#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
KIAA1217	56243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	24669943	24669943	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr10:24669943G>A	ENST00000376454.3	+	3	530	c.500G>A	c.(499-501)cGt>cAt	p.R167H	KIAA1217_ENST00000376452.3_Missense_Mutation_p.R167H|KIAA1217_ENST00000430453.2_Missense_Mutation_p.R88H|KIAA1217_ENST00000376462.1_Missense_Mutation_p.R87H|KIAA1217_ENST00000458595.1_Missense_Mutation_p.R167H	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	167					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						AGCCGGACTCGTGCGAGCCTT	0.532																																																0													54.0	55.0	55.0					10																	24669943		2203	4300	6503	SO:0001583	missense	56243			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.500G>A	10.37:g.24669943G>A	ENSP00000365637:p.Arg167His	Somatic		WXS	Illumina GAIIx	Phase_I	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	G	34	5.316615	0.95682	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000430453	T;D;T;T;T;T;T	0.94758	-0.15;-3.51;-0.15;-0.15;-0.15;-0.15;-0.15	5.54	5.54	0.83059	.	0.120225	0.56097	D	0.000028	D	0.97405	0.9151	M	0.80183	2.485	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.996;0.999	D	0.97805	1.0247	10	0.87932	D	0	.	19.4705	0.94961	0.0:0.0:1.0:0.0	.	167;167;167;167	Q5T5P2-7;A6NLF3;Q5T5P2;Q5T5P2-2	.;.;SKT_HUMAN;.	H	87;167;167;167;167;17;88	ENSP00000365645:R87H;ENSP00000365639:R167H;ENSP00000392625:R167H;ENSP00000365637:R167H;ENSP00000365635:R167H;ENSP00000404798:R17H;ENSP00000389680:R88H	ENSP00000365635:R167H	R	+	2	0	KIAA1217	24709949	1.000000	0.71417	0.755000	0.31263	0.981000	0.71138	9.452000	0.97615	2.616000	0.88540	0.591000	0.81541	CGT		0.532	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590		10	38	10	38
SVIL	6840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	29820187	29820187	+	Silent	SNP	G	G	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr10:29820187G>A	ENST00000355867.4	-	10	2792	c.2040C>T	c.(2038-2040)gtC>gtT	p.V680V	SVIL_ENST00000375398.2_Silent_p.V680V|SVIL_ENST00000375400.3_Silent_p.V286V	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	680					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				ACTTGCCATCGACAGTTGGCG	0.358																																																0													132.0	112.0	119.0					10																	29820187		2203	4300	6503	SO:0001819	synonymous_variant	6840			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.2040C>T	10.37:g.29820187G>A		Somatic		WXS	Illumina GAIIx	Phase_I	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	ENST00000355867.4	37	CCDS7164.1																																																																																				0.358	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1			14	44	14	44
C10orf91	170393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	134259250	134259250	+	Missense_Mutation	SNP	C	C	T	rs112176383	byFrequency	TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr10:134259250C>T	ENST00000392630.3	+	2	141	c.80C>T	c.(79-81)aCg>aTg	p.T27M	C10orf91_ENST00000321248.2_Missense_Mutation_p.T27M|C10orf91_ENST00000490765.1_3'UTR	NM_173541.2	NP_775812.1	Q5T1B1	CJ091_HUMAN	chromosome 10 open reading frame 91	27										endometrium(1)|kidney(1)|lung(1)|ovary(2)	5		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;6.95e-05)|Epithelial(32;0.000142)|all cancers(32;0.000162)		GCTTGCTGGACGCATGACCAG	0.607													c|||	2	0.000399361	0.0	0.0	5008	,	,		18398	0.0		0.001	False		,,,				2504	0.001															0									MET/THR	0,4406		0,0,2203	163.0	146.0	152.0		80	-1.4	0.0	10	dbSNP_132	152	1,8599	1.2+/-3.3	0,1,4299	no	missense	C10orf91	NM_173541.2	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	27/146	134259250	1,13005	2203	4300	6503	SO:0001583	missense	0			BC030794	CCDS7668.1	10q26.3	2004-03-16			ENSG00000180066	ENSG00000180066			27275	protein-coding gene	gene with protein product						12477932	Standard	NM_173541		Approved	bA432J24.4	uc001llm.3	Q5T1B1	OTTHUMG00000019289	ENST00000392630.3:c.80C>T	10.37:g.134259250C>T	ENSP00000376407:p.Thr27Met	Somatic		WXS	Illumina GAIIx	Phase_I	Q8N0T7	Missense_Mutation	SNP	ENST00000392630.3	37	CCDS7668.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	c	5.354	0.250598	0.10130	0.0	1.16E-4	ENSG00000180066	ENST00000392630;ENST00000321248	T;T	0.07021	3.23;3.23	0.817	-1.42	0.08913	.	.	.	.	.	T	0.05090	0.0136	N	0.08118	0	0.09310	N	1	D	0.69078	0.997	P	0.48089	0.566	T	0.31752	-0.9932	9	0.87932	D	0	.	4.0222	0.09670	0.0:0.4806:0.0:0.5194	.	27	Q5T1B1	CJ091_HUMAN	M	27	ENSP00000376407:T27M;ENSP00000323241:T27M	ENSP00000323241:T27M	T	+	2	0	C10orf91	134109240	0.001000	0.12720	0.000000	0.03702	0.116000	0.19942	-0.960000	0.03849	-0.636000	0.05524	0.306000	0.20318	ACG		0.607	C10orf91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051078.2	NM_173541		46	63	46	63
ZW10	9183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	113639586	113639586	+	Missense_Mutation	SNP	A	A	G			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr11:113639586A>G	ENST00000200135.3	-	2	353	c.209T>C	c.(208-210)aTt>aCt	p.I70T	RP11-667M19.2_ENST00000543486.1_RNA	NM_004724.3	NP_004715.1	O43264	ZW10_HUMAN	zw10 kinetochore protein	70	Interaction with RINT1.|Interaction with ZWINT.				ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic metaphase plate congression (GO:0007080)|mitotic sister chromatid segregation (GO:0000070)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|protein transport (GO:0015031)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|nucleus (GO:0005634)|spindle pole (GO:0000922)	centromeric DNA binding (GO:0019237)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	18		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		CAGCAGGTCAATGTCTTCAGA	0.463																																																0													176.0	160.0	165.0					11																	113639586		2201	4296	6497	SO:0001583	missense	9183			U54996	CCDS8363.1	11q23	2013-01-17	2012-12-13		ENSG00000086827	ENSG00000086827			13194	protein-coding gene	gene with protein product		603954	"""ZW10 (Drosophila) homolog, centromere/kinetochore protein"", ""ZW10, kinetochore associated, homolog (Drosophila)"""			9298984	Standard	NM_004724		Approved	KNTC1AP	uc001poe.3	O43264	OTTHUMG00000168190	ENST00000200135.3:c.209T>C	11.37:g.113639586A>G	ENSP00000200135:p.Ile70Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A1A528	Missense_Mutation	SNP	ENST00000200135.3	37	CCDS8363.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.220553	0.79464	.	.	ENSG00000086827	ENST00000200135	T	0.56444	0.46	5.07	5.07	0.68467	.	0.161857	0.56097	D	0.000027	T	0.55862	0.1947	L	0.50333	1.59	0.48040	D	0.999578	P	0.41080	0.737	P	0.46685	0.524	T	0.60777	-0.7196	10	0.72032	D	0.01	-16.6741	14.1589	0.65434	1.0:0.0:0.0:0.0	.	70	O43264	ZW10_HUMAN	T	70	ENSP00000200135:I70T	ENSP00000200135:I70T	I	-	2	0	ZW10	113144796	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.379000	0.90146	2.136000	0.66102	0.460000	0.39030	ATT		0.463	ZW10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398700.1	NM_004724		22	99	22	99
DPY19L2	283417	hgsc.bcm.edu;broad.mit.edu	37	12	64020270	64020270	+	Missense_Mutation	SNP	G	G	C			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr12:64020270G>C	ENST00000324472.4	-	7	1023	c.840C>G	c.(838-840)tgC>tgG	p.C280W	RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	280					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		TGAAAAAGAAGCACAGTACTG	0.313																																																0													10.0	13.0	12.0					12																	64020270		2103	4235	6338	SO:0001583	missense	283417				CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.840C>G	12.37:g.64020270G>C	ENSP00000315988:p.Cys280Trp	Somatic		WXS	Illumina GAIIx	Phase_I	A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	ENST00000324472.4	37	CCDS31851.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.114147	0.37339	.	.	ENSG00000177990	ENST00000324472	T	0.55760	0.5	2.65	1.7	0.24286	.	0.164638	0.56097	D	0.000032	T	0.47911	0.1471	M	0.63428	1.95	0.80722	D	1	P	0.37548	0.599	B	0.40982	0.345	T	0.32929	-0.9888	9	.	.	.	.	7.7794	0.29056	0.1394:0.0:0.8606:0.0	.	280	Q6NUT2	D19L2_HUMAN	W	280	ENSP00000315988:C280W	.	C	-	3	2	DPY19L2	62306537	1.000000	0.71417	0.964000	0.40570	0.890000	0.51754	2.010000	0.40913	0.402000	0.25451	0.398000	0.26397	TGC		0.313	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812		10	23	10	23
