#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C10orf71	118461	hgsc.bcm.edu	37	10	50534484	50534486	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr10:50534484_50534486delCTT	ENST00000374144.3	+	3	4182_4184	c.3894_3896delCTT	c.(3892-3897)accttc>acc	p.F1299del	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	1299										endometrium(1)	1						AAATCAAGACCTTCTATGACCCA	0.64																																					p.1298_1299del		Pindel,Atlas-Indel	.											.	C10orf71	179	.	0			c.3893_3895del						PASS	.																																			SO:0001651	inframe_deletion	118461	exon3			.	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.3894_3896delCTT	10.37:g.50534484_50534486delCTT	ENSP00000363259:p.Phe1299del	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	19	19	1.000	NM_001135196	A0AVL8	In_Frame_Del	DEL	ENST00000374144.3	37	CCDS44387.1																																																																																			.	.	none		0.640	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
STAT3	6774	hgsc.bcm.edu	37	17	40475061	40475063	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr17:40475061_40475063delCTT	ENST00000264657.5	-	20	2159_2161	c.1847_1849delAAG	c.(1846-1851)gaagga>gga	p.E616del	STAT3_ENST00000389272.3_In_Frame_Del_p.E518del|STAT3_ENST00000588969.1_In_Frame_Del_p.E616del|STAT3_ENST00000404395.3_In_Frame_Del_p.E616del|STAT3_ENST00000585517.1_In_Frame_Del_p.E616del	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	616	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		GTGACGCCTCCTTCTTTGCTGCT	0.562									Hyperimmunoglobulin E Recurrent Infection Syndrome		OREG0024421	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.616_617del		Pindel,Atlas-Indel	.											.	STAT3	268	.	0			c.1848_1850del						PASS	.																																			SO:0001651	inframe_deletion	6774	exon20	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	.	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.1847_1849delAAG	17.37:g.40475064_40475066delCTT	ENSP00000264657:p.Glu616del	Somatic	0	.	.	893	WXS	Illumina HiSeq	Phase_I	16	16	1.000	NM_003150	A8K7B8|K7ENL3|O14916|Q9BW54	In_Frame_Del	DEL	ENST00000264657.5	37	CCDS32656.1																																																																																			.	.	none		0.562	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305774	39305775	+	In_Frame_Ins	INS	-	-	TGGCAGCAGCTGGGG	rs137947981|rs535144703|rs141265645|rs58117746	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr17:39305774_39305775insTGGCAGCAGCTGGGG	ENST00000343246.4	-	1	279_280	c.245_246insCCCCAGCTGCTGCCA	c.(244-246)cag>caCCCCAGCTGCTGCCAg	p.81_82insHPSCC		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	81	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.Q82H(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agcaggtggtctggcagcagca	0.653																																					p.Q82delinsHPSCCQ		Atlas-Indel	.											KRTAP4-5,NS,carcinoma,0,1	KRTAP4-5	34	1	1	Substitution - Missense(1)	lung(1)	c.246_247insCCCCAGCTGCTGCCA						PASS	.																																			SO:0001652	inframe_insertion	85289	exon1			.	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.245_246insCCCCAGCTGCTGCCA	17.37:g.39305774_39305775insTGGCAGCAGCTGGGG	ENSP00000340546:p.Cys81_Gln82insHisProSerCysCys	Somatic	46	0	0		WXS	Illumina HiSeq	Phase_I	45	25	0.555556	NM_033188		In_Frame_Ins	INS	ENST00000343246.4	37	CCDS32650.1																																																																																			.	.	none		0.653	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
TBP	6908	hgsc.bcm.edu	37	6	170871013	170871014	+	In_Frame_Ins	INS	-	-	CAG	rs201732168|rs113202486|rs574714675|rs71010672	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:170871013_170871014insCAG	ENST00000392092.2	+	3	468_469	c.189_190insCAG	c.(190-192)cag>CAGcag	p.64_64Q>QQ	TBP_ENST00000540980.1_In_Frame_Ins_p.44_44Q>QQ|TBP_ENST00000230354.6_In_Frame_Ins_p.64_64Q>QQ	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q63_Q64insQ(1)|p.Q63Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacaacaacagcagcagca	0.55																																					p.Q63delinsQQ		Atlas-Indel	.											TBP,NS,carcinoma,0,5	TBP	58	5	2	Insertion - In frame(1)|Substitution - coding silent(1)	prostate(1)|breast(1)	c.189_190insCAG						PASS	.																																			SO:0001652	inframe_insertion	6908	exon3			.	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.211_213dupCAG	6.37:g.170871020_170871022dupCAG	ENSP00000375942:p.Gln95dup	Somatic	53	0	0		WXS	Illumina HiSeq	Phase_I	29	14	0.482759	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	In_Frame_Ins	INS	ENST00000392092.2	37	CCDS5315.1																																																																																			-|0.138;CAG|0.862	0.862	strong		0.550	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
DMKN	93099	hgsc.bcm.edu	37	19	36002421	36002422	+	In_Frame_Ins	INS	-	-	CTGCTGCTG	rs72334573	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:36002421_36002422insCTGCTGCTG	ENST00000339686.3	-	5	985_986	c.809_810insCAGCAGCAG	c.(808-810)ggt>ggCAGCAGCAGt	p.270_271insSSS	DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000440396.1_In_Frame_Ins_p.270_271insSSS|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000447113.2_In_Frame_Ins_p.270_271insSSS|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000451297.2_In_Frame_Ins_p.270_271insSSS|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000418261.1_In_Frame_Ins_p.270_271insSSS|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000424570.2_In_Frame_Ins_p.270_271insSSS|DMKN_ENST00000602781.1_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	270	Gly-rich.			Missing (in Ref. 3; ABN11273/ABN11274). {ECO:0000305}.		extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			tgctgctgccaccactgctgct	0.653																																					p.G270delinsGSSS		Atlas-Indel	.											DMKN,colon,carcinoma,0,1	DMKN	116	1	0			c.810_811insCAGCAGCAG						PASS	.																																			SO:0001652	inframe_insertion	93099	exon5			.	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.809_810insCAGCAGCAG	19.37:g.36002421_36002422insCTGCTGCTG	ENSP00000342012:p.Gly270_Gly271insSerSerSer	Somatic	51	0	0		WXS	Illumina HiSeq	Phase_I	47	14	0.297872	NM_033317	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	In_Frame_Ins	INS	ENST00000339686.3	37	CCDS12463.1																																																																																			.	.	alt		0.653	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
DPP7	29952	hgsc.bcm.edu	37	9	140006642	140006644	+	In_Frame_Del	DEL	GTC	GTC	-	rs199861431		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	GTC	GTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr9:140006642_140006644delGTC	ENST00000371579.2	-	9	974_976	c.970_972delGAC	c.(970-972)gacdel	p.D324del		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	324						cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		GCCGGTAGATGTCGTAGCAGTGC	0.709																																					p.324_325del		Pindel	.											.	DPP7	22	.	0			c.971_973del						PASS	.																																			SO:0001651	inframe_deletion	29952	exon9			.	AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.970_972delGAC	9.37:g.140006642_140006644delGTC	ENSP00000360635:p.Asp324del	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	24	24	1.000	NM_013379	A8K7U7|Q5VSF1|Q969X4	In_Frame_Del	DEL	ENST00000371579.2	37	CCDS7030.1																																																																																			.	.	none		0.709	DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055279.1	NM_013379	
CREBBP	1387	hgsc.bcm.edu	37	16	3779057	3779057	+	Frame_Shift_Del	DEL	G	G	-	rs201101808	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr16:3779057delG	ENST00000262367.5	-	31	6800	c.5991delC	c.(5989-5991)cccfs	p.P1997fs	CREBBP_ENST00000382070.3_Frame_Shift_Del_p.P1959fs	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1997					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TCAGGCTCACGGGGGCCATCT	0.697			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.V1998X		Pindel	.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	546	.	0			c.5992delG						PASS	.						14.0	15.0	15.0					16																	3779057		2181	4290	6471	SO:0001589	frameshift_variant	1387	exon31			.	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.5991delC	16.37:g.3779057delG	ENSP00000262367:p.Pro1997fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	19	19	1.000	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Frame_Shift_Del	DEL	ENST00000262367.5	37	CCDS10509.1																																																																																			.	.	none		0.697	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
AP1G1	164	hgsc.bcm.edu	37	16	71808467	71808468	+	Frame_Shift_Ins	INS	-	-	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr16:71808467_71808468insG	ENST00000299980.4	-	3	670_671	c.229_230insC	c.(229-231)caafs	p.Q77fs	AP1G1_ENST00000393512.3_Frame_Shift_Ins_p.Q77fs|AP1G1_ENST00000433195.2_Frame_Shift_Ins_p.Q100fs|AP1G1_ENST00000423132.2_Frame_Shift_Ins_p.Q77fs|AP1G1_ENST00000569748.1_Frame_Shift_Ins_p.Q77fs	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	77					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				TGTAAATTTTTGAGAGGCAATA	0.356																																					p.Q77fs		Pindel	.											.	AP1G1	83	.	0			c.230_231insC						PASS	.																																			SO:0001589	frameshift_variant	164	exon3			.	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.230dupC	16.37:g.71808468_71808468dupG	ENSP00000299980:p.Gln77fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	58	58	1.000	NM_001030007	O75709|O75842|Q9UG09|Q9Y3U4	Frame_Shift_Ins	INS	ENST00000299980.4	37	CCDS32480.1																																																																																			.	.	none		0.356	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1		
C7orf55-LUC7L2	100996928	hgsc.bcm.edu	37	7	139094365	139094366	+	Frame_Shift_Del	DEL	AG	AG	-	rs368249579	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr7:139094365_139094366delAG	ENST00000354926.4	+	7	1098_1099	c.744_745delAG	c.(742-747)gaagagfs	p.EE248fs	C7orf55-LUC7L2_ENST00000263545.6_Frame_Shift_Del_p.EE247fs|LUC7L2_ENST00000541515.3_Frame_Shift_Del_p.EE314fs|C7orf55-LUC7L2_ENST00000541170.3_Frame_Shift_Del_p.EE245fs	NM_001270643.1|NM_016019.4	NP_001257572.1|NP_057103.2			C7orf55-LUC7L2 readthrough																		AACGAAGAGAAGAGAGAGAGAG	0.391														64	0.0127796	0.028	0.0014	5008	,	,		16418	0.004		0.002	False		,,,				2504	0.0204				p.314_314del		Pindel	.											LUC7L2,colon,carcinoma,+1,1	.	.	1	0			c.941_942del						PASS	.			136,3410		1,134,1638						5.1	1.0			34	290,7544		0,290,3627	no	frameshift	LUC7L2	NM_016019.3		1,424,5265	A1A1,A1R,RR		3.7018,3.8353,3.7434				426,10954				SO:0001589	frameshift_variant	100996928	exon8			.		CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000354926.4:c.744_745delAG	7.37:g.139094375_139094376delAG	ENSP00000347005:p.Glu248fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	12	12	1.000	NM_001244584		Frame_Shift_Del	DEL	ENST00000354926.4	37	CCDS43656.1																																																																																			.	.	weak		0.391	C7orf55-LUC7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323618.2		
CTDSPL2	51496	hgsc.bcm.edu	37	15	44791936	44791937	+	Frame_Shift_Ins	INS	-	-	GT			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr15:44791936_44791937insGT	ENST00000260327.4	+	8	1457_1458	c.894_895insGT	c.(895-897)gtgfs	p.V299fs	CTDSPL2_ENST00000558966.1_Frame_Shift_Ins_p.V299fs|CTDSPL2_ENST00000561189.1_3'UTR|CTDSPL2_ENST00000396780.1_Frame_Shift_Ins_p.V227fs|CTDSPL2_ENST00000558373.1_Frame_Shift_Ins_p.V227fs	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2	299	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.						phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		ATGAAACACTAGTGCATTGTAG	0.287																																					p.L298fs		Pindel	.											.	CTDSPL2	31	.	0			c.894_895insGT						PASS	.																																			SO:0001589	frameshift_variant	51496	exon8			.	AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.895_896dupGT	15.37:g.44791937_44791938dupGT	ENSP00000260327:p.Val299fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	32	32	1.000	NM_016396	Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Frame_Shift_Ins	INS	ENST00000260327.4	37	CCDS10110.1																																																																																			.	.	none		0.287	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253851.1	NM_016396	
EPYC	1833	hgsc.bcm.edu	37	12	91365657	91365657	+	Frame_Shift_Del	DEL	C	C	-			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr12:91365657delC	ENST00000261172.3	-	5	714	c.622delG	c.(622-624)gaafs	p.E208fs		NM_004950.4	NP_004941.2	Q99645	EPYC_HUMAN	epiphycan	208					female pregnancy (GO:0007565)	proteinaceous extracellular matrix (GO:0005578)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(8)|skin(2)	18						GTTGGCAATTCTGGGAGCTGC	0.363																																					p.E208fs		Pindel	.											.	EPYC	35	.	0			c.623delA						PASS	.						99.0	92.0	95.0					12																	91365657		2203	4300	6503	SO:0001589	frameshift_variant	1833	exon5			.	AF031658	CCDS31870.1	12q21	2010-03-19	2006-11-21	2006-11-21	ENSG00000083782	ENSG00000083782		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3053	protein-coding gene	gene with protein product	"""epiphycan proteoglycan"""	601657	"""dermatan sulphate proteoglycan 3"", ""dermatan sulfate proteoglycan 3"""	DSPG3		8975717	Standard	NM_004950		Approved	Pg-Lb, SLRR3B	uc001tbk.3	Q99645	OTTHUMG00000170072	ENST00000261172.3:c.622delG	12.37:g.91365657delC	ENSP00000261172:p.Glu208fs	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	29	29	1.000	NM_004950	A8K3M7|Q8NEJ5	Frame_Shift_Del	DEL	ENST00000261172.3	37	CCDS31870.1																																																																																			.	.	none		0.363	EPYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407146.2	NM_004950	
HGFAC	3083	hgsc.bcm.edu	37	4	3449218	3449219	+	Splice_Site	INS	-	-	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr4:3449218_3449219insC	ENST00000382774.3	+	11	1470_1471		c.e11-1		HGFAC_ENST00000511533.1_Splice_Site	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator						proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R455fs*91(1)		central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCCTTGCACAGCCCCCCCAGGG	0.673																																					.		Pindel	.											.	HGFAC	69	.	1	Unknown(1)	large_intestine(1)	c.1356-1->C						PASS	.			7,4259		0,7,2126						3.6	0.9			59	8,8244		0,8,4118	no	frameshift-near-splice	HGFAC	NM_001528.2		0,15,6244	A1A1,A1R,RR		0.0969,0.1641,0.1198				15,12503				SO:0001630	splice_region_variant	3083	exon11			.	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.1356-1->C	4.37:g.3449225_3449225dupC		Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	24	24	1.000	NM_001528	Q14726|Q2M1W7|Q53X47	Splice_Site	INS	ENST00000382774.3	37	CCDS3369.1																																																																																			.	.	none		0.673	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		Intron
SRRT	51593	hgsc.bcm.edu	37	7	100482040	100482042	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	AGG	AGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr7:100482040_100482042delAGG	ENST00000347433.4	+	7	967_969	c.809_811delAGG	c.(808-813)caggag>cag	p.E275del	SRRT_ENST00000388793.4_In_Frame_Del_p.E275del|SRRT_ENST00000457580.2_In_Frame_Del_p.E275del|SRRT_ENST00000432932.1_In_Frame_Del_p.E275del			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	275	Glu-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						ATCCTGGAGCAGGAGGAGGAGGA	0.596																																					p.270_270del		Pindel	.											.	SRRT	108	.	0			c.808_810del						PASS	.																																			SO:0001651	inframe_deletion	51593	exon7			.		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.809_811delAGG	7.37:g.100482049_100482051delAGG	ENSP00000314491:p.Glu275del	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	10	10	1.000	NM_001128853	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	In_Frame_Del	DEL	ENST00000347433.4	37	CCDS34709.1																																																																																			.	.	none		0.596	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908	
ATRX	546	hgsc.bcm.edu	37	X	76778785	76778787	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chrX:76778785_76778787delTCT	ENST00000373344.5	-	31	7006_7008	c.6792_6794delAGA	c.(6790-6795)gaagag>gag	p.2264_2265EE>E	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_In_Frame_Del_p.2226_2227EE>E	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2264	Interaction with MECP2.|Poly-Glu.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TTCAGTCAACTCTTCTTCTTCTT	0.369			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.2265_2265del		Pindel	.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	833	.	0			c.6793_6795del						PASS	.																																			SO:0001651	inframe_deletion	546	exon31			.	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6792_6794delAGA	X.37:g.76778794_76778796delTCT	ENSP00000362441:p.Glu2265del	Somatic	0	.	.		WXS	Illumina HiSeq	Phase_I	10	10	1.000	NM_000489	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	In_Frame_Del	DEL	ENST00000373344.5	37	CCDS14434.1																																																																																			.	.	none		0.369	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
B2M	567	hgsc.bcm.edu	37	15	45007714	45007714	+	Missense_Mutation	SNP	A	A	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr15:45007714A>T	ENST00000558401.1	+	2	231	c.161A>T	c.(160-162)gAc>gTc	p.D54V	B2M_ENST00000544417.1_Missense_Mutation_p.D54V|B2M_ENST00000559220.1_Intron|B2M_ENST00000559916.1_Missense_Mutation_p.D54V	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	54	Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		CATCCATCCGACATTGAAGTT	0.413																																					p.D54V		Atlas-SNP	.											B2M,bladder,carcinoma,+1,1	B2M	99	1	0			c.A161T						scavenged	.						183.0	188.0	186.0					15																	45007714		2198	4298	6496	SO:0001583	missense	567	exon2			CATCCGACATTGA	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.161A>T	15.37:g.45007714A>T	ENSP00000452780:p.Asp54Val	Somatic	106	1	0.00943396		WXS	Illumina HiSeq	Phase_I	67	35	0.522388	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.124893	0.77436	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.03212	4.01	6.03	6.03	0.97812	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.936939	0.09208	N	0.833609	T	0.08891	0.0220	N	0.20328	0.56	0.20307	N	0.999913	P;P;P	0.50369	0.821;0.781;0.934	P;P;P	0.58331	0.6;0.721;0.837	T	0.49234	-0.8961	10	0.87932	D	0	.	12.95	0.58394	1.0:0.0:0.0:0.0	.	54;54;54	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	V	54	ENSP00000437604:D54V	ENSP00000340858:D54V	D	+	2	0	B2M	42795006	0.302000	0.24454	0.009000	0.14445	0.002000	0.02628	5.095000	0.64529	2.308000	0.77769	0.533000	0.62120	GAC	.	.	none		0.413	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
PCDHB16	57717	hgsc.bcm.edu	37	5	140563728	140563728	+	Missense_Mutation	SNP	A	A	G	rs2697532	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr5:140563728A>G	ENST00000361016.2	+	1	2749	c.1594A>G	c.(1594-1596)Agc>Ggc	p.S532G		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	532	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.		S -> G (in dbSNP:rs2697532). {ECO:0000269|PubMed:11322959, ECO:0000269|PubMed:15489334}.		calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTTCCGCGTGAGCGCCACAGA	0.682													G|||	939	0.1875	0.1339	0.1931	5008	,	,		10582	0.1855		0.2863	False		,,,				2504	0.1564				p.S532G		Atlas-SNP	.											PCDHB16,NS,carcinoma,0,1	PCDHB16	159	1	0			c.A1594G						scavenged	.						35.0	38.0	37.0					5																	140563728		1856	3453	5309	SO:0001583	missense	57717	exon1			CGCGTGAGCGCCA	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1594A>G	5.37:g.140563728A>G	ENSP00000354293:p.Ser532Gly	Somatic	41	2	0.0487805		WXS	Illumina HiSeq	Phase_I	35	7	0.2	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	N	0.027	-1.361903	0.01235	.	.	ENSG00000196963	ENST00000361016	T	0.01804	4.63	4.26	-1.08	0.09936	Cadherin (5);Cadherin-like (1);	0.236103	0.21995	N	0.066089	T	0.00967	0.0032	N	0.25201	0.72	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.48502	-0.9030	9	0.02654	T	1	.	3.6001	0.08021	0.2321:0.5022:0.139:0.1267	rs61743494	532	Q9NRJ7	PCDBG_HUMAN	G	532	ENSP00000354293:S532G	ENSP00000354293:S532G	S	+	1	0	PCDHB16	140543912	0.000000	0.05858	0.984000	0.44739	0.358000	0.29455	-1.167000	0.03126	-0.365000	0.08076	-0.204000	0.12730	AGC	A|0.667;G|0.333	0.333	strong		0.682	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PDHA2	5161	hgsc.bcm.edu	37	4	96761963	96761963	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr4:96761963A>G	ENST00000295266.4	+	1	725	c.662A>G	c.(661-663)gAg>gGg	p.E221G		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	221					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		TTCATCTGTGAGAATAACCTA	0.453																																					p.E221G		Atlas-SNP	.											.	PDHA2	118	.	0			c.A662G						PASS	.						80.0	83.0	82.0					4																	96761963		2203	4300	6503	SO:0001583	missense	5161	exon1			TCTGTGAGAATAA		CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.662A>G	4.37:g.96761963A>G	ENSP00000295266:p.Glu221Gly	Somatic	69	0	0		WXS	Illumina HiSeq	Phase_I	47	19	0.404255	NM_005390	B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	ENST00000295266.4	37	CCDS3644.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.145730	0.77888	.	.	ENSG00000163114	ENST00000295266	D	0.96522	-4.04	4.7	4.7	0.59300	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.98918	0.9633	H	0.99249	4.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98794	1.0737	10	0.87932	D	0	-26.8347	12.4398	0.55619	1.0:0.0:0.0:0.0	.	221	P29803	ODPAT_HUMAN	G	221	ENSP00000295266:E221G	ENSP00000295266:E221G	E	+	2	0	PDHA2	96980986	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	8.369000	0.90118	2.103000	0.63969	0.383000	0.25322	GAG	.	.	none		0.453	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1		
KDM4B	23030	hgsc.bcm.edu	37	19	5144411	5144411	+	Silent	SNP	T	T	C	rs10408767|rs57489512		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:5144411T>C	ENST00000159111.4	+	20	3107	c.2889T>C	c.(2887-2889)ccT>ccC	p.P963P	KDM4B_ENST00000536461.1_Silent_p.P997P	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	963	Tudor 1.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						ACCTGTACCCTGAGAGCATCA	0.642																																					p.P963P		Atlas-SNP	.											KDM4B,rectum,carcinoma,0,6	KDM4B	120	6	0			c.T2889C						scavenged	.						20.0	16.0	17.0					19																	5144411		2173	4262	6435	SO:0001819	synonymous_variant	23030	exon20			GTACCCTGAGAGC	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.2889T>C	19.37:g.5144411T>C		Somatic	65	4	0.0615385		WXS	Illumina HiSeq	Phase_I	48	8	0.166667	NM_015015	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Silent	SNP	ENST00000159111.4	37	CCDS12138.1																																																																																			T|1.000;|0.000	.	weak		0.642	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450558.1	NM_015015	
PAK2	5062	hgsc.bcm.edu	37	3	196530022	196530022	+	Silent	SNP	C	C	T	rs115224945	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:196530022C>T	ENST00000327134.3	+	4	745	c.423C>T	c.(421-423)agC>agT	p.S141S		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	141					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		AATATCTGAGCTTTACTCCTC	0.418																																					p.S141S		Atlas-SNP	.											PAK2_ENST00000327134,rectum,carcinoma,0,2	PAK2	113	2	0			c.C423T						scavenged	.						85.0	79.0	81.0					3																	196530022		2203	4300	6503	SO:0001819	synonymous_variant	5062	exon4			TCTGAGCTTTACT	U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.423C>T	3.37:g.196530022C>T		Somatic	44	2	0.0454545		WXS	Illumina HiSeq	Phase_I	66	9	0.136364	NM_002577	Q13154|Q6ISC3	Silent	SNP	ENST00000327134.3	37	CCDS3321.1																																																																																			C|0.986;T|0.015	0.015	strong		0.418	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
HLA-A	3105	hgsc.bcm.edu	37	6	29910557	29910557	+	Missense_Mutation	SNP	T	T	C	rs386698549|rs1136659	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:29910557T>C	ENST00000396634.1	+	4	438	c.97T>C	c.(97-99)Ttc>Ctc	p.F33L	HLA-A_ENST00000376809.5_Missense_Mutation_p.F33L|HLA-A_ENST00000376802.2_Missense_Mutation_p.F33L|HLA-A_ENST00000376806.5_Missense_Mutation_p.F33L			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	33	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						GAGGTATTTCTTCACATCCGT	0.721									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.F33L		Atlas-SNP	.											HLA-A,NS,lymphoid_neoplasm,-1,1	HLA-A	89	1	0			c.T97C						scavenged	.						16.0	15.0	15.0					6																	29910557		2182	4266	6448	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	TATTTCTTCACAT	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.97T>C	6.37:g.29910557T>C	ENSP00000379873:p.Phe33Leu	Somatic	125	2	0.016		WXS	Illumina HiSeq	Phase_I	129	5	0.0387597	NM_001242758	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	4.503	0.093287	0.08632	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00008	9.56;9.56;9.56;9.56	3.72	-7.44	0.01379	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	20.031000	0.00447	U	0.000090	T	0.00039	0.0001	M	0.76170	2.325	0.09310	N	1	B;B;B	0.20988	0.049;0.025;0.05	B;B;B	0.30782	0.12;0.066;0.066	T	0.33954	-0.9848	10	0.87932	D	0	.	3.506	0.07691	0.123:0.4384:0.2366:0.202	.	33;33;33	Q5SRN7;Q5SRN5;P04439	.;.;1A03_HUMAN	L	33	ENSP00000379873:F33L;ENSP00000366002:F33L;ENSP00000366005:F33L;ENSP00000365998:F33L	ENSP00000348012:F33L	F	+	1	0	HLA-A	30018536	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-9.226000	0.00013	-2.974000	0.00285	-0.712000	0.03635	TTC	A|0.086;T|0.914	.	strong		0.721	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
NTM	50863	hgsc.bcm.edu	37	11	132016345	132016345	+	Missense_Mutation	SNP	T	T	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr11:132016345T>A	ENST00000374786.1	+	2	816	c.337T>A	c.(337-339)Tac>Aac	p.Y113N	NTM_ENST00000374784.1_Missense_Mutation_p.Y113N|NTM_ENST00000425719.2_Missense_Mutation_p.Y113N|NTM_ENST00000374791.3_Missense_Mutation_p.Y113N|NTM_ENST00000427481.2_Missense_Mutation_p.Y104N|NTM_ENST00000539799.1_Missense_Mutation_p.Y113N	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	113	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						CGAGGGCCCTTACACCTGCTC	0.587																																					p.Y113N		Atlas-SNP	.											.	NTM	253	.	0			c.T337A						PASS	.						162.0	112.0	129.0					11																	132016345		2201	4297	6498	SO:0001583	missense	50863	exon2			GGCCCTTACACCT	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.337T>A	11.37:g.132016345T>A	ENSP00000363918:p.Tyr113Asn	Somatic	110	0	0		WXS	Illumina HiSeq	Phase_I	116	41	0.353448	NM_001144059	A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374786.1	37	CCDS8491.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.301473	0.81136	.	.	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000550167;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784	T;T;T;T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75;-0.75;-0.75;-0.75	5.58	5.58	0.84498	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.305913	0.36268	N	0.002692	D	0.90191	0.6934	H	0.96633	3.855	0.52501	D	0.999958	D;D;D;D;D;D	0.89917	1.0;0.997;1.0;0.997;0.999;1.0	D;D;D;D;D;D	0.85130	0.997;0.993;0.995;0.997;0.982;0.995	D	0.92723	0.6193	10	0.87932	D	0	-20.7387	12.0456	0.53477	0.1289:0.0:0.0:0.8711	.	113;104;113;113;113;113	B7Z1Z5;B7Z1I4;Q9P121-4;Q9P121;Q9P121-3;Q9P121-2	.;.;.;NTRI_HUMAN;.;.	N	113;113;104;104;113;113;113	ENSP00000363923:Y113N;ENSP00000437668:Y113N;ENSP00000448104:Y104N;ENSP00000416320:Y104N;ENSP00000363918:Y113N;ENSP00000396722:Y113N;ENSP00000363916:Y113N	ENSP00000363916:Y113N	Y	+	1	0	NTM	131521555	1.000000	0.71417	0.916000	0.36221	0.950000	0.60333	8.026000	0.88783	2.126000	0.65437	0.533000	0.62120	TAC	.	.	none		0.587	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522	
ZYG11B	79699	hgsc.bcm.edu	37	1	53287248	53287248	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:53287248C>T	ENST00000294353.6	+	14	2327	c.2182C>T	c.(2182-2184)Cgc>Tgc	p.R728C	ZYG11B_ENST00000443756.2_Missense_Mutation_p.R658C	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	728										breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						ACACATTGTGCGCCATGGGAG	0.418																																					p.R728C		Atlas-SNP	.											ZYG11B,NS,carcinoma,-1,1	ZYG11B	61	1	0			c.C2182T						scavenged	.						88.0	81.0	83.0					1																	53287248		2203	4300	6503	SO:0001583	missense	79699	exon14			ATTGTGCGCCATG	AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.2182C>T	1.37:g.53287248C>T	ENSP00000294353:p.Arg728Cys	Somatic	208	0	0		WXS	Illumina HiSeq	Phase_I	210	6	0.0285714	NM_024646	Q8N2X3|Q9H8L8	Missense_Mutation	SNP	ENST00000294353.6	37	CCDS30717.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.576884	0.86645	.	.	ENSG00000162378	ENST00000443756;ENST00000294353	T	0.48522	0.81	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.61502	0.2352	L	0.51422	1.61	0.80722	D	1	D;D	0.71674	0.998;0.995	D;P	0.66847	0.947;0.736	T	0.62905	-0.6755	10	0.66056	D	0.02	.	14.2158	0.65792	0.1493:0.8507:0.0:0.0	.	658;728	B4DK95;Q9C0D3	.;ZY11B_HUMAN	C	658;728	ENSP00000294353:R728C	ENSP00000294353:R728C	R	+	1	0	ZYG11B	53059836	0.993000	0.37304	0.996000	0.52242	0.997000	0.91878	2.987000	0.49378	2.567000	0.86603	0.591000	0.81541	CGC	.	.	none		0.418	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024749.1	NM_024646	
SBSPON	157869	hgsc.bcm.edu	37	8	73993379	73993379	+	Missense_Mutation	SNP	C	C	T	rs34728970		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:73993379C>T	ENST00000297354.6	-	2	488	c.284G>A	c.(283-285)cGt>cAt	p.R95H	RP11-956J14.1_ENST00000442274.1_RNA|SBSPON_ENST00000519697.1_5'UTR	NM_153225.3	NP_694957.3	Q8IVN8	SBSPO_HUMAN	somatomedin B and thrombospondin, type 1 domain containing	95	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				immune response (GO:0006955)	proteinaceous extracellular matrix (GO:0005578)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)										CCTCCGCACACGGGTTGTAGG	0.652																																					p.R95H		Atlas-SNP	.											C8orf84,NS,carcinoma,-1,1	.	.	1	0			c.G284A						scavenged	.						65.0	72.0	70.0					8																	73993379		2021	4174	6195	SO:0001583	missense	157869	exon2			CGCACACGGGTTG		CCDS43747.2	8q21.11	2013-08-07	2012-05-15	2012-05-15	ENSG00000164764	ENSG00000164764			30362	protein-coding gene	gene with protein product	"""RPE spondin"", ""rpe-spondin"""		"""chromosome 8 open reading frame 84"""	C8orf84		12107410	Standard	NM_153225		Approved	RPESP	uc003xzf.3	Q8IVN8	OTTHUMG00000157144	ENST00000297354.6:c.284G>A	8.37:g.73993379C>T	ENSP00000297354:p.Arg95His	Somatic	151	1	0.00662252		WXS	Illumina HiSeq	Phase_I	170	59	0.347059	NM_153225	A8KAA5|Q96J64	Missense_Mutation	SNP	ENST00000297354.6	37	CCDS43747.2	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888198	0.91814	.	.	ENSG00000164764	ENST00000297354	T	0.21191	2.02	5.29	4.4	0.53042	.	0.118037	0.56097	D	0.000031	T	0.44117	0.1278	M	0.80982	2.52	0.80722	D	1	D	0.67145	0.996	P	0.58077	0.832	T	0.52026	-0.8630	10	0.66056	D	0.02	-5.0986	15.3079	0.74008	0.1412:0.8588:0.0:0.0	.	95	Q8IVN8	RPESP_HUMAN	H	95	ENSP00000297354:R95H	ENSP00000297354:R95H	R	-	2	0	C8orf84	74155933	1.000000	0.71417	0.971000	0.41717	0.926000	0.56050	5.388000	0.66249	1.204000	0.43247	0.591000	0.81541	CGT	.	.	none		0.652	SBSPON-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347584.2	NM_153225	
CHP1	11261	hgsc.bcm.edu	37	15	41523608	41523608	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr15:41523608C>T	ENST00000334660.5	+	1	268	c.28C>T	c.(28-30)Cgg>Tgg	p.R10W	CHP1_ENST00000558351.1_Intron|EXD1_ENST00000559743.1_5'Flank|CHP1_ENST00000560397.1_Missense_Mutation_p.R10W|EXD1_ENST00000458580.2_5'Flank|EXD1_ENST00000314992.5_5'Flank	NM_007236.4	NP_009167.1	Q99653	CHP1_HUMAN	calcineurin-like EF-hand protein 1	10					calcium ion-dependent exocytosis (GO:0017156)|cellular response to acidic pH (GO:0071468)|cytoplasmic microtubule organization (GO:0031122)|membrane docking (GO:0022406)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|microtubule bundle formation (GO:0001578)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of protein glycosylation (GO:0060050)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of protein transport (GO:0051222)|positive regulation of sodium:proton antiporter activity (GO:0032417)|potassium ion transport (GO:0006813)|protein export from nucleus (GO:0006611)|protein oligomerization (GO:0051259)|protein stabilization (GO:0050821)|regulation of intracellular pH (GO:0051453)|small GTPase mediated signal transduction (GO:0007264)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|kinase binding (GO:0019900)|microtubule binding (GO:0008017)|potassium channel regulator activity (GO:0015459)|protein kinase inhibitor activity (GO:0004860)|transporter activity (GO:0005215)	p.R10W(1)									CACGTTACTGCGGGACGAAGA	0.677																																					p.R10W		Atlas-SNP	.											CHP,NS,carcinoma,0,1	.	.	1	1	Substitution - Missense(1)	prostate(1)	c.C28T						scavenged	.						35.0	24.0	28.0					15																	41523608		2198	4300	6498	SO:0001583	missense	11261	exon1			TTACTGCGGGACG		CCDS10073.1	15q13.3	2013-01-11	2013-01-11		ENSG00000187446	ENSG00000187446		"""EF-hand domain containing"""	17433	protein-coding gene	gene with protein product	"""calcineurin homologous protein"""	606988				15987692, 20720019	Standard	NM_007236		Approved	Sid470p, CHP, SLC9A1BP, p22, p24	uc001znl.3	Q99653	OTTHUMG00000130233	ENST00000334660.5:c.28C>T	15.37:g.41523608C>T	ENSP00000335632:p.Arg10Trp	Somatic	119	0	0		WXS	Illumina HiSeq	Phase_I	100	3	0.03	NM_007236	B2R6H9|Q6FHZ9	Missense_Mutation	SNP	ENST00000334660.5	37	CCDS10073.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.745030	0.89663	.	.	ENSG00000187446	ENST00000334660;ENST00000392151	T;T	0.68479	-0.33;-0.33	5.79	1.52	0.23074	.	0.000000	0.85682	D	0.000000	T	0.76219	0.3957	M	0.87758	2.905	0.80722	D	1	D	0.56521	0.976	P	0.50659	0.647	T	0.81673	-0.0826	10	0.72032	D	0.01	-10.8135	14.3342	0.66578	0.6356:0.3644:0.0:0.0	.	10	Q99653	CHP1_HUMAN	W	10	ENSP00000335632:R10W;ENSP00000440490:R10W	ENSP00000335632:R10W	R	+	1	2	AC012652.1	39310900	0.990000	0.36364	1.000000	0.80357	0.993000	0.82548	0.024000	0.13555	0.334000	0.23590	-0.277000	0.10078	CGG	.	.	none		0.677	CHP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252554.2	NM_007236	
