3	0.015625	NM_004872	B3KQL7|O75393|Q4VBP9|Q5T705|Q96KX7	Silent	SNP	ENST00000234831.5	37	CCDS586.1																																																																																			G|1.000;A|0.000	.	alt		0.388	TMEM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023254.2	NM_004872	
PIM1	5292	hgsc.bcm.edu	37	6	37138549	37138549	+	Splice_Site	SNP	G	G	A	rs377274719		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:37138549G>A	ENST00000373509.5	+	2	456	c.83G>A	c.(82-84)gGc>gAc	p.G28D		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	119					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CCTTTCCTAGGCAAGGAGAAG	0.721			T	BCL6	NHL																																p.G119D		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,3	PIM1	71	3	0			c.G356A						scavenged	.	G	ASP/GLY	1,4257		0,1,2128	18.0	26.0	23.0		83	3.8	1.0	6		23	0,8506		0,0,4253	no	missense-near-splice	PIM1	NM_002648.3	94	0,1,6381	AA,AG,GG		0.0,0.0235,0.0078	probably-damaging	28/314	37138549	1,12763	2129	4253	6382	SO:0001630	splice_region_variant	5292	exon2			TCCTAGGCAAGGA		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.83-1G>A	6.37:g.37138549G>A		Somatic	53	1	0.0188679		WXS	Illumina HiSeq	Phase_I	56	6	0.107143	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.215565	0.39102	2.35E-4	0.0	ENSG00000137193	ENST00000373509	T	0.69306	-0.39	3.83	3.83	0.44106	Protein kinase-like domain (1);	0.187844	0.33772	N	0.004562	T	0.23330	0.0564	N	0.08118	0	0.30455	N	0.774827	P	0.42827	0.791	B	0.36719	0.231	T	0.07083	-1.0791	9	.	.	.	.	9.7286	0.40348	0.0983:0.0:0.9017:0.0	.	119	P11309	PIM1_HUMAN	D	28	ENSP00000362608:G28D	.	G	+	2	0	PIM1	37246527	0.119000	0.22226	0.998000	0.56505	0.963000	0.63663	-0.036000	0.12185	2.138000	0.66242	0.549000	0.68633	GGC	.	.	weak		0.721	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		Missense_Mutation
FAM186A	121006	hgsc.bcm.edu	37	12	50746158	50746158	+	Missense_Mutation	SNP	G	G	T	rs71459097		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:50746158G>T	ENST00000327337.5	-	4	4456	c.4457C>A	c.(4456-4458)cCg>cAg	p.P1486Q	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Missense_Mutation_p.P1486Q	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1486								p.P1486Q(1)									CTGAGCCTGCGGAGGGATGAG	0.647																																					p.P1486Q	NSCLC(138;1796 1887 12511 19463 37884)	Atlas-SNP	.											FAM186A_ENST00000327337,extremity,malignant_melanoma,0,2	FAM186A	181	2	1	Substitution - Missense(1)	skin(1)	c.C4457A						scavenged	.						18.0	18.0	18.0					12																	50746158		692	1591	2283	SO:0001583	missense	121006	exon4			GCCTGCGGAGGGA		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4457C>A	12.37:g.50746158G>T	ENSP00000329995:p.Pro1486Gln	Somatic	232	7	0.0301724		WXS	Illumina HiSeq	Phase_I	254	16	0.0629921	NM_001145475		Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	-	3.047	-0.196295	0.06259	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.04049	3.72;3.72	4.53	-1.5	0.08691	.	.	.	.	.	T	0.02012	0.0063	N	0.04203	-0.255	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.49351	-0.8949	9	0.13853	T	0.58	.	7.1242	0.25463	0.0:0.1707:0.524:0.3053	.	1486;1486	F5GYN0;A6NE01	.;F186A_HUMAN	Q	1486	ENSP00000441337:P1486Q;ENSP00000329995:P1486Q	ENSP00000329995:P1486Q	P	-	2	0	FAM186A	49032425	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.921000	0.04008	-0.386000	0.07821	-0.446000	0.05623	CCG	.	.	none		0.647	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
MUC4	4585	hgsc.bcm.edu	37	3	195506626	195506626	+	Missense_Mutation	SNP	G	G	A	rs573187517	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:195506626G>A	ENST00000463781.3	-	2	12284	c.11825C>T	c.(11824-11826)aCt>aTt	p.T3942I	MUC4_ENST00000475231.1_Missense_Mutation_p.T3942I|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAAGTGCTGGTGAC	0.582													.|||	33	0.00658946	0.0091	0.0043	5008	,	,		10638	0.006		0.0099	False		,,,				2504	0.002				p.T3942I		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,-1,3	MUC4	1505	3	0			c.C11825T						scavenged	.						16.0	15.0	15.0					3																	195506626		577	1241	1818	SO:0001583	missense	4585	exon2			GAGGAAGTGCTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11825C>T	3.37:g.195506626G>A	ENSP00000417498:p.Thr3942Ile	Somatic	10	4	0.4		WXS	Illumina HiSeq	Phase_I	16	5	0.3125	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	9.517	1.107233	0.20714	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35048	1.33;1.42	.	.	.	.	.	.	.	.	T	0.33904	0.0879	N	0.14661	0.345	0.22199	N	0.999291	D	0.65815	0.995	D	0.64595	0.927	T	0.17992	-1.0351	7	.	.	.	.	6.4784	0.22049	2.0E-4:0.0:0.9998:0.0	.	3814	E7ESK3	.	I	3942	ENSP00000417498:T3942I;ENSP00000420243:T3942I	.	T	-	2	0	MUC4	196991405	0.000000	0.05858	0.044000	0.18714	0.027000	0.11550	0.124000	0.15728	0.413000	0.25759	0.064000	0.15345	ACT	.	.	none		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TMX4	56255	hgsc.bcm.edu	37	20	7967957	7967957	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr20:7967957A>G	ENST00000246024.2	-	6	808	c.593T>C	c.(592-594)gTt>gCt	p.V198A	TMX4_ENST00000530935.1_5'Flank	NM_021156.2	NP_066979.2	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	198					cell redox homeostasis (GO:0045454)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(2)|lung(11)|skin(1)	17						AAGGCCAAAAACCAAGGTGGC	0.353																																					p.V198A		Atlas-SNP	.											.	TMX4	39	.	0			c.T593C						PASS	.						75.0	73.0	73.0					20																	7967957		2203	4300	6503	SO:0001583	missense	56255	exon6			CCAAAAACCAAGG		CCDS13101.1	20p12	2011-10-19	2009-02-23	2009-02-23	ENSG00000125827	ENSG00000125827		"""Protein disulfide isomerases"""	25237	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 14"""		"""thioredoxin domain containing 13"""	TXNDC13			Standard	NM_021156		Approved	DJ971N18.2, KIAA1162, PDIA14	uc002wmx.1	Q9H1E5	OTTHUMG00000031843	ENST00000246024.2:c.593T>C	20.37:g.7967957A>G	ENSP00000246024:p.Val198Ala	Somatic	540	0	0		WXS	Illumina HiSeq	Phase_I	445	120	0.269663	NM_021156	Q8N4P7|Q8NCC1|Q9UJA1|Q9ULQ8	Missense_Mutation	SNP	ENST00000246024.2	37	CCDS13101.1	.	.	.	.	.	.	.	.	.	.	A	13.68	2.309628	0.40895	.	.	ENSG00000125827	ENST00000246024;ENST00000527925	T;T	0.41400	1.0;1.0	6.16	5.07	0.68467	.	0.500444	0.20258	N	0.095924	T	0.30916	0.0780	L	0.34521	1.04	0.25773	N	0.984812	B	0.21147	0.052	B	0.15870	0.014	T	0.18178	-1.0345	10	0.39692	T	0.17	-5.7309	9.0628	0.36444	0.9179:0.0:0.0821:0.0	.	198	Q9H1E5	TMX4_HUMAN	A	198;170	ENSP00000246024:V198A;ENSP00000435735:V170A	ENSP00000246024:V198A	V	-	2	0	TMX4	7915957	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.750000	0.62162	1.148000	0.42385	0.528000	0.53228	GTT	.	.	none		0.353	TMX4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000077928.2	NM_021156	
ZNF208	7757	hgsc.bcm.edu	37	19	22156967	22156967	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr19:22156967C>T	ENST00000397126.4	-	4	1017	c.869G>A	c.(868-870)tGt>tAt	p.C290Y	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	290					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GGCTTTGCCACATTCTTCACA	0.388																																					p.C290Y		Atlas-SNP	.											.	ZNF208	817	.	0			c.G869A						PASS	.						48.0	52.0	51.0					19																	22156967		2144	4264	6408	SO:0001583	missense	7757	exon4			TTGCCACATTCTT	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.869G>A	19.37:g.22156967C>T	ENSP00000380315:p.Cys290Tyr	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	38	21	0.552632	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.596455	0.46318	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	D	0.85861	-2.04	2.89	1.79	0.24919	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.90689	0.7079	.	.	.	0.34667	D	0.723249	D	0.89917	1.0	D	0.78314	0.991	D	0.91372	0.5120	8	0.62326	D	0.03	.	10.3364	0.43852	0.0:0.7964:0.2036:0.0	.	290	O43345	ZN208_HUMAN	Y	290	ENSP00000380315:C290Y	ENSP00000380315:C290Y	C	-	2	0	ZNF208	21948807	0.925000	0.31364	0.001000	0.08648	0.023000	0.10783	2.741000	0.47426	0.187000	0.20147	0.306000	0.20318	TGT	.	.	none		0.388	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZBTB49	166793	hgsc.bcm.edu	37	4	4322555	4322555	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:4322555G>A	ENST00000337872.4	+	8	1931	c.1810G>A	c.(1810-1812)Gag>Aag	p.E604K	ZBTB49_ENST00000538529.1_Missense_Mutation_p.E87K|RP11-265O12.1_ENST00000509015.1_lincRNA|ZBTB49_ENST00000355834.3_Missense_Mutation_p.E482K	NM_145291.3	NP_660334.3	Q6ZSB9	ZBT49_HUMAN	zinc finger and BTB domain containing 49	604					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	28						CCAAGCCATCGAGACCTCCGA	0.577																																					p.E604K		Atlas-SNP	.											.	ZBTB49	63	.	0			c.G1810A						PASS	.						59.0	54.0	56.0					4																	4322555		2203	4300	6503	SO:0001583	missense	166793	exon8			GCCATCGAGACCT	AK095878	CCDS3375.1	4p16.2	2013-01-08	2010-01-26	2010-01-26	ENSG00000168826	ENSG00000168826		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19883	protein-coding gene	gene with protein product			"""zinc finger protein 509"""	ZNF509		12477932	Standard	NM_145291		Approved	FLJ38559	uc003ghu.3	Q6ZSB9	OTTHUMG00000090325	ENST00000337872.4:c.1810G>A	4.37:g.4322555G>A	ENSP00000338807:p.Glu604Lys	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	74	14	0.189189	NM_145291	Q59FJ4|Q5EBN0|Q8TB80	Missense_Mutation	SNP	ENST00000337872.4	37	CCDS3375.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.604935	0.46423	.	.	ENSG00000168826	ENST00000355834;ENST00000337872;ENST00000538529	T;T;T	0.14516	2.5;2.89;3.13	4.57	2.62	0.31277	.	0.279254	0.25197	N	0.032418	T	0.10809	0.0264	M	0.62723	1.935	0.09310	N	1	P;P	0.49862	0.601;0.929	B;B	0.33392	0.07;0.163	T	0.28839	-1.0031	10	0.21014	T	0.42	.	10.6094	0.45412	0.0:0.1439:0.7069:0.1491	.	482;604	Q6ZSB9-2;Q6ZSB9	.;ZBT49_HUMAN	K	482;604;87	ENSP00000348091:E482K;ENSP00000338807:E604K;ENSP00000445653:E87K	ENSP00000338807:E604K	E	+	1	0	ZBTB49	4373456	0.202000	0.23423	0.003000	0.11579	0.269000	0.26545	1.500000	0.35682	1.016000	0.39470	0.455000	0.32223	GAG	.	.	none		0.577	ZBTB49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206688.3	NM_145291	
KIAA0355	9710	hgsc.bcm.edu	37	19	34791796	34791796	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr19:34791796G>A	ENST00000299505.6	+	2	1291	c.418G>A	c.(418-420)Gcc>Acc	p.A140T		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	140								p.A140T(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					GCCTGAGATCGCCAAGATGCT	0.488																																					p.A140T		Atlas-SNP	.											KIAA0355,NS,carcinoma,0,1	KIAA0355	105	1	1	Substitution - Missense(1)	endometrium(1)	c.G418A						scavenged	.						56.0	46.0	49.0					19																	34791796		2203	4300	6503	SO:0001583	missense	9710	exon2			GAGATCGCCAAGA		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.418G>A	19.37:g.34791796G>A	ENSP00000299505:p.Ala140Thr	Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	29	5	0.172414	NM_014686	Q2M3W4	Missense_Mutation	SNP	ENST00000299505.6	37	CCDS12436.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.905079	0.92035	.	.	ENSG00000166398	ENST00000299505	.	.	.	5.25	5.25	0.73442	.	0.055990	0.64402	D	0.000001	T	0.61060	0.2317	N	0.24115	0.695	0.80722	D	1	D	0.64830	0.994	P	0.56343	0.796	T	0.66292	-0.5960	9	0.87932	D	0	-14.461	19.2076	0.93739	0.0:0.0:1.0:0.0	.	140	O15063	K0355_HUMAN	T	140	.	ENSP00000299505:A140T	A	+	1	0	KIAA0355	39483636	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.420000	0.97426	2.607000	0.88179	0.561000	0.74099	GCC	.	.	none		0.488	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686	
HUNK	30811	hgsc.bcm.edu	37	21	33318469	33318469	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr21:33318469C>T	ENST00000270112.2	+	4	1092	c.732C>T	c.(730-732)atC>atT	p.I244I		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	244	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						GCCCCAAAATCGATGTCTGGT	0.527																																					p.I244I		Atlas-SNP	.											.	HUNK	74	.	0			c.C732T						PASS	.						89.0	76.0	80.0					21																	33318469		2203	4300	6503	SO:0001819	synonymous_variant	30811	exon4			CAAAATCGATGTC	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.732C>T	21.37:g.33318469C>T		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	62	11	0.177419	NM_014586		Silent	SNP	ENST00000270112.2	37	CCDS13610.1																																																																																			.	.	none		0.527	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586	
ZNF785	146540	hgsc.bcm.edu	37	16	30594344	30594344	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr16:30594344C>T	ENST00000395216.2	-	3	914	c.755G>A	c.(754-756)gGg>gAg	p.G252E	AC002310.7_ENST00000486926.1_RNA|RP11-146F11.5_ENST00000563540.1_RNA|AC002310.7_ENST00000492040.1_RNA|ZNF785_ENST00000470110.1_Missense_Mutation_p.G237E	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	252					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						AGGCTTCTCCCCGGTGTGAGC	0.657																																					p.G252E		Atlas-SNP	.											ZNF785,NS,carcinoma,+1,1	ZNF785	30	1	0			c.G755A						PASS	.						43.0	39.0	40.0					16																	30594344		2197	4300	6497	SO:0001583	missense	146540	exon3			TTCTCCCCGGTGT	BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.755G>A	16.37:g.30594344C>T	ENSP00000378642:p.Gly252Glu	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	87	12	0.137931	NM_152458	O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	ENST00000395216.2	37	CCDS10685.1	.	.	.	.	.	.	.	.	.	.	c	22.8	4.333110	0.81801	.	.	ENSG00000197162	ENST00000470110;ENST00000395222;ENST00000395216	T;T	0.25749	1.78;1.78	3.48	2.53	0.30540	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37972	0.1023	L	0.38531	1.155	0.25695	N	0.985645	D;D;D	0.89917	0.981;1.0;0.977	P;D;B	0.91635	0.51;0.999;0.376	T	0.09207	-1.0685	9	0.87932	D	0	.	9.2692	0.37661	0.0:0.8899:0.0:0.1101	.	217;252;237	B4DQL1;A8K8V0;A8K8V0-2	.;ZN785_HUMAN;.	E	237;217;252	ENSP00000420340:G237E;ENSP00000378642:G252E	ENSP00000378642:G252E	G	-	2	0	ZNF785	30501845	0.938000	0.31826	0.229000	0.23960	0.537000	0.34900	3.507000	0.53371	1.077000	0.40990	-0.152000	0.13540	GGG	.	.	none		0.657	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255529.2	NM_152458	
PTPRN2	5799	hgsc.bcm.edu	37	7	157931091	157931091	+	Missense_Mutation	SNP	C	C	G	rs3752368	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr7:157931091C>G	ENST00000389418.4	-	7	1036	c.1027G>C	c.(1027-1029)Gtg>Ctg	p.V343L	PTPRN2_ENST00000389416.4_Missense_Mutation_p.V326L|PTPRN2_ENST00000409483.1_Missense_Mutation_p.V305L|PTPRN2_ENST00000404321.2_Missense_Mutation_p.V366L|PTPRN2_ENST00000389413.3_Missense_Mutation_p.V343L	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	343			V -> M (in dbSNP:rs3752368).		negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CCATGGTCCACGCCTTGCATC	0.667																																					p.V343L		Atlas-SNP	.											.	PTPRN2	243	.	0			c.G1027C						PASS	.						68.0	70.0	69.0					7																	157931091		2203	4300	6503	SO:0001583	missense	5799	exon7			GGTCCACGCCTTG	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1027G>C	7.37:g.157931091C>G	ENSP00000374069:p.Val343Leu	Somatic	61	0	0		WXS	Illumina HiSeq	Phase_I	41	28	0.682927	NM_130843	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	ENST00000389418.4	37	CCDS5947.1	.	.	.	.	.	.	.	.	.	.	C	8.901	0.956399	0.18507	.	.	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T;T	0.03124	4.04;4.04;4.05;4.05;4.04	4.15	2.14	0.27477	.	5.222610	0.01476	N	0.016495	T	0.03651	0.0104	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.18741	0.03;0.007;0.012;0.007;0.007	B;B;B;B;B	0.16289	0.015;0.007;0.015;0.007;0.007	T	0.46162	-0.9211	10	0.17369	T	0.5	.	9.3148	0.37928	0.1426:0.7662:0.0:0.0912	.	366;305;343;326;343	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	L	305;343;326;343;366	ENSP00000387114:V305L;ENSP00000374064:V343L;ENSP00000374067:V326L;ENSP00000374069:V343L;ENSP00000385464:V366L	ENSP00000374064:V343L	V	-	1	0	PTPRN2	157623852	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.799000	0.27028	0.316000	0.23135	-0.797000	0.03246	GTG	C|0.987;T|0.013	.	alt		0.667	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1		
SLC45A1	50651	hgsc.bcm.edu	37	1	8390800	8390800	+	Missense_Mutation	SNP	G	G	A	rs370439504		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:8390800G>A	ENST00000471889.1	+	5	1632	c.1247G>A	c.(1246-1248)cGt>cAt	p.R416H	SLC45A1_ENST00000289877.8_Missense_Mutation_p.R416H|Y_RNA_ENST00000516445.1_RNA|SLC45A1_ENST00000377479.2_Missense_Mutation_p.R450H|SLC45A1_ENST00000481265.1_3'UTR			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	416					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CGCCAGGACCGTGGACTTCTG	0.687																																					p.R416H		Atlas-SNP	.											.	SLC45A1	85	.	0			c.G1247A						PASS	.	G	HIS/ARG	0,4404		0,0,2202	30.0	32.0	32.0		1247	-0.2	0.1	1		32	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC45A1	NM_001080397.1	29	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	416/749	8390800	1,13003	2202	4300	6502	SO:0001583	missense	50651	exon4			AGGACCGTGGACT	AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.1247G>A	1.37:g.8390800G>A	ENSP00000418096:p.Arg416His	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	59	34	0.576271	NM_001080397	Q5VY46|Q5VY49	Missense_Mutation	SNP	ENST00000471889.1	37	CCDS30577.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.349538	0.24426	0.0	1.16E-4	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	T;T;T	0.18174	2.24;2.23;2.24	4.8	-0.234	0.13074	.	1.040590	0.07531	N	0.912288	T	0.14570	0.0352	L	0.36672	1.1	0.19775	N	0.999954	B	0.06786	0.001	B	0.01281	0.0	T	0.34725	-0.9817	10	0.45353	T	0.12	-10.1951	9.9895	0.41863	0.8358:0.0:0.1642:0.0	.	416	Q9Y2W3	S45A1_HUMAN	H	416;450;416	ENSP00000418096:R416H;ENSP00000366699:R450H;ENSP00000289877:R416H	ENSP00000289877:R416H	R	+	2	0	SLC45A1	8313387	0.006000	0.16342	0.068000	0.19968	0.535000	0.34838	0.743000	0.26231	-0.196000	0.10366	0.561000	0.74099	CGT	.	.	none		0.687	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001245.5		
ZDHHC7	55625	hgsc.bcm.edu	37	16	85024162	85024162	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr16:85024162G>A	ENST00000313732.4	-	3	415	c.63C>T	c.(61-63)gaC>gaT	p.D21D	ZDHHC7_ENST00000564466.1_Silent_p.D21D|ZDHHC7_ENST00000569488.1_5'UTR	NM_017740.2	NP_060210.2	Q9NXF8	ZDHC7_HUMAN	zinc finger, DHHC-type containing 7	21					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			large_intestine(6)|lung(4)	10						AGTCATAGTTGTCATTTTCAG	0.592																																					p.D21D		Atlas-SNP	.											.	ZDHHC7	55	.	0			c.C63T						PASS	.						103.0	82.0	89.0					16																	85024162		2199	4300	6499	SO:0001819	synonymous_variant	55625	exon3			ATAGTTGTCATTT	AK000286	CCDS10950.1, CCDS45538.1	16q23.1	2010-02-09			ENSG00000153786	ENSG00000153786		"""Zinc fingers, DHHC-type"""	18459	protein-coding gene	gene with protein product	"""Sertoli cell gene with zinc finger domain-&#946;"""	614604					Standard	NM_017740		Approved	FLJ10792, ZNF370, FLJ20279, SERZ-B, SERZ1	uc002fiq.2	Q9NXF8	OTTHUMG00000137645	ENST00000313732.4:c.63C>T	16.37:g.85024162G>A		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	62	27	0.435484	NM_001145548	D3DUM1|Q8WV42|Q9NVD8	Silent	SNP	ENST00000313732.4	37	CCDS10950.1																																																																																			.	.	none		0.592	ZDHHC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269087.1	NM_017740	
TECTA	7007	hgsc.bcm.edu	37	11	121008699	121008699	+	Missense_Mutation	SNP	G	G	A	rs186780639	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:121008699G>A	ENST00000392793.1	+	11	3782	c.3511G>A	c.(3511-3513)Gtg>Atg	p.V1171M	TECTA_ENST00000264037.2_Missense_Mutation_p.V1171M			O75443	TECTA_HUMAN	tectorin alpha	1171	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CTACAGCATCGTGATCCACCG	0.562													G|||	4	0.000798722	0.0	0.0	5008	,	,		20826	0.004		0.0	False		,,,				2504	0.0				p.V1171M		Atlas-SNP	.											.	TECTA	329	.	0			c.G3511A						PASS	.						58.0	47.0	51.0					11																	121008699		2203	4299	6502	SO:0001583	missense	7007	exon10			AGCATCGTGATCC	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.3511G>A	11.37:g.121008699G>A	ENSP00000376543:p.Val1171Met	Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	123	28	0.227642	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	4	0.0018315018315018315	0	0.0	0	0.0	4	0.006993006993006993	0	0.0	G	15.87	2.959524	0.53400	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.59906	0.23;0.23	4.63	4.63	0.57726	von Willebrand factor, type D domain (3);	0.143107	0.47455	D	0.000237	T	0.50803	0.1637	L	0.55213	1.73	0.36863	D	0.888532	D	0.55800	0.973	P	0.50270	0.636	T	0.62077	-0.6930	10	0.35671	T	0.21	.	11.3966	0.49845	0.0837:0.0:0.9163:0.0	.	1171	O75443	TECTA_HUMAN	M	1171	ENSP00000376543:V1171M;ENSP00000264037:V1171M	ENSP00000264037:V1171M	V	+	1	0	TECTA	120513909	0.998000	0.40836	0.967000	0.41034	0.957000	0.61999	2.702000	0.47102	2.267000	0.75376	0.655000	0.94253	GTG	G|0.998;A|0.002	0.002	strong		0.562	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
IGSF8	93185	hgsc.bcm.edu	37	1	160063649	160063649	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:160063649C>T	ENST00000368086.1	-	3	971	c.755G>A	c.(754-756)cGg>cAg	p.R252Q	IGSF8_ENST00000314485.7_Missense_Mutation_p.R252Q|IGSF8_ENST00000460351.1_5'UTR			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	252	Ig-like C2-type 2.				cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CATGCGGTACCGATCGGTCCC	0.642																																					p.R252Q		Atlas-SNP	.											.	IGSF8	59	.	0			c.G755A						PASS	.						65.0	54.0	58.0					1																	160063649		2203	4300	6503	SO:0001583	missense	93185	exon3			CGGTACCGATCGG	AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.755G>A	1.37:g.160063649C>T	ENSP00000357065:p.Arg252Gln	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	58	33	0.568965	NM_052868	Q8NG09|Q96DP4|Q9BTG9	Missense_Mutation	SNP	ENST00000368086.1	37	CCDS1195.1	.	.	.	.	.	.	.	.	.	.	C	8.668	0.902158	0.17760	.	.	ENSG00000162729	ENST00000314485;ENST00000368086;ENST00000358475;ENST00000448417	T;T;T	0.21191	2.02;2.02;2.02	3.74	1.85	0.25348	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.515891	0.17879	N	0.158924	T	0.02119	0.0066	N	0.08118	0	0.24433	N	0.994565	B	0.20164	0.042	B	0.08055	0.003	T	0.44236	-0.9341	10	0.15499	T	0.54	-16.8689	3.1886	0.06609	0.0:0.4775:0.2166:0.3059	.	252	Q969P0	IGSF8_HUMAN	Q	252	ENSP00000316664:R252Q;ENSP00000357065:R252Q;ENSP00000397464:R252Q	ENSP00000316664:R252Q	R	-	2	0	IGSF8	158330273	0.001000	0.12720	0.694000	0.30210	0.499000	0.33736	0.560000	0.23500	0.930000	0.37217	0.491000	0.48974	CGG	.	.	none		0.642	IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060636.1	NM_052868	
KRT85	3891	hgsc.bcm.edu	37	12	52761179	52761179	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:52761179C>T	ENST00000257901.3	-	1	86	c.11G>A	c.(10-12)cGc>cAc	p.R4H	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	4	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CCTGTAGGAGCGGCACGACAT	0.632																																					p.R4H		Atlas-SNP	.											.	KRT85	78	.	0			c.G11A						PASS	.						32.0	31.0	32.0					12																	52761179		2203	4300	6503	SO:0001583	missense	3891	exon1			TAGGAGCGGCACG	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.11G>A	12.37:g.52761179C>T	ENSP00000257901:p.Arg4His	Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	99	26	0.262626	NM_002283	Q9NSB1	Missense_Mutation	SNP	ENST00000257901.3	37	CCDS8824.1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.823096	0.32237	.	.	ENSG00000135443	ENST00000257901	D	0.83506	-1.73	4.63	1.68	0.24146	.	0.354724	0.24647	N	0.036744	T	0.73992	0.3658	L	0.50333	1.59	0.80722	D	1	B	0.21905	0.062	B	0.15870	0.014	T	0.67558	-0.5640	10	0.51188	T	0.08	.	5.8657	0.18773	0.4318:0.4532:0.0:0.1149	.	4	P78386	KRT85_HUMAN	H	4	ENSP00000257901:R4H	ENSP00000257901:R4H	R	-	2	0	KRT85	51047446	0.838000	0.29461	0.998000	0.56505	0.906000	0.53458	0.695000	0.25527	0.611000	0.30052	0.561000	0.74099	CGC	.	.	none		0.632	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
SERINC1	57515	hgsc.bcm.edu	37	6	122766211	122766211	+	Missense_Mutation	SNP	A	A	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:122766211A>C	ENST00000339697.4	-	10	1424	c.1340T>G	c.(1339-1341)cTt>cGt	p.L447R		NM_020755.2	NP_065806.1	Q9NRX5	SERC1_HUMAN	serine incorporator 1	447					L-serine transport (GO:0015825)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(1)	13				GBM - Glioblastoma multiforme(226;0.126)		ACGATTTGTAAGAACAAGTGG	0.413																																					p.L447R		Atlas-SNP	.											.	SERINC1	39	.	0			c.T1340G						PASS	.						97.0	86.0	89.0					6																	122766211		2203	4300	6503	SO:0001583	missense	57515	exon10			TTTGTAAGAACAA	AF087902	CCDS5125.1	6q22.32	2006-02-09	2005-10-14	2005-10-14	ENSG00000111897	ENSG00000111897			13464	protein-coding gene	gene with protein product		614548	"""tumor differentially expressed 2"""	TDE2		10637174	Standard	NM_020755		Approved	TMS-2, TDE1L, KIAA1253	uc003pyy.1	Q9NRX5	OTTHUMG00000015487	ENST00000339697.4:c.1340T>G	6.37:g.122766211A>C	ENSP00000342962:p.Leu447Arg	Somatic	89	0	0		WXS	Illumina HiSeq	Phase_I	43	24	0.55814	NM_020755	B3KY69|E1P565|O75655|Q7Z2F5|Q8TAG1|Q9NTH8|Q9ULG7	Missense_Mutation	SNP	ENST00000339697.4	37	CCDS5125.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.722297	0.89298	.	.	ENSG00000111897	ENST00000339697;ENST00000368454	T;T	0.19250	2.16;2.16	5.59	5.59	0.84812	.	0.125021	0.56097	D	0.000040	T	0.44912	0.1316	M	0.86864	2.845	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.55457	-0.8138	10	0.87932	D	0	-16.0237	15.7663	0.78128	1.0:0.0:0.0:0.0	.	447	Q9NRX5	SERC1_HUMAN	R	447	ENSP00000342962:L447R;ENSP00000357439:L447R	ENSP00000342962:L447R	L	-	2	0	SERINC1	122807910	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.315000	0.96313	2.124000	0.65301	0.533000	0.62120	CTT	.	.	none		0.413	SERINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042031.2	NM_020755	
OR8I2	120586	hgsc.bcm.edu	37	11	55860964	55860964	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:55860964T>C	ENST00000302124.2	+	1	212	c.181T>C	c.(181-183)Ttt>Ctt	p.F61L		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	61						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					CCCTATGTACTTTTTCCTGAG	0.378																																					p.F61L		Atlas-SNP	.											.	OR8I2	119	.	0			c.T181C						PASS	.						242.0	232.0	236.0					11																	55860964		2201	4296	6497	SO:0001583	missense	120586	exon1			ATGTACTTTTTCC	AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.181T>C	11.37:g.55860964T>C	ENSP00000303864:p.Phe61Leu	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	104	29	0.278846	NM_001003750	B2RNN4|Q6IFC0|Q96RC5	Missense_Mutation	SNP	ENST00000302124.2	37	CCDS31517.1	.	.	.	.	.	.	.	.	.	.	T	11.98	1.801602	0.31869	.	.	ENSG00000172154	ENST00000302124	T	0.00551	6.65	4.5	4.5	0.54988	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41500	U	0.000876	T	0.00754	0.0025	M	0.71036	2.16	0.09310	N	1	B	0.19073	0.033	B	0.14023	0.01	T	0.39014	-0.9634	10	0.66056	D	0.02	-19.7083	9.6379	0.39822	0.0:0.0:0.1757:0.8243	.	61	Q8N0Y5	OR8I2_HUMAN	L	61	ENSP00000303864:F61L	ENSP00000303864:F61L	F	+	1	0	OR8I2	55617540	0.014000	0.17966	0.905000	0.35620	0.031000	0.12232	1.570000	0.36439	1.803000	0.52742	0.362000	0.22060	TTT	.	.	none		0.378	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230302	23230302	+	Silent	SNP	C	C	T	rs546631945		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr22:23230302C>T	ENST00000526893.1	+	1	343	c.69C>T	c.(67-69)cgC>cgT	p.R23R	hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Silent_p.R23R|IGLL5_ENST00000532223.2_Silent_p.R23R	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	23						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCAGGCAGCGCTGGCCCCTGC	0.672																																					p.R23R		Atlas-SNP	.											.	IGLL5	26	.	0			c.C69T						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			GCAGCGCTGGCCC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.69C>T	22.37:g.23230302C>T		Somatic	190	0	0		WXS	Illumina HiSeq	Phase_I	155	51	0.329032	NM_001178126		Silent	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.672	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305785	39305785	+	Missense_Mutation	SNP	A	A	T	rs411367		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:39305785A>T	ENST00000343246.4	-	1	269	c.235T>A	c.(235-237)Tgc>Agc	p.C79S		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	79	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			tggcagcagcaggggcggcag	0.657																																					p.C79S		Atlas-SNP	.											KRTAP4-5,colon,carcinoma,0,3	KRTAP4-5	34	3	0			c.T235A						PASS	.						12.0	18.0	16.0					17																	39305785		2089	4172	6261	SO:0001583	missense	85289	exon1			AGCAGCAGGGGCG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.235T>A	17.37:g.39305785A>T	ENSP00000340546:p.Cys79Ser	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	51	11	0.215686	NM_033188		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	773	0.35393772893772896	210	0.4268292682926829	126	0.34806629834254144	175	0.30594405594405594	262	0.34564643799472294	.	0.010	-1.763522	0.00651	.	.	ENSG00000198271	ENST00000343246	T	0.00534	6.74	2.78	-5.56	0.02529	.	0.768893	0.10092	N	0.717076	T	0.00012	0.0000	N	0.01431	-0.87	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.23297	-1.0192	9	0.02654	T	1	.	5.4481	0.16548	0.6146:0.0:0.1542:0.2312	rs411367;rs6503604	79	Q9BYR2	KRA45_HUMAN	S	79	ENSP00000340546:C79S	ENSP00000340546:C79S	C	-	1	0	KRTAP4-5	36559311	0.977000	0.34250	0.000000	0.03702	0.000000	0.00434	-0.260000	0.08708	-1.272000	0.02427	-2.057000	0.00402	TGC	A|0.646;T|0.354	0.354	strong		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
PLB1	151056	hgsc.bcm.edu	37	2	28772953	28772953	+	Splice_Site	SNP	T	T	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr2:28772953T>G	ENST00000327757.5	+	16	1127		c.e16+2		PLB1_ENST00000329020.6_Splice_Site|PLB1_ENST00000422425.2_Splice_Site	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1						glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					AAGCTTGAGGTAAGGAAAGGT	0.448																																					.		Atlas-SNP	.											.	PLB1	255	.	0			c.1083+2T>G						PASS	.						76.0	67.0	70.0					2																	28772953		2203	4300	6503	SO:0001630	splice_region_variant	151056	exon16			TTGAGGTAAGGAA		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.1083+2T>G	2.37:g.28772953T>G		Somatic	121	0	0		WXS	Illumina HiSeq	Phase_I	87	26	0.298851	NM_153021	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Splice_Site	SNP	ENST00000327757.5	37	CCDS33168.1	.	.	.	.	.	.	.	.	.	.	T	12.05	1.822878	0.32237	.	.	ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000404858;ENST00000436544;ENST00000329020	.	.	.	4.97	3.81	0.43845	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.8203	0.23852	0.0:0.1043:0.0:0.8957	.	.	.	.	.	-1	.	.	.	+	.	.	PLB1	28626457	1.000000	0.71417	0.997000	0.53966	0.069000	0.16628	2.145000	0.42207	1.997000	0.58415	0.459000	0.35465	.	.	.	none		0.448	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		Intron
DGKI	9162	hgsc.bcm.edu	37	7	137092719	137092719	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr7:137092719C>G	ENST00000288490.5	-	31	2846	c.2846G>C	c.(2845-2847)gGa>gCa	p.G949A	DGKI_ENST00000424189.2_Missense_Mutation_p.G962A|DGKI_ENST00000446122.1_Missense_Mutation_p.G931A|DGKI_ENST00000453654.2_Missense_Mutation_p.G618A|DGKI_ENST00000494390.1_5'UTR	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	949					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CAGACTGCCTCCATTTTTATA	0.433																																					p.G949A		Atlas-SNP	.											.	DGKI	335	.	0			c.G2846C						PASS	.						151.0	139.0	143.0					7																	137092719		2203	4300	6503	SO:0001583	missense	9162	exon31			CTGCCTCCATTTT	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2846G>C	7.37:g.137092719C>G	ENSP00000288490:p.Gly949Ala	Somatic	149	0	0		WXS	Illumina HiSeq	Phase_I	113	62	0.548673	NM_004717	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.252341	0.80135	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.49720	0.77;0.77;0.77	5.6	5.6	0.85130	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.47746	0.1462	N	0.08118	0	0.80722	D	1	D;D	0.59357	0.969;0.985	P;P	0.59948	0.776;0.866	T	0.57900	-0.7731	10	0.66056	D	0.02	.	17.8057	0.88600	0.0:1.0:0.0:0.0	.	618;949	E9PFX6;O75912	.;DGKI_HUMAN	A	618;866;952;949;931	ENSP00000392161:G618A;ENSP00000288490:G949A;ENSP00000399131:G931A	ENSP00000288490:G949A	G	-	2	0	DGKI	136743259	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.019000	0.64060	2.636000	0.89361	0.655000	0.94253	GGA	.	.	none		0.433	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
PWWP2A	114825	hgsc.bcm.edu	37	5	159520910	159520910	+	Silent	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:159520910G>T	ENST00000307063.7	-	2	781	c.747C>A	c.(745-747)ccC>ccA	p.P249P	PWWP2A_ENST00000523662.1_Silent_p.P249P|PWWP2A_ENST00000456329.3_Silent_p.P249P	NM_001130864.1	NP_001124336.1	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A	249	Pro-rich.									kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGCTCAGCTCGGGATGCGGGA	0.507																																					p.P249P		Atlas-SNP	.											PWWP2A_ENST00000456329,caecum,carcinoma,0,3	PWWP2A	64	3	0			c.C747A						scavenged	.						119.0	118.0	118.0					5																	159520910		1977	4143	6120	SO:0001819	synonymous_variant	114825	exon2			CAGCTCGGGATGC		CCDS47331.1, CCDS47332.1, CCDS58990.1	5q33.3	2011-03-23			ENSG00000170234	ENSG00000170234			29406	protein-coding gene	gene with protein product							Standard	NM_052927		Approved	KIAA1935	uc011ded.2	Q96N64	OTTHUMG00000163546	ENST00000307063.7:c.747C>A	5.37:g.159520910G>T		Somatic	153	0	0		WXS	Illumina HiSeq	Phase_I	162	3	0.0185185	NM_052927	G5EA07|Q2HJJ2|Q8IYR3|Q96PV3	Silent	SNP	ENST00000307063.7	37	CCDS47332.1																																																																																			.	.	none		0.507	PWWP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374092.1		
HYDIN	54768	hgsc.bcm.edu	37	16	70993566	70993566	+	Silent	SNP	A	A	G	rs1774266	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr16:70993566A>G	ENST00000393567.2	-	39	6276	c.6126T>C	c.(6124-6126)caT>caC	p.H2042H		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2042					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				AGGGTGTCCCATGAATGATAA	0.537													G|||	2199	0.439097	0.8608	0.3919	5008	,	,		10800	0.3968		0.164	False		,,,				2504	0.229				p.H2042H		Atlas-SNP	.											LOC652153,NS,carcinoma,0,2	HYDIN	788	2	0			c.T6126C						scavenged	.						26.0	61.0	54.0					16																	70993566		879	3631	4510	SO:0001819	synonymous_variant	54768	exon39			TGTCCCATGAATG	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6126T>C	16.37:g.70993566A>G		Somatic	14	13	0.928571		WXS	Illumina HiSeq	Phase_I	13	13	1	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1																																																																																			A|0.400;G|0.600	0.600	strong		0.537	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
NEURL4	84461	hgsc.bcm.edu	37	17	7221436	7221436	+	Missense_Mutation	SNP	G	G	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:7221436G>C	ENST00000399464.2	-	25	4023	c.4008C>G	c.(4006-4008)agC>agG	p.S1336R	NEURL4_ENST00000570460.1_Missense_Mutation_p.S1312R|NEURL4_ENST00000574120.1_5'UTR|GPS2_ENST00000391950.3_5'Flank|GPS2_ENST00000380728.2_5'Flank|NEURL4_ENST00000315614.7_Missense_Mutation_p.S1334R|GPS2_ENST00000389167.5_5'Flank|RP11-542C16.2_ENST00000575474.1_Missense_Mutation_p.A150G	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	1336						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGTACTCGCAGCTCTTTAGAG	0.597																																					p.S1336R		Atlas-SNP	.											.	NEURL4	192	.	0			c.C4008G						PASS	.						97.0	108.0	105.0					17																	7221436		2064	4205	6269	SO:0001583	missense	84461	exon25			CTCGCAGCTCTTT		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.4008C>G	17.37:g.7221436G>C	ENSP00000382390:p.Ser1336Arg	Somatic	54	0	0		WXS	Illumina HiSeq	Phase_I	46	5	0.108696	NM_032442	Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	37	CCDS42251.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.355021	0.41700	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.32515	1.45;1.45	5.03	1.81	0.25067	.	0.098701	0.64402	D	0.000002	T	0.26774	0.0655	L	0.59436	1.845	0.30519	N	0.768615	P;P	0.47677	0.899;0.838	B;B	0.39258	0.295;0.154	T	0.33854	-0.9852	10	0.66056	D	0.02	-29.3741	9.9785	0.41800	0.2648:0.0:0.7352:0.0	.	1334;1336	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	R	1334;1336	ENSP00000319826:S1334R;ENSP00000382390:S1336R	ENSP00000319826:S1334R	S	-	3	2	NEURL4	7162160	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	1.751000	0.38339	0.727000	0.32360	0.305000	0.20034	AGC	.	.	none		0.597	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	NM_032442	
CEMIP	57214	hgsc.bcm.edu	37	15	81188310	81188310	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr15:81188310C>T	ENST00000394685.3	+	12	1739	c.1320C>T	c.(1318-1320)gtC>gtT	p.V440V	KIAA1199_ENST00000220244.3_Silent_p.V440V|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000356249.5_Silent_p.V440V			Q8WUJ3	CEMIP_HUMAN		440	Necessary for its endoplasmic reticulum (ER) retention and interaction with HSPA5.				hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						ATACCCTGGTCATTGCCAGTA	0.507																																					p.V440V		Atlas-SNP	.											.	KIAA1199	118	.	0			c.C1320T						PASS	.						164.0	138.0	147.0					15																	81188310		2203	4300	6503	SO:0001819	synonymous_variant	57214	exon11			CCTGGTCATTGCC																												ENST00000394685.3:c.1320C>T	15.37:g.81188310C>T		Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	118	30	0.254237	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	ENST00000394685.3	37	CCDS10315.1																																																																																			.	.	none		0.507	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
SSR1	6745	hgsc.bcm.edu	37	6	7295651	7295651	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:7295651A>G	ENST00000244763.4	-	7	853	c.767T>C	c.(766-768)aTt>aCt	p.I256T	RP11-69L16.4_ENST00000379928.4_RNA|SSR1_ENST00000479365.1_Missense_Mutation_p.I256T|SSR1_ENST00000474597.1_Missense_Mutation_p.I256T|SSR1_ENST00000489567.1_Missense_Mutation_p.I188T|SSR1_ENST00000534851.1_Missense_Mutation_p.I229T|SSR1_ENST00000397511.2_Missense_Mutation_p.I256T	NM_003144.3	NP_003135.2	P43307	SSRA_HUMAN	signal sequence receptor, alpha	256					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|positive regulation of cell proliferation (GO:0008284)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(1)	9	Ovarian(93;0.0398)					TTCCTGAGGAATCCAACTCAT	0.333																																					p.I256T		Atlas-SNP	.											.	SSR1	21	.	0			c.T767C						PASS	.						128.0	115.0	119.0					6																	7295651		2202	4300	6502	SO:0001583	missense	6745	exon7			TGAGGAATCCAAC		CCDS4499.1	6p24.3	2010-11-24	2008-08-26		ENSG00000124783	ENSG00000124783			11323	protein-coding gene	gene with protein product	"""translocon-associated protein alpha"""	600868					Standard	NM_001292008		Approved	TRAPA	uc003mxf.4	P43307	OTTHUMG00000014202	ENST00000244763.4:c.767T>C	6.37:g.7295651A>G	ENSP00000244763:p.Ile256Thr	Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	103	11	0.106796	NM_003144	A8K685|Q53GX2|Q53H19|Q5TAM3|Q6IB43|Q8NBH9|Q96IA2|Q9TNQ8|Q9UN49	Missense_Mutation	SNP	ENST00000244763.4	37	CCDS4499.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.495748	0.85069	.	.	ENSG00000124783	ENST00000474597;ENST00000244763;ENST00000397511;ENST00000534851;ENST00000489567;ENST00000479365;ENST00000479485	T;T;T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48;0.48;0.48	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.69369	0.3103	M	0.85945	2.785	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.74674	0.98;0.937;0.984	T	0.76323	-0.3001	10	0.87932	D	0	.	14.6236	0.68605	1.0:0.0:0.0:0.0	.	256;188;256	C9J5W0;C9JBX5;P43307	.;.;SSRA_HUMAN	T	256;256;256;229;188;256;93	ENSP00000418617:I256T;ENSP00000244763:I256T;ENSP00000380647:I256T;ENSP00000443020:I229T;ENSP00000420730:I188T;ENSP00000417911:I256T;ENSP00000419953:I93T	ENSP00000244763:I256T	I	-	2	0	SSR1	7240650	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.747000	0.91610	2.055000	0.61198	0.528000	0.53228	ATT	.	.	none		0.333	SSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039775.2		
HIST1H1E	3008	hgsc.bcm.edu	37	6	26156757	26156757	+	Missense_Mutation	SNP	G	G	C	rs547695315		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:26156757G>C	ENST00000304218.3	+	1	199	c.139G>C	c.(139-141)Gct>Cct	p.A47P	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	47	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						CATTACTAAAGCTGTTGCCGC	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14468	0.0		0.0	False		,,,				2504	0.0				p.A47P		Atlas-SNP	.											HIST1H1E,NS,lymphoid_neoplasm,-1,1	HIST1H1E	69	1	0			c.G139C						PASS	.						22.0	27.0	25.0					6																	26156757		2203	4300	6503	SO:0001583	missense	3008	exon1			ACTAAAGCTGTTG	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.139G>C	6.37:g.26156757G>C	ENSP00000307705:p.Ala47Pro	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	60	8	0.133333	NM_005321	Q4VB25	Missense_Mutation	SNP	ENST00000304218.3	37	CCDS4586.1	.	.	.	.	.	.	.	.	.	.	.	15.85	2.954554	0.53293	.	.	ENSG00000168298	ENST00000304218	T	0.55760	0.5	5.49	5.49	0.81192	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.170654	0.52532	D	0.000080	D	0.83436	0.5254	H	0.99156	4.45	0.51482	D	0.999923	D	0.76494	0.999	D	0.79784	0.993	D	0.90132	0.4207	10	0.87932	D	0	-2.8941	18.7044	0.91632	0.0:0.0:1.0:0.0	.	47	P10412	H14_HUMAN	P	47	ENSP00000307705:A47P	ENSP00000307705:A47P	A	+	1	0	HIST1H1E	26264736	1.000000	0.71417	0.980000	0.43619	0.175000	0.22909	4.733000	0.62036	2.727000	0.93392	0.655000	0.94253	GCT	.	.	none		0.617	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
