#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
DNHD1	144132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	6588129	6588129	+	Missense_Mutation	SNP	G	G	A	rs377176360		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr11:6588129G>A	ENST00000527990.2	+	34	11390	c.11390G>A	c.(11389-11391)cGg>cAg	p.R3797Q	DNHD1_ENST00000254579.6_Missense_Mutation_p.R3797Q			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	3797					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		ATGCAGGAGCGGCTGCTGACG	0.542																																																0								G	GLN/ARG	0,4040		0,0,2020	28.0	33.0	31.0		11390	-4.1	0.0	11		31	1,8377		0,1,4188	no	missense	DNHD1	NM_144666.2	43	0,1,6208	AA,AG,GG		0.0119,0.0,0.0081	benign	3797/4754	6588129	1,12417	2020	4189	6209	SO:0001583	missense	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.11390G>A	11.37:g.6588129G>A	ENSP00000436180:p.Arg3797Gln	Somatic		WXS	Illumina GAIIx	Phase_I	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.376850	0.24857	0.0	1.19E-4	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000525883;ENST00000530197	T;T	0.26067	1.76;1.76	4.33	-4.08	0.03963	.	1.901100	0.03078	N	0.158163	T	0.15003	0.0362	N	0.14661	0.345	0.09310	N	1	B;B	0.10296	0.003;0.0	B;B	0.06405	0.002;0.0	T	0.24584	-1.0156	10	0.25106	T	0.35	-0.3092	10.0107	0.41984	0.7818:0.0:0.2182:0.0	.	65;3797	D3DQT9;Q96M86	.;DNHD1_HUMAN	Q	3797;3797;65;65	ENSP00000254579:R3797Q;ENSP00000436180:R3797Q	ENSP00000254579:R3797Q	R	+	2	0	DNHD1	6544705	0.025000	0.19082	0.006000	0.13384	0.081000	0.17604	-0.360000	0.07622	-0.676000	0.05238	-1.000000	0.02509	CGG		0.542	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666		9	12	9	12
CD82	3732	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	44640201	44640201	+	Silent	SNP	G	G	A			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr11:44640201G>A	ENST00000227155.4	+	9	902	c.654G>A	c.(652-654)gaG>gaA	p.E218E	CD82_ENST00000342935.3_Silent_p.E193E|CD82_ENST00000530931.1_3'UTR	NM_002231.3	NP_002222.1	P27701	CD82_HUMAN	CD82 molecule	218						extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				large_intestine(1)|ovary(1)	2						GCTGCATGGAGAAGGTGCAGG	0.667																																																0													113.0	103.0	107.0					11																	44640201		2203	4299	6502	SO:0001819	synonymous_variant	3732			U20770	CCDS7909.1, CCDS31469.1	11p11.2	2013-02-14	2006-03-28	2005-03-03		ENSG00000085117		"""CD molecules"", ""Tetraspanins"""	6210	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 6"", ""R2 leukocyte antigen"""	600623	"""kangai 1 (suppression of tumorigenicity 6, prostate; CD82 antigen (R2 leukocyte antigen, antigen detected by monoclonal and antibody IA4))"", ""CD82 antigen"""	ST6, KAI1			Standard	XM_006718222		Approved	R2, IA4, TSPAN27	uc001myc.3	P27701		ENST00000227155.4:c.654G>A	11.37:g.44640201G>A		Somatic		WXS	Illumina GAIIx	Phase_I	D3DQN6|E9PC70|Q7Z2D4|Q7Z5N2	Silent	SNP	ENST00000227155.4	37	CCDS7909.1																																																																																				0.667	CD82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389886.1			21	76	21	76
CCDC84	338657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	118885707	118885707	+	Missense_Mutation	SNP	C	C	G			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr11:118885707C>G	ENST00000334418.1	+	9	775	c.719C>G	c.(718-720)gCc>gGc	p.A240G	RPS25_ENST00000528547.1_5'Flank	NM_198489.1	NP_940891.1	Q86UT8	CCD84_HUMAN	coiled-coil domain containing 84	240										breast(1)|kidney(1)|large_intestine(1)|liver(1)|ovary(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		TTTTCAGGTGCCACACCTCCC	0.353																																																0													61.0	67.0	65.0					11																	118885707		2199	4295	6494	SO:0001583	missense	338657			AB094093	CCDS8405.1	11q23.3	2006-03-13			ENSG00000186166	ENSG00000186166			30460	protein-coding gene	gene with protein product							Standard	NM_198489		Approved	DLNB14	uc001pul.3	Q86UT8	OTTHUMG00000166348	ENST00000334418.1:c.719C>G	11.37:g.118885707C>G	ENSP00000334767:p.Ala240Gly	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000334418.1	37	CCDS8405.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810831	0.90707	.	.	ENSG00000186166	ENST00000334418	T	0.71934	-0.61	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.84224	0.5425	M	0.67700	2.07	0.53688	D	0.999975	D	0.89917	1.0	D	0.83275	0.996	D	0.84462	0.0594	10	0.87932	D	0	-15.5944	20.3213	0.98679	0.0:1.0:0.0:0.0	.	240	Q86UT8	CCD84_HUMAN	G	240	ENSP00000334767:A240G	ENSP00000334767:A240G	A	+	2	0	CCDC84	118390917	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	5.900000	0.69853	2.810000	0.96702	0.650000	0.86243	GCC		0.353	CCDC84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389315.1	NM_198489		31	71	31	71
ACAD8	27034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	134130962	134130962	+	Missense_Mutation	SNP	C	C	G			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr11:134130962C>G	ENST00000281182.4	+	7	836	c.730C>G	c.(730-732)Cga>Gga	p.R244G	ACAD8_ENST00000374752.4_Missense_Mutation_p.R117G|ACAD8_ENST00000543332.1_Missense_Mutation_p.R146G|ACAD8_ENST00000537423.1_Missense_Mutation_p.R167G|ACAD8_ENST00000524547.1_3'UTR	NM_014384.2	NP_055199.1	Q9UKU7	ACAD8_HUMAN	acyl-CoA dehydrogenase family, member 8	244					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|lipid metabolic process (GO:0006629)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.R244*(1)		endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)	Flavin adenine dinucleotide(DB03147)	CCAGCCAACACGAGCTGTGAT	0.612																																					GBM(65;238 1125 33403 41853 48889)											1	Substitution - Nonsense(1)	lung(1)											57.0	50.0	53.0					11																	134130962		2201	4297	6498	SO:0001583	missense	27034			AF126245	CCDS8498.1	11q25	2014-09-17	2010-04-30		ENSG00000151498	ENSG00000151498			87	protein-coding gene	gene with protein product		604773	"""acyl-Coenzyme A dehydrogenase family, member 8"""			10524212	Standard	NM_014384		Approved		uc001qhk.3	Q9UKU7	OTTHUMG00000167177	ENST00000281182.4:c.730C>G	11.37:g.134130962C>G	ENSP00000281182:p.Arg244Gly	Somatic		WXS	Illumina GAIIx	Phase_I	B7Z5W4|Q6ZWP6|Q9BUS8	Missense_Mutation	SNP	ENST00000281182.4	37	CCDS8498.1	.	.	.	.	.	.	.	.	.	.	C	14.72	2.619747	0.46736	.	.	ENSG00000151498	ENST00000281182;ENST00000537423;ENST00000543332;ENST00000374752;ENST00000537915	D;D;D;D	0.98474	-4.95;-4.95;-4.95;-4.95	5.44	4.45	0.53987	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.049058	0.85682	D	0.000000	D	0.95924	0.8673	L	0.42529	1.33	0.80722	D	1	B;B;B	0.25563	0.129;0.015;0.043	B;B;B	0.16722	0.007;0.01;0.016	D	0.94326	0.7558	10	0.41790	T	0.15	.	15.0213	0.71632	0.2352:0.7648:0.0:0.0	.	167;117;244	B7Z5W4;Q6ZWP6;Q9UKU7	.;.;ACAD8_HUMAN	G	244;167;146;117;206	ENSP00000281182:R244G;ENSP00000443763:R167G;ENSP00000438302:R146G;ENSP00000363884:R117G	ENSP00000281182:R244G	R	+	1	2	ACAD8	133636172	0.936000	0.31750	0.953000	0.39169	0.968000	0.65278	1.535000	0.36061	2.561000	0.86390	0.561000	0.74099	CGA		0.612	ACAD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393607.1	NM_014384		3	23	3	23
TPP2	7174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	103299660	103299660	+	Missense_Mutation	SNP	G	G	C	rs142623109		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr13:103299660G>C	ENST00000376065.4	+	21	2630	c.2594G>C	c.(2593-2595)aGa>aCa	p.R865T	TPP2_ENST00000376052.3_Missense_Mutation_p.R865T	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	865					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CAGAACAAAAGACAGATGGGT	0.388																																																0													73.0	71.0	71.0					13																	103299660		2203	4300	6503	SO:0001583	missense	7174			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.2594G>C	13.37:g.103299660G>C	ENSP00000365233:p.Arg865Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q5VZU8	Missense_Mutation	SNP	ENST00000376065.4	37	CCDS9502.1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360260	0.61403	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.76	5.76	0.90799	Peptidase S8A, tripeptidyl peptidase II (1);	0.000000	0.85682	D	0.000000	T	0.64918	0.2642	L	0.58583	1.82	0.58432	D	0.999999	P	0.36354	0.549	B	0.43623	0.425	T	0.63193	-0.6692	9	0.38643	T	0.18	.	14.1692	0.65497	0.0714:0.0:0.9286:0.0	.	865	P29144	TPP2_HUMAN	T	865	.	ENSP00000365220:R865T	R	+	2	0	TPP2	102097661	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.409000	0.73289	2.724000	0.93272	0.585000	0.79938	AGA		0.388	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2			23	43	23	43
PLA2G4F	255189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	42434838	42434838	+	Silent	SNP	G	G	A	rs544965093	byFrequency	TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr15:42434838G>A	ENST00000382396.4	-	19	2303	c.2217C>T	c.(2215-2217)gaC>gaT	p.D739D	PLA2G4F_ENST00000397272.3_Silent_p.D741D			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	739	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CCTCCTCCATGTCCTCAGGGC	0.592													G|||	3	0.000599042	0.0	0.0	5008	,	,		18008	0.003		0.0	False		,,,				2504	0.0															0													83.0	72.0	76.0					15																	42434838		2203	4299	6502	SO:0001819	synonymous_variant	255189				CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.2217C>T	15.37:g.42434838G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q6ZMC8	Silent	SNP	ENST00000382396.4	37	CCDS32204.1																																																																																				0.592	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600		29	69	29	69
RPGRIP1L	23322	hgsc.bcm.edu;broad.mit.edu	37	16	53679916	53679916	+	Splice_Site	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr16:53679916C>T	ENST00000379925.3	-	17	2355		c.e17-1		RPGRIP1L_ENST00000262135.4_Splice_Site|RPGRIP1L_ENST00000564374.1_Splice_Site|RPGRIP1L_ENST00000563746.1_Splice_Site	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like						camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				GCTGACTTAACTGGAAAAACA	0.358																																																0			GRCh37	CS073524	RPGRIP1L	S							54.0	52.0	53.0					16																	53679916		2198	4300	6498	SO:0001630	splice_region_variant	23322				CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.2305-1G>A	16.37:g.53679916C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A0PJ88|Q9Y2K8	Splice_Site	SNP	ENST00000379925.3	37	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.166528	0.57476	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	.	.	.	5.21	4.2	0.49525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9366	0.58319	0.2583:0.7417:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RPGRIP1L	52237417	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.933000	0.28897	2.608000	0.88229	0.555000	0.69702	.		0.358	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	Intron	21	49	21	49