TSPAN31	6302	hgsc.bcm.edu	37	12	58140844	58140844	+	Missense_Mutation	SNP	A	A	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr12:58140844A>C	ENST00000257910.3	+	5	762	c.488A>C	c.(487-489)aAg>aCg	p.K163T	TSPAN31_ENST00000553221.1_3'UTR|TSPAN31_ENST00000547992.1_Missense_Mutation_p.K79T|TSPAN31_ENST00000547472.1_Missense_Mutation_p.K80T|CDK4_ENST00000551888.1_5'Flank	NM_005981.3	NP_005972.1	Q12999	TSN31_HUMAN	tetraspanin 31	163					positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(1)|kidney(1)|lung(5)	7	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			TGTGGAGAAAAGTTTCTTAAG	0.438																																					p.K163T		Atlas-SNP	.											.	TSPAN31	20	.	0			c.A488C						PASS	.						128.0	133.0	131.0					12																	58140844		2203	4300	6503	SO:0001583	missense	6302	exon5			GAGAAAAGTTTCT		CCDS8952.1	12q13-q14	2013-02-14	2005-08-16	2005-08-16		ENSG00000135452		"""Tetraspanins"""	10539	protein-coding gene	gene with protein product		181035	"""sarcoma amplified sequence"""	SAS			Standard	NM_005981		Approved		uc001spt.3	Q12999		ENST00000257910.3:c.488A>C	12.37:g.58140844A>C	ENSP00000257910:p.Lys163Thr	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	164	64	0.390244	NM_005981	O00577|Q53X76	Missense_Mutation	SNP	ENST00000257910.3	37	CCDS8952.1	.	.	.	.	.	.	.	.	.	.	A	13.64	2.296104	0.40594	.	.	ENSG00000135452	ENST00000257910;ENST00000547992;ENST00000547472;ENST00000548167	T;T	0.80566	-1.39;-1.39	5.03	2.65	0.31530	.	0.157358	0.53938	N	0.000054	T	0.72326	0.3446	M	0.73962	2.25	0.46028	D	0.99882	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.58244	-0.7670	10	0.13853	T	0.58	-5.5034	3.0344	0.06117	0.6323:0.1468:0.0797:0.1412	.	79;163	F8VS78;Q12999	.;TSN31_HUMAN	T	163;79;80;85	ENSP00000257910:K163T;ENSP00000449199:K80T	ENSP00000257910:K163T	K	+	2	0	TSPAN31	56427111	0.931000	0.31567	0.895000	0.35142	0.995000	0.86356	1.087000	0.30865	0.483000	0.27608	0.459000	0.35465	AAG	.	.	none		0.438	TSPAN31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408778.1		
VAV1	7409	hgsc.bcm.edu	37	19	6772991	6772991	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:6772991G>T	ENST00000602142.1	+	1	255	c.173G>T	c.(172-174)cGt>cTt	p.R58L	VAV1_ENST00000596764.1_Missense_Mutation_p.R58L|VAV1_ENST00000539284.1_5'UTR|VAV1_ENST00000304076.2_Missense_Mutation_p.R58L	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	58	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.|Leu-rich.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						ATCAACCTGCGTGAGGTCAAC	0.652																																					p.R58L		Atlas-SNP	.											VAV1,NS,carcinoma,+1,1	VAV1	140	1	0			c.G173T						scavenged	.						135.0	102.0	113.0					19																	6772991		2203	4300	6503	SO:0001583	missense	7409	exon1			ACCTGCGTGAGGT		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.173G>T	19.37:g.6772991G>T	ENSP00000472929:p.Arg58Leu	Somatic	83	0	0		WXS	Illumina HiSeq	Phase_I	95	3	0.0315789	NM_005428	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	g	18.18	3.567497	0.65651	.	.	ENSG00000141968	ENST00000304076	T	0.64260	-0.09	4.32	4.32	0.51571	Calponin homology domain (5);	0.194857	0.31450	U	0.007633	T	0.62380	0.2423	L	0.38838	1.175	0.80722	D	1	P;P	0.48503	0.911;0.75	P;P	0.51297	0.665;0.541	T	0.65026	-0.6268	10	0.49607	T	0.09	.	14.3169	0.66457	0.0:0.0:1.0:0.0	.	58;58	B2R8B5;P15498	.;VAV_HUMAN	L	58	ENSP00000302269:R58L	ENSP00000302269:R58L	R	+	2	0	VAV1	6723991	0.962000	0.33011	0.976000	0.42696	0.926000	0.56050	2.421000	0.44688	1.953000	0.56701	0.306000	0.20318	CGT	.	.	none		0.652	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
DNAH17	8632	hgsc.bcm.edu	37	17	76567366	76567366	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr17:76567366G>A	ENST00000585328.1	-	5	951	c.827C>T	c.(826-828)aCt>aTt	p.T276I	DNAH17_ENST00000389840.5_Missense_Mutation_p.T276I	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	276	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CTCACCTTCAGTGACGTTGGT	0.517																																					p.T276I		Atlas-SNP	.											.	DNAH17	347	.	0			c.C827T						PASS	.						80.0	82.0	82.0					17																	76567366		2151	4244	6395	SO:0001583	missense	8632	exon5			CCTTCAGTGACGT	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.827C>T	17.37:g.76567366G>A	ENSP00000465516:p.Thr276Ile	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	157	64	0.407643	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	G	10.10	1.258295	0.23051	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.57107	0.42	4.31	2.14	0.27477	.	.	.	.	.	T	0.38746	0.1052	N	0.24115	0.695	0.23371	N	0.997811	.	.	.	.	.	.	T	0.21621	-1.0240	7	0.35671	T	0.21	.	6.7434	0.23449	0.0:0.3411:0.4984:0.1605	.	.	.	.	I	276	ENSP00000374490:T276I	ENSP00000300671:T276I	T	-	2	0	DNAH17	74078961	0.326000	0.24669	0.376000	0.26042	0.015000	0.08874	0.724000	0.25954	2.115000	0.64714	0.561000	0.74099	ACT	.	.	none		0.517	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
IRF8	3394	hgsc.bcm.edu	37	16	85936784	85936784	+	Missense_Mutation	SNP	T	T	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr16:85936784T>G	ENST00000268638.5	+	2	585	c.163T>G	c.(163-165)Tcc>Gcc	p.S55A	IRF8_ENST00000563180.1_Missense_Mutation_p.S55A	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	55					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.S55A(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				AGTGGATGCCTCCATTTTTAA	0.483																																					p.S55A		Atlas-SNP	.											IRF8,lymph_node,lymphoid_neoplasm,0,1	IRF8	65	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.T163G						PASS	.						74.0	70.0	71.0					16																	85936784		2198	4300	6498	SO:0001583	missense	3394	exon2			GATGCCTCCATTT	M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.163T>G	16.37:g.85936784T>G	ENSP00000268638:p.Ser55Ala	Somatic	75	0	0		WXS	Illumina HiSeq	Phase_I	88	69	0.784091	NM_002163	A0AV82	Missense_Mutation	SNP	ENST00000268638.5	37	CCDS10956.1	.	.	.	.	.	.	.	.	.	.	T	4.129	0.022168	0.08006	.	.	ENSG00000140968	ENST00000268638	D	0.97598	-4.45	5.58	5.58	0.84498	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.112568	0.64402	D	0.000006	D	0.89378	0.6698	N	0.00738	-1.235	0.80722	D	1	B;B	0.30973	0.302;0.041	B;B	0.43728	0.429;0.023	D	0.87510	0.2439	10	0.02654	T	1	-37.9646	11.4255	0.50007	0.0:0.0:0.1508:0.8491	.	55;55	B2R8V7;Q02556	.;IRF8_HUMAN	A	55	ENSP00000268638:S55A	ENSP00000268638:S55A	S	+	1	0	IRF8	84494285	1.000000	0.71417	0.997000	0.53966	0.596000	0.36781	3.823000	0.55715	2.122000	0.65172	0.454000	0.30748	TCC	.	.	none		0.483	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	NM_002163	
TRIOBP	11078	hgsc.bcm.edu	37	22	38119859	38119859	+	Silent	SNP	C	C	T	rs66505048	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr22:38119859C>T	ENST00000406386.3	+	7	1551	c.1296C>T	c.(1294-1296)tgC>tgT	p.C432C		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	432					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.C432C(6)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GAACATCCTGCGCCCAGCGGG	0.582																																					p.C432C		Atlas-SNP	.											TRIOBP_ENST00000344404,NS,carcinoma,0,8	TRIOBP	262	8	6	Substitution - coding silent(6)	kidney(3)|cervix(1)|lung(1)|endometrium(1)	c.C1296T						scavenged	.																																			SO:0001819	synonymous_variant	11078	exon7			ATCCTGCGCCCAG	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1296C>T	22.37:g.38119859C>T		Somatic	207	1	0.00483092		WXS	Illumina HiSeq	Phase_I	212	3	0.0141509	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	ENST00000406386.3	37	CCDS43015.1																																																																																			C|0.500;T|0.500	0.500	strong		0.582	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
HLA-G	3135	hgsc.bcm.edu	37	6	29797436	29797436	+	Silent	SNP	T	T	C	rs74547057	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:29797436T>C	ENST00000360323.6	+	4	885	c.861T>C	c.(859-861)caT>caC	p.H287H	HLA-G_ENST00000376818.3_Silent_p.H195H|HLA-G_ENST00000376815.3_Intron|HLA-G_ENST00000376828.2_Silent_p.H292H|HLA-G_ENST00000428701.1_Silent_p.H287H			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	287	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.H287H(1)		central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						ATGTGCAGCATGAGGGGCTGC	0.577																																					p.H287H		Atlas-SNP	.											HLA-G,NS,carcinoma,0,1	HLA-G	90	1	1	Substitution - coding silent(1)	prostate(1)	c.T861C						scavenged	.						55.0	57.0	56.0					6																	29797436		2203	4300	6503	SO:0001819	synonymous_variant	3135	exon5			GCAGCATGAGGGG		CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.861T>C	6.37:g.29797436T>C		Somatic	94	1	0.0106383		WXS	Illumina HiSeq	Phase_I	140	12	0.0857143	NM_002127		Silent	SNP	ENST00000360323.6	37	CCDS4668.1																																																																																			T|0.985;C|0.015	0.015	strong		0.577	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076286.2	NM_002127	
EFHD1	80303	hgsc.bcm.edu	37	2	233546429	233546429	+	Nonstop_Mutation	SNP	G	G	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr2:233546429G>T	ENST00000264059.3	+	4	1197	c.720G>T	c.(718-720)taG>taT	p.*240Y	EFHD1_ENST00000409613.1_Nonstop_Mutation_p.*144Y|EFHD1_ENST00000409708.1_Nonstop_Mutation_p.*128Y|snoU13_ENST00000459149.1_RNA|EFHD1_ENST00000410095.1_Nonstop_Mutation_p.*128Y	NM_025202.3	NP_079478.1	Q9BUP0	EFHD1_HUMAN	EF-hand domain family, member D1	0					neuron projection development (GO:0031175)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|large_intestine(2)|lung(3)	7		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Breast(86;0.0199)|Renal(207;0.025)		Epithelial(121;2.08e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00825)|Lung(119;0.0101)		TCAATACATAGTCCTGCTGAC	0.582																																					p.X240Y		Atlas-SNP	.											.	EFHD1	28	.	0			c.G720T						PASS	.						71.0	61.0	64.0					2																	233546429		2203	4300	6503	SO:0001578	stop_lost	80303	exon4			TACATAGTCCTGC		CCDS2497.1, CCDS58755.1	2q37.1	2014-07-01	2005-01-25		ENSG00000115468	ENSG00000115468		"""EF-hand domain containing"""	29556	protein-coding gene	gene with protein product	"""swiprosin-2"""	611617	"""EF hand domain containing 1"""			21244694	Standard	NM_025202		Approved	FLJ13612	uc002vtc.3	Q9BUP0	OTTHUMG00000133263	ENST00000264059.3:c.720G>T	2.37:g.233546429G>T	ENSP00000264059:p.*240Tyrext*3	Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	45	13	0.288889	NM_025202	B2RD83|E9PFH3|Q9BTF8|Q9H8I2|Q9HBQ0	Missense_Mutation	SNP	ENST00000264059.3	37	CCDS2497.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.899836	0.72754	.	.	ENSG00000115468	ENST00000409613;ENST00000264059;ENST00000540187;ENST00000409708;ENST00000410095	.	.	.	5.59	3.77	0.43336	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0595	0.25117	0.0907:0.1752:0.7341:0.0	.	.	.	.	Y	144;240;143;128;128	.	.	X	+	3	2	EFHD1	233254673	0.965000	0.33210	0.119000	0.21687	0.759000	0.43091	2.287000	0.43505	1.345000	0.45676	0.591000	0.81541	TAG	.	.	none		0.582	EFHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257040.2	NM_025202	
LILRB1	10859	hgsc.bcm.edu	37	19	55147988	55147988	+	Missense_Mutation	SNP	A	A	C	rs202204734	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:55147988A>C	ENST00000396331.1	+	15	2048	c.1691A>C	c.(1690-1692)gAg>gCg	p.E564A	LILRB1_ENST00000448689.1_3'UTR|LILRB1_ENST00000427581.2_Missense_Mutation_p.E615A|LILRB1_ENST00000396317.1_Missense_Mutation_p.E548A|LILRB1_ENST00000396332.4_Missense_Mutation_p.E565A|LILRB1_ENST00000434867.2_Missense_Mutation_p.E564A|LILRB1_ENST00000396327.3_Missense_Mutation_p.E565A|LILRB1_ENST00000418536.2_Missense_Mutation_p.E548A|LILRB1_ENST00000324602.7_Missense_Mutation_p.E566A|AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000396315.1_Missense_Mutation_p.E566A|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000396321.2_Missense_Mutation_p.E564A	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	564					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)	p.E564>?(2)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		ACGTATGCCGAGGTGAAACAC	0.582										HNSCC(37;0.09)			a|||	69	0.013778	0.0272	0.0043	5008	,	,		15480	0.0149		0.005	False		,,,				2504	0.0102				p.E566A		Atlas-SNP	.											LILRB1,NS,carcinoma,+1,3	LILRB1	140	3	2	Complex(2)	NS(1)|skin(1)	c.A1697C						scavenged	.						82.0	76.0	78.0					19																	55147988		2202	4297	6499	SO:0001583	missense	10859	exon14			ATGCCGAGGTGAA	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1691A>C	19.37:g.55147988A>C	ENSP00000379622:p.Glu564Ala	Somatic	199	7	0.0351759		WXS	Illumina HiSeq	Phase_I	211	20	0.0947867	NM_001081637	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	37	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	A	2.522	-0.310424	0.05458	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T	0.00495	7.09;7.05;7.09;7.05;7.04;7.09;7.08;6.99;7.05;7.04	1.59	-2.69	0.06022	.	.	.	.	.	T	0.00300	0.0009	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B	0.19200	0.001;0.034;0.0;0.009;0.009	B;B;B;B;B	0.21708	0.003;0.036;0.001;0.009;0.01	T	0.32375	-0.9909	9	0.32370	T	0.25	.	3.7184	0.08446	0.6055:0.2341:0.1604:0.0	.	548;566;565;565;564	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	A	564;548;564;565;566;564;565;615;548;566	ENSP00000379614:E564A;ENSP00000391514:E548A;ENSP00000379622:E564A;ENSP00000379618:E565A;ENSP00000315997:E566A;ENSP00000405243:E564A;ENSP00000379623:E565A;ENSP00000395004:E615A;ENSP00000379610:E548A;ENSP00000379608:E566A	ENSP00000315997:E566A	E	+	2	0	LILRB1	59839800	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.127000	0.15790	-0.858000	0.04110	-3.676000	0.00025	GAG	.	.	weak		0.582	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
PARP4	143	hgsc.bcm.edu	37	13	25060323	25060323	+	Silent	SNP	G	G	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr13:25060323G>T	ENST00000381989.3	-	11	1440	c.1335C>A	c.(1333-1335)atC>atA	p.I445I		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	445	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.I445I(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		AGATTCCCACGATGTTTTGTA	0.373																																					p.I445I		Atlas-SNP	.											PARP4,rectum,carcinoma,0,1	PARP4	142	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C1335A						scavenged	.						105.0	92.0	97.0					13																	25060323		2203	4300	6503	SO:0001819	synonymous_variant	143	exon11			TCCCACGATGTTT	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.1335C>A	13.37:g.25060323G>T		Somatic	499	1	0.00200401		WXS	Illumina HiSeq	Phase_I	498	5	0.0100402	NM_006437	O75903|Q14682|Q5QNZ9|Q9H1M6	Silent	SNP	ENST00000381989.3	37	CCDS9307.1																																																																																			.	.	none		0.373	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	
MUC6	4588	hgsc.bcm.edu	37	11	1016770	1016770	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr11:1016770G>A	ENST00000421673.2	-	31	6081	c.6031C>T	c.(6031-6033)Cct>Tct	p.P2011S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2011	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.P2011S(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGGAGAAAGGTGGAACGTGA	0.532																																					p.P2011S		Atlas-SNP	.											MUC6_ENST00000421673,extremity,malignant_melanoma,0,1	MUC6	408	1	1	Substitution - Missense(1)	skin(1)	c.C6031T						scavenged	.																																			SO:0001583	missense	4588	exon31			AGAAAGGTGGAAC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6031C>T	11.37:g.1016770G>A	ENSP00000406861:p.Pro2011Ser	Somatic	562	8	0.0142349		WXS	Illumina HiSeq	Phase_I	534	14	0.0262172	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.638370	0.00799	.	.	ENSG00000184956	ENST00000421673	T	0.17370	2.28	2.4	-4.79	0.03200	.	.	.	.	.	T	0.06735	0.0172	N	0.21194	0.64	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39014	-0.9634	9	0.07990	T	0.79	.	1.1636	0.01810	0.3722:0.1007:0.2914:0.2356	.	2011	Q6W4X9	MUC6_HUMAN	S	2011	ENSP00000406861:P2011S	ENSP00000406861:P2011S	P	-	1	0	MUC6	1006770	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.781000	0.00773	-2.945000	0.00295	-0.671000	0.03813	CCT	.	.	none		0.532	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
KIR3DL2	3812	hgsc.bcm.edu	37	19	55367311	55367311	+	Missense_Mutation	SNP	G	G	A	rs113800142	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:55367311G>A	ENST00000326321.3	+	5	926	c.893G>A	c.(892-894)cGt>cAt	p.R298H	KIR3DL1_ENST00000402254.2_Intron|KIR3DL2_ENST00000270442.5_Missense_Mutation_p.R298H	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	298	Ig-like C2-type 3.				cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		GGCTCTTTCCGTGCCCTGCCC	0.567													.|||	348	0.0694888	0.0794	0.0591	5008	,	,		10257	0.0397		0.0636	False		,,,				2504	0.1002				p.R298H		Atlas-SNP	.											KIR3DL2,NS,carcinoma,0,1	KIR3DL2	55	1	0			c.G893A						scavenged	.	G	HIS/ARG	173,3101		9,155,1473	5.0	6.0	6.0		893	-2.0	0.0	19	dbSNP_132	6	521,6479		39,443,3018	no	missense	KIR3DL2	NM_006737.3	29	48,598,4491	AA,AG,GG		7.4429,5.2841,6.7549	benign	298/456	55367311	694,9580	1637	3500	5137	SO:0001583	missense	3812	exon5			CTTTCCGTGCCCT	L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.893G>A	19.37:g.55367311G>A	ENSP00000325525:p.Arg298His	Somatic	42	19	0.452381		WXS	Illumina HiSeq	Phase_I	33	23	0.69697	NM_001242867	Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Missense_Mutation	SNP	ENST00000326321.3	37	CCDS12906.1	.	.	.	.	.	.	.	.	.	.	g	0.311	-0.967828	0.02232	0.052841	0.074429	ENSG00000240403	ENST00000326321;ENST00000270442	T;T	0.00768	5.72;5.72	0.993	-1.99	0.07457	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00073	0.0002	L	0.43701	1.375	0.09310	N	1	B;B;B	0.15930	0.015;0.011;0.013	B;B;B	0.06405	0.002;0.001;0.0	T	0.44544	-0.9321	9	0.52906	T	0.07	.	2.9371	0.05818	0.3559:0.2417:0.4024:0.0	.	298;298;103	Q95366;P43630;B5MCJ6	.;KI3L2_HUMAN;.	H	298	ENSP00000325525:R298H;ENSP00000270442:R298H	ENSP00000270442:R298H	R	+	2	0	KIR3DL2	60059123	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-4.304000	0.00256	-1.364000	0.02161	-1.254000	0.01491	CGT	G|0.910;A|0.091	0.091	strong		0.567	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141241.1		
PPP1R12C	54776	hgsc.bcm.edu	37	19	55628609	55628609	+	Silent	SNP	A	A	G	rs66707428	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:55628609A>G	ENST00000263433.3	-	1	318	c.303T>C	c.(301-303)ggT>ggC	p.G101G	PPP1R12C_ENST00000376393.2_Silent_p.G101G	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GGGCGCTGATACCGTCGGCGT	0.781													N|||	1009	0.201478	0.2806	0.0965	5008	,	,		7556	0.2738		0.1093	False		,,,				2504	0.1892				p.G101G		Atlas-SNP	.											.	PPP1R12C	46	.	0			c.T303C						PASS	.						1.0	2.0	1.0					19																	55628609		1184	2666	3850	SO:0001819	synonymous_variant	54776	exon1			GCTGATACCGTCG	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.303T>C	19.37:g.55628609A>G		Somatic	6	0	0		WXS	Illumina HiSeq	Phase_I	7	4	0.571429	NM_017607		Silent	SNP	ENST00000263433.3	37	CCDS12916.1																																																																																			A|0.808;G|0.192	0.192	strong		0.781	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607	
OR10C1	442194	hgsc.bcm.edu	37	6	29407999	29407999	+	Missense_Mutation	SNP	G	G	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:29407999G>C	ENST00000444197.2	+	1	917	c.207G>C	c.(205-207)gaG>gaC	p.E69D	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CGGCCTTGGAGATTGGCTATA	0.572																																					p.E69D		Atlas-SNP	.											.	OR10C1	58	.	0			c.G207C						PASS	.						176.0	154.0	161.0					6																	29407999		1511	2708	4219	SO:0001583	missense	442194	exon1			CTTGGAGATTGGC		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.207G>C	6.37:g.29407999G>C	ENSP00000419119:p.Glu69Asp	Somatic	58	0	0		WXS	Illumina HiSeq	Phase_I	74	28	0.378378	NM_013941	Q5SUN7|Q96R18	Missense_Mutation	SNP	ENST00000444197.2	37	CCDS34364.1	.	.	.	.	.	.	.	.	.	.	G	3.194	-0.165267	0.06461	.	.	ENSG00000206474	ENST00000444197	T	0.00008	9.61	3.6	3.6	0.41247	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39615	N	0.001313	T	0.00012	0.0000	N	0.21240	0.645	0.22975	N	0.998488	B	0.18461	0.028	B	0.24394	0.053	T	0.49835	-0.8897	10	0.15499	T	0.54	.	2.6706	0.05066	0.1058:0.1827:0.5232:0.1884	.	69	Q96KK4	O10C1_HUMAN	D	69	ENSP00000419119:E69D	ENSP00000419119:E69D	E	+	3	2	OR10C1	29515978	0.000000	0.05858	0.633000	0.29310	0.011000	0.07611	-0.801000	0.04550	2.008000	0.58898	0.430000	0.28490	GAG	.	.	none		0.572	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2		
CGRRF1	10668	hgsc.bcm.edu	37	14	54997723	54997723	+	Silent	SNP	G	G	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr14:54997723G>T	ENST00000216420.7	+	4	657	c.525G>T	c.(523-525)gcG>gcT	p.A175A	CGRRF1_ENST00000557512.1_3'UTR	NM_006568.2	NP_006559.1	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1	175					cell cycle arrest (GO:0007050)|negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|lung(5)|ovary(2)|stomach(1)	13						CATTGGTAGCGCTATTGACCT	0.348																																					p.A175A		Atlas-SNP	.											CGRRF1,caecum,carcinoma,0,2	CGRRF1	30	2	0			c.G525T						scavenged	.						72.0	70.0	70.0					14																	54997723		2203	4300	6503	SO:0001819	synonymous_variant	10668	exon4			GGTAGCGCTATTG	BC015063	CCDS9719.1	14q22.2	2013-09-20			ENSG00000100532	ENSG00000100532		"""RING-type (C3HC4) zinc fingers"""	15528	protein-coding gene	gene with protein product		606138				8968090	Standard	NM_006568		Approved	CGR19, RNF197	uc001xay.3	Q99675	OTTHUMG00000140308	ENST00000216420.7:c.525G>T	14.37:g.54997723G>T		Somatic	318	0	0		WXS	Illumina HiSeq	Phase_I	292	3	0.010274	NM_006568	Q96BX2	Silent	SNP	ENST00000216420.7	37	CCDS9719.1																																																																																			.	.	none		0.348	CGRRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276905.2	NM_006568	
CDKL5	6792	hgsc.bcm.edu	37	X	18671625	18671625	+	Silent	SNP	C	C	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chrX:18671625C>G	ENST00000379989.3	+	22	3339	c.3054C>G	c.(3052-3054)ctC>ctG	p.L1018L	RS1_ENST00000379984.3_Intron|CDKL5_ENST00000379996.3_Silent_p.L1018L|RS1_ENST00000476595.1_5'Flank	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	1018					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					AAGCTGCGCTCCTGACATACC	0.547																																					p.L1018L		Atlas-SNP	.											.	CDKL5	124	.	0			c.C3054G						PASS	.						70.0	52.0	58.0					X																	18671625		2203	4300	6503	SO:0001819	synonymous_variant	6792	exon21			TGCGCTCCTGACA	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.3054C>G	X.37:g.18671625C>G		Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	46	13	0.282609	NM_003159	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Silent	SNP	ENST00000379989.3	37	CCDS14186.1																																																																																			.	.	none		0.547	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
ZNF717	100131827	hgsc.bcm.edu	37	3	75790797	75790797	+	De_novo_Start_InFrame	SNP	C	C	T	rs147946451	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:75790797C>T	ENST00000478296.1	-	0	274				ZNF717_ENST00000477374.1_Missense_Mutation_p.V50M|ZNF717_ENST00000400845.3_Missense_Mutation_p.V43M|ZNF717_ENST00000422325.1_Missense_Mutation_p.V50M|ZNF717_ENST00000491507.1_5'UTR			Q9BY31	ZN717_HUMAN	zinc finger protein 717						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						TCCAGCATCACGTCCCTGTAC	0.502																																					p.V50M		Atlas-SNP	.											ZNF717,NS,malignant_melanoma,0,1	ZNF717	160	1	0			c.G148A						scavenged	.						16.0	13.0	14.0					3																	75790797		444	1237	1681			100131827	exon3			GCATCACGTCCCT	AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965		3.37:g.75790797C>T		Somatic	8	1	0.125		WXS	Illumina HiSeq	Phase_I	15	5	0.333333	NM_001128223		Missense_Mutation	SNP	ENST00000478296.1	37		562	0.2573260073260073	83	0.16869918699186992	111	0.30662983425414364	134	0.23426573426573427	234	0.3087071240105541	.	14.80	2.645039	0.47258	.	.	ENSG00000227124	ENST00000477374;ENST00000422325;ENST00000400845;ENST00000468296	T;T;T;T	0.04015	3.73;3.73;3.73;3.73	1.97	1.97	0.26223	.	.	.	.	.	T	0.00012	0.0000	M	0.92833	3.35	0.36926	P	0.10836100000000004	D	0.89917	1.0	D	0.64776	0.929	T	0.22417	-1.0217	8	0.72032	D	0.01	.	9.6897	0.40120	0.0:1.0:0.0:0.0	.	50	C9JSV9	.	M	50;50;43;50	ENSP00000417902:V50M;ENSP00000409514:V50M;ENSP00000383643:V43M;ENSP00000418187:V50M	ENSP00000383643:V43M	V	-	1	0	ZNF717	75873487	0.243000	0.23878	0.981000	0.43875	0.552000	0.35366	1.184000	0.32053	1.127000	0.42034	0.545000	0.68477	GTG	C|0.753;T|0.247	0.247	strong		0.502	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000352764.2	NM_001128223	
HLA-C	3107	hgsc.bcm.edu	37	6	31238010	31238010	+	Missense_Mutation	SNP	T	T	G	rs1131015	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:31238010T>G	ENST00000376228.5	-	4	886	c.872A>C	c.(871-873)cAa>cCa	p.Q291P	HLA-C_ENST00000383329.3_Missense_Mutation_p.Q291P	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	291	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						GAGGGGCTCTTGCAGCCCCTC	0.587													g|||	3612	0.721246	0.6891	0.7723	5008	,	,		13143	0.7758		0.6909	False		,,,				2504	0.7035				p.Q291P		Atlas-SNP	.											HLA-C_ENST00000383329,colon,carcinoma,+1,2	HLA-C	92	2	0			c.A872C						scavenged	.						23.0	30.0	28.0					6																	31238010		2131	4204	6335	SO:0001583	missense	3107	exon4			GGCTCTTGCAGCC	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.872A>C	6.37:g.31238010T>G	ENSP00000365402:p.Gln291Pro	Somatic	81	20	0.246914		WXS	Illumina HiSeq	Phase_I	58	46	0.793103	NM_002117	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	1245|1245	0.570054945054945|0.570054945054945	247|247	0.5020325203252033|0.5020325203252033	233|233	0.643646408839779|0.643646408839779	365|365	0.6381118881118881|0.6381118881118881	400|400	0.5277044854881267|0.5277044854881267	.|.	0.011|0.011	-1.716298|-1.716298	0.00706|0.00706	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000415537|ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	.|T;T	.|0.02787	.|4.16;4.16	2.67|2.67	-1.54|-1.54	0.08584|0.08584	.|Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	.|0.909660	.|0.08985	.|N	.|0.865274	T|T	0.00300|0.00300	0.0009|0.0009	.|.	.|.	.|.	0.80722|0.80722	P|P	0.0|0.0	.|B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0	.|B;B;B;B	.|0.01281	.|0.0;0.0;0.0;0.0	T|T	0.44205|0.44205	-0.9343|-0.9343	3|8	.|0.02654	.|T	.|1	.|.	3.57|3.57	0.07913|0.07913	0.2392:0.0:0.4421:0.3187|0.2392:0.0:0.4421:0.3187	rs2308624;rs2308625;rs9264631|rs2308624;rs2308625;rs9264631	.|291;291;291;291	.|A2AEA4;A6H578;A2AEA2;P10321	.|.;.;.;1C07_HUMAN	Q|P	255|291;291;291;328	.|ENSP00000365402:Q291P;ENSP00000372819:Q291P	.|ENSP00000365402:Q291P	K|Q	-|-	1|2	0|0	HLA-C|HLA-C	31345989|31345989	0.015000|0.015000	0.18098|0.18098	0.113000|0.113000	0.21522|0.21522	0.012000|0.012000	0.07955|0.07955	0.038000|0.038000	0.13862|0.13862	-0.793000|-0.793000	0.04475|0.04475	-2.419000|-2.419000	0.00218|0.00218	AAG|CAA	T|0.429;G|0.571	0.571	strong		0.587	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
RFX1	5989	hgsc.bcm.edu	37	19	14074787	14074787	+	Silent	SNP	C	C	T	rs137952654	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:14074787C>T	ENST00000254325.4	-	17	2478	c.2244G>A	c.(2242-2244)ctG>ctA	p.L748L		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	748	Necessary for dimerization.				immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			TGTAGCGCCGCAGTGTCTGCG	0.697													C|||	16	0.00319489	0.0	0.0043	5008	,	,		9368	0.0		0.0119	False		,,,				2504	0.001				p.L748L		Atlas-SNP	.											RFX1,NS,carcinoma,0,1	RFX1	63	1	0			c.G2244A						scavenged	.	C		6,4174		0,6,2084	21.0	13.0	15.0		2244	1.0	1.0	19	dbSNP_134	15	48,8144		0,48,4048	no	coding-synonymous	RFX1	NM_002918.4		0,54,6132	TT,TC,CC		0.5859,0.1435,0.4365		748/980	14074787	54,12318	2090	4096	6186	SO:0001819	synonymous_variant	5989	exon17			GCGCCGCAGTGTC		CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.2244G>A	19.37:g.14074787C>T		Somatic	15	3	0.2		WXS	Illumina HiSeq	Phase_I	13	9	0.692308	NM_002918		Silent	SNP	ENST00000254325.4	37	CCDS12301.1																																																																																			C|0.996;T|0.004	0.004	strong		0.697	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	NM_002918	
DUSP15	128853	hgsc.bcm.edu	37	20	30449325	30449325	+	Intron	SNP	C	C	G	rs947310	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr20:30449325C>G	ENST00000278979.3	-	6	503				DUSP15_ENST00000339738.5_Missense_Mutation_p.V197L|DUSP15_ENST00000486996.1_Missense_Mutation_p.V94L|DUSP15_ENST00000398083.1_Missense_Mutation_p.V94L|DUSP15_ENST00000375966.4_Missense_Mutation_p.V194L|DUSP15_ENST00000493115.1_5'Flank|DUSP15_ENST00000398084.2_Missense_Mutation_p.V94L			Q9H1R2	DUS15_HUMAN	dual specificity phosphatase 15						positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(1)|lung(4)|pancreas(1)|stomach(1)	7			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			AGGCGCTGCACGGTTCCCTCG	0.746													G|||	1767	0.352835	0.7625	0.3458	5008	,	,		10036	0.004		0.4066	False		,,,				2504	0.1084				p.V197L		Atlas-SNP	.											.	DUSP15	28	.	0			c.G589C						PASS	.	G	LEU/VAL,LEU/VAL,LEU/VAL	2270,1484		747,776,354	3.0	5.0	4.0		280,589,280	1.3	1.0	20	dbSNP_86	4	2513,5053		543,1427,1813	no	missense,missense,missense	DUSP15	NM_001012644.1,NM_080611.3,NM_177991.1	32,32,32	1290,2203,2167	GG,GC,CC		33.2144,39.5312,42.2527	benign,benign,benign	94/133,197/236,94/133	30449325	4783,6537	1877	3783	5660	SO:0001627	intron_variant	128853	exon7			GCTGCACGGTTCC		CCDS13193.1, CCDS42862.1	20q11.21	2011-06-09	2005-03-09		ENSG00000149599	ENSG00000149599		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16236	protein-coding gene	gene with protein product			"""dual specificity phosphatase-like 15"""			15138252	Standard	NM_080611		Approved	bA243J16.6, VHY	uc002wwx.1	Q9H1R2	OTTHUMG00000032182	ENST00000278979.3:c.426+1048G>C	20.37:g.30449325C>G		Somatic	3	0	0		WXS	Illumina HiSeq	Phase_I	6	6	1	NM_080611	A6NH79|A8MVC8|Q5QP62|Q5QP63|Q5QP65|Q6PGN7|Q8N826|Q9BX24	Missense_Mutation	SNP	ENST00000278979.3	37		795	0.364010989010989	359	0.7296747967479674	129	0.356353591160221	3	0.005244755244755245	304	0.40105540897097625	G	2.098	-0.406724	0.04832	0.604688	0.332144	ENSG00000149599	ENST00000398084;ENST00000339738;ENST00000486996;ENST00000375966;ENST00000398083	T;T;T;T;T	0.39787	1.06;3.96;1.06;3.96;1.06	3.38	1.28	0.21552	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.53688	P	2.1000000000048757E-5	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39840	-0.9594	7	0.07990	T	0.79	.	4.2732	0.10796	0.2356:0.362:0.4024:0.0	rs947310;rs17857463;rs947310	197;94	Q9H1R2-3;A8MVC8	.;.	L	94;197;94;194;94	ENSP00000381158:V94L;ENSP00000341658:V197L;ENSP00000419818:V94L;ENSP00000365133:V194L;ENSP00000381157:V94L	ENSP00000341658:V197L	V	-	1	0	DUSP15	29912986	0.998000	0.40836	0.994000	0.49952	0.596000	0.36781	0.214000	0.17541	-0.127000	0.11661	-1.248000	0.01517	GTG	C|0.640;G|0.360	0.360	strong		0.746	DUSP15-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078555.3	NM_080611	
MOS	4342	hgsc.bcm.edu	37	8	57026520	57026520	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:57026520G>A	ENST00000311923.1	-	1	21	c.22C>T	c.(22-24)Cgc>Tgc	p.R8C		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	8					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			AGGTAGGGGCGTAGGGCCAGG	0.642																																					p.R8C	Esophageal Squamous(124;373 2870 4778)	Atlas-SNP	.											.	MOS	63	.	0			c.C22T						PASS	.						14.0	17.0	16.0					8																	57026520		2187	4271	6458	SO:0001583	missense	4342	exon1			AGGGGCGTAGGGC		CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.22C>T	8.37:g.57026520G>A	ENSP00000310722:p.Arg8Cys	Somatic	144	0	0		WXS	Illumina HiSeq	Phase_I	112	33	0.294643	NM_005372	Q3KPG9|Q3KPH0	Missense_Mutation	SNP	ENST00000311923.1	37	CCDS6164.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.763732	0.31228	.	.	ENSG00000172680	ENST00000311923	D	0.81739	-1.53	5.14	0.608	0.17569	.	0.727768	0.12172	N	0.492935	T	0.53254	0.1785	N	0.03115	-0.41	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.46219	-0.9207	10	0.62326	D	0.03	.	0.6283	0.00789	0.1882:0.23:0.3053:0.2765	.	8	P00540	MOS_HUMAN	C	8	ENSP00000310722:R8C	ENSP00000310722:R8C	R	-	1	0	MOS	57189074	0.028000	0.19301	0.000000	0.03702	0.008000	0.06430	2.093000	0.41710	0.541000	0.28827	0.557000	0.71058	CGC	.	.	none		0.642	MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378174.1	NM_005372	
RHPN2	85415	hgsc.bcm.edu	37	19	33493201	33493201	+	Missense_Mutation	SNP	C	C	T	rs201601538	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:33493201C>T	ENST00000254260.3	-	9	1092	c.1057G>A	c.(1057-1059)Gcg>Acg	p.A353T	RHPN2_ENST00000400226.4_Missense_Mutation_p.A202T	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	353	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.A353T(2)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					GCCAGGGCCGCGTAGTGGTGG	0.642																																					p.A353T		Atlas-SNP	.											RHPN2,caecum,carcinoma,0,17	RHPN2	107	17	2	Substitution - Missense(2)	central_nervous_system(2)	c.G1057A						scavenged	.						51.0	48.0	49.0					19																	33493201		2203	4300	6503	SO:0001583	missense	85415	exon9			GGGCCGCGTAGTG	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.1057G>A	19.37:g.33493201C>T	ENSP00000254260:p.Ala353Thr	Somatic	111	4	0.036036		WXS	Illumina HiSeq	Phase_I	133	10	0.075188	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	6.623	0.483344	0.12581	.	.	ENSG00000131941	ENST00000254260;ENST00000544458;ENST00000400226	T;T	0.17691	2.26;2.26	4.61	-0.585	0.11698	BRO1 domain (3);	1.055030	0.07227	N	0.861852	T	0.07279	0.0184	N	0.11560	0.145	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.41378	-0.9512	10	0.13853	T	0.58	0.2931	3.9219	0.09247	0.1643:0.3914:0.0:0.4443	.	353	Q8IUC4	RHPN2_HUMAN	T	353;83;202	ENSP00000254260:A353T;ENSP00000402244:A202T	ENSP00000254260:A353T	A	-	1	0	RHPN2	38185041	0.000000	0.05858	0.006000	0.13384	0.362000	0.29581	-0.172000	0.09868	0.142000	0.18901	-0.373000	0.07131	GCG	C|0.929;T|0.070	0.070	strong		0.642	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