EPB41L1	2036	hgsc.bcm.edu	37	20	34775618	34775618	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr20:34775618C>T	ENST00000338074.2	+	8	967	c.806C>T	c.(805-807)gCa>gTa	p.A269V	EPB41L1_ENST00000202028.5_Missense_Mutation_p.A207V|EPB41L1_ENST00000373946.3_Missense_Mutation_p.A238V|EPB41L1_ENST00000373941.1_Missense_Mutation_p.A269V|EPB41L1_ENST00000441639.1_Missense_Mutation_p.A207V|EPB41L1_ENST00000373950.2_Missense_Mutation_p.A172V	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	269	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CCGGGAGAAGCAGAAATCCAC	0.537																																					p.A269V		Atlas-SNP	.											.	EPB41L1	111	.	0			c.C806T						PASS	.						64.0	57.0	59.0					20																	34775618		2203	4300	6503	SO:0001583	missense	2036	exon9			GAGAAGCAGAAAT	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.806C>T	20.37:g.34775618C>T	ENSP00000337168:p.Ala269Val	Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	78	18	0.230769	NM_001258329	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	ENST00000338074.2	37	CCDS13271.1	.	.	.	.	.	.	.	.	.	.	C	36	5.903422	0.97087	.	.	ENSG00000088367	ENST00000202028;ENST00000430276;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000373946;ENST00000338074;ENST00000373941	D;D;D;D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79;-1.79;-1.79;-1.79	6.17	6.17	0.99709	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);FERM conserved site (1);	.	.	.	.	D	0.93877	0.8041	M	0.94021	3.485	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.996;1.0;0.999;0.999	D;D;D;D;D;D	0.91635	0.969;0.999;0.914;0.998;0.996;0.955	D	0.94417	0.7637	9	0.87932	D	0	.	19.4432	0.94831	0.0:1.0:0.0:0.0	.	269;269;238;172;172;207	B7Z653;Q9H4G0;Q9H4G0-4;Q9H4G0-3;B3KUB6;Q9H4G0-2	.;E41L1_HUMAN;.;.;.;.	V	207;207;172;269;172;207;238;269;269	ENSP00000202028:A207V;ENSP00000404341:A207V;ENSP00000363061:A172V;ENSP00000399214:A207V;ENSP00000363057:A238V;ENSP00000337168:A269V;ENSP00000363052:A269V	ENSP00000202028:A207V	A	+	2	0	EPB41L1	34239032	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GCA	.	.	none		0.537	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
FHDC1	85462	hgsc.bcm.edu	37	4	153875426	153875426	+	Silent	SNP	A	A	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:153875426A>G	ENST00000511601.1	+	4	806	c.618A>G	c.(616-618)tcA>tcG	p.S206S	FHDC1_ENST00000260008.3_Silent_p.S206S			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	206	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.								ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					ATTATGGATCAGAGACCTTGC	0.383																																					p.S206S		Atlas-SNP	.											.	FHDC1	102	.	0			c.A618G						PASS	.						113.0	117.0	116.0					4																	153875426		2203	4300	6503	SO:0001819	synonymous_variant	85462	exon3			TGGATCAGAGACC	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.618A>G	4.37:g.153875426A>G		Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	93	18	0.193548	NM_033393		Silent	SNP	ENST00000511601.1	37	CCDS34081.1																																																																																			.	.	none		0.383	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393	
MUC4	4585	hgsc.bcm.edu	37	3	195506983	195506983	+	Missense_Mutation	SNP	G	G	A	rs541438739	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:195506983G>A	ENST00000463781.3	-	2	11927	c.11468C>T	c.(11467-11469)aCc>aTc	p.T3823I	MUC4_ENST00000475231.1_Missense_Mutation_p.T3823I|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3823I(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGAGGGGTGGTGTCACC	0.587													.|||	248	0.0495208	0.1399	0.0317	5008	,	,		9423	0.002		0.0358	False		,,,				2504	0.0031				p.T3823I		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,+1,2	MUC4	1505	2	1	Substitution - Missense(1)	kidney(1)	c.C11468T						scavenged	.						5.0	5.0	5.0					3																	195506983		440	1246	1686	SO:0001583	missense	4585	exon2			AGAGGGGTGGTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11468C>T	3.37:g.195506983G>A	ENSP00000417498:p.Thr3823Ile	Somatic	53	2	0.0377358		WXS	Illumina HiSeq	Phase_I	69	6	0.0869565	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	6.889	0.533565	0.13188	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33216	1.42;1.55	.	.	.	.	.	.	.	.	T	0.13200	0.0320	N	0.14661	0.345	0.09310	N	1	P	0.47604	0.898	B	0.36885	0.235	T	0.15838	-1.0423	7	.	.	.	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	3695	E7ESK3	.	I	3823	ENSP00000417498:T3823I;ENSP00000420243:T3823I	.	T	-	2	0	MUC4	196991762	0.000000	0.05858	0.110000	0.21437	0.111000	0.19643	-0.374000	0.07484	0.064000	0.16427	0.064000	0.15345	ACC	.	.	none		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
LOXHD1	125336	hgsc.bcm.edu	37	18	44152070	44152070	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr18:44152070C>T	ENST00000398722.4	-	8	1191	c.1192G>A	c.(1192-1194)Gac>Aac	p.D398N	LOXHD1_ENST00000441551.2_Missense_Mutation_p.D676N|LOXHD1_ENST00000536736.1_Missense_Mutation_p.D676N			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	398			D -> G (in dbSNP:rs16978578).		calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GCGCTGCTGTCACTGGGTAGC	0.567																																					p.D676N		Atlas-SNP	.											.	LOXHD1	367	.	0			c.G2026A						PASS	.						117.0	111.0	113.0					18																	44152070		692	1591	2283	SO:0001583	missense	125336	exon15			TGCTGTCACTGGG	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.1192G>A	18.37:g.44152070C>T	ENSP00000381707:p.Asp398Asn	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	63	9	0.142857	NM_144612	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	ENST00000398722.4	37		.	.	.	.	.	.	.	.	.	.	C	16.67	3.188822	0.57909	.	.	ENSG00000167210	ENST00000398722;ENST00000536736;ENST00000335730	T;T	0.06142	3.34;3.34	5.9	5.9	0.94986	.	0.281928	0.38436	N	0.001687	T	0.10165	0.0249	M	0.68952	2.095	0.80722	D	1	P;B	0.35272	0.493;0.145	B;B	0.29942	0.109;0.109	T	0.22521	-1.0214	10	0.18276	T	0.48	.	20.2799	0.98512	0.0:1.0:0.0:0.0	.	676;398	F5GZB4;Q8IVV2-2	.;.	N	398;676;398	ENSP00000381707:D398N;ENSP00000444586:D676N	ENSP00000338222:D398N	D	-	1	0	LOXHD1	42406068	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	1.818000	0.39012	2.804000	0.96469	0.549000	0.68633	GAC	.	.	none		0.567	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_144612	
GPR88	54112	hgsc.bcm.edu	37	1	101004706	101004706	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:101004706C>T	ENST00000315033.4	+	2	623	c.184C>T	c.(184-186)Ctg>Ttg	p.L62L		NM_022049.2	NP_071332.2	Q9GZN0	GPR88_HUMAN	G protein-coupled receptor 88	62					G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuronal action potential (GO:0019228)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			large_intestine(2)|skin(1)	3		all_epithelial(167;1.19e-05)|all_lung(203;0.00159)|Lung NSC(277;0.00171)		Epithelial(280;0.0372)|all cancers(265;0.0558)|COAD - Colon adenocarcinoma(174;0.141)|Colorectal(144;0.156)|Lung(183;0.189)		CTTCCGAAAGCTGCAGACCAC	0.677																																					p.L62L		Atlas-SNP	.											.	GPR88	17	.	0			c.C184T						PASS	.						40.0	37.0	38.0					1																	101004706		2203	4300	6503	SO:0001819	synonymous_variant	54112	exon2			CGAAAGCTGCAGA	AB042411	CCDS772.1	1p21.3	2012-08-21	2006-02-15		ENSG00000181656	ENSG00000181656		"""GPCR / Class A : Orphans"""	4539	protein-coding gene	gene with protein product		607468	"""G-protein coupled receptor 88"", ""G protein coupled receptor 88"""				Standard	NM_022049		Approved		uc001dth.3	Q9GZN0	OTTHUMG00000010981	ENST00000315033.4:c.184C>T	1.37:g.101004706C>T		Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	94	40	0.425532	NM_022049	Q29S24|Q6VN48	Silent	SNP	ENST00000315033.4	37	CCDS772.1																																																																																			.	.	none		0.677	GPR88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030212.1	NM_022049	
NEFH	4744	hgsc.bcm.edu	37	22	29885686	29885686	+	Missense_Mutation	SNP	C	C	A	rs200302220		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr22:29885686C>A	ENST00000310624.6	+	4	2090	c.2057C>A	c.(2056-2058)gCa>gAa	p.A686E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	692	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.A686E(1)		cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAGTGAAGGCAGAAGCAAAG	0.562																																					p.A686E		Atlas-SNP	.											NEFH,NS,carcinoma,0,1	NEFH	178	1	1	Substitution - Missense(1)	endometrium(1)	c.C2057A						scavenged	.						86.0	90.0	89.0					22																	29885686		2203	4297	6500	SO:0001583	missense	4744	exon4			TGAAGGCAGAAGC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2057C>A	22.37:g.29885686C>A	ENSP00000311997:p.Ala686Glu	Somatic	348	4	0.0114943		WXS	Illumina HiSeq	Phase_I	373	8	0.0214477	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-2.972244	0.00048	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.81579	-1.51	4.35	0.981	0.19756	.	0.859378	0.09876	N	0.744254	T	0.55816	0.1944	N	0.04043	-0.29	0.18873	N	0.999989	B	0.20780	0.048	B	0.27715	0.082	T	0.45629	-0.9248	10	0.05436	T	0.98	.	6.9319	0.24445	0.6374:0.2859:0.0767:0.0	.	692	P12036	NFH_HUMAN	E	686	ENSP00000311997:A686E	ENSP00000311997:A686E	A	+	2	0	NEFH	28215686	0.010000	0.17322	0.020000	0.16555	0.035000	0.12851	0.923000	0.28757	0.003000	0.14656	-0.259000	0.10710	GCA	.	.	weak		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
C12orf40	283461	hgsc.bcm.edu	37	12	40044041	40044041	+	Splice_Site	SNP	C	C	T	rs568770394		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:40044041C>T	ENST00000324616.5	+	7	725	c.571C>T	c.(571-573)Cgc>Tgc	p.R191C	C12orf40_ENST00000405531.3_Splice_Site_p.R191C|C12orf40_ENST00000398716.1_Splice_Site_p.R114C	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	191								p.R191C(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						TTTTTTTCAGCGCAGTACTGT	0.269													C|||	1	0.000199681	0.0	0.0	5008	,	,		12472	0.0		0.0	False		,,,				2504	0.001				p.R191C		Atlas-SNP	.											C12orf40,NS,carcinoma,0,1	C12orf40	118	1	1	Substitution - Missense(1)	endometrium(1)	c.C571T						scavenged	.						74.0	64.0	67.0					12																	40044041		1784	4060	5844	SO:0001630	splice_region_variant	283461	exon7			TTTCAGCGCAGTA	AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.571-1C>T	12.37:g.40044041C>T		Somatic	291	0	0		WXS	Illumina HiSeq	Phase_I	245	6	0.0244898	NM_001031748	B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	ENST00000324616.5	37	CCDS41770.1	.	.	.	.	.	.	.	.	.	.	C	5.619	0.298950	0.10622	.	.	ENSG00000180116	ENST00000405531;ENST00000398716;ENST00000324616	T;T	0.45276	0.9;0.91	3.53	2.61	0.31194	.	0.479030	0.15666	N	0.250646	T	0.18800	0.0451	N	0.08118	0	0.26580	N	0.973408	B	0.24368	0.102	B	0.06405	0.002	T	0.15694	-1.0428	9	.	.	.	.	7.3809	0.26856	0.0:0.876:0.0:0.124	.	191	Q86WS4	CL040_HUMAN	C	191;114;191	ENSP00000383897:R191C;ENSP00000317671:R191C	.	R	+	1	0	C12orf40	38330308	0.027000	0.19231	0.785000	0.31869	0.303000	0.27691	-0.145000	0.10265	1.031000	0.39867	0.650000	0.86243	CGC	.	.	none		0.269	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257664.2	NM_173599	Missense_Mutation
REEP1	65055	hgsc.bcm.edu	37	2	86459825	86459825	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr2:86459825G>A	ENST00000165698.5	-	6	661	c.518C>T	c.(517-519)cCg>cTg	p.P173L	REEP1_ENST00000541910.1_Missense_Mutation_p.R95W|REEP1_ENST00000535845.1_Missense_Mutation_p.P146L|REEP1_ENST00000473407.1_5'Flank|REEP1_ENST00000540790.1_Missense_Mutation_p.P152L|REEP1_ENST00000538924.1_Missense_Mutation_p.P180L	NM_022912.2	NP_075063.1	Q9H902	REEP1_HUMAN	receptor accessory protein 1	173	Poly-Pro.				cell death (GO:0008219)|endoplasmic reticulum tubular network organization (GO:0071786)|protein insertion into membrane (GO:0051205)|regulation of intracellular transport (GO:0032386)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	microtubule binding (GO:0008017)|olfactory receptor binding (GO:0031849)			breast(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	13						CCCAGACCCCGGTGGTGGGGG	0.647																																					p.P180L		Atlas-SNP	.											.	REEP1	22	.	0			c.C539T						PASS	.						34.0	33.0	33.0					2																	86459825		2203	4300	6503	SO:0001583	missense	65055	exon6			GACCCCGGTGGTG	AK023172	CCDS1989.1, CCDS54372.1, CCDS54373.1, CCDS54374.1	2p11.2	2014-09-17	2006-02-07	2006-02-07	ENSG00000068615	ENSG00000068615		"""Receptor accessory proteins"""	25786	protein-coding gene	gene with protein product	"""receptor expression enhancing protein 1"""	609139	"""chromosome 2 open reading frame 23"""	C2orf23		16271481, 15550249	Standard	NM_022912		Approved	FLJ13110, SPG31	uc002srh.4	Q9H902	OTTHUMG00000130205	ENST00000165698.5:c.518C>T	2.37:g.86459825G>A	ENSP00000165698:p.Pro173Leu	Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	33	9	0.272727	NM_001164730	B7Z4D7|B7Z4F2|B7Z5R9|D6W5M2|Q53TI0	Missense_Mutation	SNP	ENST00000165698.5	37	CCDS1989.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.09|15.09	2.729874|2.729874	0.48833|0.48833	.|.	.|.	ENSG00000068615|ENSG00000068615	ENST00000165698;ENST00000538924;ENST00000535845;ENST00000540790;ENST00000453231|ENST00000541910;ENST00000437769	D;D;D;D;D|D;D	0.88354|0.95001	-2.35;-2.37;-1.53;-1.53;-2.32|-3.58;-3.52	5.48|5.48	4.6|4.6	0.57074|0.57074	.|.	0.302480|.	0.28760|.	N|.	0.014224|.	D|D	0.90356|0.90356	0.6982|0.6982	N|N	0.22421|0.22421	0.69|0.69	0.21290|0.21290	N|N	0.999732|0.999732	B;B;B|D	0.20887|0.56968	0.012;0.049;0.012|0.978	B;B;B|B	0.19148|0.43623	0.003;0.024;0.003|0.425	D|D	0.83759|0.83759	0.0213|0.0213	10|9	0.17369|0.62326	T|D	0.5|0.03	.|.	13.2924|13.2924	0.60278|0.60278	0.0:0.0:0.8413:0.1587|0.0:0.0:0.8413:0.1587	.|.	146;152;173|95	B7Z5R9;F5H7Z9;Q9H902|B7Z4D7	.;.;REEP1_HUMAN|.	L|W	173;180;146;152;180|95	ENSP00000165698:P173L;ENSP00000438346:P180L;ENSP00000437567:P146L;ENSP00000443831:P152L;ENSP00000392197:P180L|ENSP00000442681:R95W;ENSP00000401140:R95W	ENSP00000165698:P173L|ENSP00000401140:R95W	P|R	-|-	2|1	0|2	REEP1|REEP1	86313336|86313336	0.994000|0.994000	0.37717|0.37717	0.134000|0.134000	0.22075|0.22075	0.187000|0.187000	0.23431|0.23431	5.056000|5.056000	0.64287|0.64287	1.430000|1.430000	0.47334|0.47334	0.655000|0.655000	0.94253|0.94253	CCG|CGG	.	.	none		0.647	REEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252523.2	NM_022912	
MUC4	4585	hgsc.bcm.edu	37	3	195513411	195513411	+	Silent	SNP	A	A	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:195513411A>T	ENST00000463781.3	-	2	5499	c.5040T>A	c.(5038-5040)ccT>ccA	p.P1680P	MUC4_ENST00000475231.1_Silent_p.P1680P|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGACAGGAAGAGGGGTGGCGT	0.612																																					p.P1680P		Atlas-SNP	.											MUC4_ENST00000463781,trunk,malignant_melanoma,-2,4	MUC4	1505	4	0			c.T5040A						scavenged	.						38.0	36.0	37.0					3																	195513411		690	1583	2273	SO:0001819	synonymous_variant	4585	exon2			AGGAAGAGGGGTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5040T>A	3.37:g.195513411A>T		Somatic	330	5	0.0151515		WXS	Illumina HiSeq	Phase_I	372	9	0.0241935	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	none		0.612	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
UBQLN1	29979	hgsc.bcm.edu	37	9	86322427	86322427	+	Missense_Mutation	SNP	G	G	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr9:86322427G>C	ENST00000376395.4	-	1	691	c.168C>G	c.(166-168)agC>agG	p.S56R	UBQLN1_ENST00000257468.7_Missense_Mutation_p.S56R|RP11-522I20.3_ENST00000531661.1_RNA|RP11-522I20.3_ENST00000524818.1_RNA	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	56	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						GCTGGACGGAGCTATTCTCGG	0.692																																					p.S56R	Melanoma(186;1284 2073 12755 14558 18426)	Atlas-SNP	.											.	UBQLN1	49	.	0			c.C168G						PASS	.						21.0	22.0	21.0					9																	86322427		2201	4298	6499	SO:0001583	missense	29979	exon1			GACGGAGCTATTC	AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.168C>G	9.37:g.86322427G>C	ENSP00000365576:p.Ser56Arg	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	79	12	0.151899	NM_053067	Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Missense_Mutation	SNP	ENST00000376395.4	37	CCDS6663.1	.	.	.	.	.	.	.	.	.	.	G	19.47	3.833689	0.71258	.	.	ENSG00000135018	ENST00000376395;ENST00000257468;ENST00000529923	T;T;T	0.80123	-0.8;-0.8;-1.34	3.88	2.97	0.34412	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.64402	D	0.000001	D	0.84224	0.5425	L	0.51853	1.615	0.46586	D	0.999117	D;D	0.76494	0.993;0.999	D;D	0.79108	0.949;0.992	T	0.83041	-0.0157	10	0.54805	T	0.06	.	8.8201	0.35020	0.1097:0.0:0.8903:0.0	.	56;56	Q9UMX0-2;Q9UMX0	.;UBQL1_HUMAN	R	56;56;30	ENSP00000365576:S56R;ENSP00000257468:S56R;ENSP00000434194:S30R	ENSP00000257468:S56R	S	-	3	2	UBQLN1	85512247	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.822000	0.48073	0.956000	0.37904	0.561000	0.74099	AGC	.	.	none		0.692	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000052834.1	NM_013438	
SOHLH1	402381	hgsc.bcm.edu	37	9	138590933	138590933	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr9:138590933C>T	ENST00000298466.5	-	2	165	c.105G>A	c.(103-105)tcG>tcA	p.S35S	SOHLH1_ENST00000425225.1_Silent_p.S35S	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1	35					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		AGCCCCGGGCCGAGTCCTCGC	0.701																																					p.S35S		Atlas-SNP	.											.	SOHLH1	70	.	0			c.G105A						PASS	.						12.0	14.0	13.0					9																	138590933		2184	4273	6457	SO:0001819	synonymous_variant	402381	exon2			CCGGGCCGAGTCC	BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915	ENST00000298466.5:c.105G>A	9.37:g.138590933C>T		Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	52	38	0.730769	NM_001012415	C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Silent	SNP	ENST00000298466.5	37	CCDS35174.1																																																																																			.	.	none		0.701	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055018.2	NM_001012415	
C7	730	hgsc.bcm.edu	37	5	40936442	40936442	+	Nonsense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:40936442C>T	ENST00000313164.9	+	5	642	c.283C>T	c.(283-285)Cag>Tag	p.Q95*		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	95	LDL-receptor class A. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				GTGTTCAGGTCAGTGCATCAG	0.463																																					p.Q95X		Atlas-SNP	.											.	C7	136	.	0			c.C283T						PASS	.						104.0	101.0	102.0					5																	40936442		1993	4174	6167	SO:0001587	stop_gained	730	exon5			TCAGGTCAGTGCA	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.283C>T	5.37:g.40936442C>T	ENSP00000322061:p.Gln95*	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	124	34	0.274194	NM_000587	Q6P3T5|Q92489	Nonsense_Mutation	SNP	ENST00000313164.9	37	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	C	37	6.596583	0.97692	.	.	ENSG00000112936	ENST00000313164;ENST00000440677;ENST00000515157	.	.	.	5.02	5.02	0.67125	.	0.058459	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-15.7368	18.483	0.90819	0.0:1.0:0.0:0.0	.	.	.	.	X	95	.	ENSP00000322061:Q95X	Q	+	1	0	C7	40972199	1.000000	0.71417	1.000000	0.80357	0.124000	0.20399	5.560000	0.67332	2.779000	0.95612	0.491000	0.48974	CAG	.	.	none		0.463	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1		
NRXN3	9369	hgsc.bcm.edu	37	14	79432416	79432416	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr14:79432416C>T	ENST00000554719.1	+	9	1816	c.1325C>T	c.(1324-1326)aCg>aTg	p.T442M	NRXN3_ENST00000335750.5_Missense_Mutation_p.T442M	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	211					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		AACATTGAAACGGGAATCATG	0.433																																					p.T442M		Atlas-SNP	.											.	NRXN3	342	.	0			c.C1325T						PASS	.						117.0	104.0	108.0					14																	79432416		2203	4300	6503	SO:0001583	missense	9369	exon9			TTGAAACGGGAAT	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1325C>T	14.37:g.79432416C>T	ENSP00000451648:p.Thr442Met	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	87	17	0.195402	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	37	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752562	0.69533	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	T;T	0.78246	-1.16;-1.16	5.22	5.22	0.72569	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.88496	0.6452	.	.	.	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.87752	0.2592	8	.	.	.	.	19.3296	0.94280	0.0:1.0:0.0:0.0	.	815;442	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	M	815;804;442;442	ENSP00000451648:T442M;ENSP00000338349:T442M	.	T	+	2	0	NRXN3	78502169	1.000000	0.71417	0.951000	0.38953	0.381000	0.30169	7.609000	0.82925	2.873000	0.98535	0.563000	0.77884	ACG	.	.	none		0.433	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	
NRAP	4892	hgsc.bcm.edu	37	10	115412746	115412746	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr10:115412746A>G	ENST00000359988.3	-	6	762	c.518T>C	c.(517-519)aTg>aCg	p.M173T	NRAP_ENST00000369360.3_Missense_Mutation_p.M173T|NRAP_ENST00000369358.4_Missense_Mutation_p.M173T|NRAP_ENST00000360478.3_Missense_Mutation_p.M173T	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		AGGTGTGATCATGGCTGGAAA	0.463																																					p.M173T		Atlas-SNP	.											.	NRAP	208	.	0			c.T518C						PASS	.						179.0	156.0	164.0					10																	115412746		2203	4300	6503	SO:0001583	missense	4892	exon6			GTGATCATGGCTG		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.518T>C	10.37:g.115412746A>G	ENSP00000353078:p.Met173Thr	Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	77	28	0.363636	NM_001261463		Missense_Mutation	SNP	ENST00000359988.3	37	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	A	6.482	0.457167	0.12283	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.16897	2.56;2.52;2.44;2.31	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.16085	0.0387	L	0.42245	1.32	0.49483	D	0.999797	B;B;B	0.19706	0.038;0.02;0.017	B;B;B	0.21708	0.024;0.036;0.016	T	0.06391	-1.0829	10	0.07813	T	0.8	.	16.3782	0.83418	1.0:0.0:0.0:0.0	.	173;173;173	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	T	173	ENSP00000358365:M173T;ENSP00000358367:M173T;ENSP00000353078:M173T;ENSP00000353666:M173T	ENSP00000353078:M173T	M	-	2	0	NRAP	115402736	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.287000	0.72671	2.277000	0.76020	0.528000	0.53228	ATG	.	.	none		0.463	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
PIM1	5292	hgsc.bcm.edu	37	6	37138791	37138791	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:37138791C>T	ENST00000373509.5	+	3	597	c.224C>T	c.(223-225)tCc>tTc	p.S75F		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	166					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)	p.S75F(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GACCGGATTTCCGACTGGGGA	0.701			T	BCL6	NHL																																p.S166F		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,carcinoma,0,1	PIM1	71	1	1	Substitution - Missense(1)	lung(1)	c.C497T						PASS	.						53.0	55.0	55.0					6																	37138791		2203	4300	6503	SO:0001583	missense	5292	exon3			GGATTTCCGACTG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.224C>T	6.37:g.37138791C>T	ENSP00000362608:p.Ser75Phe	Somatic	160	0	0		WXS	Illumina HiSeq	Phase_I	143	28	0.195804	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.566693	0.28003	.	.	ENSG00000137193	ENST00000373509	T	0.67171	-0.25	4.44	4.44	0.53790	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.073980	0.53938	D	0.000044	T	0.47764	0.1463	L	0.47716	1.5	0.47621	D	0.999477	B	0.29270	0.24	B	0.29663	0.105	T	0.48747	-0.9008	10	0.25751	T	0.34	.	17.2083	0.86924	0.0:1.0:0.0:0.0	.	166	P11309	PIM1_HUMAN	F	75	ENSP00000362608:S75F	ENSP00000362608:S75F	S	+	2	0	PIM1	37246769	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.030000	0.76484	2.468000	0.83385	0.549000	0.68633	TCC	.	.	none		0.701	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
ACSM5	54988	hgsc.bcm.edu	37	16	20441084	20441084	+	Silent	SNP	T	T	C	rs8063682	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr16:20441084T>C	ENST00000331849.4	+	8	1233	c.1086T>C	c.(1084-1086)acT>acC	p.T362T		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	362					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						AACACCAGACTGGTGTGGAGC	0.597													C|||	2717	0.542532	0.7428	0.2867	5008	,	,		16542	0.755		0.3211	False		,,,				2504	0.4622				p.T362T		Atlas-SNP	.											ACSM5,right_upper_lobe,carcinoma,+2,1	ACSM5	101	1	0			c.T1086C						scavenged	.	C		2925,1481		1058,809,336	81.0	86.0	84.0		1086	-8.9	0.1	16	dbSNP_116	84	2735,5861		558,1619,2121	no	coding-synonymous	ACSM5	NM_017888.2		1616,2428,2457	CC,CT,TT		31.8171,33.6133,43.5318		362/580	20441084	5660,7342	2203	4298	6501	SO:0001819	synonymous_variant	54988	exon8			CCAGACTGGTGTG		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1086T>C	16.37:g.20441084T>C		Somatic	35	4	0.114286		WXS	Illumina HiSeq	Phase_I	46	12	0.26087	NM_017888	Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	ENST00000331849.4	37	CCDS10585.1																																																																																			T|0.550;C|0.450	0.450	strong		0.597	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888	
CDC16	8881	hgsc.bcm.edu	37	13	115004951	115004951	+	Missense_Mutation	SNP	A	A	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr13:115004951A>T	ENST00000356221.3	+	5	475	c.367A>T	c.(367-369)Atg>Ttg	p.M123L	CDC16_ENST00000252457.5_Missense_Mutation_p.M122L|CDC16_ENST00000375312.3_Missense_Mutation_p.M29L|CDC16_ENST00000252458.6_Missense_Mutation_p.M29L|CDC16_ENST00000375310.1_Missense_Mutation_p.M29L|CDC16_ENST00000360383.3_Missense_Mutation_p.M123L|CDC16_ENST00000375308.1_Missense_Mutation_p.M29L			Q13042	CDC16_HUMAN	cell division cycle 16	123					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of mitosis (GO:0007088)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|spindle (GO:0005819)				endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			CGACTGGGAAATGTCACAGTC	0.418																																					p.M123L		Atlas-SNP	.											.	CDC16	50	.	0			c.A367T						PASS	.						39.0	43.0	42.0					13																	115004951		2203	4300	6503	SO:0001583	missense	8881	exon5			TGGGAAATGTCAC	U18291	CCDS9542.2	13q34	2013-01-17	2013-01-17		ENSG00000130177	ENSG00000130177		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1720	protein-coding gene	gene with protein product	"""anaphase-promoting complex, subunit 6"""	603461	"""CDC16 (cell division cycle 16, S. cerevisiae, homolog)"", ""CDC16 cell division cycle 16 homolog (S. cerevisiae)"", ""cell division cycle 16 homolog (S. cerevisiae)"""			7736578	Standard	NM_001078645		Approved	APC6, ANAPC6, CUT9	uc001vul.1	Q13042	OTTHUMG00000017402	ENST00000356221.3:c.367A>T	13.37:g.115004951A>T	ENSP00000348554:p.Met123Leu	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	106	19	0.179245	NM_003903	A2A365|Q5T8C8|Q96AE6|Q9Y564	Missense_Mutation	SNP	ENST00000356221.3	37	CCDS9542.2	.	.	.	.	.	.	.	.	.	.	A	6.976	0.550066	0.13374	.	.	ENSG00000130177	ENST00000360383;ENST00000375312;ENST00000356221;ENST00000375310;ENST00000252457;ENST00000375308;ENST00000252458	.	.	.	5.73	3.32	0.38043	Tetratricopeptide-like helical (1);	0.110567	0.85682	D	0.000000	T	0.37461	0.1004	N	0.19112	0.55	0.43168	D	0.994969	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.09058	-1.0692	8	.	.	.	-28.7507	9.0916	0.36614	0.7929:0.0:0.2071:0.0	.	123;122;122;123	B4DK74;Q13042-3;Q13042-2;Q13042	.;.;.;CDC16_HUMAN	L	123;29;123;29;122;29;29	.	.	M	+	1	0	CDC16	114023053	1.000000	0.71417	0.801000	0.32222	0.154000	0.21943	5.567000	0.67378	0.457000	0.26962	-0.376000	0.06991	ATG	.	.	none		0.418	CDC16-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276737.1	NM_003903	
MAGEB5	347541	hgsc.bcm.edu	37	X	26236119	26236119	+	Nonsense_Mutation	SNP	C	C	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chrX:26236119C>A	ENST00000602297.1	+	2	948	c.701C>A	c.(700-702)tCa>tAa	p.S234*	MAGEB5_ENST00000379029.2_Nonsense_Mutation_p.S234*	NM_001271752.1	NP_001258681.1	Q9BZ81	MAGB5_HUMAN	melanoma antigen family B, 5	234	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									lung(1)|ovary(1)	2						GCCTTCTCATCACAATATGAA	0.493																																					p.S234X		Atlas-SNP	.											.	MAGEB5	5	.	0			c.C701A						PASS	.																																			SO:0001587	stop_gained	347541	exon2			TCTCATCACAATA	AF333705	CCDS65233.1	Xp22	2012-04-20			ENSG00000188408	ENSG00000188408			23795	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 3"""	300466				10861452	Standard	NM_001271752		Approved	MAGE-B5, CT3.3	uc031thc.1	Q9BZ81	OTTHUMG00000021288	ENST00000602297.1:c.701C>A	X.37:g.26236119C>A	ENSP00000473493:p.Ser234*	Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	174	40	0.229885	NM_001271752		Nonsense_Mutation	SNP	ENST00000602297.1	37		.	.	.	.	.	.	.	.	.	.	C	11.46	1.646260	0.29246	.	.	ENSG00000188408	ENST00000379029	.	.	.	3.69	-1.39	0.08997	.	1.441160	0.04812	U	0.435388	.	.	.	.	.	.	0.49299	D	0.999773	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	0.5424	0.00647	0.178:0.3046:0.172:0.3455	.	.	.	.	X	234	.	ENSP00000368315:S234X	S	+	2	0	MAGEB5	26146040	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.681000	0.05191	-0.484000	0.06763	-0.224000	0.12420	TCA	.	.	none		0.493	MAGEB5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000056126.2	XM_293407	
ADPRM	56985	hgsc.bcm.edu	37	17	10608524	10608524	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:10608524T>C	ENST00000379774.4	+	2	372	c.281T>C	c.(280-282)aTg>aCg	p.M94T	ADPRM_ENST00000609540.1_Missense_Mutation_p.M94T	NM_020233.4	NP_064618.3	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent	94							ADP-ribose diphosphatase activity (GO:0047631)|CDP-glycerol diphosphatase activity (GO:0047734)|metal ion binding (GO:0046872)										GAACTTGTTATGGACATGTTC	0.378																																					p.M94T		Atlas-SNP	.											.	.	.	.	0			c.T281C						PASS	.						102.0	96.0	98.0					17																	10608524		2203	4300	6503	SO:0001583	missense	56985	exon2			TTGTTATGGACAT	BC070155	CCDS11159.2	17p13.1	2012-07-20	2012-07-20	2012-07-20	ENSG00000170222	ENSG00000170222	3.6.1.13, 3.6.1.16, 3.6.1.53		30925	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 48"""	C17orf48		18352857	Standard	XM_005256738		Approved	MDS006	uc002gmt.3	Q3LIE5	OTTHUMG00000130366	ENST00000379774.4:c.281T>C	17.37:g.10608524T>C	ENSP00000369099:p.Met94Thr	Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	100	6	0.06	NM_020233	A8K9B4|D3DTS4|Q9BVD4|Q9NRU8	Missense_Mutation	SNP	ENST00000379774.4	37	CCDS11159.2	.	.	.	.	.	.	.	.	.	.	T	13.94	2.387844	0.42308	.	.	ENSG00000170222	ENST00000379774	D	0.84589	-1.87	5.65	5.65	0.86999	Metallophosphoesterase domain (1);	0.252882	0.47093	D	0.000257	D	0.87450	0.6180	L	0.37561	1.115	0.80722	D	1	B	0.30634	0.288	P	0.52424	0.698	T	0.82339	-0.0506	10	0.16420	T	0.52	-16.4474	15.7104	0.77623	0.0:0.0:0.0:1.0	.	94	Q3LIE5	ADPRM_HUMAN	T	94	ENSP00000369099:M94T	ENSP00000369099:M94T	M	+	2	0	C17orf48	10549249	1.000000	0.71417	0.815000	0.32552	0.716000	0.41182	7.127000	0.77210	2.371000	0.80710	0.533000	0.62120	ATG	.	.	none		0.378	ADPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252732.2	NM_020233	
FAT4	79633	hgsc.bcm.edu	37	4	126329648	126329648	+	Missense_Mutation	SNP	T	T	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:126329648T>A	ENST00000394329.3	+	4	5632	c.5619T>A	c.(5617-5619)aaT>aaA	p.N1873K	FAT4_ENST00000335110.5_Missense_Mutation_p.N171K	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1873	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CTGGTGTGAATGGAGAAATTA	0.323																																					p.N1873K		Atlas-SNP	.											.	FAT4	1752	.	0			c.T5619A						PASS	.						114.0	117.0	116.0					4																	126329648		2203	4300	6503	SO:0001583	missense	79633	exon4			TGTGAATGGAGAA	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.5619T>A	4.37:g.126329648T>A	ENSP00000377862:p.Asn1873Lys	Somatic	143	0	0		WXS	Illumina HiSeq	Phase_I	118	14	0.118644	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	T	18.43	3.621835	0.66787	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.59906	0.23;0.23	5.03	2.62	0.31277	Cadherin (4);Cadherin-like (1);	0.000000	0.36519	U	0.002554	T	0.79828	0.4513	H	0.95187	3.635	0.58432	D	0.999995	D;D	0.76494	0.995;0.999	D;D	0.80764	0.98;0.994	T	0.81389	-0.0955	10	0.72032	D	0.01	.	8.8314	0.35087	0.0:0.1539:0.0:0.8461	.	171;1873	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	K	1873;171	ENSP00000377862:N1873K;ENSP00000335169:N171K	ENSP00000335169:N171K	N	+	3	2	FAT4	126549098	0.989000	0.36119	1.000000	0.80357	0.969000	0.65631	0.128000	0.15810	0.761000	0.33130	0.482000	0.46254	AAT	.	.	none		0.323	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
MYO3A	53904	hgsc.bcm.edu	37	10	26446318	26446318	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr10:26446318G>A	ENST00000265944.5	+	26	3039	c.2873G>A	c.(2872-2874)cGt>cAt	p.R958H	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	958	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R958H(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AATAGTGAGCGTCAGGCAAGA	0.408																																					p.R958H		Atlas-SNP	.											MYO3A,caecum,carcinoma,0,3	MYO3A	371	3	1	Substitution - Missense(1)	breast(1)	c.G2873A						PASS	.						139.0	131.0	133.0					10																	26446318		2203	4300	6503	SO:0001583	missense	53904	exon26			GTGAGCGTCAGGC	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.2873G>A	10.37:g.26446318G>A	ENSP00000265944:p.Arg958His	Somatic	169	0	0		WXS	Illumina HiSeq	Phase_I	153	71	0.464052	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	34	5.320239	0.95682	.	.	ENSG00000095777	ENST00000265944	D	0.87887	-2.31	5.31	5.31	0.75309	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.93713	0.7991	M	0.78223	2.4	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94022	0.7293	10	0.72032	D	0.01	.	19.3468	0.94367	0.0:0.0:1.0:0.0	.	958	Q8NEV4	MYO3A_HUMAN	H	958	ENSP00000265944:R958H	ENSP00000265944:R958H	R	+	2	0	MYO3A	26486324	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.809000	0.99208	2.640000	0.89533	0.655000	0.94253	CGT	.	.	none		0.408	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
DSC3	1825	hgsc.bcm.edu	37	18	28576767	28576767	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr18:28576767C>T	ENST00000360428.4	-	15	2563	c.2483G>A	c.(2482-2484)cGt>cAt	p.R828H	DSC3_ENST00000434452.1_Missense_Mutation_p.R828H	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	828					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			TTCACCGAGACGGGGTTGAGT	0.433																																					p.R828H		Atlas-SNP	.											DSC3_ENST00000434452,colon,carcinoma,-1,2	DSC3	225	2	0			c.G2483A						PASS	.						80.0	71.0	74.0					18																	28576767		2203	4300	6503	SO:0001583	missense	1825	exon15			CCGAGACGGGGTT	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.2483G>A	18.37:g.28576767C>T	ENSP00000353608:p.Arg828His	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	65	16	0.246154	NM_024423	A6NN35|Q14200|Q9HAZ9	Missense_Mutation	SNP	ENST00000360428.4	37	CCDS32810.1	.	.	.	.	.	.	.	.	.	.	C	9.912	1.209685	0.22289	.	.	ENSG00000134762	ENST00000360428;ENST00000434452	T;T	0.76448	-1.02;0.28	4.64	3.77	0.43336	Cadherin, cytoplasmic domain (1);	0.000000	0.32287	N	0.006305	T	0.65780	0.2724	L	0.39898	1.24	0.39448	D	0.967356	P;P	0.45634	0.616;0.863	B;B	0.37888	0.167;0.26	T	0.67647	-0.5617	10	0.45353	T	0.12	.	9.6501	0.39892	0.0:0.8391:0.0:0.1609	.	828;828	Q14574;Q14574-2	DSC3_HUMAN;.	H	828	ENSP00000353608:R828H;ENSP00000392068:R828H	ENSP00000353608:R828H	R	-	2	0	DSC3	26830765	0.994000	0.37717	0.965000	0.40720	0.627000	0.37826	2.519000	0.45546	1.296000	0.44742	-0.150000	0.13652	CGT	.	.	none		0.433	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423	
CNOT3	4849	hgsc.bcm.edu	37	19	54648016	54648016	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr19:54648016G>A	ENST00000406403.1	+	6	2034	c.431G>A	c.(430-432)aGt>aAt	p.S144N	CNOT3_ENST00000358389.3_5'UTR|CNOT3_ENST00000221232.5_Missense_Mutation_p.S144N			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	144					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CAGTTTGAGAGTGAAGTGGAG	0.567																																					p.S144N		Atlas-SNP	.											.	CNOT3	133	.	0			c.G431A						PASS	.						149.0	111.0	124.0					19																	54648016		2203	4300	6503	SO:0001583	missense	4849	exon7			TTGAGAGTGAAGT	AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.431G>A	19.37:g.54648016G>A	ENSP00000383954:p.Ser144Asn	Somatic	165	0	0		WXS	Illumina HiSeq	Phase_I	166	35	0.210843	NM_014516	Q9NZN7|Q9UF76	Missense_Mutation	SNP	ENST00000406403.1	37	CCDS12880.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.452152|5.452152	0.96223|0.96223	.|.	.|.	ENSG00000088038|ENSG00000088038	ENST00000221232;ENST00000406403|ENST00000440571	T;T|.	0.46063|.	0.88;0.88|.	5.38|5.38	5.38|5.38	0.77491|0.77491	Not CCR4-Not complex component, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74512|0.74512	0.3726|0.3726	M|M	0.67397|0.67397	2.05|2.05	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.999;0.997;0.999|.	D;D;D|.	0.83275|.	0.996;0.992;0.996|.	T|T	0.72686|0.72686	-0.4218|-0.4218	10|5	0.51188|.	T|.	0.08|.	-14.3079|-14.3079	18.2928|18.2928	0.90136|0.90136	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	144;144;68|.	B7Z6J7;O75175;Q6ZMJ6|.	.;CNOT3_HUMAN;.|.	N|M	144|65	ENSP00000221232:S144N;ENSP00000383954:S144N|.	ENSP00000221232:S144N|.	S|V	+|+	2|1	0|0	CNOT3|CNOT3	59339828|59339828	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.224000|9.224000	0.95209|0.95209	2.697000|2.697000	0.92050|0.92050	0.655000|0.655000	0.94253|0.94253	AGT|GTG	.	.	none		0.567	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142130.3	NM_014516	
PIM1	5292	hgsc.bcm.edu	37	6	37138953	37138953	+	Nonsense_Mutation	SNP	C	C	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:37138953C>A	ENST00000373509.5	+	4	666	c.293C>A	c.(292-294)tCg>tAg	p.S98*		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	189					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	AAGGTGAGCTCGGGTTTCTCC	0.647			T	BCL6	NHL																																p.S189X		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C566A						PASS	.						84.0	94.0	90.0					6																	37138953		2203	4300	6503	SO:0001587	stop_gained	5292	exon4			TGAGCTCGGGTTT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.293C>A	6.37:g.37138953C>A	ENSP00000362608:p.Ser98*	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	87	23	0.264368	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Nonsense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	40	8.002206	0.98605	.	.	ENSG00000137193	ENST00000373509	.	.	.	4.28	4.28	0.50868	.	0.237529	0.32769	N	0.005670	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.8746	0.86048	0.0:1.0:0.0:0.0	.	.	.	.	X	98	.	ENSP00000362608:S98X	S	+	2	0	PIM1	37246931	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.684000	0.61686	2.371000	0.80710	0.549000	0.68633	TCG	.	.	none		0.647	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
CNTNAP5	129684	hgsc.bcm.edu	37	2	125627339	125627339	+	Splice_Site	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr2:125627339G>T	ENST00000431078.1	+	21	3797	c.3433G>T	c.(3433-3435)Gag>Tag	p.E1145*		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1145	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CAAAGTCACAGGTATGTTGTT	0.403																																					p.E1145X		Atlas-SNP	.											.	CNTNAP5	405	.	0			c.G3433T						PASS	.						72.0	69.0	70.0					2																	125627339		1870	4105	5975	SO:0001630	splice_region_variant	129684	exon21			GTCACAGGTATGT	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3433+1G>T	2.37:g.125627339G>T		Somatic	201	0	0		WXS	Illumina HiSeq	Phase_I	150	15	0.1	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Nonsense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	G	45	11.607466	0.99582	.	.	ENSG00000155052	ENST00000431078	.	.	.	5.57	5.57	0.84162	.	0.270733	0.25535	N	0.030011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	15.1209	0.72441	0.0:0.0:1.0:0.0	.	.	.	.	X	1145	.	ENSP00000399013:E1145X	E	+	1	0	CNTNAP5	125343809	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.395000	0.66291	2.610000	0.88304	0.558000	0.71614	GAG	.	.	none		0.403	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		Nonsense_Mutation
HIST1H2AM	8336	hgsc.bcm.edu	37	6	27860580	27860580	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:27860580C>T	ENST00000359611.2	-	1	383	c.348G>A	c.(346-348)ctG>ctA	p.L116L	HIST1H2BO_ENST00000303806.4_5'Flank|HIST1H3J_ENST00000479986.1_5'UTR|HIST1H3J_ENST00000359303.2_5'Flank	NM_003514.2	NP_003505.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	116						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)	14						TCTTGGGGAGCAGTACGGCCT	0.502																																					p.L116L		Atlas-SNP	.											.	HIST1H2AM	27	.	0			c.G348A						PASS	.						131.0	126.0	128.0					6																	27860580		2203	4300	6503	SO:0001819	synonymous_variant	8336	exon1			GGGGAGCAGTACG	X57138	CCDS4639.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000233224	ENSG00000278677		"""Histones / Replication-dependent"""	4735	protein-coding gene	gene with protein product		602796	"""H2A histone family, member N"", ""histone 1, H2am"""	H2AFN		1768865, 9439656, 12408966	Standard	NM_003514		Approved	H2A/n, H2A.1	uc003nkb.1	P0C0S8	OTTHUMG00000014494	ENST00000359611.2:c.348G>A	6.37:g.27860580C>T		Somatic	172	0	0		WXS	Illumina HiSeq	Phase_I	182	25	0.137363	NM_003514	P02261|Q2M1R2|Q76PA6	Silent	SNP	ENST00000359611.2	37	CCDS4639.1																																																																																			.	.	none		0.502	HIST1H2AM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040162.1	NM_003514	
CTC-497E21.3	0	hgsc.bcm.edu	37	11	13031324	13031324	+	lincRNA	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:13031324C>T	ENST00000533002.1	-	0	0																											TGCCCGAACCCCCGAACGAGG	0.726																																					p.P67P		Atlas-SNP	.											.	.	.	.	0			c.C201T						PASS	.						7.0	8.0	8.0					11																	13031324		1862	4020	5882			644943	exon1			CGAACCCCCGAAC																													11.37:g.13031324C>T		Somatic	28	0	0		WXS	Illumina HiSeq	Phase_I	29	9	0.310345	NM_001080521		Silent	SNP	ENST00000533002.1	37																																																																																				.	.	none		0.726	CTC-497E21.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000387000.1		
