#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
ADARB2	105	hgsc.bcm.edu;broad.mit.edu	37	10	1405304	1405304	+	Silent	SNP	C	C	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr10:1405304C>T	ENST00000381312.1	-	3	1321	c.996G>A	c.(994-996)gcG>gcA	p.A332A	RP11-398B16.2_ENST00000432987.1_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	332	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GTGCGGCCTGCGCGGCCTGAC	0.746																																																0													7.0	7.0	7.0					10																	1405304		2094	4144	6238	SO:0001819	synonymous_variant	105			AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.996G>A	10.37:g.1405304C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B2RPJ5|Q5VUT6|Q5VW42	Silent	SNP	ENST00000381312.1	37	CCDS7058.1																																																																																				0.746	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046426.1	NM_018702		10	7	10	7
PRF1	5551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	72358832	72358832	+	Silent	SNP	A	A	C			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr10:72358832A>C	ENST00000441259.1	-	3	805	c.645T>G	c.(643-645)ctT>ctG	p.L215L	PRF1_ENST00000373209.2_Silent_p.L215L	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	215	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						AGTTGGAGATAAGCCTGAGGT	0.662			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																													yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	0													37.0	42.0	40.0					10																	72358832		2203	4300	6503	SO:0001819	synonymous_variant	5551	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.645T>G	10.37:g.72358832A>C		Somatic		WXS	Illumina GAIIx	Phase_I	B2R6X4|Q59F57|Q86WX7	Silent	SNP	ENST00000441259.1	37	CCDS7305.1																																																																																				0.662	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2	NM_005041		30	44	30	44
PDE6C	5146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	95425134	95425134	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr10:95425134G>A	ENST00000371447.3	+	22	2674	c.2536G>A	c.(2536-2538)Ggt>Agt	p.G846S	PDE6C_ENST00000475427.2_3'UTR	NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	846					phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	AGATTCAGGAGGTGGTGATGA	0.313																																																0													162.0	162.0	162.0					10																	95425134		2203	4300	6503	SO:0001583	missense	5146			U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.2536G>A	10.37:g.95425134G>A	ENSP00000360502:p.Gly846Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A6NCR6|Q5VY29	Missense_Mutation	SNP	ENST00000371447.3	37	CCDS7429.1	.	.	.	.	.	.	.	.	.	.	G	11.78	1.739245	0.30774	.	.	ENSG00000095464	ENST00000371447	T	0.63580	-0.05	5.15	-0.0646	0.13771	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.313322	0.37577	N	0.002035	T	0.49949	0.1587	L	0.53561	1.675	0.34085	D	0.660049	B	0.06786	0.001	B	0.11329	0.006	T	0.48833	-0.9000	10	0.52906	T	0.07	.	5.6285	0.17497	0.3255:0.1373:0.5371:0.0	.	846	P51160	PDE6C_HUMAN	S	846	ENSP00000360502:G846S	ENSP00000360502:G846S	G	+	1	0	PDE6C	95415124	0.973000	0.33851	0.485000	0.27403	0.782000	0.44232	0.723000	0.25939	0.100000	0.17581	0.655000	0.94253	GGT		0.313	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049437.1	NM_006204		9	34	9	34
OR52B4	143496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	4388941	4388941	+	Silent	SNP	T	T	C			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr11:4388941T>C	ENST00000408920.2	-	1	675	c.585A>G	c.(583-585)cgA>cgG	p.R195R		NM_001005161.3	NP_001005161.2	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B, member 4	195					cognition (GO:0050890)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(15)|skin(2)	31		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAATGTTTATTCGAATGTCAT	0.343																																																0													73.0	70.0	71.0					11																	4388941		1857	4099	5956	SO:0001819	synonymous_variant	143496			AB065792	CCDS41609.1	11p15.4	2012-08-09			ENSG00000221996	ENSG00000221996		"""GPCR / Class A : Olfactory receptors"""	15209	protein-coding gene	gene with protein product							Standard	NM_001005161		Approved		uc010qye.2	Q8NGK2	OTTHUMG00000154222	ENST00000408920.2:c.585A>G	11.37:g.4388941T>C		Somatic		WXS	Illumina GAIIx	Phase_I	A6NP68|Q6IFK6	Silent	SNP	ENST00000408920.2	37	CCDS41609.1																																																																																				0.343	OR52B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334449.3	NM_001005161		28	52	28	52
SDS	10993	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	113830761	113830761	+	Silent	SNP	A	A	G			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr12:113830761A>G	ENST00000257549.4	-	8	1094	c.972T>C	c.(970-972)aaT>aaC	p.N324N		NM_006843.2	NP_006834.2	P20132	SDHL_HUMAN	serine dehydratase	324					gluconeogenesis (GO:0006094)|L-serine catabolic process (GO:0006565)|pyruvate biosynthetic process (GO:0042866)|response to amino acid (GO:0043200)|response to cobalamin (GO:0033590)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	L-serine ammonia-lyase activity (GO:0003941)|L-threonine ammonia-lyase activity (GO:0004794)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			large_intestine(2)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(1)	11					L-Serine(DB00133)	TGGGCAACCTATTTGTCATGC	0.617																																																0													138.0	147.0	144.0					12																	113830761		2203	4300	6503	SO:0001819	synonymous_variant	10993			J05037	CCDS9169.1	12q24.13	2014-06-24			ENSG00000135094	ENSG00000135094	4.3.1.17		10691	protein-coding gene	gene with protein product	"""L-serine ammonia-lyase"""	182128				2674117	Standard	NM_006843		Approved	SDH	uc001tvg.3	P20132	OTTHUMG00000169554	ENST00000257549.4:c.972T>C	12.37:g.113830761A>G		Somatic		WXS	Illumina GAIIx	Phase_I	A8K9P5	Silent	SNP	ENST00000257549.4	37	CCDS9169.1																																																																																				0.617	SDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404790.1	NM_006843		163	214	163	214
KLF5	688	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	73636332	73636332	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr13:73636332G>A	ENST00000377687.4	+	2	1131	c.595G>A	c.(595-597)Gca>Aca	p.A199T	KLF5_ENST00000477333.1_3'UTR|KLF5_ENST00000539231.1_Missense_Mutation_p.A108T	NM_001730.3	NP_001721.2	Q13887	KLF5_HUMAN	Kruppel-like factor 5 (intestinal)	199					angiogenesis (GO:0001525)|cellular response to organic cyclic compound (GO:0071407)|cellular response to peptide (GO:1901653)|intestinal epithelial cell development (GO:0060576)|microvillus assembly (GO:0030033)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microvillus assembly (GO:0032534)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		ACACCAGACCGCAGCTCCAGA	0.532																																																0													70.0	73.0	72.0					13																	73636332		2203	4300	6503	SO:0001583	missense	688			D14520	CCDS9448.1, CCDS66562.1	13q21.3	2013-01-08			ENSG00000102554	ENSG00000102554		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6349	protein-coding gene	gene with protein product		602903		BTEB2		8479902, 9973612	Standard	NM_001730		Approved	IKLF, CKLF	uc001vje.3	Q13887	OTTHUMG00000017074	ENST00000377687.4:c.595G>A	13.37:g.73636332G>A	ENSP00000366915:p.Ala199Thr	Somatic		WXS	Illumina GAIIx	Phase_I	L0R3U5|L0R4T9|Q9UHP8	Missense_Mutation	SNP	ENST00000377687.4	37	CCDS9448.1	.	.	.	.	.	.	.	.	.	.	G	8.829	0.939422	0.18281	.	.	ENSG00000102554	ENST00000539231;ENST00000377687;ENST00000545883	T;T	0.06687	3.42;3.27	5.94	3.24	0.37175	.	0.390815	0.28290	N	0.015886	T	0.06188	0.0160	L	0.36672	1.1	0.28469	N	0.915513	B	0.10296	0.003	B	0.04013	0.001	T	0.37502	-0.9703	10	0.19147	T	0.46	.	6.5957	0.22672	0.1577:0.0:0.6969:0.1455	.	199	Q13887	KLF5_HUMAN	T	108;199;179	ENSP00000440407:A108T;ENSP00000366915:A199T	ENSP00000366915:A199T	A	+	1	0	KLF5	72534333	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.476000	0.35420	0.384000	0.24942	0.561000	0.74099	GCA		0.532	KLF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045263.1			46	44	46	44
CLEC14A	161198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	38723787	38723787	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr14:38723787C>T	ENST00000342213.2	-	1	1787	c.1441G>A	c.(1441-1443)Gcg>Acg	p.A481T		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	481						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		GGGGACTCCGCCAGCAAGGCA	0.547																																																0													71.0	73.0	72.0					14																	38723787		2203	4300	6503	SO:0001583	missense	161198				CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.1441G>A	14.37:g.38723787C>T	ENSP00000353013:p.Ala481Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q695G9|Q6PWT6|Q8N5V5	Missense_Mutation	SNP	ENST00000342213.2	37	CCDS9667.1	.	.	.	.	.	.	.	.	.	.	C	2.681	-0.275457	0.05679	.	.	ENSG00000176435	ENST00000342213	T	0.74842	-0.88	4.86	2.88	0.33553	.	1.197340	0.06536	N	0.742457	T	0.49355	0.1552	N	0.04508	-0.205	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.39231	-0.9624	10	0.08179	T	0.78	0.0971	6.2086	0.20615	0.0:0.7164:0.0:0.2836	.	481	Q86T13	CLC14_HUMAN	T	481	ENSP00000353013:A481T	ENSP00000353013:A481T	A	-	1	0	CLEC14A	37793538	0.000000	0.05858	0.007000	0.13788	0.149000	0.21700	-0.042000	0.12063	0.597000	0.29811	0.563000	0.77884	GCG		0.547	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060		50	117	50	117