METTL25	84190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	82828486	82828486	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr12:82828486G>A	ENST00000248306.3	+	7	1456	c.1387G>A	c.(1387-1389)Gtt>Att	p.V463I	METTL25_ENST00000547357.1_3'UTR	NM_032230.2	NP_115606.2	Q8N6Q8	MET25_HUMAN	methyltransferase like 25	463							methyltransferase activity (GO:0008168)										ATTGGAGCGGGTTGCAGCTGG	0.373																																																0													115.0	111.0	113.0					12																	82828486		2203	4300	6503	SO:0001583	missense	84190			BC029120	CCDS9024.1	12q21.31	2012-08-13	2012-08-13	2012-08-13	ENSG00000127720	ENSG00000127720			26228	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 26"""	C12orf26			Standard	NM_032230		Approved	FLJ22789	uc001szq.3	Q8N6Q8	OTTHUMG00000170252	ENST00000248306.3:c.1387G>A	12.37:g.82828486G>A	ENSP00000248306:p.Val463Ile	Somatic		WXS	Illumina GAIIx	Phase_I	Q9H5Y3	Missense_Mutation	SNP	ENST00000248306.3	37	CCDS9024.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.106542	0.77096	.	.	ENSG00000127720	ENST00000248306;ENST00000550298	T	0.33865	1.39	5.19	5.19	0.71726	.	0.190614	0.45606	N	0.000345	T	0.38983	0.1061	L	0.32530	0.975	0.51233	D	0.999914	P	0.43314	0.803	P	0.48166	0.569	T	0.03662	-1.1015	10	0.22706	T	0.39	-17.2692	19.0728	0.93147	0.0:0.0:1.0:0.0	.	463	Q8N6Q8	CL026_HUMAN	I	463;98	ENSP00000248306:V463I	ENSP00000248306:V463I	V	+	1	0	C12orf26	81352617	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.010000	0.64004	2.589000	0.87451	0.650000	0.86243	GTT		0.373	METTL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408192.1	NM_032230		29	62	29	62
DNAH10	196385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	124408866	124408866	+	Missense_Mutation	SNP	G	G	A	rs183103487		TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr12:124408866G>A	ENST00000409039.3	+	66	11324	c.11299G>A	c.(11299-11301)Gct>Act	p.A3767T	RP11-380L11.4_ENST00000602952.1_RNA|CCDC92_ENST00000544798.1_Intron	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3767					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AAAGCCCTGCGCTTGGTTGTC	0.403																																																0								G	THR/ALA	2,3672		0,2,1835	71.0	71.0	71.0		11299	-8.6	0.0	12		71	1,8209		0,1,4104	no	missense	DNAH10	NM_207437.3	58	0,3,5939	AA,AG,GG		0.0122,0.0544,0.0252	benign	3767/4472	124408866	3,11881	1837	4105	5942	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.11299G>A	12.37:g.124408866G>A	ENSP00000386770:p.Ala3767Thr	Somatic		WXS	Illumina GAIIx	Phase_I	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	2.301	-0.360280	0.05103	5.44E-4	1.22E-4	ENSG00000197653	ENST00000409039	T	0.08102	3.13	4.96	-8.63	0.00878	Dynein heavy chain (1);	0.581717	0.15894	N	0.239420	T	0.01800	0.0057	N	0.02973	-0.45	0.09310	N	0.999996	B	0.10296	0.003	B	0.10450	0.005	T	0.33650	-0.9860	10	0.18276	T	0.48	.	1.7376	0.02945	0.4471:0.1488:0.2352:0.1689	.	3767	Q8IVF4	DYH10_HUMAN	T	3767	ENSP00000386770:A3767T	ENSP00000386770:A3767T	A	+	1	0	DNAH10	122974819	0.000000	0.05858	0.004000	0.12327	0.053000	0.15095	-1.271000	0.02828	-1.189000	0.02702	-1.036000	0.02392	GCT		0.403	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			16	21	16	21
EDDM3B	64184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	21238446	21238446	+	Missense_Mutation	SNP	G	G	C			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr14:21238446G>C	ENST00000326783.3	+	2	235	c.137G>C	c.(136-138)aGa>aCa	p.R46T		NM_022360.4	NP_071755.1	P56851	EP3B_HUMAN	epididymal protein 3B	46						extracellular region (GO:0005576)		p.R46I(1)		central_nervous_system(1)|kidney(1)|lung(3)|ovary(1)|skin(1)	7						CGAGAATTCAGAGAGTACAAA	0.393																																																1	Substitution - Missense(1)	central_nervous_system(1)											103.0	99.0	101.0					14																	21238446		2203	4300	6503	SO:0001583	missense	64184			X76386	CCDS9557.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181552	ENSG00000181552			19223	protein-coding gene	gene with protein product		611582	"""family with sequence similarity 12, member B (epididymal)"""	FAM12B		7514008	Standard	NM_022360		Approved	HE3-BETA	uc001vyd.3	P56851	OTTHUMG00000029583	ENST00000326783.3:c.137G>C	14.37:g.21238446G>C	ENSP00000314810:p.Arg46Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A0PK89	Missense_Mutation	SNP	ENST00000326783.3	37	CCDS9557.1	.	.	.	.	.	.	.	.	.	.	g	2.401	-0.337579	0.05278	.	.	ENSG00000181552	ENST00000326783	T	0.72394	-0.65	4.05	-4.31	0.03698	Ribonuclease A, domain (3);	1.532860	0.03790	N	0.262668	T	0.46795	0.1411	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.26677	-1.0096	10	0.34782	T	0.22	.	5.9659	0.19325	0.4364:0.0:0.439:0.1246	.	46	P56851	EP3B_HUMAN	T	46	ENSP00000314810:R46T	ENSP00000314810:R46T	R	+	2	0	EDDM3B	20308286	0.000000	0.05858	0.000000	0.03702	0.167000	0.22549	-1.215000	0.02985	-0.964000	0.03595	-1.439000	0.01073	AGA		0.393	EDDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073745.2			24	86	24	86
E4F1	1877	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	2279638	2279638	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr16:2279638C>T	ENST00000301727.4	+	3	425	c.377C>T	c.(376-378)tCt>tTt	p.S126F	E4F1_ENST00000564139.1_Missense_Mutation_p.S126F|E4F1_ENST00000565090.1_Missense_Mutation_p.S126F	NM_004424.3	NP_004415.2	Q66K89	E4F1_HUMAN	E4F transcription factor 1	126					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|mitotic cell cycle arrest (GO:0071850)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell cycle process (GO:0010564)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle, embryonic (GO:0009794)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			ovary(1)	1						GAGGCGGCCTCTCTGGCAGCA	0.617																																																0													92.0	95.0	94.0					16																	2279638		2197	4300	6497	SO:0001583	missense	1877			U87269	CCDS32370.1, CCDS73809.1, CCDS73810.1	16p13.3	2013-01-08				ENSG00000167967		"""Zinc fingers, C2H2-type"""	3121	protein-coding gene	gene with protein product		603022				9763670, 8828041	Standard	XM_005255155		Approved	E4F	uc002cpm.3	Q66K89		ENST00000301727.4:c.377C>T	16.37:g.2279638C>T	ENSP00000301727:p.Ser126Phe	Somatic		WXS	Illumina GAIIx	Phase_I	A8K2R4|O00146	Missense_Mutation	SNP	ENST00000301727.4	37	CCDS32370.1	.	.	.	.	.	.	.	.	.	.	C	5.045	0.194052	0.09599	.	.	ENSG00000167967	ENST00000301727	T	0.07567	3.18	4.14	4.14	0.48551	.	0.627020	0.16507	N	0.211385	T	0.13200	0.0320	L	0.40543	1.245	0.25926	N	0.983057	P;P;P	0.51351	0.944;0.8;0.612	P;P;B	0.50490	0.642;0.467;0.259	T	0.04347	-1.0958	10	0.52906	T	0.07	-4.2603	13.2836	0.60230	0.0:1.0:0.0:0.0	.	122;126;126	E9PFZ8;E7EMF7;Q66K89	.;.;E4F1_HUMAN	F	126	ENSP00000301727:S126F	ENSP00000301727:S126F	S	+	2	0	E4F1	2219639	0.860000	0.29831	0.077000	0.20336	0.870000	0.49936	3.300000	0.51834	2.150000	0.67090	0.561000	0.74099	TCT		0.617	E4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435225.1	NM_004424		40	104	40	104
CCDC113	29070	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	58292428	58292428	+	Splice_Site	SNP	G	G	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr16:58292428G>A	ENST00000219299.4	+	4	625		c.e4+1		CCDC113_ENST00000443128.2_Splice_Site	NM_014157.3	NP_054876.2	Q9H0I3	CC113_HUMAN	coiled-coil domain containing 113							cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)				large_intestine(4)|lung(6)|ovary(1)|urinary_tract(1)	12						CCGCCGGAGGGTAAGTTGGCA	0.418																																																0													58.0	56.0	57.0					16																	58292428		2198	4300	6498	SO:0001630	splice_region_variant	29070			AL136785	CCDS10795.1, CCDS45497.1	16q21	2008-02-05			ENSG00000103021	ENSG00000103021			25002	protein-coding gene	gene with protein product						11230166, 11042152	Standard	NM_014157		Approved	HSPC065, DKFZp434N1418	uc002ene.3	Q9H0I3	OTTHUMG00000133489	ENST00000219299.4:c.546+1G>A	16.37:g.58292428G>A		Somatic		WXS	Illumina GAIIx	Phase_I	B2RAQ7|B4DR20|Q9NZX2	Splice_Site	SNP	ENST00000219299.4	37	CCDS10795.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177492	0.57692	.	.	ENSG00000103021	ENST00000443128;ENST00000219299	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3633	0.83280	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC113	56849929	1.000000	0.71417	1.000000	0.80357	0.704000	0.40688	4.404000	0.59735	2.525000	0.85131	0.655000	0.94253	.		0.418	CCDC113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257387.2	NM_014157	Intron	17	26	17	26