ALMS1	7840	hgsc.bcm.edu	37	2	73646370	73646370	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr2:73646370G>A	ENST00000264448.6	+	3	681	c.570G>A	c.(568-570)ctG>ctA	p.L190L	ALMS1_ENST00000409009.1_Silent_p.L148L|ALMS1_ENST00000377715.1_Silent_p.L190L	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	190					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						TCCCCTCTCTGGAGGAGGGCA	0.433																																					p.L190L		Atlas-SNP	.											.	ALMS1	384	.	0			c.G570A						PASS	.						131.0	124.0	126.0					2																	73646370		1849	4096	5945	SO:0001819	synonymous_variant	7840	exon3			CTCTCTGGAGGAG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.570G>A	2.37:g.73646370G>A		Somatic	98	0	0		WXS	Illumina HiSeq	Phase_I	92	28	0.304348	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	37	CCDS42697.1																																																																																			.	.	none		0.433	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
GPR149	344758	hgsc.bcm.edu	37	3	154147154	154147154	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:154147154G>T	ENST00000389740.2	-	1	350	c.251C>A	c.(250-252)tCg>tAg	p.S84*		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	84					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GATGGTCACCGACAGGACGCT	0.478																																					p.S84X		Atlas-SNP	.											GPR149,caecum,carcinoma,0,4	GPR149	134	4	0			c.C251A						scavenged	.						94.0	98.0	97.0					3																	154147154		2055	4210	6265	SO:0001587	stop_gained	344758	exon1			GTCACCGACAGGA	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.251C>A	3.37:g.154147154G>T	ENSP00000374390:p.Ser84*	Somatic	306	1	0.00326797		WXS	Illumina HiSeq	Phase_I	386	5	0.0129534	NM_001038705		Nonsense_Mutation	SNP	ENST00000389740.2	37	CCDS43162.1	.	.	.	.	.	.	.	.	.	.	G	39	7.689902	0.98434	.	.	ENSG00000174948	ENST00000389740	.	.	.	5.91	5.91	0.95273	.	0.183813	0.47455	D	0.000224	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-4.7955	20.2985	0.98592	0.0:0.0:1.0:0.0	.	.	.	.	X	84	.	ENSP00000374390:S84X	S	-	2	0	GPR149	155629848	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	9.032000	0.93736	2.793000	0.96121	0.655000	0.94253	TCG	.	.	none		0.478	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580	
FUT8	2530	hgsc.bcm.edu	37	14	66209049	66209049	+	Missense_Mutation	SNP	C	C	A	rs149328619	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr14:66209049C>A	ENST00000360689.5	+	11	3376	c.1649C>A	c.(1648-1650)aCg>aAg	p.T550K	FUT8_ENST00000394586.2_Missense_Mutation_p.T550K|FUT8_ENST00000394585.1_Missense_Mutation_p.T550K|FUT8_ENST00000358307.2_Missense_Mutation_p.T421K|FUT8_ENST00000417683.1_Missense_Mutation_p.T144K|FUT8_ENST00000557164.1_Missense_Mutation_p.T387K	NM_004480.4|NM_178155.2	NP_004471.4|NP_835368.1	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 (alpha (1,6) fucosyltransferase)	550	SH3.				cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|GDP-L-fucose metabolic process (GO:0046368)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|L-fucose catabolic process (GO:0042355)|N-glycan fucosylation (GO:0036071)|N-glycan processing (GO:0006491)|oligosaccharide biosynthetic process (GO:0009312)|post-translational protein modification (GO:0043687)|protein glycosylation in Golgi (GO:0033578)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|receptor metabolic process (GO:0043112)|respiratory gaseous exchange (GO:0007585)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycoprotein 6-alpha-L-fucosyltransferase activity (GO:0008424)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		TTGGGAAGGACGGGCCTATAT	0.443																																					p.T550K		Atlas-SNP	.											.	FUT8	101	.	0			c.C1649A						PASS	.						77.0	77.0	77.0					14																	66209049		2203	4300	6503	SO:0001583	missense	2530	exon11			GAAGGACGGGCCT	AB049740	CCDS9775.1, CCDS9776.1, CCDS9776.2	14q24.3	2013-02-26			ENSG00000033170	ENSG00000033170		"""Fucosyltransferases"""	4019	protein-coding gene	gene with protein product		602589				9368041	Standard	NM_178155		Approved		uc001xio.3	Q9BYC5	OTTHUMG00000142818	ENST00000360689.5:c.1649C>A	14.37:g.66209049C>A	ENSP00000353910:p.Thr550Lys	Somatic	134	0	0		WXS	Illumina HiSeq	Phase_I	147	6	0.0408163	NM_178155	B4DFS7|G3V5N0|O00235|Q8IUA5|Q9BYC6|Q9P2U5|Q9P2U6	Missense_Mutation	SNP	ENST00000360689.5	37	CCDS9775.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.406205	0.25378	.	.	ENSG00000033170	ENST00000360689;ENST00000394586;ENST00000557164;ENST00000394585;ENST00000358307;ENST00000417683	T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75	6.04	5.16	0.70880	Src homology-3 domain (2);	0.043935	0.85682	D	0.000000	T	0.31263	0.0791	L	0.31157	0.91	0.80722	D	1	P;P;P	0.38420	0.595;0.587;0.63	B;B;B	0.34931	0.122;0.051;0.192	T	0.10590	-1.0623	10	0.07175	T	0.84	-5.1746	13.1167	0.59303	0.0:0.9232:0.0:0.0768	.	144;421;550	Q8IUA5;G3XAD2;Q9BYC5	.;.;FUT8_HUMAN	K	550;550;387;550;421;144	ENSP00000353910:T550K;ENSP00000378087:T550K;ENSP00000452433:T387K;ENSP00000378086:T550K;ENSP00000351057:T421K;ENSP00000396770:T144K	ENSP00000351057:T421K	T	+	2	0	FUT8	65278802	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	6.089000	0.71384	1.578000	0.49821	-0.253000	0.11424	ACG	C|0.999;T|0.001	.	alt		0.443	FUT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286406.1	NM_004480	
FAM21C	253725	hgsc.bcm.edu	37	10	46254776	46254776	+	Missense_Mutation	SNP	A	A	C	rs199848673		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr10:46254776A>C	ENST00000336378.4	+	17	1680	c.1562A>C	c.(1561-1563)tAc>tCc	p.Y521S	FAM21C_ENST00000359860.4_Missense_Mutation_p.Y465S|FAM21C_ENST00000537517.1_Missense_Mutation_p.Y497S|FAM21C_ENST00000374362.2_Missense_Mutation_p.Y521S|FAM21C_ENST00000540872.1_Missense_Mutation_p.Y521S	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	521				Y -> S (in Ref. 1; BAA25518 and 2; BAG64168). {ECO:0000305}.	retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)		p.Y520S(3)|p.Y521S(2)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						ACCTTATCTTACAGCAAAAAT	0.413																																					p.Y521S		Atlas-SNP	.											FAM21C,NS,carcinoma,0,6	FAM21C	68	6	5	Substitution - Missense(5)	prostate(4)|skin(1)	c.A1562C						scavenged	.	C	SER/TYR,SER/TYR,SER/TYR	254,3222		29,196,1513	61.0	73.0	69.0		1562,1490,1562	3.3	0.7	10	dbSNP_134	69	410,7550		58,294,3628	yes	missense,missense,missense	FAM21C	NM_001169106.1,NM_001169107.1,NM_015262.2	144,144,144	87,490,5141	CC,CA,AA		5.1508,7.3072,5.8062	benign,benign,benign	521/1280,497/1246,521/1321	46254776	664,10772	1738	3980	5718	SO:0001583	missense	253725	exon17			TATCTTACAGCAA		CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.1562A>C	10.37:g.46254776A>C	ENSP00000337541:p.Tyr521Ser	Somatic	423	3	0.0070922		WXS	Illumina HiSeq	Phase_I	353	5	0.0141643	NM_015262	B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	Missense_Mutation	SNP	ENST00000336378.4	37		.	.	.	.	.	.	.	.	.	.	C	0.006	-2.057382	0.00390	0.073072	0.051508	ENSG00000172661	ENST00000336378;ENST00000540872;ENST00000537517;ENST00000374362;ENST00000399588;ENST00000359860;ENST00000436993	.	.	.	3.26	3.26	0.37387	.	0.662706	0.15995	N	0.234623	T	0.00496	0.0016	N	0.00099	-2.14	0.54753	P	1.4999999999987246E-5	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.0	T	0.25950	-1.0117	8	0.02654	T	1	0.2567	9.8043	0.40783	0.2076:0.7924:0.0:0.0	.	497;521;521;466	F5H871;Q9Y4E1-4;Q9Y4E1;Q9Y4E1-3	.;.;FA21C_HUMAN;.	S	521;521;497;521;521;465;433	.	ENSP00000337541:Y521S	Y	+	2	0	FAM21C	45574782	0.554000	0.26522	0.660000	0.29694	0.197000	0.23852	2.157000	0.42320	0.721000	0.32231	-0.488000	0.04728	TAC	A|0.300;C|0.700	0.700	strong		0.413	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
OR4C3	256144	hgsc.bcm.edu	37	11	48346815	48346815	+	Missense_Mutation	SNP	C	C	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:48346815C>A	ENST00000319856.4	+	1	344	c.323C>A	c.(322-324)gCt>gAt	p.A108D		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A108V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						AAACTCATTGCTGACTCATTG	0.463																																					p.A108D		Atlas-SNP	.											OR4C3,mouth,carcinoma,0,1	OR4C3	75	1	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C323A						PASS	.						210.0	199.0	202.0					11																	48346815		2201	4298	6499	SO:0001583	missense	256144	exon1			TCATTGCTGACTC	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.323C>A	11.37:g.48346815C>A	ENSP00000321419:p.Ala108Asp	Somatic	103	0	0		WXS	Illumina HiSeq	Phase_I	109	9	0.0825688	NM_001004702	B2RNF2|Q6IFB3	Missense_Mutation	SNP	ENST00000319856.4	37	CCDS31489.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.431927	0.43122	.	.	ENSG00000176547	ENST00000319856	T	0.00912	5.55	5.78	2.81	0.32909	GPCR, rhodopsin-like superfamily (1);	0.123186	0.37219	N	0.002190	T	0.01421	0.0046	L	0.51914	1.62	0.09310	N	1	P	0.43857	0.819	B	0.43867	0.434	T	0.46555	-0.9183	10	0.72032	D	0.01	.	7.969	0.30117	0.0:0.6612:0.0:0.3388	.	81	Q8NH37	OR4C3_HUMAN	D	108	ENSP00000321419:A108D	ENSP00000321419:A108D	A	+	2	0	OR4C3	48303391	0.000000	0.05858	0.987000	0.45799	0.357000	0.29423	-0.501000	0.06398	0.778000	0.33520	0.478000	0.44815	GCT	.	.	none		0.463	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390557.1	NM_001004702	
PRKCG	5582	hgsc.bcm.edu	37	19	54392899	54392899	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr19:54392899G>A	ENST00000263431.3	+	4	575	c.293G>A	c.(292-294)cGg>cAg	p.R98Q	PRKCG_ENST00000542049.1_Intron|PRKCG_ENST00000540413.1_Missense_Mutation_p.R98Q|PRKCG_ENST00000536044.1_Missense_Mutation_p.R98Q	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	98					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CAGGACCCCCGGAACAAACAC	0.602																																					p.R98Q		Atlas-SNP	.											.	PRKCG	246	.	0			c.G293A						PASS	.						57.0	50.0	52.0					19																	54392899		2203	4300	6503	SO:0001583	missense	5582	exon4			ACCCCCGGAACAA	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.293G>A	19.37:g.54392899G>A	ENSP00000263431:p.Arg98Gln	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	84	60	0.714286	NM_002739	B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	37	CCDS12867.1	.	.	.	.	.	.	.	.	.	.	G	18.21	3.574096	0.65765	.	.	ENSG00000126583	ENST00000536044;ENST00000540413;ENST00000263431;ENST00000419486	D;D;D	0.84370	-1.84;-1.84;-1.84	4.54	4.54	0.55810	.	.	.	.	.	D	0.82499	0.5050	M	0.74881	2.28	0.80722	D	1	P;B;P;P	0.43701	0.769;0.425;0.815;0.679	B;B;B;B	0.33121	0.149;0.066;0.111;0.158	D	0.84896	0.0839	9	0.45353	T	0.12	.	15.2147	0.73254	0.0:0.0:1.0:0.0	.	98;98;98;98	F5H5C4;B7Z870;B7Z3W6;P05129	.;.;.;KPCG_HUMAN	Q	98;98;98;121	ENSP00000440541:R98Q;ENSP00000443493:R98Q;ENSP00000263431:R98Q	ENSP00000263431:R98Q	R	+	2	0	PRKCG	59084711	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.634000	0.61325	2.260000	0.74910	0.644000	0.83932	CGG	.	.	none		0.602	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
NUDT22	84304	hgsc.bcm.edu	37	11	63994599	63994599	+	Missense_Mutation	SNP	C	C	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:63994599C>A	ENST00000279206.3	+	2	631	c.475C>A	c.(475-477)Cct>Act	p.P159T	TRPT1_ENST00000317459.6_5'Flank|RP11-783K16.14_ENST00000534988.1_RNA|TRPT1_ENST00000546133.1_5'Flank|TRPT1_ENST00000394547.3_5'Flank|TRPT1_ENST00000541278.1_5'Flank|TRPT1_ENST00000546089.1_5'Flank|NUDT22_ENST00000441250.2_Missense_Mutation_p.P159T|TRPT1_ENST00000394546.2_5'Flank|TRPT1_ENST00000540472.1_5'Flank	NM_001128612.2|NM_032344.2	NP_001122084.1|NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 22	159	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.						hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8						GCACCCTGAGCCTCAGGTGAG	0.622																																					p.P159T		Atlas-SNP	.											.	NUDT22	24	.	0			c.C475A						PASS	.						8.0	10.0	9.0					11																	63994599		2097	4232	6329	SO:0001583	missense	84304	exon2			CCTGAGCCTCAGG	BC006129	CCDS8061.1, CCDS44640.1	11q13.1	2008-02-05			ENSG00000149761	ENSG00000149761		"""Nudix motif containing"""	28189	protein-coding gene	gene with protein product						12477932	Standard	NM_032344		Approved	MGC13045	uc009ype.4	Q9BRQ3	OTTHUMG00000167791	ENST00000279206.3:c.475C>A	11.37:g.63994599C>A	ENSP00000279206:p.Pro159Thr	Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	42	14	0.333333	NM_001128613	C9JY06|Q71RD5	Missense_Mutation	SNP	ENST00000279206.3	37	CCDS8061.1	.	.	.	.	.	.	.	.	.	.	C	31	5.098505	0.94197	.	.	ENSG00000149761	ENST00000279206;ENST00000441250;ENST00000428347;ENST00000536237	T;T;T	0.49139	0.79;0.79;0.79	4.55	4.55	0.56014	NUDIX hydrolase domain (1);	0.052647	0.85682	D	0.000000	T	0.70491	0.3230	M	0.80982	2.52	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.75654	-0.3243	10	0.87932	D	0	-5.8406	16.6018	0.84817	0.0:1.0:0.0:0.0	.	159;159;159	Q9BRQ3-2;C9JY06;Q9BRQ3	.;.;NUD22_HUMAN	T	159	ENSP00000279206:P159T;ENSP00000407970:P159T;ENSP00000401085:P159T	ENSP00000279206:P159T	P	+	1	0	NUDT22	63751175	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.990000	0.76225	2.528000	0.85240	0.491000	0.48974	CCT	.	.	none		0.622	NUDT22-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396304.2	NM_032344	
MSH3	4437	hgsc.bcm.edu	37	5	79950750	79950750	+	Silent	SNP	T	T	G	rs144629981|rs3045983|rs1047489	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:79950750T>G	ENST00000265081.6	+	1	284	c.204T>G	c.(202-204)gcT>gcG	p.A68A	DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000513048.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	68					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CGCCCCCAGCTCCCGCCTTCC	0.741								Mismatch excision repair (MMR)																													p.A68A	Melanoma(88;1010 1399 13793 26548 36275)	Atlas-SNP	.											.	MSH3	129	.	0			c.T204G						PASS	.						3.0	3.0	3.0					5																	79950750		1568	3264	4832	SO:0001819	synonymous_variant	4437	exon1			CCCAGCTCCCGCC	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.204T>G	5.37:g.79950750T>G		Somatic	2	0	0		WXS	Illumina HiSeq	Phase_I	18	15	0.833333	NM_002439	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Silent	SNP	ENST00000265081.6	37	CCDS34195.1																																																																																			.	.	weak		0.741	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
DPP7	29952	hgsc.bcm.edu	37	9	140009157	140009157	+	Silent	SNP	G	G	T	rs557666825	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr9:140009157G>T	ENST00000371579.2	-	1	13	c.9C>A	c.(7-9)tcC>tcA	p.S3S		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	3						cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		CCCAGGGAGCGGAGCCCATGT	0.811													G|||	3	0.000599042	0.0	0.0	5008	,	,		6530	0.0		0.001	False		,,,				2504	0.002				p.S3S		Atlas-SNP	.											.	DPP7	22	.	0			c.C9A						PASS	.						1.0	1.0	1.0					9																	140009157		671	1474	2145	SO:0001819	synonymous_variant	29952	exon1			GGGAGCGGAGCCC	AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.9C>A	9.37:g.140009157G>T		Somatic	3	0	0		WXS	Illumina HiSeq	Phase_I	6	6	1	NM_013379	A8K7U7|Q5VSF1|Q969X4	Silent	SNP	ENST00000371579.2	37	CCDS7030.1																																																																																			.	.	none		0.811	DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055279.1	NM_013379	
PRDM9	56979	hgsc.bcm.edu	37	5	23523413	23523413	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:23523413G>T	ENST00000296682.3	+	9	1078	c.896G>T	c.(895-897)aGa>aTa	p.R299I		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	299	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						ACCAAGGGGAGAAACTGCTAT	0.433										HNSCC(3;0.000094)																											p.R299I		Atlas-SNP	.											.	PRDM9	344	.	0			c.G896T						PASS	.						129.0	125.0	126.0					5																	23523413		2203	4300	6503	SO:0001583	missense	56979	exon9			AGGGGAGAAACTG	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.896G>T	5.37:g.23523413G>T	ENSP00000296682:p.Arg299Ile	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	140	45	0.321429	NM_020227	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	g	15.01	2.707568	0.48412	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.38722	1.12	3.72	2.82	0.32997	SET domain (2);	0.189395	0.26045	N	0.026680	T	0.41558	0.1164	L	0.51853	1.615	0.45227	D	0.998238	D	0.61080	0.989	P	0.50708	0.648	T	0.37820	-0.9689	10	0.72032	D	0.01	-20.6175	6.2592	0.20891	0.1394:0.0:0.8606:0.0	.	299	Q9NQV7	PRDM9_HUMAN	I	299;93	ENSP00000296682:R299I	ENSP00000253473:R93I	R	+	2	0	PRDM9	23559170	0.996000	0.38824	1.000000	0.80357	0.992000	0.81027	2.460000	0.45031	2.009000	0.58944	0.592000	0.82586	AGA	.	.	none		0.433	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
CPNE8	144402	hgsc.bcm.edu	37	12	39299291	39299291	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:39299291G>T	ENST00000331366.5	-	1	142	c.46C>A	c.(46-48)Cag>Aag	p.Q16K	CPNE8_ENST00000360449.3_Intron|RP11-396F22.1_ENST00000551152.1_RNA	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	16	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				GCGCTCAGCTGGTTCAAGTCC	0.662																																					p.Q16K		Atlas-SNP	.											.	CPNE8	66	.	0			c.C46A						PASS	.						59.0	50.0	53.0					12																	39299291		2200	4295	6495	SO:0001583	missense	144402	exon1			TCAGCTGGTTCAA	AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.46C>A	12.37:g.39299291G>T	ENSP00000329748:p.Gln16Lys	Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	32	11	0.34375	NM_153634	Q2TB41|Q86VY2	Missense_Mutation	SNP	ENST00000331366.5	37	CCDS8733.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.748722	0.49257	.	.	ENSG00000139117	ENST00000331366	T	0.23348	1.91	4.73	4.73	0.59995	C2 calcium/lipid-binding domain, CaLB (1);	1.034400	0.07657	N	0.932936	T	0.13970	0.0338	N	0.03608	-0.345	0.80722	D	1	B	0.09022	0.002	B	0.10450	0.005	T	0.10823	-1.0613	10	0.49607	T	0.09	-3.0068	9.6428	0.39850	0.098:0.0:0.902:0.0	.	16	Q86YQ8	CPNE8_HUMAN	K	16	ENSP00000329748:Q16K	ENSP00000329748:Q16K	Q	-	1	0	CPNE8	37585558	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.799000	0.38824	2.555000	0.86185	0.563000	0.77884	CAG	.	.	none		0.662	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403856.1	NM_153634	
MUC4	4585	hgsc.bcm.edu	37	3	195513812	195513812	+	Missense_Mutation	SNP	T	T	A	rs201142885	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:195513812T>A	ENST00000463781.3	-	2	5098	c.4639A>T	c.(4639-4641)Aca>Tca	p.T1547S	MUC4_ENST00000475231.1_Missense_Mutation_p.T1547S|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.M1535_T1550delMPLPVTSPSSASTGDT(4)|p.T1547S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGTCACCTGTGGATGCTGAG	0.582																																					p.T1547S		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	5	Deletion - In frame(4)|Substitution - Missense(1)	stomach(4)|kidney(1)	c.A4639T						scavenged	.																																			SO:0001583	missense	4585	exon2			CACCTGTGGATGC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4639A>T	3.37:g.195513812T>A	ENSP00000417498:p.Thr1547Ser	Somatic	73	2	0.0273973		WXS	Illumina HiSeq	Phase_I	69	3	0.0434783	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.021	0.372220	0.11409	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32272	1.48;1.46	0.844	-0.658	0.11428	.	.	.	.	.	T	0.22437	0.0541	N	0.19112	0.55	0.09310	N	1	P	0.46578	0.88	P	0.50270	0.636	T	0.13764	-1.0497	8	.	.	.	.	3.6421	0.08170	0.0:0.3306:0.0:0.6694	.	1547	E7ESK3	.	S	1547	ENSP00000417498:T1547S;ENSP00000420243:T1547S	.	T	-	1	0	MUC4	196998207	0.034000	0.19679	0.062000	0.19696	0.063000	0.16089	-0.041000	0.12084	0.077000	0.16863	0.076000	0.15429	ACA	T|0.976;A|0.023	0.023	strong		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
GPR158	57512	hgsc.bcm.edu	37	10	25886831	25886831	+	Missense_Mutation	SNP	C	C	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr10:25886831C>A	ENST00000376351.3	+	11	2635	c.2276C>A	c.(2275-2277)aCg>aAg	p.T759K	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	759					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T759K(1)|p.T759M(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						AGACGCATTACGGAGATCCCA	0.527																																					p.T759K		Atlas-SNP	.											GPR158,NS,carcinoma,0,2	GPR158	255	2	2	Substitution - Missense(2)	lung(1)|pancreas(1)	c.C2276A						scavenged	.						102.0	114.0	110.0					10																	25886831		2203	4300	6503	SO:0001583	missense	57512	exon11			GCATTACGGAGAT	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.2276C>A	10.37:g.25886831C>A	ENSP00000365529:p.Thr759Lys	Somatic	145	1	0.00689655		WXS	Illumina HiSeq	Phase_I	126	4	0.031746	NM_020752	Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825537	0.90955	.	.	ENSG00000151025	ENST00000376351	T	0.63417	-0.04	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000003	T	0.77170	0.4091	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	T	0.77874	-0.2425	10	0.62326	D	0.03	.	19.4771	0.94994	0.0:1.0:0.0:0.0	.	759	Q5T848	GP158_HUMAN	K	759	ENSP00000365529:T759K	ENSP00000365529:T759K	T	+	2	0	GPR158	25926837	1.000000	0.71417	0.692000	0.30179	0.625000	0.37756	7.487000	0.81328	2.606000	0.88127	0.650000	0.86243	ACG	.	.	none		0.527	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	
TRPM3	80036	hgsc.bcm.edu	37	9	73461506	73461506	+	Splice_Site	SNP	T	T	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr9:73461506T>C	ENST00000377111.2	-	4	707	c.464A>G	c.(463-465)tAt>tGt	p.Y155C	TRPM3_ENST00000396292.4_Splice_Site_p.Y2C|TRPM3_ENST00000357533.2_Splice_Site_p.Y157C|TRPM3_ENST00000377097.3_Splice_Site_p.Y2C|TRPM3_ENST00000408909.2_Splice_Site_p.Y2C|TRPM3_ENST00000358082.3_Splice_Site_p.Y2C|TRPM3_ENST00000396283.1_Splice_Site_p.Y2C|TRPM3_ENST00000396285.1_Splice_Site_p.Y2C|TRPM3_ENST00000361823.5_Splice_Site_p.Y2C|TRPM3_ENST00000423814.3_Splice_Site_p.Y157C|TRPM3_ENST00000396280.5_Splice_Site_p.Y2C|TRPM3_ENST00000377106.1_Splice_Site_p.Y2C|TRPM3_ENST00000377101.1_Splice_Site_p.Y2C|TRPM3_ENST00000377110.3_Splice_Site_p.Y155C|TRPM3_ENST00000360823.2_Splice_Site_p.Y2C|TRPM3_ENST00000377105.1_Splice_Site_p.Y2C	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	155					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TACTCGCACATACTGGAAGAA	0.433																																					p.Y155C		Atlas-SNP	.											.	TRPM3	700	.	0			c.A464G						PASS	.						64.0	59.0	60.0					9																	73461506		2203	4300	6503	SO:0001630	splice_region_variant	80036	exon4			CGCACATACTGGA	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.463-1A>G	9.37:g.73461506T>C		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	79	58	0.734177	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.3|22.3	4.276497|4.276497	0.80580|0.80580	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000377097|ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814;ENST00000377101;ENST00000396283;ENST00000361823;ENST00000455451	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.68479	.|-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	6.01|6.01	6.01|6.01	0.97437|0.97437	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.86234|0.86234	0.5884|0.5884	M|M	0.93016|0.93016	3.37|3.37	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0	.|D;D;D;D;D;D;D;D;D	.|0.85130	.|0.954;0.981;0.996;0.996;0.992;0.997;0.994;0.995;0.997	D|D	0.89433|0.89433	0.3718|0.3718	5|10	.|0.87932	.|D	.|0	-6.475|-6.475	16.5285|16.5285	0.84344|0.84344	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|155;157;2;155;155;155;157;2;2	.|Q9HCF6;Q4VXD2;Q504Y1;Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1	.|TRPM3_HUMAN;.;.;.;.;.;.;.;.	V|C	45|155;155;2;2;2;157;2;2;2;2;157;2;2;2;2	.|ENSP00000366315:Y155C;ENSP00000366314:Y155C;ENSP00000366310:Y2C;ENSP00000354066:Y2C;ENSP00000366309:Y2C;ENSP00000350140:Y157C;ENSP00000386127:Y2C;ENSP00000379581:Y2C;ENSP00000379587:Y2C;ENSP00000350791:Y2C;ENSP00000389542:Y157C;ENSP00000366305:Y2C;ENSP00000379579:Y2C;ENSP00000355395:Y2C	.|ENSP00000350140:Y157C	M|Y	-|-	1|2	0|0	TRPM3|TRPM3	72651326|72651326	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.899000|0.899000	0.52679|0.52679	7.960000|7.960000	0.87893|0.87893	2.307000|2.307000	0.77673|0.77673	0.528000|0.528000	0.53228|0.53228	ATG|TAT	.	.	none		0.433	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	Missense_Mutation
MTRR	4552	hgsc.bcm.edu	37	5	7875473	7875473	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:7875473C>T	ENST00000264668.2	+	4	497	c.467C>T	c.(466-468)gCa>gTa	p.A156V	MTRR_ENST00000341013.6_3'UTR|MTRR_ENST00000502509.1_3'UTR|MTRR_ENST00000440940.2_Missense_Mutation_p.A129V	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	156	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.		A -> T (in HMAE). {ECO:0000269|PubMed:10484769}.		cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	ACTGGACATGCAGATGACTGT	0.423																																					p.A156V		Atlas-SNP	.											.	MTRR	74	.	0			c.C467T						PASS	.						138.0	146.0	143.0					5																	7875473		2203	4300	6503	SO:0001583	missense	4552	exon4			GACATGCAGATGA	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.467C>T	5.37:g.7875473C>T	ENSP00000264668:p.Ala156Val	Somatic	142	0	0		WXS	Illumina HiSeq	Phase_I	105	35	0.333333	NM_024010	O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	ENST00000264668.2	37	CCDS3874.1	.	.	.	.	.	.	.	.	.	.	C	32	5.174970	0.94807	.	.	ENSG00000124275	ENST00000264668;ENST00000440940;ENST00000502550	T;T;T	0.71817	-0.6;-0.6;-0.6	5.37	5.37	0.77165	Flavodoxin/nitric oxide synthase (2);	0.051018	0.85682	N	0.000000	T	0.81987	0.4939	L	0.55213	1.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80872	-0.1188	10	0.45353	T	0.12	-31.5321	19.4731	0.94971	0.0:1.0:0.0:0.0	.	156	Q9UBK8	MTRR_HUMAN	V	156;129;129	ENSP00000264668:A156V;ENSP00000402510:A129V;ENSP00000424599:A129V	ENSP00000264668:A156V	A	+	2	0	MTRR	7928473	1.000000	0.71417	0.592000	0.28758	0.990000	0.78478	6.576000	0.74023	2.659000	0.90383	0.655000	0.94253	GCA	.	.	none		0.423	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1		
STAT3	6774	hgsc.bcm.edu	37	17	40485746	40485746	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:40485746G>A	ENST00000264657.5	-	10	1306	c.994C>T	c.(994-996)Cat>Tat	p.H332Y	STAT3_ENST00000585517.1_Missense_Mutation_p.H332Y|STAT3_ENST00000404395.3_Missense_Mutation_p.H332Y|STAT3_ENST00000389272.3_Missense_Mutation_p.H234Y|STAT3_ENST00000588969.1_Missense_Mutation_p.H332Y	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	332					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		CGGTCAGGATGCATGGGCATG	0.577									Hyperimmunoglobulin E Recurrent Infection Syndrome																												p.H332Y		Atlas-SNP	.											.	STAT3	268	.	0			c.C994T	GRCh37	CM085729	STAT3	M		PASS	.						72.0	65.0	67.0					17																	40485746		2203	4300	6503	SO:0001583	missense	6774	exon10	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	CAGGATGCATGGG	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.994C>T	17.37:g.40485746G>A	ENSP00000264657:p.His332Tyr	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	71	24	0.338028	NM_003150	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	37	CCDS32656.1	.	.	.	.	.	.	.	.	.	.	G	34	5.310461	0.95629	.	.	ENSG00000168610	ENST00000264657;ENST00000389272;ENST00000404395	D;D;D	0.88586	-2.4;-2.4;-2.4	5.41	5.41	0.78517	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.92639	0.7661	L	0.48362	1.52	0.80722	D	1	D;D;D	0.58268	0.978;0.982;0.982	D;D;D	0.71414	0.955;0.973;0.973	D	0.92482	0.5993	10	0.51188	T	0.08	-37.9112	19.1988	0.93701	0.0:0.0:1.0:0.0	.	332;332;332	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	Y	332;234;332	ENSP00000264657:H332Y;ENSP00000373923:H234Y;ENSP00000384943:H332Y	ENSP00000264657:H332Y	H	-	1	0	STAT3	37739272	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.869000	0.99810	2.531000	0.85337	0.655000	0.94253	CAT	.	.	none		0.577	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	
NEFL	4747	hgsc.bcm.edu	37	8	24813640	24813640	+	RNA	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:24813640G>A	ENST00000221169.5	-	0	984				CTD-2168K21.2_ENST00000607735.1_RNA			P07196	NFL_HUMAN	neurofilament, light polypeptide						anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|intermediate filament organization (GO:0045109)|locomotion (GO:0040011)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament bundle assembly (GO:0033693)|neuromuscular process controlling balance (GO:0050885)|neuron projection morphogenesis (GO:0048812)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of axonogenesis (GO:0050772)|protein polymerization (GO:0051258)|regulation of axon diameter (GO:0031133)|response to corticosterone (GO:0051412)|response to peptide hormone (GO:0043434)|response to toxic substance (GO:0009636)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|neurofilament (GO:0005883)	identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|protein C-terminus binding (GO:0008022)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)	21		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		GGGATGGCTCGGAGTGCTTCT	0.662																																					p.S130S		Atlas-SNP	.											.	NEFL	47	.	0			c.C390T						PASS	.						12.0	13.0	13.0					8																	24813640		2075	4213	6288			4747	exon1			TGGCTCGGAGTGC		CCDS75712.1	8p21.2	2014-09-17	2008-09-19		ENSG00000104725	ENSG00000277586		"""Intermediate filaments type IV"""	7739	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 110"""	162280	"""neurofilament, light polypeptide 68kDa"""			17620486, 3145240	Standard	NM_006158		Approved	NFL, CMT1F, CMT2E, NF68, PPP1R110	uc003xee.4	P07196	OTTHUMG00000134284		8.37:g.24813640G>A		Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	37	15	0.405405	NM_006158	B9ZVN2|Q16154|Q8IU72	Silent	SNP	ENST00000221169.5	37																																																																																				.	.	none		0.662	NEFL-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000258943.4	NM_006158	
CPXCR1	53336	hgsc.bcm.edu	37	X	88009293	88009293	+	Missense_Mutation	SNP	A	A	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chrX:88009293A>T	ENST00000276127.4	+	3	1137	c.878A>T	c.(877-879)cAa>cTa	p.Q293L	CPXCR1_ENST00000373111.1_Missense_Mutation_p.Q293L	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	293							metal ion binding (GO:0046872)			NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						GAATTAAGACAACATTCATGC	0.299																																					p.Q293L		Atlas-SNP	.											.	CPXCR1	83	.	0			c.A878T						PASS	.						40.0	40.0	40.0					X																	88009293		2198	4294	6492	SO:0001583	missense	53336	exon3			TAAGACAACATTC	AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.878A>T	X.37:g.88009293A>T	ENSP00000276127:p.Gln293Leu	Somatic	166	0	0		WXS	Illumina HiSeq	Phase_I	170	51	0.3	NM_001184771	B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	ENST00000276127.4	37	CCDS14458.1	.	.	.	.	.	.	.	.	.	.	A	0.749	-0.773453	0.02951	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.01527	4.8;4.8	3.42	0.89	0.19218	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	1.490400	0.04667	N	0.409900	T	0.01523	0.0049	N	0.19112	0.55	0.09310	N	1	B	0.15141	0.012	B	0.10450	0.005	T	0.49588	-0.8924	9	.	.	.	2.5471	4.0038	0.09592	0.695:0.0:0.1198:0.1852	.	293	Q8N123	CPXCR_HUMAN	L	293	ENSP00000276127:Q293L;ENSP00000362203:Q293L	.	Q	+	2	0	CPXCR1	87895949	0.028000	0.19301	0.002000	0.10522	0.000000	0.00434	0.297000	0.19101	-0.207000	0.10187	-1.278000	0.01390	CAA	.	.	none		0.299	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048	
LRRN4	164312	hgsc.bcm.edu	37	20	6033004	6033004	+	Missense_Mutation	SNP	G	G	A	rs6117050	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr20:6033004G>A	ENST00000378858.4	-	2	666	c.442C>T	c.(442-444)Ctc>Ttc	p.L148F		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	148					long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						AGGGCGCGGAGGCTGCTCAGC	0.771													G|||	1252	0.25	0.0295	0.3804	5008	,	,		12105	0.4266		0.2455	False		,,,				2504	0.2781				p.L148F		Atlas-SNP	.											.	LRRN4	54	.	0			c.C442T						PASS	.	G	PHE/LEU	84,1652		0,84,784	2.0	2.0	2.0		442	5.3	0.5	20	dbSNP_114	2	753,3819		28,697,1561	no	missense	LRRN4	NM_152611.3	22	28,781,2345	AA,AG,GG		16.4698,4.8387,13.2689	probably-damaging	148/741	6033004	837,5471	868	2286	3154	SO:0001583	missense	164312	exon2			CGCGGAGGCTGCT	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.442C>T	20.37:g.6033004G>A	ENSP00000368135:p.Leu148Phe	Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	9	7	0.777778	NM_152611	A8K258|Q5JWV6|Q9H419	Missense_Mutation	SNP	ENST00000378858.4	37	CCDS13097.1	576	0.26373626373626374	16	0.032520325203252036	140	0.3867403314917127	236	0.4125874125874126	184	0.24274406332453827	G	17.75	3.466009	0.63625	0.048387	0.164698	ENSG00000125872	ENST00000378858	T	0.27256	1.68	5.29	5.29	0.74685	.	0.000000	0.56097	D	0.000039	T	0.00012	0.0000	H	0.95539	3.685	0.21897	P	0.99948733	D;D	0.89917	0.999;1.0	D;D	0.91635	0.977;0.999	T	0.38001	-0.9681	9	0.87932	D	0	-23.9152	14.8611	0.70382	0.0:0.1434:0.8566:0.0	rs6117050;rs60034875	148;148	Q6ZMD1;Q8WUT4	.;LRRN4_HUMAN	F	148	ENSP00000368135:L148F	ENSP00000368135:L148F	L	-	1	0	LRRN4	5981004	1.000000	0.71417	0.524000	0.27887	0.152000	0.21847	3.302000	0.51849	2.629000	0.89072	0.591000	0.81541	CTC	G|0.736;A|0.264	0.264	strong		0.771	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2	NM_152611	
NOP9	161424	hgsc.bcm.edu	37	14	24771450	24771450	+	Silent	SNP	A	A	G	rs182491838		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr14:24771450A>G	ENST00000267425.3	+	5	1056	c.963A>G	c.(961-963)ctA>ctG	p.L321L	DHRS1_ENST00000288111.7_5'Flank|NOP9_ENST00000396802.3_Silent_p.L321L|DHRS1_ENST00000396813.1_5'Flank	NM_174913.1	NP_777573.1	Q86U38	NOP9_HUMAN	NOP9 nucleolar protein	321							poly(A) RNA binding (GO:0044822)										CCCTACTGCTATTTCTCCGAG	0.522													A|||	1	0.000199681	0.0	0.0	5008	,	,		21836	0.0		0.001	False		,,,				2504	0.0				p.L321L		Atlas-SNP	.											.	.	.	.	0			c.A963G						PASS	.						278.0	276.0	277.0					14																	24771450		2203	4300	6503	SO:0001819	synonymous_variant	161424	exon5			ACTGCTATTTCTC		CCDS9624.1, CCDS66616.1	14q12	2012-12-10	2012-12-10	2012-06-06	ENSG00000196943	ENSG00000196943			19826	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 21"", ""NOP9 nucleolar protein homolog (yeast)"""	C14orf21		21653694	Standard	XM_005267385		Approved		uc001wol.1	Q86U38	OTTHUMG00000029342	ENST00000267425.3:c.963A>G	14.37:g.24771450A>G		Somatic	50	0	0		WXS	Illumina HiSeq	Phase_I	47	18	0.382979	NM_174913	A8MY76|Q8IVF0|Q8TBS6	Silent	SNP	ENST00000267425.3	37	CCDS9624.1																																																																																			A|1.000;G|0.000	0.000	strong		0.522	NOP9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073186.2		
ANKS6	203286	hgsc.bcm.edu	37	9	101498863	101498863	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr9:101498863G>A	ENST00000353234.4	-	15	2601	c.2554C>T	c.(2554-2556)Cac>Tac	p.H852Y	ANKS6_ENST00000375018.1_Missense_Mutation_p.H853Y|ANKS6_ENST00000540940.1_Missense_Mutation_p.H657Y|ANKS6_ENST00000375019.2_Missense_Mutation_p.H551Y			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	852						cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				AAGGAAGAGTGAAAGTTGTGA	0.483																																					p.H852Y		Atlas-SNP	.											.	ANKS6	59	.	0			c.C2554T						PASS	.						84.0	87.0	86.0					9																	101498863		1936	4135	6071	SO:0001583	missense	203286	exon15			AAGAGTGAAAGTT	AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.2554C>T	9.37:g.101498863G>A	ENSP00000297837:p.His852Tyr	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	102	28	0.27451	NM_173551	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Missense_Mutation	SNP	ENST00000353234.4	37	CCDS43856.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.6|27.6	4.850167|4.850167	0.91277|0.91277	.|.	.|.	ENSG00000165138|ENSG00000165138	ENST00000375019;ENST00000375018;ENST00000353234;ENST00000540940|ENST00000444472	T;T;T;T|.	0.69435|.	1.78;-0.4;-0.4;2.03|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	0.049154|.	0.85682|.	D|.	0.000000|.	T|T	0.52273|0.52273	0.1724|0.1724	N|N	0.19112|0.19112	0.55|0.55	0.45439|0.45439	D|D	0.998416|0.998416	D;D|.	0.63880|.	0.993;0.988|.	D;D|.	0.73708|.	0.981;0.957|.	T|T	0.46512|0.46512	-0.9186|-0.9186	10|5	0.87932|.	D|.	0|.	-21.0365|-21.0365	16.8343|16.8343	0.85953|0.85953	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	853;852|.	Q68DC2-4;Q68DC2|.	.;ANKS6_HUMAN|.	Y|L	551;853;852;657|321	ENSP00000364159:H551Y;ENSP00000364158:H853Y;ENSP00000297837:H852Y;ENSP00000442189:H657Y|.	ENSP00000297837:H852Y|.	H|S	-|-	1|2	0|0	ANKS6|ANKS6	100538684|100538684	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	8.692000|8.692000	0.91284|0.91284	2.640000|2.640000	0.89533|0.89533	0.655000|0.655000	0.94253|0.94253	CAC|TCA	.	.	none		0.483	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277053.1	NM_173551	
CNGB3	54714	hgsc.bcm.edu	37	8	87638258	87638258	+	Missense_Mutation	SNP	C	C	A	rs150642676	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:87638258C>A	ENST00000320005.5	-	13	1578	c.1531G>T	c.(1531-1533)Gcc>Tcc	p.A511S		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	511					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						ACATCAATGGCGAGGGCTAAC	0.373																																					p.A511S		Atlas-SNP	.											.	CNGB3	176	.	0			c.G1531T						PASS	.						123.0	112.0	115.0					8																	87638258		2203	4300	6503	SO:0001583	missense	54714	exon13			CAATGGCGAGGGC	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.1531G>T	8.37:g.87638258C>A	ENSP00000316605:p.Ala511Ser	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	98	17	0.173469	NM_019098	C9JA51|Q9NRE9	Missense_Mutation	SNP	ENST00000320005.5	37	CCDS6244.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346934	0.61183	.	.	ENSG00000170289	ENST00000320005	D	0.96745	-4.11	5.37	2.47	0.30058	Cyclic nucleotide-binding-like (1);	0.202097	0.41194	D	0.000925	D	0.98204	0.9406	M	0.92268	3.29	0.80722	D	1	D;D	0.59357	0.985;0.975	D;P	0.63597	0.916;0.826	D	0.98338	1.0537	10	0.72032	D	0.01	.	14.4978	0.67700	0.0:0.9177:0.0:0.0823	.	511;511	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	S	511	ENSP00000316605:A511S	ENSP00000316605:A511S	A	-	1	0	CNGB3	87707374	0.999000	0.42202	0.003000	0.11579	0.482000	0.33219	3.118000	0.50414	0.198000	0.20407	0.650000	0.86243	GCC	C|0.999;T|0.001	.	alt		0.373	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098	
TYMP	1890	hgsc.bcm.edu	37	22	50966942	50966942	+	Splice_Site	SNP	T	T	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr22:50966942T>A	ENST00000252029.3	-	4	677	c.515A>T	c.(514-516)cAg>cTg	p.Q172L	SCO2_ENST00000395693.3_5'Flank|TYMP_ENST00000395680.1_Splice_Site_p.Q172L|SCO2_ENST00000252785.3_5'Flank|SCO2_ENST00000543927.1_5'Flank|TYMP_ENST00000395678.3_Splice_Site_p.Q172L|TYMP_ENST00000395681.1_Splice_Site_p.Q172L|SCO2_ENST00000535425.1_5'Flank	NM_001113755.2|NM_001113756.2|NM_001257988.1|NM_001257989.1|NM_001953.4	NP_001107227.1|NP_001107228.1|NP_001244917.1|NP_001244918.1|NP_001944.1	P19971	TYPH_HUMAN	thymidine phosphorylase	172					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|chemotaxis (GO:0006935)|DNA replication (GO:0006260)|mitochondrial genome maintenance (GO:0000002)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphorylase activity (GO:0004645)|platelet-derived growth factor receptor binding (GO:0005161)|pyrimidine-nucleoside phosphorylase activity (GO:0016154)|thymidine phosphorylase activity (GO:0009032)|transferase activity, transferring pentosyl groups (GO:0016763)			large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Cidofovir(DB00369)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Trifluridine(DB00432)	GCCCCGTACCTGCTCTGGGCT	0.527																																					p.Q172L		Atlas-SNP	.											TYMP,NS,carcinoma,-1,1	TYMP	25	1	0			c.A515T						PASS	.						108.0	81.0	90.0					22																	50966942		2203	4300	6503	SO:0001630	splice_region_variant	1890	exon4			CGTACCTGCTCTG	M63193	CCDS14096.1, CCDS58811.1	22q13	2014-09-17	2008-01-21	2008-01-21	ENSG00000025708	ENSG00000025708	2.4.2.4		3148	protein-coding gene	gene with protein product	"""gliostatin"""	131222	"""endothelial cell growth factor 1 (platelet-derived)"""	MNGIE, ECGF1		1590793, 11733540	Standard	NM_001113755		Approved		uc003bme.5	P19971	OTTHUMG00000150249	ENST00000252029.3:c.516+1A>T	22.37:g.50966942T>A		Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	44	14	0.318182	NM_001257989	A8MW15|H9KVA0|Q13390|Q8WVB7	Missense_Mutation	SNP	ENST00000252029.3	37	CCDS14096.1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.544117	0.65198	.	.	ENSG00000025708	ENST00000395680;ENST00000395681;ENST00000252029;ENST00000395678	D;D;D;D	0.98345	-4.88;-4.88;-4.88;-4.88	4.66	4.66	0.58398	Glycosyl transferase, family 3 (3);	0.068178	0.64402	D	0.000011	D	0.96172	0.8752	L	0.57536	1.79	0.54753	D	0.999983	P;P;P	0.45531	0.86;0.563;0.563	B;B;B	0.37015	0.239;0.159;0.159	D	0.96009	0.9000	10	0.72032	D	0.01	-6.6403	12.0967	0.53758	0.0:0.0:0.0:1.0	.	172;172;172	B4DVR2;E5KRG5;P19971	.;.;TYPH_HUMAN	L	172	ENSP00000379037:Q172L;ENSP00000379038:Q172L;ENSP00000252029:Q172L;ENSP00000379036:Q172L	ENSP00000252029:Q172L	Q	-	2	0	TYMP	49313808	1.000000	0.71417	1.000000	0.80357	0.693000	0.40251	6.408000	0.73285	1.961000	0.56991	0.454000	0.30748	CAG	.	.	none		0.527	TYMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317081.1	NM_001953	Missense_Mutation
FAT1	2195	hgsc.bcm.edu	37	4	187530476	187530476	+	Splice_Site	SNP	T	T	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:187530476T>C	ENST00000441802.2	-	16	10278		c.e16-2			NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1						actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GGCCATAACCTAGAACACACC	0.433										HNSCC(5;0.00058)																											.	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.10069-2A>G						PASS	.						92.0	85.0	87.0					4																	187530476		1938	4155	6093	SO:0001630	splice_region_variant	2195	exon17			ATAACCTAGAACA	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.10069-2A>G	4.37:g.187530476T>C		Somatic	93	0	0		WXS	Illumina HiSeq	Phase_I	106	37	0.349057	NM_005245		Splice_Site	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	T	12.67	2.008466	0.35415	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3319	0.74219	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAT1	187767470	1.000000	0.71417	0.998000	0.56505	0.160000	0.22226	7.977000	0.88081	2.030000	0.59900	0.533000	0.62120	.	.	.	none		0.433	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	Intron