TELO2	9894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	1557703	1557703	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr16:1557703G>A	ENST00000262319.6	+	20	2672	c.2393G>A	c.(2392-2394)cGg>cAg	p.R798Q		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	798					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				CTGGAAGCCCGGTCCTGGCTG	0.647																																																0													48.0	41.0	43.0					16																	1557703		2198	4298	6496	SO:0001583	missense	9894			AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.2393G>A	16.37:g.1557703G>A	ENSP00000262319:p.Arg798Gln	Somatic		WXS	Illumina GAIIx	Phase_I	D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	ENST00000262319.6	37	CCDS32363.1	.	.	.	.	.	.	.	.	.	.	G	2.441	-0.328566	0.05314	.	.	ENSG00000100726	ENST00000437914;ENST00000262319	T	0.30448	1.53	5.15	4.19	0.49359	.	0.196126	0.51477	N	0.000081	T	0.28300	0.0699	L	0.54965	1.715	0.30638	N	0.756807	B	0.12013	0.005	B	0.06405	0.002	T	0.18777	-1.0326	10	0.21540	T	0.41	-11.3041	12.6233	0.56616	0.1478:0.0:0.8522:0.0	.	798	Q9Y4R8	TELO2_HUMAN	Q	321;798	ENSP00000262319:R798Q	ENSP00000262319:R798Q	R	+	2	0	TELO2	1497704	0.999000	0.42202	0.301000	0.25044	0.203000	0.24098	2.939000	0.48995	0.591000	0.29711	-1.598000	0.00824	CGG		0.647	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103602.2	NM_016111		15	30	15	30
PDILT	204474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	20387485	20387485	+	Nonsense_Mutation	SNP	G	G	A	rs139247719	byFrequency	TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr16:20387485G>A	ENST00000302451.4	-	4	696	c.448C>T	c.(448-450)Cga>Tga	p.R150*		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	150					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						CTAATTTGTCGTCTCAACCAA	0.463													G|||	2	0.000399361	0.0015	0.0	5008	,	,		19351	0.0		0.0	False		,,,				2504	0.0															0													120.0	92.0	102.0					16																	20387485		2203	4300	6503	SO:0001587	stop_gained	204474				CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.448C>T	16.37:g.20387485G>A	ENSP00000305465:p.Arg150*	Somatic		WXS	Illumina GAIIx	Phase_I	Q8IVQ5	Nonsense_Mutation	SNP	ENST00000302451.4	37	CCDS10584.1	.	.	.	.	.	.	.	.	.	.	G	37	6.503133	0.97620	.	.	ENSG00000169340	ENST00000302451	.	.	.	4.65	0.987	0.19790	.	0.089773	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	11.2991	0.49295	0.0:0.0:0.4739:0.5261	.	.	.	.	X	150	.	ENSP00000305465:R150X	R	-	1	2	PDILT	20294986	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	3.078000	0.50096	0.041000	0.15688	-0.271000	0.10264	CGA		0.463	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924		33	36	33	36
ATXN2L	11273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	28847394	28847394	+	Silent	SNP	A	A	G			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr16:28847394A>G	ENST00000336783.4	+	22	3203	c.3036A>G	c.(3034-3036)gcA>gcG	p.A1012A	ATXN2L_ENST00000395547.2_Silent_p.A1012A|ATXN2L_ENST00000564304.1_Silent_p.A1018A|ATXN2L_ENST00000570200.1_Silent_p.A1012A|ATXN2L_ENST00000340394.8_Silent_p.A1012A|ATXN2L_ENST00000325215.6_Silent_p.A1012A|ATXN2L_ENST00000382686.4_Silent_p.A1012A|RP11-24N18.1_ENST00000563565.1_RNA	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	1012					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						GGGTGCCTGCACTCTCAGCTT	0.687																																																0													41.0	49.0	46.0					16																	28847394		2194	4299	6493	SO:0001819	synonymous_variant	11273				CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.3036A>G	16.37:g.28847394A>G		Somatic		WXS	Illumina GAIIx	Phase_I	A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Silent	SNP	ENST00000336783.4	37	CCDS10641.1																																																																																				0.687	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214139.1	NM_007245		71	106	71	106
SEZ6L2	26470	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	29888271	29888271	+	Splice_Site	SNP	T	T	G			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr16:29888271T>G	ENST00000308713.5	-	12	2437	c.1910A>C	c.(1909-1911)gAg>gCg	p.E637A	SEZ6L2_ENST00000350527.3_Splice_Site_p.E567A|SEZ6L2_ENST00000537485.1_Splice_Site_p.E593A|SEZ6L2_ENST00000346932.5_Splice_Site_p.E523A	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	637	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CCTCGGGACCTCTGCAGGGGA	0.667																																																0													28.0	30.0	29.0					16																	29888271		2197	4300	6497	SO:0001630	splice_region_variant	26470			AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1910-1A>C	16.37:g.29888271T>G		Somatic		WXS	Illumina GAIIx	Phase_I	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Splice_Site	SNP	ENST00000308713.5	37	CCDS10659.1	.	.	.	.	.	.	.	.	.	.	T	31	5.101656	0.94245	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.24538	1.85;1.85;1.85;1.85	5.57	5.57	0.84162	CUB (3);	0.107337	0.41194	D	0.000930	T	0.41396	0.1157	L	0.36672	1.1	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.998;0.991;0.998;0.998;0.999	D;D;P;D;D;D	0.91635	0.999;0.992;0.901;0.995;0.986;0.997	T	0.18429	-1.0337	10	0.48119	T	0.1	.	14.7065	0.69194	0.0:0.0:0.0:1.0	.	593;637;523;567;637;567	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	A	567;637;523;593	ENSP00000310206:E567A;ENSP00000312550:E637A;ENSP00000319215:E523A;ENSP00000439412:E593A	ENSP00000312550:E637A	E	-	2	0	SEZ6L2	29795772	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.698000	0.84413	2.116000	0.64780	0.533000	0.62120	GAG		0.667	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	Missense_Mutation	17	40	17	40
CENPT	80152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	67859118	67859118	+	IGR	SNP	G	G	A			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr16:67859118G>A	ENST00000562787.1	-	0	2345				TSNAXIP1_ENST00000415766.3_Missense_Mutation_p.A184T|TSNAXIP1_ENST00000561639.1_Missense_Mutation_p.A253T|TSNAXIP1_ENST00000388833.3_Missense_Mutation_p.A199T|TSNAXIP1_ENST00000562321.1_3'UTR	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T						chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		GATCCTCATCGCAGACCTGAA	0.542																																																0													98.0	102.0	101.0					16																	67859118		2073	4214	6287	SO:0001628	intergenic_variant	55815			AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3			16.37:g.67859118G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	ENST00000562787.1	37	CCDS42182.1	.	.	.	.	.	.	.	.	.	.	G	9.244	1.039053	0.19669	.	.	ENSG00000102904	ENST00000415766;ENST00000388833	T;T	0.00958	5.5;5.5	6.07	3.94	0.45596	.	0.246251	0.33144	N	0.005229	T	0.00967	0.0032	L	0.47716	1.5	0.22199	N	0.999293	P;B;B	0.36249	0.545;0.104;0.061	B;B;B	0.23716	0.048;0.029;0.029	T	0.52223	-0.8604	10	0.31617	T	0.26	-2.6414	10.0789	0.42377	0.1671:0.0:0.8329:0.0	.	184;253;199	E7ENJ7;B4DXD0;Q2TAA8	.;.;TXIP1_HUMAN	T	184;199	ENSP00000411472:A184T;ENSP00000373485:A199T	ENSP00000373485:A199T	A	+	1	0	TSNAXIP1	66416619	0.962000	0.33011	0.117000	0.21633	0.118000	0.20060	1.875000	0.39578	0.777000	0.33496	-0.140000	0.14226	GCA		0.542	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082		45	63	45	63
NEURL4	84461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	7231068	7231068	+	Missense_Mutation	SNP	G	G	A	rs369191676		TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr17:7231068G>A	ENST00000399464.2	-	2	433	c.418C>T	c.(418-420)Cgc>Tgc	p.R140C	NEURL4_ENST00000570460.1_Missense_Mutation_p.R140C|NEURL4_ENST00000315614.7_Missense_Mutation_p.R140C	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	140	NHR 1. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AACACAGAGCGTCCATCTCTC	0.642																																																0								G	CYS/ARG,CYS/ARG	1,4315		0,1,2157	66.0	76.0	73.0		418,418	5.5	1.0	17		73	0,8506		0,0,4253	no	missense,missense	NEURL4	NM_001005408.1,NM_032442.2	180,180	0,1,6410	AA,AG,GG		0.0,0.0232,0.0078	probably-damaging,probably-damaging	140/1561,140/1563	7231068	1,12821	2158	4253	6411	SO:0001583	missense	84461				CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.418C>T	17.37:g.7231068G>A	ENSP00000382390:p.Arg140Cys	Somatic		WXS	Illumina GAIIx	Phase_I	Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	37	CCDS42251.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511903	0.85389	2.32E-4	0.0	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.73469	-0.75;-0.75	5.48	5.48	0.80851	Concanavalin A-like lectin/glucanase (1);NEUZ (2);	0.000000	0.85682	D	0.000000	T	0.80363	0.4609	L	0.33293	1	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.988	T	0.81050	-0.1108	10	0.56958	D	0.05	-15.5642	16.6242	0.84937	0.0:0.0:1.0:0.0	.	140;140	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	C	140	ENSP00000319826:R140C;ENSP00000382390:R140C	ENSP00000319826:R140C	R	-	1	0	NEURL4	7171792	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.378000	0.90144	2.731000	0.93534	0.650000	0.86243	CGC		0.642	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	NM_032442		69	98	69	98