MYH1	4619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	10404045	10404045	+	Missense_Mutation	SNP	C	C	T	rs142605633	byFrequency	TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr17:10404045C>T	ENST00000226207.5	-	28	3857	c.3763G>A	c.(3763-3765)Gct>Act	p.A1255T	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1255					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A1255T(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TCTTCTAGAGCGCGGCACATC	0.453																																																1	Substitution - Missense(1)	large_intestine(1)						C	THR/ALA	0,4406		0,0,2203	146.0	129.0	135.0		3763	3.1	0.1	17	dbSNP_134	135	2,8598	2.2+/-6.3	0,2,4298	yes	missense	MYH1	NM_005963.3	58	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	1255/1940	10404045	2,13004	2203	4300	6503	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3763G>A	17.37:g.10404045C>T	ENSP00000226207:p.Ala1255Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	2.155	-0.393510	0.04899	0.0	2.33E-4	ENSG00000109061	ENST00000226207	D	0.82433	-1.61	5.45	3.12	0.35913	Myosin tail (1);	0.320500	0.22216	N	0.063022	T	0.47930	0.1472	N	0.00468	-1.46	0.26872	N	0.967733	B	0.02656	0.0	B	0.04013	0.001	T	0.49103	-0.8974	10	0.02654	T	1	.	9.6684	0.39998	0.0:0.2075:0.0:0.7925	.	1255	P12882	MYH1_HUMAN	T	1255	ENSP00000226207:A1255T	ENSP00000226207:A1255T	A	-	1	0	MYH1	10344770	0.018000	0.18449	0.146000	0.22360	0.752000	0.42762	0.160000	0.16462	0.445000	0.26639	-0.300000	0.09419	GCT		0.453	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		17	64	17	64
DLX4	1748	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	48051291	48051291	+	Missense_Mutation	SNP	C	C	T	rs202154782		TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr17:48051291C>T	ENST00000240306.3	+	3	1002	c.707C>T	c.(706-708)tCg>tTg	p.S236L	DLX4_ENST00000411890.2_Missense_Mutation_p.S164L	NM_138281.2	NP_612138.1	Q92988	DLX4_HUMAN	distal-less homeobox 4	236					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S236L(1)		central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(3)	10						GTCCTGGCTTCGCCTCAGATG	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17706	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	large_intestine(1)						C	LEU/SER,LEU/SER	0,4406		0,0,2203	40.0	40.0	40.0		491,707	-0.6	0.0	17		40	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DLX4	NM_001934.2,NM_138281.2	145,145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	164/169,236/241	48051291	1,13005	2203	4300	6503	SO:0001583	missense	1748				CCDS11555.1, CCDS45728.1	17q21.33	2011-06-20			ENSG00000108813	ENSG00000108813		"""Homeoboxes / ANTP class : NKL subclass"""	2917	protein-coding gene	gene with protein product		601911		DLX7, DLX9			Standard	NM_138281		Approved	DLX8, BP1	uc002ipv.3	Q92988	OTTHUMG00000161839	ENST00000240306.3:c.707C>T	17.37:g.48051291C>T	ENSP00000240306:p.Ser236Leu	Somatic		WXS	Illumina GAIIx	Phase_I	D3DTX2|D3DTX3|O60480|Q13265|Q6PJK0|Q9HBE0	Missense_Mutation	SNP	ENST00000240306.3	37	CCDS11555.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	9.774	1.173571	0.21704	0.0	1.16E-4	ENSG00000108813	ENST00000240306;ENST00000411890	D;D	0.91894	-2.68;-2.93	4.84	-0.608	0.11611	.	.	.	.	.	T	0.75213	0.3819	N	0.00926	-1.1	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.65022	-0.6269	9	0.41790	T	0.15	2.7864	8.3794	0.32461	0.0:0.4325:0.0:0.5675	.	164;236	Q92988-2;Q92988	.;DLX4_HUMAN	L	236;164	ENSP00000240306:S236L;ENSP00000410622:S164L	ENSP00000240306:S236L	S	+	2	0	DLX4	45406290	0.012000	0.17670	0.001000	0.08648	0.827000	0.46813	1.282000	0.33226	-0.228000	0.09869	0.561000	0.74099	TCG		0.617	DLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366214.1			22	25	22	25
PIEZO2	63895	hgsc.bcm.edu;broad.mit.edu	37	18	10677809	10677809	+	Silent	SNP	A	A	G			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr18:10677809A>G	ENST00000503781.3	-	49	7676	c.7677T>C	c.(7675-7677)aaT>aaC	p.N2559N	PIEZO2_ENST00000302079.6_Silent_p.N2496N|PIEZO2_ENST00000538948.1_Silent_p.N516N|PIEZO2_ENST00000285141.4_Silent_p.N351N|PIEZO2_ENST00000581680.1_5'UTR|PIEZO2_ENST00000580640.1_Silent_p.N2584N	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2559					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										TTCGAGTAATATTTTTAAGAG	0.323																																																0													98.0	94.0	95.0					18																	10677809		2202	4300	6502	SO:0001819	synonymous_variant	63895			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.7677T>C	18.37:g.10677809A>G		Somatic		WXS	Illumina GAIIx	Phase_I	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Silent	SNP	ENST00000503781.3	37																																																																																					0.323	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068		5	56	5	56
CIC	23152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	42791721	42791721	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr19:42791721C>T	ENST00000575354.2	+	5	647	c.607C>T	c.(607-609)Ccc>Tcc	p.P203S	CIC_ENST00000160740.3_Missense_Mutation_p.P203S|CIC_ENST00000572681.2_Missense_Mutation_p.P1112S	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	203					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				CATCCGGCGGCCCATGAATGC	0.627			"""Mis, F, S"""		oligodendroglioma																																		Rec	yes		19	19q13.2	23152	capicua homolog		O	0													64.0	68.0	67.0					19																	42791721		2203	4300	6503	SO:0001583	missense	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.607C>T	19.37:g.42791721C>T	ENSP00000458663:p.Pro203Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	C	17.79	3.476088	0.63737	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.39	4.39	0.52855	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	.	.	.	.	D	0.85133	0.5627	M	0.92738	3.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88918	0.3364	8	0.87932	D	0	-12.2603	14.5138	0.67807	0.0:1.0:0.0:0.0	.	203	Q96RK0	CIC_HUMAN	S	203	.	ENSP00000160740:P203S	P	+	1	0	CIC	47483561	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.351000	0.79395	2.284000	0.76573	0.555000	0.69702	CCC		0.627	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2			12	28	12	28
FBXO42	54455	hgsc.bcm.edu;ucsc.edu	37	1	16578016	16578016	+	Missense_Mutation	SNP	C	C	A	rs143730419	byFrequency	TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr1:16578016C>A	ENST00000375592.3	-	10	1519	c.1303G>T	c.(1303-1305)Ggc>Tgc	p.G435C		NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	435										autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		ATAGGAGAGCCGTCTCCTCTG	0.577																																																0													32.0	33.0	33.0					1																	16578016		2203	4300	6503	SO:0001583	missense	54455			BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.1303G>T	1.37:g.16578016C>A	ENSP00000364742:p.Gly435Cys	Somatic		WXS	Illumina GAIIx	Phase_I	B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Missense_Mutation	SNP	ENST00000375592.3	37	CCDS30613.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.183424	0.38609	.	.	ENSG00000037637	ENST00000375592;ENST00000456164;ENST00000444116	T;T;T	0.46451	3.77;0.87;0.87	5.81	4.89	0.63831	.	0.146358	0.48286	D	0.000181	T	0.32823	0.0842	N	0.22421	0.69	0.46149	D	0.998897	P	0.45569	0.861	P	0.45428	0.48	T	0.05954	-1.0854	10	0.54805	T	0.06	-17.9469	9.7701	0.40585	0.0:0.858:0.0:0.142	.	435	Q6P3S6	FBX42_HUMAN	C	435;153;153	ENSP00000364742:G435C;ENSP00000415663:G153C;ENSP00000412416:G153C	ENSP00000364742:G435C	G	-	1	0	FBXO42	16450603	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	2.501000	0.45389	2.763000	0.94921	0.650000	0.86243	GGC		0.577	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006285.1			8	4	8	4