PLA2G4C	8605	hgsc.bcm.edu	37	19	48609797	48609797	+	5'UTR	SNP	G	G	A	rs570635333		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr19:48609797G>A	ENST00000599921.1	-	0	347				PLA2G4C_ENST00000413144.2_5'Flank|PLA2G4C_ENST00000599111.1_Silent_p.T17T|PLA2G4C_ENST00000354276.3_5'UTR			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)						arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		GGTGCACTGCGGTCAGAAAAT	0.517																																					p.T17T		Atlas-SNP	.											.	PLA2G4C	76	.	0			c.C51T						PASS	.						157.0	130.0	140.0					19																	48609797		2203	4300	6503	SO:0001623	5_prime_UTR_variant	8605	exon2			CACTGCGGTCAGA	AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.-11C>T	19.37:g.48609797G>A		Somatic	82	0	0		WXS	Illumina HiSeq	Phase_I	65	41	0.630769	NM_001159322	B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Silent	SNP	ENST00000599921.1	37	CCDS12710.1																																																																																			.	.	none		0.517	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1		
IGLL5	100423062	hgsc.bcm.edu	37	22	23230326	23230326	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr22:23230326G>A	ENST00000526893.1	+	1	367	c.93G>A	c.(91-93)ctG>ctA	p.L31L	hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Silent_p.L31L|IGLL5_ENST00000532223.2_Silent_p.L31L	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	31						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						TGCTGGGTCTGGCCATGGTCG	0.667																																					p.L31L		Atlas-SNP	.											.	IGLL5	26	.	0			c.G93A						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			GGGTCTGGCCATG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.93G>A	22.37:g.23230326G>A		Somatic	180	0	0		WXS	Illumina HiSeq	Phase_I	139	31	0.223022	NM_001178126		Silent	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.667	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
ARRDC4	91947	hgsc.bcm.edu	37	15	98504326	98504326	+	Missense_Mutation	SNP	A	A	G	rs12101554	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr15:98504326A>G	ENST00000268042.6	+	1	399	c.235A>G	c.(235-237)Acc>Gcc	p.T79A	ARRDC4_ENST00000538249.1_Intron	NM_183376.2	NP_899232.2	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	79			T -> A (in dbSNP:rs12101554). {ECO:0000269|PubMed:15489334}.		positive regulation of ubiquitin-protein transferase activity (GO:0051443)	endosome (GO:0005768)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|skin(3)	16	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			CTCGGCCAGCACCGCGGCCCT	0.786													g|||	3817	0.762181	0.5976	0.7118	5008	,	,		7745	0.88		0.7485	False		,,,				2504	0.9131				p.T79A		Atlas-SNP	.											.	ARRDC4	30	.	0			c.A235G						PASS	.		ALA/THR	934,448		327,280,84	1.0	1.0	1.0		235	0.8	0.0	15	dbSNP_120	1	2287,687		920,447,120	no	missense	ARRDC4	NM_183376.2	58	1247,727,204	GG,GA,AA		23.1002,32.4168,26.056	benign	79/419	98504326	3221,1135	691	1487	2178	SO:0001583	missense	91947	exon1			GCCAGCACCGCGG	BC028704	CCDS10377.1	15q26.2	2005-08-16			ENSG00000140450	ENSG00000140450			28087	protein-coding gene	gene with protein product						12477932	Standard	NM_183376		Approved	FLJ36045	uc010bom.3	Q8NCT1	OTTHUMG00000149849	ENST00000268042.6:c.235A>G	15.37:g.98504326A>G	ENSP00000268042:p.Thr79Ala	Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	8	7	0.875	NM_183376	Q6NSI9	Missense_Mutation	SNP	ENST00000268042.6	37	CCDS10377.1	1613	0.7385531135531136	289	0.5873983739837398	255	0.7044198895027625	512	0.8951048951048951	557	0.7348284960422163	g	3.442	-0.113882	0.06881	0.675832	0.768998	ENSG00000140450	ENST00000268042	T	0.07567	3.18	4.08	0.777	0.18538	Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	.	.	.	.	T	0.00012	0.0000	N	0.19112	0.55	0.46222	P	0.0010670000000000401	B	0.02656	0.0	B	0.01281	0.0	T	0.39522	-0.9610	8	0.02654	T	1	-4.3851	2.5111	0.04657	0.2812:0.0:0.3307:0.3881	rs12101554;rs17845860;rs17858835;rs57152335	79	Q8NCT1	ARRD4_HUMAN	A	79	ENSP00000268042:T79A	ENSP00000268042:T79A	T	+	1	0	ARRDC4	96305330	0.005000	0.15991	0.001000	0.08648	0.003000	0.03518	-0.193000	0.09573	0.288000	0.22398	-0.370000	0.07254	ACC	A|0.263;G|0.737	0.737	strong		0.786	ARRDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313535.1	NM_183376	
SLC45A1	50651	hgsc.bcm.edu	37	1	8399646	8399646	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:8399646T>C	ENST00000471889.1	+	8	2253	c.1868T>C	c.(1867-1869)cTc>cCc	p.L623P	SLC45A1_ENST00000377479.2_Missense_Mutation_p.L657P|SLC45A1_ENST00000289877.8_Missense_Mutation_p.L623P			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	623					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CTTGCCACCCTCTCCAGGAAC	0.577																																					p.L623P		Atlas-SNP	.											.	SLC45A1	85	.	0			c.T1868C						PASS	.						176.0	158.0	164.0					1																	8399646		2203	4300	6503	SO:0001583	missense	50651	exon7			CCACCCTCTCCAG	AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.1868T>C	1.37:g.8399646T>C	ENSP00000418096:p.Leu623Pro	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	95	4	0.0421053	NM_001080397	Q5VY46|Q5VY49	Missense_Mutation	SNP	ENST00000471889.1	37	CCDS30577.1	.	.	.	.	.	.	.	.	.	.	T	17.77	3.471360	0.63737	.	.	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	D;D;D	0.92858	-3.12;-3.12;-3.12	5.11	5.11	0.69529	Major facilitator superfamily domain, general substrate transporter (1);	0.075695	0.64402	D	0.000012	D	0.96005	0.8699	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.96576	0.9427	10	0.87932	D	0	-36.5672	14.0943	0.65010	0.0:0.0:0.0:1.0	.	623	Q9Y2W3	S45A1_HUMAN	P	623;657;623	ENSP00000418096:L623P;ENSP00000366699:L657P;ENSP00000289877:L623P	ENSP00000289877:L623P	L	+	2	0	SLC45A1	8322233	1.000000	0.71417	0.841000	0.33234	0.417000	0.31264	7.574000	0.82434	1.908000	0.55244	0.454000	0.30748	CTC	.	.	none		0.577	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001245.5		
OR12D2	26529	hgsc.bcm.edu	37	6	29365028	29365028	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:29365028G>A	ENST00000383555.2	+	1	613	c.552G>A	c.(550-552)aaG>aaA	p.K184K	OR5V1_ENST00000377154.1_Intron	NM_013936.3	NP_039224.2	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D, member 2 (gene/pseudogene)	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	31						CATTGCTAAAGCTGGCCTGTG	0.473																																					p.K184K		Atlas-SNP	.											.	OR12D2	42	.	0			c.G552A						PASS	.						165.0	168.0	167.0					6																	29365028		1511	2709	4220	SO:0001819	synonymous_variant	26529	exon1			GCTAAAGCTGGCC		CCDS4659.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000168787	ENSG00000168787		"""GPCR / Class A : Olfactory receptors"""	8178	protein-coding gene	gene with protein product			"""olfactory receptor, family 12, subfamily D, member 2"""				Standard	NM_013936		Approved	hs6M1-20	uc003nmf.4	P58182	OTTHUMG00000031049	ENST00000383555.2:c.552G>A	6.37:g.29365028G>A		Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	101	17	0.168317	NM_013936	B0S862|Q5SUN9|Q6IET9	Silent	SNP	ENST00000383555.2	37	CCDS4659.1																																																																																			.	.	none		0.473	OR12D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076054.2		
GPR116	221395	hgsc.bcm.edu	37	6	46845956	46845956	+	Missense_Mutation	SNP	C	C	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:46845956C>A	ENST00000283296.7	-	10	1511	c.1223G>T	c.(1222-1224)gGa>gTa	p.G408V	GPR116_ENST00000265417.7_Missense_Mutation_p.G408V|GPR116_ENST00000362015.4_Missense_Mutation_p.G408V|GPR116_ENST00000456426.2_Intron	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	408	Ig-like 2.				energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			ATTTATTTTTCCTTCCTGCTT	0.408																																					p.G408V	NSCLC(59;410 1274 8751 36715 50546)	Atlas-SNP	.											GPR116,NS,malignant_melanoma,-1,1	GPR116	133	1	0			c.G1223T						PASS	.						153.0	147.0	149.0					6																	46845956		2203	4300	6503	SO:0001583	missense	221395	exon10			ATTTTTCCTTCCT	AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.1223G>T	6.37:g.46845956C>A	ENSP00000283296:p.Gly408Val	Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	171	29	0.169591	NM_015234	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	ENST00000283296.7	37	CCDS4919.1	.	.	.	.	.	.	.	.	.	.	C	17.88	3.497890	0.64186	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000265417	T;T;T	0.43688	0.94;1.39;0.94	6.02	6.02	0.97574	Immunoglobulin-like (1);	0.000000	0.64402	D	0.000007	T	0.58409	0.2120	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.59225	-0.7494	10	0.66056	D	0.02	-21.2525	16.0408	0.80680	0.0:1.0:0.0:0.0	.	408;408;408	E9PBS6;A8K0D8;Q8IZF2	.;.;GP116_HUMAN	V	408	ENSP00000283296:G408V;ENSP00000354563:G408V;ENSP00000265417:G408V	ENSP00000265417:G408V	G	-	2	0	GPR116	46953915	0.275000	0.24201	0.316000	0.25252	0.830000	0.47004	2.146000	0.42216	2.865000	0.98341	0.655000	0.94253	GGA	.	.	none		0.408	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234	
BCL11B	64919	hgsc.bcm.edu	37	14	99640652	99640652	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr14:99640652G>A	ENST00000357195.3	-	4	2530	c.2521C>T	c.(2521-2523)Cgc>Tgc	p.R841C	BCL11B_ENST00000345514.2_Missense_Mutation_p.R770C|BCL11B_ENST00000443726.2_Missense_Mutation_p.R647C	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	841					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		TTCATGTGGCGCGTGAGCTTG	0.622			T	TLX3	T-ALL																																p.R841C		Atlas-SNP	.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	BCL11B,NS,carcinoma,+1,2	BCL11B	108	2	0			c.C2521T						PASS	.						78.0	62.0	68.0					14																	99640652		2203	4300	6503	SO:0001583	missense	64919	exon4			TGTGGCGCGTGAG	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.2521C>T	14.37:g.99640652G>A	ENSP00000349723:p.Arg841Cys	Somatic	24	0	0		WXS	Illumina HiSeq	Phase_I	25	6	0.24	NM_138576	Q9H162	Missense_Mutation	SNP	ENST00000357195.3	37	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.343578	0.82022	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.07688	3.17;3.17;3.17	4.7	4.7	0.59300	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.318118	0.23997	N	0.042508	T	0.24431	0.0592	L	0.46741	1.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.01033	-1.1474	10	0.72032	D	0.01	-19.448	17.9731	0.89119	0.0:0.0:1.0:0.0	.	770;841	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	C	841;770;647	ENSP00000349723:R841C;ENSP00000280435:R770C;ENSP00000387419:R647C	ENSP00000280435:R770C	R	-	1	0	BCL11B	98710405	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.352000	0.97076	2.331000	0.79229	0.462000	0.41574	CGC	.	.	none		0.622	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
FLT1	2321	hgsc.bcm.edu	37	13	28971155	28971155	+	Missense_Mutation	SNP	A	A	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr13:28971155A>C	ENST00000282397.4	-	12	1853	c.1602T>G	c.(1600-1602)atT>atG	p.I534M	FLT1_ENST00000541932.1_Missense_Mutation_p.I534M	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	534	Ig-like C2-type 5.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AAGCTATGCAAATGTAGATTC	0.408																																					p.I534M		Atlas-SNP	.											.	FLT1	393	.	0			c.T1602G						PASS	.						125.0	115.0	118.0					13																	28971155		2203	4300	6503	SO:0001583	missense	2321	exon12			TATGCAAATGTAG	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.1602T>G	13.37:g.28971155A>C	ENSP00000282397:p.Ile534Met	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	90	16	0.177778	NM_002019	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	A	14.57	2.575330	0.45902	.	.	ENSG00000102755	ENST00000282397;ENST00000541932	T;T	0.36157	1.27;2.7	5.87	2.26	0.28386	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.367956	0.33272	N	0.005099	T	0.18551	0.0445	N	0.17474	0.49	0.80722	D	1	B;B;B	0.23249	0.082;0.01;0.025	B;B;B	0.15870	0.014;0.005;0.009	T	0.05533	-1.0879	10	0.29301	T	0.29	.	6.7504	0.23483	0.5627:0.0:0.4373:0.0	.	534;534;534	P17948-3;P17948-2;P17948	.;.;VGFR1_HUMAN	M	534	ENSP00000282397:I534M;ENSP00000437631:I534M	ENSP00000282397:I534M	I	-	3	3	FLT1	27869155	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	1.203000	0.32284	0.497000	0.27926	0.533000	0.62120	ATT	.	.	none		0.408	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
FCRL3	115352	hgsc.bcm.edu	37	1	157665375	157665375	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:157665375G>A	ENST00000368184.3	-	8	1446	c.1155C>T	c.(1153-1155)ctC>ctT	p.L385L	RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000368186.5_Silent_p.L385L|FCRL3_ENST00000473231.1_5'UTR	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	385	Ig-like C2-type 5.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					CCCTGAAGGTGAGGACAGGGT	0.562																																					p.L385L		Atlas-SNP	.											.	FCRL3	163	.	0			c.C1155T						PASS	.						38.0	39.0	39.0					1																	157665375		2203	4300	6503	SO:0001819	synonymous_variant	115352	exon8			GAAGGTGAGGACA	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.1155C>T	1.37:g.157665375G>A		Somatic	139	0	0		WXS	Illumina HiSeq	Phase_I	100	56	0.56	NM_052939	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	ENST00000368184.3	37	CCDS1167.1																																																																																			.	.	none		0.562	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939	
ZC3H13	23091	hgsc.bcm.edu	37	13	46543189	46543189	+	Nonsense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr13:46543189G>A	ENST00000242848.4	-	14	3838	c.3490C>T	c.(3490-3492)Cga>Tga	p.R1164*	ZC3H13_ENST00000282007.3_Nonsense_Mutation_p.R1164*|ZC3H13_ENST00000378921.2_Nonsense_Mutation_p.R120*			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	1164							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R1164*(1)		cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		TTTTCTACTCGTGTTCTGTGG	0.488																																					p.R1164X	Esophageal Squamous(187;747 2077 11056 31291 44172)	Atlas-SNP	.											ZC3H13,colon,carcinoma,0,1	ZC3H13	197	1	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3490T						PASS	.						187.0	181.0	183.0					13																	46543189		2203	4300	6503	SO:0001587	stop_gained	23091	exon14			CTACTCGTGTTCT	AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.3490C>T	13.37:g.46543189G>A	ENSP00000242848:p.Arg1164*	Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	94	11	0.117021	NM_015070	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Nonsense_Mutation	SNP	ENST00000242848.4	37		.	.	.	.	.	.	.	.	.	.	G	43	10.293987	0.99377	.	.	ENSG00000123200	ENST00000242848;ENST00000378921;ENST00000282007	.	.	.	5.52	4.56	0.56223	.	0.000000	0.52532	D	0.000074	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.3895	0.49806	0.0:0.0:0.6178:0.3821	.	.	.	.	X	1164;120;1164	.	ENSP00000242848:R1164X	R	-	1	2	ZC3H13	45441190	0.999000	0.42202	0.964000	0.40570	0.505000	0.33919	3.399000	0.52586	2.756000	0.94617	0.655000	0.94253	CGA	.	.	none		0.488	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
FZD10	11211	hgsc.bcm.edu	37	12	130648918	130648918	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:130648918G>A	ENST00000229030.4	+	1	1915	c.1431G>A	c.(1429-1431)gcG>gcA	p.A477A	FZD10-AS1_ENST00000505807.2_RNA|FZD10_ENST00000539839.1_Missense_Mutation_p.A445T			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	477					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		TCCTGGCGGCGCAGCACAAGT	0.547																																					p.A477A		Atlas-SNP	.											.	FZD10	95	.	0			c.G1431A						PASS	.						80.0	79.0	79.0					12																	130648918		2203	4300	6503	SO:0001819	synonymous_variant	11211	exon1			GGCGGCGCAGCAC	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.1431G>A	12.37:g.130648918G>A		Somatic	100	0	0		WXS	Illumina HiSeq	Phase_I	77	10	0.12987	NM_007197		Silent	SNP	ENST00000229030.4	37	CCDS9267.1	.	.	.	.	.	.	.	.	.	.	G	7.448	0.642158	0.14451	.	.	ENSG00000111432	ENST00000539839	.	.	.	4.98	1.95	0.26073	.	3.678390	0.02114	N	0.055040	T	0.59183	0.2175	.	.	.	0.43439	D	0.995613	.	.	.	.	.	.	T	0.53415	-0.8442	6	0.87932	D	0	.	3.0754	0.06245	0.1715:0.2875:0.4239:0.1172	.	.	.	.	T	445	.	ENSP00000438460:A445T	A	+	1	0	FZD10	129214871	0.000000	0.05858	0.884000	0.34674	0.978000	0.69477	-0.874000	0.04210	0.468000	0.27243	-0.254000	0.11334	GCA	.	.	none		0.547	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
TCERG1L	256536	hgsc.bcm.edu	37	10	132896590	132896590	+	Missense_Mutation	SNP	T	T	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr10:132896590T>G	ENST00000368642.4	-	11	1668	c.1583A>C	c.(1582-1584)gAg>gCg	p.E528A	RP11-462G8.3_ENST00000436942.1_RNA	NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	528	FF 2.									cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		TTTAGATTCCTCTAGAAGTTT	0.368																																					p.E528A		Atlas-SNP	.											.	TCERG1L	91	.	0			c.A1583C						PASS	.						75.0	65.0	69.0					10																	132896590		2157	4224	6381	SO:0001583	missense	256536	exon11			GATTCCTCTAGAA	AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.1583A>C	10.37:g.132896590T>G	ENSP00000357631:p.Glu528Ala	Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	45	14	0.311111	NM_174937	Q5VWI2|Q86XM8	Missense_Mutation	SNP	ENST00000368642.4	37	CCDS7662.2	.	.	.	.	.	.	.	.	.	.	T	20.6	4.022569	0.75275	.	.	ENSG00000176769	ENST00000368642	T	0.32753	1.44	4.83	4.83	0.62350	FF domain (4);	0.000000	0.64402	D	0.000003	T	0.47691	0.1459	L	0.53671	1.685	0.80722	D	1	D	0.61697	0.99	D	0.64410	0.925	T	0.45906	-0.9229	10	0.54805	T	0.06	-8.1045	13.2339	0.59958	0.0:0.0:0.0:1.0	.	528	Q5VWI1	TCRGL_HUMAN	A	528	ENSP00000357631:E528A	ENSP00000357631:E528A	E	-	2	0	TCERG1L	132786580	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	6.505000	0.73708	1.806000	0.52798	0.460000	0.39030	GAG	.	.	none		0.368	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091619.2	NM_174937	
FAM86B1	85002	hgsc.bcm.edu	37	8	12044264	12044264	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:12044264C>T	ENST00000448228.2	-	4	368	c.319G>A	c.(319-321)Gcc>Acc	p.A107T	FAM86B1_ENST00000321602.8_Start_Codon_SNP_p.M1I|FAM86B1_ENST00000533852.2_Missense_Mutation_p.A141T|FAM86B1_ENST00000534520.1_Missense_Mutation_p.A107T|FAM86B1_ENST00000533513.1_Missense_Mutation_p.A141T	NM_001083537.1	NP_001077006.1	Q8N7N1	F86B1_HUMAN	family with sequence similarity 86, member B1	107										kidney(1)|prostate(1)|stomach(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		TAGAGGGCGGCATCCCATGTG	0.612																																					p.A107T		Atlas-SNP	.											FAM86B1,NS,carcinoma,+2,1	FAM86B1	7	1	0			c.G319A						scavenged	.						1.0	1.0	1.0					8																	12044264		461	1070	1531	SO:0001583	missense	85002	exon4			GGGCGGCATCCCA	BC007983	CCDS59512.1	8p23.1	2014-02-12	2005-08-19		ENSG00000186523	ENSG00000186523			28268	protein-coding gene	gene with protein product						12477932	Standard	NM_001083537		Approved	MGC16279	uc010lse.3	Q8N7N1	OTTHUMG00000165298	ENST00000448228.2:c.319G>A	8.37:g.12044264C>T	ENSP00000407067:p.Ala107Thr	Somatic	238	27	0.113445		WXS	Illumina HiSeq	Phase_I	236	11	0.0466102	NM_001083537		Missense_Mutation	SNP	ENST00000448228.2	37	CCDS59512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	11.97|11.97	1.796969|1.796969	0.31777|0.31777	.|.	.|.	ENSG00000186523|ENSG00000186523	ENST00000431227;ENST00000340537;ENST00000448228;ENST00000534520;ENST00000526708;ENST00000524571;ENST00000533513|ENST00000321602;ENST00000526802	T;T;T;T;T|T	0.36340|0.24350	1.26;2.52;1.26;1.56;4.06|1.86	1.17|1.17	1.17|1.17	0.20885|0.20885	.|.	10.022600|.	0.01570|.	U|.	0.020538|.	T|T	0.33731|0.33731	0.0873|0.0873	M|M	0.90309|0.90309	3.105|3.105	0.80722|0.80722	D|D	1|1	P;P|B;B	0.46457|0.15719	0.878;0.749|0.014;0.003	D;P|B;B	0.64144|0.08055	0.922;0.624|0.003;0.002	T|T	0.42050|0.42050	-0.9474|-0.9474	10|9	0.72032|0.87932	D|D	0.01|0	.|.	8.2654|8.2654	0.31810|0.31810	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	107;141|1;38	Q8N7N1;E9PN63|F6QN85;Q4KMP3	F86B1_HUMAN;.|.;.	T|I	141;107;107;107;141;79;141|1;102	ENSP00000342610:A107T;ENSP00000407067:A107T;ENSP00000431362:A107T;ENSP00000432790:A79T;ENSP00000435201:A141T|ENSP00000439686:M1I	ENSP00000342610:A107T|ENSP00000439686:M1I	A|M	-|-	1|3	0|0	FAM86B1|FAM86B1	12081673|12081673	1.000000|1.000000	0.71417|0.71417	0.088000|0.088000	0.20740|0.20740	0.049000|0.049000	0.14656|0.14656	6.283000|6.283000	0.72646|0.72646	0.950000|0.950000	0.37743|0.37743	0.173000|0.173000	0.16961|0.16961	GCC|ATG	.	.	none		0.612	FAM86B1-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000383317.1	NM_032916	
EP400	57634	hgsc.bcm.edu	37	12	132547087	132547087	+	Silent	SNP	G	G	A	rs12366766	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:132547087G>A	ENST00000333577.4	+	48	8392	c.8283G>A	c.(8281-8283)caG>caA	p.Q2761Q	EP400_ENST00000389561.2_Silent_p.Q2725Q|EP400_ENST00000332482.4_Silent_p.Q2688Q|EP400_ENST00000389562.2_Silent_p.Q2724Q|EP400_ENST00000330386.6_Silent_p.Q2644Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2761	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2724Q(16)|p.Q2725Q(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcaacaacagc	0.562													G|||	37	0.00738818	0.0038	0.0072	5008	,	,		15585	0.002		0.0149	False		,,,				2504	0.0102				p.Q2725Q		Atlas-SNP	.											EP400,NS,carcinoma,0,20	EP400	370	20	17	Substitution - coding silent(17)	prostate(4)|kidney(4)|central_nervous_system(3)|lung(3)|endometrium(2)|urinary_tract(1)	c.G8175A						scavenged	.						28.0	31.0	30.0					12																	132547087		2199	4282	6481	SO:0001819	synonymous_variant	57634	exon47			GCAGCAGCAACAA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8283G>A	12.37:g.132547087G>A		Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	92	7	0.076087	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				.	.	weak		0.562	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
ACOT1	641371	hgsc.bcm.edu	37	14	74008216	74008216	+	Silent	SNP	C	C	G	rs201966235	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr14:74008216C>G	ENST00000311148.4	+	2	785	c.477C>G	c.(475-477)ggC>ggG	p.G159G	HEATR4_ENST00000560393.1_Intron|HEATR4_ENST00000553558.1_Intron|HEATR4_ENST00000334988.2_Intron|ACOT1_ENST00000557556.1_Silent_p.G159G	NM_001037161.1	NP_001032238.1	Q86TX2	ACOT1_HUMAN	acyl-CoA thioesterase 1	159					acyl-CoA metabolic process (GO:0006637)|long-chain fatty acid metabolic process (GO:0001676)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)	p.G159G(1)		endometrium(1)|large_intestine(1)|lung(2)	4				OV - Ovarian serous cystadenocarcinoma(108;1.37e-45)|BRCA - Breast invasive adenocarcinoma(234;0.0033)		CCTTTCCTGGCATTGTGGACA	0.463													-|||	62	0.0123802	0.0257	0.0115	5008	,	,		11074	0.002		0.0139	False		,,,				2504	0.0041				p.G159G		Atlas-SNP	.											ACOT1,NS,carcinoma,0,1	ACOT1	12	1	1	Substitution - coding silent(1)	endometrium(1)	c.C477G						scavenged	.						170.0	130.0	144.0					14																	74008216		1974	3593	5567	SO:0001819	synonymous_variant	641371	exon2			TCCTGGCATTGTG	DQ082754	CCDS32117.1	14q24.3	2013-09-20			ENSG00000184227	ENSG00000184227		"""Acyl CoA thioesterases"""	33128	protein-coding gene	gene with protein product		614313				16103133, 16940157	Standard	NM_001037161		Approved	ACH2, CTE-1, LACH2		Q86TX2	OTTHUMG00000171607	ENST00000311148.4:c.477C>G	14.37:g.74008216C>G		Somatic	3	1	0.333333		WXS	Illumina HiSeq	Phase_I	5	5	1	NM_001037161	A1L173|Q3I5F9	Silent	SNP	ENST00000311148.4	37	CCDS32117.1																																																																																			C|0.785;G|0.215	0.215	strong		0.463	ACOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414432.1	NM_001037161	
VPS13B	157680	hgsc.bcm.edu	37	8	100829995	100829995	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:100829995G>A	ENST00000358544.2	+	45	8511	c.8400G>A	c.(8398-8400)ctG>ctA	p.L2800L	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Silent_p.L2775L	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2800					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ATGTGTGCCTGGAATCCAAAG	0.413																																					p.L2800L	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											.	VPS13B	811	.	0			c.G8400A						PASS	.						139.0	130.0	133.0					8																	100829995		2203	4300	6503	SO:0001819	synonymous_variant	157680	exon45			GTGCCTGGAATCC	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.8400G>A	8.37:g.100829995G>A		Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	90	21	0.233333	NM_017890	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	CCDS6280.1																																																																																			.	.	none		0.413	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
BNC1	646	hgsc.bcm.edu	37	15	83932823	83932823	+	Missense_Mutation	SNP	T	T	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr15:83932823T>A	ENST00000345382.2	-	4	1265	c.1180A>T	c.(1180-1182)Atg>Ttg	p.M394L	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.M387L	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	394					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						CTGAACACCATGTTACACCCT	0.507																																					p.M394L		Atlas-SNP	.											.	BNC1	149	.	0			c.A1180T						PASS	.						156.0	142.0	147.0					15																	83932823		2203	4300	6503	SO:0001583	missense	646	exon4			ACACCATGTTACA	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1180A>T	15.37:g.83932823T>A	ENSP00000307041:p.Met394Leu	Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	124	33	0.266129	NM_001717	Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	CCDS10324.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.455053	0.84209	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.26810	1.71	5.75	5.75	0.90469	Zinc finger, C2H2-like (1);	0.078751	0.85682	D	0.000000	T	0.54431	0.1858	M	0.80183	2.485	0.80722	D	1	D;P	0.59357	0.985;0.882	D;P	0.74674	0.984;0.858	T	0.59878	-0.7371	10	0.87932	D	0	-37.7656	16.0707	0.80928	0.0:0.0:0.0:1.0	.	387;394	F5GY04;Q01954	.;BNC1_HUMAN	L	394;387	ENSP00000307041:M394L	ENSP00000307041:M394L	M	-	1	0	BNC1	81723827	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.975000	0.88055	2.194000	0.70268	0.533000	0.62120	ATG	.	.	none		0.507	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717	
ROBO2	6092	hgsc.bcm.edu	37	3	77693936	77693936	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:77693936G>T	ENST00000461745.1	+	25	4916	c.4016G>T	c.(4015-4017)gGa>gTa	p.G1339V	ROBO2_ENST00000487694.3_Missense_Mutation_p.G1355V|ROBO2_ENST00000332191.8_Missense_Mutation_p.G1400V	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1339					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		TCTTCTAAGGGATCCACTGGA	0.517																																					p.G1339V		Atlas-SNP	.											ROBO2_ENST00000487694,colon,carcinoma,-1,3	ROBO2	527	3	0			c.G4016T						scavenged	.						85.0	87.0	87.0					3																	77693936		2017	4172	6189	SO:0001583	missense	6092	exon25			CTAAGGGATCCAC	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.4016G>T	3.37:g.77693936G>T	ENSP00000417164:p.Gly1339Val	Somatic	84	1	0.0119048		WXS	Illumina HiSeq	Phase_I	58	23	0.396552	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382918	0.61845	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000461745;ENST00000332191	T;T;T	0.70516	-0.27;-0.23;-0.49	5.85	5.85	0.93711	.	0.000000	0.45126	D	0.000396	T	0.71962	0.3402	L	0.49778	1.585	0.34784	D	0.735015	P;P;P	0.41131	0.622;0.739;0.622	B;P;B	0.46917	0.33;0.531;0.33	T	0.79822	-0.1641	9	0.66056	D	0.02	.	13.3754	0.60736	0.0716:0.0:0.9284:0.0	.	1355;1400;1339	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	V	1355;1355;1339;1400	ENSP00000417335:G1355V;ENSP00000417164:G1339V;ENSP00000327536:G1400V	ENSP00000327536:G1400V	G	+	2	0	ROBO2	77776626	1.000000	0.71417	1.000000	0.80357	0.308000	0.27856	7.394000	0.79862	2.775000	0.95449	0.655000	0.94253	GGA	.	.	none		0.517	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
ASIC2	40	hgsc.bcm.edu	37	17	31618815	31618815	+	Intron	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:31618815G>A	ENST00000359872.6	-	2	1317				ASIC2_ENST00000448983.1_5'Flank|ASIC2_ENST00000225823.2_Missense_Mutation_p.R107C	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	TAGAGCAAGCGGTTCGAGGAC	0.672																																					p.R107C		Atlas-SNP	.											.	.	.	.	0			c.C319T						PASS	.						36.0	36.0	36.0					17																	31618815		2203	4297	6500	SO:0001627	intron_variant	40	exon1			GCAAGCGGTTCGA	AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.556-179730C>T	17.37:g.31618815G>A		Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	36	4	0.111111	NM_183377	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	CCDS42296.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058468	0.55325	.	.	ENSG00000108684	ENST00000225823	T	0.65916	-0.18	4.73	3.74	0.42951	.	0.065766	0.56097	D	0.000040	T	0.65647	0.2711	M	0.79258	2.445	0.80722	D	1	P	0.50369	0.934	P	0.47044	0.535	T	0.65533	-0.6145	10	0.38643	T	0.18	-3.7744	10.0793	0.42379	0.0:0.0:0.635:0.365	.	107	E9PBX2	.	C	107	ENSP00000225823:R107C	ENSP00000225823:R107C	R	-	1	0	ACCN1	28642928	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	5.203000	0.65174	0.937000	0.37394	0.313000	0.20887	CGC	.	.	none		0.672	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094	
IRF2	3660	hgsc.bcm.edu	37	4	185309962	185309962	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:185309962C>T	ENST00000393593.3	-	9	1207	c.1000G>A	c.(1000-1002)Gtc>Atc	p.V334I		NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	334					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		TTCTTGATGACGCTGGCCCGG	0.572																																					p.V334I		Atlas-SNP	.											IRF2,caecum,carcinoma,0,1	IRF2	53	1	0			c.G1000A						PASS	.						65.0	76.0	72.0					4																	185309962		2203	4300	6503	SO:0001583	missense	3660	exon9			TGATGACGCTGGC		CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.1000G>A	4.37:g.185309962C>T	ENSP00000377218:p.Val334Ile	Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	70	19	0.271429	NM_002199	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Missense_Mutation	SNP	ENST00000393593.3	37	CCDS3835.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.664083	0.88251	.	.	ENSG00000168310	ENST00000393593	D	0.98822	-5.16	5.08	5.08	0.68730	.	0.615176	0.15998	N	0.234496	D	0.98937	0.9639	L	0.61218	1.895	0.54753	D	0.999988	D	0.89917	1.0	D	0.79108	0.992	D	0.99911	1.1201	10	0.87932	D	0	-14.8728	18.6427	0.91400	0.0:1.0:0.0:0.0	.	334	P14316	IRF2_HUMAN	I	334	ENSP00000377218:V334I	ENSP00000377218:V334I	V	-	1	0	IRF2	185546956	1.000000	0.71417	0.989000	0.46669	0.979000	0.70002	5.799000	0.69101	2.646000	0.89796	0.561000	0.74099	GTC	.	.	none		0.572	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1		
TBL1XR1	79718	hgsc.bcm.edu	37	3	176750838	176750838	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:176750838T>C	ENST00000430069.1	-	14	1596	c.1337A>G	c.(1336-1338)tAc>tGc	p.Y446C	TBL1XR1_ENST00000457928.2_Missense_Mutation_p.Y446C			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	446					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			AGCTACACTGTACACAGGCTC	0.423																																					p.Y446C		Atlas-SNP	.											.	TBL1XR1	87	.	0			c.A1337G						PASS	.						119.0	117.0	118.0					3																	176750838		1942	4178	6120	SO:0001583	missense	79718	exon14			ACACTGTACACAG	AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.1337A>G	3.37:g.176750838T>C	ENSP00000405574:p.Tyr446Cys	Somatic	278	0	0		WXS	Illumina HiSeq	Phase_I	316	124	0.392405	NM_024665	D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Missense_Mutation	SNP	ENST00000430069.1	37	CCDS46961.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.339487	0.81911	.	.	ENSG00000177565	ENST00000430069;ENST00000457928;ENST00000536758	T;T	0.60299	0.2;0.2	5.51	5.51	0.81932	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.202715	0.44483	D	0.000449	T	0.72550	0.3474	M	0.71581	2.175	0.80722	D	1	P	0.50943	0.94	P	0.61070	0.883	T	0.75439	-0.3317	10	0.62326	D	0.03	-3.9263	14.8126	0.70006	0.0:0.0:0.0:1.0	.	446	Q9BZK7	TBL1R_HUMAN	C	446;446;308	ENSP00000405574:Y446C;ENSP00000413251:Y446C	ENSP00000405574:Y446C	Y	-	2	0	TBL1XR1	178233532	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.098000	0.63641	0.533000	0.62120	TAC	.	.	none		0.423	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347587.3	NM_024665	
BTG1	694	hgsc.bcm.edu	37	12	92539171	92539171	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:92539171C>T	ENST00000256015.3	-	1	502	c.141G>A	c.(139-141)ctG>ctA	p.L47L	RP11-796E2.4_ENST00000501008.2_RNA|C12orf79_ENST00000546975.1_5'Flank|C12orf79_ENST00000549802.1_5'Flank|C12orf79_ENST00000551563.2_5'Flank|RP11-796E2.4_ENST00000499685.2_RNA	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	47					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)			haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				CACCTGCCAGCAGCTCCTGCA	0.701			T	MYC	BCLL																																p.L47L		Atlas-SNP	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	.	BTG1	30	.	0			c.G141A						PASS	.						28.0	30.0	30.0					12																	92539171		2201	4299	6500	SO:0001819	synonymous_variant	694	exon1			TGCCAGCAGCTCC		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.141G>A	12.37:g.92539171C>T		Somatic	91	0	0		WXS	Illumina HiSeq	Phase_I	110	48	0.436364	NM_001731	P31607	Silent	SNP	ENST00000256015.3	37	CCDS9043.1																																																																																			.	.	none		0.701	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
ZNF319	57567	hgsc.bcm.edu	37	16	58030541	58030541	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr16:58030541C>T	ENST00000299237.2	-	2	2251	c.1629G>A	c.(1627-1629)aaG>aaA	p.K543K	USB1_ENST00000561743.1_5'Flank	NM_020807.1	NP_065858.1	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	543					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8						ACCATACACACTTGAACTGCT	0.662																																					p.K543K		Atlas-SNP	.											.	ZNF319	42	.	0			c.G1629A						PASS	.						42.0	35.0	37.0					16																	58030541		2198	4300	6498	SO:0001819	synonymous_variant	57567	exon2			TACACACTTGAAC	AB037809	CCDS32462.1	16q21	2013-01-08				ENSG00000166188		"""Zinc fingers, C2H2-type"""	13644	protein-coding gene	gene with protein product						10718198, 11161788	Standard	XM_005256069		Approved	KIAA1388, Zfp319	uc002emx.1	Q9P2F9		ENST00000299237.2:c.1629G>A	16.37:g.58030541C>T		Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	60	7	0.116667	NM_020807	Q52LH8	Silent	SNP	ENST00000299237.2	37	CCDS32462.1																																																																																			.	.	none		0.662	ZNF319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430317.1		
RAPGEF4	11069	hgsc.bcm.edu	37	2	173882186	173882186	+	Silent	SNP	C	C	T	rs549829112		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr2:173882186C>T	ENST00000397081.3	+	21	2105	c.1962C>T	c.(1960-1962)ggC>ggT	p.G654G	RAPGEF4_ENST00000397087.3_Silent_p.G510G|RAPGEF4_ENST00000540783.1_Silent_p.G501G|RAPGEF4_ENST00000264111.6_Silent_p.G653G|RAPGEF4_ENST00000409036.1_Silent_p.G654G|RAPGEF4_ENST00000538974.1_Silent_p.G483G|RAPGEF4_ENST00000535187.1_Silent_p.G434G|RAPGEF4_ENST00000539331.1_Silent_p.G501G	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	654					blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.G654G(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			TCAATACGGGCGATGAGAGAG	0.468													c|||	1	0.000199681	0.0008	0.0	5008	,	,		17335	0.0		0.0	False		,,,				2504	0.0				p.G654G		Atlas-SNP	.											RAPGEF4,NS,carcinoma,0,2	RAPGEF4	103	2	1	Substitution - coding silent(1)	large_intestine(1)	c.C1962T						PASS	.						72.0	70.0	71.0					2																	173882186		1905	4124	6029	SO:0001819	synonymous_variant	11069	exon21			TACGGGCGATGAG	U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.1962C>T	2.37:g.173882186C>T		Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	50	10	0.2	NM_007023	B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	Silent	SNP	ENST00000397081.3	37	CCDS42775.1																																																																																			.	.	none		0.468	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257864.2	NM_007023	
GABRP	2568	hgsc.bcm.edu	37	5	170235620	170235620	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:170235620G>A	ENST00000518525.1	+	9	1160	c.696G>A	c.(694-696)ttG>ttA	p.L232L	GABRP_ENST00000265294.4_Silent_p.L232L|GABRP_ENST00000519385.1_Silent_p.L232L|GABRP_ENST00000519598.1_Silent_p.L232L			O00591	GBRP_HUMAN	gamma-aminobutyric acid (GABA) A receptor, pi	232					signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(4)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	29	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ACACTAGATTGGTCTTACAGT	0.398																																					p.L232L		Atlas-SNP	.											.	GABRP	65	.	0			c.G696A						PASS	.						184.0	164.0	170.0					5																	170235620		2203	4300	6503	SO:0001819	synonymous_variant	2568	exon8			TAGATTGGTCTTA	U95367	CCDS4375.1, CCDS75368.1	5q35.1	2012-06-22			ENSG00000094755	ENSG00000094755		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4089	protein-coding gene	gene with protein product	"""GABA(A) receptor, pi"""	602729				9182563	Standard	NM_014211		Approved		uc003mau.3	O00591	OTTHUMG00000130443	ENST00000518525.1:c.696G>A	5.37:g.170235620G>A		Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	87	13	0.149425	NM_014211	A8KA36|D3DQL2|Q32MJ1	Silent	SNP	ENST00000518525.1	37	CCDS4375.1																																																																																			.	.	none		0.398	GABRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252834.3	NM_014211	
FRG1	2483	hgsc.bcm.edu	37	4	190878625	190878625	+	Missense_Mutation	SNP	A	A	G	rs373840195		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:190878625A>G	ENST00000226798.4	+	6	727	c.505A>G	c.(505-507)Agt>Ggt	p.S169G	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	169					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.S169G(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AGAAGCAAAAAGTAAAACAGC	0.363																																					p.S169G		Atlas-SNP	.											FRG1,NS,carcinoma,0,3	FRG1	76	3	1	Substitution - Missense(1)	lung(1)	c.A505G						scavenged	.						49.0	46.0	47.0					4																	190878625		2183	4281	6464	SO:0001583	missense	2483	exon6			GCAAAAAGTAAAA	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.505A>G	4.37:g.190878625A>G	ENSP00000226798:p.Ser169Gly	Somatic	613	16	0.0261011		WXS	Illumina HiSeq	Phase_I	522	15	0.0287356	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	21.2	4.112843	0.77210	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.49139	1.86;0.79	4.19	4.19	0.49359	Actin cross-linking (1);	0.160510	0.64402	D	0.000002	T	0.58750	0.2144	M	0.77103	2.36	0.49915	D	0.999832	D	0.55800	0.973	P	0.53102	0.718	T	0.61426	-0.7065	10	0.39692	T	0.17	0.1847	11.5749	0.50856	1.0:0.0:0.0:0.0	.	169	Q14331	FRG1_HUMAN	G	169;41;106	ENSP00000226798:S169G;ENSP00000435943:S106G	ENSP00000226798:S169G	S	+	1	0	FRG1	191115619	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.044000	0.93805	1.677000	0.50941	0.373000	0.22412	AGT	.	.	weak		0.363	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
DLGAP2	9228	hgsc.bcm.edu	37	8	1624701	1624701	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:1624701G>A	ENST00000421627.2	+	8	2099	c.1965G>A	c.(1963-1965)gtG>gtA	p.V655V		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	734					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		TGAATTAGGTGGAAACGGCCA	0.493																																					p.V655V		Atlas-SNP	.											.	DLGAP2	292	.	0			c.G1965A						PASS	.						32.0	35.0	34.0					8																	1624701		1887	4107	5994	SO:0001819	synonymous_variant	9228	exon8			TTAGGTGGAAACG	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1965G>A	8.37:g.1624701G>A		Somatic	107	0	0		WXS	Illumina HiSeq	Phase_I	91	37	0.406593	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	G	8.829	0.939412	0.18281	.	.	ENSG00000198010	ENST00000520901	.	.	.	5.51	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-14.356	13.4157	0.60968	0.0769:0.0:0.9231:0.0	.	.	.	.	X	658	.	.	W	+	2	0	DLGAP2	1612108	1.000000	0.71417	1.000000	0.80357	0.095000	0.18619	4.906000	0.63293	1.292000	0.44672	0.563000	0.77884	TGG	.	.	none		0.493	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
FCHO1	23149	hgsc.bcm.edu	37	19	17897428	17897428	+	Silent	SNP	C	C	T	rs370950809		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr19:17897428C>T	ENST00000596536.1	+	27	2755	c.2472C>T	c.(2470-2472)tcC>tcT	p.S824S	FCHO1_ENST00000539407.1_Silent_p.S824S|FCHO1_ENST00000596951.1_Silent_p.S824S|FCHO1_ENST00000252771.7_Silent_p.S824S|FCHO1_ENST00000595033.1_Silent_p.S774S|FCHO1_ENST00000594202.1_Silent_p.S824S|FCHO1_ENST00000600676.1_Silent_p.S824S|FCHO1_ENST00000597512.1_Silent_p.S831S|FCHO1_ENST00000389133.4_Silent_p.S824S	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	824	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.|Mediates interaction with AGFG1, CALM, DAB2, EPS15, EPS15R, ITSN1 and clathrin.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						CAGATGTGTCCGAGGCAGGCG	0.562																																					p.S824S		Atlas-SNP	.											.	FCHO1	69	.	0			c.C2472T						PASS	.	C	,,,	0,4406		0,0,2203	59.0	61.0	60.0		2472,2472,2322,2472	-4.7	1.0	19		60	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	FCHO1	NM_001161357.1,NM_001161358.1,NM_001161359.1,NM_015122.2	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	824/892,824/890,774/840,824/890	17897428	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23149	exon26			TGTGTCCGAGGCA	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.2472C>T	19.37:g.17897428C>T		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	35	27	0.771429	NM_001161358	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Silent	SNP	ENST00000596536.1	37	CCDS32955.1																																																																																			.	.	weak		0.562	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466946.2	NM_015122	