POLR2A	5430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	7414879	7414879	+	Missense_Mutation	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr17:7414879C>T	ENST00000322644.6	+	24	4472	c.4073C>T	c.(4072-4074)aCg>aTg	p.T1358M		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	1358					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				GTACGCACCACGTCCAATGAC	0.597																																																0													111.0	82.0	92.0					17																	7414879		2203	4300	6503	SO:0001583	missense	5430					17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.4073C>T	17.37:g.7414879C>T	ENSP00000314949:p.Thr1358Met	Somatic		WXS	Illumina GAIIx	Phase_I	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.712860	0.68730	.	.	ENSG00000181222	ENST00000535204;ENST00000545644;ENST00000322644	T	0.77620	-1.11	4.59	4.59	0.56863	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	T	0.80909	0.4714	M	0.79475	2.455	0.80722	D	1	P	0.48089	0.905	P	0.44623	0.455	D	0.84692	0.0723	10	0.62326	D	0.03	-11.0006	16.7406	0.85458	0.0:1.0:0.0:0.0	.	1358	P24928	RPB1_HUMAN	M	1314;257;1358	ENSP00000314949:T1358M	ENSP00000314949:T1358M	T	+	2	0	SLC35G6	7355603	1.000000	0.71417	0.991000	0.47740	0.907000	0.53573	6.792000	0.75125	2.564000	0.86499	0.449000	0.29647	ACG		0.597	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937		8	31	8	31
KRT222	125113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	38812821	38812821	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr17:38812821G>A	ENST00000476049.1	-	6	762	c.721C>T	c.(721-723)Cga>Tga	p.R241*	KRT222_ENST00000394052.3_Nonsense_Mutation_p.R241*			Q8N1A0	KT222_HUMAN	keratin 222	241						intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(2)|skin(1)	15						TTCCTCAATCGAGGGTTATCT	0.338																																																0													74.0	73.0	74.0					17																	38812821		2203	4300	6503	SO:0001587	stop_gained	125113			AK092967	CCDS11371.1	17q21.2	2013-06-25	2009-08-25	2009-08-25	ENSG00000213424	ENSG00000213424		"""-"""	28695	protein-coding gene	gene with protein product			"""keratin 222 pseudogene"""	KRT222P		16831889	Standard	NM_152349		Approved	KA21, MGC45562	uc002hvc.2	Q8N1A0	OTTHUMG00000133374	ENST00000476049.1:c.721C>T	17.37:g.38812821G>A	ENSP00000463483:p.Arg241*	Somatic		WXS	Illumina GAIIx	Phase_I	Q7Z368	Nonsense_Mutation	SNP	ENST00000476049.1	37	CCDS11371.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.729613	0.89390	.	.	ENSG00000213424	ENST00000394049;ENST00000394052	.	.	.	5.78	4.8	0.61643	.	0.324075	0.24018	U	0.042303	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7242	13.7742	0.63044	0.0:0.0:0.7203:0.2797	.	.	.	.	X	201;241	.	ENSP00000377613:R201X	R	-	1	2	KRT222	36066347	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	4.456000	0.60081	1.416000	0.47057	0.591000	0.81541	CGA		0.338	KRT222-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000447539.1	NM_152349		34	85	34	85
SERPINB7	8710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	61449736	61449736	+	Missense_Mutation	SNP	T	T	A	rs200310628		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr18:61449736T>A	ENST00000398019.2	+	2	455	c.130T>A	c.(130-132)Ttg>Atg	p.L44M	SERPINB7_ENST00000540675.1_Missense_Mutation_p.L44M|SERPINB7_ENST00000546027.1_Missense_Mutation_p.L44M|SERPINB7_ENST00000336429.2_Missense_Mutation_p.L44M	NM_003784.3	NP_003775.1	O75635	SPB7_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 7	44					negative regulation of endopeptidase activity (GO:0010951)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	27		Esophageal squamous(42;0.129)				CCTGGTCCGCTTGGGCGCTCA	0.473																																																0													108.0	92.0	98.0					18																	61449736		2203	4300	6503	SO:0001583	missense	8710			AF027866	CCDS11988.1, CCDS58633.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166396	ENSG00000166396		"""Serine (or cysteine) peptidase inhibitors"""	13902	protein-coding gene	gene with protein product		603357	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7"""			24172014	Standard	NM_003784		Approved	MEGSIN	uc002ljl.4	O75635	OTTHUMG00000060591	ENST00000398019.2:c.130T>A	18.37:g.61449736T>A	ENSP00000381101:p.Leu44Met	Somatic		WXS	Illumina GAIIx	Phase_I	B4DUW8|F5GZC0|Q1ED45|Q3KPG4	Missense_Mutation	SNP	ENST00000398019.2	37	CCDS11988.1	.	.	.	.	.	.	.	.	.	.	T	10.38	1.334237	0.24253	.	.	ENSG00000166396	ENST00000425392;ENST00000336429;ENST00000398019;ENST00000540675;ENST00000447428;ENST00000546027;ENST00000431370	D;D;D;D;D;D;D	0.90385	-2.66;-2.21;-2.21;-2.21;-2.0;-2.21;-2.66	5.88	-11.4	0.00090	Serpin domain (3);	0.167338	0.28365	N	0.015602	D	0.87724	0.6249	M	0.66560	2.04	0.21220	N	0.999759	P;D	0.53745	0.875;0.962	B;P	0.47573	0.415;0.55	D	0.83822	0.0247	10	0.39692	T	0.17	.	17.4859	0.87688	0.0885:0.7875:0.0:0.1239	.	44;44	F5GZC0;O75635	.;SPB7_HUMAN	M	44	ENSP00000397301:L44M;ENSP00000337212:L44M;ENSP00000381101:L44M;ENSP00000444572:L44M;ENSP00000402362:L44M;ENSP00000444861:L44M;ENSP00000393947:L44M	ENSP00000337212:L44M	L	+	1	2	SERPINB7	59600716	0.000000	0.05858	0.066000	0.19879	0.136000	0.21042	-0.965000	0.03829	-1.725000	0.01371	-0.415000	0.06103	TTG		0.473	SERPINB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134007.1	NM_003784		39	94	39	94
ZNF675	171392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	23836144	23836144	+	Missense_Mutation	SNP	T	T	A			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr19:23836144T>A	ENST00000359788.4	-	4	1759	c.1591A>T	c.(1591-1593)Act>Tct	p.T531S	ZNF675_ENST00000601935.1_Intron|ZNF675_ENST00000596211.1_Intron|ZNF675_ENST00000600313.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	531					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTCTCTCCAGTATGAATTATC	0.343																																																0													69.0	71.0	70.0					19																	23836144		2202	4300	6502	SO:0001583	missense	171392				CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.1591A>T	19.37:g.23836144T>A	ENSP00000352836:p.Thr531Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q8N211	Missense_Mutation	SNP	ENST00000359788.4	37	CCDS32981.1	.	.	.	.	.	.	.	.	.	.	.	3.226	-0.158538	0.06544	.	.	ENSG00000197372	ENST00000359788	T	0.24151	1.87	0.886	0.886	0.19194	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14184	0.0343	N	0.20530	0.585	0.27477	N	0.952707	B	0.19583	0.037	B	0.20955	0.032	T	0.23797	-1.0178	9	0.51188	T	0.08	.	3.6799	0.08306	0.0:0.2529:0.0:0.7471	.	531	Q8TD23	ZN675_HUMAN	S	531	ENSP00000352836:T531S	ENSP00000352836:T531S	T	-	1	0	ZNF675	23627984	0.601000	0.26907	0.937000	0.37676	0.937000	0.57800	0.731000	0.26058	0.257000	0.21650	0.254000	0.18369	ACT		0.343	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466433.1	NM_138330		21	71	21	71
ZNF536	9745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	31038959	31038959	+	Silent	SNP	G	G	A	rs371262692		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr19:31038959G>A	ENST00000355537.3	+	4	2580	c.2433G>A	c.(2431-2433)ccG>ccA	p.P811P		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	811					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GGGCTGGGCCGCTGTCTGGGC	0.567																																																0								G		0,4406		0,0,2203	67.0	74.0	72.0		2433	-12.0	0.0	19		72	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	ZNF536	NM_014717.1		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		811/1301	31038959	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2433G>A	19.37:g.31038959G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A2RU18	Silent	SNP	ENST00000355537.3	37	CCDS32984.1																																																																																				0.567	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		35	103	35	103
KIAA0355	9710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	34832986	34832986	+	Missense_Mutation	SNP	G	G	A			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr19:34832986G>A	ENST00000299505.6	+	10	3020	c.2147G>A	c.(2146-2148)gGa>gAa	p.G716E		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	716										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					CCCCAGCCGGGACTGGCACCT	0.647																																																0													97.0	103.0	101.0					19																	34832986		2203	4300	6503	SO:0001583	missense	9710				CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.2147G>A	19.37:g.34832986G>A	ENSP00000299505:p.Gly716Glu	Somatic		WXS	Illumina GAIIx	Phase_I	Q2M3W4	Missense_Mutation	SNP	ENST00000299505.6	37	CCDS12436.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199063	0.58126	.	.	ENSG00000166398	ENST00000299505	T	0.24908	1.83	5.65	4.58	0.56647	.	0.196261	0.45606	D	0.000342	T	0.14700	0.0355	N	0.14661	0.345	0.41200	D	0.986367	B	0.32829	0.386	B	0.31101	0.124	T	0.08106	-1.0738	10	0.87932	D	0	-14.0787	8.9266	0.35643	0.0773:0.1508:0.7719:0.0	.	716	O15063	K0355_HUMAN	E	716	ENSP00000299505:G716E	ENSP00000299505:G716E	G	+	2	0	KIAA0355	39524826	1.000000	0.71417	0.679000	0.29978	0.776000	0.43924	2.212000	0.42835	1.319000	0.45190	0.655000	0.94253	GGA		0.647	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686		54	142	54	142