PRKAR1A	5573	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	66526499	66526499	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr17:66526499G>A	ENST00000589228.1	+	11	1183	c.1055G>A	c.(1054-1056)cGa>cAa	p.R352Q	PRKAR1A_ENST00000536854.2_Missense_Mutation_p.R352Q|PRKAR1A_ENST00000586397.1_Missense_Mutation_p.R352Q|PRKAR1A_ENST00000392711.1_Missense_Mutation_p.R352Q|PRKAR1A_ENST00000358598.2_Missense_Mutation_p.R352Q|PRKAR1A_ENST00000588188.2_Intron	NM_001276289.1|NM_001278433.1	NP_001263218.1|NP_001265362.1	P10644	KAP0_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, alpha	352					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cardiac muscle cell proliferation (GO:0060038)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|female meiotic division (GO:0007143)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sarcomere organization (GO:0045214)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			adrenal_gland(4)|breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|soft_tissue(2)|stomach(2)|testis(1)|thyroid(2)|upper_aerodigestive_tract(1)	31	Breast(10;1.64e-13)					AAGCTGGACCGACCTAGATTT	0.488			"""T, Mis, N, F, S"""	RET	papillary thyroid	"""myxoma, endocrine, papillary thyroid"""			Primary Pigmented Nodular Adrenocortical Disease, Familial;Carney Complex;Cardiac Myxomas, Familial Clustering of																												Ovarian(167;637 1670 33025 39608 46699 51856)	yes	"""Dom, Rec"""	yes	Carney complex	17	17q23-q24	5573	"""protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)"""		"""E, M"""	0													256.0	205.0	222.0					17																	66526499		2203	4300	6503	SO:0001583	missense	5573	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2;Carney syndrome, NAME syndrome, LAMB syndrome, Familial Myxoma syndrome;		CCDS11678.1, CCDS62307.1	17q24.2	2014-09-17	2012-07-31		ENSG00000108946	ENSG00000108946	2.7.11.1		9388	protein-coding gene	gene with protein product	"""Carney complex type 1"""	188830	"""tissue specific extinguisher 1"""	PRKAR1, TSE1		3479018, 10973256	Standard	NM_212471		Approved	CNC1	uc002jhg.4	P10644	OTTHUMG00000180128	ENST00000589228.1:c.1055G>A	17.37:g.66526499G>A	ENSP00000464977:p.Arg352Gln	Somatic		WXS	Illumina GAIIx	Phase_I	K7ER48|Q567S7	Missense_Mutation	SNP	ENST00000589228.1	37	CCDS11678.1	.	.	.	.	.	.	.	.	.	.	G	36	5.967561	0.97156	.	.	ENSG00000108946	ENST00000358598;ENST00000392711;ENST00000392710;ENST00000536854	D;D;D	0.89746	-2.56;-2.56;-2.56	5.9	5.9	0.94986	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.95001	0.8382	M	0.80508	2.5	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94502	0.7710	10	0.59425	D	0.04	-7.5886	20.2704	0.98474	0.0:0.0:1.0:0.0	.	352	P10644	KAP0_HUMAN	Q	352	ENSP00000351410:R352Q;ENSP00000376475:R352Q;ENSP00000445625:R352Q	ENSP00000351410:R352Q	R	+	2	0	PRKAR1A	64038094	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.824000	0.99380	2.793000	0.96121	0.591000	0.81541	CGA		0.488	PRKAR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449884.1			55	74	55	74
SMCHD1	23347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	2732375	2732375	+	Missense_Mutation	SNP	A	A	G			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr18:2732375A>G	ENST00000320876.6	+	25	3499	c.3161A>G	c.(3160-3162)cAt>cGt	p.H1054R	SMCHD1_ENST00000261598.8_Missense_Mutation_p.H1054R|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1054					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						CAGATCAAACATCAGGATGAG	0.363																																																0													141.0	128.0	132.0					18																	2732375		1855	4099	5954	SO:0001583	missense	23347			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.3161A>G	18.37:g.2732375A>G	ENSP00000326603:p.His1054Arg	Somatic		WXS	Illumina GAIIx	Phase_I	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	37	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	A	16.57	3.159253	0.57368	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.22539	1.95;1.95	5.27	5.27	0.74061	.	0.058133	0.64402	D	0.000002	T	0.36963	0.0986	L	0.43152	1.355	0.34449	D	0.700475	D	0.67145	0.996	D	0.65010	0.931	T	0.50491	-0.8822	10	0.54805	T	0.06	-17.4441	15.1893	0.73032	1.0:0.0:0.0:0.0	.	1054	A6NHR9	SMHD1_HUMAN	R	1054	ENSP00000326603:H1054R;ENSP00000261598:H1054R	ENSP00000261598:H1054R	H	+	2	0	SMCHD1	2722375	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.165000	0.77544	1.974000	0.57490	0.533000	0.62120	CAT		0.363	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2			33	53	33	53
PRSS57	400668	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	691902	691902	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr19:691902C>T	ENST00000329267.7	-	3	366	c.337G>A	c.(337-339)Gac>Aac	p.D113N		NM_214710.3	NP_999875	Q6UWY2	PRS57_HUMAN	protease, serine, 57	113	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|lung(5)	6						GGGTGGTAGTCGGGGTGTGTG	0.622																																																0													98.0	65.0	76.0					19																	691902		2203	4300	6503	SO:0001583	missense	400668			AY358594	CCDS12041.1	19p13.3	2012-03-26	2011-03-07	2011-03-07		ENSG00000185198		"""Serine peptidases / Serine peptidases"""	31397	protein-coding gene	gene with protein product			"""protease, serine-like 1"""	PRSSL1		12975309	Standard	NM_214710		Approved	UNQ782	uc002lpl.1	Q6UWY2		ENST00000329267.7:c.337G>A	19.37:g.691902C>T	ENSP00000327386:p.Asp113Asn	Somatic		WXS	Illumina GAIIx	Phase_I	B2RNW8	Missense_Mutation	SNP	ENST00000329267.7	37	CCDS12041.1	.	.	.	.	.	.	.	.	.	.	C	9.640	1.138666	0.21123	.	.	ENSG00000185198	ENST00000329267	D	0.92805	-3.11	4.58	-2.32	0.06745	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.162503	0.28964	N	0.013575	T	0.80623	0.4658	L	0.33339	1.005	0.09310	N	1	P;P	0.38677	0.642;0.642	B;B	0.32805	0.107;0.153	T	0.72431	-0.4296	10	0.23891	T	0.37	.	5.4087	0.16336	0.0:0.4528:0.2436:0.3035	.	112;113	B7ZMF6;Q6UWY2	.;PRS57_HUMAN	N	113	ENSP00000327386:D113N	ENSP00000327386:D113N	D	-	1	0	PRSS57	642902	0.001000	0.12720	0.009000	0.14445	0.017000	0.09413	-0.228000	0.09114	0.063000	0.16370	0.313000	0.20887	GAC		0.622	PRSS57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452480.2	NM_214710		21	48	21	48
CIC	23152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	42791817	42791817	+	Missense_Mutation	SNP	G	G	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr19:42791817G>T	ENST00000575354.2	+	5	743	c.703G>T	c.(703-705)Ggc>Tgc	p.G235C	CIC_ENST00000160740.3_Missense_Mutation_p.G235C|CIC_ENST00000572681.2_Missense_Mutation_p.G1144C	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	235					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				CAAGATCCTGGGCGAGTGGTG	0.612			"""Mis, F, S"""		oligodendroglioma																																		Rec	yes		19	19q13.2	23152	capicua homolog		O	0													81.0	74.0	76.0					19																	42791817		2203	4300	6503	SO:0001583	missense	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.703G>T	19.37:g.42791817G>T	ENSP00000458663:p.Gly235Cys	Somatic		WXS	Illumina GAIIx	Phase_I	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	G	16.56	3.158749	0.57368	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.39	4.39	0.52855	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	.	.	.	.	D	0.90521	0.7030	H	0.99225	4.475	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94144	0.7399	8	0.87932	D	0	-16.6128	14.5138	0.67807	0.0:0.0:1.0:0.0	.	235	Q96RK0	CIC_HUMAN	C	235	.	ENSP00000160740:G235C	G	+	1	0	CIC	47483657	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.261000	0.95576	2.284000	0.76573	0.555000	0.69702	GGC		0.612	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2			41	23	41	23
RBMXL1	494115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	89448560	89448560	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr1:89448560C>T	ENST00000321792.5	-	2	1377	c.950G>A	c.(949-951)cGt>cAt	p.R317H	CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000260508.4_Intron|RBMXL1_ENST00000399794.2_Missense_Mutation_p.R317H|CCBL2_ENST00000446900.2_Intron|CCBL2_ENST00000370485.2_Intron|RBMXL1_ENST00000413769.1_5'Flank	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	317	Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										ATATCCATCACGTGAGCTGCT	0.498																																																0													185.0	184.0	184.0					1																	89448560		2203	4300	6503	SO:0001583	missense	494115			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.950G>A	1.37:g.89448560C>T	ENSP00000318415:p.Arg317His	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000321792.5	37	CCDS716.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.045622	0.55110	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	T;T	0.77098	-1.07;-1.07	1.89	0.895	0.19247	.	0.000000	0.85682	D	0.000000	T	0.63604	0.2525	M	0.66939	2.045	0.32700	N	0.51303	D	0.67145	0.996	P	0.49502	0.613	T	0.59016	-0.7533	10	0.34782	T	0.22	-4.7791	6.12	0.20148	0.0:0.8158:0.0:0.1842	.	317	Q96E39	RBMXL_HUMAN	H	317	ENSP00000318415:R317H;ENSP00000446099:R317H	ENSP00000318415:R317H	R	-	2	0	RBMXL1	89221148	1.000000	0.71417	0.976000	0.42696	0.730000	0.41778	4.795000	0.62489	0.128000	0.18479	0.306000	0.20318	CGT		0.498	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610		122	43	122	43