MDN1	23195	hgsc.bcm.edu	37	6	90423000	90423000	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:90423000G>A	ENST00000369393.3	-	47	7200	c.7085C>T	c.(7084-7086)tCt>tTt	p.S2362F	MDN1_ENST00000428876.1_Missense_Mutation_p.S2362F			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2362					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AGTTGATACAGAAGATGTTGG	0.383																																					p.S2362F		Atlas-SNP	.											.	MDN1	478	.	0			c.C7085T						PASS	.						122.0	132.0	129.0					6																	90423000		2203	4300	6503	SO:0001583	missense	23195	exon47			GATACAGAAGATG	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.7085C>T	6.37:g.90423000G>A	ENSP00000358400:p.Ser2362Phe	Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	54	25	0.462963	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	G	10.01	1.234635	0.22626	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03580	3.88;3.88	5.94	4.12	0.48240	.	0.137285	0.51477	D	0.000097	T	0.06325	0.0163	M	0.68952	2.095	0.47476	D	0.999437	D	0.60575	0.988	P	0.57679	0.825	T	0.04268	-1.0964	10	0.87932	D	0	.	11.7102	0.51620	0.0665:0.1243:0.8092:0.0	.	2362	Q9NU22	MDN1_HUMAN	F	2362	ENSP00000358400:S2362F;ENSP00000413970:S2362F	ENSP00000358400:S2362F	S	-	2	0	MDN1	90479721	0.999000	0.42202	0.218000	0.23776	0.721000	0.41392	4.186000	0.58337	0.809000	0.34255	-0.262000	0.10625	TCT	.	.	none		0.383	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
TAS2R39	259285	hgsc.bcm.edu	37	7	142881334	142881334	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr7:142881334G>A	ENST00000446620.1	+	1	823	c.823G>A	c.(823-825)Gca>Aca	p.A275T		NM_176881.2	NP_795362.2	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	275					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	Melanoma(164;0.059)					CATTTTCAATGCAGTTGCTCT	0.488																																					p.A275T		Atlas-SNP	.											.	TAS2R39	42	.	0			c.G823A						PASS	.						147.0	136.0	139.0					7																	142881334		1923	4142	6065	SO:0001583	missense	259285	exon1			TTCAATGCAGTTG	AF494230	CCDS47729.1	7q34	2012-08-22			ENSG00000236398	ENSG00000236398		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18886	protein-coding gene	gene with protein product						12379855	Standard	NM_176881		Approved		uc011ksw.2	P59534	OTTHUMG00000152636	ENST00000446620.1:c.823G>A	7.37:g.142881334G>A	ENSP00000405095:p.Ala275Thr	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	82	57	0.695122	NM_176881	A4FUI7|Q3ZCN6|Q645W4	Missense_Mutation	SNP	ENST00000446620.1	37	CCDS47729.1	.	.	.	.	.	.	.	.	.	.	G	8.428	0.847872	0.17034	.	.	ENSG00000236398	ENST00000446620	T	0.37584	1.19	4.62	1.55	0.23275	.	.	.	.	.	T	0.35451	0.0932	L	0.55481	1.735	0.21064	N	0.999792	P	0.39883	0.693	B	0.41619	0.361	T	0.15292	-1.0442	9	0.27785	T	0.31	.	12.1023	0.53792	0.0:0.0:0.3507:0.6493	.	275	P59534	T2R39_HUMAN	T	275	ENSP00000405095:A275T	ENSP00000405095:A275T	A	+	1	0	TAS2R39	142591456	0.450000	0.25697	0.353000	0.25747	0.529000	0.34654	1.145000	0.31577	0.656000	0.30886	0.650000	0.86243	GCA	.	.	none		0.488	TAS2R39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327090.2	NM_176881	
NARFL	64428	hgsc.bcm.edu	37	16	787323	787323	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr16:787323C>G	ENST00000251588.2	-	3	185	c.169G>C	c.(169-171)Ggg>Cgg	p.G57R	NARFL_ENST00000540986.1_5'UTR|NARFL_ENST00000301694.5_Missense_Mutation_p.G57R|NARFL_ENST00000568545.1_5'UTR	NM_022493.1	NP_071938.1	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like	57					hematopoietic progenitor cell differentiation (GO:0002244)|iron-sulfur cluster assembly (GO:0016226)|oxygen homeostasis (GO:0032364)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	CIA complex (GO:0097361)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|large_intestine(1)|lung(7)	9		Hepatocellular(780;0.0218)				CTCCGGGTCCCGCCGTCCTAC	0.617																																					p.G57R		Atlas-SNP	.											NARFL,NS,carcinoma,0,1	NARFL	31	1	0			c.G169C						PASS	.						63.0	64.0	63.0					16																	787323		2200	4299	6499	SO:0001583	missense	64428	exon3			GGGTCCCGCCGTC	AY129231	CCDS10425.1	16p13.3	2009-12-17			ENSG00000103245	ENSG00000103245			14179	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 1"""	611118				16956324	Standard	NM_022493		Approved	FLJ21988, PRN, HPRN, IOP1	uc002cjr.3	Q9H6Q4	OTTHUMG00000122093	ENST00000251588.2:c.169G>C	16.37:g.787323C>G	ENSP00000251588:p.Gly57Arg	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	67	32	0.477612	NM_022493	A1L385|B3KTJ3|Q53GC6|Q96S10|Q9H6J8	Missense_Mutation	SNP	ENST00000251588.2	37	CCDS10425.1	.	.	.	.	.	.	.	.	.	.	C	8.934	0.964176	0.18583	.	.	ENSG00000103245	ENST00000251588;ENST00000301694	T;T	0.25912	1.77;1.77	4.29	2.31	0.28768	.	0.195215	0.43919	N	0.000519	T	0.15262	0.0368	L	0.28694	0.88	0.09310	N	0.999999	B;B;B	0.31174	0.311;0.311;0.002	B;B;B	0.30251	0.113;0.113;0.002	T	0.23368	-1.0190	10	0.16896	T	0.51	-28.7067	8.6826	0.34218	0.0:0.8105:0.0:0.1895	.	57;57;57	B4DT78;B4DEE7;Q9H6Q4	.;.;NARFL_HUMAN	R	57	ENSP00000251588:G57R;ENSP00000301694:G57R	ENSP00000251588:G57R	G	-	1	0	NARFL	727324	0.475000	0.25894	0.026000	0.17262	0.467000	0.32768	3.402000	0.52608	0.455000	0.26910	-0.192000	0.12808	GGG	.	.	none		0.617	NARFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242855.1	NM_022493	
C10orf105	414152	hgsc.bcm.edu	37	10	73498388	73498388	+	5'Flank	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr10:73498388C>T	ENST00000398786.2	-	0	0				CDH23_ENST00000224721.6_Missense_Mutation_p.A1453V	NM_001168390.1	NP_001161862.1	Q8TEF2	CJ105_HUMAN	chromosome 10 open reading frame 105							integral component of membrane (GO:0016021)											GACCCTGATGCTGGCAGCAAT	0.647																																					p.A1448V		Atlas-SNP	.											.	CDH23	365	.	0			c.C4343T						PASS	.						40.0	46.0	44.0					10																	73498388		2075	4228	6303	SO:0001631	upstream_gene_variant	64072	exon33			CTGATGCTGGCAG	AK074172	CCDS44430.1	10q22.1	2012-06-01			ENSG00000214688	ENSG00000214688			20304	protein-coding gene	gene with protein product							Standard	NM_001164375		Approved	FLJ00245	uc001jsa.2	Q8TEF2	OTTHUMG00000018427		10.37:g.73498388C>T	Exception_encountered	Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	33	7	0.212121	NM_022124		Missense_Mutation	SNP	ENST00000398786.2	37	CCDS44430.1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.011477	0.54468	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398792	.	.	.	5.38	4.46	0.54185	Cadherin (4);Cadherin-like (1);	0.198265	0.42420	D	0.000712	T	0.47414	0.1444	N	0.25094	0.71	0.80722	D	1	B;B	0.28026	0.009;0.198	B;B	0.39152	0.022;0.292	T	0.45352	-0.9267	9	0.40728	T	0.16	.	9.8858	0.41260	0.1395:0.7872:0.0:0.0733	.	268;1448	E7ERT0;Q9H251	.;CAD23_HUMAN	V	1453;1448;1451;268	.	ENSP00000224721:A1453V	A	+	2	0	CDH23	73168394	0.998000	0.40836	0.076000	0.20297	0.710000	0.40934	4.206000	0.58473	2.683000	0.91414	0.561000	0.74099	GCT	.	.	none		0.647	C10orf105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048551.2	NM_001164375	
PER2	8864	hgsc.bcm.edu	37	2	239162025	239162025	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr2:239162025G>A	ENST00000254657.3	-	19	2918	c.2639C>T	c.(2638-2640)gCt>gTt	p.A880V	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	880	Pro-rich.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		CACGGGCACAGCAGGCACTGT	0.637																																					p.A880V		Atlas-SNP	.											.	PER2	85	.	0			c.C2639T						PASS	.						30.0	31.0	31.0					2																	239162025		2203	4299	6502	SO:0001583	missense	8864	exon19			GGCACAGCAGGCA	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2639C>T	2.37:g.239162025G>A	ENSP00000254657:p.Ala880Val	Somatic	64	0	0		WXS	Illumina HiSeq	Phase_I	53	22	0.415094	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	37	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	G	1.276	-0.611740	0.03690	.	.	ENSG00000132326	ENST00000254657	T	0.11169	2.8	2.97	0.428	0.16499	.	1.738710	0.03244	N	0.180882	T	0.04952	0.0133	N	0.03115	-0.41	0.09310	N	0.999999	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.002	T	0.35624	-0.9781	10	0.15952	T	0.53	.	6.0569	0.19816	0.397:0.0:0.603:0.0	.	880;880	B4DH14;O15055	.;PER2_HUMAN	V	880	ENSP00000254657:A880V	ENSP00000254657:A880V	A	-	2	0	PER2	238826764	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	0.969000	0.29370	0.299000	0.22661	0.561000	0.74099	GCT	.	.	none		0.637	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
SIRPA	140885	hgsc.bcm.edu	37	20	1895963	1895963	+	Missense_Mutation	SNP	A	A	G	rs373583167|rs386811662|rs17855613	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr20:1895963A>G	ENST00000358771.4	+	2	450	c.298A>G	c.(298-300)Aac>Gac	p.N100D	SIRPA_ENST00000356025.3_Missense_Mutation_p.N100D|SIRPA_ENST00000400068.3_Missense_Mutation_p.N100D	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	100	Ig-like V-type.		N -> E (requires 2 nucleotide substitutions). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9062191, ECO:0000269|PubMed:9070220}.		blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CACAAAGAGAAACAACATGGA	0.522																																					p.N100D	GBM(155;1668 1920 5945 42733 48121)	Atlas-SNP	.											SIRPA,brain,glioma,-2,4	SIRPA	83	4	0			c.A298G						scavenged	.																																			SO:0001583	missense	140885	exon3			AAGAGAAACAACA	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.298A>G	20.37:g.1895963A>G	ENSP00000351621:p.Asn100Asp	Somatic	139	10	0.0719424		WXS	Illumina HiSeq	Phase_I	132	11	0.0833333	NM_001040022	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	ENST00000358771.4	37	CCDS13022.1	.	.	.	.	.	.	.	.	.	.	A	10.72	1.430951	0.25726	.	.	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.02236	4.38;4.38;4.38	5.11	-5.69	0.02428	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.743450	0.02696	N	0.111247	T	0.03651	0.0104	L	0.55481	1.735	0.09310	N	1	B;B;B	0.17465	0.0;0.022;0.0	B;B;B	0.24701	0.004;0.055;0.007	T	0.41875	-0.9484	10	0.51188	T	0.08	.	10.2665	0.43457	0.2384:0.1377:0.6239:0.0	rs17855613	80;100;100	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	D	100	ENSP00000382941:N100D;ENSP00000348307:N100D;ENSP00000351621:N100D	ENSP00000348307:N100D	N	+	1	0	SIRPA	1843963	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.479000	0.02327	-1.294000	0.02360	-0.388000	0.06559	AAC	.	.	weak		0.522	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792	
RIPK4	54101	hgsc.bcm.edu	37	21	43161063	43161063	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr21:43161063G>T	ENST00000352483.2	-	9	2498	c.2434C>A	c.(2434-2436)Cag>Aag	p.Q812K	RIPK4_ENST00000542057.1_Missense_Mutation_p.Q701K|RIPK4_ENST00000332512.3_Missense_Mutation_p.Q764K|RIPK4_ENST00000544709.1_Missense_Mutation_p.Q701K|AP001615.9_ENST00000423276.1_RNA			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	812					morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TTGAGGCTCTGCAGGTTGATG	0.711																																					p.Q764K		Atlas-SNP	.											.	RIPK4	151	.	0			c.C2290A						PASS	.						41.0	40.0	40.0					21																	43161063		2202	4298	6500	SO:0001583	missense	54101	exon8			GGCTCTGCAGGTT	AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.2434C>A	21.37:g.43161063G>T	ENSP00000330161:p.Gln812Lys	Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	45	18	0.4	NM_020639	Q96KH0	Missense_Mutation	SNP	ENST00000352483.2	37		.	.	.	.	.	.	.	.	.	.	G	14.76	2.631833	0.46944	.	.	ENSG00000183421	ENST00000332512;ENST00000352483;ENST00000544709;ENST00000542057	T;T;T;T	0.62364	0.03;0.03;0.03;0.03	4.8	4.8	0.61643	.	0.000000	0.49916	D	0.000129	T	0.46889	0.1416	N	0.12471	0.22	0.29208	N	0.874744	P	0.36837	0.571	B	0.39027	0.288	T	0.43163	-0.9408	10	0.22109	T	0.4	-41.9581	16.842	0.85971	0.0:0.0:1.0:0.0	.	764	P57078-2	.	K	764;812;701;701	ENSP00000332454:Q764K;ENSP00000330161:Q812K;ENSP00000441754:Q701K;ENSP00000442901:Q701K	ENSP00000332454:Q764K	Q	-	1	0	RIPK4	42034132	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.765000	0.85310	2.202000	0.70862	0.655000	0.94253	CAG	.	.	none		0.711	RIPK4-201	KNOWN	basic	protein_coding	protein_coding		NM_020639	
IL34	146433	hgsc.bcm.edu	37	16	70693984	70693984	+	Missense_Mutation	SNP	C	C	T	rs201277640		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr16:70693984C>T	ENST00000288098.2	+	6	1006	c.623C>T	c.(622-624)gCg>gTg	p.A208V	FLJ00418_ENST00000597002.1_5'Flank|IL34_ENST00000566361.1_Missense_Mutation_p.A183V|IL34_ENST00000429149.2_Missense_Mutation_p.A208V	NM_001172772.1	NP_001166243.1	Q6ZMJ4	IL34_HUMAN	interleukin 34	208					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein phosphorylation (GO:0001934)	extracellular space (GO:0005615)	macrophage colony-stimulating factor receptor binding (GO:0005157)	p.A208V(1)		breast(1)|central_nervous_system(1)|kidney(9)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(2)	17						TTGCAGTATGCGGCCACCCAG	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		14065	0.0		0.001	False		,,,				2504	0.0				p.A208V		Atlas-SNP	.											IL34,bladder,carcinoma,0,3	IL34	26	3	1	Substitution - Missense(1)	urinary_tract(1)	c.C623T						scavenged	.	C	VAL/ALA,VAL/ALA,VAL/ALA	1,4395	2.1+/-5.4	0,1,2197	96.0	105.0	102.0		620,623,623	-3.1	0.0	16		102	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	IL34	NM_001172771.1,NM_001172772.1,NM_152456.2	64,64,64	0,2,6496	TT,TC,CC		0.0116,0.0227,0.0154	benign,benign,benign	207/242,208/243,208/243	70693984	2,12994	2198	4300	6498	SO:0001583	missense	146433	exon7			AGTATGCGGCCAC	BC029804	CCDS10895.1	16q22.1	2008-08-01	2008-06-04	2008-06-04	ENSG00000157368	ENSG00000157368		"""Interleukins and interleukin receptors"""	28529	protein-coding gene	gene with protein product		612081	"""chromosome 16 open reading frame 77"""	C16orf77		18467591	Standard	NM_152456		Approved	MGC34647, IL-34	uc002ezh.2	Q6ZMJ4	OTTHUMG00000137581	ENST00000288098.2:c.623C>T	16.37:g.70693984C>T	ENSP00000288098:p.Ala208Val	Somatic	161	0	0		WXS	Illumina HiSeq	Phase_I	209	6	0.0287081	NM_152456	B2RC28|B2Z4A8|B2ZC70|Q8N6L2	Missense_Mutation	SNP	ENST00000288098.2	37	CCDS10895.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	1.250	-0.618797	0.03663	2.27E-4	1.16E-4	ENSG00000157368	ENST00000429149;ENST00000288098	T;T	0.34667	1.35;1.35	4.69	-3.08	0.05347	.	2.218580	0.03059	N	0.155676	T	0.10294	0.0252	N	0.01352	-0.895	0.09310	N	1	B;B	0.17465	0.022;0.022	B;B	0.08055	0.003;0.003	T	0.24261	-1.0165	10	0.05436	T	0.98	-0.0424	4.1458	0.10215	0.4149:0.3737:0.0:0.2114	.	207;208	Q6ZMJ4-2;Q6ZMJ4	.;IL34_HUMAN	V	208	ENSP00000397863:A208V;ENSP00000288098:A208V	ENSP00000288098:A208V	A	+	2	0	IL34	69251485	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.807000	0.01734	-0.832000	0.04251	-1.552000	0.00895	GCG	C|1.000;T|0.000	0.000	strong		0.647	IL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268971.3	NM_152456	
POTEF	728378	hgsc.bcm.edu	37	2	130872871	130872871	+	Silent	SNP	C	C	T	rs199770435		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr2:130872871C>T	ENST00000409914.2	-	4	951	c.552G>A	c.(550-552)ggG>ggA	p.G184G	POTEF_ENST00000361163.4_Silent_p.G184G|POTEF_ENST00000357462.5_Silent_p.G184G|POTEF_ENST00000360967.5_Silent_p.G184G	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	184					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.G184G(2)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CTTCTGAATTCCCATTGGCAG	0.423																																					p.G184G		Atlas-SNP	.											POTEF,NS,carcinoma,0,5	POTEF	140	5	2	Substitution - coding silent(2)	prostate(2)	c.G552A						scavenged	.						45.0	53.0	50.0					2																	130872871		2105	4041	6146	SO:0001819	synonymous_variant	728378	exon4			TGAATTCCCATTG	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.552G>A	2.37:g.130872871C>T		Somatic	712	16	0.0224719		WXS	Illumina HiSeq	Phase_I	597	14	0.0234506	NM_001099771	A6NC34	Silent	SNP	ENST00000409914.2	37	CCDS46409.1																																																																																			C|0.998;T|0.002	0.002	weak		0.423	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771	
SIRPA	140885	hgsc.bcm.edu	37	20	1895965	1895965	+	Missense_Mutation	SNP	C	C	A	rs17855614|rs373583167|rs386811662	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr20:1895965C>A	ENST00000358771.4	+	2	452	c.300C>A	c.(298-300)aaC>aaA	p.N100K	SIRPA_ENST00000356025.3_Missense_Mutation_p.N100K|SIRPA_ENST00000400068.3_Missense_Mutation_p.N100K	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	100	Ig-like V-type.		N -> E (requires 2 nucleotide substitutions). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9062191, ECO:0000269|PubMed:9070220}.		blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CAAAGAGAAACAACATGGACT	0.517													C|||	480	0.0958466	0.0386	0.1095	5008	,	,		14804	0.1835		0.0537	False		,,,				2504	0.1166				p.N100K	GBM(155;1668 1920 5945 42733 48121)	Atlas-SNP	.											SIRPA,brain,glioma,0,4	SIRPA	83	4	0			c.C300A						scavenged	.																																			SO:0001583	missense	140885	exon3			GAGAAACAACATG	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.300C>A	20.37:g.1895965C>A	ENSP00000351621:p.Asn100Lys	Somatic	138	10	0.0724638		WXS	Illumina HiSeq	Phase_I	131	11	0.0839695	NM_001040022	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	ENST00000358771.4	37	CCDS13022.1	.	.	.	.	.	.	.	.	.	.	C	11.08	1.533326	0.27387	.	.	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.02158	4.42;4.42;4.42	5.11	0.771	0.18504	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.743450	0.02696	N	0.111247	T	0.04634	0.0126	M	0.65975	2.015	0.09310	N	1	B;B;B	0.33299	0.003;0.407;0.039	B;B;B	0.31812	0.056;0.136;0.082	T	0.44345	-0.9334	10	0.72032	D	0.01	.	8.1767	0.31285	0.0:0.4423:0.4696:0.0881	rs17855614	80;100;100	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	K	100	ENSP00000382941:N100K;ENSP00000348307:N100K;ENSP00000351621:N100K	ENSP00000348307:N100K	N	+	3	2	SIRPA	1843965	0.000000	0.05858	0.002000	0.10522	0.013000	0.08279	-0.328000	0.07945	0.028000	0.15324	-0.315000	0.08773	AAC	.	.	weak		0.517	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792	
ARHGAP21	57584	hgsc.bcm.edu	37	10	24880821	24880821	+	Nonsense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr10:24880821G>A	ENST00000396432.2	-	22	4483	c.3997C>T	c.(3997-3999)Cag>Tag	p.Q1333*	ARHGAP21_ENST00000320481.6_Nonsense_Mutation_p.Q1120*	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1332	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						CTTACGTGCTGGATGAGCGTT	0.458																																					p.Q1333X		Atlas-SNP	.											.	ARHGAP21	185	.	0			c.C3997T						PASS	.						235.0	192.0	207.0					10																	24880821		2203	4300	6503	SO:0001587	stop_gained	57584	exon22			CGTGCTGGATGAG	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.3997C>T	10.37:g.24880821G>A	ENSP00000379709:p.Gln1333*	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	72	9	0.125	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Nonsense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.326684|10.326684	0.99383|0.99383	.|.	.|.	ENSG00000107863|ENSG00000107863	ENST00000418033|ENST00000396432;ENST00000447364;ENST00000320481	.|.	.|.	.|.	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.76586|.	0.4008|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.76727|.	-0.2853|.	3|.	.|0.49607	.|T	.|0.09	.|.	19.294|19.294	0.94115|0.94115	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|X	146|1333;782;1120	.|.	.|ENSP00000365604:Q1120X	P|Q	-|-	2|1	0|0	ARHGAP21|ARHGAP21	24920827|24920827	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.913000|0.913000	0.54294|0.54294	9.805000|9.805000	0.99149|0.99149	2.642000|2.642000	0.89623|0.89623	0.563000|0.563000	0.77884|0.77884	CCA|CAG	.	.	none		0.458	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
HIST1H1E	3008	hgsc.bcm.edu	37	6	26156929	26156929	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:26156929C>G	ENST00000304218.3	+	1	371	c.311C>G	c.(310-312)tCc>tGc	p.S104C	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	104	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						GCGTCGGGTTCCTTCAAACTC	0.602																																					p.S104C		Atlas-SNP	.											.	HIST1H1E	69	.	0			c.C311G						PASS	.						39.0	45.0	43.0					6																	26156929		2203	4300	6503	SO:0001583	missense	3008	exon1			CGGGTTCCTTCAA	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.311C>G	6.37:g.26156929C>G	ENSP00000307705:p.Ser104Cys	Somatic	157	0	0		WXS	Illumina HiSeq	Phase_I	127	43	0.338583	NM_005321	Q4VB25	Missense_Mutation	SNP	ENST00000304218.3	37	CCDS4586.1	.	.	.	.	.	.	.	.	.	.	.	19.18	3.777704	0.70107	.	.	ENSG00000168298	ENST00000304218	T	0.10960	2.82	5.35	5.35	0.76521	Histone H1/H5 (2);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.40522	0.1120	H	0.95850	3.73	0.80722	D	1	D	0.56287	0.975	D	0.64410	0.925	T	0.58725	-0.7586	10	0.87932	D	0	-5.7108	18.4042	0.90528	0.0:1.0:0.0:0.0	.	104	P10412	H14_HUMAN	C	104	ENSP00000307705:S104C	ENSP00000307705:S104C	S	+	2	0	HIST1H1E	26264908	1.000000	0.71417	0.711000	0.30485	0.551000	0.35334	7.751000	0.85126	2.658000	0.90341	0.561000	0.74099	TCC	.	.	none		0.602	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
DSPP	1834	hgsc.bcm.edu	37	4	88536451	88536451	+	Silent	SNP	C	C	T	rs111205176|rs149201255		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:88536451C>T	ENST00000282478.7	+	4	2670	c.2637C>T	c.(2635-2637)agC>agT	p.S879S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S879S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	879	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcagtgacagcagtgatagca	0.493																																					p.S879S		Atlas-SNP	.											DSPP,colon,carcinoma,0,1	DSPP	174	1	0			c.C2637T						PASS	.						71.0	84.0	80.0					4																	88536451		1629	2928	4557	SO:0001819	synonymous_variant	1834	exon5			TGACAGCAGTGAT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2637C>T	4.37:g.88536451C>T		Somatic	254	0	0		WXS	Illumina HiSeq	Phase_I	237	26	0.109705	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.	.	weak		0.493	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
CD79B	974	hgsc.bcm.edu	37	17	62006833	62006833	+	Silent	SNP	A	A	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:62006833A>G	ENST00000006750.3	-	5	644	c.552T>C	c.(550-552)gaT>gaC	p.D184D	CD79B_ENST00000392795.3_Silent_p.D185D|CD79B_ENST00000349817.2_Silent_p.D80D	NM_000626.2|NM_021602.2	NP_000617.1|NP_067613.1	P40259	CD79B_HUMAN	CD79b molecule, immunoglobulin-associated beta	184					B cell receptor signaling pathway (GO:0050853)|immune response (GO:0006955)|signal transduction (GO:0007165)	B cell receptor complex (GO:0019815)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	15						CCTTGCTGTCATCCTGGGGGC	0.647			"""Mis, O"""		DLBCL																																p.D185D		Atlas-SNP	.		Dom	yes		17	17q23	974	"""CD79b molecule, immunoglobulin-associated beta"""		L	.	CD79B	38	.	0			c.T555C						PASS	.						77.0	59.0	65.0					17																	62006833		2203	4300	6503	SO:0001819	synonymous_variant	974	exon5			GCTGTCATCCTGG	L27587	CCDS11655.1, CCDS11656.1, CCDS42372.1	17q23	2014-09-17	2006-03-28			ENSG00000007312		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1699	protein-coding gene	gene with protein product		147245	"""CD79B antigen (immunoglobulin-associated beta)"""	IGB		9545642	Standard	XM_005257858		Approved	B29	uc002jdp.1	P40259		ENST00000006750.3:c.552T>C	17.37:g.62006833A>G		Somatic	80	0	0		WXS	Illumina HiSeq	Phase_I	69	27	0.391304	NM_001039933	Q53FS2|Q9BU06	Silent	SNP	ENST00000006750.3	37	CCDS11655.1																																																																																			.	.	none		0.647	CD79B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417711.1		
GGA2	23062	hgsc.bcm.edu	37	16	23498055	23498055	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr16:23498055C>T	ENST00000309859.4	-	7	718	c.636G>A	c.(634-636)cgG>cgA	p.R212R	GGA2_ENST00000567468.1_Intron	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	212	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		TCTTGATTAACCGGTTTGCAG	0.493																																					p.R212R		Atlas-SNP	.											.	GGA2	49	.	0			c.G636A						PASS	.						288.0	275.0	279.0					16																	23498055		2197	4300	6497	SO:0001819	synonymous_variant	23062	exon7			GATTAACCGGTTT	AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.636G>A	16.37:g.23498055C>T		Somatic	104	0	0		WXS	Illumina HiSeq	Phase_I	102	25	0.245098	NM_015044	D3DWF0|O14564|Q9NYN2|Q9UPS2	Silent	SNP	ENST00000309859.4	37	CCDS10611.1																																																																																			.	.	none		0.493	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1		
SLITRK1	114798	hgsc.bcm.edu	37	13	84454325	84454325	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr13:84454325G>A	ENST00000377084.2	-	1	2203	c.1318C>T	c.(1318-1320)Cgg>Tgg	p.R440W		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	440					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.R440R(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		AATTTCTCCCGGGACAGCGTG	0.502																																					p.R440W		Atlas-SNP	.											SLITRK1,NS,carcinoma,0,1	SLITRK1	196	1	1	Substitution - coding silent(1)	lung(1)	c.C1318T						scavenged	.						122.0	115.0	118.0					13																	84454325		2203	4300	6503	SO:0001583	missense	114798	exon1			TCTCCCGGGACAG	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1318C>T	13.37:g.84454325G>A	ENSP00000366288:p.Arg440Trp	Somatic	107	1	0.00934579		WXS	Illumina HiSeq	Phase_I	84	32	0.380952	NM_052910	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.493804	0.44352	.	.	ENSG00000178235	ENST00000377084	T	0.57436	0.4	5.22	5.22	0.72569	.	0.138450	0.49305	D	0.000152	T	0.61502	0.2352	L	0.45581	1.43	0.51482	D	0.99992	D	0.57899	0.981	P	0.54629	0.757	T	0.64875	-0.6304	10	0.87932	D	0	-11.4904	17.693	0.88273	0.0:0.0:1.0:0.0	.	440	Q96PX8	SLIK1_HUMAN	W	440	ENSP00000366288:R440W	ENSP00000366288:R440W	R	-	1	2	SLITRK1	83352326	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.086000	0.64474	2.603000	0.88011	0.655000	0.94253	CGG	.	.	none		0.502	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
SPDEF	25803	hgsc.bcm.edu	37	6	34511927	34511927	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:34511927C>T	ENST00000374037.3	-	2	720	c.306G>A	c.(304-306)gcG>gcA	p.A102A	SPDEF_ENST00000544425.1_Silent_p.A102A	NM_012391.2	NP_036523.1	O95238	SPDEF_HUMAN	SAM pointed domain containing ETS transcription factor	102					cell differentiation (GO:0030154)|intestinal epithelial cell development (GO:0060576)|lung goblet cell differentiation (GO:0060480)|multicellular organismal development (GO:0007275)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell fate commitment (GO:0010455)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)	15						CCAGGCTGCCCGCTGGGGCTT	0.672																																					p.A102A		Atlas-SNP	.											SPDEF,colon,carcinoma,0,1	SPDEF	34	1	0			c.G306A						PASS	.						36.0	37.0	37.0					6																	34511927		2203	4300	6503	SO:0001819	synonymous_variant	25803	exon2			GCTGCCCGCTGGG	AF071538	CCDS4794.1, CCDS59013.1	6p21.3	2013-08-07	2013-08-07		ENSG00000124664	ENSG00000124664			17257	protein-coding gene	gene with protein product		608144	"""SAM pointed domain containing ets transcription factor"""			10625666, 6857767	Standard	NM_012391		Approved	PDEF, bA375E1.3	uc003ojq.2	O95238	OTTHUMG00000014548	ENST00000374037.3:c.306G>A	6.37:g.34511927C>T		Somatic	76	0	0		WXS	Illumina HiSeq	Phase_I	43	9	0.209302	NM_001252294	B4DWH8|F5H778	Silent	SNP	ENST00000374037.3	37	CCDS4794.1																																																																																			.	.	none		0.672	SPDEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040246.1	NM_012391	
MUC6	4588	hgsc.bcm.edu	37	11	1016849	1016849	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:1016849C>G	ENST00000421673.2	-	31	6002	c.5952G>C	c.(5950-5952)atG>atC	p.M1984I		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1984	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.M1984I(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ATGTTGCAGTCATAGGACCTG	0.582																																					p.M1984I		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,0,2	MUC6	408	2	2	Substitution - Missense(2)	lung(2)	c.G5952C						scavenged	.						1544.0	1533.0	1537.0					11																	1016849		2203	4298	6501	SO:0001583	missense	4588	exon31			TGCAGTCATAGGA	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5952G>C	11.37:g.1016849C>G	ENSP00000406861:p.Met1984Ile	Somatic	785	14	0.0178344		WXS	Illumina HiSeq	Phase_I	766	34	0.0443864	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	c	0.326	-0.959077	0.02267	.	.	ENSG00000184956	ENST00000421673	T	0.17691	2.26	2.64	-5.29	0.02747	.	.	.	.	.	T	0.09598	0.0236	L	0.43152	1.355	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.27839	-1.0062	9	0.14656	T	0.56	.	1.5757	0.02624	0.1743:0.1847:0.3717:0.2692	.	1984	Q6W4X9	MUC6_HUMAN	I	1984	ENSP00000406861:M1984I	ENSP00000406861:M1984I	M	-	3	0	MUC6	1006849	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.496000	0.02291	-4.003000	0.00082	-2.547000	0.00178	ATG	.	.	none		0.582	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
PPFIA2	8499	hgsc.bcm.edu	37	12	81688639	81688639	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:81688639G>T	ENST00000549396.1	-	24	3060	c.2900C>A	c.(2899-2901)cCt>cAt	p.P967H	PPFIA2_ENST00000549325.1_Missense_Mutation_p.P952H|PPFIA2_ENST00000541017.1_Missense_Mutation_p.P184H|RP11-121G22.3_ENST00000549161.1_lincRNA|PPFIA2_ENST00000407050.4_Missense_Mutation_p.P893H|PPFIA2_ENST00000552948.1_Missense_Mutation_p.P967H|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000541570.2_Missense_Mutation_p.P534H|PPFIA2_ENST00000443686.3_Missense_Mutation_p.P868H|PPFIA2_ENST00000548586.1_Missense_Mutation_p.P967H|PPFIA2_ENST00000550584.2_Missense_Mutation_p.P967H|PPFIA2_ENST00000550359.2_Missense_Mutation_p.P814H|PPFIA2_ENST00000333447.7_Missense_Mutation_p.P952H	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	967					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)		p.P967H(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						AGGAGCTGAAGGACTTGTTAG	0.453																																					p.P967H		Atlas-SNP	.											PPFIA2,colon,carcinoma,0,1	PPFIA2	207	1	1	Substitution - Missense(1)	large_intestine(1)	c.C2900A						scavenged	.						118.0	116.0	116.0					12																	81688639		2012	4178	6190	SO:0001583	missense	8499	exon23			GCTGAAGGACTTG	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.2900C>A	12.37:g.81688639G>T	ENSP00000450337:p.Pro967His	Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	150	3	0.02	NM_001220476	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	CCDS55857.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.8|25.8	4.670971|4.670971	0.88348|0.88348	.|.	.|.	ENSG00000139220|ENSG00000139220	ENST00000550018|ENST00000549396;ENST00000549325;ENST00000541570;ENST00000541017;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	.|T;T;T;T;T;T;T;T;T	.|0.17854	.|2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25	5.62|5.62	5.62|5.62	0.85841|0.85841	.|Sterile alpha motif/pointed domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.46678|0.46678	0.1405|0.1405	M|M	0.78637|0.78637	2.42|2.42	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.77004	.|0.989	T|T	0.45041|0.45041	-0.9288|-0.9288	5|10	.|0.87932	.|D	.|0	-15.976|-15.976	19.6517|19.6517	0.95819|0.95819	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|967	.|O75334	.|LIPA2_HUMAN	I|H	101|967;952;534;184;893;978;952;967;868;967	.|ENSP00000450337:P967H;ENSP00000450298:P952H;ENSP00000438337:P534H;ENSP00000445532:P184H;ENSP00000385093:P893H;ENSP00000327416:P952H;ENSP00000449338:P967H;ENSP00000388373:P868H;ENSP00000447868:P967H	.|ENSP00000327416:P952H	L|P	-|-	1|2	0|0	PPFIA2|PPFIA2	80212770|80212770	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	9.869000|9.869000	0.99810|0.99810	2.662000|2.662000	0.90505|0.90505	0.655000|0.655000	0.94253|0.94253	CTT|CCT	.	.	none		0.453	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
NFKB2	4791	hgsc.bcm.edu	37	10	104160708	104160708	+	Missense_Mutation	SNP	G	G	A	rs574309302		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr10:104160708G>A	ENST00000369966.3	+	18	2223	c.1973G>A	c.(1972-1974)cGg>cAg	p.R658Q	NFKB2_ENST00000428099.1_Missense_Mutation_p.R658Q|NFKB2_ENST00000189444.6_Missense_Mutation_p.R658Q	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	658			Missing (in truncated form EB308).		extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCCCAGCTCCGGGCCAACGTG	0.667			T	IGH@	B-NHL								g|||	1	0.000199681	0.0008	0.0	5008	,	,		16003	0.0		0.0	False		,,,				2504	0.0				p.R658Q		Atlas-SNP	.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	NFKB2,NS,carcinoma,+1,1	NFKB2	48	1	0			c.G1973A						scavenged	.						28.0	35.0	33.0					10																	104160708		2129	4229	6358	SO:0001583	missense	4791	exon18			AGCTCCGGGCCAA	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1973G>A	10.37:g.104160708G>A	ENSP00000358983:p.Arg658Gln	Somatic	97	2	0.0206186		WXS	Illumina HiSeq	Phase_I	90	27	0.3	NM_001077494	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Missense_Mutation	SNP	ENST00000369966.3	37	CCDS41564.1	.	.	.	.	.	.	.	.	.	.	g	11.98	1.801863	0.31869	.	.	ENSG00000077150	ENST00000428099;ENST00000369966;ENST00000336486;ENST00000189444	T;T;T	0.63913	-0.07;-0.07;-0.07	4.52	-0.74	0.11115	Ankyrin repeat-containing domain (4);	0.547844	0.19667	N	0.108844	T	0.34250	0.0891	N	0.08118	0	0.20489	N	0.999895	B;B	0.28820	0.224;0.224	B;B	0.21546	0.035;0.035	T	0.15954	-1.0419	10	0.35671	T	0.21	.	8.7763	0.34765	0.6305:0.0:0.3695:0.0	.	658;658	Q00653;A8K9D9	NFKB2_HUMAN;.	Q	658	ENSP00000410256:R658Q;ENSP00000358983:R658Q;ENSP00000189444:R658Q	ENSP00000189444:R658Q	R	+	2	0	NFKB2	104150698	0.989000	0.36119	0.926000	0.36857	0.560000	0.35617	1.729000	0.38115	-0.235000	0.09767	-0.330000	0.08379	CGG	.	.	none		0.667	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
HTR2A	3356	hgsc.bcm.edu	37	13	47409325	47409325	+	Nonsense_Mutation	SNP	C	C	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr13:47409325C>A	ENST00000378688.4	-	3	1194	c.1063G>T	c.(1063-1065)Gag>Tag	p.E355*	HTR2A_ENST00000543956.1_Nonsense_Mutation_p.E271*|HTR2A_ENST00000542664.1_Nonsense_Mutation_p.E355*			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	355					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ATGACATCCTCATTGCAGGAC	0.478																																					p.E355X		Atlas-SNP	.											.	HTR2A	98	.	0			c.G1063T						PASS	.						128.0	114.0	118.0					13																	47409325		2203	4300	6503	SO:0001587	stop_gained	3356	exon4			CATCCTCATTGCA	X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.1063G>T	13.37:g.47409325C>A	ENSP00000367959:p.Glu355*	Somatic	109	0	0		WXS	Illumina HiSeq	Phase_I	113	17	0.150442	NM_000621	B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Nonsense_Mutation	SNP	ENST00000378688.4	37	CCDS9405.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708347	0.89018	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	.	.	.	5.86	5.02	0.67125	.	0.164517	0.52532	D	0.000067	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	14.4486	0.67370	0.0:0.9297:0.0:0.0703	.	.	.	.	X	355;271;355	.	ENSP00000367959:E355X	E	-	1	0	HTR2A	46307326	0.002000	0.14202	0.220000	0.23810	0.682000	0.39822	0.639000	0.24690	1.630000	0.50440	0.650000	0.86243	GAG	.	.	none		0.478	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	NM_000621	
ITIH1	3697	hgsc.bcm.edu	37	3	52817273	52817273	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:52817273G>T	ENST00000273283.2	+	10	1167	c.1143G>T	c.(1141-1143)ttG>ttT	p.L381F	ITIH1_ENST00000540715.1_Missense_Mutation_p.L239F|ITIH1_ENST00000542827.1_Missense_Mutation_p.L381F|ITIH1_ENST00000537050.1_Missense_Mutation_p.L93F	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	381	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		TTGAGATCTTGAACCAAGTTC	0.517																																					p.L381F		Atlas-SNP	.											.	ITIH1	108	.	0			c.G1143T						PASS	.						95.0	81.0	86.0					3																	52817273		2203	4300	6503	SO:0001583	missense	3697	exon10			GATCTTGAACCAA		CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.1143G>T	3.37:g.52817273G>T	ENSP00000273283:p.Leu381Phe	Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	113	50	0.442478	NM_002215	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	37	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.003520	0.74932	.	.	ENSG00000055957	ENST00000542827;ENST00000273283;ENST00000540715;ENST00000537050	D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11	5.8	4.92	0.64577	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.91216	0.7232	M	0.63169	1.94	0.40406	D	0.979707	D	0.89917	1.0	D	0.87578	0.998	D	0.91687	0.5363	10	0.87932	D	0	-18.3723	9.4229	0.38561	0.0769:0.1441:0.779:0.0	.	381	P19827	ITIH1_HUMAN	F	381;381;239;93	ENSP00000442584:L381F;ENSP00000273283:L381F;ENSP00000443973:L239F;ENSP00000443847:L93F	ENSP00000273283:L381F	L	+	3	2	ITIH1	52792313	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	3.777000	0.55364	1.456000	0.47831	0.650000	0.86243	TTG	.	.	none		0.517	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
NR0B1	190	hgsc.bcm.edu	37	X	30326889	30326889	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chrX:30326889G>A	ENST00000378970.4	-	1	826	c.592C>T	c.(592-594)Cgc>Tgc	p.R198C	NR0B1_ENST00000378963.1_5'Flank|NR0B1_ENST00000453287.1_Missense_Mutation_p.R198C	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	198	4 X 67 AA tandem repeats.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	AAGCAGCAGCGGTACAGAAGC	0.701											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R198C		Atlas-SNP	.											.	NR0B1	61	.	0			c.C592T						PASS	.						10.0	8.0	8.0					X																	30326889		2170	4233	6403	SO:0001583	missense	190	exon1			AGCAGCGGTACAG	S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.592C>T	X.37:g.30326889G>A	ENSP00000368253:p.Arg198Cys	Somatic	86	0	0	816	WXS	Illumina HiSeq	Phase_I	128	99	0.773438	NM_000475	Q96F69	Missense_Mutation	SNP	ENST00000378970.4	37	CCDS14223.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.636797	0.29068	.	.	ENSG00000169297	ENST00000378970;ENST00000453287	D;D	0.98207	-3.84;-4.79	3.84	1.96	0.26148	.	0.363841	0.22773	N	0.055806	D	0.98419	0.9474	M	0.71581	2.175	0.19775	N	0.999955	D	0.89917	1.0	D	0.73708	0.981	D	0.95009	0.8150	10	0.87932	D	0	-22.9197	11.7993	0.52118	0.0:0.3317:0.6683:0.0	.	198	P51843	NR0B1_HUMAN	C	198	ENSP00000368253:R198C;ENSP00000396403:R198C	ENSP00000368253:R198C	R	-	1	0	NR0B1	30236810	.	.	0.104000	0.21259	0.483000	0.33249	.	.	0.381000	0.24851	0.466000	0.42574	CGC	.	.	none		0.701	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056161.1	NM_000475	
CASP1	834	hgsc.bcm.edu	37	11	104899975	104899975	+	Nonsense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:104899975C>T	ENST00000533400.1	-	7	917	c.882G>A	c.(880-882)tgG>tgA	p.W294*	CASP1_ENST00000436863.3_Nonsense_Mutation_p.W294*|CASP1_ENST00000593315.1_Nonsense_Mutation_p.W273*|CASP1_ENST00000598974.1_Nonsense_Mutation_p.W294*|CASP1_ENST00000353247.5_Intron|CASP1_ENST00000594519.1_Intron|CASP1_ENST00000415981.2_Intron|CASP1_ENST00000393136.4_Nonsense_Mutation_p.W273*|CASP1_ENST00000534497.1_Intron|CASP1_ENST00000531166.1_Intron|CASP1_ENST00000446369.1_Intron|CASP1_ENST00000527979.1_Nonsense_Mutation_p.W257*|CASP1_ENST00000526568.1_Nonsense_Mutation_p.W201*|CASP1_ENST00000528974.1_Nonsense_Mutation_p.W255*|CASP1_ENST00000525825.1_Nonsense_Mutation_p.W273*	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	294					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	AATCTTTAAACCACACCACAC	0.393																																					p.W294X	NSCLC(41;1246 1743 4934)	Atlas-SNP	.											.	CASP1	53	.	0			c.G882A						PASS	.						65.0	59.0	61.0					11																	104899975		2202	4299	6501	SO:0001587	stop_gained	834	exon7			TTTAAACCACACC	U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.882G>A	11.37:g.104899975C>T	ENSP00000433138:p.Trp294*	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	89	15	0.168539	NM_001257118	B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Nonsense_Mutation	SNP	ENST00000533400.1	37	CCDS8330.1	.	.	.	.	.	.	.	.	.	.	.	24.2	4.503509	0.85176	.	.	ENSG00000137752	ENST00000532439;ENST00000526568;ENST00000527979;ENST00000533400;ENST00000436863;ENST00000393136;ENST00000525825;ENST00000528974	.	.	.	4.25	4.25	0.50352	.	0.813732	0.11570	N	0.550882	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	12.3575	0.55184	0.0:1.0:0.0:0.0	.	.	.	.	X	143;201;257;294;294;273;273;255	.	ENSP00000376844:W273X	W	-	3	0	CASP1	104405185	0.002000	0.14202	0.067000	0.19924	0.030000	0.12068	0.280000	0.18790	2.370000	0.80446	0.557000	0.71058	TGG	.	.	none		0.393	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388116.1	NM_033292	
DSPP	1834	hgsc.bcm.edu	37	4	88536448	88536448	+	Silent	SNP	C	C	T	rs111205175		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:88536448C>T	ENST00000282478.7	+	4	2667	c.2634C>T	c.(2632-2634)gaC>gaT	p.D878D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D878D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	878	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtgacagcagtgata	0.498																																					p.D878D		Atlas-SNP	.											.	DSPP	174	.	0			c.C2634T						PASS	.						70.0	84.0	79.0					4																	88536448		1633	2930	4563	SO:0001819	synonymous_variant	1834	exon5			CAGTGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2634C>T	4.37:g.88536448C>T		Somatic	259	0	0		WXS	Illumina HiSeq	Phase_I	240	20	0.0833333	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.	.	weak		0.498	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FARP1	10160	hgsc.bcm.edu	37	13	99091388	99091388	+	Missense_Mutation	SNP	C	C	T	rs142251812		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr13:99091388C>T	ENST00000319562.6	+	21	2636	c.2371C>T	c.(2371-2373)Cgg>Tgg	p.R791W	FARP1_ENST00000376586.2_Missense_Mutation_p.R822W|FARP1_ENST00000595437.1_Missense_Mutation_p.R822W	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	791	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R791W(1)		breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			ATACACGAGCCGGGGGCTGAC	0.592																																					p.R791W		Atlas-SNP	.											FARP1,scalp,carcinoma,0,1	FARP1	207	1	1	Substitution - Missense(1)	skin(1)	c.C2371T						PASS	.	C	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	163.0	158.0	160.0		2371	-3.3	0.9	13	dbSNP_134	160	0,8600		0,0,4300	no	missense	FARP1	NM_005766.2	101	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	791/1046	99091388	2,13004	2203	4300	6503	SO:0001583	missense	10160	exon21			ACGAGCCGGGGGC	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.2371C>T	13.37:g.99091388C>T	ENSP00000322926:p.Arg791Trp	Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	89	32	0.359551	NM_005766	Q5JVI9|Q6IQ29	Missense_Mutation	SNP	ENST00000319562.6	37	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703907	0.48412	4.54E-4	0.0	ENSG00000152767	ENST00000376586;ENST00000319562	T;T	0.75821	-0.97;-0.97	5.57	-3.34	0.04943	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.067341	0.64402	D	0.000018	D	0.84933	0.5582	M	0.80746	2.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	D	0.86106	0.1559	10	0.87932	D	0	.	18.5771	0.91159	0.7275:0.2725:0.0:0.0	.	791;822	Q9Y4F1;C9JME2	FARP1_HUMAN;.	W	822;791	ENSP00000365771:R822W;ENSP00000322926:R791W	ENSP00000322926:R791W	R	+	1	2	FARP1	97889389	1.000000	0.71417	0.857000	0.33713	0.044000	0.14063	1.152000	0.31663	-0.545000	0.06224	-0.262000	0.10625	CGG	C|1.000;T|0.000	0.000	weak		0.592	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