NSD1	64324	hgsc.bcm.edu	37	5	176638303	176638303	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr5:176638303A>G	ENST00000439151.2	+	5	2948	c.2903A>G	c.(2902-2904)aAg>aGg	p.K968R	NSD1_ENST00000361032.4_Missense_Mutation_p.K865R|NSD1_ENST00000354179.4_Missense_Mutation_p.K699R|NSD1_ENST00000347982.4_Missense_Mutation_p.K699R	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	968					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TCAGAGAAAAAGGGAGATGGC	0.517			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.K968R		Atlas-SNP	.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	NSD1_ENST00000439151,colon,carcinoma,0,2	NSD1	416	2	0			c.A2903G						scavenged	.						65.0	66.0	66.0					5																	176638303		2203	4300	6503	SO:0001583	missense	64324	exon5	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AGAAAAAGGGAGA	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.2903A>G	5.37:g.176638303A>G	ENSP00000395929:p.Lys968Arg	Somatic	193	0	0		WXS	Illumina HiSeq	Phase_I	242	3	0.0123967	NM_022455	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	A	0.034	-1.316745	0.01331	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93133	-3.07;-3.07;-3.07;-3.17	4.83	-1.98	0.07480	.	0.630400	0.15556	N	0.256168	T	0.78266	0.4256	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.19817	0.039;0.039;0.023	B;B;B	0.18871	0.023;0.023;0.006	T	0.68074	-0.5505	9	.	.	.	.	5.4943	0.16793	0.5017:0.1509:0.3473:0.0	.	699;865;968	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	R	699;968;699;865	ENSP00000346111:K699R;ENSP00000395929:K968R;ENSP00000343209:K699R;ENSP00000354310:K865R	.	K	+	2	0	NSD1	176570909	0.976000	0.34144	0.030000	0.17652	0.107000	0.19398	0.281000	0.18810	-0.407000	0.07576	-0.250000	0.11733	AAG	.	.	none		0.517	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
TNFRSF10C	8794	hgsc.bcm.edu	37	8	22974315	22974315	+	Missense_Mutation	SNP	A	A	C	rs61736405		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:22974315A>C	ENST00000356864.3	+	5	1083	c.551A>C	c.(550-552)aAc>aCc	p.N184T	TNFRSF10C_ENST00000540813.1_Missense_Mutation_p.N82T	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain	184					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.N184T(1)		endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		GAGACAATGAACACCAGCCCG	0.602																																					p.N184T		Atlas-SNP	.											TNFRSF10C,trunk,malignant_melanoma,0,1	TNFRSF10C	30	1	1	Substitution - Missense(1)	skin(1)	c.A551C						scavenged	.						68.0	80.0	76.0					8																	22974315		2203	4297	6500	SO:0001583	missense	8794	exon5			CAATGAACACCAG	AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.551A>C	8.37:g.22974315A>C	ENSP00000349324:p.Asn184Thr	Somatic	132	3	0.0227273		WXS	Illumina HiSeq	Phase_I	108	4	0.037037	NM_003841	O14755|Q08AS6|Q6FH98|Q6UXM5	Missense_Mutation	SNP	ENST00000356864.3	37	CCDS6037.1	.	.	.	.	.	.	.	.	.	.	A	1.881	-0.457883	0.04508	.	.	ENSG00000173535	ENST00000356864;ENST00000540813;ENST00000544885	T;T	0.62788	0.0;1.25	.	.	.	.	0.568776	0.17737	U	0.163718	T	0.28400	0.0702	N	0.03608	-0.345	0.22213	N	0.999289	P	0.38110	0.618	B	0.33690	0.168	T	0.14924	-1.0455	9	0.37606	T	0.19	.	2.8413	0.05530	0.5024:0.497:2.0E-4:3.0E-4	rs61736405	184	O14798	TR10C_HUMAN	T	184;82;184	ENSP00000349324:N184T;ENSP00000437612:N82T	ENSP00000349324:N184T	N	+	2	0	TNFRSF10C	23030260	0.001000	0.12720	0.054000	0.19295	0.104000	0.19210	0.918000	0.28678	0.077000	0.16863	0.076000	0.15429	AAC	A|0.013;C|0.987	0.987	weak		0.602	TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215134.3		
TMEM178B	100507421	hgsc.bcm.edu	37	7	141137460	141137460	+	Silent	SNP	C	C	T	rs13233459	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr7:141137460C>T	ENST00000565468.1	+	3	628	c.549C>T	c.(547-549)ctC>ctT	p.L183L		NM_001195278.1	NP_001182207.1	H3BS89	T178B_HUMAN	transmembrane protein 178B	183						integral component of membrane (GO:0016021)											CCATCATCCTCTTTGGCTGGA	0.622													C|||	958	0.191294	0.0265	0.3329	5008	,	,		20026	0.0972		0.4543	False		,,,				2504	0.1401				p.L183L		Atlas-SNP	.											.	.	.	.	0			c.C549T						PASS	.																																			SO:0001819	synonymous_variant	100507421	exon3			CATCCTCTTTGGC		CCDS59086.1	7q34	2012-06-29			ENSG00000261115	ENSG00000261115			44112	protein-coding gene	gene with protein product							Standard	NM_001195278		Approved	DKFZp547G036	uc003vwg.2	H3BS89	OTTHUMG00000172737	ENST00000565468.1:c.549C>T	7.37:g.141137460C>T		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_001195278		Silent	SNP	ENST00000565468.1	37	CCDS59086.1																																																																																			C|0.785;T|0.215	0.215	strong		0.622	TMEM178B-001	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420337.4		
CTGF	1490	hgsc.bcm.edu	37	6	132271952	132271952	+	Missense_Mutation	SNP	G	G	C	rs7451102		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:132271952G>C	ENST00000367976.3	-	2	447	c.247C>G	c.(247-249)Cac>Gac	p.H83D	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	83	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.		H -> D (in dbSNP:rs7451102). {ECO:0000269|PubMed:1293144, ECO:0000269|PubMed:1654338, ECO:0000269|PubMed:9054739, ECO:0000269|Ref.12, ECO:0000269|Ref.4, ECO:0000269|Ref.5, ECO:0000269|Ref.6, ECO:0000269|Ref.7}.		angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GAGCCGAAGTGACAGAATAGG	0.711													C|||	5007	0.9998	1.0	1.0	5008	,	,		8487	1.0		0.999	False		,,,				2504	1.0				p.H83D	Esophageal Squamous(127;510 1660 12817 24400 38449)	Atlas-SNP	.											.	CTGF	36	.	0			c.C247G						PASS	.						7.0	8.0	7.0					6																	132271952		2119	4187	6306	SO:0001583	missense	1490	exon2			CGAAGTGACAGAA	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.247C>G	6.37:g.132271952G>C	ENSP00000356954:p.His83Asp	Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	6	6	1	NM_001901	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Missense_Mutation	SNP	ENST00000367976.3	37	CCDS5151.1	2184	1.0	492	1.0	362	1.0	572	1.0	758	1.0	C	8.018	0.758919	0.15846	.	.	ENSG00000118523	ENST00000367976	T	0.62232	0.04	5.28	5.28	0.74379	Insulin-like growth factor-binding protein, IGFBP (2);	0.048665	0.85682	N	0.000000	T	0.06781	0.0173	N	0.00042	-2.475	0.40675	P	0.017750000000000044	B	0.02656	0.0	B	0.01281	0.0	T	0.27739	-1.0065	9	0.02654	T	1	.	15.7931	0.78384	0.0:0.863:0.137:0.0	rs7451102;rs59294435	83	P29279	CTGF_HUMAN	D	83	ENSP00000356954:H83D	ENSP00000356954:H83D	H	-	1	0	CTGF	132313645	1.000000	0.71417	0.923000	0.36655	0.645000	0.38454	4.000000	0.57039	1.236000	0.43740	-0.293000	0.09583	CAC	G|0.000;C|1.000	1.000	strong		0.711	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
EPHX2	2053	hgsc.bcm.edu	37	8	27382956	27382956	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:27382956C>T	ENST00000521400.1	+	12	1566	c.1136C>T	c.(1135-1137)cCa>cTa	p.P379L	EPHX2_ENST00000517536.1_Missense_Mutation_p.P196L|EPHX2_ENST00000518379.1_Missense_Mutation_p.P347L|EPHX2_ENST00000380476.3_Missense_Mutation_p.P326L|EPHX2_ENST00000521780.1_Missense_Mutation_p.P313L	NM_001979.5	NP_001970.2	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	379	Epoxide hydrolase.				arachidonic acid metabolic process (GO:0019369)|cellular calcium ion homeostasis (GO:0006874)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|inflammatory response (GO:0006954)|phospholipid dephosphorylation (GO:0046839)|positive regulation of gene expression (GO:0010628)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|regulation of blood pressure (GO:0008217)|regulation of cholesterol metabolic process (GO:0090181)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|stilbene catabolic process (GO:0046272)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	10-hydroxy-9-(phosphonooxy)octadecanoate phosphatase activity (GO:0033885)|epoxide hydrolase activity (GO:0004301)|lipid phosphatase activity (GO:0042577)|magnesium ion binding (GO:0000287)|phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxic substance binding (GO:0015643)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	27		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)		AAAGCCAACCCAGTATTTGAT	0.478																																					p.P379L		Atlas-SNP	.											EPHX2,NS,carcinoma,-1,1	EPHX2	57	1	0			c.C1136T						PASS	.						161.0	143.0	149.0					8																	27382956		2203	4300	6503	SO:0001583	missense	2053	exon12			CCAACCCAGTATT	L05779	CCDS6060.1, CCDS59097.1, CCDS59098.1	8p21	2010-04-23			ENSG00000120915	ENSG00000120915	3.3.2.10		3402	protein-coding gene	gene with protein product		132811					Standard	NM_001979		Approved		uc003xfu.4	P34913	OTTHUMG00000102115	ENST00000521400.1:c.1136C>T	8.37:g.27382956C>T	ENSP00000430269:p.Pro379Leu	Somatic	115	0	0		WXS	Illumina HiSeq	Phase_I	154	55	0.357143	NM_001979	B2Z3B1|B3KTU8|B3KUA0|G3V134|J3KPH7|Q16764|Q9HBJ1|Q9HBJ2	Missense_Mutation	SNP	ENST00000521400.1	37	CCDS6060.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.470626	0.63625	.	.	ENSG00000120915	ENST00000521400;ENST00000517536;ENST00000521780;ENST00000380476;ENST00000415449;ENST00000518379	T;T;T;T;T	0.03441	3.93;3.93;3.93;3.93;3.93	5.24	4.35	0.52113	Alpha/beta hydrolase fold-1 (1);	2.166600	0.01505	N	0.017652	T	0.21347	0.0514	M	0.81802	2.56	0.49582	D	0.999806	D;D;D	0.89917	0.993;0.998;1.0	D;D;D	0.74023	0.978;0.944;0.982	T	0.02868	-1.1100	10	0.24483	T	0.36	-1.3552	12.0912	0.53728	0.0:0.9128:0.0:0.0872	.	347;379;379	E5RFU2;E7ETW9;P34913	.;.;HYES_HUMAN	L	379;196;313;326;326;347	ENSP00000430269:P379L;ENSP00000428875:P196L;ENSP00000430302:P313L;ENSP00000369843:P326L;ENSP00000427956:P347L	ENSP00000369843:P326L	P	+	2	0	EPHX2	27438873	0.977000	0.34250	0.428000	0.26697	0.035000	0.12851	3.791000	0.55469	2.421000	0.82119	0.563000	0.77884	CCA	.	.	none		0.478	EPHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219954.4		
UBXN11	91544	hgsc.bcm.edu	37	1	26608885	26608885	+	Missense_Mutation	SNP	C	C	T	rs201454352	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:26608885C>T	ENST00000374222.1	-	16	1932	c.1468G>A	c.(1468-1470)Ggt>Agt	p.G490S	UBXN11_ENST00000374217.2_Missense_Mutation_p.G457S|UBXN11_ENST00000374223.1_Missense_Mutation_p.G247S|UBXN11_ENST00000374221.3_Missense_Mutation_p.G490S|UBXN11_ENST00000357089.4_Missense_Mutation_p.G457S|UBXN11_ENST00000314675.7_Missense_Mutation_p.G370S			Q5T124	UBX11_HUMAN	UBX domain protein 11	490	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		Missing.|Missing. {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.2}.			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						gggccgggaccgggaccggga	0.711																																					p.G490S		Atlas-SNP	.											UBXN11,NS,carcinoma,0,2	UBXN11	54	2	1	Deletion - In frame(1)	ovary(1)	c.G1468A						scavenged	.						40.0	50.0	47.0					1																	26608885		1828	4053	5881	SO:0001583	missense	91544	exon16			CGGGACCGGGACC	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1468G>A	1.37:g.26608885C>T	ENSP00000363339:p.Gly490Ser	Somatic	32	3	0.09375		WXS	Illumina HiSeq	Phase_I	39	8	0.205128	NM_183008	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	ENST00000374222.1	37	CCDS41288.1	.	.	.	.	.	.	.	.	.	.	-	2.886	-0.230636	0.05983	.	.	ENSG00000158062	ENST00000314675;ENST00000374223;ENST00000357089;ENST00000374221;ENST00000374222;ENST00000374217	T;T;T;T;T;T	0.22945	1.93;2.02;2.37;2.3;2.3;2.37	2.5	-2.32	0.06745	.	2.616560	0.01918	N	0.040283	T	0.06096	0.0158	N	0.00926	-1.1	0.09310	N	0.999997	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.28004	-1.0057	10	0.02654	T	1	.	0.4862	0.00556	0.1926:0.2649:0.1644:0.378	.	457;452;370;490	Q5T124-2;Q5T124-4;Q5T124-3;Q5T124	.;.;.;UBX11_HUMAN	S	370;247;457;490;490;457	ENSP00000324721:G370S;ENSP00000363340:G247S;ENSP00000349601:G457S;ENSP00000363338:G490S;ENSP00000363339:G490S;ENSP00000363334:G457S	ENSP00000324721:G370S	G	-	1	0	UBXN11	26481472	0.000000	0.05858	0.001000	0.08648	0.033000	0.12548	-1.097000	0.03349	-0.363000	0.08101	0.472000	0.43445	GGT	A|0.009;C|0.939;T|0.052	0.052	strong		0.711	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
HLA-A	3105	hgsc.bcm.edu	37	6	29910693	29910693	+	Missense_Mutation	SNP	A	A	G	rs41559716	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:29910693A>G	ENST00000396634.1	+	4	574	c.233A>G	c.(232-234)cAg>cGg	p.Q78R	HLA-A_ENST00000376809.5_Missense_Mutation_p.Q78R|HLA-A_ENST00000376802.2_Missense_Mutation_p.Q78R|HLA-A_ENST00000376806.5_Missense_Mutation_p.Q78R			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	78	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.Q78R(2)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						TGGATAGAGCAGGAGGGGCCG	0.657									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.Q78R		Atlas-SNP	.											HLA-A,bladder,carcinoma,0,8	HLA-A	89	8	2	Substitution - Missense(2)	lung(1)|endometrium(1)	c.A233G						scavenged	.						54.0	57.0	56.0					6																	29910693		2203	4299	6502	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	TAGAGCAGGAGGG	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.233A>G	6.37:g.29910693A>G	ENSP00000379873:p.Gln78Arg	Somatic	184	3	0.0163043		WXS	Illumina HiSeq	Phase_I	150	14	0.0933333	NM_001242758	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	9.798	1.179669	0.21787	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00784	5.7;5.7;5.7;5.7	3.72	-4.39	0.03611	MHC class I, alpha chain, alpha1/alpha2 (3);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	1.398580	0.06189	N	0.681068	T	0.00815	0.0027	L	0.56280	1.765	0.09310	N	1	B;P;B;P;B	0.42483	0.0;0.781;0.0;0.781;0.0	B;D;B;D;B	0.71184	0.006;0.972;0.01;0.972;0.01	T	0.44952	-0.9294	10	0.87932	D	0	.	0.9552	0.01384	0.3504:0.1689:0.3159:0.1647	rs41559716	78;78;78;78;78	P13746;Q5SRN7;P16188;Q5SRN5;P04439	1A11_HUMAN;.;1A30_HUMAN;.;1A03_HUMAN	R	78	ENSP00000379873:Q78R;ENSP00000366002:Q78R;ENSP00000366005:Q78R;ENSP00000365998:Q78R	ENSP00000348012:Q78R	Q	+	2	0	HLA-A	30018672	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	-0.990000	0.03732	-0.910000	0.03847	-0.450000	0.05554	CAG	A|0.979;G|0.021	0.021	strong		0.657	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
B2M	567	hgsc.bcm.edu	37	15	45007809	45007809	+	Missense_Mutation	SNP	T	T	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr15:45007809T>G	ENST00000558401.1	+	2	326	c.256T>G	c.(256-258)Tac>Gac	p.Y86D	B2M_ENST00000544417.1_Missense_Mutation_p.Y86D|B2M_ENST00000559220.1_Intron|B2M_ENST00000559916.1_Missense_Mutation_p.Y86D	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	86	Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.Y86N(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		CTATCTCTTGTACTACACTGA	0.423																																					p.Y86D		Atlas-SNP	.											B2M,NS,lymphoid_neoplasm,-2,2	B2M	99	2	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.T256G						scavenged	.						172.0	169.0	170.0					15																	45007809		2198	4298	6496	SO:0001583	missense	567	exon2			CTCTTGTACTACA	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.256T>G	15.37:g.45007809T>G	ENSP00000452780:p.Tyr86Asp	Somatic	147	1	0.00680272		WXS	Illumina HiSeq	Phase_I	98	56	0.571429	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	T	15.60	2.880536	0.51801	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.02709	4.19	6.03	0.942	0.19525	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.726338	0.14242	N	0.332034	T	0.02970	0.0088	N	0.08118	0	0.09310	N	0.999997	P;P	0.51537	0.946;0.57	P;P	0.56042	0.79;0.708	T	0.45920	-0.9228	10	0.59425	D	0.04	.	4.1475	0.10222	0.222:0.0:0.486:0.292	.	86;86	F5H6I0;P61769	.;B2MG_HUMAN	D	86	ENSP00000437604:Y86D	ENSP00000340858:Y86D	Y	+	1	0	B2M	42795101	0.992000	0.36948	0.077000	0.20336	0.001000	0.01503	2.183000	0.42565	-0.061000	0.13110	-1.392000	0.01152	TAC	.	.	none		0.423	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
KALRN	8997	hgsc.bcm.edu	37	3	124175525	124175525	+	Silent	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:124175525C>T	ENST00000240874.3	+	23	3955	c.3798C>T	c.(3796-3798)gaC>gaT	p.D1266D	KALRN_ENST00000460856.1_Silent_p.D1257D|KALRN_ENST00000360013.3_Silent_p.D1266D	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1266					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						AGCTGCGGGACGCCAACCACG	0.557																																					p.D1266D		Atlas-SNP	.											.	KALRN	556	.	0			c.C3798T						PASS	.						105.0	100.0	102.0					3																	124175525		2203	4300	6503	SO:0001819	synonymous_variant	8997	exon23			GCGGGACGCCAAC	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.3798C>T	3.37:g.124175525C>T		Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	174	51	0.293103	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	ENST00000240874.3	37	CCDS3027.1	.	.	.	.	.	.	.	.	.	.	C	9.785	1.176432	0.21704	.	.	ENSG00000160145	ENST00000354186	.	.	.	4.88	-9.12	0.00707	.	.	.	.	.	T	0.59972	0.2233	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68401	-0.5418	4	.	.	.	.	15.3034	0.73972	0.0:0.5754:0.0:0.4246	.	.	.	.	M	1235	.	.	T	+	2	0	KALRN	125658215	0.014000	0.17966	0.808000	0.32385	0.960000	0.62799	-0.945000	0.03909	-1.767000	0.01300	-0.966000	0.02617	ACG	.	.	none		0.557	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
FAM171B	165215	hgsc.bcm.edu	37	2	187559050	187559050	+	Silent	SNP	A	A	G	rs2370705	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr2:187559050A>G	ENST00000304698.5	+	1	353	c.150A>G	c.(148-150)caA>caG	p.Q50Q	AC017101.10_ENST00000453665.1_RNA	NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	50	Gln-rich.					integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						agcagcagcaacaacaacaac	0.637																																					p.Q50Q		Atlas-SNP	.											FAM171B,colon,carcinoma,0,2	FAM171B	146	2	0			c.A150G						scavenged	.						25.0	27.0	27.0					2																	187559050		2202	4300	6502	SO:0001819	synonymous_variant	165215	exon1			GCAGCAACAACAA	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.150A>G	2.37:g.187559050A>G		Somatic	55	1	0.0181818		WXS	Illumina HiSeq	Phase_I	66	8	0.121212	NM_177454	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Silent	SNP	ENST00000304698.5	37	CCDS33347.1																																																																																			A|0.462;G|0.538	0.538	strong		0.637	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
FAM21A	387680	hgsc.bcm.edu	37	10	47909792	47909792	+	Missense_Mutation	SNP	C	C	T	rs201373575	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr10:47909792C>T	ENST00000358474.5	+	11	889	c.889C>T	c.(889-891)Cgg>Tgg	p.R297W		NM_018232.1	NP_060702.1	Q5SNT6	FA21B_HUMAN		297					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)		p.R297W(2)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10						CCCCCAGGATCGGCAAGCTGG	0.498													C|||	1254	0.250399	0.1861	0.1513	5008	,	,		7006	0.4306		0.2028	False		,,,				2504	0.271				p.R297W		Atlas-SNP	.											FAM21B_ENST00000358474,NS,carcinoma,0,2	FAM21B	31	2	2	Substitution - Missense(2)	prostate(2)	c.C889T						scavenged	.						17.0	21.0	20.0					10																	47909792		589	2506	3095	SO:0001583	missense	55747	exon11			CAGGATCGGCAAG																												ENST00000358474.5:c.889C>T	10.37:g.47909792C>T	ENSP00000351259:p.Arg297Trp	Somatic	379	5	0.0131926		WXS	Illumina HiSeq	Phase_I	382	5	0.013089	NM_018232		Missense_Mutation	SNP	ENST00000358474.5	37	CCDS44379.1	.	.	.	.	.	.	.	.	.	.	.	12.06	1.824831	0.32237	.	.	ENSG00000152726	ENST00000358474;ENST00000535219;ENST00000355876	.	.	.	2.3	1.19	0.21007	.	1.629960	0.03041	N	0.153324	T	0.31295	0.0792	M	0.68317	2.08	0.09310	N	1	P;B	0.39352	0.669;0.41	B;B	0.20577	0.03;0.021	T	0.44922	-0.9296	9	0.72032	D	0.01	0.1363	5.4742	0.16686	0.3296:0.6704:0.0:0.0	.	297;385	Q5SNT6;B7ZME8	FA21B_HUMAN;.	W	297;134;288	.	ENSP00000348138:R288W	R	+	1	2	FAM21B	47429798	0.000000	0.05858	0.005000	0.12908	0.138000	0.21146	0.358000	0.20216	1.299000	0.44798	0.152000	0.16155	CGG	C|0.949;T|0.051	0.051	strong		0.498	FAM21B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047871.2		
FAM186A	121006	hgsc.bcm.edu	37	12	50746164	50746164	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr12:50746164A>G	ENST00000327337.5	-	4	4450	c.4451T>C	c.(4450-4452)aTc>aCc	p.I1484T	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Missense_Mutation_p.I1484T	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1484																	CTGCGGAGGGATGAGAGGGAT	0.647																																					p.I1484T	NSCLC(138;1796 1887 12511 19463 37884)	Atlas-SNP	.											FAM186A_ENST00000327337,NS,carcinoma,0,1	FAM186A	181	1	0			c.T4451C						scavenged	.						21.0	21.0	21.0					12																	50746164		692	1591	2283	SO:0001583	missense	121006	exon4			GGAGGGATGAGAG		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4451T>C	12.37:g.50746164A>G	ENSP00000329995:p.Ile1484Thr	Somatic	249	18	0.0722892		WXS	Illumina HiSeq	Phase_I	213	18	0.084507	NM_001145475		Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	-	0.011	-1.715003	0.00706	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.03920	3.76;3.76	4.53	-0.968	0.10313	.	.	.	.	.	T	0.01558	0.0050	N	0.02539	-0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46359	-0.9197	9	0.02654	T	1	.	6.7987	0.23738	0.3877:0.1176:0.4948:0.0	.	1484;1484	F5GYN0;A6NE01	.;F186A_HUMAN	T	1484	ENSP00000441337:I1484T;ENSP00000329995:I1484T	ENSP00000329995:I1484T	I	-	2	0	FAM186A	49032431	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.339000	0.19875	-0.423000	0.07394	-1.222000	0.01597	ATC	.	.	none		0.647	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
PPP2CA	5515	hgsc.bcm.edu	37	5	133561476	133561476	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr5:133561476G>A	ENST00000481195.1	-	1	357	c.77C>T	c.(76-78)tCc>tTc	p.S26F	CTD-2410N18.5_ENST00000519718.1_Missense_Mutation_p.S26F|CTD-2410N18.4_ENST00000518409.1_RNA|PPP2CA_ENST00000231504.5_5'UTR|MIR3661_ENST00000577394.1_RNA|CDKL3_ENST00000609383.1_Intron|CTD-2410N18.3_ENST00000602919.1_lincRNA|CDKL3_ENST00000609654.1_Intron	NM_002715.2	NP_002706.1	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha isozyme	26					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|meiotic nuclear division (GO:0007126)|mesoderm development (GO:0007498)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein dephosphorylation (GO:0006470)|protein heterotrimerization (GO:0070208)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of protein autophosphorylation (GO:0031952)|regulation of protein catabolic process (GO:0042176)|regulation of receptor activity (GO:0010469)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	CTTGACCTGGGACTCGGACAG	0.662																																					p.S26F		Atlas-SNP	.											.	PPP2CA	29	.	0			c.C77T						PASS	.						76.0	68.0	71.0					5																	133561476		2203	4300	6503	SO:0001583	missense	5515	exon1			ACCTGGGACTCGG		CCDS4173.1	5q31.1	2013-01-24	2010-03-05		ENSG00000113575	ENSG00000113575	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9299	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, alpha isoform"""	176915	"""protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform"""			8383590	Standard	NM_002715		Approved	PP2Calpha		P67775	OTTHUMG00000129119	ENST00000481195.1:c.77C>T	5.37:g.133561476G>A	ENSP00000418447:p.Ser26Phe	Somatic	15	0	0		WXS	Illumina HiSeq	Phase_I	37	17	0.459459	NM_002715	P05323|P13197	Missense_Mutation	SNP	ENST00000481195.1	37	CCDS4173.1	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453473	0.63290	.	.	ENSG00000113558;ENSG00000113575	ENST00000519718;ENST00000481195	T;T	0.46819	0.86;0.95	5.1	5.1	0.69264	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);	0.390870	0.24755	N	0.035880	T	0.47967	0.1474	M	0.79011	2.435	0.80722	D	1	B	0.11235	0.004	B	0.09377	0.004	T	0.52704	-0.8540	10	0.72032	D	0.01	-1.9595	8.9806	0.35964	0.0:0.205:0.6547:0.1403	.	26	P67775	PP2AA_HUMAN	F	26	ENSP00000430774:S26F;ENSP00000418447:S26F	ENSP00000418447:S26F	S	-	2	0	PPP2CA;SKP1	133589375	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.051000	0.49885	2.653000	0.90120	0.655000	0.94253	TCC	.	.	none		0.662	PPP2CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251165.1	NM_002715	
MEGF9	1955	hgsc.bcm.edu	37	9	123367753	123367753	+	Silent	SNP	T	T	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr9:123367753T>C	ENST00000373930.3	-	6	1635	c.1524A>G	c.(1522-1524)gtA>gtG	p.V508V	MEGF9_ENST00000426959.1_Silent_p.V545V	NM_001080497.2	NP_001073966.2	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	508						integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	16						GGGTCCATGATACATCAGCTA	0.423																																					p.V508V		Atlas-SNP	.											.	MEGF9	33	.	0			c.A1524G						PASS	.						95.0	90.0	92.0					9																	123367753		1927	4140	6067	SO:0001819	synonymous_variant	1955	exon6			CCATGATACATCA	AB011542	CCDS48010.1, CCDS48010.2	9q32-q33.3	2008-07-21	2006-03-31	2006-03-31	ENSG00000106780	ENSG00000106780			3234	protein-coding gene	gene with protein product		604268	"""EGF-like-domain, multiple 5"""	EGFL5		9693030	Standard	NM_001080497		Approved		uc022bms.1	Q9H1U4	OTTHUMG00000021039	ENST00000373930.3:c.1524A>G	9.37:g.123367753T>C		Somatic	205	0	0		WXS	Illumina HiSeq	Phase_I	202	74	0.366337	NM_001080497	B7Z315|O75098	Silent	SNP	ENST00000373930.3	37	CCDS48010.2																																																																																			.	.	none		0.423	MEGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055513.1	NM_001080497	
IQCK	124152	hgsc.bcm.edu	37	16	19800169	19800169	+	Silent	SNP	G	G	T	rs143956012	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr16:19800169G>T	ENST00000320394.6	+	8	1314	c.615G>T	c.(613-615)ccG>ccT	p.P205P	IQCK_ENST00000564186.1_Silent_p.P205P|IQCK_ENST00000562762.1_3'UTR|IQCK_ENST00000433597.2_Silent_p.P117P|IQCK_ENST00000541926.1_Intron	NM_153208.1	NP_694940.1	Q8N0W5	IQCK_HUMAN	IQ motif containing K	205										kidney(1)|large_intestine(2)|lung(2)|skin(1)	6						GCCCACGGCCGCCAATCCCAC	0.478																																					p.P205P		Atlas-SNP	.											IQCK,colon,carcinoma,0,1	IQCK	35	1	0			c.G615T						scavenged	.						111.0	111.0	111.0					16																	19800169		2197	4300	6497	SO:0001819	synonymous_variant	124152	exon8			ACGGCCGCCAATC	AF520569	CCDS10580.1	16p12.3	2008-02-05			ENSG00000174628	ENSG00000174628			28556	protein-coding gene	gene with protein product						10493829	Standard	NM_153208		Approved	MGC35048, FLJ36575	uc002dgr.3	Q8N0W5	OTTHUMG00000131453	ENST00000320394.6:c.615G>T	16.37:g.19800169G>T		Somatic	81	0	0		WXS	Illumina HiSeq	Phase_I	92	3	0.0326087	NM_153208	B2RDU0|O43327|Q8NFF4	Silent	SNP	ENST00000320394.6	37	CCDS10580.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.277519	0.40294	.	.	ENSG00000174628	ENST00000308214	T	0.24723	1.84	5.76	-10.7	0.00240	.	.	.	.	.	T	0.16599	0.0399	.	.	.	0.38554	D	0.94954	.	.	.	.	.	.	T	0.40496	-0.9560	5	.	.	.	-7.6728	5.8052	0.18436	0.4635:0.0:0.2779:0.2586	.	.	.	.	S	162	ENSP00000309261:A162S	.	A	+	1	0	IQCK	19707670	0.000000	0.05858	0.121000	0.21740	0.966000	0.64601	-2.048000	0.01406	-1.573000	0.01659	-0.290000	0.09829	GCC	G|0.999;A|0.001	.	alt		0.478	IQCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254273.2	NM_153208	
RHPN2	85415	hgsc.bcm.edu	37	19	33493200	33493200	+	Missense_Mutation	SNP	G	G	A	rs200623446	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:33493200G>A	ENST00000254260.3	-	9	1093	c.1058C>T	c.(1057-1059)gCg>gTg	p.A353V	RHPN2_ENST00000400226.4_Missense_Mutation_p.A202V	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	353	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					GGCCAGGGCCGCGTAGTGGTG	0.637																																					p.A353V		Atlas-SNP	.											RHPN2,caecum,carcinoma,-1,17	RHPN2	107	17	0			c.C1058T						scavenged	.						50.0	48.0	49.0					19																	33493200		2203	4300	6503	SO:0001583	missense	85415	exon9			AGGGCCGCGTAGT	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.1058C>T	19.37:g.33493200G>A	ENSP00000254260:p.Ala353Val	Somatic	112	4	0.0357143		WXS	Illumina HiSeq	Phase_I	132	11	0.0833333	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.276172	0.23307	.	.	ENSG00000131941	ENST00000254260;ENST00000544458;ENST00000400226	T;T	0.18810	2.19;2.19	4.61	-4.16	0.03869	BRO1 domain (3);	1.055030	0.07227	N	0.861852	T	0.14830	0.0358	L	0.39898	1.24	0.09310	N	1	B	0.18013	0.025	B	0.15484	0.013	T	0.36114	-0.9761	10	0.30078	T	0.28	0.2931	7.8623	0.29517	0.0:0.2524:0.4684:0.2792	.	353	Q8IUC4	RHPN2_HUMAN	V	353;83;202	ENSP00000254260:A353V;ENSP00000402244:A202V	ENSP00000254260:A353V	A	-	2	0	RHPN2	38185040	0.000000	0.05858	0.001000	0.08648	0.375000	0.29983	0.178000	0.16820	-0.540000	0.06265	0.455000	0.32223	GCG	G|0.935;A|0.065	0.065	strong		0.637	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
NBPF14	25832	hgsc.bcm.edu	37	1	148010926	148010926	+	Missense_Mutation	SNP	T	T	C	rs369015353		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:148010926T>C	ENST00000369219.1	-	14	1712	c.1696A>G	c.(1696-1698)Ata>Gta	p.I566V				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	566	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					TGCTCCAATATGTAAAAGGCA	0.463																																					p.I566V		Atlas-SNP	.											NBPF14,NS,lymphoid_neoplasm,+1,1	NBPF14	107	1	0			c.A1696G						scavenged	.						2.0	1.0	1.0					1																	148010926		381	1089	1470	SO:0001583	missense	25832	exon14			CCAATATGTAAAA	AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.1696A>G	1.37:g.148010926T>C	ENSP00000358221:p.Ile566Val	Somatic	420	0	0		WXS	Illumina HiSeq	Phase_I	401	4	0.00997506	NM_015383	Q5TI23|Q8IX76|Q9UJI9	Missense_Mutation	SNP	ENST00000369219.1	37		.	.	.	.	.	.	.	.	.	.	-	0.078	-1.188628	0.01607	.	.	ENSG00000122497	ENST00000369219	T	0.05996	3.36	.	.	.	DUF1220 (2);	.	.	.	.	T	0.00468	0.0015	N	0.01576	-0.805	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.46693	-0.9173	7	0.38643	T	0.18	.	.	.	.	.	680;566	Q8IX74;Q5TI25	.;NBPFE_HUMAN	V	566	ENSP00000358221:I566V	ENSP00000358221:I566V	I	-	1	0	NBPF14	146477550	0.966000	0.33281	0.014000	0.15608	0.014000	0.08584	-2.021000	0.01440	-2.094000	0.00854	-2.075000	0.00382	ATA	.	.	none		0.463	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383	
FAM186A	121006	hgsc.bcm.edu	37	12	50746158	50746158	+	Missense_Mutation	SNP	G	G	T	rs71459097		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr12:50746158G>T	ENST00000327337.5	-	4	4456	c.4457C>A	c.(4456-4458)cCg>cAg	p.P1486Q	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_Missense_Mutation_p.P1486Q	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1486								p.P1486Q(1)									CTGAGCCTGCGGAGGGATGAG	0.647																																					p.P1486Q	NSCLC(138;1796 1887 12511 19463 37884)	Atlas-SNP	.											FAM186A_ENST00000327337,extremity,malignant_melanoma,0,2	FAM186A	181	2	1	Substitution - Missense(1)	skin(1)	c.C4457A						scavenged	.						18.0	18.0	18.0					12																	50746158		692	1591	2283	SO:0001583	missense	121006	exon4			GCCTGCGGAGGGA		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4457C>A	12.37:g.50746158G>T	ENSP00000329995:p.Pro1486Gln	Somatic	235	4	0.0170213		WXS	Illumina HiSeq	Phase_I	213	8	0.0375587	NM_001145475		Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	-	3.047	-0.196295	0.06259	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.04049	3.72;3.72	4.53	-1.5	0.08691	.	.	.	.	.	T	0.02012	0.0063	N	0.04203	-0.255	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.49351	-0.8949	9	0.13853	T	0.58	.	7.1242	0.25463	0.0:0.1707:0.524:0.3053	.	1486;1486	F5GYN0;A6NE01	.;F186A_HUMAN	Q	1486	ENSP00000441337:P1486Q;ENSP00000329995:P1486Q	ENSP00000329995:P1486Q	P	-	2	0	FAM186A	49032425	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.921000	0.04008	-0.386000	0.07821	-0.446000	0.05623	CCG	.	.	none		0.647	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
HLA-G	3135	hgsc.bcm.edu	37	6	29797406	29797406	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:29797406G>A	ENST00000360323.6	+	4	855	c.831G>A	c.(829-831)gaG>gaA	p.E277E	HLA-G_ENST00000376818.3_Silent_p.E185E|HLA-G_ENST00000376815.3_Intron|HLA-G_ENST00000376828.2_Silent_p.E282E|HLA-G_ENST00000428701.1_Silent_p.E277E			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	277	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.E277E(1)		central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						CTTCTGGAGAGGAGCAGAGAT	0.607																																					p.E277E		Atlas-SNP	.											HLA-G,NS,carcinoma,0,1	HLA-G	90	1	1	Substitution - coding silent(1)	prostate(1)	c.G831A						scavenged	.						62.0	58.0	59.0					6																	29797406		2203	4298	6501	SO:0001819	synonymous_variant	3135	exon5			TGGAGAGGAGCAG		CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.831G>A	6.37:g.29797406G>A		Somatic	100	1	0.01		WXS	Illumina HiSeq	Phase_I	130	12	0.0923077	NM_002127		Silent	SNP	ENST00000360323.6	37	CCDS4668.1																																																																																			.	.	weak		0.607	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076286.2	NM_002127	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144857010	144857010	+	Missense_Mutation	SNP	T	T	C	rs3853916		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:144857010T>C	ENST00000369354.3	-	40	6664	c.6475A>G	c.(6475-6477)Acc>Gcc	p.T2159A	PDE4DIP_ENST00000369356.4_Missense_Mutation_p.T2159A|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.T2295A|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.T2244A|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.T2053A|RP4-791M13.4_ENST00000532137.1_RNA			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	2159					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.T2159A(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TTGGGAGGGGTCTTCATTACT	0.443			T	PDGFRB	MPD																																p.T2159A		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	PDE4DIP,NS,carcinoma,0,1	PDE4DIP	817	1	1	Substitution - Missense(1)	prostate(1)	c.A6475G						scavenged	.						76.0	72.0	74.0					1																	144857010		2203	4296	6499	SO:0001583	missense	9659	exon40			GAGGGGTCTTCAT	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.6475A>G	1.37:g.144857010T>C	ENSP00000358360:p.Thr2159Ala	Somatic	1125	8	0.00711111		WXS	Illumina HiSeq	Phase_I	1127	17	0.0150843	NM_014644	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	.	12.27	1.889088	0.33348	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.01613	4.73;4.83;4.84;4.84;4.84	4.16	-0.82	0.10826	.	.	.	.	.	T	0.00637	0.0021	L	0.40543	1.245	0.09310	N	1	B;B	0.18461	0.015;0.028	B;B	0.12837	0.006;0.008	T	0.41893	-0.9483	9	0.49607	T	0.09	.	7.8317	0.29347	0.0:0.3889:0.0:0.6111	rs3853916;rs4067557	2053;2159	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	A	2053;2159;2159;2244;2295	ENSP00000327209:T2053A;ENSP00000358360:T2159A;ENSP00000358363:T2159A;ENSP00000435654:T2244A;ENSP00000358366:T2295A	ENSP00000327209:T2053A	T	-	1	0	PDE4DIP	143568367	0.002000	0.14202	0.005000	0.12908	0.631000	0.37964	-0.164000	0.09983	-0.097000	0.12307	0.369000	0.22263	ACC	.	.	weak		0.443	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