DENND2D	79961	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	111738675	111738675	+	Missense_Mutation	SNP	G	G	C			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr1:111738675G>C	ENST00000357640.4	-	6	737	c.508C>G	c.(508-510)Ctg>Gtg	p.L170V	DENND2D_ENST00000473682.1_5'UTR|DENND2D_ENST00000369752.5_Missense_Mutation_p.L167V	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	170	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		ACTTCATCCAGGATCTGCAGG	0.552																																																0													61.0	57.0	59.0					1																	111738675		2203	4300	6503	SO:0001583	missense	79961				CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.508C>G	1.37:g.111738675G>C	ENSP00000350266:p.Leu170Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q5T5V6|Q9BSU0	Missense_Mutation	SNP	ENST00000357640.4	37	CCDS831.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.048137	0.75846	.	.	ENSG00000162777	ENST00000357640;ENST00000369752	T;T	0.35048	1.33;1.33	5.51	4.59	0.56863	DENN (3);	0.066242	0.64402	D	0.000010	T	0.54663	0.1872	M	0.89163	3.01	0.32672	N	0.516675	D;D	0.67145	0.995;0.996	D;D	0.67382	0.919;0.951	T	0.62774	-0.6783	10	0.87932	D	0	-11.7253	12.4651	0.55753	0.0837:0.0:0.9163:0.0	.	167;170	Q9H6A0-2;Q9H6A0	.;DEN2D_HUMAN	V	170;167	ENSP00000350266:L170V;ENSP00000358767:L167V	ENSP00000350266:L170V	L	-	1	2	DENND2D	111540198	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.081000	0.50120	2.589000	0.87451	0.555000	0.69702	CTG		0.552	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000034456.1	NM_024901		32	7	32	7
OR6N2	81442	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	158746704	158746704	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr1:158746704C>T	ENST00000339258.1	-	1	721	c.722G>A	c.(721-723)tGt>tAt	p.C241Y		NM_001005278.1	NP_001005278.1	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N, member 2	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(112;0.0378)					ATGTGAGGCACAGGTAGAAAA	0.433																																																0													81.0	82.0	82.0					1																	158746704		2203	4300	6503	SO:0001583	missense	81442			BK004200	CCDS30906.1	1q23.1	2012-08-09			ENSG00000188340	ENSG00000188340		"""GPCR / Class A : Olfactory receptors"""	15035	protein-coding gene	gene with protein product							Standard	NM_001005278		Approved		uc010pir.2	Q8NGY6	OTTHUMG00000022775	ENST00000339258.1:c.722G>A	1.37:g.158746704C>T	ENSP00000344101:p.Cys241Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IFR2	Missense_Mutation	SNP	ENST00000339258.1	37	CCDS30906.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.826952	0.71143	.	.	ENSG00000188340	ENST00000339258	T	0.00369	7.74	4.84	4.84	0.62591	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41712	D	0.000840	T	0.01124	0.0037	H	0.97186	3.955	0.54753	D	0.999983	D	0.89917	1.0	D	0.91635	0.999	T	0.31392	-0.9945	10	0.87932	D	0	-12.4418	16.8818	0.86065	0.0:1.0:0.0:0.0	.	241	Q8NGY6	OR6N2_HUMAN	Y	241	ENSP00000344101:C241Y	ENSP00000344101:C241Y	C	-	2	0	OR6N2	157013328	1.000000	0.71417	0.980000	0.43619	0.935000	0.57460	7.279000	0.78599	2.500000	0.84329	0.650000	0.86243	TGT		0.433	OR6N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059068.1			22	25	22	25
EPRS	2058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	220142262	220142262	+	Silent	SNP	T	T	A			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr1:220142262T>A	ENST00000366923.3	-	32	4694	c.4425A>T	c.(4423-4425)ggA>ggT	p.G1475G	EPRS_ENST00000468487.1_5'UTR	NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	1475	Proline--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	GGCTTTTAGCTCCCATGGATG	0.433																																																0													115.0	109.0	111.0					1																	220142262		2203	4300	6503	SO:0001819	synonymous_variant	2058			X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.4425A>T	1.37:g.220142262T>A		Somatic		WXS	Illumina GAIIx	Phase_I	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Silent	SNP	ENST00000366923.3	37	CCDS31027.1																																																																																				0.433	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446		36	47	36	47
TLR5	7100	hgsc.bcm.edu;ucsc.edu	37	1	223286129	223286129	+	Missense_Mutation	SNP	G	G	T	rs764535	byFrequency	TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr1:223286129G>T	ENST00000540964.1	-	4	706	c.245C>A	c.(244-246)aCc>aAc	p.T82N	TLR5_ENST00000342210.6_Missense_Mutation_p.T82N			O60602	TLR5_HUMAN	toll-like receptor 5	82			T -> I (in dbSNP:rs764535).		cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		AGTCAAGGGGGTATACTGGCT	0.498																																																0													69.0	72.0	71.0					1																	223286129		2203	4300	6503	SO:0001583	missense	7100				CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.245C>A	1.37:g.223286129G>T	ENSP00000440643:p.Thr82Asn	Somatic		WXS	Illumina GAIIx	Phase_I	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Missense_Mutation	SNP	ENST00000540964.1	37	CCDS31033.1	.	.	.	.	.	.	.	.	.	.	G	3.149	-0.174703	0.06421	.	.	ENSG00000187554	ENST00000540964;ENST00000366881;ENST00000342210	T;T;T	0.58358	0.34;0.34;0.34	5.03	3.1	0.35709	.	0.611782	0.17491	N	0.172334	T	0.39963	0.1098	L	0.44542	1.39	0.09310	N	1	B	0.06786	0.001	B	0.17979	0.02	T	0.18840	-1.0324	10	0.25106	T	0.35	.	6.566	0.22513	0.1456:0.0:0.6783:0.1761	.	82	O60602	TLR5_HUMAN	N	82	ENSP00000440643:T82N;ENSP00000355846:T82N;ENSP00000340089:T82N	ENSP00000340089:T82N	T	-	2	0	TLR5	221352752	0.002000	0.14202	0.002000	0.10522	0.012000	0.07955	1.272000	0.33109	1.227000	0.43598	-0.169000	0.13324	ACC		0.498	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003268		35	55	35	55
MMP9	4318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	44641108	44641108	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr20:44641108C>T	ENST00000372330.3	+	8	1236	c.1217C>T	c.(1216-1218)gCg>gTg	p.A406V	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	406					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	TTCGGCCACGCGCTGGGCTTA	0.637																																																0													69.0	64.0	66.0					20																	44641108		2203	4300	6503	SO:0001583	missense	4318				CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.1217C>T	20.37:g.44641108C>T	ENSP00000361405:p.Ala406Val	Somatic		WXS	Illumina GAIIx	Phase_I	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Missense_Mutation	SNP	ENST00000372330.3	37	CCDS13390.1	.	.	.	.	.	.	.	.	.	.	C	34	5.403962	0.96051	.	.	ENSG00000100985	ENST00000372330;ENST00000545925	T	0.26957	1.7	4.99	4.99	0.66335	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.051428	0.85682	D	0.000000	T	0.50616	0.1626	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.52624	-0.8551	10	0.87932	D	0	.	17.4498	0.87589	0.0:1.0:0.0:0.0	.	406	P14780	MMP9_HUMAN	V	406;51	ENSP00000361405:A406V	ENSP00000361405:A406V	A	+	2	0	MMP9	44074515	1.000000	0.71417	0.658000	0.29665	0.817000	0.46193	7.544000	0.82117	2.606000	0.88127	0.561000	0.74099	GCG		0.637	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080337.1			37	56	37	56
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	C	T	rs121913500		TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr2:209113112C>T	ENST00000415913.1	-	4	776	c.395G>A	c.(394-396)cGt>cAt	p.R132H	IDH1_ENST00000345146.2_Missense_Mutation_p.R132H|IDH1_ENST00000446179.1_Missense_Mutation_p.R132H	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132H(2774)|p.R132L(59)|p.R132V(1)|p.G131_R132>VL(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	2835	Substitution - Missense(2834)|Complex - compound substitution(1)	central_nervous_system(2579)|haematopoietic_and_lymphoid_tissue(205)|bone(43)|prostate(4)|biliary_tract(2)|urinary_tract(1)|skin(1)											79.0	73.0	75.0					2																	209113112		2203	4300	6503	SO:0001583	missense	3417				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.395G>A	2.37:g.209113112C>T	ENSP00000390265:p.Arg132His	Somatic		WXS	Illumina GAIIx	Phase_I	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657324	0.88154	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	4.69	0.59074	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	H	0.99379	4.54	0.80722	D	1	B	0.25486	0.127	B	0.25405	0.06	D	0.92324	0.5868	10	0.87932	D	0	-20.0399	14.3783	0.66895	0.0:0.9288:0.0:0.0712	.	132	O75874	IDHC_HUMAN	H	132	ENSP00000260985:R132H;ENSP00000410513:R132H;ENSP00000390265:R132H;ENSP00000391075:R132H	ENSP00000260985:R132H	R	-	2	0	IDH1	208821357	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.088000	0.71371	1.356000	0.45884	0.555000	0.69702	CGT		0.393	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			25	36	25	36
ZBTB11	27107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	101373567	101373567	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr3:101373567G>A	ENST00000312938.4	-	8	2870	c.2290C>T	c.(2290-2292)Cga>Tga	p.R764*		NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	764					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						TGATAGCCTCGAACCTCAGGC	0.363																																																0													120.0	122.0	121.0					3																	101373567		2203	4300	6503	SO:0001587	stop_gained	27107			U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.2290C>T	3.37:g.101373567G>A	ENSP00000326200:p.Arg764*	Somatic		WXS	Illumina GAIIx	Phase_I	Q2NKP9	Nonsense_Mutation	SNP	ENST00000312938.4	37	CCDS2943.1	.	.	.	.	.	.	.	.	.	.	G	45	12.031159	0.99629	.	.	ENSG00000066422	ENST00000312938	.	.	.	5.8	5.8	0.92144	.	0.062472	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-9.5557	20.0609	0.97674	0.0:0.0:1.0:0.0	.	.	.	.	X	764	.	ENSP00000326200:R764X	R	-	1	2	ZBTB11	102856257	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.311000	0.96282	2.755000	0.94549	0.655000	0.94253	CGA		0.363	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353441.2	NM_014415		32	41	32	41