LRRC8B	23507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	90048483	90048483	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr1:90048483C>T	ENST00000330947.2	+	5	634	c.274C>T	c.(274-276)Cga>Tga	p.R92*	RP5-1007M22.2_ENST00000443562.1_RNA|LRRC8B_ENST00000439853.1_Nonsense_Mutation_p.R92*|LRRC8B_ENST00000358200.4_Nonsense_Mutation_p.R92*	NM_001134476.1	NP_001127948.1	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member B	92					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	26		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		GCTCCCCCTCCGAATTCAGAA	0.498																																																0													130.0	118.0	122.0					1																	90048483		2203	4300	6503	SO:0001587	stop_gained	23507			AF385436	CCDS724.1	1p22.2	2008-02-05			ENSG00000197147	ENSG00000197147			30692	protein-coding gene	gene with protein product	"""T cell activation leucine repeat rich protein"""	612888				9039502	Standard	NM_015350		Approved	TA-LRRP, KIAA0231	uc001dni.3	Q6P9F7	OTTHUMG00000010129	ENST00000330947.2:c.274C>T	1.37:g.90048483C>T	ENSP00000332674:p.Arg92*	Somatic		WXS	Illumina GAIIx	Phase_I	D3DT28|Q6UY21|Q8N106|Q92627	Nonsense_Mutation	SNP	ENST00000330947.2	37	CCDS724.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670030	0.67814	.	.	ENSG00000197147	ENST00000449440;ENST00000330947;ENST00000358200;ENST00000439853;ENST00000541858	.	.	.	5.09	2.83	0.33086	.	0.172988	0.39834	N	0.001253	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	8.6643	0.34112	0.406:0.5039:0.0901:0.0	.	.	.	.	X	92	.	ENSP00000332674:R92X	R	+	1	2	LRRC8B	89821071	0.927000	0.31430	0.996000	0.52242	0.801000	0.45260	1.681000	0.37618	1.066000	0.40716	0.655000	0.94253	CGA		0.498	LRRC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028008.1	NM_015350		59	9	59	9
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	21230714	21230714	+	Missense_Mutation	SNP	A	A	T			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr2:21230714A>T	ENST00000233242.1	-	26	9153	c.9026T>A	c.(9025-9027)cTg>cAg	p.L3009Q		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3009					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.F3010fs*15(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCTCCAAACAGTGCCATGCC	0.418																																																1	Deletion - Frameshift(1)	breast(1)											69.0	73.0	72.0					2																	21230714		2203	4300	6503	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.9026T>A	2.37:g.21230714A>T	ENSP00000233242:p.Leu3009Gln	Somatic		WXS	Illumina GAIIx	Phase_I	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	A	0.856	-0.736902	0.03111	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00659	5.94	5.87	3.44	0.39384	.	0.305250	0.23731	N	0.045121	T	0.00754	0.0025	L	0.43923	1.385	0.09310	N	0.999992	B	0.22276	0.067	B	0.15870	0.014	T	0.47394	-0.9121	10	0.15952	T	0.53	.	5.9656	0.19322	0.5439:0.0:0.0739:0.3822	.	3009	P04114	APOB_HUMAN	Q	3009	ENSP00000233242:L3009Q	ENSP00000233242:L3009Q	L	-	2	0	APOB	21084219	0.011000	0.17503	0.002000	0.10522	0.035000	0.12851	2.225000	0.42954	1.016000	0.39470	0.533000	0.62120	CTG		0.418	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			12	52	12	52
PPIG	9360	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	170460747	170460747	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr2:170460747G>A	ENST00000260970.3	+	4	332	c.112G>A	c.(112-114)Gag>Aag	p.E38K	PPIG_ENST00000448752.2_Missense_Mutation_p.E38K|PPIG_ENST00000462903.1_Missense_Mutation_p.E38K|PPIG_ENST00000409714.3_Missense_Mutation_p.E38K	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	38	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	CAAAACATGCGAGAACTTTCG	0.343																																																0													130.0	129.0	129.0					2																	170460747		2203	4300	6503	SO:0001583	missense	9360			X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.112G>A	2.37:g.170460747G>A	ENSP00000260970:p.Glu38Lys	Somatic		WXS	Illumina GAIIx	Phase_I	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Missense_Mutation	SNP	ENST00000260970.3	37	CCDS2235.1	.	.	.	.	.	.	.	.	.	.	G	35	5.434310	0.96150	.	.	ENSG00000138398	ENST00000260970;ENST00000530133;ENST00000409714;ENST00000462903;ENST00000448752;ENST00000418888;ENST00000414307	T;T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83;1.83	5.13	5.13	0.70059	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.000000	0.85682	D	0.000000	T	0.53158	0.1779	M	0.77313	2.365	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.994	D;D;P;P	0.85130	0.997;0.997;0.85;0.821	T	0.48445	-0.9035	10	0.28530	T	0.3	-14.6774	18.9436	0.92613	0.0:0.0:1.0:0.0	.	38;38;38;38	E9PG73;Q2NKQ6;Q13427-2;Q13427	.;.;.;PPIG_HUMAN	K	38	ENSP00000260970:E38K;ENSP00000386245:E38K;ENSP00000435987:E38K;ENSP00000407083:E38K;ENSP00000394202:E38K;ENSP00000402222:E38K	ENSP00000260970:E38K	E	+	1	0	PPIG	170168993	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.513000	0.98010	2.541000	0.85698	0.591000	0.81541	GAG		0.343	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2			35	107	35	107
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	C	T	rs121913500		TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr2:209113112C>T	ENST00000415913.1	-	4	776	c.395G>A	c.(394-396)cGt>cAt	p.R132H	IDH1_ENST00000345146.2_Missense_Mutation_p.R132H|IDH1_ENST00000446179.1_Missense_Mutation_p.R132H	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132H(2774)|p.R132L(59)|p.R132V(1)|p.G131_R132>VL(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	2835	Substitution - Missense(2834)|Complex - compound substitution(1)	central_nervous_system(2579)|haematopoietic_and_lymphoid_tissue(205)|bone(43)|prostate(4)|biliary_tract(2)|urinary_tract(1)|skin(1)											79.0	73.0	75.0					2																	209113112		2203	4300	6503	SO:0001583	missense	3417				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.395G>A	2.37:g.209113112C>T	ENSP00000390265:p.Arg132His	Somatic		WXS	Illumina GAIIx	Phase_I	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657324	0.88154	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	4.69	0.59074	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	H	0.99379	4.54	0.80722	D	1	B	0.25486	0.127	B	0.25405	0.06	D	0.92324	0.5868	10	0.87932	D	0	-20.0399	14.3783	0.66895	0.0:0.9288:0.0:0.0712	.	132	O75874	IDHC_HUMAN	H	132	ENSP00000260985:R132H;ENSP00000410513:R132H;ENSP00000390265:R132H;ENSP00000391075:R132H	ENSP00000260985:R132H	R	-	2	0	IDH1	208821357	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.088000	0.71371	1.356000	0.45884	0.555000	0.69702	CGT		0.393	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			35	49	35	49
SLC11A1	6556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	219258872	219258872	+	Silent	SNP	G	G	A	rs375573580		TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr2:219258872G>A	ENST00000233202.6	+	13	1684	c.1344G>A	c.(1342-1344)acG>acA	p.T448T	SLC11A1_ENST00000539932.1_Silent_p.T330T	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	448					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCATCCTCACGTTCACCAGCA	0.582													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19686	0.0		0.0	False		,,,				2504	0.0															0								G		0,4406		0,0,2203	142.0	104.0	117.0		1344	-9.0	0.0	2		117	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC11A1	NM_000578.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		448/551	219258872	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6556			D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.1344G>A	2.37:g.219258872G>A		Somatic		WXS	Illumina GAIIx	Phase_I	C0H5Y3	Silent	SNP	ENST00000233202.6	37	CCDS2415.1																																																																																				0.582	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	NM_000578		9	53	9	53