ZNF285	26974	hgsc.bcm.edu	37	19	44891010	44891010	+	Missense_Mutation	SNP	G	G	C	rs150792548	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:44891010G>C	ENST00000330997.4	-	4	1461	c.1397C>G	c.(1396-1398)gCg>gGg	p.A466G	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Missense_Mutation_p.A473G|ZNF285_ENST00000544719.2_Missense_Mutation_p.A466G	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	466					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A466G(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						AGAGCTATACGCAAAATCCTT	0.418																																					p.A466G		Atlas-SNP	.											ZNF285,NS,carcinoma,+1,2	ZNF285	86	2	1	Substitution - Missense(1)	skin(1)	c.C1397G						scavenged	.						83.0	84.0	83.0					19																	44891010		2203	4300	6503	SO:0001583	missense	26974	exon4			CTATACGCAAAAT	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1397C>G	19.37:g.44891010G>C	ENSP00000333595:p.Ala466Gly	Somatic	114	2	0.0175439		WXS	Illumina HiSeq	Phase_I	92	4	0.0434783	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	G	9.126	1.010205	0.19277	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.08008	3.14	3.46	0.829	0.18847	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08714	0.0216	L	0.45744	1.44	0.09310	N	1	B;B	0.34399	0.452;0.0	B;B	0.36666	0.23;0.001	T	0.29488	-1.0010	9	0.56958	D	0.05	.	6.4144	0.21708	0.1094:0.3586:0.532:0.0	.	490;466	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	G	489;466	ENSP00000333595:A466G	ENSP00000333595:A466G	A	-	2	0	ZNF285	49582850	0.000000	0.05858	0.002000	0.10522	0.860000	0.49131	-6.159000	0.00078	0.511000	0.28236	0.298000	0.19748	GCG	A|0.002;C|0.002;G|0.995	0.002	strong		0.418	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
CDH2	1000	hgsc.bcm.edu	37	18	25583075	25583075	+	Silent	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr18:25583075C>T	ENST00000269141.3	-	7	1329	c.906G>A	c.(904-906)ggG>ggA	p.G302G	CDH2_ENST00000399380.3_Silent_p.G271G	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	302	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						ACCTCAACATCCCATTGAGGG	0.458																																					p.G302G		Atlas-SNP	.											CDH2,right_upper_lobe,carcinoma,-1,2	CDH2	194	2	0			c.G906A						scavenged	.						235.0	171.0	193.0					18																	25583075		2203	4300	6503	SO:0001819	synonymous_variant	1000	exon7			CAACATCCCATTG	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.906G>A	18.37:g.25583075C>T		Somatic	148	1	0.00675676		WXS	Illumina HiSeq	Phase_I	107	41	0.383178	NM_001792	A8MWK3|B0YIY6|Q14923|Q8N173	Silent	SNP	ENST00000269141.3	37	CCDS11891.1																																																																																			.	.	none		0.458	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792	
UPF3A	65110	hgsc.bcm.edu	37	13	115047496	115047496	+	Splice_Site	SNP	G	G	C	rs76186578		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr13:115047496G>C	ENST00000375299.3	+	2	264	c.208G>C	c.(208-210)Gtg>Ctg	p.V70L	UPF3A_ENST00000351487.5_Splice_Site_p.V70L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	70	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.V70L(4)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		CTCCCCGCAGGTGGTCATCCG	0.731																																					p.V70L		Atlas-SNP	.											UPF3A,extremity,malignant_melanoma,0,3	UPF3A	47	3	4	Substitution - Missense(4)	skin(2)|upper_aerodigestive_tract(1)|lung(1)	c.G208C						scavenged	.						3.0	3.0	3.0					13																	115047496		1806	3727	5533	SO:0001630	splice_region_variant	65110	exon2			CCGCAGGTGGTCA	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.208-1G>C	13.37:g.115047496G>C		Somatic	29	2	0.0689655		WXS	Illumina HiSeq	Phase_I	34	7	0.205882	NM_080687	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Missense_Mutation	SNP	ENST00000375299.3	37	CCDS9543.1	.	.	.	.	.	.	.	.	.	.	g	24.7	4.562889	0.86335	.	.	ENSG00000169062	ENST00000375299;ENST00000351487	T;T	0.69806	-0.43;-0.43	4.77	4.77	0.60923	Regulator of nonsense-mediated decay, UPF3 (1);Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.79167	0.4400	L	0.58354	1.805	0.80722	D	1	D;D;D	0.89917	0.988;1.0;0.997	D;D;D	0.80764	0.951;0.994;0.991	T	0.78492	-0.2183	9	.	.	.	-20.8011	18.2246	0.89913	0.0:0.0:1.0:0.0	.	70;70;70	B4DGE0;Q9H1J1-2;Q9H1J1	.;.;REN3A_HUMAN	L	70	ENSP00000364448:V70L;ENSP00000329592:V70L	.	V	+	1	0	UPF3A	114065598	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	6.880000	0.75578	2.371000	0.80710	0.473000	0.43528	GTG	.	.	weak		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		Missense_Mutation
AGGF1	55109	hgsc.bcm.edu	37	5	76332463	76332463	+	Missense_Mutation	SNP	C	C	A	rs78273685		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr5:76332463C>A	ENST00000312916.7	+	4	981	c.599C>A	c.(598-600)gCg>gAg	p.A200E		NM_018046.4	NP_060516.2	Q8N302	AGGF1_HUMAN	angiogenic factor with G patch and FHA domains 1	200					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|RNA processing (GO:0006396)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	nucleic acid binding (GO:0003676)	p.A200E(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	20		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		GCAGCAGAAGCGGCTGTATCA	0.398																																					p.A200E		Atlas-SNP	.											AGGF1,NS,carcinoma,0,1	AGGF1	71	1	1	Substitution - Missense(1)	prostate(1)	c.C599A						scavenged	.						80.0	80.0	80.0					5																	76332463		2203	4300	6503	SO:0001583	missense	55109	exon4			CAGAAGCGGCTGT	AK001145	CCDS4035.1	5q13.3	2013-10-11			ENSG00000164252	ENSG00000164252		"""G patch domain containing"""	24684	protein-coding gene	gene with protein product		608464				18564129, 17103452	Standard	NM_018046		Approved	VG5Q, HSU84971, FLJ10283, GPATC7, GPATCH7	uc003ket.3	Q8N302	OTTHUMG00000102132	ENST00000312916.7:c.599C>A	5.37:g.76332463C>A	ENSP00000316109:p.Ala200Glu	Somatic	165	1	0.00606061		WXS	Illumina HiSeq	Phase_I	167	5	0.0299401	NM_018046	O00581|Q53YS3|Q9BU84|Q9NW66	Missense_Mutation	SNP	ENST00000312916.7	37	CCDS4035.1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.675227	0.47781	.	.	ENSG00000164252	ENST00000312916	D	0.85629	-2.01	5.09	5.09	0.68999	.	0.065026	0.64402	D	0.000007	D	0.84392	0.5462	L	0.41710	1.295	0.80722	D	1	D	0.52996	0.957	P	0.48921	0.595	D	0.83644	0.0152	9	.	.	.	-37.6142	18.4903	0.90844	0.0:1.0:0.0:0.0	.	200	Q8N302	AGGF1_HUMAN	E	200	ENSP00000316109:A200E	.	A	+	2	0	AGGF1	76368219	1.000000	0.71417	0.999000	0.59377	0.884000	0.51177	5.450000	0.66626	2.363000	0.80096	0.585000	0.79938	GCG	A|0.001;C|0.999	0.001	weak		0.398	AGGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219971.2	NM_018046	
MUC4	4585	hgsc.bcm.edu	37	3	195515257	195515257	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:195515257G>T	ENST00000463781.3	-	2	3653	c.3194C>A	c.(3193-3195)gCa>gAa	p.A1065E	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A1065E|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	498					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A1065E(3)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAGT	0.562																																					p.A1065E		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,3	MUC4	1505	3	3	Substitution - Missense(3)	NS(2)|endometrium(1)	c.C3194A						scavenged	.						24.0	18.0	20.0					3																	195515257		690	1590	2280	SO:0001583	missense	4585	exon2			GTGGATGCTGAGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3194C>A	3.37:g.195515257G>T	ENSP00000417498:p.Ala1065Glu	Somatic	99	3	0.030303		WXS	Illumina HiSeq	Phase_I	82	6	0.0731707	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.830	0.522392	0.13066	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32753	1.44;1.44	0.573	-1.15	0.09709	.	.	.	.	.	T	0.14960	0.0361	N	0.19112	0.55	0.09310	N	1	B	0.19200	0.034	B	0.14023	0.01	T	0.28744	-1.0034	8	.	.	.	.	4.0999	0.10009	0.5176:0.0:0.4824:0.0	.	1065	E7ESK3	.	E	1065	ENSP00000417498:A1065E;ENSP00000420243:A1065E	.	A	-	2	0	MUC4	196999652	.	.	0.002000	0.10522	0.032000	0.12392	.	.	-0.302000	0.08869	-2.092000	0.00371	GCA	G|0.500;A|0.500	.	alt		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
STK3	6788	hgsc.bcm.edu	37	8	99608261	99608261	+	Splice_Site	SNP	T	T	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:99608261T>C	ENST00000419617.2	-	7	961	c.821A>G	c.(820-822)cAg>cGg	p.Q274R	STK3_ENST00000521768.1_5'UTR|STK3_ENST00000523601.1_Splice_Site_p.Q302R	NM_006281.3	NP_006272.2	Q13188	STK3_HUMAN	serine/threonine kinase 3	274	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		AGCACTGACCTGTAAAAGTTG	0.403																																					p.Q302R		Atlas-SNP	.											STK3,NS,carcinoma,+1,1	STK3	47	1	0			c.A905G						scavenged	.						67.0	64.0	65.0					8																	99608261		1906	4103	6009	SO:0001630	splice_region_variant	6788	exon9			CTGACCTGTAAAA	BC010640	CCDS47900.1, CCDS59108.1, CCDS75774.1	8q22.2	2011-05-24	2010-06-25		ENSG00000104375	ENSG00000104375			11406	protein-coding gene	gene with protein product		605030	"""serine/threonine kinase 3 (Ste20, yeast homolog)"""			8816758	Standard	NM_006281		Approved	MST2, KRS1	uc003yip.4	Q13188	OTTHUMG00000164651	ENST00000419617.2:c.822+1A>G	8.37:g.99608261T>C		Somatic	128	0	0		WXS	Illumina HiSeq	Phase_I	121	3	0.0247934	NM_001256312	A8K722|B3KYA7|Q15445|Q15801|Q96FM6	Missense_Mutation	SNP	ENST00000419617.2	37	CCDS47900.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.311827	0.60414	.	.	ENSG00000104375	ENST00000419617;ENST00000523601;ENST00000518165	T;T;T	0.66099	-0.19;-0.19;-0.19	5.28	4.1	0.47936	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.058483	0.64402	D	0.000001	T	0.45054	0.1323	N	0.11427	0.14	0.53688	D	0.999976	P;B;P	0.40282	0.49;0.344;0.711	B;B;B	0.41646	0.162;0.273;0.362	T	0.46582	-0.9181	10	0.48119	T	0.1	.	11.701	0.51571	0.1327:0.0:0.0:0.8673	.	163;274;302	E5RFQ9;Q13188;B3KYA7	.;STK3_HUMAN;.	R	274;302;163	ENSP00000390500:Q274R;ENSP00000429744:Q302R;ENSP00000428014:Q163R	ENSP00000390500:Q274R	Q	-	2	0	STK3	99677437	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.997000	0.88414	0.929000	0.37192	0.383000	0.25322	CAG	.	.	none		0.403	STK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379635.1	NM_006281	Missense_Mutation
PAK2	5062	hgsc.bcm.edu	37	3	196509544	196509544	+	Silent	SNP	T	T	C	rs79361419	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:196509544T>C	ENST00000327134.3	+	2	349	c.27T>C	c.(25-27)gaT>gaC	p.D9D	RNU6-42P_ENST00000384165.1_RNA	NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	9					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)	p.D9D(2)		breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		AACTGGAAGATAAGCCTCCAG	0.423																																					p.D9D		Atlas-SNP	.											PAK2_ENST00000327134,NS,carcinoma,0,4	PAK2	113	4	2	Substitution - coding silent(2)	prostate(2)	c.T27C						scavenged	.						99.0	104.0	102.0					3																	196509544		2203	4300	6503	SO:0001819	synonymous_variant	5062	exon2			GGAAGATAAGCCT	U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.27T>C	3.37:g.196509544T>C		Somatic	220	1	0.00454545		WXS	Illumina HiSeq	Phase_I	237	9	0.0379747	NM_002577	Q13154|Q6ISC3	Silent	SNP	ENST00000327134.3	37	CCDS3321.1																																																																																			T|0.994;C|0.006	0.006	strong		0.423	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
HLA-A	3105	hgsc.bcm.edu	37	6	29910609	29910609	+	Missense_Mutation	SNP	G	G	T	rs199474372		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:29910609G>T	ENST00000396634.1	+	4	490	c.149G>T	c.(148-150)gGc>gTc	p.G50V	HLA-A_ENST00000376809.5_Missense_Mutation_p.G50V|HLA-A_ENST00000376802.2_Missense_Mutation_p.G50V|HLA-A_ENST00000376806.5_Missense_Mutation_p.G50V			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	50	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						ATCGCCGTGGGCTACGTGGAC	0.687									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.G50V		Atlas-SNP	.											.	HLA-A	89	.	0			c.G149T						PASS	.						38.0	33.0	35.0					6																	29910609		2202	4299	6501	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	CCGTGGGCTACGT	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.149G>T	6.37:g.29910609G>T	ENSP00000379873:p.Gly50Val	Somatic	174	0	0		WXS	Illumina HiSeq	Phase_I	200	107	0.535	NM_001242758	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	15.22	2.768304	0.49680	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.01438	4.89;4.89;4.89;4.89	3.72	3.72	0.42706	MHC class I, alpha chain, alpha1/alpha2 (3);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	0.000000	0.34110	U	0.004248	T	0.12817	0.0311	H	0.99859	4.855	0.48975	D	0.999735	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.985;1.0;0.999;1.0;0.999	T	0.14727	-1.0462	10	0.87932	D	0	.	11.3314	0.49479	0.0:0.0:1.0:0.0	.	50;50;50;50;50	P13746;Q5SRN7;P16188;Q5SRN5;P04439	1A11_HUMAN;.;1A30_HUMAN;.;1A03_HUMAN	V	50	ENSP00000379873:G50V;ENSP00000366002:G50V;ENSP00000366005:G50V;ENSP00000365998:G50V	ENSP00000348012:G50V	G	+	2	0	HLA-A	30018588	0.997000	0.39634	0.992000	0.48379	0.629000	0.37895	2.884000	0.48562	2.112000	0.64535	0.478000	0.44815	GGC	.	.	alt		0.687	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
CIDEB	27141	hgsc.bcm.edu	37	14	24775219	24775219	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr14:24775219G>A	ENST00000336557.5	-	7	1763	c.461C>T	c.(460-462)gCc>gTc	p.A154V	NOP9_ENST00000267425.3_3'UTR|LTB4R2_ENST00000528054.1_5'Flank|CIDEB_ENST00000554411.1_Missense_Mutation_p.A154V|CIDEB_ENST00000258807.5_Missense_Mutation_p.A154V			Q9UHD4	CIDEB_HUMAN	cell death-inducing DFFA-like effector b	154					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|regulation of apoptotic process (GO:0042981)	cytosol (GO:0005829)|lipid particle (GO:0005811)	identical protein binding (GO:0042802)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0181)		GTAGAATGTGGCTTTGACATT	0.512																																					p.A154V		Atlas-SNP	.											.	CIDEB	17	.	0			c.C461T						PASS	.						160.0	146.0	151.0					14																	24775219		2203	4300	6503	SO:0001583	missense	27141	exon6			AATGTGGCTTTGA	AF190901	CCDS32056.1	14q12	2012-09-20			ENSG00000136305	ENSG00000136305			1977	protein-coding gene	gene with protein product		604441				10619428, 10837461	Standard	XM_005267540		Approved		uc001woo.3	Q9UHD4	OTTHUMG00000171555	ENST00000336557.5:c.461C>T	14.37:g.24775219G>A	ENSP00000337731:p.Ala154Val	Somatic	60	0	0		WXS	Illumina HiSeq	Phase_I	65	23	0.353846	NM_014430	D3DS73|Q546V8|Q9NNW9	Missense_Mutation	SNP	ENST00000336557.5	37	CCDS32056.1	.	.	.	.	.	.	.	.	.	.	G	34	5.325029	0.95708	.	.	ENSG00000136305	ENST00000554411;ENST00000336557;ENST00000258807;ENST00000541830	D;D;D	0.84516	-1.86;-1.86;-1.86	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	D	0.92838	0.7722	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.93644	0.6967	10	0.87932	D	0	-23.741	17.4084	0.87480	0.0:0.0:1.0:0.0	.	154	Q9UHD4	CIDEB_HUMAN	V	154	ENSP00000451089:A154V;ENSP00000337731:A154V;ENSP00000258807:A154V	ENSP00000258807:A154V	A	-	2	0	CIDEB	23845059	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.787000	0.75099	2.654000	0.90174	0.563000	0.77884	GCC	.	.	none		0.512	CIDEB-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414120.1		
RUNX2	860	hgsc.bcm.edu	37	6	45390482	45390482	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:45390482C>G	ENST00000371438.1	+	2	569	c.211C>G	c.(211-213)Cag>Gag	p.Q71E	RUNX2_ENST00000371432.3_Missense_Mutation_p.Q57E|RUNX2_ENST00000352853.5_Missense_Mutation_p.Q139E|RUNX2_ENST00000576263.1_Missense_Mutation_p.Q71E|RUNX2_ENST00000465038.2_Missense_Mutation_p.Q71E|RUNX2_ENST00000359524.5_Missense_Mutation_p.Q57E|RUNX2_ENST00000541979.1_Missense_Mutation_p.Q139E|RUNX2_ENST00000371436.6_Missense_Mutation_p.Q71E|RP1-244F24.1_ENST00000606796.1_RNA	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	71	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						gcagcagcagcaggaggcggc	0.716																																					p.Q71E		Atlas-SNP	.											RUNX2_ENST00000352853,NS,carcinoma,0,2	RUNX2	128	2	0			c.C211G						scavenged	.						6.0	10.0	9.0					6																	45390482		1279	2789	4068	SO:0001583	missense	860	exon3			CAGCAGCAGGAGG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.211C>G	6.37:g.45390482C>G	ENSP00000360493:p.Gln71Glu	Somatic	17	1	0.0588235		WXS	Illumina HiSeq	Phase_I	24	2	0.0833333	NM_001024630	O14614|O14615|O95181	Missense_Mutation	SNP	ENST00000371438.1	37	CCDS43467.2	.	.	.	.	.	.	.	.	.	.	C	12.60	1.985548	0.35036	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08;0.08	3.45	3.45	0.39498	.	1.972660	0.03402	N	0.203449	T	0.19248	0.0462	N	0.14661	0.345	0.27094	N	0.962779	B;B;B	0.23806	0.033;0.055;0.091	B;B;B	0.20384	0.029;0.013;0.029	T	0.13818	-1.0495	10	0.02654	T	1	.	14.8379	0.70197	0.0:1.0:0.0:0.0	.	139;71;57	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	E	71;139;139;71;71;57;57	ENSP00000420707:Q71E;ENSP00000319087:Q139E;ENSP00000446290:Q139E;ENSP00000360493:Q71E;ENSP00000360491:Q71E;ENSP00000352514:Q57E;ENSP00000360486:Q57E	ENSP00000319087:Q139E	Q	+	1	0	RUNX2	45498460	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.268000	0.33062	1.622000	0.50330	0.407000	0.27541	CAG	.	.	none		0.716	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
MUC2	4583	hgsc.bcm.edu	37	11	1092890	1092890	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr11:1092890C>T	ENST00000441003.2	+	30	4736	c.4709C>T	c.(4708-4710)aCc>aTc	p.T1570I	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1571I	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACCACGGTGaccccaacccca	0.637																																					p.T1570I		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,-1,2	MUC2	614	2	0			c.C4709T						scavenged	.						119.0	156.0	143.0					11																	1092890		1961	3652	5613	SO:0001583	missense	4583	exon30			CGGTGACCCCAAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4709C>T	11.37:g.1092890C>T	ENSP00000415183:p.Thr1570Ile	Somatic	78	1	0.0128205		WXS	Illumina HiSeq	Phase_I	77	3	0.038961	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	1.561	-0.536608	0.04082	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.15487	2.42;3.24	1.3	-2.33	0.06724	.	0.589600	0.12692	U	0.447130	T	0.07548	0.0190	.	.	.	0.09310	N	1	P	0.34699	0.464	B	0.21546	0.035	T	0.24799	-1.0150	9	0.38643	T	0.18	.	4.395	0.11358	0.3284:0.4793:0.1923:0.0	.	1570	E7EUV1	.	I	1570;1571	ENSP00000415183:T1570I;ENSP00000351956:T1571I	ENSP00000351956:T1571I	T	+	2	0	MUC2	1082890	0.002000	0.14202	0.000000	0.03702	0.033000	0.12548	0.404000	0.20999	-0.107000	0.12088	0.064000	0.15345	ACC	.	.	none		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
RNASE4	6038	hgsc.bcm.edu	37	14	21167775	21167775	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr14:21167775G>A	ENST00000555835.1	+	2	921	c.245G>A	c.(244-246)cGt>cAt	p.R82H	RNASE4_ENST00000397995.2_Missense_Mutation_p.R82H|RNASE4_ENST00000304704.4_Missense_Mutation_p.R82H|RNASE4_ENST00000555597.1_Missense_Mutation_p.R82H|RP11-903H12.3_ENST00000554286.1_RNA|AL163636.6_ENST00000553909.1_3'UTR	NM_002937.3	NP_002928.1	P34096	RNAS4_HUMAN	ribonuclease, RNase A family, 4	82					cellular response to starvation (GO:0009267)|mRNA cleavage (GO:0006379)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_cancers(95;0.00304)		Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	GBM - Glioblastoma multiforme(265;0.0133)		TGGAACATTCGTAGTATCTGC	0.463																																					p.R82H	Esophageal Squamous(59;1059 1362 26290 51151)	Atlas-SNP	.											RNASE4,caecum,carcinoma,+1,2	RNASE4	18	2	0			c.G245A						PASS	.						165.0	134.0	145.0					14																	21167775		2203	4300	6503	SO:0001583	missense	6038	exon2			ACATTCGTAGTAT	U36775	CCDS9555.1	14q11	2014-07-16			ENSG00000258818	ENSG00000258818		"""Ribonucleases, RNase A"""	10047	protein-coding gene	gene with protein product		601030				7501448	Standard	NM_002937		Approved		uc001vxy.4	P34096	OTTHUMG00000029575	ENST00000555835.1:c.245G>A	14.37:g.21167775G>A	ENSP00000452245:p.Arg82His	Somatic	36	0	0		WXS	Illumina HiSeq	Phase_I	34	8	0.235294	NM_002937		Missense_Mutation	SNP	ENST00000555835.1	37	CCDS9555.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021831	0.35701	.	.	ENSG00000258818;ENSG00000258818;ENSG00000258818;ENSG00000181784;ENSG00000181784;ENSG00000181784	ENST00000555835;ENST00000397995;ENST00000555597;ENST00000398001;ENST00000304704;ENST00000397999	T;T;T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75;-0.75;-0.75	5.81	-3.72	0.04411	Ribonuclease A, domain (4);	0.988640	0.08242	N	0.975881	T	0.61689	0.2367	L	0.48877	1.53	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.52193	-0.8608	10	0.56958	D	0.05	-2.1766	4.7289	0.12955	0.4995:0.0:0.2424:0.2581	.	82	P34096	RNAS4_HUMAN	H	82	ENSP00000452245:R82H;ENSP00000381081:R82H;ENSP00000451624:R82H;ENSP00000381087:R82H;ENSP00000307096:R82H;ENSP00000381085:R82H	ENSP00000307096:R82H	R	+	2	0	AL163636.2;RNASE4	20237615	0.000000	0.05858	0.001000	0.08648	0.915000	0.54546	-0.828000	0.04419	-0.537000	0.06290	-0.899000	0.02877	CGT	.	.	none		0.463	RNASE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073729.3		
MARCKSL1	65108	hgsc.bcm.edu	37	1	32800454	32800454	+	Missense_Mutation	SNP	T	T	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:32800454T>A	ENST00000329421.7	-	2	677	c.332A>T	c.(331-333)gAg>gTg	p.E111V		NM_023009.6	NP_075385.1	P49006	MRP_HUMAN	MARCKS-like 1	111					positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				breast(1)|large_intestine(3)|lung(1)|ovary(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				ACCCCCACCCTCCTTCCGATT	0.572																																					p.E111V		Atlas-SNP	.											.	MARCKSL1	17	.	0			c.A332T						PASS	.						45.0	45.0	45.0					1																	32800454		2203	4300	6503	SO:0001583	missense	65108	exon2			CCACCCTCCTTCC	AF031640	CCDS361.1	1p35.1	2008-02-05	2004-11-17	2004-11-17	ENSG00000175130	ENSG00000175130			7142	protein-coding gene	gene with protein product		602940	"""MARCKS-like protein"""	MLP		9598313	Standard	NM_023009		Approved	F52, MacMARCKS, MLP1	uc001bvd.4	P49006	OTTHUMG00000007589	ENST00000329421.7:c.332A>T	1.37:g.32800454T>A	ENSP00000362638:p.Glu111Val	Somatic	42	0	0		WXS	Illumina HiSeq	Phase_I	48	13	0.270833	NM_023009	D3DPQ0|Q5TEE6|Q6NXS5	Missense_Mutation	SNP	ENST00000329421.7	37	CCDS361.1	.	.	.	.	.	.	.	.	.	.	T	19.60	3.858221	0.71834	.	.	ENSG00000175130	ENST00000329421	T	0.47528	0.84	5.17	4.04	0.47022	.	0.310671	0.35805	N	0.002978	T	0.52041	0.1710	L	0.52011	1.625	0.41063	D	0.985396	D	0.53462	0.96	P	0.52386	0.697	T	0.55250	-0.8170	10	0.87932	D	0	-5.9678	11.0117	0.47667	0.0:0.0745:0.0:0.9254	.	111	P49006	MRP_HUMAN	V	111	ENSP00000362638:E111V	ENSP00000362638:E111V	E	-	2	0	MARCKSL1	32573041	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.764000	0.55264	0.923000	0.37045	0.459000	0.35465	GAG	.	.	none		0.572	MARCKSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020059.3	NM_023009	
NCOA6	23054	hgsc.bcm.edu	37	20	33345744	33345744	+	Silent	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr20:33345744C>T	ENST00000374796.2	-	8	3377	c.807G>A	c.(805-807)caG>caA	p.Q269Q	NCOA6_ENST00000359003.2_Silent_p.Q269Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q269Q(15)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gctgctgctgctgttgttgtt	0.537																																					p.Q269Q		Atlas-SNP	.											NCOA6,NS,carcinoma,0,18	NCOA6	219	18	15	Substitution - coding silent(15)	lung(5)|prostate(4)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)	c.G807A						PASS	.						64.0	52.0	56.0					20																	33345744		2203	4300	6503	SO:0001819	synonymous_variant	23054	exon7			CTGCTGCTGTTGT	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.807G>A	20.37:g.33345744C>T		Somatic	49	0	0		WXS	Illumina HiSeq	Phase_I	43	4	0.0930233	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	CCDS13241.1																																																																																			.	.	none		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
RFPL3	10738	hgsc.bcm.edu	37	22	32756576	32756576	+	Missense_Mutation	SNP	A	A	C	rs199572344	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr22:32756576A>C	ENST00000249007.4	+	2	916	c.711A>C	c.(709-711)ttA>ttC	p.L237F	RFPL3S_ENST00000461833.1_5'Flank|RFPL3_ENST00000382088.3_Missense_Mutation_p.L208F|RFPL3_ENST00000397468.1_Missense_Mutation_p.L208F|RFPL3S_ENST00000382084.4_3'UTR|RFPL3S_ENST00000400234.1_3'UTR	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	237	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						CTTTCCTCTTAGTAGACCGCA	0.498													N|||	61	0.0121805	0.0174	0.0058	5008	,	,		21076	0.004		0.0288	False		,,,				2504	0.001				p.L237F		Atlas-SNP	.											RFPL3_ENST00000249007,NS,carcinoma,0,2	RFPL3	91	2	0			c.A711C						scavenged	.						116.0	105.0	109.0					22																	32756576		2203	4300	6503	SO:0001583	missense	10738	exon2			CCTCTTAGTAGAC	AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	ENST00000249007.4:c.711A>C	22.37:g.32756576A>C	ENSP00000249007:p.Leu237Phe	Somatic	217	4	0.0184332		WXS	Illumina HiSeq	Phase_I	235	13	0.0553191	NM_001098535	A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Missense_Mutation	SNP	ENST00000249007.4	37	CCDS43011.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.477361	0.01035	.	.	ENSG00000128276	ENST00000397468;ENST00000249007;ENST00000382088	T;T;T	0.68479	-0.33;-0.33;-0.33	0.664	-1.33	0.09172	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.42017	0.1184	N	0.21142	0.635	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.22765	-1.0207	9	0.10111	T	0.7	.	3.6544	0.08215	0.2182:0.2587:0.5231:0.0	.	237	O75679	RFPL3_HUMAN	F	208;237;208	ENSP00000380609:L208F;ENSP00000249007:L237F;ENSP00000371520:L208F	ENSP00000249007:L237F	L	+	3	2	RFPL3	31086576	0.000000	0.05858	0.001000	0.08648	0.283000	0.27025	-0.614000	0.05604	-1.459000	0.01914	-1.045000	0.02358	TTA	A|0.999;C|0.001	0.001	weak		0.498	RFPL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075172.3	NM_006604	
CACNA2D4	93589	hgsc.bcm.edu	37	12	1993483	1993483	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr12:1993483C>T	ENST00000382722.5	-	12	1639	c.1277G>A	c.(1276-1278)cGa>cAa	p.R426Q	CACNA2D4_ENST00000587995.1_Missense_Mutation_p.R426Q|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000586184.1_Missense_Mutation_p.R426Q|CACNA2D4_ENST00000588077.1_Missense_Mutation_p.R362Q|CACNA2D4_ENST00000585708.1_Missense_Mutation_p.R362Q	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	426	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		AGTGAAAACTCGGACCTAACC	0.478																																					p.R426Q	Colon(2;101 179 21030 23310 28141)	Atlas-SNP	.											.	CACNA2D4	220	.	0			c.G1277A						PASS	.						78.0	85.0	82.0					12																	1993483		2017	4193	6210	SO:0001583	missense	93589	exon12			AAAACTCGGACCT	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.1277G>A	12.37:g.1993483C>T	ENSP00000372169:p.Arg426Gln	Somatic	71	0	0		WXS	Illumina HiSeq	Phase_I	78	28	0.358974	NM_172364	Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	ENST00000382722.5	37	CCDS44785.1	.	.	.	.	.	.	.	.	.	.	C	33	5.206269	0.95033	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	T	0.09163	3.01	5.27	5.27	0.74061	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	T	0.38772	0.1053	M	0.90082	3.085	0.80722	D	1	D	0.69078	0.997	P	0.59424	0.857	T	0.50118	-0.8865	10	0.87932	D	0	.	18.4934	0.90855	0.0:1.0:0.0:0.0	.	426	Q7Z3S7	CA2D4_HUMAN	Q	362;426;426	ENSP00000372169:R426Q	ENSP00000280663:R426Q	R	-	2	0	CACNA2D4	1863744	1.000000	0.71417	0.834000	0.33040	0.831000	0.47069	7.780000	0.85658	2.463000	0.83235	0.603000	0.83216	CGA	.	.	none		0.478	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2		
RASSF9	9182	hgsc.bcm.edu	37	12	86198771	86198771	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr12:86198771G>A	ENST00000361228.3	-	2	1385	c.1017C>T	c.(1015-1017)atC>atT	p.I339I		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	339					endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)			endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCTCTTTCTGGATGCCACTCA	0.373																																					p.I339I		Atlas-SNP	.											.	RASSF9	100	.	0			c.C1017T						PASS	.						179.0	182.0	181.0					12																	86198771		1854	4089	5943	SO:0001819	synonymous_variant	9182	exon2			TTTCTGGATGCCA		CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.1017C>T	12.37:g.86198771G>A		Somatic	133	0	0		WXS	Illumina HiSeq	Phase_I	113	45	0.39823	NM_005447	B3KMQ4|Q8N5U8	Silent	SNP	ENST00000361228.3	37	CCDS44950.1																																																																																			.	.	none		0.373	RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406109.1		
ZNF709	163051	hgsc.bcm.edu	37	19	12577645	12577645	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:12577645T>C	ENST00000397732.3	-	2	194	c.23A>G	c.(22-24)gAt>gGt	p.D8G	CTD-3105H18.18_ENST00000598753.1_Missense_Mutation_p.D8G|ZNF709_ENST00000428311.1_Missense_Mutation_p.D8G	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	8	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						CACAGCCACATCCTCAAAGAC	0.473																																					p.D8G	GBM(33;565 669 12371 29134 51667)	Atlas-SNP	.											.	ZNF709	80	.	0			c.A23G						PASS	.						92.0	93.0	93.0					19																	12577645		2203	4300	6503	SO:0001583	missense	163051	exon2			GCCACATCCTCAA	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.23A>G	19.37:g.12577645T>C	ENSP00000380840:p.Asp8Gly	Somatic	78	0	0		WXS	Illumina HiSeq	Phase_I	50	11	0.22	NM_152601	A8K4E6	Missense_Mutation	SNP	ENST00000397732.3	37	CCDS42504.1	.	.	.	.	.	.	.	.	.	.	T	18.00	3.525627	0.64860	.	.	ENSG00000242852;ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000455490;ENST00000428311	T;T;T	0.11930	2.73;2.73;2.73	3.09	3.09	0.35607	Krueppel-associated box (4);	0.000000	0.34828	N	0.003641	T	0.48624	0.1510	H	0.97465	4.01	0.34327	D	0.687282	D	0.89917	1.0	D	0.97110	1.0	T	0.70608	-0.4825	10	0.87932	D	0	.	9.6307	0.39778	0.0:0.0:0.0:1.0	.	8	Q8N972	ZN709_HUMAN	G	8;37;8	ENSP00000380840:D8G;ENSP00000398085:D37G;ENSP00000404127:D8G	ENSP00000404127:D8G	D	-	2	0	ZNF709;CTD-2192J16.17	12438645	0.989000	0.36119	1.000000	0.80357	0.994000	0.84299	1.442000	0.35046	1.660000	0.50760	0.402000	0.26972	GAT	.	.	none		0.473	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	NM_152601	
HELT	391723	hgsc.bcm.edu	37	4	185941741	185941741	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr4:185941741G>A	ENST00000515777.1	+	4	632	c.544G>A	c.(544-546)Gcg>Acg	p.A182T	HELT_ENST00000338875.4_Missense_Mutation_p.A267T|HELT_ENST00000505610.1_Missense_Mutation_p.A181T			A6NFD8	HELT_HUMAN	helt bHLH transcription factor	182	Pro-rich.				central nervous system development (GO:0007417)|GABAergic neuron differentiation in basal ganglia (GO:0021858)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	14		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;8.92e-26)|Epithelial(43;3.02e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-11)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		GCCGCCTGGCGCGGCCCGCAG	0.756																																					p.A267T		Atlas-SNP	.											.	HELT	34	.	0			c.G799A						PASS	.						7.0	9.0	8.0					4																	185941741		2021	4009	6030	SO:0001583	missense	391723	exon4			CCTGGCGCGGCCC	BC144567	CCDS75214.1, CCDS75215.1	4q35.1	2014-07-17	2011-09-12		ENSG00000187821	ENSG00000187821		"""Basic helix-loop-helix proteins"""	33783	protein-coding gene	gene with protein product	"""megane bHLH factor"", ""HES-like"""		"""Hey-like transcription factor (zebrafish)"", ""HES/HEY-like transcription factor"""			14764602, 17611227	Standard	XM_005262989		Approved	HESL, HCM1228, Mgn, bHLHb44, MEGANE	uc011ckq.2	A6NFD8	OTTHUMG00000160484	ENST00000515777.1:c.544G>A	4.37:g.185941741G>A	ENSP00000426033:p.Ala182Thr	Somatic	31	0	0		WXS	Illumina HiSeq	Phase_I	21	11	0.52381	NM_001029887	B2RTS5|B7ZMI7|B7ZMI8	Missense_Mutation	SNP	ENST00000515777.1	37		.	.	.	.	.	.	.	.	.	.	G	5.378	0.255065	0.10185	.	.	ENSG00000187821	ENST00000505610;ENST00000515777;ENST00000338875	T;T;T	0.64260	-0.08;-0.09;1.92	4.96	1.05	0.20165	.	0.293161	0.33916	N	0.004423	T	0.31796	0.0808	N	0.12182	0.205	0.28373	N	0.919909	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.06588	-1.0818	10	0.13853	T	0.58	.	1.5726	0.02618	0.3402:0.3161:0.2239:0.1198	.	267;182;181	A6NFD8;B7ZMI7;A6NFD8-2	HELT_HUMAN;.;.	T	181;182;267	ENSP00000422140:A181T;ENSP00000426033:A182T;ENSP00000343464:A267T	ENSP00000343464:A267T	A	+	1	0	HELT	186178735	0.996000	0.38824	0.101000	0.21167	0.038000	0.13279	0.539000	0.23175	0.138000	0.18790	0.561000	0.74099	GCG	.	.	none		0.756	HELT-002	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000360792.1	NM_001300781	
ZC3H4	23211	hgsc.bcm.edu	37	19	47572412	47572412	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:47572412C>G	ENST00000253048.5	-	14	2372	c.2335G>C	c.(2335-2337)Gag>Cag	p.E779Q	ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	779							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		TCCTCCTCCTCCTGCTGCTTC	0.701																																					p.E779Q		Atlas-SNP	.											ZC3H4,colon,carcinoma,0,1	ZC3H4	96	1	0			c.G2335C						scavenged	.						60.0	69.0	66.0					19																	47572412		2082	4205	6287	SO:0001583	missense	23211	exon14			CCTCCTCCTGCTG	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.2335G>C	19.37:g.47572412C>G	ENSP00000253048:p.Glu779Gln	Somatic	45	0	0		WXS	Illumina HiSeq	Phase_I	35	2	0.0571429	NM_015168	Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	37	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.765923	0.90020	.	.	ENSG00000130749	ENST00000253048	T	0.21361	2.01	5.03	5.03	0.67393	.	0.259884	0.30043	N	0.010552	T	0.41305	0.1153	L	0.48642	1.525	0.54753	D	0.999986	D	0.89917	1.0	D	0.83275	0.996	T	0.13202	-1.0518	10	0.56958	D	0.05	.	17.2939	0.87164	0.0:1.0:0.0:0.0	.	779	Q9UPT8	ZC3H4_HUMAN	Q	779	ENSP00000253048:E779Q	ENSP00000253048:E779Q	E	-	1	0	ZC3H4	52264252	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.347000	0.59373	2.619000	0.88677	0.491000	0.48974	GAG	.	.	none		0.701	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