ZBTB20	26137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	114058129	114058129	+	Missense_Mutation	SNP	T	T	C			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr3:114058129T>C	ENST00000474710.1	-	5	2127	c.1949A>G	c.(1948-1950)aAc>aGc	p.N650S	ZBTB20_ENST00000471418.1_Missense_Mutation_p.N577S|ZBTB20_ENST00000462705.1_Missense_Mutation_p.N577S|ZBTB20_ENST00000393785.2_Missense_Mutation_p.N577S|ZBTB20_ENST00000464560.1_Missense_Mutation_p.N577S|ZBTB20_ENST00000481632.1_Missense_Mutation_p.N577S|ZBTB20_ENST00000357258.3_Missense_Mutation_p.N577S	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	650						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		CATGTGCACGTTGAGGGAGCT	0.527																																					NSCLC(69;748 1344 9802 11203 30933)											0													204.0	179.0	187.0					3																	114058129		2203	4300	6503	SO:0001583	missense	26137			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.1949A>G	3.37:g.114058129T>C	ENSP00000419153:p.Asn650Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	ENST00000474710.1	37	CCDS54626.1	.	.	.	.	.	.	.	.	.	.	T	16.21	3.059543	0.55325	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.03272	3.99;3.99;3.99;3.99;3.99;3.99;3.99	5.97	5.97	0.96955	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.047714	0.85682	D	0.000000	T	0.02688	0.0081	N	0.04203	-0.255	0.58432	D	0.999999	P	0.43826	0.818	B	0.41466	0.358	T	0.68546	-0.5380	10	0.19590	T	0.45	.	16.4608	0.84044	0.0:0.0:0.0:1.0	.	650	Q9HC78	ZBT20_HUMAN	S	577;577;577;577;650;577;577	ENSP00000420324:N577S;ENSP00000377375:N577S;ENSP00000418092:N577S;ENSP00000419902:N577S;ENSP00000419153:N650S;ENSP00000349803:N577S;ENSP00000417307:N577S	ENSP00000349803:N577S	N	-	2	0	ZBTB20	115540819	1.000000	0.71417	0.981000	0.43875	0.997000	0.91878	6.139000	0.71728	2.288000	0.76882	0.533000	0.62120	AAC		0.527	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642		79	154	79	154
IGSF10	285313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	151162901	151162901	+	Missense_Mutation	SNP	T	T	C			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr3:151162901T>C	ENST00000282466.3	-	4	4867	c.4868A>G	c.(4867-4869)aAg>aGg	p.K1623R		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1623					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AACTGGTTTCTTATCAAAGTC	0.438																																																0													256.0	225.0	235.0					3																	151162901		2203	4300	6503	SO:0001583	missense	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.4868A>G	3.37:g.151162901T>C	ENSP00000282466:p.Lys1623Arg	Somatic		WXS	Illumina GAIIx	Phase_I	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	T	4.801	0.148982	0.09185	.	.	ENSG00000152580	ENST00000282466;ENST00000544042	T	0.69175	-0.38	5.66	1.8	0.24995	.	0.444437	0.18784	N	0.131250	T	0.37210	0.0995	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.15263	-1.0443	10	0.15066	T	0.55	.	3.6994	0.08376	0.2737:0.1512:0.0:0.5751	.	1623	Q6WRI0	IGS10_HUMAN	R	1623;250	ENSP00000282466:K1623R	ENSP00000282466:K1623R	K	-	2	0	IGSF10	152645591	0.009000	0.17119	0.000000	0.03702	0.158000	0.22134	1.477000	0.35431	0.063000	0.16370	0.528000	0.53228	AAG		0.438	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822		51	65	51	65
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	Somatic		WXS	Illumina GAIIx	Phase_I	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			17	23	17	23
PCDHGC3	5098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	140857769	140857769	+	Missense_Mutation	SNP	C	C	A			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr5:140857769C>A	ENST00000308177.3	+	1	2190	c.2086C>A	c.(2086-2088)Ctt>Att	p.L696I	PCDHGA10_ENST00000398610.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB1_ENST00000523390.1_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	696					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTATCTACTTCTTTCTCTAAT	0.488											OREG0016865	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0													163.0	202.0	189.0					5																	140857769		2203	4300	6503	SO:0001583	missense	5098			AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.2086C>A	5.37:g.140857769C>A	ENSP00000312070:p.Leu696Ile	Somatic	1659	WXS	Illumina GAIIx	Phase_I	O60622|Q08192|Q9Y5C4	Missense_Mutation	SNP	ENST00000308177.3	37	CCDS4261.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.078855	0.36662	.	.	ENSG00000240184	ENST00000308177	T	0.38240	1.15	5.55	4.61	0.57282	.	.	.	.	.	T	0.43233	0.1238	L	0.31157	0.91	0.23632	N	0.997248	D;D	0.71674	0.983;0.998	P;D	0.63113	0.723;0.911	T	0.17501	-1.0367	9	0.27082	T	0.32	.	12.7021	0.57038	0.0:0.9125:0.0:0.0875	.	696;696	Q9UN70;Q9UN70-2	PCDGK_HUMAN;.	I	696	ENSP00000312070:L696I	ENSP00000312070:L696I	L	+	1	0	PCDHGC3	140837953	0.001000	0.12720	1.000000	0.80357	0.985000	0.73830	-0.175000	0.09825	2.885000	0.99019	0.655000	0.94253	CTT		0.488	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588		208	279	208	279
EZR	7430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	159188410	159188410	+	Silent	SNP	G	G	A	rs201524101		TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr6:159188410G>A	ENST00000367075.3	-	13	1647	c.1479C>T	c.(1477-1479)ggC>ggT	p.G493G	EZR_ENST00000337147.7_Silent_p.G493G|MIR3918_ENST00000581555.1_RNA|EZR_ENST00000392177.4_Silent_p.G461G	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	493	Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		TGGGCTCTGCGCCCTCATCCT	0.642			T	ROS1	NSCLC								G|||	1	0.000199681	0.0	0.0	5008	,	,		18606	0.001		0.0	False		,,,				2504	0.0						Dom	yes		6	6q25.3	7430	ezrin		E	0								G	,	0,4406		0,0,2203	76.0	79.0	78.0		1479,1479	-1.6	0.9	6		78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	EZR	NM_001111077.1,NM_003379.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	493/587,493/587	159188410	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	7430			AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.1479C>T	6.37:g.159188410G>A		Somatic		WXS	Illumina GAIIx	Phase_I	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Silent	SNP	ENST00000367075.3	37	CCDS5258.1																																																																																				0.642	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1	NM_003379		51	104	51	104
AGR3	155465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	16918142	16918142	+	Missense_Mutation	SNP	A	A	G			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr7:16918142A>G	ENST00000310398.2	-	2	171	c.101T>C	c.(100-102)cTc>cCc	p.L34P	AGR3_ENST00000402239.3_Missense_Mutation_p.L34P	NM_176813.3	NP_789783.1	Q8TD06	AGR3_HUMAN	anterior gradient 3	34						extracellular region (GO:0005576)	dystroglycan binding (GO:0002162)			central_nervous_system(1)|kidney(8)|lung(2)|skin(1)|stomach(1)	13	Lung NSC(10;0.0376)|all_lung(11;0.0721)|all_epithelial(12;0.202)			UCEC - Uterine corpus endometrioid carcinoma (126;0.184)		ACCTCTTGAGAGTGTCTGAGG	0.383																																																0													94.0	99.0	97.0					7																	16918142		2203	4300	6503	SO:0001583	missense	155465			AY069977	CCDS5365.1	7p21.1	2013-07-31	2013-07-31		ENSG00000173467	ENSG00000173467		"""Protein disulfide isomerases"""	24167	protein-coding gene	gene with protein product	"""breast cancer membrane protein 11"", ""protein disulfide isomerase family A, member 18"""	609482	"""anterior gradient 3 homolog (Xenopus laevis)"""			12592373, 12477722	Standard	NM_176813		Approved	HAG3, hAG-3, BCMP11, PDIA18	uc003sts.3	Q8TD06	OTTHUMG00000128411	ENST00000310398.2:c.101T>C	7.37:g.16918142A>G	ENSP00000308606:p.Leu34Pro	Somatic		WXS	Illumina GAIIx	Phase_I	A4D120	Missense_Mutation	SNP	ENST00000310398.2	37	CCDS5365.1	.	.	.	.	.	.	.	.	.	.	A	17.58	3.425132	0.62733	.	.	ENSG00000173467	ENST00000310398;ENST00000402239	.	.	.	4.15	4.15	0.48705	Thioredoxin-like fold (1);	0.000000	0.52532	D	0.000078	T	0.70029	0.3177	M	0.64997	1.995	0.80722	D	1	D	0.71674	0.998	D	0.71656	0.974	T	0.72074	-0.4400	9	0.56958	D	0.05	0.3692	11.5512	0.50721	1.0:0.0:0.0:0.0	.	34	Q8TD06	AGR3_HUMAN	P	34	.	ENSP00000308606:L34P	L	-	2	0	AGR3	16884667	0.995000	0.38212	0.906000	0.35671	0.990000	0.78478	4.508000	0.60441	2.108000	0.64289	0.454000	0.30748	CTC		0.383	AGR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250191.2	NM_176813		19	32	19	32