ULK4	54986	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	41953050	41953050	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr3:41953050C>T	ENST00000301831.4	-	10	1460	c.998G>A	c.(997-999)gGt>gAt	p.G333D	ULK4_ENST00000420927.1_Missense_Mutation_p.G333D	NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	333					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		GAAAGAGTGACCTAGTGGTTG	0.408																																																0													146.0	135.0	139.0					3																	41953050		1886	4103	5989	SO:0001583	missense	54986			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.998G>A	3.37:g.41953050C>T	ENSP00000301831:p.Gly333Asp	Somatic		WXS	Illumina GAIIx	Phase_I	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	37	CCDS43071.1	.	.	.	.	.	.	.	.	.	.	C	2.415	-0.334502	0.05278	.	.	ENSG00000168038	ENST00000301831;ENST00000420927	T;T	0.65364	0.68;-0.15	5.08	1.84	0.25277	.	0.772455	0.13086	N	0.414946	T	0.39064	0.1064	N	0.22421	0.69	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.21999	-1.0229	10	0.08381	T	0.77	.	5.2285	0.15408	0.0:0.5173:0.0:0.4827	.	333;333	B4E2M4;Q96C45	.;ULK4_HUMAN	D	333	ENSP00000301831:G333D;ENSP00000412187:G333D	ENSP00000301831:G333D	G	-	2	0	ULK4	41928054	0.250000	0.23951	0.001000	0.08648	0.207000	0.24258	0.436000	0.21526	0.553000	0.29044	0.555000	0.69702	GGT		0.408	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989		11	111	11	111
CCDC13	152206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	42754752	42754752	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr3:42754752C>T	ENST00000310232.6	-	14	1858	c.1775G>A	c.(1774-1776)cGa>cAa	p.R592Q		NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	592										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						GGTGCGGTGTCGCTCCTCCTG	0.602																																																0													113.0	104.0	107.0					3																	42754752		2203	4300	6503	SO:0001583	missense	152206			AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1775G>A	3.37:g.42754752C>T	ENSP00000309836:p.Arg592Gln	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000310232.6	37	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.980557	0.53827	.	.	ENSG00000244607	ENST00000310232	T	0.12465	2.68	5.26	5.26	0.73747	.	0.069979	0.56097	D	0.000033	T	0.21186	0.0510	M	0.76574	2.34	0.28465	N	0.915688	D	0.56287	0.975	P	0.47827	0.558	T	0.14783	-1.0460	10	0.16896	T	0.51	.	11.8556	0.52435	0.0:0.9147:0.0:0.0853	.	592	Q8IYE1	CCD13_HUMAN	Q	592	ENSP00000309836:R592Q	ENSP00000309836:R592Q	R	-	2	0	CCDC13	42729756	0.997000	0.39634	0.985000	0.45067	0.882000	0.50991	2.941000	0.49011	2.464000	0.83262	0.591000	0.81541	CGA		0.602	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719		30	112	30	112
CBLB	868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	105495351	105495351	+	Missense_Mutation	SNP	T	T	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr3:105495351T>A	ENST00000264122.4	-	4	776	c.455A>T	c.(454-456)cAc>cTc	p.H152L	CBLB_ENST00000403724.1_Missense_Mutation_p.H152L|CBLB_ENST00000545639.1_Intron|CBLB_ENST00000405772.1_Missense_Mutation_p.H152L|CBLB_ENST00000394027.3_Missense_Mutation_p.H174L	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	152	4H.|Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						TGCCAGCATGTGACTGAAGAT	0.378			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	0													121.0	117.0	119.0					3																	105495351		2203	4300	6503	SO:0001583	missense	868			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.455A>T	3.37:g.105495351T>A	ENSP00000264122:p.His152Leu	Somatic		WXS	Illumina GAIIx	Phase_I	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	ENST00000264122.4	37	CCDS2948.1	.	.	.	.	.	.	.	.	.	.	T	28.9	4.962813	0.92791	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95	5.79	5.79	0.91817	Adaptor protein Cbl, N-terminal helical (3);Adaptor protein Cbl, PTB domain (1);	0.000000	0.85682	D	0.000000	D	0.91798	0.7405	M	0.71871	2.18	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.997;1.0	D	0.92629	0.6114	10	0.87932	D	0	-17.3059	16.1163	0.81306	0.0:0.0:0.0:1.0	.	174;152;152	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	L	152;174;152;152	ENSP00000264122:H152L;ENSP00000377595:H174L;ENSP00000384816:H152L;ENSP00000384938:H152L	ENSP00000264122:H152L	H	-	2	0	CBLB	106978041	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.216000	0.71823	0.455000	0.32223	CAC		0.378	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662		15	99	15	99
NMD3	51068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	160952983	160952983	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr3:160952983G>A	ENST00000460469.1	+	6	1015	c.560G>A	c.(559-561)cGt>cAt	p.R187H	NMD3_ENST00000351193.2_Missense_Mutation_p.R187H|NMD3_ENST00000472947.1_Missense_Mutation_p.R187H|NMD3_ENST00000478160.1_3'UTR			Q96D46	NMD3_HUMAN	NMD3 ribosome export adaptor	187					protein transport (GO:0015031)|ribosomal large subunit export from nucleus (GO:0000055)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|ribosomal large subunit binding (GO:0043023)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(10)|ovary(1)|skin(1)|urinary_tract(2)	25			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			AATACACTTCGTATCAAAGAG	0.249																																																0													32.0	35.0	34.0					3																	160952983		2194	4270	6464	SO:0001583	missense	51068			BC013317	CCDS3194.1	3q26.1	2013-08-06	2013-08-06		ENSG00000169251	ENSG00000169251			24250	protein-coding gene	gene with protein product		611021	"""NMD3 homolog (S. cerevisiae)"""			10810093, 23782956, 12773398	Standard	NM_015938		Approved	CGI-07	uc003feb.1	Q96D46	OTTHUMG00000159063	ENST00000460469.1:c.560G>A	3.37:g.160952983G>A	ENSP00000419004:p.Arg187His	Somatic		WXS	Illumina GAIIx	Phase_I	D3DNM7|Q9Y2Z6	Missense_Mutation	SNP	ENST00000460469.1	37	CCDS3194.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.759357	0.69763	.	.	ENSG00000169251	ENST00000493066;ENST00000351193;ENST00000472947;ENST00000463518;ENST00000460469;ENST00000540137	T;T;T;T;T	0.44881	0.91;0.92;0.92;0.91;0.92	4.57	4.57	0.56435	.	0.105878	0.64402	D	0.000003	T	0.57636	0.2067	M	0.75264	2.295	0.47183	D	0.999347	D;D;D	0.64830	0.984;0.984;0.994	P;P;P	0.57911	0.767;0.829;0.727	T	0.61907	-0.6966	10	0.56958	D	0.05	-29.7645	12.3097	0.54922	0.087:0.0:0.913:0.0	.	187;187;187	B3KT11;C9JA08;Q96D46	.;.;NMD3_HUMAN	H	187;187;187;187;187;67	ENSP00000419030:R187H;ENSP00000307525:R187H;ENSP00000417559:R187H;ENSP00000418908:R187H;ENSP00000419004:R187H	ENSP00000307525:R187H	R	+	2	0	NMD3	162435677	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.674000	0.68117	2.243000	0.73865	0.591000	0.81541	CGT		0.249	NMD3-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353114.1	NM_015938		27	32	27	32
TTC14	151613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	180327531	180327531	+	Missense_Mutation	SNP	A	A	G			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr3:180327531A>G	ENST00000296015.4	+	12	1646	c.1514A>G	c.(1513-1515)cAt>cGt	p.H505R	TTC14_ENST00000382584.4_Missense_Mutation_p.H505R|TTC14_ENST00000412756.2_3'UTR|TTC14_ENST00000465625.1_3'UTR	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	505	Ser-rich.						RNA binding (GO:0003723)			endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CATAAGAAACATAAGAGGAAC	0.413																																																0													96.0	89.0	91.0					3																	180327531		2203	4300	6503	SO:0001583	missense	151613			AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.1514A>G	3.37:g.180327531A>G	ENSP00000296015:p.His505Arg	Somatic		WXS	Illumina GAIIx	Phase_I	G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	ENST00000296015.4	37	CCDS3237.1	.	.	.	.	.	.	.	.	.	.	A	2.051	-0.417831	0.04766	.	.	ENSG00000163728	ENST00000296015;ENST00000382584	T;D	0.97016	1.05;-4.21	5.92	-5.62	0.02481	.	1.312740	0.04742	N	0.422997	D	0.87481	0.6188	N	0.01705	-0.755	0.21782	N	0.999547	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.77910	-0.2411	10	0.09084	T	0.74	-0.1631	17.2105	0.86929	0.388:0.0:0.612:0.0	.	505;505	Q96N46-2;Q96N46	.;TTC14_HUMAN	R	505	ENSP00000296015:H505R;ENSP00000372027:H505R	ENSP00000296015:H505R	H	+	2	0	TTC14	181810225	0.999000	0.42202	0.697000	0.30258	0.988000	0.76386	1.187000	0.32090	-1.137000	0.02888	-0.242000	0.12053	CAT		0.413	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1	NM_133462		18	57	18	57