C9orf41	138199	hgsc.bcm.edu	37	9	77614780	77614780	+	Silent	SNP	A	A	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr9:77614780A>G	ENST00000376834.3	-	4	749	c.597T>C	c.(595-597)ccT>ccC	p.P199P	C9orf41_ENST00000376837.3_Intron	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	199										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						TTACTTTAGAAGGATCCCTGA	0.368																																					p.P199P		Atlas-SNP	.											.	C9orf41	57	.	0			c.T597C						PASS	.						83.0	83.0	83.0					9																	77614780		2203	4300	6503	SO:0001819	synonymous_variant	138199	exon4			TTTAGAAGGATCC	AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.597T>C	9.37:g.77614780A>G		Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	108	32	0.296296	NM_152420	Q7Z383|Q8N7C5	Silent	SNP	ENST00000376834.3	37	CCDS6649.1																																																																																			.	.	none		0.368	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052703.1	NM_152420	
SDHA	6389	hgsc.bcm.edu	37	5	228322	228322	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:228322A>G	ENST00000264932.6	+	6	759	c.644A>G	c.(643-645)tAt>tGt	p.Y215C	SDHA_ENST00000510361.1_Missense_Mutation_p.Y167C|SDHA_ENST00000504309.1_Missense_Mutation_p.Y215C	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	215					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GATACCAGCTATTTTGTGGAG	0.438									Familial Paragangliomas																												p.Y215C		Atlas-SNP	.											.	SDHA	80	.	0			c.A644G						PASS	.						69.0	70.0	70.0					5																	228322		2203	4300	6503	SO:0001583	missense	6389	exon6	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	CCAGCTATTTTGT	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.644A>G	5.37:g.228322A>G	ENSP00000264932:p.Tyr215Cys	Somatic	57	0	0		WXS	Illumina HiSeq	Phase_I	56	4	0.0714286	NM_004168	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.	.	.	.	.	.	.	.	.	.	g	20.8	4.054712	0.75960	.	.	ENSG00000073578	ENST00000264932;ENST00000504309;ENST00000510361	T;T;T	0.70045	-0.45;-0.45;-0.45	5.23	5.23	0.72850	Fumarate reductase/succinate dehydrogenase flavoprotein, N-terminal (1);	0.000000	0.64402	U	0.000001	T	0.68229	0.2978	L	0.61218	1.895	0.80722	D	1	P;P;P;P;P	0.49559	0.496;0.767;0.925;0.525;0.525	B;P;P;B;B	0.46076	0.429;0.452;0.503;0.32;0.32	T	0.73668	-0.3910	10	0.87932	D	0	.	13.4155	0.60966	1.0:0.0:0.0:0.0	.	167;215;215;215;221	E9PBJ5;B4DYN5;D6RFM5;P31040;Q59GW8	.;.;.;DHSA_HUMAN;.	C	215;215;167	ENSP00000264932:Y215C;ENSP00000426514:Y215C;ENSP00000427703:Y167C	ENSP00000264932:Y215C	Y	+	2	0	SDHA	281322	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.156000	0.77453	2.127000	0.65507	0.524000	0.50904	TAT	.	.	none		0.438	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
SPATA18	132671	hgsc.bcm.edu	37	4	52926593	52926593	+	Silent	SNP	G	G	T	rs141339947	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:52926593G>T	ENST00000295213.4	+	2	470	c.96G>T	c.(94-96)acG>acT	p.T32T	SPATA18_ENST00000506829.1_Intron|SPATA18_ENST00000419395.2_Silent_p.T32T	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	32					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			AGACAAACACGTGTGATCAAA	0.507																																					p.T32T		Atlas-SNP	.											SPATA18_ENST00000295213,NS,carcinoma,+1,2	SPATA18	222	2	0			c.G96T						scavenged	.						97.0	88.0	91.0					4																	52926593		2203	4300	6503	SO:0001819	synonymous_variant	132671	exon2			AAACACGTGTGAT	BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.96G>T	4.37:g.52926593G>T		Somatic	249	0	0		WXS	Illumina HiSeq	Phase_I	224	3	0.0133929	NM_145263	B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Silent	SNP	ENST00000295213.4	37	CCDS3489.1																																																																																			G|0.999;A|0.001	.	alt		0.507	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250597.2	NM_145263	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230359	23230359	+	Missense_Mutation	SNP	G	G	A	rs536568891	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr22:23230359G>A	ENST00000526893.1	+	1	400	c.126G>A	c.(124-126)atG>atA	p.M42I	hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Missense_Mutation_p.M42I|IGLL5_ENST00000532223.2_Missense_Mutation_p.M42I	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	42						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						TGCGCCCAATGGTTGCACCGC	0.672													G|||	2	0.000399361	0.0008	0.0	5008	,	,		11398	0.001		0.0	False		,,,				2504	0.0				p.W7X		Atlas-SNP	.											.	IGLL5	26	.	0			c.G20A						PASS	.																																			SO:0001583	missense	100423062	exon1			CCCAATGGTTGCA	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.126G>A	22.37:g.23230359G>A	ENSP00000431254:p.Met42Ile	Somatic	167	0	0		WXS	Illumina HiSeq	Phase_I	124	29	0.233871	NM_001256296		Nonsense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.503640	0.26949	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00558	6.61;6.61	3.81	-7.61	0.01299	.	.	.	.	.	T	0.00328	0.0010	N	0.14661	0.345	0.09310	N	1	B	0.14012	0.009	B	0.08055	0.003	T	0.43956	-0.9359	9	0.52906	T	0.07	.	6.9861	0.24729	0.6223:0.0:0.1512:0.2265	.	42	B9A064	IGLL5_HUMAN	I	42	ENSP00000436353:M42I;ENSP00000431254:M42I	ENSP00000431254:M42I	M	+	3	0	IGLL5	21560359	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.041000	0.00632	-2.254000	0.00697	0.643000	0.83706	ATG	.	.	none		0.672	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
LRCH1	23143	hgsc.bcm.edu	37	13	47224430	47224430	+	Silent	SNP	C	C	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr13:47224430C>A	ENST00000389798.3	+	2	599	c.402C>A	c.(400-402)gtC>gtA	p.V134V	LRCH1_ENST00000389797.3_Silent_p.V134V|LRCH1_ENST00000311191.6_Silent_p.V134V	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	134										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		GTATCAGAGTCATTCCTGAGG	0.338																																					p.V134V		Atlas-SNP	.											.	LRCH1	104	.	0			c.C402A						PASS	.						90.0	82.0	85.0					13																	47224430		2203	4300	6503	SO:0001819	synonymous_variant	23143	exon2			CAGAGTCATTCCT	AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.402C>A	13.37:g.47224430C>A		Somatic	92	0	0		WXS	Illumina HiSeq	Phase_I	98	18	0.183673	NM_015116	B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Silent	SNP	ENST00000389798.3	37	CCDS31972.1																																																																																			.	.	none		0.338	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044824.2	NM_015116	
GLI2	2736	hgsc.bcm.edu	37	2	121708912	121708912	+	Silent	SNP	C	C	T	rs140711756		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr2:121708912C>T	ENST00000452319.1	+	4	408	c.348C>T	c.(346-348)aaC>aaT	p.N116N	GLI2_ENST00000314490.11_5'UTR|GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000361492.4_Silent_p.N116N					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CCCCCTTCAACGCCCCCCACC	0.667																																					p.N116N		Atlas-SNP	.											GLI2,NS,adenocarcinoma,0,1	GLI2	187	1	0			c.C348T						PASS	.	C		6,4400	12.9+/-30.5	0,6,2197	61.0	66.0	64.0		348	-5.0	0.2	2	dbSNP_134	64	0,8600		0,0,4300	no	coding-synonymous	GLI2	NM_005270.4		0,6,6497	TT,TC,CC		0.0,0.1362,0.0461		116/1587	121708912	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	2736	exon3			CTTCAACGCCCCC		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.348C>T	2.37:g.121708912C>T		Somatic	159	0	0		WXS	Illumina HiSeq	Phase_I	111	21	0.189189	NM_005270		Silent	SNP	ENST00000452319.1	37	CCDS33283.1																																																																																			C|1.000;T|0.000	0.000	weak		0.667	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
NMUR1	10316	hgsc.bcm.edu	37	2	232393132	232393132	+	Silent	SNP	G	G	A	rs370312738		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr2:232393132G>A	ENST00000305141.4	-	2	733	c.600C>T	c.(598-600)caC>caT	p.H200H		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	200					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GCCGGATGCCGTGCAGGCTGG	0.672																																					p.H200H		Atlas-SNP	.											.	NMUR1	46	.	0			c.C600T						PASS	.	G		0,4404		0,0,2202	30.0	29.0	29.0		600	-2.6	0.8	2		29	1,8595		0,1,4297	no	coding-synonymous	NMUR1	NM_006056.4		0,1,6499	AA,AG,GG		0.0116,0.0,0.0077		200/427	232393132	1,12999	2202	4298	6500	SO:0001819	synonymous_variant	10316	exon2			GATGCCGTGCAGG	AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.600C>T	2.37:g.232393132G>A		Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	48	14	0.291667	NM_006056	O43664|Q7LDP6|Q8NE20	Silent	SNP	ENST00000305141.4	37	CCDS2486.1																																																																																			.	.	weak		0.672	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256961.1	NM_006056	
SYNE2	23224	hgsc.bcm.edu	37	14	64519861	64519861	+	Missense_Mutation	SNP	C	C	T	rs200742016	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr14:64519861C>T	ENST00000344113.4	+	48	9442	c.9230C>T	c.(9229-9231)cCg>cTg	p.P3077L	SYNE2_ENST00000358025.3_Missense_Mutation_p.P3077L|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.P3110L	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3077					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GATAGCTCTCCGGAAAGCAGA	0.338													C|||	4	0.000798722	0.0	0.0014	5008	,	,		18796	0.0		0.002	False		,,,				2504	0.001				p.P3077L		Atlas-SNP	.											SYNE2,NS,carcinoma,-1,1	SYNE2	577	1	0			c.C9230T						scavenged	.	C	LEU/PRO,LEU/PRO	4,3616		0,4,1806	46.0	45.0	45.0		9230,9230	4.8	0.5	14	dbSNP_134	45	16,8132		0,16,4058	yes	missense,missense	SYNE2	NM_015180.4,NM_182914.2	98,98	0,20,5864	TT,TC,CC		0.1964,0.1105,0.17	possibly-damaging,possibly-damaging	3077/6886,3077/6908	64519861	20,11748	1810	4074	5884	SO:0001583	missense	23224	exon48			GCTCTCCGGAAAG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.9230C>T	14.37:g.64519861C>T	ENSP00000341781:p.Pro3077Leu	Somatic	408	0	0		WXS	Illumina HiSeq	Phase_I	488	5	0.0102459	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	8.986	0.976576	0.18736	0.001105	0.001964	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.58210	0.74;0.74;0.35	5.69	4.8	0.61643	.	0.000000	0.56097	D	0.000025	T	0.49474	0.1559	L	0.29908	0.895	0.80722	D	1	D;D	0.65815	0.995;0.992	P;P	0.51582	0.674;0.661	T	0.39187	-0.9626	10	0.22109	T	0.4	.	14.4958	0.67685	0.1468:0.8532:0.0:0.0	.	3077;3077	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	L	3077;3077;3110;3110	ENSP00000350719:P3077L;ENSP00000341781:P3077L;ENSP00000452570:P3110L	ENSP00000261678:P3110L	P	+	2	0	SYNE2	63589614	0.728000	0.28080	0.505000	0.27651	0.011000	0.07611	3.490000	0.53245	1.397000	0.46682	0.462000	0.41574	CCG	C|0.999;T|0.001	0.001	strong		0.338	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
CTNNA3	29119	hgsc.bcm.edu	37	10	68940122	68940122	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr10:68940122C>T	ENST00000433211.2	-	7	1174	c.1000G>A	c.(1000-1002)Gcc>Acc	p.A334T	CTNNA3_ENST00000373744.4_Missense_Mutation_p.A334T|CTNNA3_ENST00000545309.1_Missense_Mutation_p.A334T	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3									p.A334T(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TGGCGAATGGCGTTGCATTCT	0.517																																					p.A334T		Atlas-SNP	.											CTNNA3_ENST00000433211,colon,carcinoma,0,2	CTNNA3	401	2	2	Substitution - Missense(2)	large_intestine(2)	c.G1000A						PASS	.						133.0	114.0	120.0					10																	68940122		2203	4300	6503	SO:0001583	missense	29119	exon7			GAATGGCGTTGCA	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1000G>A	10.37:g.68940122C>T	ENSP00000389714:p.Ala334Thr	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	78	11	0.141026	NM_013266		Missense_Mutation	SNP	ENST00000433211.2	37	CCDS7269.1	.	.	.	.	.	.	.	.	.	.	C	17.46	3.396049	0.62177	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000545309	T;T;T	0.38401	1.14;1.14;1.23	5.83	4.85	0.62838	.	0.000000	0.50627	D	0.000112	T	0.59128	0.2171	M	0.86573	2.825	0.36848	D	0.887738	D;D;D;P	0.56746	0.977;0.977;0.965;0.74	P;P;P;B	0.56343	0.604;0.604;0.796;0.157	T	0.71111	-0.4687	10	0.62326	D	0.03	-9.5472	14.885	0.70560	0.2138:0.7862:0.0:0.0	.	334;334;334;334	A8K141;F2Z2R0;Q9UI47-2;Q9UI47	.;.;.;CTNA3_HUMAN	T	334	ENSP00000389714:A334T;ENSP00000362849:A334T;ENSP00000441444:A334T	ENSP00000362849:A334T	A	-	1	0	CTNNA3	68610128	0.937000	0.31787	0.885000	0.34714	0.939000	0.58152	2.034000	0.41145	2.753000	0.94483	0.585000	0.79938	GCC	.	.	none		0.517	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230389	23230389	+	Silent	SNP	T	T	A	rs576960332		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr22:23230389T>A	ENST00000526893.1	+	1	430	c.156T>A	c.(154-156)ccT>ccA	p.P52P	hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Silent_p.P52P|IGLL5_ENST00000532223.2_Silent_p.P52P	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	52						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						ACCCAGACCCTGGAGCCTCAG	0.677																																					p.L17Q		Atlas-SNP	.											.	IGLL5	26	.	0			c.T50A						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			AGACCCTGGAGCC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.156T>A	22.37:g.23230389T>A		Somatic	163	0	0		WXS	Illumina HiSeq	Phase_I	115	22	0.191304	NM_001256296		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.677	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
HIST1H4K	8362	hgsc.bcm.edu	37	6	27799131	27799131	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:27799131G>A	ENST00000357549.2	-	1	174	c.175C>T	c.(175-177)Ctg>Ttg	p.L59L		NM_003541.2	NP_003532.1	P62805	H4_HUMAN	histone cluster 1, H4k	59					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|lung(3)|ovary(1)|prostate(1)	7						AACACCTTCAGCACCCCGCGA	0.637																																					p.L59L		Atlas-SNP	.											HIST1H4K,NS,carcinoma,+2,1	HIST1H4K	15	1	0			c.C175T						scavenged	.						10.0	12.0	11.0					6																	27799131		2147	4241	6388	SO:0001819	synonymous_variant	8362	exon1			CCTTCAGCACCCC	X60483	CCDS4631.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197914	ENSG00000273542		"""Histones / Replication-dependent"""	4784	protein-coding gene	gene with protein product		602825	"""H4 histone family, member D"", ""histone 1, H4k"""	H4FD		9439656, 12408966	Standard	NM_003541		Approved	H4/d, H4F2iii, dJ160A22.1	uc003njr.3	P62805	OTTHUMG00000014488	ENST00000357549.2:c.175C>T	6.37:g.27799131G>A		Somatic	358	0	0		WXS	Illumina HiSeq	Phase_I	292	23	0.0787671	NM_003541	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	ENST00000357549.2	37	CCDS4631.1																																																																																			.	.	none		0.637	HIST1H4K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040156.1	NM_003541	
CTTN	2017	hgsc.bcm.edu	37	11	70265880	70265880	+	Silent	SNP	C	C	T	rs35414621	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:70265880C>T	ENST00000301843.8	+	9	803	c.597C>T	c.(595-597)taC>taT	p.Y199Y	CTTN_ENST00000346329.3_Silent_p.Y199Y|CTTN_ENST00000376561.3_Silent_p.Y199Y|CTTN_ENST00000538675.1_5'Flank	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	199					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GCGGCAAATACGGTATCGACA	0.413													C|||	49	0.00978435	0.0	0.0086	5008	,	,		18676	0.0		0.0119	False		,,,				2504	0.0317				p.Y199Y		Atlas-SNP	.											.	CTTN	162	.	0			c.C597T						PASS	.	C	,,	8,4392	14.3+/-33.2	0,8,2192	74.0	70.0	71.0		597,597,597	-7.3	0.2	11	dbSNP_126	71	113,8475	60.6+/-122.4	1,111,4182	no	coding-synonymous,coding-synonymous,coding-synonymous	CTTN	NM_001184740.1,NM_005231.3,NM_138565.2	,,	1,119,6374	TT,TC,CC		1.3158,0.1818,0.9316	,,	199/635,199/551,199/514	70265880	121,12867	2200	4294	6494	SO:0001819	synonymous_variant	2017	exon9			CAAATACGGTATC	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.597C>T	11.37:g.70265880C>T		Somatic	136	0	0		WXS	Illumina HiSeq	Phase_I	150	31	0.206667	NM_001184740	Q8N707|Q96H99	Silent	SNP	ENST00000301843.8	37	CCDS41680.1	11	0.005036630036630037	0	0.0	2	0.0055248618784530384	0	0.0	9	0.011873350923482849	C	0.906	-0.720787	0.03182	0.001818	0.013158	ENSG00000085733	ENST00000415461	.	.	.	4.92	-7.32	0.01436	.	.	.	.	.	T	0.55752	0.1940	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67345	-0.5694	4	.	.	.	-15.9401	17.09	0.86619	0.0:0.2583:0.0:0.7417	rs35414621;rs61749188	.	.	.	M	181	.	.	T	+	2	0	CTTN	69943528	0.004000	0.15560	0.164000	0.22755	0.079000	0.17450	-1.423000	0.02450	-1.404000	0.02050	-0.971000	0.02607	ACG	C|0.993;T|0.007	0.007	strong		0.413	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259233.2	NM_138565	
GPR101	83550	hgsc.bcm.edu	37	X	136113230	136113230	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chrX:136113230C>T	ENST00000298110.1	-	1	603	c.604G>A	c.(604-606)Gtc>Atc	p.V202I		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	202						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					AGTGGAATGACGATGAAGGAC	0.567																																					p.V202I		Atlas-SNP	.											.	GPR101	96	.	0			c.G604A						PASS	.						78.0	66.0	70.0					X																	136113230		2203	4300	6503	SO:0001583	missense	83550	exon1			GAATGACGATGAA	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.604G>A	X.37:g.136113230C>T	ENSP00000298110:p.Val202Ile	Somatic	20	0	0		WXS	Illumina HiSeq	Phase_I	46	38	0.826087	NM_054021	Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	37	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.499489	0.01001	.	.	ENSG00000165370	ENST00000298110	T	0.73152	-0.72	5.13	-1.89	0.07689	GPCR, rhodopsin-like superfamily (1);	0.589703	0.12687	N	0.447441	T	0.51907	0.1702	N	0.26042	0.785	0.19300	N	0.99997	B	0.11235	0.004	B	0.06405	0.002	T	0.37686	-0.9695	10	0.54805	T	0.06	-6.8495	6.9808	0.24702	0.0:0.3125:0.1519:0.5356	.	202	Q96P66	GP101_HUMAN	I	202	ENSP00000298110:V202I	ENSP00000298110:V202I	V	-	1	0	GPR101	135940896	0.594000	0.26849	0.042000	0.18584	0.676000	0.39594	-0.176000	0.09811	-0.530000	0.06349	-0.208000	0.12717	GTC	.	.	none		0.567	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1		
FAM212B	55924	hgsc.bcm.edu	37	1	112269753	112269753	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:112269753C>T	ENST00000357260.5	-	2	912	c.731G>A	c.(730-732)cGc>cAc	p.R244H	FAM212B_ENST00000534365.1_Intron|FAM212B_ENST00000444059.2_Missense_Mutation_p.R229H	NM_019099.4	NP_061972.1	Q9NTI7	F212B_HUMAN	family with sequence similarity 212, member B	244										cervix(1)|endometrium(1)	2						CTTCTGTGAGCGGCCGGTTCG	0.617																																					p.R244H		Atlas-SNP	.											.	FAM212B	17	.	0			c.G731A						PASS	.						61.0	66.0	64.0					1																	112269753		2203	4300	6503	SO:0001583	missense	55924	exon2			TGTGAGCGGCCGG	AK055667	CCDS841.1, CCDS44195.1	1p13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000197852	ENSG00000197852			28045	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 183"""	C1orf183			Standard	NM_019099		Approved	FLJ31105	uc001ebo.2	Q9NTI7	OTTHUMG00000011953	ENST00000357260.5:c.731G>A	1.37:g.112269753C>T	ENSP00000349805:p.Arg244His	Somatic	88	0	0		WXS	Illumina HiSeq	Phase_I	56	39	0.696429	NM_019099	B3KP38|B4DF94|Q9NTI6	Missense_Mutation	SNP	ENST00000357260.5	37	CCDS841.1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.696087	0.48202	.	.	ENSG00000197852	ENST00000357260;ENST00000444059	.	.	.	4.93	4.93	0.64822	.	0.061291	0.64402	D	0.000012	T	0.51092	0.1654	L	0.32530	0.975	0.34183	D	0.671209	D;D	0.89917	1.0;1.0	D;D	0.72338	0.977;0.977	T	0.56823	-0.7915	9	0.51188	T	0.08	-18.9743	13.6697	0.62418	0.0:1.0:0.0:0.0	.	229;244	Q9NTI7-2;Q9NTI7	.;CA183_HUMAN	H	244;229	.	ENSP00000349805:R244H	R	-	2	0	C1orf183	112071276	1.000000	0.71417	0.569000	0.28460	0.039000	0.13416	6.056000	0.71111	2.287000	0.76781	0.555000	0.69702	CGC	.	.	none		0.617	FAM212B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033060.2	NM_019099	
PLCB1	23236	hgsc.bcm.edu	37	20	8741074	8741074	+	Missense_Mutation	SNP	A	A	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr20:8741074A>C	ENST00000338037.6	+	25	2704	c.2677A>C	c.(2677-2679)Aaa>Caa	p.K893Q	PLCB1_ENST00000378641.3_Missense_Mutation_p.K893Q|PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378637.2_Missense_Mutation_p.K893Q	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	893					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						GGCACCTGCCAAAACAGAAGA	0.353																																					p.Q893Q		Atlas-SNP	.											.	PLCB1	394	.	0			c.C2677C						PASS	.						52.0	51.0	52.0					20																	8741074		2203	4300	6503	SO:0001583	missense	23236	exon25			CCTGCCAAAACAG	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.2677A>C	20.37:g.8741074A>C	ENSP00000338185:p.Lys893Gln	Somatic	521	0	0		WXS	Illumina HiSeq	Phase_I	461	75	0.16269	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Silent	SNP	ENST00000338037.6	37	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	A	12.27	1.887080	0.33348	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.18960	2.18;2.18;2.18	6.07	6.07	0.98685	.	0.054036	0.64402	D	0.000001	T	0.15003	0.0362	N	0.25144	0.715	0.53688	D	0.999978	B;B	0.28378	0.209;0.02	B;B	0.24394	0.031;0.053	T	0.10847	-1.0612	10	0.13470	T	0.59	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	893;893	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	Q	893;893;893;813;813	ENSP00000367908:K893Q;ENSP00000338185:K893Q;ENSP00000367904:K893Q	ENSP00000338185:K893Q	K	+	1	0	PLCB1	8689074	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.476000	0.90421	2.326000	0.78906	0.533000	0.62120	AAA	.	.	none		0.353	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
RNF39	80352	hgsc.bcm.edu	37	6	30039324	30039324	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:30039324G>A	ENST00000244360.6	-	4	924	c.827C>T	c.(826-828)gCg>gTg	p.A276V	RNF39_ENST00000376751.3_Missense_Mutation_p.A276V	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	276	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										GAAGCCCTGCGCACCCAGCAC	0.716																																					p.A276V	NSCLC(8;188 360 1520 20207 31481)	Atlas-SNP	.											.	RNF39	27	.	0			c.C827T						PASS	.						3.0	3.0	3.0					6																	30039324		1332	2321	3653	SO:0001583	missense	80352	exon4			CCCTGCGCACCCA	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.827C>T	6.37:g.30039324G>A	ENSP00000244360:p.Ala276Val	Somatic	12	0	0		WXS	Illumina HiSeq	Phase_I	16	6	0.375	NM_025236	A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	ENST00000244360.6	37	CCDS4673.1	.	.	.	.	.	.	.	.	.	.	g	24.3	4.518055	0.85495	.	.	ENSG00000204618	ENST00000376751;ENST00000244360	T;T	0.10860	2.83;2.83	4.54	4.54	0.55810	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.000000	0.43919	D	0.000520	T	0.15955	0.0384	L	0.47716	1.5	0.41952	D	0.990666	D;D	0.69078	0.996;0.997	P;D	0.63488	0.853;0.915	T	0.00857	-1.1538	10	0.56958	D	0.05	-16.6616	15.217	0.73277	0.0:0.0:1.0:0.0	.	276;276	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	V	276	ENSP00000365942:A276V;ENSP00000244360:A276V	ENSP00000244360:A276V	A	-	2	0	RNF39	30147303	0.000000	0.05858	0.882000	0.34594	0.806000	0.45545	0.239000	0.18023	2.252000	0.74401	0.282000	0.19409	GCG	.	.	none		0.716	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769	
KBTBD6	89890	hgsc.bcm.edu	37	13	41705897	41705897	+	Missense_Mutation	SNP	G	G	C	rs150633583	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr13:41705897G>C	ENST00000379485.1	-	1	985	c.751C>G	c.(751-753)Ccc>Gcc	p.P251A	KBTBD6_ENST00000499385.2_Missense_Mutation_p.P185A	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	251								p.P251A(1)		NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		CGCTCTTTGGGAGCAGCCTCC	0.587													G|||	4	0.000798722	0.003	0.0	5008	,	,		19033	0.0		0.0	False		,,,				2504	0.0				p.P251A		Atlas-SNP	.											KBTBD6,trunk,malignant_melanoma,0,2	KBTBD6	83	2	1	Substitution - Missense(1)	skin(1)	c.C751G						scavenged	.	G	ALA/PRO	14,4392	19.1+/-41.9	0,14,2189	64.0	65.0	65.0		751	3.7	1.0	13	dbSNP_134	65	0,8600		0,0,4300	yes	missense	KBTBD6	NM_152903.4	27	0,14,6489	CC,CG,GG		0.0,0.3177,0.1076	benign	251/675	41705897	14,12992	2203	4300	6503	SO:0001583	missense	89890	exon1			CTTTGGGAGCAGC	AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.751C>G	13.37:g.41705897G>C	ENSP00000368799:p.Pro251Ala	Somatic	160	2	0.0125		WXS	Illumina HiSeq	Phase_I	113	2	0.0176991	NM_152903	Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Missense_Mutation	SNP	ENST00000379485.1	37	CCDS9376.1	.	.	.	.	.	.	.	.	.	.	g	3.422	-0.117976	0.06838	0.003177	0.0	ENSG00000165572	ENST00000379485;ENST00000499385	T;T	0.67523	-0.27;-0.27	3.68	3.68	0.42216	BTB/Kelch-associated (2);	0.074945	0.53938	D	0.000048	T	0.51193	0.1660	L	0.31926	0.97	0.38217	D	0.940638	B;B	0.10296	0.003;0.001	B;B	0.15052	0.012;0.006	T	0.48328	-0.9045	10	0.08837	T	0.75	.	13.263	0.60117	0.0:0.0:1.0:0.0	.	185;251	F5GZN7;Q86V97	.;KBTB6_HUMAN	A	251;185	ENSP00000368799:P251A;ENSP00000444326:P185A	ENSP00000368799:P251A	P	-	1	0	KBTBD6	40603897	0.817000	0.29147	0.996000	0.52242	0.966000	0.64601	1.519000	0.35888	2.060000	0.61445	0.455000	0.32223	CCC	G|0.998;C|0.002	0.002	strong		0.587	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	NM_152903	
MUC4	4585	hgsc.bcm.edu	37	3	195506982	195506982	+	Silent	SNP	G	G	C	rs562381906	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:195506982G>C	ENST00000463781.3	-	2	11928	c.11469C>G	c.(11467-11469)acC>acG	p.T3823T	MUC4_ENST00000475231.1_Silent_p.T3823T|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGGAAGAGGGGTGGTGTCAC	0.592													.|||	152	0.0303514	0.112	0.0029	5008	,	,		9549	0.0		0.002	False		,,,				2504	0.0				p.T3823T		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	0			c.C11469G						scavenged	.						5.0	5.0	5.0					3																	195506982		422	1223	1645	SO:0001819	synonymous_variant	4585	exon2			AAGAGGGGTGGTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11469C>G	3.37:g.195506982G>C		Somatic	52	3	0.0576923		WXS	Illumina HiSeq	Phase_I	67	7	0.104478	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	none		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
LTBP2	4053	hgsc.bcm.edu	37	14	74970174	74970174	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr14:74970174G>A	ENST00000261978.4	-	32	5104	c.4718C>T	c.(4717-4719)aCg>aTg	p.T1573M	LTBP2_ENST00000556690.1_Missense_Mutation_p.T1529M	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1573					protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CCACTCACCCGTGCTGCTGGT	0.677																																					p.T1573M		Atlas-SNP	.											.	LTBP2	158	.	0			c.C4718T						PASS	.						42.0	36.0	38.0					14																	74970174		2202	4300	6502	SO:0001583	missense	4053	exon32			TCACCCGTGCTGC		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.4718C>T	14.37:g.74970174G>A	ENSP00000261978:p.Thr1573Met	Somatic	43	0	0		WXS	Illumina HiSeq	Phase_I	43	9	0.209302	NM_000428	Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	37	CCDS9831.1	.	.	.	.	.	.	.	.	.	.	G	5.194	0.221357	0.09863	.	.	ENSG00000119681	ENST00000261978;ENST00000556690	T;T	0.78924	-1.22;-1.22	4.86	-6.15	0.02105	.	2.988510	0.01279	N	0.009675	T	0.68961	0.3058	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.57015	-0.7883	10	0.45353	T	0.12	.	14.329	0.66541	0.6899:0.0:0.3101:0.0	.	1573	Q14767	LTBP2_HUMAN	M	1573;1529	ENSP00000261978:T1573M;ENSP00000451477:T1529M	ENSP00000261978:T1573M	T	-	2	0	LTBP2	74039927	0.000000	0.05858	0.000000	0.03702	0.340000	0.28889	-0.517000	0.06275	-1.200000	0.02662	-0.224000	0.12420	ACG	.	.	none		0.677	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
IGF2BP3	10643	hgsc.bcm.edu	37	7	23353246	23353246	+	Missense_Mutation	SNP	A	A	C	rs199812608		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr7:23353246A>C	ENST00000258729.3	-	13	1778	c.1422T>G	c.(1420-1422)atT>atG	p.I474M		NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	474					anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)	p.I474M(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						TTTCTTCTTTAATTTTTCCAT	0.383																																					p.I474M		Atlas-SNP	.											IGF2BP3,NS,carcinoma,0,1	IGF2BP3	71	1	1	Substitution - Missense(1)	endometrium(1)	c.T1422G						scavenged	.						87.0	84.0	85.0					7																	23353246		2203	4300	6503	SO:0001583	missense	10643	exon13			TTCTTTAATTTTT	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.1422T>G	7.37:g.23353246A>C	ENSP00000258729:p.Ile474Met	Somatic	75	1	0.0133333		WXS	Illumina HiSeq	Phase_I	73	3	0.0410959	NM_006547	A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Missense_Mutation	SNP	ENST00000258729.3	37	CCDS5382.1	.	.	.	.	.	.	.	.	.	.	A	11.25	1.582136	0.28180	.	.	ENSG00000136231	ENST00000258729	T	0.65916	-0.18	5.55	1.78	0.24846	K Homology (1);	0.172230	0.51477	D	0.000097	T	0.28764	0.0713	N	0.04880	-0.145	0.35528	D	0.802005	P	0.37158	0.585	B	0.32090	0.14	T	0.14392	-1.0474	10	0.22109	T	0.4	-2.3591	2.611	0.04891	0.6156:0.126:0.1369:0.1214	.	474	O00425	IF2B3_HUMAN	M	474	ENSP00000258729:I474M	ENSP00000258729:I474M	I	-	3	3	IGF2BP3	23319771	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.434000	0.34958	0.449000	0.26747	0.533000	0.62120	ATT	.	.	weak		0.383	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	NM_006547	
PLEC	5339	hgsc.bcm.edu	37	8	145010055	145010055	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:145010055C>T	ENST00000322810.4	-	6	1143	c.974G>A	c.(973-975)aGa>aAa	p.R325K	PLEC_ENST00000354958.2_Missense_Mutation_p.R166K|PLEC_ENST00000357649.2_Missense_Mutation_p.R192K|PLEC_ENST00000354589.3_Missense_Mutation_p.R188K|PLEC_ENST00000356346.3_Missense_Mutation_p.R174K|PLEC_ENST00000398774.2_Missense_Mutation_p.R156K|PLEC_ENST00000436759.2_Missense_Mutation_p.R215K|PLEC_ENST00000527096.1_Missense_Mutation_p.R215K|PLEC_ENST00000345136.3_Missense_Mutation_p.R188K	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	325	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.|Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCGGCCGTCTCTCCAGCTGGA	0.657																																					p.R325K		Atlas-SNP	.											.	PLEC	1144	.	0			c.G974A						PASS	.						53.0	65.0	61.0					8																	145010055		2088	4210	6298	SO:0001583	missense	5339	exon6			CCGTCTCTCCAGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.974G>A	8.37:g.145010055C>T	ENSP00000323856:p.Arg325Lys	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	68	13	0.191176	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721462	0.68959	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096;ENST00000528025;ENST00000526416	D;D;D;D;D;D;D;D;D;D;D	0.94828	-3.53;-3.53;-3.53;-3.53;-3.53;-3.53;-3.53;-3.53;-3.53;-3.53;-3.53	4.39	4.39	0.52855	Calponin homology domain (5);	0.000000	0.64402	U	0.000012	D	0.94850	0.8336	L	0.35249	1.045	0.53688	D	0.99997	D;P;P;D;P;P;D;D	0.56968	0.971;0.949;0.949;0.958;0.949;0.949;0.978;0.978	D;D;D;D;D;D;D;D	0.69307	0.963;0.927;0.927;0.957;0.927;0.927;0.946;0.946	D	0.95054	0.8189	10	0.52906	T	0.07	.	14.4611	0.67450	0.0:1.0:0.0:0.0	.	215;174;166;325;156;188;192;188	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	K	188;192;188;156;325;166;174;215;215;232;165	ENSP00000344848:R188K;ENSP00000350277:R192K;ENSP00000346602:R188K;ENSP00000381756:R156K;ENSP00000323856:R325K;ENSP00000347044:R166K;ENSP00000348702:R174K;ENSP00000388180:R215K;ENSP00000434583:R215K;ENSP00000437303:R232K;ENSP00000433557:R165K	ENSP00000323856:R325K	R	-	2	0	PLEC	145082043	1.000000	0.71417	0.909000	0.35828	0.884000	0.51177	4.835000	0.62781	1.995000	0.58328	0.462000	0.41574	AGA	.	.	none		0.657	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230360	23230360	+	Missense_Mutation	SNP	G	G	A	rs6003368	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr22:23230360G>A	ENST00000526893.1	+	1	401	c.127G>A	c.(127-129)Gtt>Att	p.V43I	hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Missense_Mutation_p.V43I|IGLL5_ENST00000532223.2_Missense_Mutation_p.V43I	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	43						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GCGCCCAATGGTTGCACCGCA	0.672																																					p.W7X		Atlas-SNP	.											.	IGLL5	26	.	0			c.G21A						PASS	.																																			SO:0001583	missense	100423062	exon1			CCAATGGTTGCAC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.127G>A	22.37:g.23230360G>A	ENSP00000431254:p.Val43Ile	Somatic	170	0	0		WXS	Illumina HiSeq	Phase_I	121	28	0.231405	NM_001256296		Nonsense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	9.827	1.187440	0.21870	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00568	6.53;6.53	3.92	0.473	0.16763	.	.	.	.	.	T	0.00300	0.0009	N	0.08118	0	0.09310	N	1	B	0.16166	0.016	B	0.10450	0.005	T	0.44034	-0.9354	9	0.49607	T	0.09	.	2.3416	0.04261	0.1095:0.1927:0.4993:0.1985	rs6003368;rs6003368	43	B9A064	IGLL5_HUMAN	I	43	ENSP00000436353:V43I;ENSP00000431254:V43I	ENSP00000431254:V43I	V	+	1	0	IGLL5	21560360	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.128000	0.03247	0.192000	0.20272	0.643000	0.83706	GTT	G|1.000;|0.000	.	weak		0.672	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
CADM1	23705	hgsc.bcm.edu	37	11	115110994	115110994	+	Splice_Site	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:115110994G>A	ENST00000452722.3	-	2	291	c.271C>T	c.(271-273)Cct>Tct	p.P91S	CADM1_ENST00000542447.2_Splice_Site_p.P91S|CADM1_ENST00000537058.1_Splice_Site_p.P91S|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000536727.1_Splice_Site_p.P91S|CADM1_ENST00000331581.6_Splice_Site_p.P91S	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		GGAAACTTACGCCTGAAGTCC	0.398																																					p.P91S		Atlas-SNP	.											.	CADM1	74	.	0			c.C271T						PASS	.						79.0	73.0	75.0					11																	115110994		2201	4296	6497	SO:0001630	splice_region_variant	23705	exon2			ACTTACGCCTGAA	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.271+1C>T	11.37:g.115110994G>A		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	85	30	0.352941	NM_014333		Missense_Mutation	SNP	ENST00000452722.3	37	CCDS8373.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.4|20.4	3.981333|3.981333	0.74474|0.74474	.|.	.|.	ENSG00000182985|ENSG00000182985	ENST00000545380|ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581;ENST00000545094	.|T;T;T;T;T;T	.|0.67171	.|-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	5.97|5.97	5.97|5.97	0.96955|0.96955	.|Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78253|0.78253	0.4254|0.4254	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	.|D;D;D;P;D	.|0.89917	.|1.0;1.0;1.0;0.635;0.995	.|D;D;D;B;P	.|0.91635	.|0.998;0.998;0.999;0.364;0.691	T|T	0.75703|0.75703	-0.3225|-0.3225	5|9	.|.	.|.	.|.	.|.	15.856|15.856	0.78977|0.78977	0.0:0.1349:0.8651:0.0|0.0:0.1349:0.8651:0.0	.|.	.|91;91;92;91;91	.|Q9BY67-2;F5H0J4;A4FVB5;Q9BY67;A0A4Z1	.|.;.;.;CADM1_HUMAN;.	V|S	89|91;91;91;91;50;91;58	.|ENSP00000439176:P91S;ENSP00000395359:P91S;ENSP00000439817:P91S;ENSP00000440322:P91S;ENSP00000329797:P91S;ENSP00000439696:P58S	.|.	A|P	-|-	2|1	0|0	CADM1|CADM1	114616204|114616204	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	9.434000|9.434000	0.97515|0.97515	2.834000|2.834000	0.97654|0.97654	0.650000|0.650000	0.86243|0.86243	GCC|CCT	.	.	none		0.398	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	Missense_Mutation
PLEKHM1	9842	hgsc.bcm.edu	37	17	43552790	43552790	+	Missense_Mutation	SNP	G	G	T	rs147167801		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:43552790G>T	ENST00000430334.3	-	4	732	c.599C>A	c.(598-600)cCg>cAg	p.P200Q	PLEKHM1_ENST00000421073.2_Missense_Mutation_p.P111Q	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	200					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					CTCAGAAAGCGGGCAAAGCCC	0.532																																					p.P200Q		Atlas-SNP	.											PLEKHM1,colon,carcinoma,+1,1	PLEKHM1	69	1	0			c.C599A						scavenged	.						51.0	47.0	48.0					17																	43552790		2201	4290	6491	SO:0001583	missense	9842	exon4			GAAAGCGGGCAAA	X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.599C>A	17.37:g.43552790G>T	ENSP00000389913:p.Pro200Gln	Somatic	181	1	0.00552486		WXS	Illumina HiSeq	Phase_I	167	2	0.011976	NM_014798	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	ENST00000430334.3	37	CCDS32671.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.193235	0.38707	.	.	ENSG00000225190	ENST00000430334;ENST00000446609;ENST00000421073	T;T	0.71817	-0.53;-0.6	5.03	5.03	0.67393	.	0.199334	0.44097	D	0.000500	T	0.75664	0.3880	L	0.27053	0.805	0.53688	D	0.99997	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.78396	-0.2220	10	0.72032	D	0.01	.	15.2171	0.73277	0.0:0.0:1.0:0.0	.	111;200	F8W648;Q9Y4G2	.;PKHM1_HUMAN	Q	200;149;111	ENSP00000389913:P200Q;ENSP00000414352:P111Q	ENSP00000414352:P111Q	P	-	2	0	PLEKHM1	40908573	1.000000	0.71417	0.957000	0.39632	0.855000	0.48748	8.612000	0.90909	2.608000	0.88229	0.655000	0.94253	CCG	G|1.000;A|0.000	.	alt		0.532	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444659.1	NM_014798	
MAML2	84441	hgsc.bcm.edu	37	11	95825386	95825386	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:95825386C>T	ENST00000524717.1	-	2	3093	c.1809G>A	c.(1807-1809)caG>caA	p.Q603Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	603					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgctgctgct	0.522			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q603Q		Atlas-SNP	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,NS,carcinoma,0,2	MAML2	94	2	0			c.G1809A						scavenged	.						20.0	30.0	26.0					11																	95825386		1926	3789	5715	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1809G>A	11.37:g.95825386C>T		Somatic	55	1	0.0181818		WXS	Illumina HiSeq	Phase_I	76	5	0.0657895	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.	.	none		0.522	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
MUC4	4585	hgsc.bcm.edu	37	3	195506499	195506499	+	Silent	SNP	G	G	A	rs542643120	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:195506499G>A	ENST00000463781.3	-	2	12411	c.11952C>T	c.(11950-11952)ccC>ccT	p.P3984P	MUC4_ENST00000475231.1_Silent_p.P3984P|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P3984P(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGACAGGAAGGGGGGTGGCGT	0.592													.|||	1079	0.215455	0.2126	0.183	5008	,	,		8207	0.0952		0.338	False		,,,				2504	0.2403				p.P3984P		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	1	Substitution - coding silent(1)	stomach(1)	c.C11952T						scavenged	.						10.0	7.0	8.0					3																	195506499		443	903	1346	SO:0001819	synonymous_variant	4585	exon2			AGGAAGGGGGGTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11952C>T	3.37:g.195506499G>A		Somatic	6	5	0.833333		WXS	Illumina HiSeq	Phase_I	19	19	1	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	none		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PLCB4	5332	hgsc.bcm.edu	37	20	9288481	9288481	+	Missense_Mutation	SNP	T	T	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr20:9288481T>G	ENST00000378493.1	+	1	35	c.20T>G	c.(19-21)tTt>tGt	p.F7C	PLCB4_ENST00000378473.3_Missense_Mutation_p.F7C|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000378501.2_Missense_Mutation_p.F7C|PLCB4_ENST00000334005.3_Missense_Mutation_p.F7C|PLCB4_ENST00000278655.4_Missense_Mutation_p.F7C|PLCB4_ENST00000414679.2_Missense_Mutation_p.F7C			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	7					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						CCTTATGAATTTAACTGGCAG	0.328																																					p.F7C		Atlas-SNP	.											.	PLCB4	204	.	0			c.T20G						PASS	.						61.0	57.0	59.0					20																	9288481		2203	4299	6502	SO:0001583	missense	5332	exon2			ATGAATTTAACTG		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.20T>G	20.37:g.9288481T>G	ENSP00000367754:p.Phe7Cys	Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	78	20	0.25641	NM_182797	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	ENST00000378493.1	37	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.041460	0.75732	.	.	ENSG00000101333	ENST00000407043;ENST00000441846;ENST00000334005;ENST00000378473;ENST00000437503;ENST00000416836;ENST00000278655;ENST00000378493;ENST00000378501	T;T;T;T;T;T;T;T;T	0.68765	0.5;0.51;1.84;1.87;0.37;-0.35;1.85;1.85;1.84	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.81583	0.4853	M	0.75615	2.305	0.58432	D	0.999995	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.97110	0.998;0.971;1.0	D	0.83766	0.0217	10	0.87932	D	0	.	15.2632	0.73640	0.0:0.0:0.0:1.0	.	7;7;7	E2QRH8;Q15147;Q15147-4	.;PLCB4_HUMAN;.	C	7	ENSP00000385805:F7C;ENSP00000412982:F7C;ENSP00000334105:F7C;ENSP00000367734:F7C;ENSP00000391614:F7C;ENSP00000395753:F7C;ENSP00000278655:F7C;ENSP00000367754:F7C;ENSP00000367762:F7C	ENSP00000278655:F7C	F	+	2	0	PLCB4	9236481	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.792000	0.69052	2.248000	0.74166	0.533000	0.62120	TTT	.	.	none		0.328	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