TNNT1	7138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	55649402	55649402	+	Missense_Mutation	SNP	C	C	T	rs367977700		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr19:55649402C>T	ENST00000588981.1	-	10	632	c.428G>A	c.(427-429)cGg>cAg	p.R143Q	TNNT1_ENST00000585321.2_Missense_Mutation_p.R73Q|TNNT1_ENST00000588426.1_Missense_Mutation_p.R40Q|TNNT1_ENST00000587758.1_Missense_Mutation_p.R132Q|TNNT1_ENST00000587465.2_Missense_Mutation_p.R73Q|TNNT1_ENST00000356783.5_Missense_Mutation_p.R132Q|TNNT1_ENST00000536926.1_Missense_Mutation_p.R132Q|TNNT1_ENST00000592920.1_5'UTR|TNNT1_ENST00000291901.8_Missense_Mutation_p.R143Q	NM_003283.4	NP_003274.3	P13805	TNNT1_HUMAN	troponin T type 1 (skeletal, slow)	143					muscle filament sliding (GO:0030049)|negative regulation of muscle contraction (GO:0045932)|skeletal muscle contraction (GO:0003009)|slow-twitch skeletal muscle fiber contraction (GO:0031444)	cytosol (GO:0005829)|troponin complex (GO:0005861)	tropomyosin binding (GO:0005523)			endometrium(2)|kidney(3)|lung(4)|ovary(1)	10			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		ATCCTCTGCCCGCTTCTTGGC	0.572																																																0								C	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	205.0	177.0	186.0		428,395,428	4.4	1.0	19		186	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	TNNT1	NM_001126132.1,NM_001126133.1,NM_003283.4	43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	143/263,132/252,143/279	55649402	1,13005	2203	4300	6503	SO:0001583	missense	7138				CCDS12917.1, CCDS46185.1, CCDS59421.1	19q13.4	2014-09-17	2005-09-12			ENSG00000105048			11948	protein-coding gene	gene with protein product	"""slow skeletal muscle troponin T"", ""troponin T1, skeletal, slow"", ""nemaline myopathy type 5"""	191041	"""troponin T1, skeletal, slow"""			1505979	Standard	XM_006723343		Approved	ANM, STNT, TNT, TNTS, FLJ98147, MGC104241, NEM5	uc002qjb.4	P13805		ENST00000588981.1:c.428G>A	19.37:g.55649402C>T	ENSP00000467176:p.Arg143Gln	Somatic		WXS	Illumina GAIIx	Phase_I	O95472|Q16061|Q5U0E1	Missense_Mutation	SNP	ENST00000588981.1	37	CCDS12917.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981247	0.74474	0.0	1.16E-4	ENSG00000105048	ENST00000291901;ENST00000356783;ENST00000536926;ENST00000537693;ENST00000429737	D;D;D	0.92299	-3.01;-3.01;-3.01	4.37	4.37	0.52481	.	0.229781	0.35805	N	0.002964	D	0.93949	0.8063	M	0.83012	2.62	0.48135	D	0.999595	P;D;D;D;D	0.60160	0.918;0.958;0.958;0.987;0.958	B;B;B;P;B	0.50617	0.393;0.301;0.43;0.646;0.301	D	0.94311	0.7545	10	0.51188	T	0.08	-12.6403	14.7823	0.69776	0.0:1.0:0.0:0.0	.	143;132;143;143;132	Q56R94;P13805-2;P13805-3;P13805;F5H1H4	.;.;.;TNNT1_HUMAN;.	Q	143;132;132;73;158	ENSP00000291901:R143Q;ENSP00000349233:R132Q;ENSP00000439640:R132Q	ENSP00000291901:R143Q	R	-	2	0	TNNT1	60341214	0.950000	0.32346	0.994000	0.49952	0.997000	0.91878	2.457000	0.45005	2.167000	0.68274	0.484000	0.47621	CGG		0.572	TNNT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451825.2	NM_003283		37	98	37	98
NBL1	4681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	19981874	19981874	+	Silent	SNP	A	A	C			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr1:19981874A>C	ENST00000375136.3	+	3	531	c.228A>C	c.(226-228)acA>acC	p.T76T	MINOS1-NBL1_ENST00000602662.1_Silent_p.T76T|NBL1_ENST00000289749.2_Silent_p.T111T|NBL1_ENST00000548815.1_Silent_p.T75T	NM_001204085.1|NM_001204089.1|NM_001278164.1|NM_001278166.1	NP_001191014.1|NP_001191018.1|NP_001265093.1|NP_001265095.1	P41271	NBL1_HUMAN	neuroblastoma 1, DAN family BMP antagonist	76	CTCK.				determination of dorsal identity (GO:0048263)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of monocyte chemotaxis (GO:0090027)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)|positive regulation of neuron differentiation (GO:0045666)|sequestering of BMP from receptor via BMP binding (GO:0038098)|sequestering of BMP in extracellular matrix (GO:0035582)	extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)			lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00043)|Ovarian(437;0.00373)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.9e-05)|Kidney(64;0.000173)|GBM - Glioblastoma multiforme(114;0.0012)|KIRC - Kidney renal clear cell carcinoma(64;0.0026)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CACAGTCCACAGAGTCCCTGG	0.622																																																0													201.0	142.0	162.0					1																	19981874		2203	4300	6503	SO:0001819	synonymous_variant	4681				CCDS196.1, CCDS41278.1, CCDS196.2, CCDS72720.1	1p36.3-p36.2	2013-02-26	2013-02-26		ENSG00000158747	ENSG00000158747			7650	protein-coding gene	gene with protein product	"""neuroblastoma candidate region, suppression of tumorigenicity 1"", ""neuroblastoma suppressor of tumorigenicity 1"", ""differential screening-selected gene aberrant in neuroblastoma"""	600613	"""neuroblastoma, suppression of tumorigenicity 1"""			7633401	Standard	NM_182744		Approved	D1S1733E, NB, DAN, NO3, DAND1	uc001bcj.2	P41271	OTTHUMG00000002700	ENST00000375136.3:c.228A>C	1.37:g.19981874A>C		Somatic		WXS	Illumina GAIIx	Phase_I	A3KFI7|Q5TGZ2|Q5U0N4|Q96L68	Silent	SNP	ENST00000375136.3	37	CCDS196.2																																																																																				0.622	NBL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007681.4	NM_005380		32	66	32	66
ERI3	79033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	44804751	44804751	+	Missense_Mutation	SNP	T	T	G			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr1:44804751T>G	ENST00000372257.2	-	3	636	c.455A>C	c.(454-456)gAg>gCg	p.E152A	ERI3_ENST00000537474.1_Intron|ERI3_ENST00000495828.1_5'UTR	NM_024066.1	NP_076971.1	O43414	ERI3_HUMAN	ERI1 exoribonuclease family member 3	152	Exonuclease.						exonuclease activity (GO:0004527)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GCACGTGGCCTCAAAGTCCAG	0.547																																																0													168.0	179.0	175.0					1																	44804751		2203	4300	6503	SO:0001583	missense	79033			AF007157	CCDS30696.1	1p34.1	2009-10-07	2009-10-07	2008-12-16	ENSG00000117419	ENSG00000117419		"""Enhanced RNAi three prime mRNA exonucleases"""	17276	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 3 (C.elegans)"", ""exoribonuclease 3"""	609917	"""prion protein interacting protein"""	PRNPIP			Standard	XM_005271184		Approved	FLJ22943, PINT1	uc001clt.3	O43414	OTTHUMG00000007637	ENST00000372257.2:c.455A>C	1.37:g.44804751T>G	ENSP00000361331:p.Glu152Ala	Somatic		WXS	Illumina GAIIx	Phase_I	B1AK98|Q5T2T7|Q5T2T9|Q5TG35|Q9BQA0|Q9UEB4	Missense_Mutation	SNP	ENST00000372257.2	37	CCDS30696.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.478808	0.84747	.	.	ENSG00000117419	ENST00000372257;ENST00000372253;ENST00000457571	D;D	0.91945	-2.94;-2.94	6.17	6.17	0.99709	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.064020	0.64402	D	0.000007	D	0.97601	0.9214	H	0.96996	3.92	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.998;1.0	D	0.98797	1.0738	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	150;74;152	F6UGJ8;B4DN03;O43414	.;.;ERI3_HUMAN	A	152;18;150	ENSP00000361331:E152A;ENSP00000412291:E150A	ENSP00000361327:E18A	E	-	2	0	ERI3	44577338	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.201000	0.65163	2.371000	0.80710	0.533000	0.62120	GAG		0.547	ERI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020243.1	NM_024066		145	229	145	229
FLG	2312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	152275719	152275719	+	Silent	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr1:152275719C>T	ENST00000368799.1	-	3	11678	c.11643G>A	c.(11641-11643)gaG>gaA	p.E3881E	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3881	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGAAGCAGACTCAGATCGCC	0.567									Ichthyosis																																							0													114.0	118.0	116.0					1																	152275719		2203	4300	6503	SO:0001819	synonymous_variant	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11643G>A	1.37:g.152275719C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																				0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		43	158	43	158
PEAR1	375033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	156883725	156883725	+	Missense_Mutation	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr1:156883725C>T	ENST00000338302.3	+	23	3020	c.2795C>T	c.(2794-2796)cCc>cTc	p.P932L	PEAR1_ENST00000292357.7_Missense_Mutation_p.P932L			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	932	Pro-rich.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CGGGACCTGCCCAGCTTGCCA	0.617																																																0													30.0	34.0	33.0					1																	156883725		2203	4300	6503	SO:0001583	missense	375033			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.2795C>T	1.37:g.156883725C>T	ENSP00000344465:p.Pro932Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541325	0.65085	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	D;D	0.95980	-3.87;-3.87	5.6	4.68	0.58851	.	0.136830	0.34002	N	0.004358	D	0.89399	0.6704	L	0.46819	1.47	0.80722	D	1	P	0.38110	0.618	B	0.32211	0.142	D	0.91082	0.4900	10	0.62326	D	0.03	.	12.6434	0.56721	0.0:0.9177:0.0:0.0823	.	932	Q5VY43	PEAR1_HUMAN	L	932	ENSP00000344465:P932L;ENSP00000292357:P932L	ENSP00000292357:P932L	P	+	2	0	PEAR1	155150349	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	5.357000	0.66058	2.640000	0.89533	0.655000	0.94253	CCC		0.617	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471		33	42	33	42
PAPPA2	60676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	176525627	176525627	+	Nonsense_Mutation	SNP	C	C	T	rs557625059		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr1:176525627C>T	ENST00000367662.3	+	2	1333	c.169C>T	c.(169-171)Cga>Tga	p.R57*	PAPPA2_ENST00000367661.3_Nonsense_Mutation_p.R57*	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	57					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GGCCAAGGTTCGAAGACCCAG	0.567													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18176	0.0		0.0	False		,,,				2504	0.0															0													94.0	93.0	93.0					1																	176525627		1977	4155	6132	SO:0001587	stop_gained	60676			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.169C>T	1.37:g.176525627C>T	ENSP00000356634:p.Arg57*	Somatic		WXS	Illumina GAIIx	Phase_I	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Nonsense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	45	11.583246	0.99579	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	.	.	.	4.82	3.9	0.45041	.	0.490245	0.15234	U	0.273249	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0935	10.5937	0.45325	0.1919:0.8081:0.0:0.0	.	.	.	.	X	57	.	ENSP00000356633:R57X	R	+	1	2	PAPPA2	174792250	0.003000	0.15002	0.083000	0.20561	0.709000	0.40893	1.687000	0.37680	1.019000	0.39547	0.561000	0.74099	CGA		0.567	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			113	132	113	132
RGS21	431704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	192321182	192321182	+	Missense_Mutation	SNP	C	C	A			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr1:192321182C>A	ENST00000417209.2	+	4	268	c.94C>A	c.(94-96)Cta>Ata	p.L32I		NM_001039152.3	NP_001034241.1	Q2M5E4	RGS21_HUMAN	regulator of G-protein signaling 21	32	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			NS(1)|endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	15						TATAGCTGGTCTAGATGCTTT	0.303																																																0													51.0	48.0	49.0					1																	192321182		1798	4068	5866	SO:0001583	missense	431704			AY643711	CCDS41448.1	1q31.2	2013-09-24	2007-08-14		ENSG00000253148	ENSG00000253148		"""Regulators of G-protein signaling"""	26839	protein-coding gene	gene with protein product		612407	"""regulator of G-protein signalling 21"""			15066150	Standard	NM_001039152		Approved		uc001gsh.3	Q2M5E4	OTTHUMG00000035594	ENST00000417209.2:c.94C>A	1.37:g.192321182C>A	ENSP00000428343:p.Leu32Ile	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000417209.2	37	CCDS41448.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.327672	0.60743	.	.	ENSG00000253148	ENST00000417209	T	0.02085	4.46	5.77	1.82	0.25136	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.000000	0.27778	U	0.017895	T	0.05318	0.0141	L	0.49699	1.58	0.26280	N	0.978287	B	0.28439	0.212	P	0.45406	0.479	T	0.25363	-1.0134	10	0.42905	T	0.14	.	10.0981	0.42488	0.0:0.7227:0.0:0.2773	.	32	Q2M5E4	RGS21_HUMAN	I	32	ENSP00000428343:L32I	ENSP00000428343:L32I	L	+	1	2	RGS21	190587805	0.001000	0.12720	0.991000	0.47740	0.903000	0.53119	0.126000	0.15769	0.089000	0.17243	0.557000	0.71058	CTA		0.303	RGS21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086387.2			19	41	19	41