DSPP	1834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	88534157	88534157	+	Silent	SNP	T	T	C			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr4:88534157T>C	ENST00000282478.7	+	3	852	c.819T>C	c.(817-819)agT>agC	p.S273S	DSPP_ENST00000399271.1_Silent_p.S273S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	273					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		GAAAAGACAGTAGTAATAACA	0.438																																																0													116.0	129.0	125.0					4																	88534157		2038	4188	6226	SO:0001819	synonymous_variant	1834			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.819T>C	4.37:g.88534157T>C		Somatic		WXS	Illumina GAIIx	Phase_I	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																				0.438	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208		22	27	22	27
MROH2B	133558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	41004891	41004891	+	Silent	SNP	G	G	A	rs542700965		TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr5:41004891G>A	ENST00000399564.4	-	36	4446	c.3996C>T	c.(3994-3996)tcC>tcT	p.S1332S	MROH2B_ENST00000506092.2_Silent_p.S887S	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1332																	GAGGAGCCCCGGATGCTGTGT	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		20152	0.0		0.001	False		,,,				2504	0.0															0													85.0	80.0	82.0					5																	41004891		1898	4126	6024	SO:0001819	synonymous_variant	133558				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.3996C>T	5.37:g.41004891G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	ENST00000399564.4	37	CCDS47202.1																																																																																				0.478	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		9	57	9	57
N4BP3	23138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	177547253	177547253	+	Silent	SNP	G	G	A	rs377627701		TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr5:177547253G>A	ENST00000274605.5	+	3	764	c.405G>A	c.(403-405)gcG>gcA	p.A135A		NM_015111.1	NP_055926.1	O15049	N4BP3_HUMAN	NEDD4 binding protein 3	135						cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)				breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAAGTCTGGCGTCCCACAAAG	0.682													G|||	1	0.000199681	0.0	0.0	5008	,	,		13875	0.0		0.0	False		,,,				2504	0.001															0								G		0,4406		0,0,2203	38.0	39.0	39.0		405	-10.0	0.1	5		39	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	N4BP3	NM_015111.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		135/545	177547253	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23138			AB002339	CCDS34307.1	5q35.3	2012-05-17				ENSG00000145911			29852	protein-coding gene	gene with protein product						9205841, 11717310	Standard	XM_006714834		Approved	LZTS4	uc003mik.1	O15049		ENST00000274605.5:c.405G>A	5.37:g.177547253G>A		Somatic		WXS	Illumina GAIIx	Phase_I	B4DIL3|D3DWP3|Q6ZSQ6|Q7Z6I3	Silent	SNP	ENST00000274605.5	37	CCDS34307.1																																																																																				0.682	N4BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373552.2	NM_015111		25	28	25	28
GPR116	221395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	46830657	46830657	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr6:46830657C>T	ENST00000283296.7	-	15	2455	c.2167G>A	c.(2167-2169)Gcc>Acc	p.A723T	GPR116_ENST00000362015.4_Missense_Mutation_p.A723T|GPR116_ENST00000456426.2_Missense_Mutation_p.A581T|GPR116_ENST00000545669.1_Missense_Mutation_p.A152T|GPR116_ENST00000265417.7_Missense_Mutation_p.A723T	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	723					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			TTTATTGGGGCAGAGATGCAG	0.512																																					NSCLC(59;410 1274 8751 36715 50546)											0													207.0	201.0	203.0					6																	46830657		2203	4300	6503	SO:0001583	missense	221395			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.2167G>A	6.37:g.46830657C>T	ENSP00000283296:p.Ala723Thr	Somatic		WXS	Illumina GAIIx	Phase_I	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	ENST00000283296.7	37	CCDS4919.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.948256	0.34377	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000545557;ENST00000265417;ENST00000545669	T;T;T;T;T	0.27256	1.71;2.09;1.73;1.71;1.68	5.09	5.09	0.68999	.	0.108147	0.41294	D	0.000920	T	0.28200	0.0696	M	0.72118	2.19	0.32042	N	0.598122	P;B;D;B;D	0.58620	0.473;0.149;0.983;0.34;0.983	B;B;P;B;P	0.55011	0.208;0.053;0.766;0.113;0.766	T	0.11179	-1.0598	10	0.17369	T	0.5	-26.0578	15.6047	0.76658	0.0:1.0:0.0:0.0	.	152;278;723;581;723	F5GWK9;B4DTV3;E9PBS6;Q8IZF2-3;Q8IZF2	.;.;.;.;GP116_HUMAN	T	723;723;723;581;94;723;152	ENSP00000283296:A723T;ENSP00000354563:A723T;ENSP00000412866:A581T;ENSP00000265417:A723T;ENSP00000441581:A152T	ENSP00000265417:A723T	A	-	1	0	GPR116	46938616	0.001000	0.12720	0.985000	0.45067	0.011000	0.07611	0.853000	0.27777	2.537000	0.85549	0.655000	0.94253	GCC		0.512	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234		44	147	44	147
LMOD2	442721	hgsc.bcm.edu;broad.mit.edu	37	7	123302491	123302491	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr7:123302491G>A	ENST00000458573.2	+	2	1008	c.851G>A	c.(850-852)gGg>gAg	p.G284E	LMOD2_ENST00000456238.2_Intron	NM_207163.1	NP_997046.1	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	284						cytoskeleton (GO:0005856)											ACGGGAAAGGGGATCCTGGCC	0.542																																																0													94.0	93.0	93.0					7																	123302491		2144	4247	6391	SO:0001583	missense	442721			AC006333	CCDS47693.1	7q31.32	2008-08-08			ENSG00000170807	ENSG00000170807			6648	protein-coding gene	gene with protein product		608006					Standard	NM_207163		Approved		uc003vky.2	Q6P5Q4	OTTHUMG00000157149	ENST00000458573.2:c.851G>A	7.37:g.123302491G>A	ENSP00000411932:p.Gly284Glu	Somatic		WXS	Illumina GAIIx	Phase_I	A4D0W9|A4D0Y2|Q8WVJ8	Missense_Mutation	SNP	ENST00000458573.2	37	CCDS47693.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.947867	0.92593	.	.	ENSG00000170807	ENST00000458573;ENST00000444702;ENST00000332074	D	0.92911	-3.13	5.35	5.35	0.76521	.	.	.	.	.	D	0.97176	0.9077	M	0.92738	3.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97720	1.0196	9	0.72032	D	0.01	-14.2314	19.4255	0.94740	0.0:0.0:1.0:0.0	.	284	Q6P5Q4	LMOD2_HUMAN	E	284;244;255	ENSP00000411932:G284E	ENSP00000405123:G255E	G	+	2	0	LMOD2	123089727	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	9.813000	0.99286	2.648000	0.89879	0.591000	0.81541	GGG		0.542	LMOD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348525.1			7	96	7	96
BRINP1	1620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	122075489	122075489	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr9:122075489G>A	ENST00000265922.3	-	2	606	c.145C>T	c.(145-147)Cac>Tac	p.H49Y	BRINP1_ENST00000373964.2_Missense_Mutation_p.H49Y	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	49					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											CTGGAGTGGTGGAAAGGCCCC	0.502																																																0													105.0	101.0	102.0					9																	122075489		2203	4300	6503	SO:0001583	missense	1620			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.145C>T	9.37:g.122075489G>A	ENSP00000265922:p.His49Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.553042	0.86127	.	.	ENSG00000078725	ENST00000373969;ENST00000265922;ENST00000373964	D;D	0.83506	-1.73;-1.73	5.26	5.26	0.73747	Membrane attack complex component/perforin (MACPF) domain (1);	0.000000	0.85682	D	0.000000	D	0.88085	0.6342	L	0.45137	1.4	0.80722	D	1	P;P	0.49559	0.908;0.925	P;D	0.65140	0.888;0.932	D	0.88558	0.3121	10	0.59425	D	0.04	-30.2984	18.859	0.92265	0.0:0.0:1.0:0.0	.	49;49	O60477-2;O60477	.;DBC1_HUMAN	Y	49	ENSP00000265922:H49Y;ENSP00000363075:H49Y	ENSP00000265922:H49Y	H	-	1	0	DBC1	121115310	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.473000	0.83533	0.561000	0.74099	CAC		0.502	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618		7	52	7	52