GGT1	2678	hgsc.bcm.edu	37	22	25023419	25023419	+	Silent	SNP	C	C	T	rs202087650	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr22:25023419C>T	ENST00000400382.1	+	12	1796	c.1041C>T	c.(1039-1041)tcC>tcT	p.S347S	GGT1_ENST00000403838.1_Silent_p.S3S|GGT1_ENST00000404223.1_Silent_p.S3S|GGT1_ENST00000406383.2_Silent_p.S347S|GGT1_ENST00000404532.1_Silent_p.S3S|GGT1_ENST00000400380.1_Silent_p.S347S|GGT1_ENST00000248923.4_Silent_p.S347S|GGT1_ENST00000401885.1_Silent_p.S3S|GGT1_ENST00000404920.1_Silent_p.S3S|GGT1_ENST00000466310.1_3'UTR|GGT1_ENST00000400383.1_Silent_p.S347S			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	347					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	ACATGACCTCCGAGTTCTTCG	0.647																																					p.S347S		Atlas-SNP	.											GGT1,NS,carcinoma,0,2	GGT1	68	2	0			c.C1041T						scavenged	.						53.0	54.0	54.0					22																	25023419		2201	4297	6498	SO:0001819	synonymous_variant	2678	exon12			GACCTCCGAGTTC	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.1041C>T	22.37:g.25023419C>T		Somatic	241	17	0.0705394		WXS	Illumina HiSeq	Phase_I	223	14	0.0627803	NM_013430	Q08247|Q14404|Q8TBS1|Q9UMK1	Silent	SNP	ENST00000400382.1	37	CCDS42992.1																																																																																			C|0.989;T|0.011	0.011	strong		0.647	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1	NM_013430	
VPRBP	9730	hgsc.bcm.edu	37	3	51497147	51497147	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:51497147C>T	ENST00000335891.5	-	4	367	c.358G>A	c.(358-360)Gtc>Atc	p.V120I				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	120					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		TGAAAGACGACAGCAGTTTCC	0.373																																					p.V120I		Atlas-SNP	.											VPRBP,colon,carcinoma,+1,1	VPRBP	107	1	0			c.G358A						scavenged	.						56.0	52.0	53.0					3																	51497147		1903	4142	6045	SO:0001583	missense	9730	exon6			AGACGACAGCAGT	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.358G>A	3.37:g.51497147C>T	ENSP00000338857:p.Val120Ile	Somatic	83	1	0.0120482		WXS	Illumina HiSeq	Phase_I	100	38	0.38	NM_014703	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	ENST00000335891.5	37		.	.	.	.	.	.	.	.	.	.	C	27.4	4.825197	0.90955	.	.	ENSG00000145041	ENST00000335891;ENST00000504652	T;T	0.57595	0.39;0.81	5.51	5.51	0.81932	Armadillo-type fold (1);	0.057232	0.64402	D	0.000002	T	0.54711	0.1875	M	0.65975	2.015	0.30565	N	0.764119	P	0.41784	0.762	B	0.38327	0.271	T	0.63506	-0.6622	10	0.51188	T	0.08	-11.4123	19.0105	0.92871	0.0:1.0:0.0:0.0	.	120	Q9Y4B6	VPRBP_HUMAN	I	120	ENSP00000338857:V120I;ENSP00000421724:V120I	ENSP00000338857:V120I	V	-	1	0	VPRBP	51472187	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.332000	0.79203	2.589000	0.87451	0.561000	0.74099	GTC	.	.	none		0.373	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	
KIAA2018	205717	hgsc.bcm.edu	37	3	113380105	113380105	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:113380105G>T	ENST00000478658.1	-	5	441	c.424C>A	c.(424-426)Cag>Aag	p.Q142K	KIAA2018_ENST00000316407.4_Missense_Mutation_p.Q142K|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	142						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TTTTGAACCTGGTCACTAGGA	0.368																																					p.Q142K		Atlas-SNP	.											KIAA2018,NS,carcinoma,+2,1	KIAA2018	180	1	0			c.C424A						scavenged	.						92.0	88.0	89.0					3																	113380105		1812	4073	5885	SO:0001583	missense	205717	exon7			GAACCTGGTCACT	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.424C>A	3.37:g.113380105G>T	ENSP00000420721:p.Gln142Lys	Somatic	171	0	0		WXS	Illumina HiSeq	Phase_I	189	2	0.010582	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	37	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.154726	0.57259	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.15718	2.4;2.4	5.81	5.81	0.92471	.	0.142736	0.47455	D	0.000226	T	0.17195	0.0413	L	0.29908	0.895	0.43559	D	0.995871	B	0.22346	0.068	B	0.15870	0.014	T	0.02917	-1.1094	10	0.87932	D	0	-1.3537	20.0628	0.97684	0.0:0.0:1.0:0.0	.	142	Q68DE3	K2018_HUMAN	K	142	ENSP00000320794:Q142K;ENSP00000420721:Q142K	ENSP00000320794:Q142K	Q	-	1	0	KIAA2018	114862795	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	5.888000	0.69758	2.745000	0.94114	0.655000	0.94253	CAG	.	.	none		0.368	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
MUC4	4585	hgsc.bcm.edu	37	3	195505772	195505772	+	Missense_Mutation	SNP	C	C	G	rs556354486		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:195505772C>G	ENST00000463781.3	-	2	13138	c.12679G>C	c.(12679-12681)Gtc>Ctc	p.V4227L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V4227L|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	984					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V4227L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGCTGGTGACAGGAAGAGGG	0.582													.|||	1	0.000199681	0.0	0.0	5008	,	,		15508	0.0		0.001	False		,,,				2504	0.0				p.V4227L		Atlas-SNP	.											MUC4_ENST00000463781,bladder,carcinoma,0,4	MUC4	1505	4	1	Substitution - Missense(1)	lung(1)	c.G12679C						scavenged	.																																			SO:0001583	missense	4585	exon2			TGGTGACAGGAAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12679G>C	3.37:g.195505772C>G	ENSP00000417498:p.Val4227Leu	Somatic	82	5	0.0609756		WXS	Illumina HiSeq	Phase_I	98	5	0.0510204	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	5.247	0.230981	0.09969	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.56;1.6	1.57	0.566	0.17317	.	.	.	.	.	T	0.14227	0.0344	N	0.14661	0.345	0.19300	N	0.999978	B	0.27765	0.188	B	0.22601	0.04	T	0.27640	-1.0068	8	.	.	.	.	5.595	0.17321	0.0:0.6491:0.3509:0.0	.	4099	E7ESK3	.	L	4227	ENSP00000417498:V4227L;ENSP00000420243:V4227L	.	V	-	1	0	MUC4	196990551	0.000000	0.05858	0.020000	0.16555	0.011000	0.07611	-0.070000	0.11523	0.201000	0.20466	0.484000	0.47621	GTC	.	.	none		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SALL4	57167	hgsc.bcm.edu	37	20	50408196	50408196	+	Missense_Mutation	SNP	T	T	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr20:50408196T>G	ENST00000217086.4	-	2	937	c.826A>C	c.(826-828)Agc>Cgc	p.S276R	SALL4_ENST00000371539.3_Intron|SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000395997.3_Missense_Mutation_p.S276R	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	276					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCTTTCTGGCTGAGCAAAGCC	0.607																																					p.S276R		Atlas-SNP	.											.	SALL4	168	.	0			c.A826C						PASS	.						53.0	44.0	47.0					20																	50408196		2203	4300	6503	SO:0001583	missense	57167	exon2			TCTGGCTGAGCAA	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.826A>C	20.37:g.50408196T>G	ENSP00000217086:p.Ser276Arg	Somatic	41	0	0		WXS	Illumina HiSeq	Phase_I	29	8	0.275862	NM_020436	A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	T	17.81	3.481871	0.63849	.	.	ENSG00000101115	ENST00000217086;ENST00000395997	T;T	0.70631	-0.5;-0.5	5.29	4.17	0.49024	.	0.116249	0.39759	N	0.001276	T	0.65302	0.2678	M	0.80028	2.48	0.80722	D	1	P;P	0.47302	0.893;0.744	B;B	0.39068	0.289;0.289	T	0.71199	-0.4663	10	0.87932	D	0	-37.3797	3.3042	0.06993	0.0:0.3594:0.0:0.6406	.	276;276	A2A2D8;Q9UJQ4	.;SALL4_HUMAN	R	276	ENSP00000217086:S276R;ENSP00000379319:S276R	ENSP00000217086:S276R	S	-	1	0	SALL4	49841603	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.877000	0.63086	1.996000	0.58369	0.533000	0.62120	AGC	.	.	none		0.607	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3		
MUC2	4583	hgsc.bcm.edu	37	11	1093296	1093296	+	Silent	SNP	T	T	C	rs200837746|rs56068864		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr11:1093296T>C	ENST00000441003.2	+	30	5142	c.5115T>C	c.(5113-5115)acT>acC	p.T1705T	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Silent_p.T1672T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaccaccactacggtgaccc	0.642																																					p.T1705T		Atlas-SNP	.											MUC2_ENST00000441003,rectum,carcinoma,+1,2	MUC2	614	2	0			c.T5115C						scavenged	.						111.0	159.0	142.0					11																	1093296		1883	3466	5349	SO:0001819	synonymous_variant	4583	exon30			CACCACTACGGTG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5115T>C	11.37:g.1093296T>C		Somatic	51	6	0.117647		WXS	Illumina HiSeq	Phase_I	61	12	0.196721	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.	.	weak		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
NBPF10	100132406	hgsc.bcm.edu	37	1	145299805	145299805	+	Missense_Mutation	SNP	A	A	C	rs61814629	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:145299805A>C	ENST00000369338.1	+	2	231	c.41A>C	c.(40-42)gAg>gCg	p.E14A	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000342960.5_Missense_Mutation_p.E285A|RP11-458D21.5_ENST00000468030.1_3'UTR			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	285						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.E285A(1)|p.E14A(1)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GAGAAGGCAGAGATGAACATT	0.493													.|||	179	0.0357428	0.0015	0.0231	5008	,	,		43597	0.0635		0.0487	False		,,,				2504	0.0491				p.E285A		Atlas-SNP	.											NBPF10_ENST00000369338,extremity,malignant_melanoma,0,2	NBPF10	221	2	2	Substitution - Missense(2)	skin(2)	c.A854C						scavenged	.						9.0	8.0	8.0					1																	145299805		690	1570	2260	SO:0001583	missense	100132406	exon6			AGGCAGAGATGAA	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369338.1:c.41A>C	1.37:g.145299805A>C	ENSP00000358344:p.Glu14Ala	Somatic	70	2	0.0285714		WXS	Illumina HiSeq	Phase_I	80	3	0.0375	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369338.1	37		.	.	.	.	.	.	.	.	.	.	.	11.71	1.719994	0.30503	.	.	ENSG00000163386	ENST00000448873;ENST00000369338;ENST00000369334;ENST00000342960	T;T	0.03663	3.85;3.85	1.05	1.05	0.20165	.	.	.	.	.	T	0.03095	0.0091	M	0.74647	2.275	0.09310	N	1	P	0.37398	0.593	P	0.45577	0.486	T	0.39941	-0.9589	9	0.66056	D	0.02	.	4.3442	0.11124	1.0:0.0:0.0:0.0	rs61814629	14	Q86T75-2	.	A	210;14;14;285	ENSP00000358344:E14A;ENSP00000345684:E285A	ENSP00000345684:E285A	E	+	2	0	NBPF10	144011162	0.002000	0.14202	0.003000	0.11579	0.032000	0.12392	-0.314000	0.08092	0.731000	0.32448	0.234000	0.17832	GAG	A|0.999;G|0.001	.	weak		0.493	NBPF10-003	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038552.1	NM_001039703	
CTSD	1509	hgsc.bcm.edu	37	11	1780809	1780809	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr11:1780809C>T	ENST00000236671.2	-	3	421	c.289G>A	c.(289-291)Gac>Aac	p.D97N	RP11-295K3.1_ENST00000427721.1_5'Flank|AC068580.6_ENST00000449248.1_RNA	NM_001909.4	NP_001900.1	P07339	CATD_HUMAN	cathepsin D	97					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic vacuole assembly (GO:0000045)|cell death (GO:0008219)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(1)|large_intestine(4)|lung(8)	13		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GAGCCCGTGTCGAAGACGACT	0.657																																					p.D97N		Atlas-SNP	.											.	CTSD	26	.	0			c.G289A						PASS	.						65.0	63.0	64.0					11																	1780809		2202	4299	6501	SO:0001583	missense	1509	exon3			CCGTGTCGAAGAC	M11233	CCDS7725.1	11p15.5	2009-06-26	2006-12-05		ENSG00000117984	ENSG00000117984	3.4.23.5	"""Cathepsins"""	2529	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 10"""	116840	"""cathepsin D (lysosomal aspartyl protease)"""	CPSD		3927292	Standard	NM_001909		Approved	CLN10	uc001luc.2	P07339	OTTHUMG00000044760	ENST00000236671.2:c.289G>A	11.37:g.1780809C>T	ENSP00000236671:p.Asp97Asn	Somatic	29	0	0		WXS	Illumina HiSeq	Phase_I	23	7	0.304348	NM_001909	Q6IB57	Missense_Mutation	SNP	ENST00000236671.2	37	CCDS7725.1	.	.	.	.	.	.	.	.	.	.	c	29.3	4.994971	0.93167	.	.	ENSG00000117984	ENST00000236671;ENST00000438213;ENST00000367196	D;T;D	0.84944	-1.92;-1.39;-1.83	4.2	4.2	0.49525	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.052549	0.64402	D	0.000001	D	0.96027	0.8706	H	0.99498	4.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98537	1.0630	10	0.87932	D	0	.	16.9432	0.86224	0.0:1.0:0.0:0.0	.	97	P07339	CATD_HUMAN	N	97;82;62	ENSP00000236671:D97N;ENSP00000415036:D82N;ENSP00000356164:D62N	ENSP00000236671:D97N	D	-	1	0	CTSD	1737385	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	6.980000	0.76160	2.061000	0.61500	0.486000	0.48141	GAC	.	.	none		0.657	CTSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104272.5	NM_001909	
AHCYL2	23382	hgsc.bcm.edu	37	7	129028933	129028933	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr7:129028933C>T	ENST00000325006.3	+	3	566	c.512C>T	c.(511-513)tCg>tTg	p.S171L	AHCYL2_ENST00000446212.1_Missense_Mutation_p.S69L|AHCYL2_ENST00000472554.1_3'UTR|AHCYL2_ENST00000446544.2_Missense_Mutation_p.S170L|AHCYL2_ENST00000490911.1_Missense_Mutation_p.S68L|AHCYL2_ENST00000474594.1_Missense_Mutation_p.S68L|AHCYL2_ENST00000531335.2_Missense_Mutation_p.S90L	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	171					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						GATGAGACATCGCCCAGGGAC	0.398																																					p.S171L	Pancreas(160;1736 1964 29875 40941 45605)	Atlas-SNP	.											AHCYL2,caecum,carcinoma,-1,1	AHCYL2	79	1	0			c.C512T						scavenged	.						100.0	94.0	96.0					7																	129028933		2203	4300	6503	SO:0001583	missense	23382	exon3			AGACATCGCCCAG	AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.512C>T	7.37:g.129028933C>T	ENSP00000315931:p.Ser171Leu	Somatic	175	1	0.00571429		WXS	Illumina HiSeq	Phase_I	180	77	0.427778	NM_015328	B4DIZ5|D9N155|O94917	Missense_Mutation	SNP	ENST00000325006.3	37	CCDS5812.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.086009|5.086009	0.94100|0.94100	.|.	.|.	ENSG00000158467|ENSG00000158467	ENST00000466924|ENST00000325006;ENST00000446544;ENST00000531335;ENST00000460109;ENST00000474594;ENST00000446212;ENST00000490911;ENST00000466993	.|T;T;T;T;T;T;T	.|0.78595	.|-1.19;-1.19;-1.15;-1.14;-1.14;-1.14;-0.96	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85039|0.85039	0.5606|0.5606	L|L	0.45352|0.45352	1.415|1.415	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.87578	.|0.996;0.996;0.996;0.996;0.998	D|D	0.86023|0.86023	0.1508|0.1508	5|10	.|0.87932	.|D	.|0	-15.2176|-15.2176	18.6782|18.6782	0.91537|0.91537	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|68;69;171;68;170	.|B4DIZ5;D7UEQ7;Q96HN2;D9N155;Q96HN2-2	.|.;.;SAHH3_HUMAN;.;.	C|L	78|171;170;90;69;68;69;68;69	.|ENSP00000315931:S171L;ENSP00000413639:S170L;ENSP00000431787:S90L;ENSP00000420459:S68L;ENSP00000405267:S69L;ENSP00000420801:S68L;ENSP00000419608:S69L	.|ENSP00000315931:S171L	R|S	+|+	1|2	0|0	AHCYL2|AHCYL2	128816169|128816169	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.991000|0.991000	0.79684|0.79684	7.776000|7.776000	0.85560|0.85560	2.648000|2.648000	0.89879|0.89879	0.650000|0.650000	0.86243|0.86243	CGC|TCG	.	.	none		0.398	AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354065.1		
HYDIN	54768	hgsc.bcm.edu	37	16	70989411	70989411	+	Silent	SNP	G	G	A	rs375756894	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr16:70989411G>A	ENST00000393567.2	-	40	6333	c.6183C>T	c.(6181-6183)aaC>aaT	p.N2061N		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2061					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGCAGGCTGCGTTGTAGTACT	0.552													G|||	2	0.000399361	0.0008	0.0	5008	,	,		19316	0.0		0.001	False		,,,				2504	0.0				p.N2061N		Atlas-SNP	.											.	HYDIN	788	.	0			c.C6183T						PASS	.	G		2,3706		0,2,1852	24.0	22.0	23.0		6180	-8.0	0.0	16		23	2,8124		0,2,4061	no	coding-synonymous	HYDIN	NM_032821.2		0,4,5913	AA,AG,GG		0.0246,0.0539,0.0338		2060/5121	70989411	4,11830	1854	4063	5917	SO:0001819	synonymous_variant	54768	exon40			GGCTGCGTTGTAG	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6183C>T	16.37:g.70989411G>A		Somatic	47	0	0		WXS	Illumina HiSeq	Phase_I	39	12	0.307692	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1																																																																																			.	.	weak		0.552	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
SIGLEC10	89790	hgsc.bcm.edu	37	19	51920119	51920119	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:51920119G>A	ENST00000339313.5	-	3	623	c.507C>T	c.(505-507)gcC>gcT	p.A169A	CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000353836.5_Silent_p.A169A|SIGLEC10_ENST00000441969.3_Intron|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000439889.2_Intron|SIGLEC10_ENST00000525998.1_Silent_p.A169A|SIGLEC10_ENST00000432469.2_Intron|CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000356298.5_Silent_p.A169A|SIGLEC10_ENST00000442846.3_Intron|SIGLEC10_ENST00000436984.2_Intron			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	169	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		ATTCCTCAAAGGCCCAGTTAA	0.597																																					p.A169A		Atlas-SNP	.											SIGLEC10,NS,carcinoma,-1,1	SIGLEC10	112	1	0			c.C507T						scavenged	.						98.0	99.0	98.0					19																	51920119		2203	4300	6503	SO:0001819	synonymous_variant	89790	exon3			CTCAAAGGCCCAG	AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.507C>T	19.37:g.51920119G>A		Somatic	176	2	0.0113636		WXS	Illumina HiSeq	Phase_I	197	6	0.0304569	NM_001171157	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Silent	SNP	ENST00000339313.5	37	CCDS12832.1																																																																																			.	.	none		0.597	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130	
C5orf42	65250	hgsc.bcm.edu	37	5	37224369	37224369	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr5:37224369T>C	ENST00000508244.1	-	13	2660	c.2567A>G	c.(2566-2568)gAa>gGa	p.E856G	C5orf42_ENST00000425232.2_Missense_Mutation_p.E856G|C5orf42_ENST00000274258.7_5'UTR			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	856						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CTCTTCGATTTCTTGTAGAGC	0.328																																					p.E856G		Atlas-SNP	.											.	C5orf42	422	.	0			c.A2567G						PASS	.						266.0	193.0	215.0					5																	37224369		692	1588	2280	SO:0001583	missense	65250	exon14			TCGATTTCTTGTA		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.2567A>G	5.37:g.37224369T>C	ENSP00000421690:p.Glu856Gly	Somatic	156	0	0		WXS	Illumina HiSeq	Phase_I	123	39	0.317073	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	T	18.35	3.603999	0.66445	.	.	ENSG00000197603	ENST00000508244;ENST00000425232	T;T	0.27402	1.67;1.67	5.38	5.38	0.77491	.	0.192036	0.31821	U	0.007004	T	0.55081	0.1898	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.58335	-0.7654	10	0.62326	D	0.03	-11.8602	15.3477	0.74355	0.0:0.0:0.0:1.0	.	856	E9PH94	.	G	856	ENSP00000421690:E856G;ENSP00000389014:E856G	ENSP00000389014:E856G	E	-	2	0	C5orf42	37260126	1.000000	0.71417	0.986000	0.45419	0.706000	0.40770	3.584000	0.53936	2.175000	0.68902	0.533000	0.62120	GAA	.	.	none		0.328	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
GPN3	51184	hgsc.bcm.edu	37	12	110902947	110902947	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr12:110902947G>A	ENST00000228827.3	-	2	183	c.121C>T	c.(121-123)Cca>Tca	p.P41S	GPN3_ENST00000552180.1_5'UTR|GPN3_ENST00000537466.2_Missense_Mutation_p.P51S|GPN3_ENST00000543199.1_Missense_Mutation_p.P80S	NM_016301.3	NP_057385.3			GPN-loop GTPase 3											endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|urinary_tract(1)	8						TCTGCTGCTGGATCCAGGTTT	0.537																																					p.P80S		Atlas-SNP	.											.	GPN3	37	.	0			c.C238T						PASS	.						197.0	157.0	170.0					12																	110902947		2203	4300	6503	SO:0001583	missense	51184	exon2			CTGCTGGATCCAG	BC008416	CCDS9147.1, CCDS53830.1, CCDS53831.1	12q24.11	2012-12-18	2008-04-30	2008-04-30	ENSG00000111231	ENSG00000111231		"""GPN-loop GTPases"""	30186	protein-coding gene	gene with protein product			"""ATP binding domain 1 family, member C"""	ATPBD1C		12975309	Standard	NM_016301		Approved	MGC14560	uc021rdu.1	Q9UHW5	OTTHUMG00000169524	ENST00000228827.3:c.121C>T	12.37:g.110902947G>A	ENSP00000228827:p.Pro41Ser	Somatic	94	0	0		WXS	Illumina HiSeq	Phase_I	87	37	0.425287	NM_001164372		Missense_Mutation	SNP	ENST00000228827.3	37	CCDS9147.1	.	.	.	.	.	.	.	.	.	.	G	35	5.541728	0.96474	.	.	ENSG00000111231	ENST00000228827;ENST00000543199;ENST00000537466;ENST00000550974	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.77987	0.4213	M	0.92738	3.34	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.79108	0.987;0.992	T	0.82172	-0.0589	10	0.87932	D	0	-14.8795	20.3789	0.98926	0.0:0.0:1.0:0.0	.	51;41	Q9UHW5-2;Q9UHW5	.;GPN3_HUMAN	S	41;80;51;19	ENSP00000228827:P41S;ENSP00000442770:P80S;ENSP00000443068:P51S;ENSP00000447480:P19S	ENSP00000228827:P41S	P	-	1	0	GPN3	109387330	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.221000	0.95188	2.826000	0.97356	0.563000	0.77884	CCA	.	.	none		0.537	GPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404607.1	NM_016301	
LILRB1	10859	hgsc.bcm.edu	37	19	55147987	55147987	+	Missense_Mutation	SNP	G	G	C	rs41308744	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:55147987G>C	ENST00000396331.1	+	15	2047	c.1690G>C	c.(1690-1692)Gag>Cag	p.E564Q	LILRB1_ENST00000448689.1_3'UTR|LILRB1_ENST00000427581.2_Missense_Mutation_p.E615Q|LILRB1_ENST00000396317.1_Missense_Mutation_p.E548Q|LILRB1_ENST00000396332.4_Missense_Mutation_p.E565Q|LILRB1_ENST00000434867.2_Missense_Mutation_p.E564Q|LILRB1_ENST00000396327.3_Missense_Mutation_p.E565Q|LILRB1_ENST00000418536.2_Missense_Mutation_p.E548Q|LILRB1_ENST00000324602.7_Missense_Mutation_p.E566Q|AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000396315.1_Missense_Mutation_p.E566Q|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000396321.2_Missense_Mutation_p.E564Q	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	564					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)	p.E564>?(2)|p.E564Q(2)|p.E564K(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GACGTATGCCGAGGTGAAACA	0.577										HNSCC(37;0.09)			a|||	69	0.013778	0.0272	0.0043	5008	,	,		15883	0.0149		0.005	False		,,,				2504	0.0102				p.E566Q		Atlas-SNP	.											LILRB1,NS,carcinoma,0,3	LILRB1	140	3	5	Substitution - Missense(3)|Complex(2)	NS(2)|prostate(2)|skin(1)	c.G1696C						scavenged	.						81.0	75.0	77.0					19																	55147987		2202	4297	6499	SO:0001583	missense	10859	exon14			TATGCCGAGGTGA	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1690G>C	19.37:g.55147987G>C	ENSP00000379622:p.Glu564Gln	Somatic	195	5	0.025641		WXS	Illumina HiSeq	Phase_I	210	19	0.0904762	NM_001081637	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	37	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	g	0.003	-2.505137	0.00155	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T	0.00468	7.35;7.28;7.35;7.34;7.29;7.35;7.34;7.22;7.28;7.29	1.59	0.518	0.17030	.	.	.	.	.	T	0.00109	0.0003	N	0.00165	-1.945	0.09310	N	1	B;B;B;B;B	0.12630	0.0;0.006;0.001;0.003;0.003	B;B;B;B;B	0.10450	0.001;0.005;0.003;0.003;0.002	T	0.37731	-0.9693	9	0.02654	T	1	.	3.9648	0.09426	0.2745:0.4569:0.2686:0.0	.	548;566;565;565;564	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	Q	564;548;564;565;566;564;565;615;548;566	ENSP00000379614:E564Q;ENSP00000391514:E548Q;ENSP00000379622:E564Q;ENSP00000379618:E565Q;ENSP00000315997:E566Q;ENSP00000405243:E564Q;ENSP00000379623:E565Q;ENSP00000395004:E615Q;ENSP00000379610:E548Q;ENSP00000379608:E566Q	ENSP00000315997:E566Q	E	+	1	0	LILRB1	59839799	0.000000	0.05858	0.004000	0.12327	0.001000	0.01503	-1.376000	0.02561	-0.080000	0.12685	-3.289000	0.00047	GAG	.	.	weak		0.577	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
CRISP3	10321	hgsc.bcm.edu	37	6	49704124	49704124	+	Missense_Mutation	SNP	C	C	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:49704124C>A	ENST00000393666.1	-	2	175	c.169G>T	c.(169-171)Gcc>Tcc	p.A57S	CRISP3_ENST00000423399.2_Intron|CRISP3_ENST00000433368.2_Missense_Mutation_p.A80S|CRISP3_ENST00000263045.4_Missense_Mutation_p.A70S|CRISP3_ENST00000371159.4_Missense_Mutation_p.A88S			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3	57	SCP.				defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			ATGTTTCTGGCAGGGGGAGAT	0.458																																					p.A80S		Atlas-SNP	.											.	CRISP3	67	.	0			c.G238T						PASS	.						183.0	163.0	170.0					6																	49704124		2203	4300	6503	SO:0001583	missense	10321	exon3			TTCTGGCAGGGGG	X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823	ENST00000393666.1:c.169G>T	6.37:g.49704124C>A	ENSP00000377274:p.Ala57Ser	Somatic	125	0	0		WXS	Illumina HiSeq	Phase_I	107	37	0.345794	NM_001190986	A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Missense_Mutation	SNP	ENST00000393666.1	37		.	.	.	.	.	.	.	.	.	.	C	17.17	3.321590	0.60634	.	.	ENSG00000096006	ENST00000263045;ENST00000433368;ENST00000393666;ENST00000371159;ENST00000354620	T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66	4.9	4.02	0.46733	CAP domain (3);	0.000000	0.64402	U	0.000005	T	0.54565	0.1866	H	0.94222	3.51	0.80722	D	1	P	0.50943	0.94	D	0.66602	0.945	T	0.67059	-0.5766	10	0.87932	D	0	.	11.4692	0.50257	0.0:0.8177:0.1823:0.0	.	57	P54108	CRIS3_HUMAN	S	70;80;57;88;80	ENSP00000263045:A70S;ENSP00000389026:A80S;ENSP00000377274:A57S;ENSP00000360201:A88S;ENSP00000346636:A80S	ENSP00000263045:A70S	A	-	1	0	CRISP3	49812083	0.735000	0.28153	0.754000	0.31244	0.652000	0.38707	1.138000	0.31491	1.179000	0.42884	0.561000	0.74099	GCC	.	.	none		0.458	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_006061	
SCN9A	6335	hgsc.bcm.edu	37	2	167163537	167163537	+	Silent	SNP	G	G	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr2:167163537G>T	ENST00000409435.1	-	2	305	c.306C>A	c.(304-306)gcC>gcA	p.A102A	SCN9A_ENST00000303354.6_Silent_p.A102A|SCN9A_ENST00000375387.4_Silent_p.A102A|SCN9A_ENST00000409672.1_Silent_p.A102A			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	102					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAGCAGGTGTGGCATTGAAAC	0.318																																					p.A102A		Atlas-SNP	.											SCN9A,colon,carcinoma,-1,1	SCN9A	296	1	0			c.C306A						scavenged	.						83.0	81.0	81.0					2																	167163537		1835	4091	5926	SO:0001819	synonymous_variant	6335	exon3			AGGTGTGGCATTG	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.306C>A	2.37:g.167163537G>T		Somatic	470	0	0		WXS	Illumina HiSeq	Phase_I	436	6	0.0137615	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Silent	SNP	ENST00000409435.1	37	CCDS46441.1																																																																																			.	.	none		0.318	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
CLEC18B	497190	hgsc.bcm.edu	37	16	74447510	74447510	+	Missense_Mutation	SNP	G	G	A	rs201069655		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr16:74447510G>A	ENST00000339953.5	-	4	642	c.521C>T	c.(520-522)gCg>gTg	p.A174V		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	174	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.A174V(1)		endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GGCTTCTATCGCTGTCTGGCC	0.607																																					p.A174V		Atlas-SNP	.											CLEC18B,NS,carcinoma,0,1	CLEC18B	45	1	1	Substitution - Missense(1)	ovary(1)	c.C521T						scavenged	.																																			SO:0001583	missense	497190	exon4			TCTATCGCTGTCT	AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.521C>T	16.37:g.74447510G>A	ENSP00000341051:p.Ala174Val	Somatic	200	11	0.055		WXS	Illumina HiSeq	Phase_I	167	10	0.0598802	NM_001011880	B4DF90	Missense_Mutation	SNP	ENST00000339953.5	37	CCDS32484.1	.	.	.	.	.	.	.	.	.	.	g	0.788	-0.759876	0.03019	.	.	ENSG00000140839	ENST00000429489;ENST00000339953;ENST00000268492;ENST00000425714	T	0.09163	3.01	3.1	2.07	0.26955	CAP domain (3);	0.396709	0.26397	N	0.024613	T	0.03608	0.0103	N	0.05554	-0.025	0.09310	N	1	P;B;B	0.36222	0.544;0.005;0.005	B;B;B	0.28385	0.089;0.005;0.007	T	0.43491	-0.9388	10	0.16420	T	0.52	.	6.2019	0.20581	0.0:0.0:0.5117:0.4883	.	94;174;174	Q6UXF7-2;C9JSV1;Q6UXF7	.;.;CL18B_HUMAN	V	174;174;174;94	ENSP00000341051:A174V	ENSP00000268492:A174V	A	-	2	0	CLEC18B	73005011	0.004000	0.15560	0.030000	0.17652	0.250000	0.25880	0.525000	0.22956	0.423000	0.26033	0.537000	0.68136	GCG	.	.	weak		0.607	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434697.1	NM_001011880	
NBPF10	100132406	hgsc.bcm.edu	37	1	145299809	145299809	+	Missense_Mutation	SNP	G	G	A	rs61814630	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:145299809G>A	ENST00000369338.1	+	2	235	c.45G>A	c.(43-45)atG>atA	p.M15I	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000342960.5_Missense_Mutation_p.M286I|RP11-458D21.5_ENST00000468030.1_3'UTR			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	286						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.M15I(1)|p.M286I(1)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGGCAGAGATGAACATTCTAG	0.502													.|||	179	0.0357428	0.0015	0.0231	5008	,	,		41767	0.0635		0.0487	False		,,,				2504	0.0491				p.M286I		Atlas-SNP	.											NBPF10_ENST00000369338,extremity,malignant_melanoma,0,3	NBPF10	221	3	2	Substitution - Missense(2)	skin(2)	c.G858A						scavenged	.																																			SO:0001583	missense	100132406	exon6			AGAGATGAACATT	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369338.1:c.45G>A	1.37:g.145299809G>A	ENSP00000358344:p.Met15Ile	Somatic	69	3	0.0434783		WXS	Illumina HiSeq	Phase_I	78	3	0.0384615	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369338.1	37		.	.	.	.	.	.	.	.	.	.	.	10.66	1.411877	0.25465	.	.	ENSG00000163386	ENST00000448873;ENST00000369338;ENST00000369334;ENST00000342960	T;T	0.02863	4.13;4.13	1.05	-0.082	0.13700	.	.	.	.	.	T	0.01092	0.0036	L	0.49350	1.555	0.09310	N	1	B	0.14805	0.011	B	0.23018	0.043	T	0.44544	-0.9321	9	0.56958	D	0.05	.	4.7437	0.13028	0.0:0.404:0.596:0.0	rs61814630	15	Q86T75-2	.	I	211;15;15;286	ENSP00000358344:M15I;ENSP00000345684:M286I	ENSP00000345684:M286I	M	+	3	0	NBPF10	144011166	0.000000	0.05858	0.003000	0.11579	0.029000	0.11900	-1.452000	0.02385	-0.014000	0.14175	0.281000	0.19383	ATG	.	.	weak		0.502	NBPF10-003	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038552.1	NM_001039703	
S1PR2	9294	hgsc.bcm.edu	37	19	10334796	10334796	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:10334796G>T	ENST00000590320.1	-	2	896	c.786C>A	c.(784-786)caC>caA	p.H262Q	CTD-2369P2.2_ENST00000317726.4_lincRNA	NM_004230.3	NP_004221.3	O95136	S1PR2_HUMAN	sphingosine-1-phosphate receptor 2	262					activation of MAPK activity (GO:0000187)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of endothelial barrier (GO:1903142)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						TCGGGCAGGAGTGGACGGGAC	0.597																																					p.H262Q	Pancreas(194;229 3020 15179 45747)	Atlas-SNP	.											.	S1PR2	36	.	0			c.C786A						PASS	.						79.0	67.0	71.0					19																	10334796		2203	4300	6503	SO:0001583	missense	9294	exon2			GCAGGAGTGGACG	AF034780	CCDS12229.1	19q13	2013-03-13	2008-04-30	2008-04-30	ENSG00000267534	ENSG00000267534		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3169	protein-coding gene	gene with protein product		605111	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 5"""	EDG5		8087418, 8878560	Standard	NM_004230		Approved	Gpcr13, H218, AGR16	uc002mnl.2	O95136	OTTHUMG00000180399	ENST00000590320.1:c.786C>A	19.37:g.10334796G>T	ENSP00000466933:p.His262Gln	Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	18	8	0.444444	NM_004230	Q86UN8	Missense_Mutation	SNP	ENST00000590320.1	37	CCDS12229.1	.	.	.	.	.	.	.	.	.	.	G	5.422	0.263065	0.10294	.	.	ENSG00000175898	ENST00000317726	.	.	.	5.63	-9.3	0.00649	GPCR, rhodopsin-like superfamily (1);	0.279293	0.32068	N	0.006628	T	0.15176	0.0366	N	0.11673	0.155	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.12811	-1.0533	9	0.36615	T	0.2	.	8.6306	0.33917	0.1406:0.6179:0.1056:0.136	.	262	O95136	S1PR2_HUMAN	Q	262	.	ENSP00000322049:H262Q	H	-	3	2	S1PR2	10195796	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-2.194000	0.01243	-0.667000	0.05303	-0.141000	0.14075	CAC	.	.	none		0.597	S1PR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451194.1	NM_004230	
DACH2	117154	hgsc.bcm.edu	37	X	85403679	85403679	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chrX:85403679C>T	ENST00000373125.4	+	1	55	c.55C>T	c.(55-57)Ccg>Tcg	p.P19S	DACH2_ENST00000373131.1_Missense_Mutation_p.P19S	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	19					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						CGCCGGCGTCCCGGGGGGCTT	0.582																																					p.P19S		Atlas-SNP	.											.	DACH2	263	.	0			c.C55T						PASS	.						17.0	17.0	17.0					X																	85403679		2201	4291	6492	SO:0001583	missense	117154	exon1			GGCGTCCCGGGGG	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.55C>T	X.37:g.85403679C>T	ENSP00000362217:p.Pro19Ser	Somatic	164	0	0		WXS	Illumina HiSeq	Phase_I	121	41	0.338843	NM_001139514	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	C	1.400	-0.578490	0.03854	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125	D;T	0.81499	-1.5;-1.49	4.64	2.87	0.33458	.	0.669254	0.13433	N	0.388254	T	0.55337	0.1914	N	0.08118	0	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.37572	-0.9700	10	0.10377	T	0.69	.	3.1449	0.06468	0.0:0.4362:0.2055:0.3583	.	19;19	Q96NX9-2;Q96NX9	.;DACH2_HUMAN	S	19	ENSP00000362223:P19S;ENSP00000362217:P19S	ENSP00000345134:P19S	P	+	1	0	DACH2	85290335	0.011000	0.17503	0.888000	0.34837	0.009000	0.06853	0.048000	0.14078	0.409000	0.25649	-0.276000	0.10085	CCG	.	.	none		0.582	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