PLCG1	5335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	39802384	39802384	+	Missense_Mutation	SNP	G	G	A			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr20:39802384G>A	ENST00000373271.1	+	29	3892	c.3487G>A	c.(3487-3489)Gag>Aag	p.E1163K	PLCG1_ENST00000244007.3_Missense_Mutation_p.E1163K|PLCG1_ENST00000608689.1_3'UTR|PLCG1_ENST00000373272.2_Missense_Mutation_p.E1163K	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	1163	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				CGTGGTGTATGAGGAAGACAT	0.517											OREG0025953	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0													130.0	113.0	118.0					20																	39802384		2203	4300	6503	SO:0001583	missense	5335			M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.3487G>A	20.37:g.39802384G>A	ENSP00000362368:p.Glu1163Lys	Somatic	888	WXS	Illumina GAIIx	Phase_I	B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	ENST00000373271.1	37	CCDS13314.1	.	.	.	.	.	.	.	.	.	.	G	35	5.494412	0.96339	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	T;T;T	0.69685	-0.42;-0.42;-0.42	5.51	5.51	0.81932	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.82715	0.5097	M	0.84082	2.675	0.80722	D	1	P;D;D	0.57257	0.946;0.979;0.957	P;P;P	0.62298	0.839;0.9;0.9	D	0.84894	0.0838	10	0.72032	D	0.01	.	19.4219	0.94725	0.0:0.0:1.0:0.0	.	1163;1163;1163	P19174-2;P19174;A2A284	.;PLCG1_HUMAN;.	K	1163	ENSP00000244007:E1163K;ENSP00000362368:E1163K;ENSP00000362369:E1163K	ENSP00000244007:E1163K	E	+	1	0	PLCG1	39235798	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.858000	0.99539	2.593000	0.87608	0.455000	0.32223	GAG		0.517	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080514.3	NM_182811		54	121	54	121
ABCG1	9619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	21	43708163	43708163	+	Nonsense_Mutation	SNP	C	C	T	rs577566323		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr21:43708163C>T	ENST00000361802.2	+	9	1283	c.1138C>T	c.(1138-1140)Cga>Tga	p.R380*	ABCG1_ENST00000398437.1_Nonsense_Mutation_p.R526*|ABCG1_ENST00000347800.2_Intron|ABCG1_ENST00000462050.1_Intron|ABCG1_ENST00000343687.3_Intron|ABCG1_ENST00000398457.2_Intron|ABCG1_ENST00000340588.4_Nonsense_Mutation_p.R488*|ABCG1_ENST00000398449.3_Intron	NM_004915.3	NP_004906.3	P45844	ABCG1_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 1	380					amyloid precursor protein catabolic process (GO:0042987)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|detection of hormone stimulus (GO:0009720)|glycoprotein transport (GO:0034436)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of cholesterol efflux (GO:0010875)|regulation of cholesterol esterification (GO:0010872)|regulation of transcription, DNA-templated (GO:0006355)|response to high density lipoprotein particle (GO:0055099)|response to lipid (GO:0033993)|response to organic substance (GO:0010033)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|glycoprotein transporter activity (GO:0034437)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sterol-transporting ATPase activity (GO:0034041)|toxin transporter activity (GO:0019534)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(3)|prostate(2)|stomach(1)	29					Adenosine triphosphate(DB00171)	GCAGACAAAACGATTAAAGGG	0.562													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18775	0.0		0.0	False		,,,				2504	0.0															0													107.0	111.0	110.0					21																	43708163		2203	4300	6503	SO:0001587	stop_gained	9619			U34919	CCDS13681.1, CCDS13682.1, CCDS13683.1, CCDS42937.1, CCDS42938.1	21q22.3	2012-03-14			ENSG00000160179	ENSG00000160179		"""ATP binding cassette transporters / subfamily G"""	73	protein-coding gene	gene with protein product	"""ATP-binding cassette transporter 8"""	603076				8659545, 16870176	Standard	NM_016818		Approved	ABC8	uc002zaq.3	P45844	OTTHUMG00000086791	ENST00000361802.2:c.1138C>T	21.37:g.43708163C>T	ENSP00000354995:p.Arg380*	Somatic		WXS	Illumina GAIIx	Phase_I	Q86SU8|Q96L76|Q9BXK6|Q9BXK7|Q9BXK8|Q9BXK9|Q9BXL0|Q9BXL1|Q9BXL2|Q9BXL3|Q9BXL4	Nonsense_Mutation	SNP	ENST00000361802.2	37	CCDS13682.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	6.894930|6.894930	0.97916|0.97916	.|.	.|.	ENSG00000160179|ENSG00000160179	ENST00000361802;ENST00000398437;ENST00000340588|ENST00000489035	.|.	.|.	.|.	4.08|4.08	-0.407|-0.407	0.12385|0.12385	.|.	1.136030|.	0.06968|.	U|.	0.817564|.	.|T	.|0.37210	.|0.0995	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.44251	.|-0.9340	.|3	.|.	.|.	.|.	.|.	6.6515|6.6515	0.22965|0.22965	0.0:0.3667:0.447:0.1863|0.0:0.3667:0.447:0.1863	.|.	.|.	.|.	.|.	X|M	380;526;488|115	.|.	.|.	R|T	+|+	1|2	2|0	ABCG1|ABCG1	42581232|42581232	0.000000|0.000000	0.05858|0.05858	0.127000|0.127000	0.21898|0.21898	0.930000|0.930000	0.56654|0.56654	-0.314000|-0.314000	0.08092|0.08092	-0.128000|-0.128000	0.11641|0.11641	0.467000|0.467000	0.42956|0.42956	CGA|ACG		0.562	ABCG1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195318.2	NM_207174		22	181	22	181
CLASP1	23332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	122139824	122139824	+	Missense_Mutation	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr2:122139824C>T	ENST00000263710.4	-	33	3840	c.3451G>A	c.(3451-3453)Gct>Act	p.A1151T	CLASP1_ENST00000541377.1_Intron|CLASP1_ENST00000455322.2_Intron|CLASP1_ENST00000541859.1_Intron|CLASP1_ENST00000545861.1_Intron|CLASP1_ENST00000397587.3_Intron|CLASP1_ENST00000409078.3_Intron	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	1151					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					TGGGAGGGAGCGGTGGGGATG	0.522																																																0													62.0	74.0	70.0					2																	122139824		1981	4141	6122	SO:0001583	missense	23332			AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.3451G>A	2.37:g.122139824C>T	ENSP00000263710:p.Ala1151Thr	Somatic		WXS	Illumina GAIIx	Phase_I	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	37		.	.	.	.	.	.	.	.	.	.	C	16.90	3.249058	0.59103	.	.	ENSG00000074054	ENST00000263710	T	0.17691	2.26	5.55	5.55	0.83447	Armadillo-type fold (1);	0.067192	0.56097	D	0.000025	T	0.08670	0.0215	N	0.08118	0	0.80722	D	1	P	0.43352	0.804	B	0.32864	0.154	T	0.34925	-0.9809	10	0.22706	T	0.39	-20.0262	18.0488	0.89341	0.0:1.0:0.0:0.0	.	1151	Q7Z460	CLAP1_HUMAN	T	1151	ENSP00000263710:A1151T	ENSP00000263710:A1151T	A	-	1	0	CLASP1	121856294	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.438000	0.66550	2.768000	0.95171	0.655000	0.94253	GCT		0.522	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282		11	11	11	11
BIN1	274	hgsc.bcm.edu;broad.mit.edu	37	2	127828379	127828379	+	Missense_Mutation	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr2:127828379C>T	ENST00000316724.5	-	3	590	c.179G>A	c.(178-180)cGg>cAg	p.R60Q	BIN1_ENST00000393041.3_Missense_Mutation_p.R60Q|BIN1_ENST00000351659.3_Missense_Mutation_p.R60Q|BIN1_ENST00000376113.2_Missense_Mutation_p.R60Q|BIN1_ENST00000357970.3_Missense_Mutation_p.R60Q|BIN1_ENST00000348750.4_Missense_Mutation_p.R60Q|BIN1_ENST00000409400.1_Missense_Mutation_p.R60Q|BIN1_ENST00000352848.3_Missense_Mutation_p.R60Q|BIN1_ENST00000259238.4_Missense_Mutation_p.R60Q|BIN1_ENST00000393040.3_Missense_Mutation_p.R60Q|BIN1_ENST00000346226.3_Missense_Mutation_p.R60Q	NM_139343.2	NP_647593.1	O00499	BIN1_HUMAN	bridging integrator 1	60	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.|Interaction with BIN2.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|lipid tube assembly (GO:0060988)|muscle cell differentiation (GO:0042692)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of endocytosis (GO:0045807)|positive regulation of GTPase activity (GO:0043547)|regulation of cell cycle arrest (GO:0071156)|regulation of neuron differentiation (GO:0045664)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon initial segment (GO:0043194)|axon terminus (GO:0043679)|cerebellar mossy fiber (GO:0044300)|cytoplasm (GO:0005737)|I band (GO:0031674)|lipid tube (GO:0060987)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)|T-tubule (GO:0030315)|varicosity (GO:0043196)|Z disc (GO:0030018)	identical protein binding (GO:0042802)|tau protein binding (GO:0048156)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)	24	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		CTTCTGCAGCCGGGTGCCCTC	0.637																																																0													40.0	39.0	40.0					2																	127828379		2203	4300	6503	SO:0001583	missense	274			U68485	CCDS2137.1, CCDS2138.1, CCDS2139.1, CCDS2140.1, CCDS2141.1, CCDS2142.1, CCDS2143.1, CCDS42743.1, CCDS42744.1, CCDS46403.1	2q14	2014-09-17			ENSG00000136717	ENSG00000136717			1052	protein-coding gene	gene with protein product	"""amphiphysin II"""	601248		AMPHL		8725406, 8782822, 17676042	Standard	NM_004305		Approved	SH3P9, AMPH2	uc002tns.2	O00499	OTTHUMG00000131465	ENST00000316724.5:c.179G>A	2.37:g.127828379C>T	ENSP00000316779:p.Arg60Gln	Somatic		WXS	Illumina GAIIx	Phase_I	O00297|O00545|O43867|O60552|O60553|O60554|O60555|O75514|O75515|O75516|O75517|O75518|Q659B7|Q92944|Q99688	Missense_Mutation	SNP	ENST00000316724.5	37	CCDS2138.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.591030	0.46214	.	.	ENSG00000136717	ENST00000376113;ENST00000357970;ENST00000393040;ENST00000348750;ENST00000259238;ENST00000346226;ENST00000393041;ENST00000351659;ENST00000352848;ENST00000316724;ENST00000409400	T;T;T;T;T;T;T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15	4.49	3.56	0.40772	BAR (3);	0.161679	0.53938	D	0.000051	T	0.48537	0.1505	L	0.53671	1.685	0.46044	D	0.998839	B;B;B;B;B;P;B;B;B;B;B;B;B	0.44627	0.053;0.127;0.04;0.094;0.071;0.839;0.188;0.19;0.071;0.068;0.041;0.092;0.212	B;B;B;B;B;B;B;B;B;B;B;B;B	0.28232	0.037;0.062;0.003;0.007;0.003;0.077;0.036;0.012;0.003;0.004;0.002;0.002;0.087	T	0.60647	-0.7222	10	0.72032	D	0.01	-19.4026	11.1702	0.48567	0.1831:0.8169:0.0:0.0	.	60;36;60;60;60;60;60;60;60;60;60;60;60	B7Z2Z2;B7Z6Y2;O00499-4;O00499-7;O00499-6;O00499-2;O00499-3;O00499-8;O00499-11;O00499-5;O00499-10;O00499-9;O00499	.;.;.;.;.;.;.;.;.;.;.;.;BIN1_HUMAN	Q	60	ENSP00000365281:R60Q;ENSP00000350654:R60Q;ENSP00000376760:R60Q;ENSP00000259237:R60Q;ENSP00000259238:R60Q;ENSP00000315411:R60Q;ENSP00000376761:R60Q;ENSP00000315388:R60Q;ENSP00000315284:R60Q;ENSP00000316779:R60Q;ENSP00000386797:R60Q	ENSP00000259238:R60Q	R	-	2	0	BIN1	127544849	0.999000	0.42202	1.000000	0.80357	0.660000	0.38997	3.168000	0.50801	2.326000	0.78906	0.561000	0.74099	CGG		0.637	BIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254298.2	NM_139343		12	43	12	43