NOTCH1	4851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	139412252	139412252	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr9:139412252C>T	ENST00000277541.6	-	8	1468	c.1393G>A	c.(1393-1395)Gcc>Acc	p.A465T	MIR4673_ENST00000584777.1_RNA	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	465	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		AGGCAGGTGGCGTCGTTCTGG	0.672			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																													Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													58.0	65.0	62.0					9																	139412252		2160	4236	6396	SO:0001583	missense	4851			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1393G>A	9.37:g.139412252C>T	ENSP00000277541:p.Ala465Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	C	35	5.434800	0.96150	.	.	ENSG00000148400	ENST00000277541	D	0.91792	-2.91	4.57	4.57	0.56435	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.95582	0.8564	M	0.81179	2.53	0.80722	D	1	D	0.61697	0.99	P	0.62813	0.907	D	0.96347	0.9255	10	0.87932	D	0	.	16.3317	0.83023	0.0:1.0:0.0:0.0	.	465	P46531	NOTC1_HUMAN	T	465	ENSP00000277541:A465T	ENSP00000277541:A465T	A	-	1	0	NOTCH1	138532073	1.000000	0.71417	0.989000	0.46669	0.924000	0.55760	5.872000	0.69636	2.088000	0.63022	0.462000	0.41574	GCC		0.672	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617		6	60	6	60
ZBED1	9189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	2407265	2407265	+	Missense_Mutation	SNP	T	T	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chrX:2407265T>A	ENST00000381223.4	-	2	1699	c.1496A>T	c.(1495-1497)gAa>gTa	p.E499V	DHRSX_ENST00000334651.5_Intron|ZBED1_ENST00000381218.3_Missense_Mutation_p.E499V|ZBED1_ENST00000381222.2_Missense_Mutation_p.E499V|ZBED1_ENST00000515319.1_5'Flank	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	499					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CTTGGCCTCTTCCACCACGCG	0.637																																																0													77.0	82.0	80.0					X																	2407265		2203	4296	6499	SO:0001583	missense	9189			AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.1496A>T	X.37:g.2407265T>A	ENSP00000370621:p.Glu499Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q96BY4	Missense_Mutation	SNP	ENST00000381223.4	37	CCDS14118.1	.	.	.	.	.	.	.	.	.	.	T	7.523	0.657033	0.14580	.	.	ENSG00000214717	ENST00000381223;ENST00000381222;ENST00000381218	T;T;T	0.23147	1.92;1.92;1.92	3.06	3.06	0.35304	Ribonuclease H-like (1);	0.366169	0.21304	N	0.076749	T	0.33089	0.0851	.	.	.	0.09310	N	1	D	0.64830	0.994	P	0.53988	0.739	T	0.07829	-1.0752	9	0.36615	T	0.2	-16.315	10.7645	0.46286	0.0:0.0:0.0:1.0	.	499	O96006	ZBED1_HUMAN	V	499	ENSP00000370621:E499V;ENSP00000370620:E499V;ENSP00000370616:E499V	ENSP00000370616:E499V	E	-	2	0	ZBED1	2417265	1.000000	0.71417	0.024000	0.17045	0.119000	0.20118	3.611000	0.54132	0.943000	0.37553	0.422000	0.28245	GAA		0.637	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144310.3	NM_004729		51	54	51	54
WAS	7454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	48542340	48542340	+	Missense_Mutation	SNP	A	A	G			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chrX:48542340A>G	ENST00000376701.4	+	1	173	c.98A>G	c.(97-99)cAg>cGg	p.Q33R	WAS_ENST00000483750.1_3'UTR	NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	33					actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				CACGAGAACCAGCGACTCTTT	0.622			"""Mis, N, F, S"""			lymphoma																																	X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Wiskott-Aldrich syndrome		L	0													111.0	88.0	96.0					X																	48542340		2203	4300	6503	SO:0001583	missense	7454			AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.98A>G	X.37:g.48542340A>G	ENSP00000365891:p.Gln33Arg	Somatic		WXS	Illumina GAIIx	Phase_I	Q9BU11|Q9UNJ9	Missense_Mutation	SNP	ENST00000376701.4	37	CCDS14303.1	.	.	.	.	.	.	.	.	.	.	A	15.18	2.757079	0.49468	.	.	ENSG00000015285	ENST00000450772;ENST00000376701	D;D	0.99704	-6.22;-6.46	4.27	4.27	0.50696	Pleckstrin homology-type (1);	0.064337	0.64402	D	0.000009	D	0.97371	0.9140	N	0.08118	0	0.29754	N	0.836064	B	0.29862	0.259	B	0.24394	0.053	D	0.97672	1.0167	10	0.72032	D	0.01	-9.7816	9.0118	0.36146	1.0:0.0:0.0:0.0	.	33	P42768	WASP_HUMAN	R	33	ENSP00000410537:Q33R;ENSP00000365891:Q33R	ENSP00000365891:Q33R	Q	+	2	0	WAS	48427284	1.000000	0.71417	0.985000	0.45067	0.808000	0.45660	5.647000	0.67923	1.380000	0.46344	0.231000	0.17811	CAG		0.622	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083379.1	NM_000377		10	72	10	72
NUDT10	170685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	51075880	51075880	+	Silent	SNP	G	G	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chrX:51075880G>A	ENST00000376006.3	+	2	283	c.63G>A	c.(61-63)gcG>gcA	p.A21A	NUDT10_ENST00000356450.2_Silent_p.A21A	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	0					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					AGCGGGCGGCGTGCCTGTGCT	0.672																																					NSCLC(90;1817 2035 37909 38249)											0													43.0	34.0	37.0					X																	51075880		2203	4300	6503	SO:0001819	synonymous_variant	170685			AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.63G>A	X.37:g.51075880G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																				0.672	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183		13	10	13	10
ITIH6	347365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	54777700	54777700	+	Missense_Mutation	SNP	T	T	C			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chrX:54777700T>C	ENST00000218436.6	-	12	3495	c.3466A>G	c.(3466-3468)Act>Gct	p.T1156A		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	1156					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										ATGGTGATAGTATAGGCCCGG	0.592																																																0													79.0	66.0	71.0					X																	54777700		2203	4300	6503	SO:0001583	missense	347365			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.3466A>G	X.37:g.54777700T>C	ENSP00000218436:p.Thr1156Ala	Somatic		WXS	Illumina GAIIx	Phase_I	A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	T	0.015	-1.541531	0.00934	.	.	ENSG00000102313	ENST00000218436	T	0.02177	4.41	3.58	-0.554	0.11811	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.236559	0.22223	U	0.062938	T	0.00998	0.0033	N	0.12182	0.205	0.09310	N	1	B	0.11235	0.004	B	0.14023	0.01	T	0.48293	-0.9048	10	0.05525	T	0.97	.	3.8097	0.08792	0.235:0.4953:0.0:0.2697	.	1156	Q6UXX5	ITH5L_HUMAN	A	1156	ENSP00000218436:T1156A	ENSP00000218436:T1156A	T	-	1	0	ITIH5L	54794425	0.870000	0.30015	0.001000	0.08648	0.019000	0.09904	0.761000	0.26489	0.205000	0.20568	0.237000	0.17872	ACT		0.592	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		24	25	24	25
ZC3H12B	340554	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	64721755	64721755	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chrX:64721755C>T	ENST00000338957.4	+	5	1244	c.1177C>T	c.(1177-1179)Cgc>Tgc	p.R393C	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.R382C	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	393							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGATGAGCTCCGCATCAGTGC	0.522																																																0													33.0	34.0	33.0					X																	64721755		1961	4137	6098	SO:0001583	missense	340554			BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.1177C>T	X.37:g.64721755C>T	ENSP00000340839:p.Arg393Cys	Somatic		WXS	Illumina GAIIx	Phase_I	B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	ENST00000338957.4	37	CCDS48131.2	.	.	.	.	.	.	.	.	.	.	C	15.64	2.893429	0.52121	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.32988	1.43;1.44	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.53045	0.1772	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.56786	-0.7921	10	0.87932	D	0	-31.1364	11.5633	0.50790	0.1784:0.8216:0.0:0.0	.	382	Q5HYM0	ZC12B_HUMAN	C	393;382;329	ENSP00000340839:R393C;ENSP00000408077:R382C	ENSP00000218172:R329C	R	+	1	0	ZC3H12B	64638480	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.540000	0.53611	2.163000	0.67991	0.513000	0.50165	CGC		0.522	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378734.2	XM_293334		7	17	7	17