C8A	731	hgsc.bcm.edu	37	1	57378088	57378088	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:57378088C>T	ENST00000361249.3	+	10	1489	c.1393C>T	c.(1393-1395)Cac>Tac	p.H465Y		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	465	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						GCAGCCTATCCACGAGGTGCT	0.617																																					p.H465Y		Atlas-SNP	.											.	C8A	103	.	0			c.C1393T						PASS	.						38.0	40.0	39.0					1																	57378088		2203	4299	6502	SO:0001583	missense	731	exon10			CCTATCCACGAGG	M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.1393C>T	1.37:g.57378088C>T	ENSP00000354458:p.His465Tyr	Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	79	47	0.594937	NM_000562	A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	ENST00000361249.3	37	CCDS606.1	.	.	.	.	.	.	.	.	.	.	C	0.288	-0.981797	0.02197	.	.	ENSG00000157131	ENST00000361249	D	0.83837	-1.77	5.55	-5.79	0.02354	Membrane attack complex component/perforin (MACPF) domain (3);	0.486260	0.24917	N	0.034574	T	0.54127	0.1839	N	0.05383	-0.06	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.56829	-0.7914	10	0.02654	T	1	-3.2246	9.1379	0.36886	0.0:0.3531:0.1005:0.5464	.	465	P07357	CO8A_HUMAN	Y	465	ENSP00000354458:H465Y	ENSP00000354458:H465Y	H	+	1	0	C8A	57150676	0.000000	0.05858	0.012000	0.15200	0.003000	0.03518	-0.562000	0.05950	-0.689000	0.05149	-0.748000	0.03510	CAC	.	.	none		0.617	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562	
MUC5B	727897	hgsc.bcm.edu	37	11	1264581	1264581	+	Silent	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:1264581C>T	ENST00000529681.1	+	31	6529	c.6471C>T	c.(6469-6471)ccC>ccT	p.P2157P	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.P2160P	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2157	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ggacaactcccatccccccag	0.647																																					p.P2157P		Atlas-SNP	.											MUC5B,NS,carcinoma,+1,2	MUC5B	473	2	0			c.C6471T						scavenged	.						105.0	136.0	126.0					11																	1264581		2094	4146	6240	SO:0001819	synonymous_variant	727897	exon31			AACTCCCATCCCC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.6471C>T	11.37:g.1264581C>T		Somatic	415	4	0.00963855		WXS	Illumina HiSeq	Phase_I	394	4	0.0101523	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.	.	none		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
USP24	23358	hgsc.bcm.edu	37	1	55622939	55622939	+	Missense_Mutation	SNP	A	A	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:55622939A>C	ENST00000294383.6	-	11	1331	c.1332T>G	c.(1330-1332)atT>atG	p.I444M	USP24_ENST00000407756.1_Missense_Mutation_p.I332M	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	444					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						CTTCCAGTGCAATCGACAGAA	0.289																																					p.I444M		Atlas-SNP	.											.	USP24	323	.	0			c.T1332G						PASS	.						74.0	68.0	70.0					1																	55622939		1813	4073	5886	SO:0001583	missense	23358	exon11			CAGTGCAATCGAC	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.1332T>G	1.37:g.55622939A>C	ENSP00000294383:p.Ile444Met	Somatic	183	0	0		WXS	Illumina HiSeq	Phase_I	159	97	0.610063	NM_015306	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	A	13.78	2.340683	0.41498	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.80033	-1.33;-1.33	5.93	0.863	0.19062	.	0.057109	0.64402	D	0.000003	T	0.71005	0.3289	L	0.49126	1.545	0.35414	D	0.792651	P	0.44578	0.838	B	0.42422	0.387	T	0.69632	-0.5093	10	0.46703	T	0.11	.	4.0534	0.09806	0.5186:0.0:0.2415:0.2399	.	332	B7WPF4	.	M	444;332	ENSP00000294383:I444M;ENSP00000385700:I332M	ENSP00000294383:I444M	I	-	3	3	USP24	55395527	1.000000	0.71417	1.000000	0.80357	0.575000	0.36095	2.338000	0.43957	0.140000	0.18849	-1.518000	0.00936	ATT	.	.	none		0.289	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
WDR88	126248	hgsc.bcm.edu	37	19	33642122	33642122	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr19:33642122G>T	ENST00000355868.3	+	6	791	c.715G>T	c.(715-717)Gac>Tac	p.D239Y	WDR88_ENST00000361680.2_Missense_Mutation_p.D239Y	NM_173479.3	NP_775750.3	Q6ZMY6	WDR88_HUMAN	WD repeat domain 88	239										breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25	Esophageal squamous(110;0.137)					ATGCTGCTTTGACCCCGACAG	0.557																																					p.D239Y		Atlas-SNP	.											.	WDR88	50	.	0			c.G715T						PASS	.						149.0	90.0	110.0					19																	33642122		2203	4300	6503	SO:0001583	missense	126248	exon6			TGCTTTGACCCCG	BC031227	CCDS12429.1	19q13.11	2013-01-09	2007-04-04	2007-04-04		ENSG00000166359		"""WD repeat domain containing"""	26999	protein-coding gene	gene with protein product			"""PQQ repeat and WD repeat domain containing"""	PQWD		12477932	Standard	NM_173479		Approved		uc002nui.3	Q6ZMY6		ENST00000355868.3:c.715G>T	19.37:g.33642122G>T	ENSP00000348129:p.Asp239Tyr	Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	61	39	0.639344	NM_173479	Q8NEF8	Missense_Mutation	SNP	ENST00000355868.3	37	CCDS12429.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744689	0.69418	.	.	ENSG00000166359	ENST00000355868;ENST00000361680	T;T	0.60920	0.15;0.15	5.89	4.67	0.58626	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	3.304740	0.00998	N	0.003621	T	0.77485	0.4137	L	0.59436	1.845	0.32073	N	0.594173	D	0.89917	1.0	D	0.85130	0.997	T	0.63554	-0.6611	10	0.66056	D	0.02	.	14.6624	0.68882	0.0826:0.0:0.9174:0.0	.	239	Q6ZMY6	WDR88_HUMAN	Y	239	ENSP00000348129:D239Y;ENSP00000355148:D239Y	ENSP00000348129:D239Y	D	+	1	0	WDR88	38333962	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	4.586000	0.60984	2.783000	0.95769	0.655000	0.94253	GAC	.	.	none		0.557	WDR88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450840.1	NM_173479	
TGM3	7053	hgsc.bcm.edu	37	20	2312744	2312744	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr20:2312744A>G	ENST00000381458.5	+	10	1493	c.1430A>G	c.(1429-1431)gAg>gGg	p.E477G		NM_003245.3	NP_003236.3	Q08188	TGM3_HUMAN	transglutaminase 3	477					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|hair follicle morphogenesis (GO:0031069)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	calcium ion binding (GO:0005509)|catalytic activity (GO:0003824)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|transferase activity, transferring acyl groups (GO:0016746)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(11)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	39					L-Glutamine(DB00130)	TTGGAAACAGAGGAACAGGAG	0.522																																					p.E477G		Atlas-SNP	.											.	TGM3	105	.	0			c.A1430G						PASS	.						77.0	67.0	71.0					20																	2312744		2203	4300	6503	SO:0001583	missense	7053	exon10			AAACAGAGGAACA	L10386	CCDS33435.1	20q11.2	2013-05-02	2013-05-02		ENSG00000125780	ENSG00000125780	2.3.2.13	"""Transglutaminases"""	11779	protein-coding gene	gene with protein product	"""E polypeptide, protein-glutamine-gamma-glutamyltransferase"""	600238	"""transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7851911, 9452468	Standard	NM_003245		Approved	TGE	uc002wfx.4	Q08188	OTTHUMG00000031690	ENST00000381458.5:c.1430A>G	20.37:g.2312744A>G	ENSP00000370867:p.Glu477Gly	Somatic	183	0	0		WXS	Illumina HiSeq	Phase_I	169	64	0.378698	NM_003245	A8K5N6|B2RCR6|D3DVX1|O95933|Q32ML9|Q32MM0	Missense_Mutation	SNP	ENST00000381458.5	37	CCDS33435.1	.	.	.	.	.	.	.	.	.	.	A	10.47	1.360470	0.24598	.	.	ENSG00000125780	ENST00000381458;ENST00000420960	T	0.80393	-1.37	5.14	1.38	0.22167	.	1.225800	0.05291	N	0.521192	T	0.65228	0.2671	N	0.22421	0.69	0.09310	N	1	B	0.23128	0.08	B	0.15484	0.013	T	0.49234	-0.8961	10	0.25106	T	0.35	-13.1893	2.8138	0.05450	0.6238:0.1494:0.0829:0.1439	.	477	Q08188	TGM3_HUMAN	G	477	ENSP00000370867:E477G	ENSP00000370867:E477G	E	+	2	0	TGM3	2260744	0.002000	0.14202	0.003000	0.11579	0.016000	0.09150	0.221000	0.17680	0.403000	0.25479	0.533000	0.62120	GAG	.	.	none		0.522	TGM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077579.2	NM_003245	
PCDHAC2	56134	hgsc.bcm.edu	37	5	140346765	140346765	+	Silent	SNP	A	A	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr5:140346765A>T	ENST00000289269.5	+	1	946	c.414A>T	c.(412-414)atA>atT	p.I138I	PCDHA13_ENST00000409494.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA13_ENST00000289272.2_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	138	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTGGAAATATTGGACATCA	0.612																																					p.I138I	Melanoma(190;638 2083 3390 11909 52360)	Atlas-SNP	.											.	PCDHAC2	142	.	0			c.A414T						PASS	.						39.0	42.0	41.0					5																	140346765		2203	4300	6503	SO:0001819	synonymous_variant	56134	exon1			GGAAATATTGGAC	AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.414A>T	5.37:g.140346765A>T		Somatic	162	0	0		WXS	Illumina HiSeq	Phase_I	155	47	0.303226	NM_031883	Q2M3V1|Q9Y5F4	Silent	SNP	ENST00000289269.5	37	CCDS4242.1																																																																																			.	.	none		0.612	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251802.2	NM_018899	
PIM1	5292	hgsc.bcm.edu	37	6	37138355	37138355	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:37138355C>G	ENST00000373509.5	+	1	377	c.4C>G	c.(4-6)Ctc>Gtc	p.L2V		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	93					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)	p.L2V(1)|p.L2F(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GGTTGGGATGCTCTTGTCCAA	0.701			T	BCL6	NHL																																p.L93V		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,3	PIM1	71	3	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.C277G						scavenged	.						30.0	30.0	30.0					6																	37138355		2201	4298	6499	SO:0001583	missense	5292	exon1			GGGATGCTCTTGT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.4C>G	6.37:g.37138355C>G	ENSP00000362608:p.Leu2Val	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	44	7	0.159091	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.688054	0.88639	.	.	ENSG00000137193	ENST00000373509	T	0.70164	-0.46	4.05	4.05	0.47172	.	0.000000	0.32147	N	0.006517	T	0.36468	0.0968	N	0.08118	0	0.45390	D	0.998372	P	0.38020	0.615	B	0.37091	0.241	T	0.55198	-0.8178	10	0.72032	D	0.01	.	16.7252	0.85419	0.0:1.0:0.0:0.0	.	93	P11309	PIM1_HUMAN	V	2	ENSP00000362608:L2V	ENSP00000362608:L2V	L	+	1	0	PIM1	37246333	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.672000	0.61597	2.211000	0.71520	0.542000	0.68232	CTC	.	.	none		0.701	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
IGLL5	100423062	hgsc.bcm.edu	37	22	23230311	23230311	+	Silent	SNP	G	G	A	rs551962377	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr22:23230311G>A	ENST00000526893.1	+	1	352	c.78G>A	c.(76-78)ctG>ctA	p.L26L	hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Silent_p.L26L|IGLL5_ENST00000532223.2_Silent_p.L26L	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	26						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GCTGGCCCCTGCTGCTGCTGG	0.667																																					p.L26L		Atlas-SNP	.											.	IGLL5	26	.	0			c.G78A						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			GCCCCTGCTGCTG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.78G>A	22.37:g.23230311G>A		Somatic	182	0	0		WXS	Illumina HiSeq	Phase_I	146	49	0.335616	NM_001178126		Silent	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.667	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
RGS22	26166	hgsc.bcm.edu	37	8	101016183	101016183	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:101016183G>T	ENST00000360863.6	-	17	2792	c.2598C>A	c.(2596-2598)ttC>ttA	p.F866L	RGS22_ENST00000523287.1_Missense_Mutation_p.F685L|RGS22_ENST00000519421.1_5'UTR|SNORD77_ENST00000391112.1_RNA|RGS22_ENST00000523437.1_Missense_Mutation_p.F854L	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	866	RGS 1. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			GAAACTGACGGAAATGTTCAA	0.333																																					p.F866L		Atlas-SNP	.											.	RGS22	319	.	0			c.C2598A						PASS	.						132.0	122.0	125.0					8																	101016183		1850	4091	5941	SO:0001583	missense	26166	exon17			CTGACGGAAATGT	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.2598C>A	8.37:g.101016183G>T	ENSP00000354109:p.Phe866Leu	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	91	12	0.131868	NM_015668	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	37	CCDS43758.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.749832	0.69533	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437;ENST00000517828	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.49	0.68	0.17980	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.71256	0.3318	M	0.62723	1.935	0.33255	D	0.558978	D;D;P	0.76494	0.999;0.999;0.734	D;D;B	0.83275	0.996;0.996;0.391	T	0.73538	-0.3951	10	0.40728	T	0.16	.	9.3926	0.38383	0.358:0.0:0.642:0.0	.	854;866;685	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	L	866;854;685;854;181	ENSP00000354109:F866L;ENSP00000429382:F685L;ENSP00000428212:F854L;ENSP00000427754:F181L	ENSP00000354109:F866L	F	-	3	2	RGS22	101085359	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	0.755000	0.26405	-0.163000	0.10946	0.655000	0.94253	TTC	.	.	none		0.333	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668	
ARCN1	372	hgsc.bcm.edu	37	11	118463477	118463477	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:118463477G>A	ENST00000264028.4	+	7	1133	c.1038G>A	c.(1036-1038)ctG>ctA	p.L346L	ARCN1_ENST00000359415.4_Silent_p.L387L|ARCN1_ENST00000534182.2_Intron|ARCN1_ENST00000392859.3_Silent_p.L258L|RNU6-1157P_ENST00000384456.1_RNA	NM_001655.4	NP_001646.2	P48444	COPD_HUMAN	archain 1	346	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer maturation (GO:0021691)|COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pigmentation (GO:0043473)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	clathrin adaptor complex (GO:0030131)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|urinary_tract(1)	13	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		TAATTGGCCTGAAGAATCCAG	0.423																																					p.L346L		Atlas-SNP	.											.	ARCN1	33	.	0			c.G1038A						PASS	.						179.0	186.0	184.0					11																	118463477		2200	4295	6495	SO:0001819	synonymous_variant	372	exon7			TGGCCTGAAGAAT	X81197	CCDS8400.1, CCDS44749.1	11q23.3	2010-04-21	2003-01-29		ENSG00000095139	ENSG00000095139			649	protein-coding gene	gene with protein product		600820	"""coatomer protein complex, subunit delta"""	COPD		7782067, 8854871	Standard	NM_001655		Approved		uc001ptq.3	P48444	OTTHUMG00000166340	ENST00000264028.4:c.1038G>A	11.37:g.118463477G>A		Somatic	106	0	0		WXS	Illumina HiSeq	Phase_I	140	42	0.3	NM_001655	B4E1X2|E9PEU4|Q52M80	Silent	SNP	ENST00000264028.4	37	CCDS8400.1																																																																																			.	.	none		0.423	ARCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389278.1		
RPS20	6224	hgsc.bcm.edu	37	8	56985814	56985814	+	Silent	SNP	T	T	C	rs1050403	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:56985814T>C	ENST00000521262.1	-	4	448	c.195A>G	c.(193-195)acA>acG	p.T65T	RPS20_ENST00000524349.1_Silent_p.T10T|RPS20_ENST00000520490.1_5'UTR|SNORD54_ENST00000459159.1_RNA|RPS20_ENST00000523936.1_3'UTR|RPS20_ENST00000519807.1_Silent_p.T65T|CTA-397H3.3_ENST00000521403.1_RNA|RPS20_ENST00000520627.1_Silent_p.T10T|RPS20_ENST00000519606.1_Missense_Mutation_p.K41E|RPS20_ENST00000009589.3_Silent_p.T65T			P60866	RS20_HUMAN	ribosomal protein S20	65					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)						all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.155)	Epithelial(17;0.00117)|all cancers(17;0.00879)			GAGTTTTTCTTGTAGTGATTC	0.373													T|||	446	0.0890575	0.0234	0.1571	5008	,	,		21606	0.002		0.2266	False		,,,				2504	0.0777				p.T65T		Atlas-SNP	.											.	RPS20	16	.	0			c.A195G						PASS	.	T	,	201,3951		4,193,1879	83.0	87.0	86.0		195,195	-10.2	0.8	8	dbSNP_86	86	1752,6150		194,1364,2393	no	coding-synonymous,coding-synonymous	RPS20	NM_001023.3,NM_001146227.1	,	198,1557,4272	CC,CT,TT		22.1716,4.841,16.2021	,	65/120,65/143	56985814	1953,10101	2076	3951	6027	SO:0001819	synonymous_variant	6224	exon4			TTTTCTTGTAGTG	L06498	CCDS6163.1, CCDS55231.1	8q12.1	2011-04-05				ENSG00000008988		"""S ribosomal proteins"""	10405	protein-coding gene	gene with protein product		603682				9582194, 8479924	Standard	NM_001023		Approved	S20	uc003xsm.2	P60866		ENST00000521262.1:c.195A>G	8.37:g.56985814T>C		Somatic	4	0	0		WXS	Illumina HiSeq	Phase_I	10	7	0.7	NM_001146227	B2R4F4|B4DW28|P17075|Q5M8S9	Silent	SNP	ENST00000521262.1	37		241	0.11034798534798534	13	0.026422764227642278	69	0.19060773480662985	0	0.0	159	0.20976253298153033	T	11.86	1.764707	0.31228	0.04841	0.221716	ENSG00000008988	ENST00000519606	.	.	.	5.1	-10.2	0.00374	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999999	.	.	.	.	.	.	T	0.25984	-1.0116	4	0.87932	D	0	-25.2257	3.7165	0.08439	0.0927:0.2245:0.3814:0.3015	rs2976047;rs2976047	.	.	.	E	41	.	ENSP00000429333:K41E	K	-	1	0	RPS20	57148368	0.016000	0.18221	0.787000	0.31911	0.702000	0.40608	-0.858000	0.04281	-1.780000	0.01279	0.482000	0.46254	AAG	T|0.863;C|0.137	0.137	strong		0.373	RPS20-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000378166.1	NM_001023	
TRPM3	80036	hgsc.bcm.edu	37	9	73477848	73477848	+	Silent	SNP	T	T	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr9:73477848T>A	ENST00000377111.2	-	3	681	c.438A>T	c.(436-438)ggA>ggT	p.G146G	TRPM3_ENST00000396292.4_5'Flank|TRPM3_ENST00000357533.2_Silent_p.G148G|TRPM3_ENST00000377097.3_5'UTR|TRPM3_ENST00000408909.2_5'Flank|TRPM3_ENST00000358082.3_5'Flank|TRPM3_ENST00000396283.1_5'UTR|TRPM3_ENST00000437699.3_5'UTR|TRPM3_ENST00000396285.1_5'Flank|TRPM3_ENST00000361823.5_5'UTR|TRPM3_ENST00000423814.3_Silent_p.G148G|TRPM3_ENST00000396280.5_5'Flank|TRPM3_ENST00000377106.1_5'UTR|TRPM3_ENST00000377101.1_5'UTR|TRPM3_ENST00000377110.3_Silent_p.G146G|TRPM3_ENST00000360823.2_5'UTR|TRPM3_ENST00000377105.1_5'UTR	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	146					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						AATGGCCACCTCCTTGGAACT	0.488																																					p.G146G		Atlas-SNP	.											TRPM3_ENST00000423814,NS,carcinoma,-2,2	TRPM3	700	2	0			c.A438T						PASS	.						210.0	198.0	202.0					9																	73477848		2203	4300	6503	SO:0001819	synonymous_variant	80036	exon3			GCCACCTCCTTGG	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.438A>T	9.37:g.73477848T>A		Somatic	254	0	0		WXS	Illumina HiSeq	Phase_I	181	123	0.679558	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	ENST00000377111.2	37		.	.	.	.	.	.	.	.	.	.	T	11.19	1.566901	0.28003	.	.	ENSG00000083067	ENST00000377097	.	.	.	5.95	3.44	0.39384	.	.	.	.	.	T	0.60431	0.2268	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57165	-0.7858	4	.	.	.	-14.1673	10.6299	0.45530	0.3559:0.0:0.0:0.6441	.	.	.	.	V	36	.	.	E	-	2	0	TRPM3	72667668	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.519000	0.35888	1.034000	0.39945	0.533000	0.62120	GAG	.	.	none		0.488	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
UBAP2L	9898	hgsc.bcm.edu	37	1	154209612	154209612	+	Splice_Site	SNP	A	A	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:154209612A>G	ENST00000361546.2	+	7	745	c.703A>G	c.(703-705)Agt>Ggt	p.S235G	UBAP2L_ENST00000271877.7_Splice_Site_p.S246G|UBAP2L_ENST00000428931.1_Splice_Site_p.S235G|UBAP2L_ENST00000343815.6_Splice_Site_p.S235G			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	235					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGATGGGACGAGTGAGTGACC	0.398																																					p.S235G		Atlas-SNP	.											.	UBAP2L	197	.	0			c.A703G						PASS	.						125.0	102.0	110.0					1																	154209612		2203	4300	6503	SO:0001630	splice_region_variant	9898	exon8			GGGACGAGTGAGT	BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.703+1A>G	1.37:g.154209612A>G		Somatic	273	1	0.003663		WXS	Illumina HiSeq	Phase_I	183	98	0.535519	NM_001127320	B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	ENST00000361546.2	37	CCDS1063.1	.	.	.	.	.	.	.	.	.	.	A	7.104	0.574611	0.13623	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000271877;ENST00000412596;ENST00000368504;ENST00000437652;ENST00000361546	T;T;T;T;T;T;T	0.41400	2.87;2.87;2.84;1.01;1.02;1.0;2.87	5.68	5.68	0.88126	.	0.281854	0.44285	D	0.000464	T	0.08088	0.0202	N	0.01242	-0.935	0.31470	N	0.668466	P;B;P;P;P	0.49783	0.882;0.008;0.928;0.928;0.788	B;B;P;P;B	0.46975	0.332;0.004;0.533;0.533;0.287	T	0.10894	-1.0610	10	0.02654	T	1	0.5595	15.1058	0.72322	1.0:0.0:0.0:0.0	.	149;246;228;235;235	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	G	235;235;246;235;246;228;235	ENSP00000345308:S235G;ENSP00000389445:S235G;ENSP00000271877:S246G;ENSP00000389052:S235G;ENSP00000357490:S246G;ENSP00000389717:S228G;ENSP00000355343:S235G	ENSP00000271877:S246G	S	+	1	0	UBAP2L	152476236	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.569000	0.60865	2.161000	0.67846	0.482000	0.46254	AGT	.	.	none		0.398	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1	NM_014847	Missense_Mutation
MUC4	4585	hgsc.bcm.edu	37	3	195509331	195509331	+	Silent	SNP	C	C	A	rs369416005		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:195509331C>A	ENST00000463781.3	-	2	9579	c.9120G>T	c.(9118-9120)ccG>ccT	p.P3040P	MUC4_ENST00000475231.1_Silent_p.P3040P|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	981					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P3040P(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGACAGGAAGCGGGGTGGCGT	0.607																																					p.P3040P		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	1	Substitution - coding silent(1)	endometrium(1)	c.G9120T						scavenged	.						9.0	7.0	7.0					3																	195509331		602	1470	2072	SO:0001819	synonymous_variant	4585	exon2			AGGAAGCGGGGTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9120G>T	3.37:g.195509331C>A		Somatic	77	2	0.025974		WXS	Illumina HiSeq	Phase_I	91	10	0.10989	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.	.	weak		0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NINL	22981	hgsc.bcm.edu	37	20	25457204	25457204	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr20:25457204C>T	ENST00000278886.6	-	17	2796	c.2723G>A	c.(2722-2724)cGc>cAc	p.R908H	NINL_ENST00000422516.1_Intron	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	908					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GGGCTGCATGCGTGACCACCT	0.711																																					p.R908H		Atlas-SNP	.											.	NINL	148	.	0			c.G2723A						PASS	.						10.0	13.0	12.0					20																	25457204		2045	4077	6122	SO:0001583	missense	22981	exon17			TGCATGCGTGACC		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.2723G>A	20.37:g.25457204C>T	ENSP00000278886:p.Arg908His	Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	27	8	0.296296	NM_025176	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	37	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	C	3.161	-0.172044	0.06421	.	.	ENSG00000101004	ENST00000278886	T	0.23754	1.89	2.27	-4.54	0.03452	.	7.030270	0.00166	N	0.000001	T	0.11024	0.0269	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18524	-1.0334	10	0.33141	T	0.24	6.6904	5.9106	0.19027	0.0:0.5264:0.1852:0.2884	.	908	Q9Y2I6	NINL_HUMAN	H	908	ENSP00000278886:R908H	ENSP00000278886:R908H	R	-	2	0	NINL	25405204	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-1.476000	0.01874	-2.579000	0.00168	CGC	.	.	none		0.711	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
OR52W1	120787	hgsc.bcm.edu	37	11	6221264	6221264	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:6221264C>T	ENST00000311352.2	+	1	889	c.811C>T	c.(811-813)Cat>Tat	p.H271Y	RP11-290F24.6_ENST00000600308.1_lincRNA	NM_001005178.1	NP_001005178.1	Q6IF63	O52W1_HUMAN	olfactory receptor, family 52, subfamily W, member 1	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)	11		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCGCTTTGGTCATCACACTGT	0.542																																					p.H271Y		Atlas-SNP	.											.	OR52W1	33	.	0			c.C811T						PASS	.						446.0	414.0	425.0					11																	6221264		2201	4296	6497	SO:0001583	missense	120787	exon1			TTTGGTCATCACA	AB065511	CCDS31407.1	11p15.4	2012-08-09		2004-03-10	ENSG00000175485	ENSG00000175485		"""GPCR / Class A : Olfactory receptors"""	15239	protein-coding gene	gene with protein product				OR52W1P			Standard	NM_001005178		Approved		uc010qzz.2	Q6IF63	OTTHUMG00000165378	ENST00000311352.2:c.811C>T	11.37:g.6221264C>T	ENSP00000309673:p.His271Tyr	Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	50	8	0.16	NM_001005178	Q8NH78	Missense_Mutation	SNP	ENST00000311352.2	37	CCDS31407.1	.	.	.	.	.	.	.	.	.	.	C	6.164	0.398365	0.11696	.	.	ENSG00000175485	ENST00000311352	T	0.37058	1.22	4.59	4.59	0.56863	GPCR, rhodopsin-like superfamily (1);	0.392383	0.18710	N	0.133340	T	0.19366	0.0465	N	0.08118	0	0.22811	N	0.998706	P	0.41313	0.745	B	0.38428	0.273	T	0.08027	-1.0742	10	0.48119	T	0.1	.	10.3227	0.43775	0.1965:0.8035:0.0:0.0	.	271	Q6IF63	O52W1_HUMAN	Y	271	ENSP00000309673:H271Y	ENSP00000309673:H271Y	H	+	1	0	OR52W1	6177840	0.023000	0.18921	0.991000	0.47740	0.037000	0.13140	3.010000	0.49559	2.518000	0.84900	0.563000	0.77884	CAT	.	.	none		0.542	OR52W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383758.1	NM_001005178	
PEX1	5189	hgsc.bcm.edu	37	7	92146905	92146905	+	Silent	SNP	T	T	C			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr7:92146905T>C	ENST00000248633.4	-	5	1019	c.924A>G	c.(922-924)aaA>aaG	p.K308K	PEX1_ENST00000541751.1_5'Flank|PEX1_ENST00000428214.1_Silent_p.K308K|PEX1_ENST00000438045.1_Intron	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	308					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TGGCACAGTGTTTATGAAAAA	0.383																																					p.K308K		Atlas-SNP	.											.	PEX1	102	.	0			c.A924G						PASS	.						73.0	68.0	69.0					7																	92146905		2203	4300	6503	SO:0001819	synonymous_variant	5189	exon5			ACAGTGTTTATGA	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.924A>G	7.37:g.92146905T>C		Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	119	76	0.638655	NM_000466	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Silent	SNP	ENST00000248633.4	37	CCDS5627.1																																																																																			.	.	none		0.383	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	
ANK1	286	hgsc.bcm.edu	37	8	41577226	41577226	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:41577226C>T	ENST00000347528.4	-	10	1143	c.1060G>A	c.(1060-1062)Gct>Act	p.A354T	ANK1_ENST00000396945.1_Missense_Mutation_p.A354T|ANK1_ENST00000352337.4_Missense_Mutation_p.A354T|ANK1_ENST00000396942.1_Missense_Mutation_p.A354T|ANK1_ENST00000379758.2_Missense_Mutation_p.A354T|ANK1_ENST00000289734.7_Missense_Mutation_p.A354T|ANK1_ENST00000265709.8_Missense_Mutation_p.A387T	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	354	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			AGGACCTTAGCCACCCTGTGG	0.622																																					p.A387T		Atlas-SNP	.											.	ANK1	497	.	0			c.G1159A						PASS	.						196.0	180.0	186.0					8																	41577226		2203	4300	6503	SO:0001583	missense	286	exon10			CCTTAGCCACCCT	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1060G>A	8.37:g.41577226C>T	ENSP00000339620:p.Ala354Thr	Somatic	86	0	0		WXS	Illumina HiSeq	Phase_I	68	38	0.558824	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470456	0.84533	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09	5.76	4.89	0.63831	Ankyrin repeat-containing domain (3);	0.107603	0.64402	D	0.000006	T	0.67496	0.2899	L	0.31845	0.965	0.80722	D	1	D;D;P;D;D	0.67145	0.996;0.982;0.794;0.994;0.996	D;P;B;P;D	0.70016	0.967;0.883;0.363;0.837;0.967	T	0.63211	-0.6688	10	0.20046	T	0.44	.	14.6541	0.68820	0.0:0.9304:0.0:0.0696	.	387;354;354;354;354	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	T	354;354;354;354;354;354;387;354	ENSP00000339620:A354T;ENSP00000289734:A354T;ENSP00000369082:A354T;ENSP00000380149:A354T;ENSP00000380147:A354T;ENSP00000309131:A354T;ENSP00000265709:A387T	ENSP00000265709:A387T	A	-	1	0	ANK1	41696383	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	6.086000	0.71352	1.460000	0.47911	0.555000	0.69702	GCT	.	.	none		0.622	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
CRB1	23418	hgsc.bcm.edu	37	1	197390429	197390429	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:197390429G>A	ENST00000367400.3	+	6	1606	c.1471G>A	c.(1471-1473)Gat>Aat	p.D491N	CRB1_ENST00000367399.2_Missense_Mutation_p.D379N|CRB1_ENST00000367397.1_De_novo_Start_OutOfFrame|CRB1_ENST00000544212.1_De_novo_Start_OutOfFrame|CRB1_ENST00000476483.1_3'UTR|CRB1_ENST00000543483.1_Missense_Mutation_p.D190N|CRB1_ENST00000538660.1_Missense_Mutation_p.D491N|CRB1_ENST00000535699.1_Missense_Mutation_p.D422N	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	491	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.		D -> V (found in a patient with early- onset retinal dystrophy; unknown pathological significance). {ECO:0000269|PubMed:20683928}.		cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D491N(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						ATTTGAGGGCGATGGCTTCCT	0.517																																					p.D491N		Atlas-SNP	.											CRB1,bladder,carcinoma,0,1	CRB1	284	1	1	Substitution - Missense(1)	urinary_tract(1)	c.G1471A						PASS	.						108.0	97.0	101.0					1																	197390429		2203	4300	6503	SO:0001583	missense	23418	exon6			GAGGGCGATGGCT		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.1471G>A	1.37:g.197390429G>A	ENSP00000356370:p.Asp491Asn	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	69	40	0.57971	NM_001257966	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.762289	0.00651	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000543483;ENST00000367401	T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22	5.82	-0.494	0.12034	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	T	0.35828	0.0945	N	0.00193	-1.875	0.28017	N	0.934662	B;B;B;B;B	0.10296	0.002;0.0;0.003;0.001;0.001	B;B;B;B;B	0.06405	0.001;0.0;0.002;0.0;0.0	T	0.40701	-0.9549	9	0.11182	T	0.66	.	7.0169	0.24892	0.6755:0.112:0.2124:0.0	.	491;422;379;140;491	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	N	422;491;491;379;190;140	ENSP00000438786:D422N;ENSP00000438091:D491N;ENSP00000356370:D491N;ENSP00000356369:D379N;ENSP00000439579:D190N	ENSP00000356369:D379N	D	+	1	0	CRB1	195657052	0.013000	0.17824	0.007000	0.13788	0.001000	0.01503	0.490000	0.22403	-0.339000	0.08401	-1.283000	0.01379	GAT	.	.	none		0.517	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
BTG2	7832	hgsc.bcm.edu	37	1	203274836	203274836	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:203274836G>A	ENST00000290551.4	+	1	173	c.102G>A	c.(100-102)agG>agA	p.R34R	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	34					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			GCGAGCAGAGGCTTAAGGTCT	0.716																																					p.R34R		Atlas-SNP	.											.	BTG2	16	.	0			c.G102A						PASS	.						15.0	16.0	15.0					1																	203274836		2144	4202	6346	SO:0001819	synonymous_variant	7832	exon1			GCAGAGGCTTAAG		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.102G>A	1.37:g.203274836G>A		Somatic	123	0	0		WXS	Illumina HiSeq	Phase_I	78	27	0.346154	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Silent	SNP	ENST00000290551.4	37	CCDS1437.1																																																																																			.	.	none		0.716	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
L3MBTL4	91133	hgsc.bcm.edu	37	18	6138191	6138191	+	Splice_Site	SNP	A	A	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr18:6138191A>G	ENST00000284898.6	-	14	1400		c.e14+1		L3MBTL4_ENST00000535782.1_Splice_Site|L3MBTL4_ENST00000400104.3_Splice_Site|L3MBTL4_ENST00000400105.2_Splice_Site|L3MBTL4_ENST00000317931.7_Splice_Site	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)						chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				GAAAAATGTTACCTGTGATGT	0.463																																					.	Esophageal Squamous(41;748 902 17366 28959 43175)	Atlas-SNP	.											.	L3MBTL4	87	.	0			c.1199+2T>C						PASS	.						53.0	47.0	49.0					18																	6138191		2203	4300	6503	SO:0001630	splice_region_variant	91133	exon15			AATGTTACCTGTG	BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.1199+1T>C	18.37:g.6138191A>G		Somatic	39	0	0		WXS	Illumina HiSeq	Phase_I	43	14	0.325581	NM_173464	A8MTL8|Q8IXS3	Splice_Site	SNP	ENST00000284898.6	37	CCDS11839.2	.	.	.	.	.	.	.	.	.	.	A	15.63	2.889732	0.52014	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000535782;ENST00000400104	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5945	0.45329	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	L3MBTL4	6128191	1.000000	0.71417	0.999000	0.59377	0.620000	0.37586	4.228000	0.58619	1.773000	0.52216	0.528000	0.53228	.	.	.	none		0.463	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254448.2	NM_173464	Intron
COL4A5	1287	hgsc.bcm.edu	37	X	107816878	107816878	+	Silent	SNP	A	A	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chrX:107816878A>G	ENST00000361603.2	+	9	784	c.540A>G	c.(538-540)ggA>ggG	p.G180G	COL4A5_ENST00000328300.6_Silent_p.G180G	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	180	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GTCCTCCTGGAATACAAGTAA	0.378									Alport syndrome with Diffuse Leiomyomatosis																												p.G180G		Atlas-SNP	.											.	COL4A5	262	.	0			c.A540G						PASS	.						111.0	105.0	107.0					X																	107816878		2203	4300	6503	SO:0001819	synonymous_variant	1287	exon9	Familial Cancer Database		TCCTGGAATACAA	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.540A>G	X.37:g.107816878A>G		Somatic	129	0	0		WXS	Illumina HiSeq	Phase_I	142	12	0.084507	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Silent	SNP	ENST00000361603.2	37	CCDS14543.1																																																																																			.	.	none		0.378	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
CD79B	974	hgsc.bcm.edu	37	17	62006799	62006799	+	Missense_Mutation	SNP	A	A	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:62006799A>T	ENST00000006750.3	-	5	678	c.586T>A	c.(586-588)Tac>Aac	p.Y196N	CD79B_ENST00000392795.3_Missense_Mutation_p.Y197N|CD79B_ENST00000349817.2_Missense_Mutation_p.Y92N	NM_000626.2|NM_021602.2	NP_000617.1|NP_067613.1	P40259	CD79B_HUMAN	CD79b molecule, immunoglobulin-associated beta	196	ITAM. {ECO:0000255|PROSITE- ProRule:PRU00379}.				B cell receptor signaling pathway (GO:0050853)|immune response (GO:0006955)|signal transduction (GO:0007165)	B cell receptor complex (GO:0019815)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)	p.Y196H(2)|p.Y196N(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	15						CTTACCTCGTAGGTGTGATCT	0.632			"""Mis, O"""		DLBCL																																p.Y197N		Atlas-SNP	.		Dom	yes		17	17q23	974	"""CD79b molecule, immunoglobulin-associated beta"""		L	CD79B,NS,lymphoid_neoplasm,0,13	CD79B	38	13	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)	c.T589A						PASS	.						94.0	74.0	81.0					17																	62006799		2203	4300	6503	SO:0001583	missense	974	exon5			CCTCGTAGGTGTG	L27587	CCDS11655.1, CCDS11656.1, CCDS42372.1	17q23	2014-09-17	2006-03-28			ENSG00000007312		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1699	protein-coding gene	gene with protein product		147245	"""CD79B antigen (immunoglobulin-associated beta)"""	IGB		9545642	Standard	XM_005257858		Approved	B29	uc002jdp.1	P40259		ENST00000006750.3:c.586T>A	17.37:g.62006799A>T	ENSP00000006750:p.Tyr196Asn	Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	72	29	0.402778	NM_001039933	Q53FS2|Q9BU06	Missense_Mutation	SNP	ENST00000006750.3	37	CCDS11655.1	.	.	.	.	.	.	.	.	.	.	A	14.45	2.539798	0.45176	.	.	ENSG00000007312	ENST00000349817;ENST00000392795;ENST00000006750	D;D;D	0.96651	-4.08;-4.08;-4.08	4.2	4.2	0.49525	.	0.000000	0.64402	D	0.000002	D	0.95601	0.8570	N	0.24115	0.695	0.49915	D	0.999838	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	D	0.95387	0.8478	10	0.87932	D	0	-12.4743	9.5967	0.39578	1.0:0.0:0.0:0.0	.	92;196	P40259-2;P40259	.;CD79B_HUMAN	N	92;197;196	ENSP00000245862:Y92N;ENSP00000376544:Y197N;ENSP00000006750:Y196N	ENSP00000006750:Y196N	Y	-	1	0	CD79B	59360531	1.000000	0.71417	0.995000	0.50966	0.298000	0.27526	4.559000	0.60796	1.782000	0.52362	0.358000	0.22013	TAC	.	.	none		0.632	CD79B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417711.1		
GPHN	10243	hgsc.bcm.edu	37	14	67147830	67147830	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr14:67147830G>T	ENST00000315266.5	+	2	1191	c.70G>T	c.(70-72)Gat>Tat	p.D24Y	GPHN_ENST00000478722.1_Missense_Mutation_p.D24Y|GPHN_ENST00000459628.1_Missense_Mutation_p.D24Y|GPHN_ENST00000305960.9_Missense_Mutation_p.D24Y|GPHN_ENST00000543237.1_Missense_Mutation_p.D24Y	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	24	MPT Mo-transferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		TTTAGTGAGTGATAGTTGCTT	0.323			T	MLL	AL																																p.D24Y		Atlas-SNP	.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN	79	.	0			c.G70T						PASS	.						74.0	76.0	75.0					14																	67147830		2203	4300	6503	SO:0001583	missense	10243	exon2			GTGAGTGATAGTT	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.70G>T	14.37:g.67147830G>T	ENSP00000312771:p.Asp24Tyr	Somatic	101	0	0		WXS	Illumina HiSeq	Phase_I	114	18	0.157895	NM_001024218	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	37	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890906	0.52014	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000459628;ENST00000543237;ENST00000305960	D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62	5.11	5.11	0.69529	Molybdenum cofactor synthesis (1);Molybdopterin binding (4);	0.000000	0.85682	D	0.000000	D	0.94149	0.8123	H	0.96748	3.875	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.994;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.986;1.0;0.997;0.999;1.0	D	0.95993	0.8987	10	0.87932	D	0	-7.1651	16.0118	0.80409	0.0:0.0:1.0:0.0	.	24;24;24;24;24	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2;G3V582	.;.;GEPH_HUMAN;.;.	Y	24	ENSP00000312771:D24Y;ENSP00000417901:D24Y;ENSP00000452220:D24Y;ENSP00000438404:D24Y;ENSP00000303019:D24Y	ENSP00000303019:D24Y	D	+	1	0	GPHN	66217583	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.659000	0.91116	2.374000	0.81015	0.579000	0.79373	GAT	.	.	none		0.323	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
KRTAP1-1	81851	hgsc.bcm.edu	37	17	39197248	39197248	+	Silent	SNP	G	G	A	rs570985299	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:39197248G>A	ENST00000306271.4	-	1	465	c.402C>T	c.(400-402)tgC>tgT	p.C134C		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	134						keratin filament (GO:0045095)		p.C134C(1)		NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCTCACCACGCAGCAGGGGG	0.672													a|||	3	0.000599042	0.0008	0.0	5008	,	,		16961	0.0		0.0	False		,,,				2504	0.002				p.C134C		Atlas-SNP	.											KRTAP1-1,NS,carcinoma,0,1	KRTAP1-1	23	1	1	Substitution - coding silent(1)	endometrium(1)	c.C402T						scavenged	.						24.0	29.0	27.0					17																	39197248		2078	4173	6251	SO:0001819	synonymous_variant	81851	exon1			CACCACGCAGCAG	AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.402C>T	17.37:g.39197248G>A		Somatic	181	1	0.00552486		WXS	Illumina HiSeq	Phase_I	138	3	0.0217391	NM_030967	A6NC32|Q96S60|Q96S67	Silent	SNP	ENST00000306271.4	37	CCDS42324.1																																																																																			.	.	none		0.672	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257696.1	NM_030967	
KCNH6	81033	hgsc.bcm.edu	37	17	61622590	61622590	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:61622590C>G	ENST00000583023.1	+	13	2667	c.2656C>G	c.(2656-2658)Ccc>Gcc	p.P886A	KCNH6_ENST00000581784.1_Missense_Mutation_p.P797A|KCNH6_ENST00000456941.2_Missense_Mutation_p.P797A|KCNH6_ENST00000314672.5_Missense_Mutation_p.P850A	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	886					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GAGTCCAGGGCCCAGGCTGCC	0.632																																					p.P886A		Atlas-SNP	.											.	KCNH6	122	.	0			c.C2656G						PASS	.						53.0	54.0	54.0					17																	61622590		2203	4300	6503	SO:0001583	missense	81033	exon13			CCAGGGCCCAGGC	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2656C>G	17.37:g.61622590C>G	ENSP00000463533:p.Pro886Ala	Somatic	67	0	0		WXS	Illumina HiSeq	Phase_I	45	22	0.488889	NM_030779	Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	37	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	C	7.956	0.745821	0.15710	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D	0.99220	-5.58	4.82	1.64	0.23874	.	1.794330	0.02752	N	0.117564	D	0.96759	0.8942	L	0.29908	0.895	0.09310	N	0.999998	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	D	0.93664	0.6984	10	0.10377	T	0.69	.	4.0312	0.09710	0.1928:0.5845:0.1298:0.0929	.	727;850;797;886	B4DPJ3;B4DKC0;Q9H252-2;Q9H252	.;.;.;KCNH6_HUMAN	A	886;797	ENSP00000396900:P797A	ENSP00000318212:P886A	P	+	1	0	KCNH6	58976322	0.000000	0.05858	0.005000	0.12908	0.035000	0.12851	0.146000	0.16180	0.253000	0.21552	0.655000	0.94253	CCC	.	.	none		0.632	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779	
EXPH5	23086	hgsc.bcm.edu	37	11	108380629	108380629	+	Missense_Mutation	SNP	C	C	T	rs181581015		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:108380629C>T	ENST00000265843.4	-	6	5715	c.5605G>A	c.(5605-5607)Ggg>Agg	p.G1869R	EXPH5_ENST00000428840.1_Missense_Mutation_p.G1793R|EXPH5_ENST00000525344.1_Missense_Mutation_p.G1862R|EXPH5_ENST00000443411.1_Missense_Mutation_p.G1681R	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1869					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		GTTTTTGTCCCGCTGCGATAA	0.413													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19294	0.0		0.0	False		,,,				2504	0.0				p.G1869R		Atlas-SNP	.											.	EXPH5	193	.	0			c.G5605A						PASS	.	C	ARG/GLY	2,4400	4.2+/-10.8	0,2,2199	60.0	59.0	60.0		5605	-0.9	0.0	11		60	0,8596		0,0,4298	no	missense	EXPH5	NM_015065.2	125	0,2,6497	TT,TC,CC		0.0,0.0454,0.0154	benign	1869/1990	108380629	2,12996	2201	4298	6499	SO:0001583	missense	23086	exon6			TTGTCCCGCTGCG		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.5605G>A	11.37:g.108380629C>T	ENSP00000265843:p.Gly1869Arg	Somatic	152	0	0		WXS	Illumina HiSeq	Phase_I	180	47	0.261111	NM_015065	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	CCDS8341.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	0.005	-2.195634	0.00299	4.54E-4	0.0	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956	T;T;T;T	0.02737	4.4;4.33;4.18;4.4	5.95	-0.868	0.10652	.	0.272209	0.32372	N	0.006197	T	0.00580	0.0019	N	0.00104	-2.125	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.45818	-0.9235	10	0.05351	T	0.99	-1.6345	8.4291	0.32746	0.0:0.177:0.1025:0.7206	.	1869	Q8NEV8	EXPH5_HUMAN	R	1869;1793;1681;1862;699	ENSP00000265843:G1869R;ENSP00000391966:G1793R;ENSP00000411390:G1681R;ENSP00000432546:G1862R	ENSP00000265843:G1869R	G	-	1	0	EXPH5	107885839	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.794000	0.26958	-0.340000	0.08388	-1.090000	0.02178	GGG	C|1.000;T|0.000	0.000	strong		0.413	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