LCT	3938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	136567270	136567270	+	Missense_Mutation	SNP	C	C	T	rs187369069		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr2:136567270C>T	ENST00000264162.2	-	8	2657	c.2647G>A	c.(2647-2649)Gtt>Att	p.V883I	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	883	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TTTTCCCAAACGACTTTAGCC	0.502													c|||	1	0.000199681	0.0	0.0014	5008	,	,		18799	0.0		0.0	False		,,,				2504	0.0															0													147.0	153.0	151.0					2																	136567270		2203	4300	6503	SO:0001583	missense	3938			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2647G>A	2.37:g.136567270C>T	ENSP00000264162:p.Val883Ile	Somatic		WXS	Illumina GAIIx	Phase_I	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	c	14.49	2.550711	0.45383	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.30448	1.53	5.78	4.0	0.46444	.	0.124466	0.56097	N	0.000024	T	0.33702	0.0872	M	0.78049	2.395	0.32537	N	0.534142	P	0.41345	0.746	B	0.37091	0.241	T	0.50215	-0.8854	10	0.33940	T	0.23	-16.8748	12.7448	0.57276	0.0:0.8673:0.0:0.1327	.	883	P09848	LPH_HUMAN	I	883;315	ENSP00000264162:V883I	ENSP00000264162:V883I	V	-	1	0	LCT	136283740	0.996000	0.38824	0.992000	0.48379	0.903000	0.53119	3.375000	0.52410	0.803000	0.34113	-0.213000	0.12676	GTT		0.502	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299		46	131	46	131
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	179465605	179465605	+	Missense_Mutation	SNP	G	G	A			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr2:179465605G>A	ENST00000591111.1	-	238	51327	c.51103C>T	c.(51103-51105)Cct>Tct	p.P17035S	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P9611S|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P18676S|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P9736S|TTN_ENST00000342992.6_Missense_Mutation_p.P16108S|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P9803S|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589234.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17035	Fibronectin type-III 23. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAGTCACAGGGCCAACAGTG	0.448																																																0													119.0	126.0	124.0					2																	179465605		2200	4296	6496	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.51103C>T	2.37:g.179465605G>A	ENSP00000465570:p.Pro17035Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	14.91	2.676099	0.47886	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	5.66	5.66	0.87406	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71239	0.3316	M	0.73753	2.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.72773	-0.4192	9	0.87932	D	0	.	20.1041	0.97884	0.0:0.0:1.0:0.0	.	9803;17035	E7ET18;Q8WZ42	.;TITIN_HUMAN	S	16108;9611;9803;9736;9611	ENSP00000343764:P16108S;ENSP00000434586:P9611S;ENSP00000340554:P9803S;ENSP00000352154:P9736S	ENSP00000340554:P9803S	P	-	1	0	TTN	179173850	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	9.751000	0.98889	2.826000	0.97356	0.655000	0.94253	CCT		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		44	135	44	135
SDPR	8436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	192711355	192711355	+	Silent	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr2:192711355C>T	ENST00000304141.4	-	1	626	c.297G>A	c.(295-297)aaG>aaA	p.K99K	AC098617.1_ENST00000424116.2_RNA	NM_004657.5	NP_004648.1			serum deprivation response											NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			ACTTGGAGAGCTTGGTGAGGT	0.592																																																0													102.0	88.0	93.0					2																	192711355		2203	4300	6503	SO:0001819	synonymous_variant	8436			AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.297G>A	2.37:g.192711355C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000304141.4	37	CCDS2313.1																																																																																				0.592	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334791.2	NM_004657		21	52	21	52
ANKRD44	91526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	197943464	197943464	+	Missense_Mutation	SNP	T	T	G			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr2:197943464T>G	ENST00000328737.2	-	16	1614	c.1538A>C	c.(1537-1539)tAt>tCt	p.Y513S	ANKRD44_ENST00000539527.1_Missense_Mutation_p.Y466S|ANKRD44_ENST00000337207.5_Missense_Mutation_p.Y513S|ANKRD44_ENST00000477852.1_5'Flank|ANKRD44_ENST00000450567.1_Missense_Mutation_p.Y513S|ANKRD44_ENST00000282272.8_Missense_Mutation_p.Y530S|ANKRD44_ENST00000409153.1_Missense_Mutation_p.Y538S			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	538										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GGCGGCAGCATAATGTATGCT	0.413																																																0													113.0	96.0	102.0					2																	197943464		2203	4300	6503	SO:0001583	missense	91526			AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1538A>C	2.37:g.197943464T>G	ENSP00000331516:p.Tyr513Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	ENST00000328737.2	37		.	.	.	.	.	.	.	.	.	.	T	26.1	4.704685	0.88924	.	.	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207;ENST00000422886;ENST00000409153;ENST00000539527	T;T;T;T;T;T;T;T	0.72505	-0.14;-0.11;-0.14;-0.14;-0.11;-0.14;-0.14;-0.66	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.82029	0.4948	M	0.66506	2.035	0.58432	D	0.999999	D;D;D	0.76494	0.99;0.999;0.999	D;D;D	0.87578	0.947;0.998;0.998	T	0.80874	-0.1187	10	0.35671	T	0.21	.	15.6084	0.76692	0.0:0.0:0.0:1.0	.	466;538;556	F5H682;Q8N8A2-3;Q8N8A2-2	.;.;.	S	353;530;513;513;513;213;538;466	ENSP00000403415:Y353S;ENSP00000282272:Y530S;ENSP00000331516:Y513S;ENSP00000402420:Y513S;ENSP00000338794:Y513S;ENSP00000416319:Y213S;ENSP00000387141:Y538S;ENSP00000437825:Y466S	ENSP00000282272:Y530S	Y	-	2	0	ANKRD44	197651709	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	7.825000	0.86693	2.326000	0.78906	0.533000	0.62120	TAT		0.413	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697		11	37	11	37
GK2	2712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	80328975	80328975	+	Missense_Mutation	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr4:80328975C>T	ENST00000358842.3	-	1	397	c.380G>A	c.(379-381)aGt>aAt	p.S127N		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						AATTTTTTTACTAAGATCCTC	0.428																																																0													132.0	131.0	131.0					4																	80328975		2203	4300	6503	SO:0001583	missense	2712			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.380G>A	4.37:g.80328975C>T	ENSP00000351706:p.Ser127Asn	Somatic		WXS	Illumina GAIIx	Phase_I	Q7Z4Q4	Missense_Mutation	SNP	ENST00000358842.3	37	CCDS3585.1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.899771	0.00517	.	.	ENSG00000196475	ENST00000358842	T	0.48836	0.8	3.76	0.981	0.19756	Carbohydrate kinase, FGGY, N-terminal (1);	0.557783	0.19543	N	0.111756	T	0.25901	0.0631	N	0.20881	0.62	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.09952	-1.0651	10	0.27785	T	0.31	.	2.7942	0.05396	0.1774:0.3743:0.3459:0.1023	.	127	Q14410	GLPK2_HUMAN	N	127	ENSP00000351706:S127N	ENSP00000351706:S127N	S	-	2	0	GK2	80547999	0.002000	0.14202	0.003000	0.11579	0.001000	0.01503	1.604000	0.36804	0.182000	0.20032	-0.291000	0.09656	AGT		0.428	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	NM_033214		58	158	58	158
CDH9	1007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	26881407	26881407	+	Silent	SNP	T	T	G			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr5:26881407T>G	ENST00000231021.4	-	12	2380	c.2208A>C	c.(2206-2208)gcA>gcC	p.A736A		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	736					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AGGCATACGTTGCCAGCGAAT	0.418																																					Melanoma(8;187 585 15745 40864 52829)											0													143.0	134.0	137.0					5																	26881407		2203	4300	6503	SO:0001819	synonymous_variant	1007			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.2208A>C	5.37:g.26881407T>G		Somatic		WXS	Illumina GAIIx	Phase_I	Q3B7I5	Silent	SNP	ENST00000231021.4	37	CCDS3893.1																																																																																				0.418	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		63	126	63	126
ZNF366	167465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	71756221	71756221	+	Missense_Mutation	SNP	A	A	G			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr5:71756221A>G	ENST00000318442.5	-	2	1593	c.1103T>C	c.(1102-1104)gTg>gCg	p.V368A		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	368					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		GCCGCACTCCACACAGATGTT	0.657																																																0													82.0	73.0	76.0					5																	71756221		2203	4300	6503	SO:0001583	missense	167465			AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.1103T>C	5.37:g.71756221A>G	ENSP00000313158:p.Val368Ala	Somatic		WXS	Illumina GAIIx	Phase_I	Q5HYI9|Q7RTV4	Missense_Mutation	SNP	ENST00000318442.5	37	CCDS4015.1	.	.	.	.	.	.	.	.	.	.	A	19.82	3.898222	0.72639	.	.	ENSG00000178175	ENST00000318442	T	0.27256	1.68	5.8	5.8	0.92144	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.64402	D	0.000019	T	0.14830	0.0358	N	0.05554	-0.025	0.58432	D	0.999995	P	0.42908	0.793	B	0.41332	0.354	T	0.11891	-1.0569	10	0.10111	T	0.7	-38.6419	16.1412	0.81522	1.0:0.0:0.0:0.0	.	368	Q8N895	ZN366_HUMAN	A	368	ENSP00000313158:V368A	ENSP00000313158:V368A	V	-	2	0	ZNF366	71791977	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.361000	0.73070	2.211000	0.71520	0.459000	0.35465	GTG		0.657	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3			11	41	11	41