PNPLA6	10908	hgsc.bcm.edu	37	19	7620541	7620541	+	Silent	SNP	C	C	T	rs572115607		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:7620541C>T	ENST00000221249.6	+	27	3302	c.2871C>T	c.(2869-2871)gtC>gtT	p.V957V	PNPLA6_ENST00000450331.3_Silent_p.V957V|PNPLA6_ENST00000414982.3_Silent_p.V1005V|PNPLA6_ENST00000600737.1_Silent_p.V995V|PNPLA6_ENST00000545201.2_Silent_p.V930V	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	996					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						AGGCGGGGGTCCCCGTGGACC	0.672													C|||	1	0.000199681	0.0008	0.0	5008	,	,		10953	0.0		0.0	False		,,,				2504	0.0				p.V1005V		Atlas-SNP	.											.	PNPLA6	163	.	0			c.C3015T						PASS	.						33.0	33.0	33.0					19																	7620541		2203	4300	6503	SO:0001819	synonymous_variant	10908	exon26			GGGGGTCCCCGTG	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.2871C>T	19.37:g.7620541C>T		Somatic	70	0	0		WXS	Illumina HiSeq	Phase_I	84	36	0.428571	NM_001166111	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Silent	SNP	ENST00000221249.6	37	CCDS32891.1																																																																																			.	.	none		0.672	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702	
FAM81B	153643	hgsc.bcm.edu	37	5	94764428	94764428	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr5:94764428G>A	ENST00000283357.5	+	6	824	c.778G>A	c.(778-780)Gac>Aac	p.D260N		NM_152548.2	NP_689761	Q96LP2	FA81B_HUMAN	family with sequence similarity 81, member B	260						nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		CAAGAACTTGGACATGAAGGT	0.408																																					p.D260N		Atlas-SNP	.											FAM81B,NS,carcinoma,0,1	FAM81B	51	1	0			c.G778A						scavenged	.						115.0	106.0	109.0					5																	94764428		1844	4088	5932	SO:0001583	missense	153643	exon6			AACTTGGACATGA		CCDS43341.1	5q15	2008-02-05			ENSG00000153347	ENSG00000153347			26335	protein-coding gene	gene with protein product							Standard	NM_152548		Approved	FLJ25333	uc003kla.1	Q96LP2	OTTHUMG00000162837	ENST00000283357.5:c.778G>A	5.37:g.94764428G>A	ENSP00000283357:p.Asp260Asn	Somatic	180	1	0.00555556		WXS	Illumina HiSeq	Phase_I	195	67	0.34359	NM_152548		Missense_Mutation	SNP	ENST00000283357.5	37	CCDS43341.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860601	0.71834	.	.	ENSG00000153347	ENST00000283357;ENST00000512365	T	0.21361	2.01	5.87	5.87	0.94306	.	0.251835	0.40469	N	0.001099	T	0.47266	0.1436	M	0.69823	2.125	0.36848	D	0.887755	D	0.76494	0.999	D	0.69479	0.964	T	0.46679	-0.9174	10	0.46703	T	0.11	-11.1539	18.9772	0.92742	0.0:0.0:1.0:0.0	.	260	Q96LP2	FA81B_HUMAN	N	260;16	ENSP00000283357:D260N	ENSP00000283357:D260N	D	+	1	0	FAM81B	94790184	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	5.789000	0.69029	2.780000	0.95670	0.655000	0.94253	GAC	.	.	none		0.408	FAM81B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370690.1	NM_152548	
RHPN2	85415	hgsc.bcm.edu	37	19	33493188	33493188	+	Missense_Mutation	SNP	T	T	A	rs193179333	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:33493188T>A	ENST00000254260.3	-	9	1105	c.1070A>T	c.(1069-1071)cAc>cTc	p.H357L	RHPN2_ENST00000400226.4_Missense_Mutation_p.H206L	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	357	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.H357L(2)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					AGTGAAGTAGTGGGCCAGGGC	0.647																																					p.H357L		Atlas-SNP	.											RHPN2,colon,carcinoma,0,9	RHPN2	107	9	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	c.A1070T						scavenged	.						45.0	42.0	43.0					19																	33493188		2203	4300	6503	SO:0001583	missense	85415	exon9			AAGTAGTGGGCCA	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.1070A>T	19.37:g.33493188T>A	ENSP00000254260:p.His357Leu	Somatic	115	4	0.0347826		WXS	Illumina HiSeq	Phase_I	115	10	0.0869565	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.323917	0.81580	.	.	ENSG00000131941	ENST00000254260;ENST00000544458;ENST00000400226	T;T	0.20598	2.06;2.06	4.61	4.61	0.57282	BRO1 domain (3);	0.045255	0.85682	D	0.000000	T	0.46619	0.1402	M	0.87269	2.87	0.80722	D	1	D	0.61080	0.989	P	0.58077	0.832	T	0.57934	-0.7725	10	0.87932	D	0	-27.93	14.3018	0.66357	0.0:0.0:0.0:1.0	.	357	Q8IUC4	RHPN2_HUMAN	L	357;87;206	ENSP00000254260:H357L;ENSP00000402244:H206L	ENSP00000254260:H357L	H	-	2	0	RHPN2	38185028	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	7.570000	0.82390	1.829000	0.53265	0.374000	0.22700	CAC	T|0.902;A|0.097	0.097	strong		0.647	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
PEG3	5178	hgsc.bcm.edu	37	19	57327786	57327786	+	Missense_Mutation	SNP	C	C	G	rs371769465		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:57327786C>G	ENST00000326441.9	-	10	2387	c.2024G>C	c.(2023-2025)cGt>cCt	p.R675P	PEG3_ENST00000598410.1_Missense_Mutation_p.R551P|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.R675P|PEG3_ENST00000593695.1_Missense_Mutation_p.R549P	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	675					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGTTTTCTGACGCCTTTTAAG	0.423																																					p.R675P		Atlas-SNP	.											ZIM2_ENST00000326441,NS,carcinoma,0,4	PEG3	414	4	0			c.G2024C						PASS	.						106.0	108.0	107.0					19																	57327786		2203	4300	6503	SO:0001583	missense	5178	exon9			TTCTGACGCCTTT	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2024G>C	19.37:g.57327786C>G	ENSP00000326581:p.Arg675Pro	Somatic	198	0	0		WXS	Illumina HiSeq	Phase_I	181	8	0.0441989	NM_001146184	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872774	0.51695	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02682	4.2;4.2	4.05	0.0115	0.14087	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.662273	0.13428	N	0.388633	T	0.10165	0.0249	M	0.73962	2.25	.	.	.	D;D;D	0.71674	0.976;0.997;0.998	P;P;D	0.65323	0.706;0.902;0.934	T	0.10847	-1.0612	9	0.72032	D	0.01	-9.8771	6.8386	0.23951	0.0:0.4257:0.0:0.5743	.	551;675;610	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	P	675	ENSP00000326581:R675P;ENSP00000403051:R675P	ENSP00000326581:R675P	R	-	2	0	ZIM2	62019598	0.746000	0.28272	0.080000	0.20451	0.673000	0.39480	0.972000	0.29409	0.072000	0.16694	0.585000	0.79938	CGT	.	.	alt		0.423	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
S1PR2	9294	hgsc.bcm.edu	37	19	10334795	10334795	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:10334795A>G	ENST00000590320.1	-	2	897	c.787T>C	c.(787-789)Tcc>Ccc	p.S263P	CTD-2369P2.2_ENST00000317726.4_lincRNA	NM_004230.3	NP_004221.3	O95136	S1PR2_HUMAN	sphingosine-1-phosphate receptor 2	263					activation of MAPK activity (GO:0000187)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of endothelial barrier (GO:1903142)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						ATCGGGCAGGAGTGGACGGGA	0.602																																					p.S263P	Pancreas(194;229 3020 15179 45747)	Atlas-SNP	.											.	S1PR2	36	.	0			c.T787C						PASS	.						79.0	67.0	71.0					19																	10334795		2203	4300	6503	SO:0001583	missense	9294	exon2			GGCAGGAGTGGAC	AF034780	CCDS12229.1	19q13	2013-03-13	2008-04-30	2008-04-30	ENSG00000267534	ENSG00000267534		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3169	protein-coding gene	gene with protein product		605111	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 5"""	EDG5		8087418, 8878560	Standard	NM_004230		Approved	Gpcr13, H218, AGR16	uc002mnl.2	O95136	OTTHUMG00000180399	ENST00000590320.1:c.787T>C	19.37:g.10334795A>G	ENSP00000466933:p.Ser263Pro	Somatic	40	0	0		WXS	Illumina HiSeq	Phase_I	18	8	0.444444	NM_004230	Q86UN8	Missense_Mutation	SNP	ENST00000590320.1	37	CCDS12229.1	.	.	.	.	.	.	.	.	.	.	A	7.551	0.662679	0.14645	.	.	ENSG00000175898	ENST00000317726	.	.	.	5.63	-11.3	0.00108	GPCR, rhodopsin-like superfamily (1);	0.999489	0.08097	N	0.998495	T	0.23289	0.0563	N	0.13352	0.335	0.19775	N	0.999952	B	0.27316	0.175	B	0.31869	0.137	T	0.40136	-0.9579	9	0.12766	T	0.61	.	17.8161	0.88634	0.8127:0.1317:0.0:0.0557	.	263	O95136	S1PR2_HUMAN	P	263	.	ENSP00000322049:S263P	S	-	1	0	S1PR2	10195795	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-3.435000	0.00472	-2.793000	0.00355	-0.319000	0.08680	TCC	.	.	none		0.602	S1PR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451194.1	NM_004230	
ZNF547	284306	hgsc.bcm.edu	37	19	57889498	57889498	+	Missense_Mutation	SNP	A	A	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:57889498A>C	ENST00000282282.3	+	4	1304	c.1154A>C	c.(1153-1155)aAa>aCa	p.K385T	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K385R(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GAATGTGGGAAATTCTTTAGG	0.448																																					p.K385T		Atlas-SNP	.											ZNF547,NS,carcinoma,0,1	ZNF547	45	1	1	Substitution - Missense(1)	endometrium(1)	c.A1154C						PASS	.						75.0	68.0	70.0					19																	57889498		2203	4300	6503	SO:0001583	missense	284306	exon4			GTGGGAAATTCTT	AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.1154A>C	19.37:g.57889498A>C	ENSP00000282282:p.Lys385Thr	Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	73	19	0.260274	NM_173631	A8K5Z9|Q96NC4	Missense_Mutation	SNP	ENST00000282282.3	37	CCDS33131.1	.	.	.	.	.	.	.	.	.	.	A	17.43	3.387608	0.61956	.	.	ENSG00000152433	ENST00000282282	T	0.60299	0.2	1.81	1.81	0.25067	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.75398	0.3844	M	0.92459	3.31	0.23144	N	0.998222	D	0.61697	0.99	P	0.58577	0.841	T	0.64300	-0.6440	8	.	.	.	.	8.9234	0.35625	1.0:0.0:0.0:0.0	.	385	Q8IVP9	ZN547_HUMAN	T	385	ENSP00000282282:K385T	.	K	+	2	0	ZNF547	62581310	0.988000	0.35896	0.327000	0.25402	0.678000	0.39670	0.685000	0.25378	1.088000	0.41272	0.397000	0.26171	AAA	.	.	none		0.448	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465787.1	NM_173631	
ITGAV	3685	hgsc.bcm.edu	37	2	187533626	187533626	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr2:187533626G>A	ENST00000261023.3	+	25	2845	c.2571G>A	c.(2569-2571)gaG>gaA	p.E857E	ITGAV_ENST00000474571.1_3'UTR|ITGAV_ENST00000433736.2_Silent_p.E811E|ITGAV_ENST00000374907.3_Silent_p.E821E|AC017101.10_ENST00000453665.1_RNA	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	857					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	CAGATATGGAGATCAACCCTT	0.323																																					p.E857E	Melanoma(58;108 1995 6081)	Atlas-SNP	.											.	ITGAV	124	.	0			c.G2571A						PASS	.						116.0	114.0	115.0					2																	187533626		2203	4300	6503	SO:0001819	synonymous_variant	3685	exon25			TATGGAGATCAAC		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.2571G>A	2.37:g.187533626G>A		Somatic	187	0	0		WXS	Illumina HiSeq	Phase_I	174	60	0.344828	NM_002210	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Silent	SNP	ENST00000261023.3	37	CCDS2292.1	.	.	.	.	.	.	.	.	.	.	G	8.464	0.856071	0.17106	.	.	ENSG00000138448	ENST00000430709	.	.	.	5.54	3.75	0.43078	.	.	.	.	.	T	0.59321	0.2185	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54302	-0.8314	4	.	.	.	.	9.257	0.37590	0.2825:0.0:0.7175:0.0	.	.	.	.	K	8	.	.	R	+	2	0	ITGAV	187241871	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.129000	0.31381	0.716000	0.32124	-0.143000	0.13931	AGA	.	.	none		0.323	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210	
MUC4	4585	hgsc.bcm.edu	37	3	195506076	195506076	+	Missense_Mutation	SNP	C	C	G	rs547812110	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:195506076C>G	ENST00000463781.3	-	2	12834	c.12375G>C	c.(12373-12375)caG>caC	p.Q4125H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.Q4125H|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.Q4125H(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCCTGACCTGTGG	0.582													.|||	590	0.117812	0.2995	0.0937	5008	,	,		9585	0.0288		0.0825	False		,,,				2504	0.0174				p.Q4125H		Atlas-SNP	.											MUC4_ENST00000463781,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	MUC4	1505	1	1	Substitution - Missense(1)	central_nervous_system(1)	c.G12375C						scavenged	.						12.0	9.0	10.0					3																	195506076		599	1486	2085	SO:0001583	missense	4585	exon2			GGTGGCCTGACCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12375G>C	3.37:g.195506076C>G	ENSP00000417498:p.Gln4125His	Somatic	77	7	0.0909091		WXS	Illumina HiSeq	Phase_I	91	7	0.0769231	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.505	-0.869207	0.02570	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31510	1.49;1.49	0.423	0.423	0.16463	.	.	.	.	.	T	0.12220	0.0297	N	0.08118	0	0.09310	N	1	B	0.26876	0.162	B	0.08055	0.003	T	0.29671	-1.0004	8	.	.	.	.	5.9813	0.19409	0.0:0.3299:0.6701:0.0	.	3997	E7ESK3	.	H	4125	ENSP00000417498:Q4125H;ENSP00000420243:Q4125H	.	Q	-	3	2	MUC4	196990855	0.006000	0.16342	0.001000	0.08648	0.007000	0.05969	0.550000	0.23345	-1.409000	0.02038	-1.964000	0.00472	CAG	.	.	none		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SLC25A37	51312	hgsc.bcm.edu	37	8	23429084	23429084	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:23429084G>A	ENST00000519973.1	+	4	931	c.733G>A	c.(733-735)Ggg>Agg	p.G245R	FP15737_ENST00000399967.3_5'Flank	NM_016612.2	NP_057696.2	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25 (mitochondrial iron transporter), member 37	245					iron ion homeostasis (GO:0055072)|mitochondrial iron ion transport (GO:0048250)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	iron ion transmembrane transporter activity (GO:0005381)	p.G245W(1)		NS(1)|endometrium(3)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)		CGGGCTGGCCGGGGCCCTCGC	0.652																																					p.G245R		Atlas-SNP	.											SLC25A37,NS,carcinoma,0,1	SLC25A37	27	1	1	Substitution - Missense(1)	lung(1)	c.G733A						PASS	.						25.0	29.0	28.0					8																	23429084		1907	4113	6020	SO:0001583	missense	51312	exon4			CTGGCCGGGGCCC	AF495725	CCDS47828.1	8p21.2	2013-05-22	2012-03-29		ENSG00000147454	ENSG00000147454		"""Solute carriers"""	29786	protein-coding gene	gene with protein product	"""mitoferrin"""	610387	"""solute carrier family 25, member 37"""			16511496	Standard	XM_006716352		Approved	MSCP, MFRN, MFRN1	uc003xdo.3	Q9NYZ2	OTTHUMG00000163865	ENST00000519973.1:c.733G>A	8.37:g.23429084G>A	ENSP00000429200:p.Gly245Arg	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	86	35	0.406977	NM_016612	A2RU93|Q53FT7|Q69YJ8|Q969S1|Q9P0J2	Missense_Mutation	SNP	ENST00000519973.1	37	CCDS47828.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.004468	0.93287	.	.	ENSG00000147454	ENST00000519973	D	0.85339	-1.97	5.8	5.8	0.92144	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.94984	0.8377	H	0.95114	3.625	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.95928	0.8936	10	0.87932	D	0	-3.0931	18.6148	0.91299	0.0:0.0:1.0:0.0	.	245	Q9NYZ2	MFRN1_HUMAN	R	245	ENSP00000429200:G245R	ENSP00000429200:G245R	G	+	1	0	SLC25A37	23485029	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.460000	0.97641	2.740000	0.93945	0.650000	0.86243	GGG	.	.	none		0.652	SLC25A37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376039.1	NM_016612	
HNRNPCL1	343069	hgsc.bcm.edu	37	1	12907708	12907708	+	Silent	SNP	A	A	G	rs4026149	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:12907708A>G	ENST00000317869.6	-	2	660	c.435T>C	c.(433-435)cgT>cgC	p.R145R		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	145						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						ATAGACGTTGACGTTTCGAGG	0.483																																					p.R145R		Atlas-SNP	.											HNRNPCL1,NS,carcinoma,-1,1	HNRNPCL1	68	1	0			c.T435C						scavenged	.						120.0	124.0	122.0					1																	12907708		2201	4297	6498	SO:0001819	synonymous_variant	343069	exon2			ACGTTGACGTTTC	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.435T>C	1.37:g.12907708A>G		Somatic	204	15	0.0735294		WXS	Illumina HiSeq	Phase_I	199	26	0.130653	NM_001013631	B2RP44	Silent	SNP	ENST00000317869.6	37	CCDS30591.1																																																																																			A|0.667;G|0.333	0.333	strong		0.483	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
TRIM51	84767	hgsc.bcm.edu	37	11	55655597	55655597	+	Silent	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr11:55655597A>G	ENST00000449290.2	+	4	689	c.597A>G	c.(595-597)gaA>gaG	p.E199E	TRIM51_ENST00000244891.3_Silent_p.E56E	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	199						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										ATCACTTGGAAAGGCTGCGAA	0.433																																					p.E199E		Atlas-SNP	.											SPRYD5_ENST00000327733,NS,carcinoma,+2,2	.	.	2	0			c.A597G						scavenged	.						61.0	58.0	59.0					11																	55655597		2201	4296	6497	SO:0001819	synonymous_variant	84767	exon4			CTTGGAAAGGCTG	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.597A>G	11.37:g.55655597A>G		Somatic	557	20	0.0359066		WXS	Illumina HiSeq	Phase_I	514	30	0.0583658	NM_032681	A6NMG2	Silent	SNP	ENST00000449290.2	37																																																																																				.	.	none		0.433	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	
FMN2	56776	hgsc.bcm.edu	37	1	240370997	240370997	+	Missense_Mutation	SNP	C	C	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:240370997C>A	ENST00000319653.9	+	5	3115	c.2885C>A	c.(2884-2886)gCa>gAa	p.A962E		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	962	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CTTCCCGGGGCAGGCATACCC	0.697																																					p.A962E		Atlas-SNP	.											FMN2,NS,carcinoma,-1,2	FMN2	451	2	0			c.C2885A						scavenged	.						20.0	23.0	22.0					1																	240370997		2200	4297	6497	SO:0001583	missense	56776	exon5			CCGGGGCAGGCAT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2885C>A	1.37:g.240370997C>A	ENSP00000318884:p.Ala962Glu	Somatic	93	1	0.0107527		WXS	Illumina HiSeq	Phase_I	96	64	0.666667	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	C	7.783	0.709962	0.15239	.	.	ENSG00000155816	ENST00000319653	T	0.56941	0.43	3.8	-3.7	0.04437	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (1);	.	.	.	.	T	0.31295	0.0792	L	0.38175	1.15	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22173	-1.0224	8	.	.	.	.	0.4251	0.00462	0.2272:0.1627:0.2561:0.3541	.	962	Q9NZ56	FMN2_HUMAN	E	962	ENSP00000318884:A962E	.	A	+	2	0	FMN2	238437620	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-6.269000	0.00073	-0.532000	0.06332	-0.878000	0.02970	GCA	.	.	none		0.697	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
PAK2	5062	hgsc.bcm.edu	37	3	196509577	196509577	+	Missense_Mutation	SNP	C	C	G	rs76714248	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:196509577C>G	ENST00000327134.3	+	2	382	c.60C>G	c.(58-60)agC>agG	p.S20R	RNU6-42P_ENST00000384165.1_RNA	NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	20					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		GAATGAGCAGCACCATCTTTA	0.443																																					p.S20R		Atlas-SNP	.											PAK2_ENST00000327134,colon,carcinoma,0,2	PAK2	113	2	0			c.C60G						scavenged	.						123.0	129.0	127.0					3																	196509577		2203	4300	6503	SO:0001583	missense	5062	exon2			GAGCAGCACCATC	U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.60C>G	3.37:g.196509577C>G	ENSP00000314067:p.Ser20Arg	Somatic	216	3	0.0138889		WXS	Illumina HiSeq	Phase_I	240	10	0.0416667	NM_002577	Q13154|Q6ISC3	Missense_Mutation	SNP	ENST00000327134.3	37	CCDS3321.1	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749766	0.69533	.	.	ENSG00000180370	ENST00000327134	T	0.74737	-0.87	5.21	-3.63	0.04529	.	0.081384	0.85682	D	0.000000	D	0.83115	0.5184	M	0.78456	2.415	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.83597	0.0126	10	0.87932	D	0	.	14.4339	0.67268	0.0:0.6189:0.0:0.3811	.	20	Q13177	PAK2_HUMAN	R	20	ENSP00000314067:S20R	ENSP00000314067:S20R	S	+	3	2	PAK2	197993974	0.899000	0.30636	0.987000	0.45799	0.994000	0.84299	-0.061000	0.11693	-0.583000	0.05921	-0.290000	0.09829	AGC	C|0.991;G|0.009	0.009	strong		0.443	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
SPIDR	23514	hgsc.bcm.edu	37	8	48614293	48614293	+	Missense_Mutation	SNP	A	A	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:48614293A>C	ENST00000297423.4	+	13	2168	c.1784A>C	c.(1783-1785)cAt>cCt	p.H595P	SPIDR_ENST00000517693.1_Missense_Mutation_p.H70P|SPIDR_ENST00000541342.1_Missense_Mutation_p.H525P|SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000518074.1_Missense_Mutation_p.H535P	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	595					cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											ATAAAAACTCATCTGCCTCCT	0.348																																					p.H595P		Atlas-SNP	.											KIAA0146,bladder,carcinoma,+1,1	KIAA0146	64	1	0			c.A1784C						PASS	.						129.0	121.0	124.0					8																	48614293		1882	4119	6001	SO:0001583	missense	23514	exon13			AAACTCATCTGCC	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1784A>C	8.37:g.48614293A>C	ENSP00000297423:p.His595Pro	Somatic	126	0	0		WXS	Illumina HiSeq	Phase_I	111	40	0.36036	NM_001080394	B4DFV2|B4E0Y6|Q96BI5	Missense_Mutation	SNP	ENST00000297423.4	37	CCDS43737.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.029|9.029	0.986713|0.986713	0.18889|0.18889	.|.	.|.	ENSG00000164808|ENSG00000164808	ENST00000297423;ENST00000518074;ENST00000541342;ENST00000519141;ENST00000517693;ENST00000519362|ENST00000519401	.|.	.|.	.|.	5.4|5.4	2.96|2.96	0.34315|0.34315	.|.	0.536026|.	0.20846|.	N|.	0.084612|.	T|T	0.35740|0.35740	0.0942|0.0942	L|L	0.40543|0.40543	1.245|1.245	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B;B;B|.	0.23442|.	0.001;0.001;0.013;0.011;0.085;0.009;0.001;0.05|.	B;B;B;B;B;B;B;B|.	0.18561|.	0.001;0.001;0.014;0.012;0.014;0.007;0.001;0.022|.	T|T	0.21861|0.21861	-1.0233|-1.0233	9|5	0.48119|.	T|.	0.1|.	.|.	6.9387|6.9387	0.24481|0.24481	0.7729:0.1496:0.0775:0.0|0.7729:0.1496:0.0775:0.0	.|.	85;100;535;525;595;284;70;595|.	B4DZY2;B4DWT8;B4E0Y6;B4DFV2;B4DEV5;B4DFT3;B3KP42;Q14159|.	.;.;.;.;.;.;.;K0146_HUMAN|.	P|L	595;535;525;100;70;70|277	.|.	ENSP00000297423:H595P|.	H|I	+|+	2|1	0|0	KIAA0146|KIAA0146	48776846|48776846	0.000000|0.000000	0.05858|0.05858	0.056000|0.056000	0.19401|0.19401	0.921000|0.921000	0.55340|0.55340	0.966000|0.966000	0.29331|0.29331	0.336000|0.336000	0.23639|0.23639	0.528000|0.528000	0.53228|0.53228	CAT|ATC	.	.	none		0.348	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
IGSF3	3321	hgsc.bcm.edu	37	1	117150572	117150572	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:117150572A>G	ENST00000369486.3	-	5	1979	c.1214T>C	c.(1213-1215)cTc>cCc	p.L405P	IGSF3_ENST00000369483.1_Missense_Mutation_p.L405P|IGSF3_ENST00000318837.6_Missense_Mutation_p.L405P	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	405	Ig-like C2-type 4.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		ACTGAGGGGGAGGACTATGAT	0.517																																					p.L405P		Atlas-SNP	.											IGSF3_ENST00000369483,NS,carcinoma,+1,2	IGSF3	294	2	0			c.T1214C						scavenged	.						96.0	106.0	103.0					1																	117150572		2203	4300	6503	SO:0001583	missense	3321	exon5			AGGGGGAGGACTA	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.1214T>C	1.37:g.117150572A>G	ENSP00000358498:p.Leu405Pro	Somatic	225	0	0		WXS	Illumina HiSeq	Phase_I	247	3	0.0121457	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	A	16.66	3.184701	0.57909	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.03065	4.08;4.06;4.06	4.67	4.67	0.58626	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.075884	0.56097	D	0.000026	T	0.04998	0.0134	L	0.34521	1.04	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.993	D;D;P	0.68621	0.929;0.959;0.851	T	0.51474	-0.8701	10	0.39692	T	0.17	-41.7205	12.3628	0.55213	1.0:0.0:0.0:0.0	.	405;405;405	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	P	405	ENSP00000358498:L405P;ENSP00000358495:L405P;ENSP00000321184:L405P	ENSP00000321184:L405P	L	-	2	0	IGSF3	116952095	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	4.645000	0.61404	2.078000	0.62432	0.455000	0.32223	CTC	.	.	none		0.517	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
CTGF	1490	hgsc.bcm.edu	37	6	132271959	132271959	+	Silent	SNP	T	T	G	rs12206231		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:132271959T>G	ENST00000367976.3	-	2	440	c.240A>C	c.(238-240)ctA>ctC	p.L80L	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	80	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		AGTGACAGAATAGGCCCTTGT	0.701													G|||	5008	1.0	1.0	1.0	5008	,	,		8368	1.0		1.0	False		,,,				2504	1.0				p.L80L	Esophageal Squamous(127;510 1660 12817 24400 38449)	Atlas-SNP	.											.	CTGF	36	.	0			c.A240C						PASS	.						7.0	8.0	7.0					6																	132271959		2127	4192	6319	SO:0001819	synonymous_variant	1490	exon2			ACAGAATAGGCCC	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.240A>C	6.37:g.132271959T>G		Somatic	0	0	.		WXS	Illumina HiSeq	Phase_I	5	5	1	NM_001901	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Silent	SNP	ENST00000367976.3	37	CCDS5151.1																																																																																			T|0.000;G|1.000	1.000	strong		0.701	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
PTPN3	5774	hgsc.bcm.edu	37	9	112225710	112225710	+	Missense_Mutation	SNP	G	G	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr9:112225710G>C	ENST00000374541.2	-	2	109	c.5C>G	c.(4-6)aCc>aGc	p.T2S	PTPN3_ENST00000262539.3_5'UTR	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	2					negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TAACCGGGAGGTCATAACTAT	0.408																																					p.T2S		Atlas-SNP	.											.	PTPN3	106	.	0			c.C5G						PASS	.						100.0	99.0	100.0					9																	112225710		2203	4300	6503	SO:0001583	missense	5774	exon2			CGGGAGGTCATAA		CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.5C>G	9.37:g.112225710G>C	ENSP00000363667:p.Thr2Ser	Somatic	99	0	0		WXS	Illumina HiSeq	Phase_I	103	36	0.349515	NM_001145368	A0AUW9|E7EN99|E9PGU7	Missense_Mutation	SNP	ENST00000374541.2	37	CCDS6776.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.799131	0.50208	.	.	ENSG00000070159	ENST00000394831;ENST00000374541	T	0.70749	-0.51	5.25	4.23	0.50019	.	0.157695	0.41396	D	0.000896	T	0.49932	0.1586	N	0.17082	0.46	0.80722	D	1	B;P;B	0.35612	0.172;0.512;0.067	B;B;B	0.31442	0.058;0.13;0.034	T	0.50363	-0.8837	10	0.29301	T	0.29	.	10.8355	0.46685	0.0:0.0:0.6104:0.3896	.	2;2;2	B7Z9V1;Q45VJ3;P26045	.;.;PTN3_HUMAN	S	2	ENSP00000363667:T2S	ENSP00000363667:T2S	T	-	2	0	PTPN3	111265531	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.591000	0.53986	2.604000	0.88044	0.557000	0.71058	ACC	.	.	none		0.408	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4		
MN1	4330	hgsc.bcm.edu	37	22	28194933	28194933	+	Silent	SNP	T	T	C	rs572936881|rs373314940|rs71194738	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr22:28194933T>C	ENST00000302326.4	-	1	2553	c.1599A>G	c.(1597-1599)caA>caG	p.Q533Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	533	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgttgctgctgct	0.652			T	ETV6	"""AML, meningioma"""								T|||	98	0.0195687	0.0613	0.0086	5008	,	,		12327	0.002		0.005	False		,,,				2504	0.0041				p.Q533Q		Atlas-SNP	.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	MN1,caecum,carcinoma,0,2	MN1	122	2	0			c.A1599G						scavenged	.	C		9,3561		0,9,1776	4.0	5.0	5.0		1599	-0.4	1.0	22		5	5,7341		0,5,3668	no	coding-synonymous	MN1	NM_002430.2		0,14,5444	CC,CT,TT		0.0681,0.2521,0.1283		533/1321	28194933	14,10902	1785	3673	5458	SO:0001819	synonymous_variant	4330	exon1			CTGCTGTTGCTGC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1599A>G	22.37:g.28194933T>C		Somatic	64	1	0.015625		WXS	Illumina HiSeq	Phase_I	55	5	0.0909091	NM_002430	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																			.	.	weak		0.652	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
KCNQ4	9132	hgsc.bcm.edu	37	1	41296932	41296932	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:41296932G>A	ENST00000347132.5	+	10	1551	c.1469G>A	c.(1468-1470)cGc>cAc	p.R490H	KCNQ4_ENST00000509682.2_Missense_Mutation_p.R436H|KCNQ4_ENST00000506017.1_3'UTR	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	490					inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	GACCGCACCCGCTTCCGGGCA	0.667																																					p.R490H		Atlas-SNP	.											KCNQ4,NS,carcinoma,+1,1	KCNQ4	58	1	0			c.G1469A						scavenged	.						39.0	34.0	36.0					1																	41296932		2203	4298	6501	SO:0001583	missense	9132	exon10			GCACCCGCTTCCG	AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.1469G>A	1.37:g.41296932G>A	ENSP00000262916:p.Arg490His	Somatic	195	0	0		WXS	Illumina HiSeq	Phase_I	228	3	0.0131579	NM_004700	O96025	Missense_Mutation	SNP	ENST00000347132.5	37	CCDS456.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.658340	0.88154	.	.	ENSG00000117013	ENST00000347132;ENST00000509682	D;D	0.99745	-6.61;-6.61	5.13	4.19	0.49359	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99539	0.9835	M	0.73962	2.25	0.50171	D	0.999856	D;B	0.89917	1.0;0.159	D;B	0.67900	0.954;0.039	D	0.98243	1.0489	10	0.54805	T	0.06	-25.8458	12.8442	0.57821	0.0:0.0:0.8355:0.1645	.	436;490	P56696-2;P56696	.;KCNQ4_HUMAN	H	490;436	ENSP00000262916:R490H;ENSP00000423756:R436H	ENSP00000262916:R490H	R	+	2	0	KCNQ4	41069519	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.619000	0.98369	1.246000	0.43901	0.543000	0.68304	CGC	.	.	none		0.667	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000020812.1	NM_004700	
MUC4	4585	hgsc.bcm.edu	37	3	195506147	195506147	+	Missense_Mutation	SNP	G	G	A	rs200473856	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:195506147G>A	ENST00000463781.3	-	2	12763	c.12304C>T	c.(12304-12306)Ctt>Ttt	p.L4102F	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L4102F|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAAGGCTGGTGAGA	0.592																																					p.L4102F		Atlas-SNP	.											MUC4_ENST00000463781,NS,lymphoid_neoplasm,0,1	MUC4	1505	1	0			c.C12304T						scavenged	.						18.0	10.0	12.0					3																	195506147		567	1388	1955	SO:0001583	missense	4585	exon2			AGGAAAGGCTGGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12304C>T	3.37:g.195506147G>A	ENSP00000417498:p.Leu4102Phe	Somatic	76	2	0.0263158		WXS	Illumina HiSeq	Phase_I	85	4	0.0470588	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	12.07	1.828712	0.32329	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32023	1.47;1.49	.	.	.	.	.	.	.	.	T	0.22244	0.0536	N	0.19112	0.55	0.09310	N	0.999998	P	0.44006	0.824	P	0.48704	0.587	T	0.17107	-1.0380	6	.	.	.	.	.	.	.	.	3974	E7ESK3	.	F	4102	ENSP00000417498:L4102F;ENSP00000420243:L4102F	.	L	-	1	0	MUC4	196990926	0.002000	0.14202	0.004000	0.12327	0.022000	0.10575	0.632000	0.24583	-0.417000	0.07461	0.064000	0.15345	CTT	G|0.981;A|0.019	0.019	strong		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SCNN1A	6337	hgsc.bcm.edu	37	12	6471387	6471387	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr12:6471387G>A	ENST00000228916.2	-	4	803	c.705C>T	c.(703-705)gaC>gaT	p.D235D	SCNN1A_ENST00000360168.3_Silent_p.D294D|SCNN1A_ENST00000543768.1_Silent_p.D258D|SCNN1A_ENST00000396966.2_Silent_p.D235D|SCNN1A_ENST00000358945.3_Silent_p.D235D|SCNN1A_ENST00000538979.1_Intron|SCNN1A_ENST00000540037.1_5'UTR	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	235					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	GGTAGAAGCAGTCCGATTTGT	0.562																																					p.D294D		Atlas-SNP	.											SCNN1A,NS,adenocarcinoma,-2,1	SCNN1A	54	1	0			c.C882T						PASS	.						158.0	112.0	128.0					12																	6471387		2203	4300	6503	SO:0001819	synonymous_variant	6337	exon3			GAAGCAGTCCGAT	Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.705C>T	12.37:g.6471387G>A		Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	97	24	0.247423	NM_001159576	A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Silent	SNP	ENST00000228916.2	37	CCDS8543.1																																																																																			.	.	none		0.562	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399055.1		
ZSCAN20	7579	hgsc.bcm.edu	37	1	33956948	33956948	+	Silent	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:33956948C>T	ENST00000361328.3	+	6	1243	c.1090C>T	c.(1090-1092)Cta>Tta	p.L364L	ZSCAN20_ENST00000373413.2_Silent_p.L310L	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	364					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TGCAGAGCAGCTAAGGGCAAG	0.532																																					p.L364L		Atlas-SNP	.											.	ZSCAN20	107	.	0			c.C1090T						PASS	.						94.0	98.0	97.0					1																	33956948		1957	4167	6124	SO:0001819	synonymous_variant	7579	exon6			GAGCAGCTAAGGG	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1090C>T	1.37:g.33956948C>T		Somatic	135	0	0		WXS	Illumina HiSeq	Phase_I	107	42	0.392523	NM_145238	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Silent	SNP	ENST00000361328.3	37	CCDS41300.1																																																																																			.	.	none		0.532	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238	
HLA-A	3105	hgsc.bcm.edu	37	6	29910558	29910558	+	Missense_Mutation	SNP	T	T	A	rs386698549|rs2075684	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:29910558T>A	ENST00000396634.1	+	4	439	c.98T>A	c.(97-99)tTc>tAc	p.F33Y	HLA-A_ENST00000376809.5_Missense_Mutation_p.F33Y|HLA-A_ENST00000376802.2_Missense_Mutation_p.F33Y|HLA-A_ENST00000376806.5_Missense_Mutation_p.F33Y			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	33	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.F33S(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						AGGTATTTCTTCACATCCGTG	0.726									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)			N|||	1103	0.220248	0.1641	0.1556	5008	,	,		13512	0.3333		0.1471	False		,,,				2504	0.3006				p.F33Y		Atlas-SNP	.											HLA-A,NS,lymphoid_neoplasm,0,1	HLA-A	89	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.T98A						scavenged	.						16.0	15.0	15.0					6																	29910558		2180	4265	6445	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	ATTTCTTCACATC	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.98T>A	6.37:g.29910558T>A	ENSP00000379873:p.Phe33Tyr	Somatic	128	2	0.015625		WXS	Illumina HiSeq	Phase_I	129	5	0.0387597	NM_001242758	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	3.323	-0.138290	0.06669	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00008	9.61;9.61;9.61;9.61	3.72	-2.31	0.06765	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	20.031000	0.00447	N	0.000090	T	0.00012	0.0000	.	.	.	0.09310	N	1	B;B;B	0.24092	0.097;0.0;0.0	B;B;B	0.42062	0.374;0.002;0.002	T	0.28902	-1.0029	9	0.02654	T	1	.	5.7818	0.18310	0.2651:0.4571:0.0:0.2778	rs2075684;rs3179175;rs17423951;rs41542415	33;33;33	Q5SRN7;Q5SRN5;P04439	.;.;1A03_HUMAN	Y	33	ENSP00000379873:F33Y;ENSP00000366002:F33Y;ENSP00000366005:F33Y;ENSP00000365998:F33Y	ENSP00000348012:F33Y	F	+	2	0	HLA-A	30018537	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-6.129000	0.00079	-0.931000	0.03746	-4.308000	0.00007	TTC	T|0.574;C|0.414;A|0.012	0.012	strong		0.726	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