SKAP2	8935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	26729921	26729921	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr7:26729921C>T	ENST00000345317.2	-	10	1170	c.857G>A	c.(856-858)aGt>aAt	p.S286N	SKAP2_ENST00000489977.1_5'Flank|SKAP2_ENST00000539623.1_Missense_Mutation_p.S114N	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	286					B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						GTGATGGACACTATCCTGACT	0.378																																																0													280.0	208.0	233.0					7																	26729921		2203	4300	6503	SO:0001583	missense	8935				CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.857G>A	7.37:g.26729921C>T	ENSP00000005587:p.Ser286Asn	Somatic		WXS	Illumina GAIIx	Phase_I	A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Missense_Mutation	SNP	ENST00000345317.2	37	CCDS5400.1	.	.	.	.	.	.	.	.	.	.	C	0.217	-1.032118	0.02029	.	.	ENSG00000005020	ENST00000345317;ENST00000539623;ENST00000535331	T;T	0.32753	1.44;1.44	5.85	1.82	0.25136	Src homology-3 domain (1);	0.693854	0.15875	N	0.240301	T	0.15046	0.0363	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.13335	-1.0513	10	0.27785	T	0.31	-5.4329	1.3282	0.02130	0.1574:0.3282:0.3056:0.2088	.	271;286	B7Z5N4;O75563	.;SKAP2_HUMAN	N	286;114;271	ENSP00000005587:S286N;ENSP00000443593:S114N	ENSP00000005587:S286N	S	-	2	0	SKAP2	26696446	0.002000	0.14202	0.348000	0.25681	0.361000	0.29550	-0.167000	0.09940	0.910000	0.36722	0.655000	0.94253	AGT		0.378	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214128.1			25	49	25	49
MCPH1	79648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	6301937	6301937	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr8:6301937C>T	ENST00000344683.5	+	8	770	c.694C>T	c.(694-696)Cac>Tac	p.H232Y	MCPH1_ENST00000522905.1_Missense_Mutation_p.H184Y|MCPH1_ENST00000519480.1_Missense_Mutation_p.H232Y	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	232					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		TGGTGGCTTACACTCATCTTT	0.338																																					Colon(95;1448 1467 8277 34473 35819)											0													123.0	113.0	116.0					8																	6301937		1845	4092	5937	SO:0001583	missense	79648			AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.694C>T	8.37:g.6301937C>T	ENSP00000342924:p.His232Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Missense_Mutation	SNP	ENST00000344683.5	37	CCDS43689.1	.	.	.	.	.	.	.	.	.	.	C	4.148	0.025837	0.08054	.	.	ENSG00000147316	ENST00000344683;ENST00000519480;ENST00000522905	T;T;T	0.10668	2.85;2.85;2.85	5.14	0.572	0.17357	.	0.821220	0.11504	N	0.557453	T	0.21468	0.0517	M	0.71036	2.16	0.09310	N	1	D;B;B	0.63880	0.993;0.055;0.134	P;B;B	0.60012	0.867;0.058;0.031	T	0.12167	-1.0558	10	0.66056	D	0.02	-0.9529	2.7146	0.05184	0.3897:0.3714:0.146:0.0929	.	184;232;232	E9PH63;Q8NEM0;E9PGU5	.;MCPH1_HUMAN;.	Y	232;232;184	ENSP00000342924:H232Y;ENSP00000430962:H232Y;ENSP00000430768:H184Y	ENSP00000342924:H232Y	H	+	1	0	MCPH1	6289345	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.111000	0.10807	0.282000	0.22254	-0.136000	0.14681	CAC		0.338	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596		22	38	22	38
WNK2	65268	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	96018613	96018613	+	Silent	SNP	C	C	T	rs372392898		TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr9:96018613C>T	ENST00000297954.4	+	9	2067	c.2067C>T	c.(2065-2067)ccC>ccT	p.P689P	WNK2_ENST00000427277.2_Silent_p.P301P|WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000349097.3_Silent_p.P301P|WNK2_ENST00000395477.2_Silent_p.P689P|WNK2_ENST00000395475.2_Intron	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	689					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						TCCCGGCCCCCGCCTGCCCTC	0.751																																																0								C		2,4294		0,2,2146	8.0	9.0	9.0		2067	-2.2	0.2	9		9	0,8424		0,0,4212	no	coding-synonymous	WNK2	NM_006648.3		0,2,6358	TT,TC,CC		0.0,0.0466,0.0157		689/2218	96018613	2,12718	2148	4212	6360	SO:0001819	synonymous_variant	65268			AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.2067C>T	9.37:g.96018613C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Silent	SNP	ENST00000297954.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.606|0.606	-0.827143|-0.827143	0.02734|0.02734	4.66E-4|4.66E-4	0.0|0.0	ENSG00000165238|ENSG00000165238	ENST00000432730|ENST00000411624	T|.	0.70869|.	-0.52|.	4.21|4.21	-2.25|-2.25	0.06888|0.06888	.|.	0.227229|.	0.36234|.	N|.	0.002701|.	T|T	0.48187|0.48187	0.1486|0.1486	.|.	.|.	.|.	0.50813|0.50813	D|D	0.999892|0.999892	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.39921|0.39921	-0.9590|-0.9590	7|4	0.13470|.	T|.	0.59|.	.|.	5.0301|5.0301	0.14405|0.14405	0.2232:0.3639:0.0:0.413|0.2232:0.3639:0.0:0.413	.|.	.|.	.|.	.|.	L|C	685|293	ENSP00000415038:P685L|.	ENSP00000415038:P685L|.	P|R	+|+	2|1	0|0	WNK2|WNK2	95058434|95058434	0.000000|0.000000	0.05858|0.05858	0.209000|0.209000	0.23619|0.23619	0.082000|0.082000	0.17680|0.17680	-0.656000|-0.656000	0.05342|0.05342	-0.250000|-0.250000	0.09555|0.09555	0.462000|0.462000	0.41574|0.41574	CCG|CGC		0.751	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648		7	14	7	14
AGPAT2	10555	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	139571516	139571516	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr9:139571516C>T	ENST00000371696.2	-	3	454	c.389G>A	c.(388-390)gGc>gAc	p.G130D	AGPAT2_ENST00000538402.1_Missense_Mutation_p.G130D|AGPAT2_ENST00000371694.3_Missense_Mutation_p.G130D	NM_006412.3	NP_006403.2	O15120	PLCB_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 2	130					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|epidermis development (GO:0008544)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			endometrium(1)|large_intestine(1)|lung(2)|prostate(2)	6	all_cancers(76;0.0893)|all_epithelial(76;0.231)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		CATGATGAGGCCCACGGGCCC	0.637																																																0													75.0	85.0	82.0					9																	139571516		2203	4300	6503	SO:0001583	missense	10555			AF000237	CCDS7003.1, CCDS35181.1	9q34.3	2013-02-05	2013-02-05		ENSG00000169692	ENSG00000169692	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	325	protein-coding gene	gene with protein product	"""LPAAT-beta"", ""lysophosphatidic acid acyltransferase, beta"""	603100	"""Berardinelli-Seip congenital lipodystrophy"", ""1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)"""	BSCL		9242711, 9212163	Standard	NM_006412		Approved		uc004cii.1	O15120	OTTHUMG00000020936	ENST00000371696.2:c.389G>A	9.37:g.139571516C>T	ENSP00000360761:p.Gly130Asp	Somatic		WXS	Illumina GAIIx	Phase_I	O00516|O15106|Q5VUD3|Q5VUD4|Q9BSV7|Q9BWR7	Missense_Mutation	SNP	ENST00000371696.2	37	CCDS7003.1	.	.	.	.	.	.	.	.	.	.	C	18.17	3.564553	0.65651	.	.	ENSG00000169692	ENST00000371694;ENST00000371696;ENST00000538402	D;D;D	0.94931	-3.56;-3.56;-3.56	4.75	4.75	0.60458	Phospholipid/glycerol acyltransferase (2);1-acyl-sn-glycerol-3-phosphate acyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.98463	0.9488	H	0.98446	4.235	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.99856	1.1077	10	0.87932	D	0	-11.3164	16.7351	0.85445	0.0:1.0:0.0:0.0	.	130;130	O15120-2;O15120	.;PLCB_HUMAN	D	130	ENSP00000360759:G130D;ENSP00000360761:G130D;ENSP00000438919:G130D	ENSP00000360759:G130D	G	-	2	0	AGPAT2	138691337	1.000000	0.71417	1.000000	0.80357	0.195000	0.23768	5.058000	0.64300	2.175000	0.68902	0.563000	0.77884	GGC		0.637	AGPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055090.1	NM_006412		75	134	75	134
ASMTL	8623	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	1551213	1551213	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chrX:1551213G>A	ENST00000381317.3	-	6	490	c.458C>T	c.(457-459)tCg>tTg	p.S153L	ASMTL_ENST00000416733.2_Missense_Mutation_p.S77L|ASMTL_ENST00000381333.4_Missense_Mutation_p.S137L|ASMTL_ENST00000534940.1_Missense_Mutation_p.S95L|ASMTL_ENST00000463763.1_5'UTR	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	153	MAF-like.					cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGACAGCTCCGAGAACTTCAC	0.637																																																0													146.0	151.0	150.0					X																	1551213		2031	4155	6186	SO:0001583	missense	8623			Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.458C>T	X.37:g.1551213G>A	ENSP00000370718:p.Ser153Leu	Somatic		WXS	Illumina GAIIx	Phase_I	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Missense_Mutation	SNP	ENST00000381317.3	37	CCDS43917.1	.	.	.	.	.	.	.	.	.	.	g	18.36	3.607444	0.66558	.	.	ENSG00000169093	ENST00000416733;ENST00000534940;ENST00000381333;ENST00000381317	T;T;T;T	0.01998	4.51;4.51;4.54;4.51	2.17	2.17	0.27698	.	0.079540	0.49305	U	0.000158	T	0.10078	0.0247	M	0.71036	2.16	0.09310	N	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.78314	0.991;0.989;0.933	T	0.01420	-1.1359	10	0.72032	D	0.01	.	12.6822	0.56928	0.0:0.0:1.0:0.0	.	77;137;153	E7ER97;O95671-2;O95671	.;.;ASML_HUMAN	L	77;95;137;153	ENSP00000410578:S77L;ENSP00000446410:S95L;ENSP00000370734:S137L;ENSP00000370718:S153L	ENSP00000370718:S153L	S	-	2	0	ASMTL	1511213	1.000000	0.71417	0.551000	0.28230	0.773000	0.43773	7.354000	0.79424	0.865000	0.35603	0.457000	0.33378	TCG		0.637	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055595.1	NM_004192		33	20	33	20