ARHGAP26	23092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	142526856	142526856	+	Missense_Mutation	SNP	G	G	A			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr5:142526856G>A	ENST00000274498.4	+	20	2276	c.1898G>A	c.(1897-1899)aGc>aAc	p.S633N	ARHGAP26_ENST00000378004.3_Missense_Mutation_p.S633N	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	633	Ser-rich.				actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AATCCAAACAGCATCCTTAAT	0.473																																																0													136.0	123.0	127.0					5																	142526856		2203	4300	6503	SO:0001583	missense	23092			AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.1898G>A	5.37:g.142526856G>A	ENSP00000274498:p.Ser633Asn	Somatic		WXS	Illumina GAIIx	Phase_I	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	ENST00000274498.4	37	CCDS4277.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.8|24.8	4.566594|4.566594	0.86439|0.86439	.|.	.|.	ENSG00000145819|ENSG00000145819	ENST00000443674;ENST00000418236|ENST00000274498;ENST00000378004;ENST00000418668	.|T;T	.|0.09255	.|3.0;3.11	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	.|0.278809	.|0.45361	.|D	.|0.000376	T|T	0.21022|0.21022	0.0506|0.0506	L|L	0.29908|0.29908	0.895|0.895	0.51767|0.51767	D|D	0.999932|0.999932	.|D;D;D	.|0.57899	.|0.967;0.967;0.981	.|P;P;D	.|0.63597	.|0.827;0.827;0.916	T|T	0.01208|0.01208	-1.1418|-1.1418	5|10	.|0.31617	.|T	.|0.26	.|.	18.111|18.111	0.89536|0.89536	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|633;206;633	.|Q9UNA1;B3KT96;Q9UNA1-2	.|RHG26_HUMAN;.;.	T|N	252;205|633;633;206	.|ENSP00000274498:S633N;ENSP00000367243:S633N	.|ENSP00000274498:S633N	A|S	+|+	1|2	0|0	ARHGAP26|ARHGAP26	142507049|142507049	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.986000|5.986000	0.70563|0.70563	2.636000|2.636000	0.89361|0.89361	0.655000|0.655000	0.94253|0.94253	GCA|AGC		0.473	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071		45	109	45	109
MGAM	8972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	141736692	141736692	+	Missense_Mutation	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr7:141736692C>T	ENST00000549489.2	+	18	2241	c.2146C>T	c.(2146-2148)Cgc>Tgc	p.R716C	MGAM_ENST00000475668.2_Missense_Mutation_p.R716C	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	716	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCTTAACATCCGCTATACTCT	0.532																																																0													186.0	193.0	191.0					7																	141736692		2118	4241	6359	SO:0001583	missense	8972			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2146C>T	7.37:g.141736692C>T	ENSP00000447378:p.Arg716Cys	Somatic		WXS	Illumina GAIIx	Phase_I	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782092	0.90282	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.97352	-4.35	5.81	4.91	0.64330	Glycoside hydrolase, superfamily (1);	0.000000	0.53938	D	0.000042	D	0.99146	0.9705	H	0.98849	4.35	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.98708	1.0703	10	0.87932	D	0	.	14.8449	0.70254	0.1529:0.8471:0.0:0.0	.	716	O43451	MGA_HUMAN	C	716;716;593	ENSP00000447378:R716C	ENSP00000316431:R593C	R	+	1	0	MGAM	141383161	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.075000	0.71261	1.427000	0.47276	0.650000	0.86243	CGC		0.532	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3			93	302	93	302
ADAM7	8756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	24350112	24350112	+	Splice_Site	SNP	T	T	A			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr8:24350112T>A	ENST00000175238.6	+	15	1738		c.e15+2		ADAM7_ENST00000380789.1_Splice_Site|RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000520720.1_Splice_Site|RP11-561E1.1_ENST00000519364.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TGAGGAGAAGTAAGTGCCCTG	0.373																																																0													74.0	80.0	78.0					8																	24350112		2203	4300	6503	SO:0001630	splice_region_variant	8756			AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.1655+2T>A	8.37:g.24350112T>A		Somatic		WXS	Illumina GAIIx	Phase_I	A8K8X7|O75959|Q6PEJ6	Splice_Site	SNP	ENST00000175238.6	37	CCDS6045.1	.	.	.	.	.	.	.	.	.	.	T	17.56	3.419016	0.62622	.	.	ENSG00000069206	ENST00000175238;ENST00000380789;ENST00000520720;ENST00000335595	.	.	.	5.54	4.36	0.52297	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9412	0.47275	0.0:0.0:0.1575:0.8425	.	.	.	.	.	-1	.	.	.	+	.	.	ADAM7	24406002	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	5.755000	0.68750	0.923000	0.37045	0.374000	0.22700	.		0.373	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817	Intron	22	56	22	56
ADAM7	8756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	24350563	24350563	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr8:24350563A>T	ENST00000175238.6	+	16	1746	c.1663A>T	c.(1663-1665)Aga>Tga	p.R555*	ADAM7_ENST00000380789.1_Nonsense_Mutation_p.R555*|RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000520720.1_Nonsense_Mutation_p.R327*|RP11-561E1.1_ENST00000519364.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	555	Cys-rich.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		CAGAGATGTCAGATGTGGAAA	0.448																																																0													70.0	72.0	71.0					8																	24350563		2203	4300	6503	SO:0001587	stop_gained	8756			AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.1663A>T	8.37:g.24350563A>T	ENSP00000175238:p.Arg555*	Somatic		WXS	Illumina GAIIx	Phase_I	A8K8X7|O75959|Q6PEJ6	Nonsense_Mutation	SNP	ENST00000175238.6	37	CCDS6045.1	.	.	.	.	.	.	.	.	.	.	A	36	5.853345	0.97030	.	.	ENSG00000069206	ENST00000175238;ENST00000380789;ENST00000520720;ENST00000335595	.	.	.	5.64	5.64	0.86602	.	0.209925	0.32952	N	0.005458	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	13.816	0.63292	1.0:0.0:0.0:0.0	.	.	.	.	X	555;555;327;370	.	ENSP00000175238:R555X	R	+	1	2	ADAM7	24406453	1.000000	0.71417	0.968000	0.41197	0.304000	0.27724	3.098000	0.50259	2.162000	0.67917	0.455000	0.32223	AGA		0.448	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817		13	62	13	62
MTERF3	51001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	97256197	97256197	+	Missense_Mutation	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr8:97256197C>T	ENST00000287025.3	-	7	1107	c.1009G>A	c.(1009-1011)Gtg>Atg	p.V337M	MTERFD1_ENST00000522822.1_Missense_Mutation_p.V216M|MTERFD1_ENST00000523821.1_Missense_Mutation_p.V337M|MTERFD1_ENST00000524341.1_Intron	NM_015942.3	NP_057026.3	Q96E29	MTEF3_HUMAN		337					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)	transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	24	Breast(36;5.16e-05)					ACATTGTGCACAAAATCAAAC	0.403																																																0													240.0	235.0	236.0					8																	97256197		2203	4300	6503	SO:0001583	missense	51001																														ENST00000287025.3:c.1009G>A	8.37:g.97256197C>T	ENSP00000287025:p.Val337Met	Somatic		WXS	Illumina GAIIx	Phase_I	B3KMG6|G3V130|Q9Y301	Missense_Mutation	SNP	ENST00000287025.3	37	CCDS6270.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947376	0.34377	.	.	ENSG00000156469	ENST00000523821;ENST00000522822;ENST00000287025	T;T;T	0.13307	2.6;2.6;2.6	6.16	5.28	0.74379	.	0.254699	0.39475	N	0.001359	T	0.30572	0.0769	M	0.71581	2.175	0.41349	D	0.987353	D;D	0.71674	0.983;0.998	P;P	0.60541	0.836;0.876	T	0.04454	-1.0950	10	0.56958	D	0.05	-14.6372	9.9417	0.41585	0.3729:0.5072:0.1199:0.0	.	337;337	E5RIK9;Q96E29	.;MTER1_HUMAN	M	337;216;337	ENSP00000429400:V337M;ENSP00000430138:V216M;ENSP00000287025:V337M	ENSP00000287025:V337M	V	-	1	0	MTERFD1	97325373	0.012000	0.17670	0.890000	0.34922	0.091000	0.18340	0.012000	0.13287	1.573000	0.49748	-0.284000	0.09977	GTG		0.403	MTERFD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379876.1			27	83	27	83
EFR3A	23167	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	132971845	132971845	+	Missense_Mutation	SNP	C	C	G			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr8:132971845C>G	ENST00000254624.5	+	8	1015	c.790C>G	c.(790-792)Cac>Gac	p.H264D	EFR3A_ENST00000519656.1_Missense_Mutation_p.H228D|EFR3A_ENST00000334503.4_Missense_Mutation_p.H264D	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	264						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			TTTAGATCATCACAAACTGTG	0.284																																																0													57.0	62.0	60.0					8																	132971845		2202	4288	6490	SO:0001583	missense	23167			D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.790C>G	8.37:g.132971845C>G	ENSP00000254624:p.His264Asp	Somatic		WXS	Illumina GAIIx	Phase_I	A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Missense_Mutation	SNP	ENST00000254624.5	37	CCDS34942.2	.	.	.	.	.	.	.	.	.	.	C	23.9	4.472459	0.84640	.	.	ENSG00000132294	ENST00000254624;ENST00000377917;ENST00000334503;ENST00000519656	T;T;T	0.63417	3.71;3.71;-0.04	5.64	5.64	0.86602	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80507	0.4636	M	0.81112	2.525	0.80722	D	1	D	0.65815	0.995	D	0.66979	0.948	T	0.82564	-0.0394	10	0.87932	D	0	-17.2853	18.7087	0.91648	0.0:1.0:0.0:0.0	.	264	Q14156	EFR3A_HUMAN	D	264;264;264;228	ENSP00000254624:H264D;ENSP00000334769:H264D;ENSP00000428086:H228D	ENSP00000254624:H264D	H	+	1	0	EFR3A	133041027	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.260000	0.78391	2.671000	0.90904	0.650000	0.86243	CAC		0.284	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318886.1	NM_015137		21	68	21	68
ADAMTSL1	92949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	18777565	18777565	+	Missense_Mutation	SNP	T	T	A			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr9:18777565T>A	ENST00000380548.4	+	19	3677	c.3338T>A	c.(3337-3339)cTg>cAg	p.L1113Q		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1113						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CGCAGCCACCTGGAGCACCAG	0.647																																																0													20.0	24.0	23.0					9																	18777565		2060	4187	6247	SO:0001583	missense	92949			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.3338T>A	9.37:g.18777565T>A	ENSP00000369921:p.Leu1113Gln	Somatic		WXS	Illumina GAIIx	Phase_I	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	T	3.375	-0.127522	0.06753	.	.	ENSG00000178031	ENST00000380548	T	0.62941	-0.01	5.88	2.21	0.28008	.	0.063246	0.08080	U	1.000000	T	0.38134	0.1029	N	0.14661	0.345	0.20975	N	0.999814	B	0.02656	0.0	B	0.06405	0.002	T	0.23691	-1.0181	10	0.13853	T	0.58	.	2.4251	0.04457	0.1245:0.1312:0.1306:0.6137	.	1113	Q8N6G6	ATL1_HUMAN	Q	1113	ENSP00000369921:L1113Q	ENSP00000369921:L1113Q	L	+	2	0	ADAMTSL1	18767565	0.003000	0.15002	0.319000	0.25293	0.102000	0.19082	1.309000	0.33539	0.125000	0.18397	-0.379000	0.06801	CTG		0.647	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1			6	13	6	13