CISD2	493856	hgsc.bcm.edu	37	4	103806567	103806567	+	Missense_Mutation	SNP	A	A	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr4:103806567A>T	ENST00000273986.4	+	2	405	c.298A>T	c.(298-300)Agg>Tgg	p.R100W	CISD2_ENST00000503643.1_Missense_Mutation_p.R110W|SLC9B1_ENST00000394789.3_Intron	NM_001008388.4	NP_001008389.1	Q8N5K1	CISD2_HUMAN	CDGSH iron sulfur domain 2	100					mitochondrion degradation (GO:0000422)|multicellular organismal aging (GO:0010259)|regulation of autophagy (GO:0010506)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|protein complex (GO:0043234)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(3)	4				OV - Ovarian serous cystadenocarcinoma(123;1.97e-08)		AGCTTATTGTAGGTGTTGGCG	0.343																																					p.R100W		Atlas-SNP	.											.	CISD2	9	.	0			c.A298T						PASS	.						53.0	51.0	52.0					4																	103806567		2203	4300	6503	SO:0001583	missense	493856	exon2			TATTGTAGGTGTT	BX537971	CCDS34040.1	4q24	2009-03-25	2007-08-10	2007-08-10	ENSG00000145354	ENSG00000145354		"""CDGSH iron sulfur domain containing"""	24212	protein-coding gene	gene with protein product	"""mitoNEET related 1"", ""endoplasmic reticulum intermembrane small protein"""	611507	"""zinc finger, CDGSH-type domain 2"", ""Wolfram syndrome 2"""	ZCD2, WFS2		17376863, 17584744, 17846994	Standard	NM_001008388		Approved	Miner1, ERIS	uc003hwt.4	Q8N5K1	OTTHUMG00000161014	ENST00000273986.4:c.298A>T	4.37:g.103806567A>T	ENSP00000273986:p.Arg100Trp	Somatic	96	0	0		WXS	Illumina HiSeq	Phase_I	97	34	0.350515	NM_001008388	Q7Z3D5	Missense_Mutation	SNP	ENST00000273986.4	37	CCDS34040.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.460468	0.84317	.	.	ENSG00000145354	ENST00000273986;ENST00000503643	.	.	.	6.17	2.16	0.27623	Iron sulphur-containing domain, CDGSH-type, subfamily (1);Iron sulphur-containing domain, CDGSH-type (1);	0.000000	0.85682	D	0.000000	D	0.83691	0.5309	M	0.89904	3.07	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.85812	0.1380	9	0.87932	D	0	-30.1136	14.2849	0.66240	0.4988:0.5012:0.0:0.0	.	100	Q8N5K1	CISD2_HUMAN	W	100;110	.	ENSP00000273986:R100W	R	+	1	2	CISD2	104026002	0.999000	0.42202	0.964000	0.40570	0.979000	0.70002	1.460000	0.35244	0.142000	0.18901	0.533000	0.62120	AGG	.	.	none		0.343	CISD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363417.2	NM_001008388	
KIAA0040	9674	hgsc.bcm.edu	37	1	175129933	175129933	+	Missense_Mutation	SNP	T	T	C	rs150137790		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:175129933T>C	ENST00000423313.1	-	4	753	c.217A>G	c.(217-219)Aag>Gag	p.K73E	KIAA0040_ENST00000545251.2_Missense_Mutation_p.K73E|KIAA0040_ENST00000567124.1_5'Flank|KIAA0040_ENST00000444639.1_Missense_Mutation_p.K73E	NM_001162893.1|NM_001162895.1|NM_014656.2	NP_001156365.1|NP_001156367.1|NP_055471.2	Q15053	K0040_HUMAN	KIAA0040	0																	tccttcttcttcttcttcttc	0.502																																					p.K73E		Atlas-SNP	.											KIAA0040,colon,carcinoma,0,1	KIAA0040	2	1	0			c.A217G						scavenged	.						107.0	90.0	95.0					1																	175129933		692	1591	2283	SO:0001583	missense	9674	exon3			TCTTCTTCTTCTT	D25539		1q24-q25	2012-11-29			ENSG00000235750	ENSG00000235750			28950	protein-coding gene	gene with protein product							Standard	NM_014656		Approved		uc001gkn.3	Q15053	OTTHUMG00000034880	ENST00000423313.1:c.217A>G	1.37:g.175129933T>C	ENSP00000462172:p.Lys73Glu	Somatic	48	1	0.0208333		WXS	Illumina HiSeq	Phase_I	58	7	0.12069	NM_001162895	A8K9H6|Q2NKQ0	Missense_Mutation	SNP	ENST00000423313.1	37																																																																																				.	.	none		0.502	KIAA0040-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000084420.3	NM_014656	
ZNF547	284306	hgsc.bcm.edu	37	19	57889497	57889497	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:57889497A>G	ENST00000282282.3	+	4	1303	c.1153A>G	c.(1153-1155)Aaa>Gaa	p.K385E	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGAATGTGGGAAATTCTTTAG	0.448																																					p.K385E		Atlas-SNP	.											ZNF547,NS,carcinoma,-1,1	ZNF547	45	1	0			c.A1153G						PASS	.						75.0	68.0	70.0					19																	57889497		2203	4300	6503	SO:0001583	missense	284306	exon4			TGTGGGAAATTCT	AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.1153A>G	19.37:g.57889497A>G	ENSP00000282282:p.Lys385Glu	Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	73	20	0.273973	NM_173631	A8K5Z9|Q96NC4	Missense_Mutation	SNP	ENST00000282282.3	37	CCDS33131.1	.	.	.	.	.	.	.	.	.	.	A	15.64	2.893684	0.52121	.	.	ENSG00000152433	ENST00000282282	T	0.60040	0.22	1.81	1.81	0.25067	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.59128	0.2171	M	0.75447	2.3	0.22354	N	0.999175	P	0.50369	0.934	P	0.45660	0.489	T	0.51973	-0.8637	8	.	.	.	.	8.9234	0.35625	1.0:0.0:0.0:0.0	.	385	Q8IVP9	ZN547_HUMAN	E	385	ENSP00000282282:K385E	.	K	+	1	0	ZNF547	62581309	0.987000	0.35691	0.383000	0.26132	0.685000	0.39939	0.230000	0.17852	1.088000	0.41272	0.397000	0.26171	AAA	.	.	none		0.448	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465787.1	NM_173631	
TNN	63923	hgsc.bcm.edu	37	1	175049323	175049323	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:175049323T>C	ENST00000239462.4	+	4	922	c.809T>C	c.(808-810)cTg>cCg	p.L270P		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	270	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GGCCTGCAGCTGCTCAAGAAC	0.607																																					p.L270P		Atlas-SNP	.											.	TNN	297	.	0			c.T809C						PASS	.						49.0	51.0	50.0					1																	175049323		2203	4300	6503	SO:0001583	missense	63923	exon4			TGCAGCTGCTCAA	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.809T>C	1.37:g.175049323T>C	ENSP00000239462:p.Leu270Pro	Somatic	32	0	0		WXS	Illumina HiSeq	Phase_I	40	14	0.35	NM_022093	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.159759	0.78226	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.58940	0.3	5.58	5.58	0.84498	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.146450	0.47455	D	0.000233	T	0.76884	0.4050	M	0.81802	2.56	0.80722	D	1	D;B	0.76494	0.999;0.118	D;B	0.73708	0.981;0.118	T	0.80246	-0.1462	10	0.66056	D	0.02	.	15.4264	0.75055	0.0:0.0:0.0:1.0	.	270;270	B3KXB6;Q9UQP3	.;TENN_HUMAN	P	270	ENSP00000239462:L270P	ENSP00000239462:L270P	L	+	2	0	TNN	173315946	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	3.954000	0.56708	2.119000	0.64992	0.528000	0.53228	CTG	.	.	none		0.607	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
ATOH1	474	hgsc.bcm.edu	37	4	94751127	94751127	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr4:94751127G>A	ENST00000306011.3	+	1	1086	c.1050G>A	c.(1048-1050)tcG>tcA	p.S350S		NM_005172.1	NP_005163.1	Q92858	ATOH1_HUMAN	atonal homolog 1 (Drosophila)	350					auditory receptor cell fate determination (GO:0042668)|auditory receptor cell fate specification (GO:0042667)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|cerebral cortex development (GO:0021987)|inner ear morphogenesis (GO:0042472)|negative regulation of apoptotic process (GO:0043066)|neuron migration (GO:0001764)|positive regulation of auditory receptor cell differentiation (GO:0045609)|positive regulation of neuron differentiation (GO:0045666)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		ACAGTGACTCGGATGAGGCAA	0.547																																					p.S350S		Atlas-SNP	.											.	ATOH1	40	.	0			c.G1050A						PASS	.						53.0	57.0	56.0					4																	94751127		2203	4294	6497	SO:0001819	synonymous_variant	474	exon1			TGACTCGGATGAG	U61148	CCDS3638.1	4q22	2013-05-21			ENSG00000172238	ENSG00000172238		"""Basic helix-loop-helix proteins"""	797	protein-coding gene	gene with protein product		601461				8872459	Standard	NM_005172		Approved	HATH1, MATH-1, Math1, bHLHa14	uc003hta.1	Q92858	OTTHUMG00000130972	ENST00000306011.3:c.1050G>A	4.37:g.94751127G>A		Somatic	74	0	0		WXS	Illumina HiSeq	Phase_I	83	23	0.277108	NM_005172	Q14CT9	Silent	SNP	ENST00000306011.3	37	CCDS3638.1																																																																																			.	.	none		0.547	ATOH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253585.1	NM_005172	
APOA1	335	hgsc.bcm.edu	37	11	116707093	116707093	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr11:116707093A>G	ENST00000236850.4	-	4	600	c.235T>C	c.(235-237)Tcc>Ccc	p.S79P	APOA1_ENST00000375323.1_Missense_Mutation_p.S79P|AP006216.12_ENST00000444200.1_RNA|APOA1_ENST00000359492.2_Missense_Mutation_p.S79P|APOA1_ENST00000375329.2_Missense_Mutation_p.S57P|APOA1_ENST00000375320.1_Missense_Mutation_p.S79P	NM_000039.1	NP_000030.1	P02647	APOA1_HUMAN	apolipoprotein A-I	79	10 X approximate tandem repeats.				adrenal gland development (GO:0030325)|blood coagulation (GO:0007596)|blood vessel endothelial cell migration (GO:0043534)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor signaling pathway (GO:0007186)|glucocorticoid metabolic process (GO:0008211)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|integrin-mediated signaling pathway (GO:0007229)|lipid storage (GO:0019915)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|negative chemotaxis (GO:0050919)|negative regulation of cell adhesion molecule production (GO:0060354)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of lipase activity (GO:0060192)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|organ regeneration (GO:0031100)|peptidyl-methionine modification (GO:0018206)|peripheral nervous system axon regeneration (GO:0014012)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of hydrolase activity (GO:0051345)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transferase activity (GO:0051347)|protein oxidation (GO:0018158)|protein stabilization (GO:0050821)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of protein phosphorylation (GO:0001932)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to nutrient (GO:0007584)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule lumen (GO:0034774)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	apolipoprotein A-I receptor binding (GO:0034191)|apolipoprotein receptor binding (GO:0034190)|beta-amyloid binding (GO:0001540)|chemorepellent activity (GO:0045499)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|enzyme binding (GO:0019899)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor binding (GO:0070653)|identical protein binding (GO:0042802)|lipase inhibitor activity (GO:0055102)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)			cervix(1)|endometrium(1)|lung(4)|prostate(1)|skin(2)	9	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.59e-05)|all cancers(92;0.000162)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		CTGAAGGTGGAGGTCACGCTG	0.612																																					p.S79P		Atlas-SNP	.											.	APOA1	19	.	0			c.T235C						PASS	.						50.0	48.0	48.0					11																	116707093		2201	4292	6493	SO:0001583	missense	335	exon4			AGGTGGAGGTCAC	X02162	CCDS8378.1	11q23-q24	2014-09-17			ENSG00000118137	ENSG00000118137		"""Apolipoproteins"""	600	protein-coding gene	gene with protein product		107680					Standard	NM_000039		Approved		uc001ppv.1	P02647	OTTHUMG00000046112	ENST00000236850.4:c.235T>C	11.37:g.116707093A>G	ENSP00000236850:p.Ser79Pro	Somatic	66	0	0		WXS	Illumina HiSeq	Phase_I	78	32	0.410256	NM_000039	A8K866|Q6LDN9|Q6Q785|Q9UCS8|Q9UCT8	Missense_Mutation	SNP	ENST00000236850.4	37	CCDS8378.1	.	.	.	.	.	.	.	.	.	.	A	13.91	2.378823	0.42207	.	.	ENSG00000118137	ENST00000375320;ENST00000359492;ENST00000375329;ENST00000375323;ENST00000236850	T;T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9;-0.9	5.38	-7.41	0.01392	Apolipoprotein/apolipophorin (1);	0.971554	0.08387	N	0.953551	T	0.58878	0.2153	L	0.55743	1.74	0.09310	N	1	B	0.14805	0.011	B	0.17979	0.02	T	0.51301	-0.8723	10	0.45353	T	0.12	-4.2027	1.3102	0.02096	0.4455:0.194:0.0931:0.2674	.	79	P02647	APOA1_HUMAN	P	79;79;57;79;79	ENSP00000364469:S79P;ENSP00000352471:S79P;ENSP00000364478:S57P;ENSP00000364472:S79P;ENSP00000236850:S79P	ENSP00000236850:S79P	S	-	1	0	APOA1	116212303	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.029000	0.03585	-0.810000	0.04375	-0.379000	0.06801	TCC	.	.	none		0.612	APOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106281.2	NM_000039	
HLA-C	3107	hgsc.bcm.edu	37	6	31239006	31239006	+	Missense_Mutation	SNP	G	G	T	rs76907552		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:31239006G>T	ENST00000376228.5	-	3	477	c.463C>A	c.(463-465)Cgc>Agc	p.R155S	HLA-C_ENST00000383329.3_Missense_Mutation_p.R155S	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	155	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)	p.R155S(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						GTCCAGGAGCGCAGGTCCTCG	0.697																																					p.R155S		Atlas-SNP	.											HLA-C,trunk,malignant_melanoma,0,1	HLA-C	92	1	1	Substitution - Missense(1)	skin(1)	c.C463A						scavenged	.						35.0	27.0	30.0					6																	31239006		2178	4236	6414	SO:0001583	missense	3107	exon3			AGGAGCGCAGGTC	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.463C>A	6.37:g.31239006G>T	ENSP00000365402:p.Arg155Ser	Somatic	112	3	0.0267857		WXS	Illumina HiSeq	Phase_I	161	18	0.111801	NM_002117	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	539|539	0.2467948717948718|0.2467948717948718	144|144	0.2926829268292683|0.2926829268292683	105|105	0.2900552486187845|0.2900552486187845	109|109	0.19055944055944055|0.19055944055944055	181|181	0.23878627968337732|0.23878627968337732	.|.	13.99|13.99	2.401987|2.401987	0.42613|0.42613	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000415537|ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	.|T;T	.|0.00753	.|5.74;5.74	2.81|2.81	0.177|0.177	0.15054|0.15054	.|MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.|1.196610	.|0.06966	.|N	.|0.817182	T|T	0.01287|0.01287	0.0042|0.0042	M|M	0.71206|0.71206	2.165|2.165	0.42157|0.42157	P|P	0.008411999999999975|0.008411999999999975	.|D;B;D;B	.|0.63046	.|0.992;0.016;0.992;0.005	.|D;B;D;B	.|0.85130	.|0.997;0.103;0.997;0.049	T|T	0.46898|0.46898	-0.9158|-0.9158	4|9	.|0.54805	.|T	.|0.06	.|.	5.7525|5.7525	0.18154|0.18154	0.0:0.1715:0.3014:0.5271|0.0:0.1715:0.3014:0.5271	.|.	.|155;155;155;155	.|A2AEA4;A6H578;A2AEA2;P10321	.|.;.;.;1C07_HUMAN	E|S	154|155;155;155;192	.|ENSP00000365402:R155S;ENSP00000372819:R155S	.|ENSP00000365402:R155S	A|R	-|-	2|1	0|0	HLA-C|HLA-C	31346985|31346985	0.000000|0.000000	0.05858|0.05858	0.994000|0.994000	0.49952|0.49952	0.090000|0.090000	0.18270|0.18270	-1.467000|-1.467000	0.02352|0.02352	0.025000|0.025000	0.15241|0.15241	-0.692000|-0.692000	0.03713|0.03713	GCG|CGC	G|0.754;T|0.246	0.246	strong		0.697	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
USH2A	7399	hgsc.bcm.edu	37	1	216251568	216251568	+	Missense_Mutation	SNP	A	A	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:216251568A>C	ENST00000307340.3	-	27	5821	c.5435T>G	c.(5434-5436)aTa>aGa	p.I1812R	RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000442606.1_RNA|RP11-22M7.2_ENST00000445619.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.I1812R|RP11-22M7.2_ENST00000446411.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1812	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACTTGCTGATATGAAAGAGCC	0.438										HNSCC(13;0.011)																											p.I1812R		Atlas-SNP	.											.	USH2A	1168	.	0			c.T5435G						PASS	.						156.0	158.0	158.0					1																	216251568		2203	4300	6503	SO:0001583	missense	7399	exon27			GCTGATATGAAAG	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5435T>G	1.37:g.216251568A>C	ENSP00000305941:p.Ile1812Arg	Somatic	130	0	0		WXS	Illumina HiSeq	Phase_I	114	39	0.342105	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	A	18.27	3.586819	0.66105	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.79141	-1.24;-1.24	5.01	3.88	0.44766	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.468184	0.17640	N	0.167065	D	0.82706	0.5095	M	0.66939	2.045	0.09310	N	1	P	0.47484	0.896	P	0.55455	0.776	T	0.73858	-0.3850	10	0.72032	D	0.01	.	10.3204	0.43762	0.922:0.0:0.078:0.0	.	1812	O75445	USH2A_HUMAN	R	1812	ENSP00000305941:I1812R;ENSP00000355910:I1812R	ENSP00000305941:I1812R	I	-	2	0	USH2A	214318191	0.191000	0.23288	0.001000	0.08648	0.523000	0.34469	4.275000	0.58927	0.772000	0.33382	0.528000	0.53228	ATA	.	.	none		0.438	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
MURC	347273	hgsc.bcm.edu	37	9	103348299	103348299	+	Missense_Mutation	SNP	A	A	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr9:103348299A>T	ENST00000307584.5	+	2	726	c.661A>T	c.(661-663)Att>Ttt	p.I221F		NM_001018116.1	NP_001018126.1	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	221					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Z disc (GO:0030018)				endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)	16		Acute lymphoblastic leukemia(62;0.0461)				AGTGAACAGAATTAGAACTAG	0.478																																					p.I221F		Atlas-SNP	.											.	MURC	43	.	0			c.A661T						PASS	.						110.0	118.0	115.0					9																	103348299		2203	4300	6503	SO:0001583	missense	347273	exon2			AACAGAATTAGAA	BC090888	CCDS35083.1	9q31.1	2014-09-17			ENSG00000170681	ENSG00000170681			33742	protein-coding gene	gene with protein product	"""muscle-restricted coiled-coil protein"""					18508909, 18332105	Standard	NM_001018116		Approved	cavin-4, CAVIN4	uc004bba.3	Q5BKX8	OTTHUMG00000020368	ENST00000307584.5:c.661A>T	9.37:g.103348299A>T	ENSP00000418668:p.Ile221Phe	Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	115	38	0.330435	NM_001018116	B1PRL3|B4DT88	Missense_Mutation	SNP	ENST00000307584.5	37	CCDS35083.1	.	.	.	.	.	.	.	.	.	.	A	15.85	2.955464	0.53293	.	.	ENSG00000170681	ENST00000307584	T	0.61274	0.12	5.27	4.09	0.47781	.	0.186907	0.46758	D	0.000270	T	0.51466	0.1676	L	0.49126	1.545	0.44603	D	0.997578	P	0.41131	0.739	B	0.40066	0.318	T	0.52548	-0.8561	10	0.56958	D	0.05	-8.7658	10.5979	0.45349	0.838:0.162:0.0:0.0	.	221	Q5BKX8	MURC_HUMAN	F	221	ENSP00000418668:I221F	ENSP00000418668:I221F	I	+	1	0	MURC	102388120	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	2.488000	0.45276	0.905000	0.36596	0.459000	0.35465	ATT	.	.	none		0.478	MURC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053419.2	NM_001018116	
RASL12	51285	hgsc.bcm.edu	37	15	65347441	65347441	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr15:65347441G>A	ENST00000220062.4	-	5	873	c.597C>T	c.(595-597)tcC>tcT	p.S199S	RASL12_ENST00000421977.3_Silent_p.S180S|RASL12_ENST00000434605.2_Silent_p.S188S	NM_016563.2	NP_057647.1	Q9NYN1	RASLC_HUMAN	RAS-like, family 12	199					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			lung(1)|ovary(1)|skin(1)|urinary_tract(1)	4						CCCTCTCCTCGGAGATGAAGA	0.662																																					p.S199S		Atlas-SNP	.											.	RASL12	32	.	0			c.C597T						PASS	.						15.0	16.0	16.0					15																	65347441		2200	4298	6498	SO:0001819	synonymous_variant	51285	exon5			CTCCTCGGAGATG	AF233588	CCDS10200.1	15q11.2-q22.33	2014-05-09			ENSG00000103710	ENSG00000103710			30289	protein-coding gene	gene with protein product	"""Ras family member Ris"""					12107412	Standard	NM_016563		Approved	RIS	uc002aoi.1	Q9NYN1	OTTHUMG00000133115	ENST00000220062.4:c.597C>T	15.37:g.65347441G>A		Somatic	33	0	0		WXS	Illumina HiSeq	Phase_I	49	16	0.326531	NM_016563	B2RC29|B4DJW2|B4DU82	Silent	SNP	ENST00000220062.4	37	CCDS10200.1																																																																																			.	.	none		0.662	RASL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256782.2	NM_016563	
CYP2C8	1558	hgsc.bcm.edu	37	10	96802724	96802724	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr10:96802724A>G	ENST00000371270.3	-	7	1166	c.1072T>C	c.(1072-1074)Tac>Cac	p.Y358H	CYP2C8_ENST00000539050.1_Missense_Mutation_p.Y272H|CYP2C8_ENST00000535898.1_Missense_Mutation_p.Y256H	NM_000770.3|NM_001198853.1|NM_001198855.1	NP_000761.3|NP_001185782.1|NP_001185784.1	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 8	358					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|omega-hydroxylase P450 pathway (GO:0097267)|organic acid metabolic process (GO:0006082)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|skin(3)	21		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Abiraterone(DB05812)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Almotriptan(DB00918)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Candesartan(DB00796)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cisapride(DB00604)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Domperidone(DB01184)|Eltrombopag(DB06210)|Enzalutamide(DB08899)|Erlotinib(DB00530)|Estradiol(DB00783)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fluorouracil(DB00544)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Halofantrine(DB01218)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Liotrix(DB01583)|Loperamide(DB00836)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Methadone(DB00333)|Metronidazole(DB00916)|Mirtazapine(DB00370)|Mometasone(DB00764)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Naloxone(DB01183)|Naproxen(DB00788)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Omeprazole(DB00338)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paramethadione(DB00617)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Perphenazine(DB00850)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quinidine(DB00908)|Quinine(DB00468)|Raloxifene(DB00481)|Regorafenib(DB08896)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Salmeterol(DB00938)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Sorafenib(DB00398)|Spironolactone(DB00421)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Tazarotene(DB00799)|Temazepam(DB00231)|Terbinafine(DB00857)|Testosterone(DB00624)|Theophylline(DB00277)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Torasemide(DB00214)|Trametinib(DB08911)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vismodegib(DB08828)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zopiclone(DB01198)	AGGTCACTGTATCTCTGGATC	0.498																																					p.Y358H		Atlas-SNP	.											.	CYP2C8	73	.	0			c.T1072C						PASS	.						273.0	218.0	236.0					10																	96802724		2203	4300	6503	SO:0001583	missense	1558	exon7			CACTGTATCTCTG	M17397	CCDS7438.1, CCDS55721.1, CCDS73166.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138115	ENSG00000138115		"""Cytochrome P450s"""	2622	protein-coding gene	gene with protein product		601129	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 8"""			7841444	Standard	NM_001198853		Approved	CPC8	uc001kkb.3	P10632	OTTHUMG00000018804	ENST00000371270.3:c.1072T>C	10.37:g.96802724A>G	ENSP00000360317:p.Tyr358His	Somatic	111	0	0		WXS	Illumina HiSeq	Phase_I	133	49	0.368421	NM_000770	A8K9N8|B0AZN2|B7Z1F6|Q5VX93|Q8WWB1|Q9UCZ9	Missense_Mutation	SNP	ENST00000371270.3	37	CCDS7438.1	.	.	.	.	.	.	.	.	.	.	A	11.07	1.531632	0.27387	.	.	ENSG00000138115	ENST00000371270;ENST00000535868;ENST00000535898;ENST00000539050	T;T;T	0.69806	-0.43;-0.43;-0.43	4.49	3.32	0.38043	.	0.348041	0.24856	U	0.035053	T	0.58352	0.2116	L	0.31845	0.965	0.25918	N	0.983155	B;P;P;B	0.45594	0.426;0.862;0.554;0.303	B;P;P;B	0.46237	0.282;0.508;0.462;0.329	T	0.53330	-0.8454	10	0.72032	D	0.01	.	8.5378	0.33373	0.8271:0.0:0.0:0.1729	.	272;256;326;358	F5H7Q9;B7Z1F6;B7Z8S1;P10632	.;.;.;CP2C8_HUMAN	H	358;325;256;272	ENSP00000360317:Y358H;ENSP00000445062:Y256H;ENSP00000442343:Y272H	ENSP00000360317:Y358H	Y	-	1	0	CYP2C8	96792714	1.000000	0.71417	0.923000	0.36655	0.130000	0.20726	4.231000	0.58639	0.725000	0.32318	0.477000	0.44152	TAC	.	.	none		0.498	CYP2C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049499.2	NM_000770	
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274311	39274311	+	Missense_Mutation	SNP	T	T	C	rs425755		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr17:39274311T>C	ENST00000391413.2	-	1	295	c.257A>G	c.(256-258)aAg>aGg	p.K86R		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	86	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.K86R(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCACTGGGGCTTGCAGCAGCT	0.657																																					p.K86R		Atlas-SNP	.											KRTAP4-11,rectum,carcinoma,0,5	KRTAP4-11	94	5	1	Substitution - Missense(1)	endometrium(1)	c.A257G						PASS	.																																			SO:0001583	missense	653240	exon1			TGGGGCTTGCAGC	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.257A>G	17.37:g.39274311T>C	ENSP00000375232:p.Lys86Arg	Somatic	44	0	0		WXS	Illumina HiSeq	Phase_I	52	13	0.25	NM_033059	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	0.090	-1.168142	0.01660	.	.	ENSG00000212721	ENST00000391413	T	0.00591	6.35	4.25	-7.14	0.01527	.	.	.	.	.	T	0.00178	0.0005	N	0.01109	-1.01	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41215	-0.9521	8	0.10111	T	0.7	.	1.4913	0.02457	0.232:0.3447:0.0991:0.3242	rs425755	86	Q9BYQ6	KR411_HUMAN	R	86	ENSP00000375232:K86R	ENSP00000375232:K86R	K	-	2	0	KRTAP4-11	36527837	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.427000	0.06999	-1.427000	0.01992	-2.307000	0.00257	AAG	.	.	weak		0.657	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KDM4C	23081	hgsc.bcm.edu	37	9	6986601	6986601	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr9:6986601G>T	ENST00000381309.3	+	11	2177	c.1612G>T	c.(1612-1614)Ggc>Tgc	p.G538C	KDM4C_ENST00000543771.1_Missense_Mutation_p.G538C|KDM4C_ENST00000536108.1_Missense_Mutation_p.G357C|KDM4C_ENST00000381306.3_Missense_Mutation_p.G538C|KDM4C_ENST00000535193.1_Missense_Mutation_p.G560C|KDM4C_ENST00000428870.2_Missense_Mutation_p.G225C|KDM4C_ENST00000442236.2_Intron	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	538					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						CCATGGGAATGGCCTTGAACC	0.478																																					p.G560C		Atlas-SNP	.											KDM4C_ENST00000381306,right_upper_lobe,carcinoma,-2,2	KDM4C	186	2	0			c.G1678T						scavenged	.						89.0	80.0	83.0					9																	6986601		2203	4300	6503	SO:0001583	missense	23081	exon11			GGGAATGGCCTTG	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.1612G>T	9.37:g.6986601G>T	ENSP00000370710:p.Gly538Cys	Somatic	120	0	0		WXS	Illumina HiSeq	Phase_I	141	2	0.0141844	NM_001146696	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	ENST00000381309.3	37	CCDS6471.1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.086548	0.55861	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306;ENST00000536108;ENST00000428870	T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83	5.3	1.31	0.21738	.	2.090350	0.01795	N	0.032526	T	0.61476	0.2350	L	0.53249	1.67	0.27106	N	0.962497	D;D;B;D	0.69078	0.997;0.988;0.005;0.973	P;P;B;P	0.58873	0.847;0.8;0.006;0.724	T	0.43491	-0.9388	10	0.59425	D	0.04	-0.0306	9.2199	0.37370	0.4198:0.0:0.5802:0.0	.	538;560;538;538	F5H347;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;KDM4C_HUMAN;.	C	560;538;538;538;357;225	ENSP00000442382:G560C;ENSP00000445427:G538C;ENSP00000370710:G538C;ENSP00000370707:G538C;ENSP00000440656:G357C;ENSP00000405739:G225C	ENSP00000370707:G538C	G	+	1	0	KDM4C	6976601	0.977000	0.34250	0.142000	0.22268	0.835000	0.47333	0.803000	0.27083	0.068000	0.16574	0.655000	0.94253	GGC	.	.	none		0.478	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061	
LTN1	26046	hgsc.bcm.edu	37	21	30365143	30365143	+	5'UTR	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr21:30365143G>A	ENST00000361371.5	-	0	63				LTN1_ENST00000389194.2_Missense_Mutation_p.T41I|LTN1_ENST00000389195.2_Missense_Mutation_p.T41I			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1						protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						GGTTGCAGCTGTACTCTGAGC	0.637																																					p.T41I		Atlas-SNP	.											.	LTN1	141	.	0			c.C122T						PASS	.						71.0	56.0	61.0					21																	30365143		2203	4300	6503	SO:0001623	5_prime_UTR_variant	26046	exon1			GCAGCTGTACTCT	AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.-17C>T	21.37:g.30365143G>A		Somatic	85	0	0		WXS	Illumina HiSeq	Phase_I	84	27	0.321429	NM_015565	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	ENST00000361371.5	37		.	.	.	.	.	.	.	.	.	.	G	11.79	1.744234	0.30865	.	.	ENSG00000198862	ENST00000389194;ENST00000389195	T;T	0.23950	2.24;1.88	4.49	-1.12	0.09808	.	.	.	.	.	T	0.11324	0.0276	N	0.14661	0.345	0.20196	N	0.999928	.	.	.	.	.	.	T	0.29852	-0.9998	7	0.26408	T	0.33	.	2.0606	0.03591	0.314:0.1198:0.4439:0.1224	.	.	.	.	I	41	ENSP00000373846:T41I;ENSP00000373847:T41I	ENSP00000373846:T41I	T	-	2	0	LTN1	29287014	0.000000	0.05858	0.004000	0.12327	0.011000	0.07611	-0.194000	0.09559	-0.140000	0.11394	-0.345000	0.07892	ACA	.	.	none		0.637	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
CDC27	996	hgsc.bcm.edu	37	17	45214527	45214527	+	Missense_Mutation	SNP	T	T	C	rs62075618|rs200720095	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr17:45214527T>C	ENST00000066544.3	-	14	1997	c.1904A>G	c.(1903-1905)tAt>tGt	p.Y635C	CDC27_ENST00000531206.1_Missense_Mutation_p.Y641C|CDC27_ENST00000446365.2_Missense_Mutation_p.Y574C|CDC27_ENST00000527547.1_Missense_Mutation_p.Y634C	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	635					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						CCATGCATTATAATGTCTAGG	0.338																																					p.Y641C		Atlas-SNP	.											CDC27_ENST00000531206,colon,carcinoma,-1,2	CDC27	337	2	0			c.A1922G						scavenged	.						35.0	35.0	35.0					17																	45214527		2203	4300	6503	SO:0001583	missense	996	exon14			GCATTATAATGTC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1904A>G	17.37:g.45214527T>C	ENSP00000066544:p.Tyr635Cys	Somatic	20	2	0.1		WXS	Illumina HiSeq	Phase_I	30	5	0.166667	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.004463	0.93287	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.59502	0.26;0.26;0.26;0.26	5.98	5.98	0.97165	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.80798	0.4692	H	0.96943	3.91	0.09310	P	0.999999999633698	D;D;D;D	0.59357	0.985;0.982;0.982;0.969	P;P;P;P	0.56042	0.79;0.753;0.753;0.727	D	0.88807	0.3289	9	0.87932	D	0	-24.5847	14.4087	0.67101	0.0:0.0:0.0:1.0	rs62075618	574;634;641;635	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	C	635;641;574;634	ENSP00000066544:Y635C;ENSP00000434614:Y641C;ENSP00000392802:Y574C;ENSP00000437339:Y634C	ENSP00000066544:Y635C	Y	-	2	0	CDC27	42569526	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.308000	0.72820	2.293000	0.77203	0.477000	0.44152	TAT	T|0.500;C|0.500	0.500	strong		0.338	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
ADAM22	53616	hgsc.bcm.edu	37	7	87765308	87765308	+	Silent	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr7:87765308C>T	ENST00000265727.7	+	14	1261	c.1182C>T	c.(1180-1182)tgC>tgT	p.C394C	ADAM22_ENST00000398204.4_Silent_p.C394C|ADAM22_ENST00000315984.7_Silent_p.C394C|ADAM22_ENST00000398201.4_Silent_p.C394C|ADAM22_ENST00000398209.3_Silent_p.C394C			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	394	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			AATGTAAATGCGAGGACACGT	0.383																																					p.C394C		Atlas-SNP	.											.	ADAM22	280	.	0			c.C1182T						PASS	.						177.0	167.0	170.0					7																	87765308		1890	4107	5997	SO:0001819	synonymous_variant	53616	exon14			TAAATGCGAGGAC	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.1182C>T	7.37:g.87765308C>T		Somatic	79	0	0		WXS	Illumina HiSeq	Phase_I	72	19	0.263889	NM_021722	O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Silent	SNP	ENST00000265727.7	37	CCDS47637.1																																																																																			.	.	none		0.383	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723	
MAGEC1	9947	hgsc.bcm.edu	37	X	140995449	140995449	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chrX:140995449G>A	ENST00000285879.4	+	4	2545	c.2259G>A	c.(2257-2259)ttG>ttA	p.L753L	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	753										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CCACTTCTTTGAGTCTTCCCC	0.552										HNSCC(15;0.026)																											p.L753L		Atlas-SNP	.											.	MAGEC1	317	.	0			c.G2259A						PASS	.						133.0	145.0	141.0					X																	140995449		2203	4300	6503	SO:0001819	synonymous_variant	9947	exon4			TTCTTTGAGTCTT	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2259G>A	X.37:g.140995449G>A		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	49	17	0.346939	NM_005462	A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	37	CCDS35417.1																																																																																			.	.	none		0.552	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
HLA-C	3107	hgsc.bcm.edu	37	6	31238983	31238983	+	Silent	SNP	G	G	C	rs200155513|rs2308585	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:31238983G>C	ENST00000376228.5	-	3	500	c.486C>G	c.(484-486)acC>acG	p.T162T	HLA-C_ENST00000383329.3_Silent_p.T162T	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	162	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						TCTGAGCCGCGGTGTCCGCGG	0.692													N|||	2273	0.453874	0.4728	0.4424	5008	,	,		10880	0.4563		0.4056	False		,,,				2504	0.4836				p.T162T		Atlas-SNP	.											HLA-C_ENST00000383329,NS,carcinoma,0,2	HLA-C	92	2	0			c.C486G						scavenged	.						30.0	22.0	25.0					6																	31238983		2142	4169	6311	SO:0001819	synonymous_variant	3107	exon3			AGCCGCGGTGTCC	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.486C>G	6.37:g.31238983G>C		Somatic	121	3	0.0247934		WXS	Illumina HiSeq	Phase_I	156	17	0.108974	NM_002117	O02864|O02958|Q29643|Q9MY30	Silent	SNP	ENST00000376228.5	37	CCDS34393.1	1058	0.48443223443223443	236	0.4796747967479675	198	0.5469613259668509	283	0.49475524475524474	341	0.449868073878628	.	5.989	0.366349	0.11352	.	.	ENSG00000204525	ENST00000415537	.	.	.	2.81	-2.02	0.07388	.	.	.	.	.	T	0.42765	0.1217	.	.	.	0.58432	P	2.9999999999752447E-6	.	.	.	.	.	.	T	0.44605	-0.9317	3	.	.	.	.	15.0314	0.71710	0.0:0.2262:0.7738:0.0	rs2308585;rs9264657	.	.	.	G	162	.	.	R	-	1	0	HLA-C	31346962	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-3.817000	0.00359	-0.877000	0.04012	-0.676000	0.03789	CGC	G|0.514;C|0.486	0.486	strong		0.692	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