NHS	4810	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	17744930	17744930	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chrX:17744930G>T	ENST00000380060.3	+	6	2979	c.2641G>T	c.(2641-2643)Gaa>Taa	p.E881*	NHS_ENST00000398097.3_Nonsense_Mutation_p.E725*	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	902					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					TTCTCGAATGGAAAACGCCAA	0.468																																																0													105.0	96.0	99.0					X																	17744930		2203	4300	6503	SO:0001587	stop_gained	4810				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.2641G>T	X.37:g.17744930G>T	ENSP00000369400:p.Glu881*	Somatic		WXS	Illumina GAIIx	Phase_I	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Nonsense_Mutation	SNP	ENST00000380060.3	37	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	G	42	9.428869	0.99167	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	.	.	.	5.93	5.93	0.95920	.	0.231914	0.45867	D	0.000331	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-19.5676	19.2927	0.94108	0.0:0.0:1.0:0.0	.	.	.	.	X	881;725;723	.	ENSP00000369397:E723X	E	+	1	0	NHS	17654851	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.274000	0.72587	2.509000	0.84616	0.538000	0.68166	GAA		0.468	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270		68	80	68	80
GK	2710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	30739086	30739086	+	Missense_Mutation	SNP	G	G	A			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chrX:30739086G>A	ENST00000378943.3	+	17	1636	c.1457G>A	c.(1456-1458)cGg>cAg	p.R486Q	GK_ENST00000378946.3_Missense_Mutation_p.R492Q|GK-AS1_ENST00000464659.1_RNA|RP11-242C19.2_ENST00000497961.1_RNA|GK_ENST00000378945.3_Missense_Mutation_p.R486Q|GK_ENST00000427190.1_Missense_Mutation_p.R287Q	NM_001128127.2	NP_001121599.1	P32189	GLPK_HUMAN	glycerol kinase	492					cellular lipid metabolic process (GO:0044255)|glucose homeostasis (GO:0042593)|glycerol catabolic process (GO:0019563)|glycerol metabolic process (GO:0006071)|glycerol-3-phosphate biosynthetic process (GO:0046167)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			central_nervous_system(1)|large_intestine(3)	4						ACGATGGAGCGGTTTGAACCT	0.502																																																0													50.0	42.0	45.0					X																	30739086		2202	4300	6502	SO:0001583	missense	2710			X78711	CCDS14225.1, CCDS35224.1, CCDS48090.1, CCDS75963.1	Xp21.3	2014-09-17			ENSG00000198814	ENSG00000198814	2.7.1.30	"""Glycerol kinases"""	4289	protein-coding gene	gene with protein product		300474				7987308	Standard	NM_203391		Approved	GK1, GKD	uc022buj.1	P32189	OTTHUMG00000021328	ENST00000378943.3:c.1457G>A	X.37:g.30739086G>A	ENSP00000368226:p.Arg486Gln	Somatic		WXS	Illumina GAIIx	Phase_I	A6NJP5|B2R833|Q6IQ27|Q8IVR5|Q9UMP0|Q9UMP1	Missense_Mutation	SNP	ENST00000378943.3	37	CCDS48090.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.401064	0.62288	.	.	ENSG00000198814	ENST00000378946;ENST00000378943;ENST00000534212;ENST00000378945;ENST00000427190;ENST00000451432;ENST00000378938	D;D;D;D;D	0.90444	-2.67;-2.67;-2.67;-2.67;-2.67	5.49	5.49	0.81192	.	0.053023	0.85682	D	0.000000	D	0.87022	0.6074	L	0.33137	0.985	0.50467	D	0.999874	B;B;B;B;B	0.16396	0.017;0.006;0.001;0.004;0.006	B;B;B;B;B	0.09377	0.004;0.001;0.001;0.001;0.001	T	0.82944	-0.0206	10	0.66056	D	0.02	.	18.6129	0.91293	0.0:0.0:1.0:0.0	.	329;492;486;486;492	E7EQC0;P32189;P32189-2;P32189-1;A6NJP5	.;GLPK_HUMAN;.;.;.	Q	492;486;492;486;287;329;81	ENSP00000368229:R492Q;ENSP00000368226:R486Q;ENSP00000368228:R486Q;ENSP00000401720:R287Q;ENSP00000368221:R81Q	ENSP00000368221:R81Q	R	+	2	0	GK	30649007	1.000000	0.71417	0.994000	0.49952	0.927000	0.56198	5.145000	0.64839	2.426000	0.82243	0.600000	0.82982	CGG		0.502	GK-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056170.1	NM_000167		23	29	23	29
TRO	7216	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	54957391	54957391	+	Missense_Mutation	SNP	A	A	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chrX:54957391A>T	ENST00000173898.7	+	12	4346	c.4234A>T	c.(4234-4236)Acc>Tcc	p.T1412S	TRO_ENST00000319167.8_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000375022.4_Intron|TRO_ENST00000375041.2_Missense_Mutation_p.T1015S|TRO_ENST00000420798.2_Missense_Mutation_p.T943S	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	1412	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						TGGACCGAGCACCAGTGCTGG	0.587																																																0													39.0	39.0	39.0					X																	54957391		2014	4160	6174	SO:0001583	missense	7216			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.4234A>T	X.37:g.54957391A>T	ENSP00000173898:p.Thr1412Ser	Somatic		WXS	Illumina GAIIx	Phase_I	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	37	CCDS43959.1	.	.	.	.	.	.	.	.	.	.	A	6.608	0.480516	0.12581	.	.	ENSG00000067445	ENST00000173898;ENST00000319179;ENST00000420798;ENST00000375041	T;T;T	0.07327	3.95;3.2;3.59	3.77	3.77	0.43336	.	.	.	.	.	T	0.15392	0.0371	L	0.29908	0.895	0.09310	N	1	P;P	0.52842	0.956;0.956	D;D	0.65010	0.931;0.931	T	0.07347	-1.0777	9	0.87932	D	0	.	8.614	0.33820	1.0:0.0:0.0:0.0	.	1015;1412	B1AKE9;Q12816	.;TROP_HUMAN	S	1412;338;943;1015	ENSP00000173898:T1412S;ENSP00000405126:T943S;ENSP00000364181:T1015S	ENSP00000173898:T1412S	T	+	1	0	TRO	54974116	0.000000	0.05858	0.003000	0.11579	0.010000	0.07245	-0.124000	0.10595	1.481000	0.48307	0.483000	0.47432	ACC		0.587	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157		25	30	25	30
PBDC1	51260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	75397598	75397598	+	Missense_Mutation	SNP	A	A	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chrX:75397598A>T	ENST00000373358.3	+	6	760	c.557A>T	c.(556-558)aAc>aTc	p.N186I	PBDC1_ENST00000373357.3_Missense_Mutation_p.T149S	NM_016500.3	NP_057584.2	Q9BVG4	PBDC1_HUMAN	polysaccharide biosynthesis domain containing 1	186																	gaagaagagaacaccaagaat	0.413																																																0													109.0	98.0	102.0					X																	75397598		2203	4300	6503	SO:0001583	missense	51260			BC001220	CCDS14432.1, CCDS75995.1	Xq13.2	2012-11-28	2012-11-28	2012-11-28	ENSG00000102390	ENSG00000102390			28790	protein-coding gene	gene with protein product			"""chromosome X open reading frame 26"""	CXorf26		11042152	Standard	NM_016500		Approved	MGC874	uc004ecl.1	Q9BVG4	OTTHUMG00000021876	ENST00000373358.3:c.557A>T	X.37:g.75397598A>T	ENSP00000362456:p.Asn186Ile	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000373358.3	37	CCDS14432.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.423|7.423	0.637104|0.637104	0.14386|0.14386	.|.	.|.	ENSG00000102390|ENSG00000102390	ENST00000373358|ENST00000373357	.|.	.|.	.|.	0.597|0.597	0.597|0.597	0.17504|0.17504	.|.	.|.	.|.	.|.	.|.	T|T	0.17450|0.17450	0.0419|0.0419	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.26876|.	0.162|.	B|.	0.06405|.	0.002|.	T|T	0.26326|0.26326	-1.0106|-1.0106	7|5	0.52906|0.28530	T|T	0.07|0.3	.|.	.|.	.|.	.|.	.|.	186|.	Q9BVG4|.	CX026_HUMAN|.	I|S	186|149	.|.	ENSP00000362456:N186I|ENSP00000362455:T149S	N|T	+|+	2|1	0|0	CXorf26|CXorf26	75314001|75314001	0.447000|0.447000	0.25673|0.25673	0.004000|0.004000	0.12327|0.12327	0.323000|0.323000	0.28346|0.28346	0.790000|0.790000	0.26900|0.26900	0.444000|0.444000	0.26612|0.26612	0.237000|0.237000	0.17872|0.17872	AAC|ACA		0.413	PBDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057294.1	NM_016500		11	16	11	16
USP26	83844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	132159579	132159579	+	Silent	SNP	T	T	C			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chrX:132159579T>C	ENST00000511190.1	-	6	3139	c.2670A>G	c.(2668-2670)gaA>gaG	p.E890E	USP26_ENST00000370832.1_Silent_p.E890E|USP26_ENST00000406273.1_Silent_p.E890E	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	890					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					TCAACATCTCTTCAAAGATCT	0.458																																					NSCLC(104;342 1621 36940 47097 52632)											0													138.0	109.0	119.0					X																	132159579		2203	4300	6503	SO:0001819	synonymous_variant	83844			AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.2670A>G	X.37:g.132159579T>C		Somatic		WXS	Illumina GAIIx	Phase_I	B9WRT6|Q5H9H4	Silent	SNP	ENST00000511190.1	37	CCDS14635.1																																																																																				0.458	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907		30	43	30	43
GPR112	139378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	135405392	135405392	+	Missense_Mutation	SNP	C	C	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chrX:135405392C>T	ENST00000394143.1	+	5	817	c.526C>T	c.(526-528)Cgt>Tgt	p.R176C	GPR112_ENST00000370652.1_Missense_Mutation_p.R176C|GPR112_ENST00000287534.4_Missense_Mutation_p.R113C|GPR112_ENST00000394141.1_Intron|GPR112_ENST00000412101.1_Intron	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	176					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R176S(2)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AAGCATGATGCGTAGCTTTCC	0.448																																																2	Substitution - Missense(2)	lung(2)											185.0	160.0	169.0					X																	135405392		2203	4300	6503	SO:0001583	missense	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.526C>T	X.37:g.135405392C>T	ENSP00000377699:p.Arg176Cys	Somatic		WXS	Illumina GAIIx	Phase_I	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	C	6.332	0.429385	0.11987	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000287534	T;T;T	0.64803	3.25;3.25;-0.12	5.62	4.75	0.60458	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.45597	0.1350	N	0.08118	0	0.09310	N	1	P	0.50710	0.938	P	0.44394	0.448	T	0.33624	-0.9861	9	0.72032	D	0.01	.	10.6492	0.45638	0.3467:0.6533:0.0:0.0	.	176	Q8IZF6	GP112_HUMAN	C	176;176;113	ENSP00000377699:R176C;ENSP00000359686:R176C;ENSP00000287534:R113C	ENSP00000287534:R113C	R	+	1	0	GPR112	135233058	0.002000	0.14202	0.002000	0.10522	0.003000	0.03518	1.488000	0.35551	1.107000	0.41642	0.513000	0.50165	CGT		0.448	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			85	98	85	98