ALDH1B1	219	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	38396064	38396064	+	Missense_Mutation	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr9:38396064C>T	ENST00000377698.3	+	2	472	c.319C>T	c.(319-321)Cgc>Tgc	p.R107C		NM_000692.4	NP_000683.3	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1 family, member B1	107			L -> R (in allele ALDHA1B1*3; dbSNP:rs2073478). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15164053, ECO:0000269|PubMed:8244338}.		carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)			NS(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(2)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)		GCTGCTGAACCGCCTGGCAGA	0.632																																																0													79.0	89.0	86.0					9																	38396064		2203	4300	6503	SO:0001583	missense	219			M63967	CCDS6615.1	9p13	2008-02-05			ENSG00000137124	ENSG00000137124	1.2.1.3	"""Aldehyde dehydrogenases"""	407	protein-coding gene	gene with protein product		100670		ALDH5		2061311	Standard	NM_000692		Approved	ALDHX	uc004aay.3	P30837	OTTHUMG00000019938	ENST00000377698.3:c.319C>T	9.37:g.38396064C>T	ENSP00000366927:p.Arg107Cys	Somatic		WXS	Illumina GAIIx	Phase_I	B2R8F0|Q8WX76|Q9BV45	Missense_Mutation	SNP	ENST00000377698.3	37	CCDS6615.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.164321	0.38217	.	.	ENSG00000137124	ENST00000377698	T	0.78364	-1.17	5.61	1.63	0.23807	.	0.182441	0.37761	N	0.001953	T	0.63815	0.2543	N	0.14661	0.345	0.58432	D	0.999993	.	.	.	.	.	.	T	0.59231	-0.7493	8	0.87932	D	0	.	6.0555	0.19809	0.2653:0.5884:0.0:0.1463	.	.	.	.	C	107	ENSP00000366927:R107C	ENSP00000366927:R107C	R	+	1	0	ALDH1B1	38386064	0.282000	0.24268	0.990000	0.47175	0.994000	0.84299	0.120000	0.15647	0.040000	0.15660	-0.126000	0.14955	CGC		0.632	ALDH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052492.1			39	117	39	117
CDK5RAP2	55755	hgsc.bcm.edu;broad.mit.edu	37	9	123152041	123152041	+	Missense_Mutation	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr9:123152041C>T	ENST00000349780.4	-	37	5782	c.5603G>A	c.(5602-5604)cGg>cAg	p.R1868Q	CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.R1827Q|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.R1789Q|CDK5RAP2_ENST00000480467.1_5'UTR|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.R1836Q	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1868	Interaction with PCNT and AKAP9.|Required for centrosomal attachment, Golgi localization and CALM1 interaction.				brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						TCTGGCCTTCCGAAGGATTTT	0.517																																																0													155.0	133.0	140.0					9																	123152041		2203	4300	6503	SO:0001583	missense	55755			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.5603G>A	9.37:g.123152041C>T	ENSP00000343818:p.Arg1868Gln	Somatic		WXS	Illumina GAIIx	Phase_I	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	ENST00000349780.4	37	CCDS6823.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930040	0.92389	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449;ENST00000425647	T;T;T;T;T;T	0.28069	3.46;3.4;3.46;3.39;1.92;1.63	5.64	5.64	0.86602	.	0.108387	0.40144	N	0.001175	T	0.55433	0.1920	M	0.72894	2.215	0.36045	D	0.840331	D;D;D;D	0.89917	0.998;1.0;1.0;0.999	P;D;D;D	0.87578	0.811;0.998;0.997;0.927	T	0.65236	-0.6217	10	0.72032	D	0.01	.	15.1982	0.73112	0.0:1.0:0.0:0.0	.	878;1789;1868;1262	Q5JTU8;Q96SN8-4;Q96SN8;B1AMJ5	.;.;CK5P2_HUMAN;.	Q	1836;1827;1868;1789;1262;878	ENSP00000354065:R1836Q;ENSP00000352258:R1827Q;ENSP00000343818:R1868Q;ENSP00000353317:R1789Q;ENSP00000400395:R1262Q;ENSP00000409941:R878Q	ENSP00000343818:R1868Q	R	-	2	0	CDK5RAP2	122191862	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.803000	0.38863	2.652000	0.90054	0.655000	0.94253	CGG		0.517	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249		6	66	6	66
DDX3X	1654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	41204458	41204458	+	Missense_Mutation	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chrX:41204458C>T	ENST00000399959.2	+	11	1906	c.1051C>T	c.(1051-1053)Cgg>Tgg	p.R351W	DDX3X_ENST00000457138.2_Missense_Mutation_p.R335W|DDX3X_ENST00000542215.1_3'UTR|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000478993.1_3'UTR|DDX3X_ENST00000441189.2_Intron	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	351	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Interaction with GSK3B.|Necessary for interaction with XPO1.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						TGAAGCTGATCGGATGTTGGA	0.408										HNSCC(61;0.18)																																						0													148.0	137.0	141.0					X																	41204458		2128	4268	6396	SO:0001583	missense	1654			U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1051C>T	X.37:g.41204458C>T	ENSP00000382840:p.Arg351Trp	Somatic		WXS	Illumina GAIIx	Phase_I	A8K538|B4E3E8|O15536	Missense_Mutation	SNP	ENST00000399959.2	37	CCDS43931.1	.	.	.	.	.	.	.	.	.	.	c	18.17	3.565120	0.65651	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	T;T	0.06371	3.31;3.31	5.5	3.67	0.42095	RNA helicase, ATP-dependent, DEAD-box, conserved site (1);DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.049958	0.85682	D	0.000000	T	0.39682	0.1087	H	0.98068	4.14	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.998;0.992;0.992	T	0.59408	-0.7460	10	0.87932	D	0	-8.2356	13.6505	0.62308	0.5837:0.4163:0.0:0.0	.	351;335;363;351	B4DLU5;B4E3E8;Q59GX6;O00571	.;.;.;DDX3X_HUMAN	W	351;335	ENSP00000382840:R351W;ENSP00000392494:R335W	ENSP00000382840:R351W	R	+	1	2	DDX3X	41089402	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	1.298000	0.33412	0.461000	0.27071	-0.229000	0.12294	CGG		0.408	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056253.1	NM_024005		60	52	60	52
RGAG1	57529	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	109695334	109695334	+	Missense_Mutation	SNP	A	A	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chrX:109695334A>T	ENST00000465301.2	+	3	1735	c.1489A>T	c.(1489-1491)Atg>Ttg	p.M497L	RGAG1_ENST00000540313.1_Missense_Mutation_p.M497L	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	497										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CTCTGGAAAGATGTCCACGCC	0.507																																																0													143.0	132.0	136.0					X																	109695334		2203	4300	6503	SO:0001583	missense	57529			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1489A>T	X.37:g.109695334A>T	ENSP00000419786:p.Met497Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	A	0.927	-0.713810	0.03206	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.42513	0.97;0.97	2.93	1.75	0.24633	.	.	.	.	.	T	0.35624	0.0938	M	0.62723	1.935	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.27262	-1.0079	8	.	.	.	9.1245	5.8164	0.18495	0.8572:0.0:0.1428:0.0	.	497	Q8NET4	RGAG1_HUMAN	L	497	ENSP00000419786:M497L;ENSP00000441452:M497L	.	M	+	1	0	RGAG1	109581990	0.003000	0.15002	0.000000	0.03702	0.016000	0.09150	1.603000	0.36794	0.395000	0.25257	0.345000	0.21793	ATG		0.507	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769		66	63	66	63
SMARCA1	6594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	128632026	128632026	+	Missense_Mutation	SNP	C	C	G	rs35325660		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chrX:128632026C>G	ENST00000371122.4	-	11	1429	c.1300G>C	c.(1300-1302)Gat>Cat	p.D434H	SMARCA1_ENST00000371121.3_Missense_Mutation_p.D434H|SMARCA1_ENST00000371123.1_Missense_Mutation_p.D434H	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	434					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						ACATCAATATCTTTCATCAGG	0.308																																																0													52.0	47.0	49.0					X																	128632026		2203	4300	6503	SO:0001583	missense	6594			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.1300G>C	X.37:g.128632026C>G	ENSP00000360163:p.Asp434His	Somatic		WXS	Illumina GAIIx	Phase_I	Q5JV41|Q5JV42	Missense_Mutation	SNP	ENST00000371122.4	37	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	c	20.9	4.070691	0.76301	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	D;D;D;D	0.93076	-3.16;-3.16;-3.16;-3.16	4.64	4.64	0.57946	SNF2-related (1);	0.000000	0.64402	U	0.000010	D	0.96546	0.8873	M	0.76838	2.35	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.998;0.999	D	0.97341	0.9957	10	0.87932	D	0	-16.8398	16.9538	0.86252	0.0:1.0:0.0:0.0	.	413;434;434;434	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	H	434;434;434;413	ENSP00000360162:D434H;ENSP00000360164:D434H;ENSP00000360163:D434H;ENSP00000404275:D413H	ENSP00000360162:D434H	D	-	1	0	SMARCA1	128459707	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.736000	0.84948	1.919000	0.55581	0.274000	0.19336	GAT		0.308	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069		18	18	18	18
IKBKE	9641	broad.mit.edu;ucsc.edu	37	1	206647731	206647731	+	Missense_Mutation	SNP	C	C	T	rs143140330		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr1:206647731C>T	ENST00000367120.3	+	4	518	c.145C>T	c.(145-147)Cgc>Tgc	p.R49C	IKBKE_ENST00000463979.1_3'UTR|IKBKE_ENST00000537984.1_5'UTR	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	49	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					CCTGCGGCCCCGCGAGGTGCA	0.582																																																0								C	,CYS/ARG,CYS/ARG	0,4406		0,0,2203	75.0	61.0	66.0		,145,145	5.2	0.9	1	dbSNP_134	66	1,8599	1.2+/-3.3	0,1,4299	no	utr-5,missense,missense	IKBKE	NM_001193321.1,NM_001193322.1,NM_014002.3	,180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,possibly-damaging,possibly-damaging	,49/658,49/717	206647731	1,13005	2203	4300	6503	SO:0001583	missense	9641			AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.145C>T	1.37:g.206647731C>T	ENSP00000356087:p.Arg49Cys	Somatic		WXS	Illumina GAIIx	Phase_I	D3DT78|Q3B754|Q3KR43|Q5JTS6	Missense_Mutation	SNP	ENST00000367120.3	37	CCDS30996.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670068	0.67814	0.0	1.16E-4	ENSG00000143466	ENST00000367120	T	0.65916	-0.18	5.25	5.25	0.73442	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.452022	0.25848	N	0.027908	T	0.69415	0.3108	L	0.45285	1.41	0.80722	D	1	D	0.76494	0.999	P	0.56916	0.809	T	0.68213	-0.5468	10	0.39692	T	0.17	0.0329	18.8572	0.92257	0.0:1.0:0.0:0.0	.	49	Q14164	IKKE_HUMAN	C	49	ENSP00000356087:R49C	ENSP00000356087:R49C	R	+	1	0	IKBKE	204714354	0.361000	0.24972	0.936000	0.37596	0.440000	0.31957	3.668000	0.54554	2.456000	0.83038	0.561000	0.74099	CGC		0.582	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088484.1			24	32	24	32