MUC4	4585	hgsc.bcm.edu	37	3	195515026	195515026	+	Missense_Mutation	SNP	G	G	C	rs200763050		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:195515026G>C	ENST00000463781.3	-	2	3884	c.3425C>G	c.(3424-3426)aCt>aGt	p.T1142S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T1142S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	616					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T1142S(3)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAGTGTCGGTGAC	0.567																																					p.T1142S		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,4	MUC4	1505	4	3	Substitution - Missense(3)	skin(2)|kidney(1)	c.C3425G						PASS	.						11.0	7.0	8.0					3																	195515026		675	1482	2157	SO:0001583	missense	4585	exon2			GAGGAAGTGTCGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3425C>G	3.37:g.195515026G>C	ENSP00000417498:p.Thr1142Ser	Somatic	90	0	0		WXS	Illumina HiSeq	Phase_I	87	5	0.0574713	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	3.313	-0.140308	0.06669	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34667	1.35;1.35	0.545	-0.879	0.10613	.	.	.	.	.	T	0.31420	0.0796	N	0.14661	0.345	0.09310	N	1	D	0.60160	0.987	D	0.63488	0.915	T	0.16394	-1.0404	8	.	.	.	.	3.9497	0.09363	0.5686:0.0:0.4314:0.0	.	1142	E7ESK3	.	S	1142	ENSP00000417498:T1142S;ENSP00000420243:T1142S	.	T	-	2	0	MUC4	196999421	0.002000	0.14202	0.000000	0.03702	0.066000	0.16364	0.481000	0.22260	-0.332000	0.08489	0.064000	0.15345	ACT	G|0.998;C|0.002	0.002	weak		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TUBA3C	7278	hgsc.bcm.edu	37	13	19751301	19751301	+	Silent	SNP	C	C	T	rs140548354		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr13:19751301C>T	ENST00000400113.3	-	4	926	c.822G>A	c.(820-822)ccG>ccA	p.P274P		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	274					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CTGAGATGACCGGGGCGTAGG	0.607																																					p.P274P		Atlas-SNP	.											TUBA3C,bladder,carcinoma,-2,1	TUBA3C	166	1	0			c.G822A						scavenged	.						123.0	114.0	117.0					13																	19751301		2203	4300	6503	SO:0001819	synonymous_variant	7278	exon4			GATGACCGGGGCG	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.822G>A	13.37:g.19751301C>T		Somatic	112	0	0		WXS	Illumina HiSeq	Phase_I	124	6	0.0483871	NM_006001	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																			C|0.999;T|0.001	0.001	weak		0.607	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
MUC4	4585	hgsc.bcm.edu	37	3	195505742	195505742	+	Missense_Mutation	SNP	G	G	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:195505742G>C	ENST00000463781.3	-	2	13168	c.12709C>G	c.(12709-12711)Cac>Gac	p.H4237D	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H4237D|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	994					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H4237D(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGCGTGACCTGTGGAT	0.587																																					p.H4237D		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	1	Substitution - Missense(1)	lung(1)	c.C12709G						scavenged	.						49.0	50.0	49.0					3																	195505742		2110	4203	6313	SO:0001583	missense	4585	exon2			TGGCGTGACCTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12709C>G	3.37:g.195505742G>C	ENSP00000417498:p.His4237Asp	Somatic	79	3	0.0379747		WXS	Illumina HiSeq	Phase_I	100	6	0.06	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	2.170	-0.390211	0.04932	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.30448	1.55;1.53	2.31	-0.661	0.11417	.	.	.	.	.	T	0.21841	0.0526	L	0.38175	1.15	0.09310	N	1	P;P	0.47604	0.797;0.898	B;B	0.43623	0.343;0.425	T	0.13019	-1.0525	8	.	.	.	.	4.9563	0.14041	0.5176:0.0:0.4824:0.0	.	4109;994	E7ESK3;Q99102	.;MUC4_HUMAN	D	4237;4237;963	ENSP00000417498:H4237D;ENSP00000420243:H4237D	.	H	-	1	0	MUC4	196990521	0.025000	0.19082	0.033000	0.17914	0.009000	0.06853	1.101000	0.31037	-0.196000	0.10366	-0.213000	0.12676	CAC	.	.	none		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NUDT5	11164	hgsc.bcm.edu	37	10	12215729	12215729	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr10:12215729C>T	ENST00000491614.1	-	6	768	c.373G>A	c.(373-375)Gaa>Aaa	p.E125K	NUDT5_ENST00000378940.3_Missense_Mutation_p.E125K|NUDT5_ENST00000378952.3_5'UTR|NUDT5_ENST00000378927.3_Missense_Mutation_p.E125K|NUDT5_ENST00000378937.3_Missense_Mutation_p.E138K|NUDT5_ENST00000537776.1_Missense_Mutation_p.E125K			Q9UKK9	NUDT5_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 5	125	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				D-ribose catabolic process (GO:0019303)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|ribonucleoside diphosphate catabolic process (GO:0009191)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)|magnesium ion binding (GO:0000287)|nucleoside-diphosphatase activity (GO:0017110)|snoRNA binding (GO:0030515)			breast(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)	8		Renal(717;0.228)				GGAGAACATTCGGCAATGTCC	0.463																																					p.E125K		Atlas-SNP	.											.	NUDT5	10	.	0			c.G373A						PASS	.						180.0	176.0	178.0					10																	12215729		2203	4300	6503	SO:0001583	missense	11164	exon6			AACATTCGGCAAT	AF155832	CCDS7089.1	10p14	2008-05-14			ENSG00000165609	ENSG00000165609		"""Nudix motif containing"""	8052	protein-coding gene	gene with protein product		609230				10373642	Standard	NM_014142		Approved	hYSAH1, YSA1H	uc001ilj.3	Q9UKK9	OTTHUMG00000017682	ENST00000491614.1:c.373G>A	10.37:g.12215729C>T	ENSP00000419628:p.Glu125Lys	Somatic	77	0	0		WXS	Illumina HiSeq	Phase_I	60	21	0.35	NM_014142	A8K516|Q6IAG0|Q9UH49	Missense_Mutation	SNP	ENST00000491614.1	37	CCDS7089.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.279041	0.80692	.	.	ENSG00000165609	ENST00000491614;ENST00000378929;ENST00000378937;ENST00000537776;ENST00000378940;ENST00000378927	T;T;T;T;T	0.07800	3.16;3.16;3.16;3.16;3.16	5.76	5.76	0.90799	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.047168	0.85682	D	0.000000	T	0.18002	0.0432	L	0.28776	0.89	0.58432	D	0.999999	D;D	0.76494	0.999;0.998	P;P	0.62491	0.903;0.707	T	0.01557	-1.1325	10	0.28530	T	0.3	-33.9397	20.3242	0.98691	0.0:1.0:0.0:0.0	.	125;125	A6NCQ0;Q9UKK9	.;NUDT5_HUMAN	K	125;125;138;125;125;125	ENSP00000419628:E125K;ENSP00000368219:E138K;ENSP00000445116:E125K;ENSP00000368222:E125K;ENSP00000368209:E125K	ENSP00000368209:E125K	E	-	1	0	NUDT5	12255735	1.000000	0.71417	0.984000	0.44739	0.547000	0.35210	6.507000	0.73717	2.882000	0.98803	0.655000	0.94253	GAA	.	.	none		0.463	NUDT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046811.1		
ZWINT	11130	hgsc.bcm.edu	37	10	58120984	58120984	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr10:58120984T>C	ENST00000373944.3	-	1	52	c.14A>G	c.(13-15)gAg>gGg	p.E5G	ZWINT_ENST00000361148.6_Missense_Mutation_p.E5G|ZWINT_ENST00000460654.1_5'Flank|ZWINT_ENST00000395405.1_Missense_Mutation_p.E5G|ZWINT_ENST00000318387.2_5'Flank			O95229	ZWINT_HUMAN	ZW10 interacting kinetochore protein	5					establishment of localization in cell (GO:0051649)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|kinetochore (GO:0000776)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)	20						CGCCTCTGTCTCCGCTGCCTC	0.587																																					p.E5G		Atlas-SNP	.											.	ZWINT	39	.	0			c.A14G						PASS	.						37.0	35.0	36.0					10																	58120984		2203	4300	6503	SO:0001583	missense	11130	exon1			TCTGTCTCCGCTG	AF067656	CCDS7249.1, CCDS31205.1	10q21-q22	2013-05-01	2013-05-01		ENSG00000122952	ENSG00000122952			13195	protein-coding gene	gene with protein product		609177	"""ZW10 interactor"""				Standard	XM_005269463		Approved	KNTC2AP	uc001jka.1	O95229	OTTHUMG00000018261	ENST00000373944.3:c.14A>G	10.37:g.58120984T>C	ENSP00000363055:p.Glu5Gly	Somatic	26	0	0		WXS	Illumina HiSeq	Phase_I	27	16	0.592593	NM_007057	A6NNV6|Q0D2I3|Q9BWD0	Missense_Mutation	SNP	ENST00000373944.3	37	CCDS7249.1	.	.	.	.	.	.	.	.	.	.	T	11.77	1.737651	0.30774	.	.	ENSG00000122952	ENST00000373944;ENST00000395405;ENST00000373940;ENST00000361148	T;T;T	0.38401	1.14;1.14;1.17	4.03	-2.36	0.06663	.	0.931407	0.08897	N	0.877771	T	0.25754	0.0627	L	0.44542	1.39	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.002	T	0.27123	-1.0083	10	0.38643	T	0.18	0.0641	5.5396	0.17031	0.0:0.4279:0.1986:0.3735	.	5;5	A6NNV6;O95229	.;ZWINT_HUMAN	G	5	ENSP00000363055:E5G;ENSP00000378801:E5G;ENSP00000354921:E5G	ENSP00000354921:E5G	E	-	2	0	ZWINT	57790990	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.057000	0.14279	-0.452000	0.07087	-0.256000	0.11100	GAG	.	.	none		0.587	ZWINT-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048132.1		
MYH13	8735	hgsc.bcm.edu	37	17	10236473	10236473	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr17:10236473G>A	ENST00000418404.3	-	18	2255	c.2092C>T	c.(2092-2094)Cgc>Tgc	p.R698C	RP11-401O9.3_ENST00000577743.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.R698C			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	698	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CCGTTACAGCGCAGCTGGTGC	0.577																																					p.R698C		Atlas-SNP	.											MYH13_ENST00000252172,NS,carcinoma,0,2	MYH13	533	2	0			c.C2092T						scavenged	.						28.0	33.0	31.0					17																	10236473		1927	3907	5834	SO:0001583	missense	8735	exon19			TACAGCGCAGCTG	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.2092C>T	17.37:g.10236473G>A	ENSP00000404570:p.Arg698Cys	Somatic	50	3	0.06		WXS	Illumina HiSeq	Phase_I	53	20	0.377358	NM_003802	O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.157304	0.78114	.	.	ENSG00000006788	ENST00000252172;ENST00000418404	D	0.88896	-2.44	4.21	4.21	0.49690	Myosin head, motor domain (2);	.	.	.	.	D	0.96953	0.9005	H	0.99357	4.53	0.53688	D	0.999977	D	0.69078	0.997	D	0.70935	0.971	D	0.99016	1.0816	9	0.87932	D	0	.	17.1181	0.86694	0.0:0.0:1.0:0.0	.	698	Q9UKX3	MYH13_HUMAN	C	698;373	ENSP00000252172:R698C	ENSP00000252172:R698C	R	-	1	0	MYH13	10177198	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	1.219000	0.32479	2.333000	0.79357	0.561000	0.74099	CGC	.	.	none		0.577	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
FRG2B	441581	hgsc.bcm.edu	37	10	135438933	135438933	+	Silent	SNP	C	C	T	rs200793608		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr10:135438933C>T	ENST00000425520.1	-	4	559	c.507G>A	c.(505-507)ccG>ccA	p.P169P	FRG2B_ENST00000443774.1_Silent_p.P170P	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	169						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TTCGAATTGACGGTGTTTGGA	0.552																																					p.P169P		Atlas-SNP	.											FRG2B,colon,carcinoma,-1,1	FRG2B	47	1	0			c.G507A						scavenged	.						126.0	151.0	143.0					10																	135438933		2193	4291	6484	SO:0001819	synonymous_variant	441581	exon4			AATTGACGGTGTT	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.507G>A	10.37:g.135438933C>T		Somatic	317	3	0.00946372		WXS	Illumina HiSeq	Phase_I	310	6	0.0193548	NM_001080998	Q5VSQ1	Silent	SNP	ENST00000425520.1	37	CCDS44502.1																																																																																			C|0.996;T|0.004	0.004	weak		0.552	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
XIRP1	165904	hgsc.bcm.edu	37	3	39230658	39230658	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:39230658G>A	ENST00000340369.3	-	2	507	c.279C>T	c.(277-279)tgC>tgT	p.C93C	XIRP1_ENST00000396251.1_Silent_p.C93C|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	93					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TCCAGCGCATGCACTGAACGT	0.607																																					p.C93C		Atlas-SNP	.											.	XIRP1	173	.	0			c.C279T						PASS	.						72.0	70.0	71.0					3																	39230658		2203	4300	6503	SO:0001819	synonymous_variant	165904	exon2			GCGCATGCACTGA	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.279C>T	3.37:g.39230658G>A		Somatic	63	0	0		WXS	Illumina HiSeq	Phase_I	63	6	0.0952381	NM_001198621	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Silent	SNP	ENST00000340369.3	37	CCDS2683.1																																																																																			.	.	none		0.607	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
FAAH2	158584	hgsc.bcm.edu	37	X	57515299	57515299	+	Silent	SNP	G	G	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chrX:57515299G>T	ENST00000374900.4	+	11	1653	c.1533G>T	c.(1531-1533)ctG>ctT	p.L511L	FAAH2_ENST00000491179.1_3'UTR	NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	511						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						ATGATCATCTGACCCTGGCTG	0.527										HNSCC(52;0.14)																											p.L511L		Atlas-SNP	.											.	FAAH2	66	.	0			c.G1533T						PASS	.						85.0	74.0	78.0					X																	57515299		2203	4300	6503	SO:0001819	synonymous_variant	158584	exon11			TCATCTGACCCTG	AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.1533G>T	X.37:g.57515299G>T		Somatic	131	0	0		WXS	Illumina HiSeq	Phase_I	130	34	0.261538	NM_174912	Q86VT2|Q96N98	Silent	SNP	ENST00000374900.4	37	CCDS14375.1																																																																																			.	.	none		0.527	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056919.1	NM_174912	
PSG2	5670	hgsc.bcm.edu	37	19	43585253	43585253	+	Silent	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:43585253C>T	ENST00000406487.1	-	2	308	c.210G>A	c.(208-210)ggG>ggA	p.G70G	PSG2_ENST00000491995.1_5'Flank	NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	70	Ig-like V-type.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.G70G(2)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				CCCTGATTTGCCCTTTGTACC	0.433																																					p.G70G		Atlas-SNP	.											PSG2,NS,carcinoma,0,2	PSG2	84	2	2	Substitution - coding silent(2)	prostate(2)	c.G210A						scavenged	.						92.0	96.0	94.0					19																	43585253		2201	4285	6486	SO:0001819	synonymous_variant	5670	exon2			GATTTGCCCTTTG		CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.210G>A	19.37:g.43585253C>T		Somatic	207	2	0.00966184		WXS	Illumina HiSeq	Phase_I	180	3	0.0166667	NM_031246	Q8TCD9|Q9UEA4|Q9UQ78	Silent	SNP	ENST00000406487.1	37	CCDS12616.1																																																																																			.	.	none		0.433	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246	
STARD13	90627	hgsc.bcm.edu	37	13	33684064	33684064	+	Missense_Mutation	SNP	T	T	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr13:33684064T>A	ENST00000336934.5	-	12	3109	c.2993A>T	c.(2992-2994)cAg>cTg	p.Q998L	STARD13_ENST00000399365.3_Missense_Mutation_p.Q880L|STARD13_ENST00000255486.4_Missense_Mutation_p.Q990L	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	998	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		CAGCACATACTGGTAGATCTC	0.527											OREG0022359	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q998L		Atlas-SNP	.											.	STARD13	100	.	0			c.A2993T						PASS	.						233.0	186.0	202.0					13																	33684064		2203	4300	6503	SO:0001583	missense	90627	exon12			ACATACTGGTAGA	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.2993A>T	13.37:g.33684064T>A	ENSP00000338785:p.Gln998Leu	Somatic	81	0	0	841	WXS	Illumina HiSeq	Phase_I	81	32	0.395062	NM_178006	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	ENST00000336934.5	37	CCDS9348.1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.812965	0.70912	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934	T;T;T	0.29397	1.57;1.57;1.57	5.86	5.86	0.93980	Lipid-binding START (3);START-like domain (1);	0.053876	0.85682	D	0.000000	T	0.48677	0.1513	M	0.84683	2.71	0.80722	D	1	B;B;B	0.32653	0.107;0.379;0.215	B;B;B	0.40901	0.11;0.343;0.139	T	0.54070	-0.8348	10	0.87932	D	0	.	16.255	0.82510	0.0:0.0:0.0:1.0	.	963;998;990	Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;STA13_HUMAN;.	L	880;990;998	ENSP00000382300:Q880L;ENSP00000255486:Q990L;ENSP00000338785:Q998L	ENSP00000255486:Q990L	Q	-	2	0	STARD13	32582064	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	7.950000	0.87804	2.240000	0.73641	0.533000	0.62120	CAG	.	.	none		0.527	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276118.2	NM_001243466	
HES3	390992	hgsc.bcm.edu	37	1	6305292	6305292	+	Missense_Mutation	SNP	C	C	A	rs61760836	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:6305292C>A	ENST00000377898.3	+	4	351	c.286C>A	c.(286-288)Ccc>Acc	p.P96T		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	96	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CCCCCTGGTGCCCGAGAGCGC	0.751													C|||	2794	0.557907	0.3079	0.755	5008	,	,		7447	0.5615		0.6849	False		,,,				2504	0.6217				p.P96T		Atlas-SNP	.											.	HES3	3	.	0			c.C286A						PASS	.	C	THR/PRO	1430,1518		391,648,435	2.0	3.0	2.0		286	2.4	0.2	1	dbSNP_129	2	4911,1731		1926,1059,336	no	missense	HES3	NM_001024598.3	38	2317,1707,771	AA,AC,CC		26.0614,48.5075,33.879	benign	96/187	6305292	6341,3249	1474	3321	4795	SO:0001583	missense	390992	exon4			CTGGTGCCCGAGA		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.286C>A	1.37:g.6305292C>A	ENSP00000367130:p.Pro96Thr	Somatic	2	0	0		WXS	Illumina HiSeq	Phase_I	4	4	1	NM_001024598	Q5TGS0	Missense_Mutation	SNP	ENST00000377898.3	37	CCDS41238.1	1241	0.5682234432234432	158	0.32113821138211385	254	0.7016574585635359	313	0.5472027972027972	516	0.6807387862796834	C	2.270	-0.367136	0.05069	0.485075	0.739386	ENSG00000173673	ENST00000377898	T	0.29397	1.57	3.31	2.4	0.29515	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.22003	0.063	B	0.17098	0.017	T	0.30765	-0.9967	8	0.11794	T	0.64	-26.1056	6.4315	0.21798	0.0:0.8639:0.0:0.1361	rs61760836	96	Q5TGS1	HES3_HUMAN	T	96	ENSP00000367130:P96T	ENSP00000367130:P96T	P	+	1	0	HES3	6227879	0.724000	0.28038	0.207000	0.23584	0.040000	0.13550	1.220000	0.32491	0.982000	0.38575	0.289000	0.19496	CCC	C|0.430;A|0.570	0.570	strong		0.751	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
MARCH1	55016	hgsc.bcm.edu	37	4	164466777	164466777	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr4:164466777G>A	ENST00000503008.1	-	7	1518	c.542C>T	c.(541-543)gCg>gTg	p.A181V	MARCH1_ENST00000274056.7_Missense_Mutation_p.A181V|MARCH1_ENST00000339875.5_Missense_Mutation_p.A164V|MARCH1_ENST00000514618.1_Missense_Mutation_p.A437V	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase	181					antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A164E(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GATTTCCTCCGCTGTCCGGTC	0.433																																					p.A181V		Atlas-SNP	.											MARCH1,NS,carcinoma,0,1	MARCH1	83	1	1	Substitution - Missense(1)	lung(1)	c.C542T						scavenged	.						233.0	178.0	196.0					4																	164466777		2203	4300	6503	SO:0001583	missense	55016	exon7			TCCTCCGCTGTCC	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.542C>T	4.37:g.164466777G>A	ENSP00000427223:p.Ala181Val	Somatic	119	1	0.00840336		WXS	Illumina HiSeq	Phase_I	163	2	0.0122699	NM_001166373	D3DP29|Q9NWR0	Missense_Mutation	SNP	ENST00000503008.1	37	CCDS54814.1	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681862	0.68042	.	.	ENSG00000145416	ENST00000274056;ENST00000503008;ENST00000514618;ENST00000339875	T;T;T;T	0.36340	1.68;1.68;1.26;1.3	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000002	T	0.38214	0.1032	L	0.60455	1.87	0.80722	D	1	P;P	0.49635	0.85;0.926	B;B	0.42282	0.142;0.382	T	0.21211	-1.0252	10	0.22706	T	0.39	.	18.346	0.90322	0.0:0.0:1.0:0.0	.	181;164	Q8TCQ1;Q8TCQ1-2	MARH1_HUMAN;.	V	181;181;437;164	ENSP00000274056:A181V;ENSP00000427223:A181V;ENSP00000421322:A437V;ENSP00000345676:A164V	ENSP00000274056:A181V	A	-	2	0	MARCH1	164686227	1.000000	0.71417	0.210000	0.23637	0.634000	0.38068	9.476000	0.97823	2.331000	0.79229	0.655000	0.94253	GCG	.	.	none		0.433	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923	
PAK2	5062	hgsc.bcm.edu	37	3	196509522	196509522	+	Missense_Mutation	SNP	C	C	G	rs67093638		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:196509522C>G	ENST00000327134.3	+	2	327	c.5C>G	c.(4-6)tCt>tGt	p.S2C	RNU6-42P_ENST00000384165.1_RNA	NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	2					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)	p.S2C(2)		breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		TGAATCATGTCTGATAACGGA	0.408																																					p.S2C		Atlas-SNP	.											PAK2_ENST00000327134,NS,carcinoma,0,4	PAK2	113	4	2	Substitution - Missense(2)	prostate(2)	c.C5G						scavenged	.						81.0	87.0	85.0					3																	196509522		2203	4300	6503	SO:0001583	missense	5062	exon2			TCATGTCTGATAA	U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.5C>G	3.37:g.196509522C>G	ENSP00000314067:p.Ser2Cys	Somatic	220	1	0.00454545		WXS	Illumina HiSeq	Phase_I	220	5	0.0227273	NM_002577	Q13154|Q6ISC3	Missense_Mutation	SNP	ENST00000327134.3	37	CCDS3321.1	42	0.019230769230769232	6	0.012195121951219513	0	0.0	7	0.012237762237762238	29	0.03825857519788918	C	14.90	2.672409	0.47781	.	.	ENSG00000180370	ENST00000327134	T	0.70631	-0.5	5.21	5.21	0.72293	.	0.055816	0.64402	D	0.000001	T	0.30417	0.0764	N	0.25426	0.745	0.54753	D	0.999985	B	0.15141	0.012	B	0.20577	0.03	T	0.51284	-0.8725	10	0.62326	D	0.03	.	18.756	0.91833	0.0:1.0:0.0:0.0	.	2	Q13177	PAK2_HUMAN	C	2	ENSP00000314067:S2C	ENSP00000314067:S2C	S	+	2	0	PAK2	197993919	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.961000	0.49168	2.456000	0.83038	0.655000	0.94253	TCT	C|0.986;G|0.014	0.014	strong		0.408	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
TMEM177	80775	hgsc.bcm.edu	37	2	120438454	120438454	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr2:120438454G>A	ENST00000424086.1	+	2	498	c.25G>A	c.(25-27)Gca>Aca	p.A9T	TMEM177_ENST00000409951.1_Missense_Mutation_p.A9T|TMEM177_ENST00000496203.1_Intron|TMEM177_ENST00000401466.1_Missense_Mutation_p.A9T|TMEM177_ENST00000272521.6_Missense_Mutation_p.A9T	NM_001105198.1	NP_001098668.1	Q53S58	TM177_HUMAN	transmembrane protein 177	9						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	13	Colorectal(110;0.196)					GTGGCGGACCGCAGCATTTGT	0.577																																					p.A9T		Atlas-SNP	.											.	TMEM177	26	.	0			c.G25A						PASS	.						31.0	32.0	32.0					2																	120438454		2203	4300	6503	SO:0001583	missense	80775	exon2			CGGACCGCAGCAT	BC004404	CCDS2128.1	2q14.2	2008-02-05			ENSG00000144120	ENSG00000144120			28143	protein-coding gene	gene with protein product						12477932	Standard	NM_001105198		Approved	MGC10993	uc002tmc.1	Q53S58	OTTHUMG00000153312	ENST00000424086.1:c.25G>A	2.37:g.120438454G>A	ENSP00000402661:p.Ala9Thr	Somatic	97	0	0		WXS	Illumina HiSeq	Phase_I	98	37	0.377551	NM_030577	Q9BT20	Missense_Mutation	SNP	ENST00000424086.1	37	CCDS2128.1	.	.	.	.	.	.	.	.	.	.	G	3.212	-0.161456	0.06502	.	.	ENSG00000144120	ENST00000401466;ENST00000424086;ENST00000272521;ENST00000445518;ENST00000409951;ENST00000415646	T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26	4.05	-1.07	0.09968	.	0.587988	0.18617	N	0.135983	T	0.10380	0.0254	L	0.47716	1.5	0.09310	N	1	B;B	0.14012	0.009;0.005	B;B	0.10450	0.005;0.003	T	0.25257	-1.0137	10	0.26408	T	0.33	.	0.9877	0.01450	0.3926:0.1542:0.296:0.1572	.	9;9	B8ZZT5;Q53S58	.;TM177_HUMAN	T	9	ENSP00000385966:A9T;ENSP00000402661:A9T;ENSP00000272521:A9T;ENSP00000405898:A9T;ENSP00000386430:A9T	ENSP00000272521:A9T	A	+	1	0	TMEM177	120154924	0.001000	0.12720	0.000000	0.03702	0.267000	0.26476	-0.011000	0.12721	-0.221000	0.09973	0.549000	0.68633	GCA	.	.	none		0.577	TMEM177-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330673.1	NM_030577	
MYD88	4615	hgsc.bcm.edu	37	3	38181908	38181908	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:38181908A>G	ENST00000396334.3	+	3	716	c.532A>G	c.(532-534)Atc>Gtc	p.I178V	MYD88_ENST00000443433.2_Intron|MYD88_ENST00000417037.2_Missense_Mutation_p.I178V|MYD88_ENST00000424893.1_Missense_Mutation_p.I133V|MYD88_ENST00000481122.1_3'UTR|MYD88_ENST00000495303.1_Intron	NM_002468.4	NP_002459.2	Q99836	MYD88_HUMAN	myeloid differentiation primary response 88	165	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|establishment of endothelial intestinal barrier (GO:0090557)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to molecule of fungal origin (GO:0002238)|response to peptidoglycan (GO:0032494)|response to virus (GO:0009615)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|type I interferon biosynthetic process (GO:0045351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)	death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|TIR domain binding (GO:0070976)			breast(1)|haematopoietic_and_lymphoid_tissue(226)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	237				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CGATGCCTTCATCTGCTATTG	0.552			Mis		ABC-DLBCL																																p.I178V		Atlas-SNP	.		Dom	yes		3	3p22	4615	myeloid differentiation primary response gene (88)		L	.	MYD88	900	.	0			c.A532G						PASS	.						118.0	91.0	100.0					3																	38181908		2203	4300	6503	SO:0001583	missense	4615	exon3			GCCTTCATCTGCT	U84408	CCDS2674.2, CCDS54565.1, CCDS54566.1, CCDS54567.1, CCDS54568.1	3p22	2014-09-17	2012-11-15		ENSG00000172936	ENSG00000172936			7562	protein-coding gene	gene with protein product		602170	"""myeloid differentiation primary response gene (88)"""			9013863	Standard	NM_002468		Approved		uc003chx.3	Q99836	OTTHUMG00000131083	ENST00000396334.3:c.532A>G	3.37:g.38181908A>G	ENSP00000379625:p.Ile178Val	Somatic	37	0	0		WXS	Illumina HiSeq	Phase_I	40	27	0.675	NM_002468	B4DKH8|B4DKU4|B4DQ60|B4DQ72|J3KPU4|J3KQ87|J3KQJ6|P78397|Q53XS7	Missense_Mutation	SNP	ENST00000396334.3	37	CCDS2674.2	.	.	.	.	.	.	.	.	.	.	A	15.34	2.805447	0.50315	.	.	ENSG00000172936	ENST00000417037;ENST00000396334;ENST00000424893;ENST00000421516;ENST00000415158	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	5.61	5.61	0.85477	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.000000	0.85682	D	0.000000	T	0.24586	0.0596	L	0.43701	1.375	0.80722	D	1	B;B;B	0.22909	0.077;0.031;0.031	B;B;B	0.29077	0.086;0.098;0.098	T	0.05550	-1.0878	10	0.14252	T	0.57	.	15.3005	0.73945	1.0:0.0:0.0:0.0	.	120;165;154	Q99836-2;Q99836;B4E3D6	.;MYD88_HUMAN;.	V	178;178;133;177;154	ENSP00000401399:I178V;ENSP00000379625:I178V;ENSP00000389979:I133V;ENSP00000391753:I177V	ENSP00000379625:I178V	I	+	1	0	MYD88	38156912	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.964000	0.76061	2.281000	0.76405	0.533000	0.62120	ATC	.	.	none		0.552	MYD88-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253743.4	NM_002468	
HLA-C	3107	hgsc.bcm.edu	37	6	31238009	31238009	+	Silent	SNP	T	T	C	rs1131014	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:31238009T>C	ENST00000376228.5	-	4	887	c.873A>G	c.(871-873)caA>caG	p.Q291Q	HLA-C_ENST00000383329.3_Silent_p.Q291Q	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	291	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						TGAGGGGCTCTTGCAGCCCCT	0.592													C|||	2561	0.511382	0.6172	0.549	5008	,	,		13431	0.5744		0.4404	False		,,,				2504	0.3497				p.Q291Q		Atlas-SNP	.											HLA-C_ENST00000383329,colon,carcinoma,0,2	HLA-C	92	2	0			c.A873G						scavenged	.						23.0	30.0	28.0					6																	31238009		2121	4194	6315	SO:0001819	synonymous_variant	3107	exon4			GGGCTCTTGCAGC	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.873A>G	6.37:g.31238009T>C		Somatic	81	20	0.246914		WXS	Illumina HiSeq	Phase_I	56	44	0.785714	NM_002117	O02864|O02958|Q29643|Q9MY30	Silent	SNP	ENST00000376228.5	37	CCDS34393.1	872	0.3992673992673993	230	0.46747967479674796	148	0.4088397790055249	255	0.4458041958041958	239	0.3153034300791557	.	0.019	-1.465537	0.01053	.	.	ENSG00000204525	ENST00000415537	.	.	.	2.67	-5.33	0.02713	.	.	.	.	.	T	0.06005	0.0156	.	.	.	0.53005	P	3.799999999998249E-5	.	.	.	.	.	.	T	0.24154	-1.0168	3	.	.	.	.	2.6503	0.04996	0.1827:0.239:0.4507:0.1277	rs41551714	.	.	.	R	255	.	.	K	-	2	0	HLA-C	31345988	0.000000	0.05858	0.108000	0.21378	0.013000	0.08279	-3.876000	0.00344	-1.974000	0.00998	-0.711000	0.03637	AAG	T|0.651;C|0.349	0.349	strong		0.592	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
ZHX2	22882	hgsc.bcm.edu	37	8	123966206	123966206	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:123966206T>C	ENST00000314393.4	+	3	3291	c.2456T>C	c.(2455-2457)gTg>gCg	p.V819A		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	819					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GCAGAAGGTGTGTCGGAACTG	0.597																																					p.V819A	Esophageal Squamous(94;1056 1388 11767 13799 49639)	Atlas-SNP	.											.	ZHX2	106	.	0			c.T2456C						PASS	.						101.0	73.0	82.0					8																	123966206		2203	4300	6503	SO:0001583	missense	22882	exon3			AAGGTGTGTCGGA	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.2456T>C	8.37:g.123966206T>C	ENSP00000314709:p.Val819Ala	Somatic	87	0	0		WXS	Illumina HiSeq	Phase_I	98	50	0.510204	NM_014943		Missense_Mutation	SNP	ENST00000314393.4	37	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.328921	0.00229	.	.	ENSG00000178764	ENST00000314393	T	0.16073	2.37	6.04	-2.28	0.06826	.	2.219640	0.01526	N	0.018567	T	0.06554	0.0168	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17258	-1.0375	10	0.08179	T	0.78	0.1412	0.4746	0.00538	0.2626:0.3085:0.1678:0.2611	.	819	Q9Y6X8	ZHX2_HUMAN	A	819	ENSP00000314709:V819A	ENSP00000314709:V819A	V	+	2	0	ZHX2	124035387	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.290000	0.18975	-0.298000	0.08921	-2.109000	0.00356	GTG	.	.	none		0.597	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
FCER1G	2207	hgsc.bcm.edu	37	1	161187859	161187859	+	Silent	SNP	C	C	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:161187859C>A	ENST00000289902.1	+	2	158	c.133C>A	c.(133-135)Cga>Aga	p.R45R	FCER1G_ENST00000490414.1_Intron|AL590714.1_ENST00000594609.1_5'Flank|FCER1G_ENST00000367992.3_Silent_p.R45R	NM_004106.1	NP_004097.1	P30273	FCERG_HUMAN	Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide	45					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mast cell activation (GO:0045576)|negative regulation of mast cell apoptotic process (GO:0033026)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|phagocytosis, engulfment (GO:0006911)|platelet activation (GO:0030168)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of mast cell cytokine production (GO:0032765)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I hypersensitivity (GO:0001812)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation of type III hypersensitivity (GO:0001805)|protein localization to plasma membrane (GO:0072659)|regulation of platelet activation (GO:0010543)|serotonin secretion by platelet (GO:0002554)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|Fc-epsilon receptor I complex (GO:0032998)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)			endometrium(1)|lung(5)	6	all_cancers(52;1.35e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Benzylpenicilloyl Polylysine(DB00895)	CCTCTACTGTCGACTGAAGGT	0.562																																					p.R45R		Atlas-SNP	.											FCER1G,NS,carcinoma,-1,2	FCER1G	11	2	0			c.C133A						PASS	.						145.0	133.0	137.0					1																	161187859		2203	4300	6503	SO:0001819	synonymous_variant	2207	exon2			TACTGTCGACTGA		CCDS1225.1	1q23	2008-02-05			ENSG00000158869	ENSG00000158869			3611	protein-coding gene	gene with protein product		147139				2138619	Standard	NM_004106		Approved		uc001fyz.1	P30273	OTTHUMG00000034343	ENST00000289902.1:c.133C>A	1.37:g.161187859C>A		Somatic	52	0	0		WXS	Illumina HiSeq	Phase_I	74	24	0.324324	NM_004106	Q5VTW4	Silent	SNP	ENST00000289902.1	37	CCDS1225.1																																																																																			.	.	none		0.562	FCER1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083012.1	NM_004106	
OR1S2	219958	hgsc.bcm.edu	37	11	57971190	57971190	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr11:57971190G>A	ENST00000302592.6	-	1	463	c.464C>T	c.(463-465)aCt>aTt	p.T155I		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T155I(1)		endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				TGTGAGCAAAGTGCCGAACCT	0.488																																					p.T155I		Atlas-SNP	.											OR1S2,trunk,malignant_melanoma,0,1	OR1S2	119	1	1	Substitution - Missense(1)	skin(1)	c.C464T						scavenged	.						183.0	172.0	176.0					11																	57971190		2201	4296	6497	SO:0001583	missense	219958	exon1			AGCAAAGTGCCGA	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.464C>T	11.37:g.57971190G>A	ENSP00000305469:p.Thr155Ile	Somatic	127	0	0		WXS	Illumina HiSeq	Phase_I	157	3	0.0191083	NM_001004459	Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	CCDS31545.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.862128	0.00552	.	.	ENSG00000197887	ENST00000302592	T	0.35421	1.31	4.47	0.804	0.18697	GPCR, rhodopsin-like superfamily (1);	1.024400	0.07804	N	0.956995	T	0.11367	0.0277	N	0.00525	-1.395	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.24440	-1.0160	10	0.34782	T	0.22	.	7.5141	0.27590	0.6178:0.0:0.3822:0.0	.	155	Q8NGQ3	OR1S2_HUMAN	I	155	ENSP00000305469:T155I	ENSP00000305469:T155I	T	-	2	0	OR1S2	57727766	0.000000	0.05858	0.013000	0.15412	0.026000	0.11368	-0.153000	0.10144	0.277000	0.22141	-0.285000	0.09966	ACT	.	.	none		0.488	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
APBA3	9546	hgsc.bcm.edu	37	19	3751204	3751204	+	Missense_Mutation	SNP	T	T	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:3751204T>G	ENST00000316757.3	-	10	1839	c.1639A>C	c.(1639-1641)Acc>Ccc	p.T547P	AC005954.4_ENST00000586503.1_RNA	NM_004886.3	NP_004877.1	O96018	APBA3_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 3	547	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				in utero embryonic development (GO:0001701)|negative regulation of catalytic activity (GO:0043086)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|large_intestine(1)|skin(1)	3		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		TAGGCCTCGGTGAGCAGCTCG	0.706																																					p.T547P		Atlas-SNP	.											.	APBA3	28	.	0			c.A1639C						PASS	.						15.0	14.0	14.0					19																	3751204		2142	4234	6376	SO:0001583	missense	9546	exon10			CCTCGGTGAGCAG	AB021638	CCDS12110.1	19p13.3	2008-07-18	2008-07-18			ENSG00000011132			580	protein-coding gene	gene with protein product	"""X11-like 2"""	604262				10049767	Standard	NM_004886		Approved	X11L2, mint3	uc002lyp.1	O96018		ENST00000316757.3:c.1639A>C	19.37:g.3751204T>G	ENSP00000315136:p.Thr547Pro	Somatic	55	0	0		WXS	Illumina HiSeq	Phase_I	33	10	0.30303	NM_004886	O60483|Q9UPZ2	Missense_Mutation	SNP	ENST00000316757.3	37	CCDS12110.1	.	.	.	.	.	.	.	.	.	.	T	11.98	1.801049	0.31869	.	.	ENSG00000011132	ENST00000316757	T	0.28069	1.63	4.68	3.66	0.41972	PDZ/DHR/GLGF (4);	0.126503	0.52532	D	0.000076	T	0.45558	0.1348	M	0.64997	1.995	0.47009	D	0.999282	D	0.76494	0.999	D	0.69824	0.966	T	0.37709	-0.9694	10	0.66056	D	0.02	.	5.0977	0.14742	0.1586:0.0873:0.0:0.7542	.	547	O96018	APBA3_HUMAN	P	547	ENSP00000315136:T547P	ENSP00000315136:T547P	T	-	1	0	APBA3	3702204	1.000000	0.71417	0.838000	0.33150	0.015000	0.08874	3.472000	0.53114	0.637000	0.30526	-0.441000	0.05720	ACC	.	.	none		0.706	APBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453634.2		