AFF2	2334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	148068962	148068962	+	Missense_Mutation	SNP	A	A	G			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chrX:148068962A>G	ENST00000370460.2	+	20	4168	c.3689A>G	c.(3688-3690)aAt>aGt	p.N1230S	AFF2_ENST00000342251.3_Missense_Mutation_p.N1197S|AFF2_ENST00000286437.5_Missense_Mutation_p.N871S|AFF2_ENST00000370457.5_Missense_Mutation_p.N1195S	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	1230					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					AACTGTAACAATGGCCCAGTC	0.532																																																0													229.0	169.0	189.0					X																	148068962		2203	4300	6503	SO:0001583	missense	2334			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.3689A>G	X.37:g.148068962A>G	ENSP00000359489:p.Asn1230Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	A	2.305	-0.359261	0.05138	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.60797	0.16;0.16;0.16;0.16	5.73	4.45	0.53987	.	0.313634	0.28871	N	0.013879	T	0.28699	0.0711	N	0.03948	-0.315	0.09310	N	1	B;B;B;P;P;P	0.39576	0.012;0.043;0.043;0.628;0.628;0.679	B;B;B;B;B;B	0.44315	0.055;0.078;0.078;0.318;0.318;0.446	T	0.46638	-0.9177	10	0.02654	T	1	.	3.0185	0.06067	0.5725:0.0:0.2121:0.2154	.	871;1195;1195;1191;1220;1230	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	S	1230;1195;1197;871	ENSP00000359489:N1230S;ENSP00000359486:N1195S;ENSP00000345459:N1197S;ENSP00000286437:N871S	ENSP00000286437:N871S	N	+	2	0	AFF2	147876668	0.988000	0.35896	0.879000	0.34478	0.086000	0.17979	3.002000	0.49496	1.933000	0.56026	0.481000	0.45027	AAT		0.532	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		67	91	67	91
COL8A1	1295	broad.mit.edu;ucsc.edu	37	3	99513494	99513494	+	Missense_Mutation	SNP	C	C	T	rs200078198		TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr3:99513494C>T	ENST00000261037.3	+	5	1129	c.749C>T	c.(748-750)gCg>gTg	p.A250V	COL8A1_ENST00000273342.4_Missense_Mutation_p.A250V	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	250	Triple-helical region (COL1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						ATGCCAGGTGCGCCAGGTGTA	0.642																																																0								C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	77.0	90.0	85.0		749,749	4.4	0.3	3		85	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	COL8A1	NM_020351.2,NM_001850.3	64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	250/745,250/745	99513494	1,13005	2203	4300	6503	SO:0001583	missense	1295			AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.749C>T	3.37:g.99513494C>T	ENSP00000261037:p.Ala250Val	Somatic		WXS	Illumina GAIIx	Phase_I	D3DN42|Q53XI6|Q96D07	Missense_Mutation	SNP	ENST00000261037.3	37	CCDS2934.1	.	.	.	.	.	.	.	.	.	.	C	0.043	-1.278214	0.01410	0.0	1.16E-4	ENSG00000144810	ENST00000261037;ENST00000273342	D;D	0.97529	-4.42;-4.42	5.52	4.37	0.52481	.	0.312432	0.30193	N	0.010199	D	0.90672	0.7074	N	0.11845	0.185	0.19575	N	0.999961	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.79027	-0.1971	10	0.15499	T	0.54	.	8.9684	0.35890	0.0:0.0902:0.0:0.9098	.	251;250	E7EPK9;P27658	.;CO8A1_HUMAN	V	250	ENSP00000261037:A250V;ENSP00000273342:A250V	ENSP00000261037:A250V	A	+	2	0	COL8A1	100996184	0.067000	0.21026	0.251000	0.24312	0.002000	0.02628	2.256000	0.43231	0.937000	0.37394	-0.302000	0.09304	GCG		0.642	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309001.1	NM_001850		68	129	68	129
HECW1	23072	broad.mit.edu;ucsc.edu	37	7	43483866	43483866	+	Silent	SNP	G	G	A			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr7:43483866G>A	ENST00000395891.2	+	11	1700	c.1095G>A	c.(1093-1095)caG>caA	p.Q365Q	HECW1_ENST00000453890.1_Silent_p.Q365Q	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	365					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CCCAAATTCAGGACAGCCCCA	0.532																																																0													63.0	70.0	68.0					7																	43483866		2114	4230	6344	SO:0001819	synonymous_variant	23072			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1095G>A	7.37:g.43483866G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	ENST00000395891.2	37	CCDS5469.2																																																																																				0.532	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052		21	47	21	47
TDGF1P3	6998	broad.mit.edu;ucsc.edu	37	X	109764561	109764561	+	RNA	SNP	G	G	A			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chrX:109764561G>A	ENST00000602699.1	+	0	1022					NR_002718.2		P51864	TDGF3_HUMAN	teratocarcinoma-derived growth factor 1 pseudogene 3						signal transduction (GO:0007165)	cell outer membrane (GO:0009279)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)										AGCGTGTGCTGCCCATGGGAA	0.572																																																0																																												6998			M96956		Xq23	2011-06-24	2011-06-24	2011-06-24	ENSG00000225366	ENSG00000225366			11703	pseudogene	pseudogene			"""teratocarcinoma-derived growth factor 3, pseudogene"""	TDGF3		1882841	Standard	NR_002718		Approved	TDGF2, CR-3, CRIPTO-3, CRIPTO3	uc004eos.1	P51864	OTTHUMG00000022195		X.37:g.109764561G>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000602699.1	37																																																																																					0.572	TDGF1P3-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467333.2	NR_002718		47	55	47	55
ZCCHC10	54819	broad.mit.edu;hgsc.bcm.edu	37	5	132334445	132334446	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr5:132334445_132334446insT	ENST00000509437.1	-	5	415_416	c.408_409insA	c.(406-411)tcagagfs	p.E137fs	ZCCHC10_ENST00000324170.3_Frame_Shift_Ins_p.E115fs|ZCCHC10_ENST00000355372.2_Frame_Shift_Ins_p.E131fs|ZCCHC10_ENST00000508080.1_5'UTR|ZCCHC10_ENST00000513848.1_Frame_Shift_Ins_p.E101fs|ZCCHC10_ENST00000513541.1_3'UTR|ZCCHC10_ENST00000509008.1_3'UTR			Q8TBK6	ZCH10_HUMAN	zinc finger, CCHC domain containing 10	137	Ser-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCACTGTCCTCTGAGGAGGAAG	0.48																																																0																																										SO:0001589	frameshift_variant	54819			BC005211	CCDS4165.1, CCDS75300.1, CCDS75301.1, CCDS75302.1	5q31.1	2008-05-02			ENSG00000155329	ENSG00000155329		"""Zinc fingers, CCHC domain containing"""	25954	protein-coding gene	gene with protein product						12477932	Standard	XM_005272024		Approved	FLJ20094	uc003kyg.3	Q8TBK6	OTTHUMG00000129013	ENST00000509437.1:c.409dupA	5.37:g.132334446_132334446dupT	ENSP00000423276:p.Glu137fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q9NXR4	Frame_Shift_Ins	INS	ENST00000509437.1	37																																																																																					0.480	ZCCHC10-004	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000370163.1	NM_017665		12	22	12	22
ZNF292	23036	broad.mit.edu;hgsc.bcm.edu	37	6	87964502	87964503	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chr6:87964502_87964503insA	ENST00000369577.3	+	8	1198_1199	c.1155_1156insA	c.(1156-1158)aaafs	p.K386fs	ZNF292_ENST00000339907.4_Frame_Shift_Ins_p.K381fs	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	386						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		ATCTGGAAGTTAAACGTGCTTG	0.376																																																0																																										SO:0001589	frameshift_variant	23036			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.1158dupA	6.37:g.87964505_87964505dupA	ENSP00000358590:p.Lys386fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Frame_Shift_Ins	INS	ENST00000369577.3	37	CCDS47457.1																																																																																				0.376	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021		19	39	19	39
BCOR	54880	broad.mit.edu;hgsc.bcm.edu	37	X	39930292	39930292	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DB-A64W-01A-11D-A29Q-08	TCGA-DB-A64W-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7e7f9bb4-37b2-4e68-8a34-a2388eac7ba0	5bb15587-a86c-4da2-be1d-7b1fa9f105a8	g.chrX:39930292delG	ENST00000378444.4	-	6	3400	c.3172delC	c.(3172-3174)cagfs	p.Q1058fs	BCOR_ENST00000397354.3_Frame_Shift_Del_p.Q1058fs|BCOR_ENST00000378463.1_5'Flank|BCOR_ENST00000342274.4_Frame_Shift_Del_p.Q1058fs|BCOR_ENST00000378455.4_Frame_Shift_Del_p.Q1040fs	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1058					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TTTTTGTCCTGATTTCCTTTC	0.493			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																																Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		0													192.0	149.0	163.0					X																	39930292		2202	4300	6502	SO:0001589	frameshift_variant	54880			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.3172delC	X.37:g.39930292delG	ENSP00000367705:p.Gln1058fs	Somatic		WXS	Illumina GAIIx	Phase_I	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Frame_Shift_Del	DEL	ENST00000378444.4	37	CCDS48093.1																																																																																				0.493	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745		40	58	40	58