DNHD1	144132	broad.mit.edu;ucsc.edu	37	11	6588423	6588423	+	Missense_Mutation	SNP	G	G	A	rs376727342		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr11:6588423G>A	ENST00000527990.2	+	34	11684	c.11684G>A	c.(11683-11685)cGt>cAt	p.R3895H	DNHD1_ENST00000254579.6_Missense_Mutation_p.R3895H			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	3895					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		ATGAAGCCACGTGAGATTAAT	0.577																																																0								G	HIS/ARG	1,4203		0,1,2101	84.0	92.0	89.0		11684	-5.5	0.0	11		89	0,8424		0,0,4212	no	missense	DNHD1	NM_144666.2	29	0,1,6313	AA,AG,GG		0.0,0.0238,0.0079	benign	3895/4754	6588423	1,12627	2102	4212	6314	SO:0001583	missense	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.11684G>A	11.37:g.6588423G>A	ENSP00000436180:p.Arg3895His	Somatic		WXS	Illumina GAIIx	Phase_I	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	3.582	-0.085497	0.07097	2.38E-4	0.0	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000525883;ENST00000530197	T;T	0.27557	1.66;1.66	4.78	-5.46	0.02608	.	1.947330	0.02346	N	0.075446	T	0.14442	0.0349	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.22452	-1.0216	10	0.14252	T	0.57	9.9248	9.5164	0.39109	0.7016:0.1222:0.1762:0.0	.	2983;163;3895	B0I1S4;D3DQT9;Q96M86	.;.;DNHD1_HUMAN	H	3895;3895;163;163	ENSP00000254579:R3895H;ENSP00000436180:R3895H	ENSP00000254579:R3895H	R	+	2	0	DNHD1	6544999	0.000000	0.05858	0.000000	0.03702	0.818000	0.46254	-0.345000	0.07770	-0.674000	0.05253	0.561000	0.74099	CGT		0.577	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666		43	112	43	112
DNAH11	8701	broad.mit.edu;ucsc.edu	37	7	21742356	21742356	+	Missense_Mutation	SNP	T	T	C			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr7:21742356T>C	ENST00000409508.3	+	37	6240	c.6209T>C	c.(6208-6210)aTt>aCt	p.I2070T	DNAH11_ENST00000328843.6_Missense_Mutation_p.I2077T	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2077	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CTTCGTGCTATTAAGTCTGTC	0.388									Kartagener syndrome																																							0													129.0	120.0	122.0					7																	21742356		1907	4137	6044	SO:0001583	missense	8701	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.6209T>C	7.37:g.21742356T>C	ENSP00000475939:p.Ile2070Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	T	22.1	4.245867	0.80024	.	.	ENSG00000105877	ENST00000328843	T	0.14144	2.53	4.86	4.86	0.63082	.	0.228496	0.37857	N	0.001918	T	0.20455	0.0492	.	.	.	0.48395	D	0.999648	P	0.37781	0.608	B	0.43386	0.418	T	0.01524	-1.1333	9	0.87932	D	0	.	13.7234	0.62743	0.0:0.0:0.0:1.0	.	2077	Q96DT5	DYH11_HUMAN	T	2077	ENSP00000330671:I2077T	ENSP00000330671:I2077T	I	+	2	0	DNAH11	21708881	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.926000	0.87569	1.948000	0.56530	0.459000	0.35465	ATT		0.388	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777		12	42	12	42
KRTAP21-2	337978	broad.mit.edu;ucsc.edu	37	21	32119504	32119504	+	Missense_Mutation	SNP	T	T	C	rs145167151		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr21:32119504T>C	ENST00000333892.2	-	1	47	c.17A>G	c.(16-18)tAc>tGc	p.Y6C		NM_181617.1	NP_853648.1	Q3LI59	KR212_HUMAN	keratin associated protein 21-2	6						intermediate filament (GO:0005882)	structural constituent of cutaneous appendage (GO:0030281)			lung(4)|skin(2)|upper_aerodigestive_tract(1)	7						GCAGTTTCTGTAGTAGTTGCA	0.468																																																0								T	CYS/TYR	1,4405	2.1+/-5.4	0,1,2202	151.0	154.0	153.0		17	-1.7	0.0	21	dbSNP_134	153	0,8600		0,0,4300	no	missense	KRTAP21-2	NM_181617.1	194	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	possibly-damaging	6/84	32119504	1,13005	2203	4300	6503	SO:0001583	missense	337978			AP001709	CCDS13605.1	21q22.1	2006-03-13			ENSG00000187026	ENSG00000187026		"""Keratin associated proteins"""	18946	protein-coding gene	gene with protein product						12359730	Standard	NM_181617		Approved	KAP21.2	uc011adh.2	Q3LI59	OTTHUMG00000057769	ENST00000333892.2:c.17A>G	21.37:g.32119504T>C	ENSP00000334287:p.Tyr6Cys	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000333892.2	37	CCDS13605.1	.	.	.	.	.	.	.	.	.	.	T	1.028	-0.682779	0.03353	2.27E-4	0.0	ENSG00000187026	ENST00000333892	T	0.18016	2.24	4.96	-1.73	0.08081	.	0.236971	0.21589	U	0.072134	T	0.11707	0.0285	.	.	.	0.09310	N	1	P	0.46020	0.871	B	0.43331	0.416	T	0.16129	-1.0413	9	0.87932	D	0	-10.4293	0.9402	0.01354	0.1513:0.2645:0.1564:0.4279	.	6	Q3LI59	KR212_HUMAN	C	6	ENSP00000334287:Y6C	ENSP00000334287:Y6C	Y	-	2	0	KRTAP21-2	31041375	0.427000	0.25514	0.002000	0.10522	0.029000	0.11900	0.404000	0.20999	-0.363000	0.08101	0.454000	0.30748	TAC		0.468	KRTAP21-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128221.2			48	108	48	108
ANKRD34A	284615	broad.mit.edu;ucsc.edu	37	1	145473827	145473827	+	Missense_Mutation	SNP	G	G	A	rs201078779		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr1:145473827G>A	ENST00000323397.4	+	4	1792	c.499G>A	c.(499-501)Ggg>Agg	p.G167R	RP11-315I20.1_ENST00000600340.1_RNA	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	167						cytoplasm (GO:0005737)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ACCATCCCCAGGGGTGGAGGA	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16404	0.0		0.0	False		,,,				2504	0.0															0													59.0	58.0	58.0					1																	145473827		2203	4300	6503	SO:0001583	missense	284615			AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.499G>A	1.37:g.145473827G>A	ENSP00000314103:p.Gly167Arg	Somatic		WXS	Illumina GAIIx	Phase_I	B3KSU3	Missense_Mutation	SNP	ENST00000323397.4	37	CCDS30829.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	18.08	3.543156	0.65198	.	.	ENSG00000181039	ENST00000323397	T	0.72725	-0.68	5.1	5.1	0.69264	.	0.669254	0.13820	N	0.360468	T	0.69753	0.3146	L	0.42245	1.32	0.48185	D	0.999602	D	0.64830	0.994	P	0.56343	0.796	T	0.68842	-0.5302	10	0.46703	T	0.11	-14.5409	16.1	0.81166	0.0:0.0:1.0:0.0	.	167	Q69YU3	AN34A_HUMAN	R	167	ENSP00000314103:G167R	ENSP00000314103:G167R	G	+	1	0	ANKRD34A	144185184	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.277000	0.72608	2.654000	0.90174	0.485000	0.47835	GGG		0.617	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038512.1			23	90	23	90
OR10A5	144124	broad.mit.edu;ucsc.edu	37	11	6867517	6867517	+	Missense_Mutation	SNP	G	G	A	rs199844475		TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr11:6867517G>A	ENST00000299454.4	+	1	635	c.604G>A	c.(604-606)Gtc>Atc	p.V202I	OR10A5_ENST00000379831.2_Missense_Mutation_p.V206I			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	202					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V202L(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CTACGCCATCGTCGGAACCAT	0.512																																					Pancreas(44;21 1072 25662 28041 45559)											1	Substitution - Missense(1)	lung(1)						G	ILE/VAL	0,4402		0,0,2201	294.0	235.0	255.0		604	-3.4	0.0	11		255	1,8591		0,1,4295	no	missense	OR10A5	NM_178168.1	29	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	benign	202/318	6867517	1,12993	2201	4296	6497	SO:0001583	missense	144124			AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.604G>A	11.37:g.6867517G>A	ENSP00000299454:p.Val202Ile	Somatic		WXS	Illumina GAIIx	Phase_I	O95223|Q52M66|Q96R21|Q96R22	Missense_Mutation	SNP	ENST00000299454.4	37	CCDS7773.1	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	.	0.007	-1.943423	0.00479	0.0	1.16E-4	ENSG00000166363	ENST00000299454;ENST00000379831	T;T	0.00174	8.62;8.62	3.59	-3.44	0.04796	GPCR, rhodopsin-like superfamily (1);	0.239799	0.29218	N	0.012790	T	0.00073	0.0002	N	0.13003	0.285	0.09310	N	1	B	0.12630	0.006	B	0.15484	0.013	T	0.30736	-0.9968	10	0.19147	T	0.46	.	11.6873	0.51494	0.4858:0.0:0.5142:0.0	.	202	Q9H207	O10A5_HUMAN	I	202;206	ENSP00000299454:V202I;ENSP00000369159:V206I	ENSP00000299454:V202I	V	+	1	0	OR10A5	6824093	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-2.130000	0.01312	-1.185000	0.02716	-3.121000	0.00061	GTC		0.512	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385983.1	NM_178168		50	131	50	131
EFEMP2	30008	broad.mit.edu;ucsc.edu	37	11	65638766	65638766	+	Missense_Mutation	SNP	C	C	T			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr11:65638766C>T	ENST00000307998.6	-	4	459	c.229G>A	c.(229-231)Ggc>Agc	p.G77S	EFEMP2_ENST00000528176.1_Missense_Mutation_p.G77S	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	77	EGF-like 1; atypical. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		CACAAGTAGCCCCCGTAGTGG	0.647																																																0													126.0	137.0	133.0					11																	65638766		2201	4296	6497	SO:0001583	missense	30008			AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.229G>A	11.37:g.65638766C>T	ENSP00000309953:p.Gly77Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A8K7R4|B3KM31|B3KQT1|O75967	Missense_Mutation	SNP	ENST00000307998.6	37	CCDS8116.1	.	.	.	.	.	.	.	.	.	.	C	33	5.216206	0.95104	.	.	ENSG00000172638	ENST00000528176;ENST00000307998;ENST00000526624;ENST00000527378	D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48	4.93	4.93	0.64822	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);	0.000000	0.40222	N	0.001146	D	0.89026	0.6598	L	0.28608	0.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.83771	0.0220	10	0.02654	T	1	.	15.6604	0.77182	0.0:1.0:0.0:0.0	.	77;77	E9PRU1;O95967	.;FBLN4_HUMAN	S	77	ENSP00000434151:G77S;ENSP00000309953:G77S;ENSP00000435419:G77S;ENSP00000435963:G77S	ENSP00000309953:G77S	G	-	1	0	EFEMP2	65395342	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.429000	0.66495	2.553000	0.86117	0.655000	0.94253	GGC		0.647	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391047.4	NM_016938		36	140	36	140
PDGFRA	5156	broad.mit.edu	37	4	55161298	55161298	+	Missense_Mutation	SNP	G	G	C			TCGA-CS-4941-01A-01D-1468-08	TCGA-CS-4941-10A-01D-1468-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	003ed478-ceca-4752-8ae4-4cf12e6844bd	56e3b45b-55fa-4b7e-8998-920c8125aab1	g.chr4:55161298G>C	ENST00000257290.5	+	23	3460	c.3129G>C	c.(3127-3129)caG>caC	p.Q1043H	FIP1L1_ENST00000507166.1_Missense_Mutation_p.Q803H	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	1043	Ser-rich.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	CCAGCTCGCAGACCTCTGAAG	0.507			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	0													112.0	100.0	104.0					4																	55161298		2203	4300	6503	SO:0001583	missense	5156	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.3129G>C	4.37:g.55161298G>C	ENSP00000257290:p.Gln1043His	Somatic		WXS	Illumina GAIIx	Phase_I	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	37	CCDS3495.1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.648885	0.29336	.	.	ENSG00000145216;ENSG00000134853	ENST00000507166;ENST00000257290	T;T	0.78364	-1.17;-1.0	5.75	4.91	0.64330	.	0.000000	0.30781	U	0.008885	D	0.83110	0.5183	L	0.51422	1.61	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	T	0.82596	-0.0379	10	0.45353	T	0.12	.	10.7578	0.46247	0.1448:0.0:0.8552:0.0	.	1043	P16234	PGFRA_HUMAN	H	803;1043	ENSP00000423325:Q803H;ENSP00000257290:Q1043H	ENSP00000423325:Q803H	Q	+	3	2	FIP1L1;PDGFRA	54856055	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	3.198000	0.51035	1.439000	0.47511	0.462000	0.41574	CAG		0.507	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206		5	129	5	129