POTEC	388468	hgsc.bcm.edu	37	18	14542888	14542888	+	Silent	SNP	A	A	G	rs543140115	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr18:14542888A>G	ENST00000358970.5	-	1	257	c.258T>C	c.(256-258)caT>caC	p.H86H	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	86			H -> D (in dbSNP:rs45469098). {ECO:0000269|PubMed:15489334}.							NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						AGGAGTTGTCATGGTCTCCAG	0.587													.|||	10	0.00199681	0.0076	0.0	5008	,	,		28860	0.0		0.0	False		,,,				2504	0.0				p.H86H		Atlas-SNP	.											POTEC,NS,carcinoma,-2,1	POTEC	129	1	0			c.T258C						scavenged	.						51.0	57.0	55.0					18																	14542888		692	1591	2283	SO:0001819	synonymous_variant	388468	exon1			GTTGTCATGGTCT	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.258T>C	18.37:g.14542888A>G		Somatic	305	3	0.00983607		WXS	Illumina HiSeq	Phase_I	259	3	0.011583	NM_001137671		Silent	SNP	ENST00000358970.5	37	CCDS45835.1																																																																																			.	.	weak		0.587	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
ATG2A	23130	hgsc.bcm.edu	37	11	64662599	64662599	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:64662599C>G	ENST00000377264.3	-	41	5775	c.5663G>C	c.(5662-5664)gGc>gCc	p.G1888A	ATG2A_ENST00000421419.2_Missense_Mutation_p.G1890A	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1888					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						GCGGATCACGCCCCCCACGGC	0.672																																					p.G1888A		Atlas-SNP	.											.	ATG2A	133	.	0			c.G5663C						PASS	.						39.0	38.0	39.0					11																	64662599		2200	4295	6495	SO:0001583	missense	23130	exon41			ATCACGCCCCCCA		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.5663G>C	11.37:g.64662599C>G	ENSP00000366475:p.Gly1888Ala	Somatic	48	0	0		WXS	Illumina HiSeq	Phase_I	51	14	0.27451	NM_015104	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	37	CCDS31602.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.524797	0.44969	.	.	ENSG00000110046	ENST00000421419;ENST00000377262;ENST00000377264	T;T	0.05996	3.36;3.36	3.99	3.06	0.35304	Autophagy-related, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.14227	0.0344	L	0.47078	1.49	0.53005	D	0.999966	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.14811	-1.0459	10	0.12103	T	0.63	.	10.8388	0.46702	0.1905:0.8095:0.0:0.0	.	1888;1890	Q2TAZ0;Q2TAZ0-3	ATG2A_HUMAN;.	A	1890;281;1888	ENSP00000410522:G1890A;ENSP00000366475:G1888A	ENSP00000366473:G281A	G	-	2	0	ATG2A	64419175	1.000000	0.71417	0.846000	0.33378	0.094000	0.18550	5.489000	0.66875	0.999000	0.39023	0.561000	0.74099	GGC	.	.	none		0.672	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104	
PXDNL	137902	hgsc.bcm.edu	37	8	52321593	52321593	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr8:52321593C>T	ENST00000356297.4	-	17	2691	c.2591G>A	c.(2590-2592)cGc>cAc	p.R864H	PXDNL_ENST00000543296.1_Missense_Mutation_p.R864H	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	864					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.R63L(1)|p.R864L(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GGGGCTGGAGCGCGCGAAGAG	0.662																																					p.R864H		Atlas-SNP	.											PXDNL_ENST00000356297,colon,carcinoma,-1,3	PXDNL	414	3	2	Substitution - Missense(2)	lung(2)	c.G2591A						PASS	.						23.0	27.0	25.0					8																	52321593		2024	4155	6179	SO:0001583	missense	137902	exon17			CTGGAGCGCGCGA		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2591G>A	8.37:g.52321593C>T	ENSP00000348645:p.Arg864His	Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	54	24	0.444444	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.420939	0.42918	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	D;D	0.84660	-1.88;-1.88	3.31	2.41	0.29592	.	0.272281	0.26156	N	0.026002	D	0.94991	0.8379	H	0.99286	4.5	0.35901	D	0.830399	D	0.89917	1.0	D	0.87578	0.998	D	0.95258	0.8366	10	0.87932	D	0	.	9.6539	0.39914	0.2105:0.7895:0.0:0.0	.	864	A1KZ92	PXDNL_HUMAN	H	864	ENSP00000348645:R864H;ENSP00000444865:R864H	ENSP00000348645:R864H	R	-	2	0	PXDNL	52484146	1.000000	0.71417	0.249000	0.24280	0.019000	0.09904	5.019000	0.64060	0.487000	0.27698	0.650000	0.86243	CGC	.	.	none		0.662	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
C3	718	hgsc.bcm.edu	37	19	6696418	6696418	+	Silent	SNP	G	G	A	rs139152390		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr19:6696418G>A	ENST00000245907.6	-	23	3014	c.2922C>T	c.(2920-2922)acC>acT	p.T974T		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	974					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	TCTCAGACTCGGTGTCCGGGA	0.572																																					p.T974T		Atlas-SNP	.											.	C3	192	.	0			c.C2922T						PASS	.	A		1,4405	2.1+/-5.4	0,1,2202	167.0	124.0	138.0		2922	-11.9	0.0	19	dbSNP_134	138	0,8600		0,0,4300	no	coding-synonymous	C3	NM_000064.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		974/1664	6696418	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	718	exon23			AGACTCGGTGTCC	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.2922C>T	19.37:g.6696418G>A		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	77	6	0.0779221	NM_000064	A7E236	Silent	SNP	ENST00000245907.6	37	CCDS32883.1																																																																																			G|1.000;A|0.000	0.000	weak		0.572	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
PKD1	5310	hgsc.bcm.edu	37	16	2166542	2166542	+	Silent	SNP	G	G	A	rs367983387	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr16:2166542G>A	ENST00000262304.4	-	8	1918	c.1710C>T	c.(1708-1710)caC>caT	p.H570H	RP11-304L19.2_ENST00000562027.1_RNA|PKD1_ENST00000423118.1_Silent_p.H570H	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	570					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCACGGGCTCGTGCGGGGCTG	0.687													g|||	17	0.00339457	0.0	0.0014	5008	,	,		12902	0.001		0.0149	False		,,,				2504	0.0				p.H570H		Atlas-SNP	.											.	PKD1	184	.	0			c.C1710T						PASS	.	G	,	3,4305		0,3,2151	7.0	8.0	8.0		1710,1710	0.9	0.0	16		8	40,8422		0,40,4191	no	coding-synonymous,coding-synonymous	PKD1	NM_000296.3,NM_001009944.2	,	0,43,6342	AA,AG,GG		0.4727,0.0696,0.3367	,	570/4303,570/4304	2166542	43,12727	2154	4231	6385	SO:0001819	synonymous_variant	5310	exon8			GGGCTCGTGCGGG	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.1710C>T	16.37:g.2166542G>A		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	62	28	0.451613	NM_000296	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			.	.	weak		0.687	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
C15orf39	56905	hgsc.bcm.edu	37	15	75500343	75500343	+	Nonsense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr15:75500343C>T	ENST00000360639.2	+	2	2274	c.1954C>T	c.(1954-1956)Cga>Tga	p.R652*	C15orf39_ENST00000567617.1_Nonsense_Mutation_p.R652*|C15orf39_ENST00000394987.4_Nonsense_Mutation_p.R652*			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	652						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						CTTCATGTTCCGAAAGTTCAA	0.602																																					p.R652X		Atlas-SNP	.											.	C15orf39	64	.	0			c.C1954T						PASS	.						99.0	85.0	90.0					15																	75500343		2197	4295	6492	SO:0001587	stop_gained	56905	exon2			ATGTTCCGAAAGT	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.1954C>T	15.37:g.75500343C>T	ENSP00000353854:p.Arg652*	Somatic	59	0	0		WXS	Illumina HiSeq	Phase_I	60	19	0.316667	NM_015492	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Nonsense_Mutation	SNP	ENST00000360639.2	37	CCDS10276.1	.	.	.	.	.	.	.	.	.	.	C	42	9.497434	0.99187	.	.	ENSG00000167173	ENST00000360639;ENST00000394987;ENST00000446981	.	.	.	5.64	3.67	0.42095	.	0.378991	0.25701	N	0.028880	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1494	8.5421	0.33399	0.3109:0.5386:0.1506:0.0	.	.	.	.	X	652;652;50	.	ENSP00000353854:R652X	R	+	1	2	C15orf39	73287396	0.996000	0.38824	0.974000	0.42286	0.996000	0.88848	1.192000	0.32150	0.667000	0.31107	0.655000	0.94253	CGA	.	.	none		0.602	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492	
CNTLN	54875	hgsc.bcm.edu	37	9	17135258	17135258	+	Silent	SNP	C	C	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr9:17135258C>A	ENST00000380647.3	+	1	279	c.195C>A	c.(193-195)ggC>ggA	p.G65G	CNTLN_ENST00000262360.5_Silent_p.G65G|CNTLN_ENST00000425824.1_Silent_p.G65G|CNTLN_ENST00000380641.4_Silent_p.G65G|CNTLN_ENST00000484374.1_3'UTR			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	65					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GGTCAGGGGGCCGGCGAGGGC	0.682																																					p.G65G		Atlas-SNP	.											.	CNTLN	128	.	0			c.C195A						PASS	.						12.0	17.0	16.0					9																	17135258		1913	4098	6011	SO:0001819	synonymous_variant	54875	exon1			AGGGGGCCGGCGA	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.195C>A	9.37:g.17135258C>A		Somatic	102	0	0		WXS	Illumina HiSeq	Phase_I	83	25	0.301205	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Silent	SNP	ENST00000380647.3	37	CCDS43789.1																																																																																			.	.	none		0.682	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
DST	667	hgsc.bcm.edu	37	6	56350230	56350230	+	Missense_Mutation	SNP	T	T	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:56350230T>G	ENST00000361203.3	-	83	20134	c.20127A>C	c.(20125-20127)caA>caC	p.Q6709H	DST_ENST00000446842.2_Missense_Mutation_p.Q6494H|DST_ENST00000370788.2_Missense_Mutation_p.Q4623H|DST_ENST00000421834.2_Missense_Mutation_p.Q4732H|DST_ENST00000370769.4_Missense_Mutation_p.Q6820H|DST_ENST00000370754.5_Missense_Mutation_p.Q6998H|DST_ENST00000244364.6_Missense_Mutation_p.Q4406H|DST_ENST00000312431.6_3'UTR			Q03001	DYST_HUMAN	dystonin	6708					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CATCTGTGAATTGTCCAGAAA	0.408																																					p.Q4406H		Atlas-SNP	.											.	DST	1427	.	0			c.A13218C						PASS	.						60.0	58.0	59.0					6																	56350230		1822	4072	5894	SO:0001583	missense	667	exon69			TGTGAATTGTCCA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.20127A>C	6.37:g.56350230T>G	ENSP00000354508:p.Gln6709His	Somatic	105	0	0		WXS	Illumina HiSeq	Phase_I	103	21	0.203883	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	T	14.11	2.438295	0.43326	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52;0.52;0.52	5.76	0.0736	0.14391	.	0.000000	0.52532	D	0.000071	T	0.59088	0.2168	M	0.78456	2.415	0.32844	D	0.505733	D;D;D;D;D;D	0.89917	0.998;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D	0.97110	0.998;1.0;0.998;0.94;0.999;0.998	T	0.64993	-0.6276	9	0.62326	D	0.03	.	11.513	0.50504	0.0:0.4674:0.0:0.5326	.	4732;6820;6998;102;6818;4406	Q5TBT1;E7ERU2;E9PEB9;Q9H722;Q03001;Q03001-8	.;.;.;.;DYST_HUMAN;.	H	4406;6998;6820;4732;6494;4623;6709	ENSP00000244364:Q4406H;ENSP00000359790:Q6998H;ENSP00000359805:Q6820H;ENSP00000400883:Q4732H;ENSP00000393645:Q6494H;ENSP00000359824:Q4623H;ENSP00000354508:Q6709H	ENSP00000244364:Q4406H	Q	-	3	2	DST	56458189	0.986000	0.35501	0.997000	0.53966	0.669000	0.39330	0.216000	0.17585	-0.125000	0.11703	-0.263000	0.10527	CAA	.	.	none		0.408	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
FAT1	2195	hgsc.bcm.edu	37	4	187539926	187539926	+	Missense_Mutation	SNP	A	A	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:187539926A>T	ENST00000441802.2	-	10	8023	c.7814T>A	c.(7813-7815)aTc>aAc	p.I2605N		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2605	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						ACTGGACCCGATATTCACTTC	0.468										HNSCC(5;0.00058)																											p.I2605N	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.T7814A						PASS	.						56.0	55.0	56.0					4																	187539926		1986	4156	6142	SO:0001583	missense	2195	exon10			GACCCGATATTCA	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.7814T>A	4.37:g.187539926A>T	ENSP00000406229:p.Ile2605Asn	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	101	26	0.257426	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	A	14.05	2.420334	0.42918	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.01854	4.6	5.1	5.1	0.69264	Cadherin (3);Cadherin-like (1);	0.158326	0.56097	D	0.000030	T	0.19327	0.0464	H	0.95539	3.685	0.58432	D	0.999999	D	0.64830	0.994	D	0.66716	0.946	T	0.09465	-1.0673	10	0.87932	D	0	.	15.3444	0.74324	1.0:0.0:0.0:0.0	.	2605	Q14517	FAT1_HUMAN	N	2605;2607	ENSP00000406229:I2605N	ENSP00000260147:I2607N	I	-	2	0	FAT1	187776920	1.000000	0.71417	0.445000	0.26908	0.015000	0.08874	9.139000	0.94554	2.263000	0.75096	0.533000	0.62120	ATC	.	.	none		0.468	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
HYDIN	54768	hgsc.bcm.edu	37	16	71264561	71264561	+	5'UTR	SNP	A	A	G	rs3743953	byFrequency	TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr16:71264561A>G	ENST00000393567.2	-	0	31				HYDIN_ENST00000288168.10_Splice_Site|HYDIN_ENST00000541601.1_Splice_Site|HYDIN_ENST00000393550.2_5'Flank|HYDIN_ENST00000448691.1_5'UTR|HYDIN_ENST00000448089.2_5'Flank|HYDIN_ENST00000321489.5_5'UTR|HYDIN_ENST00000538248.1_Silent_p.G10G	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein						cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGGGCTCCATACCCAGCTTGA	0.662													A|||	820	0.163738	0.0083	0.3689	5008	,	,		13863	0.2768		0.1014	False		,,,				2504	0.1759				p.G10G		Atlas-SNP	.											.	HYDIN	788	.	0			c.T30C						PASS	.																																			SO:0001623	5_prime_UTR_variant	54768	exon1			CTCCATACCCAGC	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.-120T>C	16.37:g.71264561A>G		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_001198542	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1	378	0.17307692307692307	10	0.02032520325203252	118	0.3259668508287293	168	0.2937062937062937	82	0.10817941952506596	A	5.517	0.280404	0.10458	.	.	ENSG00000157423	ENST00000541601;ENST00000288168	.	.	.	3.46	-0.217	0.13149	.	.	.	.	.	.	.	.	.	.	.	0.47341	P	6.099999999999994E-4	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.6954	0.12800	0.4241:0.3879:0.0:0.1879	rs3743953	.	.	.	.	-1	.	.	.	-	.	.	HYDIN	69822062	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	0.405000	0.21015	-0.072000	0.12864	0.379000	0.24179	.	A|0.773;G|0.227	0.227	strong		0.662	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
SLC5A12	159963	hgsc.bcm.edu	37	11	26700336	26700336	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:26700336G>A	ENST00000396005.3	-	13	1811	c.1502C>T	c.(1501-1503)tCg>tTg	p.S501L		NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	501					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						GTAGGAGATCGAGTACCAGGT	0.468																																					p.S501L		Atlas-SNP	.											.	SLC5A12	134	.	0			c.C1502T						PASS	.						122.0	121.0	121.0					11																	26700336		1978	4171	6149	SO:0001583	missense	159963	exon13			GAGATCGAGTACC	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.1502C>T	11.37:g.26700336G>A	ENSP00000379326:p.Ser501Leu	Somatic	117	0	0		WXS	Illumina HiSeq	Phase_I	107	7	0.0654206	NM_178498	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	37	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	G	21.1	4.102821	0.76983	.	.	ENSG00000148942	ENST00000396005	T	0.77750	-1.12	5.95	5.95	0.96441	.	0.451885	0.21540	N	0.072906	D	0.84406	0.5465	M	0.72576	2.205	0.80722	D	1	D	0.56035	0.974	P	0.55391	0.775	D	0.85350	0.1101	10	0.72032	D	0.01	.	14.7327	0.69393	0.0:0.1448:0.8552:0.0	.	501	Q1EHB4	SC5AC_HUMAN	L	501	ENSP00000379326:S501L	ENSP00000379326:S501L	S	-	2	0	SLC5A12	26656912	1.000000	0.71417	0.842000	0.33263	0.625000	0.37756	5.509000	0.67012	2.825000	0.97269	0.655000	0.94253	TCG	.	.	none		0.468	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
KDR	3791	hgsc.bcm.edu	37	4	55961059	55961059	+	Missense_Mutation	SNP	G	G	A	rs530419081		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:55961059G>A	ENST00000263923.4	-	21	3176	c.2881C>T	c.(2881-2883)Cgg>Tgg	p.R961W	RP11-530I17.1_ENST00000511222.1_RNA	NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	961	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.R961W(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCCAAGCGCCGTTTCAGATCC	0.488			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)			G|||	1	0.000199681	0.0	0.0	5008	,	,		18407	0.0		0.0	False		,,,				2504	0.001				p.R961W		Atlas-SNP	.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	KDR,NS,carcinoma,0,1	KDR	307	1	1	Substitution - Missense(1)	breast(1)	c.C2881T						PASS	.						122.0	112.0	115.0					4																	55961059		2203	4300	6503	SO:0001583	missense	3791	exon21			AGCGCCGTTTCAG	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2881C>T	4.37:g.55961059G>A	ENSP00000263923:p.Arg961Trp	Somatic	137	0	0		WXS	Illumina HiSeq	Phase_I	105	23	0.219048	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111932	0.77210	.	.	ENSG00000128052	ENST00000263923	T	0.77620	-1.11	5.87	4.08	0.47627	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.331135	0.32258	N	0.006349	T	0.77011	0.4068	L	0.42245	1.32	0.38997	D	0.959262	D	0.76494	0.999	P	0.53185	0.72	T	0.78303	-0.2256	10	0.72032	D	0.01	.	9.5094	0.39067	0.0669:0.0:0.679:0.2541	.	961	P35968	VGFR2_HUMAN	W	961	ENSP00000263923:R961W	ENSP00000263923:R961W	R	-	1	2	KDR	55655816	1.000000	0.71417	0.974000	0.42286	0.668000	0.39293	3.418000	0.52721	0.755000	0.32990	0.655000	0.94253	CGG	.	.	none		0.488	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
FRG1	2483	hgsc.bcm.edu	37	4	190878658	190878658	+	Splice_Site	SNP	G	G	A	rs76810924		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:190878658G>A	ENST00000226798.4	+	6	759		c.e6+1		FRG1_ENST00000514482.1_Splice_Site	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1						mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AATGATCAAGGTAATGATGAC	0.348																																					.		Atlas-SNP	.											FRG1,right_upper_lobe,carcinoma,0,1	FRG1	76	1	0			c.537+1G>A						scavenged	.						47.0	43.0	44.0					4																	190878658		2169	4247	6416	SO:0001630	splice_region_variant	2483	exon6			ATCAAGGTAATGA	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.537+1G>A	4.37:g.190878658G>A		Somatic	520	10	0.0192308		WXS	Illumina HiSeq	Phase_I	419	12	0.0286396	NM_004477	A8K775	Splice_Site	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	N	15.05	2.718286	0.48622	.	.	ENSG00000109536	ENST00000226798;ENST00000524583	.	.	.	3.8	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6226	0.62146	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1	191115652	1.000000	0.71417	1.000000	0.80357	0.557000	0.35523	9.554000	0.98121	1.860000	0.53959	0.454000	0.30748	.	G|0.875;A|0.125	0.125	weak		0.348	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	Intron
FAM13C	220965	hgsc.bcm.edu	37	10	61028362	61028362	+	Missense_Mutation	SNP	C	C	T	rs534813877		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr10:61028362C>T	ENST00000373868.2	-	8	980	c.893G>A	c.(892-894)cGg>cAg	p.R298Q	FAM13C_ENST00000373867.3_Missense_Mutation_p.R215Q|FAM13C_ENST00000442566.3_Missense_Mutation_p.R319Q|FAM13C_ENST00000277705.6_Missense_Mutation_p.R319Q|FAM13C_ENST00000422313.2_Missense_Mutation_p.R298Q|FAM13C_ENST00000435852.2_Missense_Mutation_p.R298Q|FAM13C_ENST00000419214.2_Missense_Mutation_p.R298Q|FAM13C_ENST00000468840.2_Missense_Mutation_p.R215Q	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	298								p.R298L(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CCGAATTTTCCGCTTGAGGCT	0.502													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18151	0.0		0.0	False		,,,				2504	0.0				p.R298Q		Atlas-SNP	.											FAM13C,mouth,carcinoma,0,1	FAM13C	124	1	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G893A						PASS	.						70.0	69.0	69.0					10																	61028362		2203	4300	6503	SO:0001583	missense	220965	exon8			ATTTTCCGCTTGA	U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.893G>A	10.37:g.61028362C>T	ENSP00000362975:p.Arg298Gln	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	50	11	0.22	NM_198215	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	ENST00000373868.2	37	CCDS7255.1	.	.	.	.	.	.	.	.	.	.	C	32	5.178996	0.94846	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313;ENST00000468696	T;T;T;T;T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;0.9;-1.12;-1.12;-1.12;-1.12	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	D	0.86768	0.6012	L	0.55834	1.745	0.39444	D	0.967292	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.978;0.993;0.984;0.998	D	0.84996	0.0897	10	0.45353	T	0.12	-9.5074	20.8794	0.99867	0.0:1.0:0.0:0.0	.	298;215;298;298;298	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	Q	215;298;319;319;298;215;298;298;76	ENSP00000362974:R215Q;ENSP00000362975:R298Q;ENSP00000395661:R319Q;ENSP00000277705:R319Q;ENSP00000391993:R298Q;ENSP00000423896:R215Q;ENSP00000392302:R298Q;ENSP00000400241:R298Q;ENSP00000445068:R76Q	ENSP00000277705:R319Q	R	-	2	0	FAM13C	60698368	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	3.452000	0.52971	2.941000	0.99782	0.655000	0.94253	CGG	.	.	none		0.502	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2		
MUC6	4588	hgsc.bcm.edu	37	11	1017566	1017566	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr11:1017566G>A	ENST00000421673.2	-	31	5285	c.5235C>T	c.(5233-5235)acC>acT	p.T1745T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1745	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGATGTAGAGGTTTTGGCCG	0.547																																					p.T1745T		Atlas-SNP	.											MUC6_ENST00000421673,NS,carcinoma,-2,2	MUC6	408	2	0			c.C5235T						scavenged	.						769.0	740.0	750.0					11																	1017566		2199	4287	6486	SO:0001819	synonymous_variant	4588	exon31			TGTAGAGGTTTTG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5235C>T	11.37:g.1017566G>A		Somatic	253	10	0.0395257		WXS	Illumina HiSeq	Phase_I	271	24	0.0885609	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																			.	.	none		0.547	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
CCDC57	284001	hgsc.bcm.edu	37	17	80121138	80121138	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:80121138G>A	ENST00000389641.4	-	13	2014	c.1978C>T	c.(1978-1980)Ctc>Ttc	p.L660F	RP11-1376P16.1_ENST00000582774.1_RNA|CCDC57_ENST00000392343.3_Missense_Mutation_p.L660F|CCDC57_ENST00000392347.1_Missense_Mutation_p.L660F|CCDC57_ENST00000327026.3_5'UTR			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	660										endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			AGCTTCCTGAGTGCCAGTCCA	0.582																																					p.L660F		Atlas-SNP	.											.	CCDC57	102	.	0			c.C1978T						PASS	.						124.0	129.0	127.0					17																	80121138		2022	4182	6204	SO:0001583	missense	284001	exon13			TCCTGAGTGCCAG	BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.1978C>T	17.37:g.80121138G>A	ENSP00000374292:p.Leu660Phe	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	84	30	0.357143	NM_198082	A6NP51|A8MQC7|Q8IWG2|Q8TER3	Missense_Mutation	SNP	ENST00000389641.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.19|10.19	1.281031|1.281031	0.23392|0.23392	.|.	.|.	ENSG00000176155|ENSG00000176155	ENST00000389641;ENST00000392347;ENST00000327026;ENST00000392343|ENST00000419322	T;T;T|.	0.54071|.	1.93;1.93;0.59|.	2.86|2.86	-0.301|-0.301	0.12800|0.12800	.|.	0.893166|.	0.09083|.	N|.	0.851066|.	T|T	0.43010|0.43010	0.1228|0.1228	M|M	0.67953|0.67953	2.075|2.075	0.09310|0.09310	N|N	1|1	B;B|.	0.27498|.	0.18;0.09|.	B;B|.	0.31442|.	0.13;0.046|.	T|T	0.38972|0.38972	-0.9636|-0.9636	10|5	0.66056|.	D|.	0.02|.	-0.0705|-0.0705	5.0858|5.0858	0.14680|0.14680	0.4431:0.0:0.5569:0.0|0.4431:0.0:0.5569:0.0	.|.	660;660|.	Q2TAC2-2;Q2TAC2|.	.;CCD57_HUMAN|.	F|I	660;660;168;660|5	ENSP00000374292:L660F;ENSP00000376158:L660F;ENSP00000376154:L660F|.	ENSP00000315967:L168F|.	L|T	-|-	1|2	0|0	CCDC57|CCDC57	77714427|77714427	0.115000|0.115000	0.22152|0.22152	0.001000|0.001000	0.08648|0.08648	0.047000|0.047000	0.14425|0.14425	1.267000|1.267000	0.33050|0.33050	-0.017000|-0.017000	0.14103|0.14103	-0.262000|-0.262000	0.10625|0.10625	CTC|ACT	.	.	none		0.582	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000277182.3	NM_198082	
MUC17	140453	hgsc.bcm.edu	37	7	100683876	100683876	+	Missense_Mutation	SNP	T	T	G	rs145514577		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr7:100683876T>G	ENST00000306151.4	+	3	9243	c.9179T>G	c.(9178-9180)aTt>aGt	p.I3060S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3060	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCAGTGGCCATTCCTGAGGCT	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		25521	0.0		0.001	False		,,,				2504	0.0				p.I3060S		Atlas-SNP	.											MUC17,NS,carcinoma,0,1	MUC17	804	1	0			c.T9179G						scavenged	.						275.0	283.0	280.0					7																	100683876		2203	4300	6503	SO:0001583	missense	140453	exon3			TGGCCATTCCTGA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9179T>G	7.37:g.100683876T>G	ENSP00000302716:p.Ile3060Ser	Somatic	32	3	0.09375		WXS	Illumina HiSeq	Phase_I	23	4	0.173913	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	N	0.327	-0.958208	0.02267	.	.	ENSG00000169876	ENST00000306151	T	0.02197	4.4	0.814	-0.258	0.12975	.	.	.	.	.	T	0.00998	0.0033	N	0.03608	-0.345	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.48681	-0.9014	9	0.17369	T	0.5	.	3.7091	0.08413	0.0:0.5408:0.2591:0.2001	.	3060	Q685J3	MUC17_HUMAN	S	3060	ENSP00000302716:I3060S	ENSP00000302716:I3060S	I	+	2	0	MUC17	100470596	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-4.610000	0.00209	-0.661000	0.05345	-2.058000	0.00401	ATT	.	.	weak		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
RCOR3	55758	hgsc.bcm.edu	37	1	211486068	211486068	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr1:211486068G>A	ENST00000367005.4	+	10	1049	c.908G>A	c.(907-909)cGc>cAc	p.R303H	RCOR3_ENST00000452621.2_Missense_Mutation_p.R361H|RCOR3_ENST00000367006.4_Intron|RCOR3_ENST00000419091.2_Missense_Mutation_p.R361H|RCOR3_ENST00000526255.1_3'UTR	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	303	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		CCAGGTGTCCGCAAATATGGT	0.398																																					p.R361H		Atlas-SNP	.											RCOR3,NS,carcinoma,+1,1	RCOR3	51	1	0			c.G1082A						scavenged	.						101.0	102.0	101.0					1																	211486068		2203	4300	6503	SO:0001583	missense	55758	exon11			GTGTCCGCAAATA	AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.908G>A	1.37:g.211486068G>A	ENSP00000355972:p.Arg303His	Somatic	141	0	0		WXS	Illumina HiSeq	Phase_I	120	4	0.0333333	NM_001136223	B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Missense_Mutation	SNP	ENST00000367005.4	37	CCDS31016.1	.	.	.	.	.	.	.	.	.	.	G	19.64	3.865091	0.71949	.	.	ENSG00000117625	ENST00000452621;ENST00000419091;ENST00000367005;ENST00000529763	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.22	5.22	0.72569	Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.85682	D	0.000000	T	0.72366	0.3451	M	0.90483	3.12	0.54753	D	0.999986	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.985;0.999;0.998	T	0.77859	-0.2431	10	0.59425	D	0.04	-5.1021	19.1219	0.93365	0.0:0.0:1.0:0.0	.	361;303;361	Q9P2K3-3;Q9P2K3;Q9P2K3-4	.;RCOR3_HUMAN;.	H	361;361;303;121	ENSP00000398558:R361H;ENSP00000413929:R361H;ENSP00000355972:R303H;ENSP00000437048:R121H	ENSP00000355972:R303H	R	+	2	0	RCOR3	209552691	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.685000	0.98661	2.590000	0.87494	0.650000	0.86243	CGC	.	.	none		0.398	RCOR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089821.1	NM_018254	
ACACA	31	hgsc.bcm.edu	37	17	35609904	35609904	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr17:35609904C>T	ENST00000394406.2	-	15	1964	c.1774G>A	c.(1774-1776)Gaa>Aaa	p.E592K	ACACA_ENST00000335166.5_Missense_Mutation_p.E514K|ACACA_ENST00000360679.3_Missense_Mutation_p.E534K|ACACA_ENST00000353139.5_Missense_Mutation_p.E629K	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	592	Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	ATCAGGTATTCAACTGTAGTT	0.423																																					p.E629K	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	Atlas-SNP	.											.	ACACA	395	.	0			c.G1885A						PASS	.						159.0	155.0	156.0					17																	35609904		2203	4300	6503	SO:0001583	missense	31	exon15			GGTATTCAACTGT	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.1774G>A	17.37:g.35609904C>T	ENSP00000377928:p.Glu592Lys	Somatic	95	0	0		WXS	Illumina HiSeq	Phase_I	91	17	0.186813	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	37	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	C	36	5.896819	0.97081	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	6.04	6.04	0.98038	Rudiment single hybrid motif (1);ATP-grasp fold, subdomain 2 (1);Biotin carboxylation domain (1);Biotin carboxylase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.68366	0.2993	M	0.82056	2.57	0.80722	D	1	D;D;D	0.60575	0.984;0.988;0.984	D;D;P	0.71414	0.973;0.934;0.891	T	0.68808	-0.5311	10	0.59425	D	0.04	-18.994	19.5674	0.95401	0.0:1.0:0.0:0.0	.	629;592;534	Q13085-4;Q13085;Q13085-2	.;ACACA_HUMAN;.	K	629;534;592;616;514	ENSP00000344789:E629K;ENSP00000353898:E534K;ENSP00000377928:E592K;ENSP00000335323:E514K	ENSP00000335323:E514K	E	-	1	0	ACACA	32684017	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.818000	0.86416	2.873000	0.98535	0.561000	0.74099	GAA	.	.	none		0.423	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
NELFB	25920	hgsc.bcm.edu	37	9	140158730	140158730	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr9:140158730C>T	ENST00000343053.4	+	6	1154	c.817C>T	c.(817-819)Cgg>Tgg	p.R273W		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	273					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CATCCGAGAGCGGTTCGTGGA	0.657																																					p.R273W		Atlas-SNP	.											.	.	.	.	0			c.C817T						PASS	.						51.0	48.0	49.0					9																	140158730		2200	4299	6499	SO:0001583	missense	25920	exon6			CGAGAGCGGTTCG	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.817C>T	9.37:g.140158730C>T	ENSP00000339495:p.Arg273Trp	Somatic	38	0	0		WXS	Illumina HiSeq	Phase_I	33	10	0.30303	NM_015456	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	ENST00000343053.4	37	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.917586	0.73098	.	.	ENSG00000188986	ENST00000343053	.	.	.	4.85	2.75	0.32379	.	0.107079	0.64402	D	0.000008	T	0.55657	0.1934	L	0.38175	1.15	0.35791	D	0.822412	D	0.65815	0.995	P	0.59889	0.865	T	0.66232	-0.5975	9	0.87932	D	0	-52.3267	10.4259	0.44378	0.5916:0.4084:0.0:0.0	.	273	Q8WX92	NELFB_HUMAN	W	273	.	ENSP00000339495:R273W	R	+	1	2	COBRA1	139278551	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.438000	0.59961	1.001000	0.39076	0.313000	0.20887	CGG	.	.	none		0.657	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	
DSPP	1834	hgsc.bcm.edu	37	4	88536460	88536460	+	Silent	SNP	C	C	T	rs199691318		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr4:88536460C>T	ENST00000282478.7	+	4	2679	c.2646C>T	c.(2644-2646)agC>agT	p.S882S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S882S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	882	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcagtgatagcagtgacagca	0.498																																					p.S882S		Atlas-SNP	.											.	DSPP	174	.	0			c.C2646T						PASS	.						73.0	87.0	82.0					4																	88536460		1617	2929	4546	SO:0001819	synonymous_variant	1834	exon5			TGATAGCAGTGAC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2646C>T	4.37:g.88536460C>T		Somatic	248	0	0		WXS	Illumina HiSeq	Phase_I	236	27	0.114407	NM_014208	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.	.	weak		0.498	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
PRDM1	639	hgsc.bcm.edu	37	6	106553289	106553289	+	Nonsense_Mutation	SNP	C	C	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr6:106553289C>G	ENST00000369096.4	+	5	1488	c.1254C>G	c.(1252-1254)taC>taG	p.Y418*	PRDM1_ENST00000369091.2_Nonsense_Mutation_p.Y382*|PRDM1_ENST00000369089.3_Nonsense_Mutation_p.Y284*	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	418					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		TGCCCCCCTACGGCATGAATT	0.587			"""D, N, Mis, F, S"""		DLBCL																																p.Y418X		Atlas-SNP	.		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	.	PRDM1	195	.	0			c.C1254G						PASS	.						77.0	58.0	65.0					6																	106553289		2203	4300	6503	SO:0001587	stop_gained	639	exon5			CCCCTACGGCATG		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.1254C>G	6.37:g.106553289C>G	ENSP00000358092:p.Tyr418*	Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	33	21	0.636364	NM_001198	B2REA6|E1P5E0|Q86WM7	Nonsense_Mutation	SNP	ENST00000369096.4	37	CCDS5054.2	.	.	.	.	.	.	.	.	.	.	C	35	5.568123	0.96540	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000369089	.	.	.	5.32	-4.24	0.03777	.	0.055914	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.8074	15.6863	0.77411	0.0:0.3976:0.0:0.6024	.	.	.	.	X	382;418;382;284	.	ENSP00000358085:Y284X	Y	+	3	2	PRDM1	106659982	0.001000	0.12720	0.465000	0.27155	0.971000	0.66376	-1.479000	0.02327	-0.847000	0.04168	-0.150000	0.13652	TAC	.	.	none		0.587	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3		
AGAP2	116986	hgsc.bcm.edu	37	12	58131511	58131511	+	Silent	SNP	G	G	A			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:58131511G>A	ENST00000547588.1	-	1	518	c.519C>T	c.(517-519)acC>acT	p.T173T	AGAP2_ENST00000257897.3_Intron	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	173					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						TCCGGCTGCCGGTGCCAGGGT	0.766																																					p.T173T		Atlas-SNP	.											.	AGAP2	167	.	0			c.C519T						PASS	.						2.0	2.0	2.0					12																	58131511		1052	2723	3775	SO:0001819	synonymous_variant	116986	exon1			GCTGCCGGTGCCA	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.519C>T	12.37:g.58131511G>A		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	50	7	0.14	NM_001122772	A8K9F7|O00578|Q548E0|Q8IWU3	Silent	SNP	ENST00000547588.1	37	CCDS44932.1	.	.	.	.	.	.	.	.	.	.	g	3.978	-0.007039	0.07773	.	.	ENSG00000135439	ENST00000328568	.	.	.	4.07	-0.962	0.10333	.	.	.	.	.	T	0.54159	0.1841	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47446	-0.9117	4	.	.	.	.	8.364	0.32376	0.5943:0.0:0.4057:0.0	.	.	.	.	W	37	.	.	R	-	1	2	AGAP2	56417778	0.000000	0.05858	0.991000	0.47740	0.624000	0.37722	-3.808000	0.00361	-0.164000	0.10927	-0.372000	0.07161	CGG	.	.	none		0.766	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
POMT2	29954	hgsc.bcm.edu	37	14	77762563	77762563	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr14:77762563A>G	ENST00000261534.4	-	9	1262	c.1060T>C	c.(1060-1062)Tat>Cat	p.Y354H		NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	354	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		GAGTGCAGATAGCCGATGGCC	0.602																																					p.Y354H		Atlas-SNP	.											.	POMT2	47	.	0			c.T1060C						PASS	.						99.0	67.0	78.0					14																	77762563		2203	4300	6503	SO:0001583	missense	29954	exon9			GCAGATAGCCGAT	AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.1060T>C	14.37:g.77762563A>G	ENSP00000261534:p.Tyr354His	Somatic	34	0	0		WXS	Illumina HiSeq	Phase_I	51	7	0.137255	NM_013382	Q9NSG6|Q9P1W0|Q9P1W2	Missense_Mutation	SNP	ENST00000261534.4	37	CCDS9857.1	.	.	.	.	.	.	.	.	.	.	A	19.06	3.753167	0.69648	.	.	ENSG00000009830	ENST00000261534	D	0.88509	-2.39	4.98	4.98	0.66077	MIR motif (2);MIR (2);	0.000000	0.85682	D	0.000000	D	0.95014	0.8386	M	0.88842	2.985	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.95884	0.8901	10	0.87932	D	0	-7.1602	14.6543	0.68823	1.0:0.0:0.0:0.0	.	354	Q9UKY4	POMT2_HUMAN	H	354	ENSP00000261534:Y354H	ENSP00000261534:Y354H	Y	-	1	0	POMT2	76832316	1.000000	0.71417	1.000000	0.80357	0.278000	0.26855	9.179000	0.94861	1.859000	0.53934	0.379000	0.24179	TAT	.	.	none		0.602	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414155.1	NM_013382	
MYD88	4615	hgsc.bcm.edu	37	3	38182641	38182641	+	Nonstop_Mutation	SNP	T	T	C	rs387907272		TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr3:38182641T>C	ENST00000495303.1	+	3	483	c.478T>C	c.(478-480)Tga>Cga	p.*160R	MYD88_ENST00000396334.3_Missense_Mutation_p.L265P|MYD88_ENST00000481122.1_3'UTR|MYD88_ENST00000424893.1_Missense_Mutation_p.L220P|MYD88_ENST00000417037.2_Missense_Mutation_p.L273P|MYD88_ENST00000443433.2_Nonstop_Mutation_p.*205R	NM_001172566.1	NP_001166037.1	Q99836	MYD88_HUMAN	myeloid differentiation primary response 88	0	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|establishment of endothelial intestinal barrier (GO:0090557)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to molecule of fungal origin (GO:0002238)|response to peptidoglycan (GO:0032494)|response to virus (GO:0009615)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|type I interferon biosynthetic process (GO:0045351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)	death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|TIR domain binding (GO:0070976)	p.L265P(188)		breast(1)|haematopoietic_and_lymphoid_tissue(226)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	237				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CAGAAGCGACTGATCCCCATC	0.552			Mis		ABC-DLBCL								T|||	1	0.000199681	0.0	0.0	5008	,	,		22034	0.0		0.001	False		,,,				2504	0.0				p.X205R		Atlas-SNP	.		Dom	yes		3	3p22	4615	myeloid differentiation primary response gene (88)		L	MYD88,NS,lymphoid_neoplasm,0,828	MYD88	900	828	188	Substitution - Missense(188)	haematopoietic_and_lymphoid_tissue(188)	c.T613C						PASS	.						148.0	119.0	129.0					3																	38182641		2203	4300	6503	SO:0001578	stop_lost	4615	exon4			AGCGACTGATCCC	U84408	CCDS2674.2, CCDS54565.1, CCDS54566.1, CCDS54567.1, CCDS54568.1	3p22	2014-09-17	2012-11-15		ENSG00000172936	ENSG00000172936			7562	protein-coding gene	gene with protein product		602170	"""myeloid differentiation primary response gene (88)"""			9013863	Standard	NM_002468		Approved		uc003chx.3	Q99836	OTTHUMG00000131083	ENST00000495303.1:c.478T>C	3.37:g.38182641T>C	ENSP00000417848:p.*160Argext*8	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	80	30	0.375	NM_001172569	B4DKH8|B4DKU4|B4DQ60|B4DQ72|J3KPU4|J3KQ87|J3KQJ6|P78397|Q53XS7	Missense_Mutation	SNP	ENST00000495303.1	37	CCDS54568.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.85|18.85	3.710754|3.710754	0.68730|0.68730	.|.	.|.	ENSG00000172936|ENSG00000172936	ENST00000417037;ENST00000396334;ENST00000424893;ENST00000421516;ENST00000415158|ENST00000495303;ENST00000443433	T;T;T;T|.	0.15487|.	2.42;2.42;2.42;2.42|.	5.74|5.74	5.74|5.74	0.90152|0.90152	Toll/interleukin-1 receptor homology (TIR) domain (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.71676|.	0.3368|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.998;0.999;0.999|.	T|.	0.70626|.	-0.4820|.	9|.	0.87932|.	D|.	0|.	-17.9268|-17.9268	15.535|15.535	0.75996|0.75996	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	207;252;241|.	Q99836-2;Q99836;B4E3D6|.	.;MYD88_HUMAN;.|.	P|R	273;265;220;272;241|160;205	ENSP00000401399:L273P;ENSP00000379625:L265P;ENSP00000389979:L220P;ENSP00000391753:L272P|.	ENSP00000379625:L265P|.	L|X	+|+	2|1	0|0	MYD88|MYD88	38157645|38157645	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.639000|7.639000	0.83342|0.83342	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	CTG|TGA	.	.	none		0.552	MYD88-008	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000342700.1	NM_002468	
SUSD2	56241	hgsc.bcm.edu	37	22	24583607	24583607	+	Nonsense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr22:24583607C>T	ENST00000358321.3	+	12	2221	c.1960C>T	c.(1960-1962)Caa>Taa	p.Q654*		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	654	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						CTTCCTGTACCAACCCAAGCA	0.607																																					p.Q654X		Atlas-SNP	.											.	SUSD2	68	.	0			c.C1960T						PASS	.						170.0	136.0	148.0					22																	24583607		2203	4300	6503	SO:0001587	stop_gained	56241	exon12			CTGTACCAACCCA	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.1960C>T	22.37:g.24583607C>T	ENSP00000351075:p.Gln654*	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	92	30	0.326087	NM_019601	Q9H5Y6	Nonsense_Mutation	SNP	ENST00000358321.3	37	CCDS13824.1	.	.	.	.	.	.	.	.	.	.	C	38	6.727593	0.97792	.	.	ENSG00000099994	ENST00000358321	.	.	.	4.52	-4.27	0.03744	.	0.879590	0.09795	N	0.754864	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-0.0961	12.2189	0.54423	0.1287:0.2034:0.6679:0.0	.	.	.	.	X	654	.	ENSP00000351075:Q654X	Q	+	1	0	SUSD2	22913607	0.000000	0.05858	0.000000	0.03702	0.884000	0.51177	0.100000	0.15231	-0.175000	0.10725	0.505000	0.49811	CAA	.	.	none		0.607	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	
CCER1	196477	hgsc.bcm.edu	37	12	91348068	91348068	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A68N-01A-11D-A31X-10	TCGA-RQ-A68N-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0f86783-1a4a-4b9c-a8aa-6b06f57ab5c9	8e299ec1-c619-4564-80cd-223c3c960027	g.chr12:91348068C>T	ENST00000358859.2	-	1	885	c.452G>A	c.(451-453)cGc>cAc	p.R151H	CCER1_ENST00000548187.1_Intron	NM_152638.2	NP_689851.1	Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1	151																	AGGGTGGTGGCGCAGGCCGCG	0.697																																					p.R151H		Atlas-SNP	.											.	.	.	.	0			c.G452A						PASS	.						16.0	19.0	18.0					12																	91348068		2195	4288	6483	SO:0001583	missense	196477	exon1			TGGTGGCGCAGGC	BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000358859.2:c.452G>A	12.37:g.91348068C>T	ENSP00000351727:p.Arg151His	Somatic	18	0	0		WXS	Illumina HiSeq	Phase_I	19	6	0.315789	NM_152638	Q8TC47	Missense_Mutation	SNP	ENST00000358859.2	37	CCDS9036.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.917602	0.73098	.	.	ENSG00000197651	ENST00000358859	T	0.38240	1.15	4.49	4.49	0.54785	.	0.000000	0.35040	N	0.003499	T	0.45054	0.1323	L	0.27053	0.805	0.33723	D	0.617254	D	0.89917	1.0	D	0.74348	0.983	T	0.59048	-0.7527	10	0.87932	D	0	-16.1942	12.5539	0.56242	0.0:1.0:0.0:0.0	.	151	Q8TC90	CL012_HUMAN	H	151	ENSP00000351727:R151H	ENSP00000351727:R151H	R	-	2	0	C12orf12	89872199	0.987000	0.35691	1.000000	0.80357	0.598000	0.36846	1.586000	0.36611	2.311000	0.77944	0.313000	0.20887	CGC	.	.	none		0.697	CCER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407142.2	NM_152638	