PCDH11X	27328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	91090710	91090710	+	Silent	SNP	C	C	T			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chrX:91090710C>T	ENST00000373094.1	+	1	1052	c.207C>T	c.(205-207)acC>acT	p.T69T	PCDH11X_ENST00000406881.1_Silent_p.T69T|PCDH11X_ENST00000504220.2_Silent_p.T69T|PCDH11X_ENST00000373088.1_Silent_p.T69T|PCDH11X_ENST00000298274.8_Silent_p.T69T|PCDH11X_ENST00000395337.2_Silent_p.T69T|PCDH11X_ENST00000373097.1_Silent_p.T69T|PCDH11X_ENST00000361724.1_Silent_p.T69T|PCDH11X_ENST00000361655.2_Silent_p.T69T	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	69	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						TGTACAAGACCGGAGATGTGC	0.458													C|||	1	0.000264901	0.0008	0.0	3775	,	,		14186	0.0		0.0	False		,,,				2504	0.0				NSCLC(38;925 1092 2571 38200 45895)											0													170.0	139.0	150.0					X																	91090710		2203	4300	6503	SO:0001819	synonymous_variant	27328			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.207C>T	X.37:g.91090710C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	ENST00000373094.1	37	CCDS14461.1																																																																																				0.458	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		28	139	28	139
RGAG1	57529	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	109696415	109696415	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chrX:109696415G>A	ENST00000465301.2	+	3	2816	c.2570G>A	c.(2569-2571)gGg>gAg	p.G857E	RGAG1_ENST00000540313.1_Missense_Mutation_p.G857E	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	857										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GCCTCTGGAGGGATGTCCATG	0.527																																																0													174.0	161.0	165.0					X																	109696415		2203	4300	6503	SO:0001583	missense	57529			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2570G>A	X.37:g.109696415G>A	ENSP00000419786:p.Gly857Glu	Somatic		WXS	Illumina GAIIx	Phase_I	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.639695	0.29157	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.48522	0.81;0.81	3.98	-1.99	0.07457	.	1.035980	0.07737	N	0.946229	T	0.43233	0.1238	L	0.44542	1.39	0.09310	N	0.999991	P	0.48016	0.904	P	0.48227	0.571	T	0.39418	-0.9615	9	.	.	.	0.749	6.6959	0.23199	0.0:0.378:0.2109:0.4111	.	857	Q8NET4	RGAG1_HUMAN	E	857	ENSP00000419786:G857E;ENSP00000441452:G857E	.	G	+	2	0	RGAG1	109583071	0.002000	0.14202	0.032000	0.17829	0.720000	0.41350	-3.069000	0.00619	-0.572000	0.06006	0.466000	0.42574	GGG		0.527	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769		103	153	103	153
GPR112	139378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	135405538	135405538	+	Silent	SNP	G	G	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chrX:135405538G>A	ENST00000394143.1	+	5	963	c.672G>A	c.(670-672)agG>agA	p.R224R	GPR112_ENST00000412101.1_Intron|GPR112_ENST00000370652.1_Silent_p.R224R|GPR112_ENST00000287534.4_Silent_p.R161R|GPR112_ENST00000394141.1_Intron	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	224					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CTGTTGACAGGACACTGCGCT	0.433																																																0													95.0	84.0	88.0					X																	135405538		2203	4300	6503	SO:0001819	synonymous_variant	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.672G>A	X.37:g.135405538G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	ENST00000394143.1	37	CCDS35409.1																																																																																				0.433	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			14	151	14	151
SLC6A3	6531	broad.mit.edu;ucsc.edu	37	5	1409936	1409936	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr5:1409936C>T	ENST00000270349.9	-	10	1425	c.1298G>A	c.(1297-1299)gGg>gAg	p.G433E	SLC6A3_ENST00000453492.2_Missense_Mutation_p.G433E	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	433					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	ATCGATGAGCCCGGTGATCAC	0.612																																																0													183.0	139.0	154.0					5																	1409936		2203	4300	6503	SO:0001583	missense	6531				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.1298G>A	5.37:g.1409936C>T	ENSP00000270349:p.Gly433Glu	Somatic		WXS	Illumina GAIIx	Phase_I	A2RUN4|Q14996	Missense_Mutation	SNP	ENST00000270349.9	37	CCDS3863.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.961967	0.74016	.	.	ENSG00000142319	ENST00000270349;ENST00000453492	T;T	0.75154	-0.91;-0.91	4.19	4.19	0.49359	.	0.000000	0.85682	D	0.000000	D	0.87912	0.6297	M	0.90082	3.085	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90589	0.4535	10	0.87932	D	0	.	14.0096	0.64488	0.0:1.0:0.0:0.0	.	433	Q01959	SC6A3_HUMAN	E	433	ENSP00000270349:G433E;ENSP00000399806:G433E	ENSP00000270349:G433E	G	-	2	0	SLC6A3	1462936	1.000000	0.71417	0.991000	0.47740	0.869000	0.49853	5.397000	0.66302	1.880000	0.54463	0.478000	0.44815	GGG		0.612	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	NM_001044		18	40	18	40
PLIN4	729359	broad.mit.edu;ucsc.edu	37	19	4511137	4511137	+	Silent	SNP	G	G	A	rs551750122		TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr19:4511137G>A	ENST00000301286.3	-	3	2792	c.2793C>T	c.(2791-2793)acC>acT	p.T931T		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	931	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						CTGTCTGGACGGTCCCTTTGG	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		22971	0.001		0.0	False		,,,				2504	0.0															0													60.0	64.0	63.0					19																	4511137		2161	4254	6415	SO:0001819	synonymous_variant	729359			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2793C>T	19.37:g.4511137G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A6NEI2	Silent	SNP	ENST00000301286.3	37	CCDS45927.1																																																																																				0.597	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901		12	52	12	52
PLEKHG4B	153478	broad.mit.edu;ucsc.edu	37	5	169649	169649	+	Missense_Mutation	SNP	G	G	A	rs139086978	byFrequency	TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr5:169649G>A	ENST00000283426.6	+	12	2653	c.2603G>A	c.(2602-2604)cGg>cAg	p.R868Q		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	868	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R868Q(1)|p.R59Q(1)		endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CACTTCCTCCGGGAGCTGGAG	0.622																																																2	Substitution - Missense(2)	skin(2)						G	GLN/ARG	0,4406		0,0,2203	73.0	76.0	75.0		2603	-7.1	0.0	5	dbSNP_134	75	5,8595	4.3+/-15.6	0,5,4295	yes	missense	PLEKHG4B	NM_052909.3	43	0,5,6498	AA,AG,GG		0.0581,0.0,0.0384	possibly-damaging	868/1272	169649	5,13001	2203	4300	6503	SO:0001583	missense	153478			BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.2603G>A	5.37:g.169649G>A	ENSP00000283426:p.Arg868Gln	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000283426.6	37	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.353502	0.24512	0.0	5.81E-4	ENSG00000153404	ENST00000283426	T	0.62498	0.02	3.55	-7.1	0.01547	Dbl homology (DH) domain (5);	.	.	.	.	T	0.32071	0.0817	N	0.14661	0.345	0.09310	N	1	B	0.21071	0.051	B	0.18561	0.022	T	0.15435	-1.0437	9	0.22706	T	0.39	.	1.5182	0.02510	0.355:0.1667:0.3442:0.1341	.	868	Q96PX9	PKH4B_HUMAN	Q	868	ENSP00000283426:R868Q	ENSP00000283426:R868Q	R	+	2	0	PLEKHG4B	222649	0.000000	0.05858	0.007000	0.13788	0.888000	0.51559	-0.052000	0.11865	-1.984000	0.00985	-0.670000	0.03821	CGG		0.622	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909		31	52	31	52
KIFC2	90990	broad.mit.edu;ucsc.edu	37	8	145694030	145694030	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr8:145694030G>A	ENST00000301332.2	+	9	1377	c.1000G>A	c.(1000-1002)Gca>Aca	p.A334T	KIFC2_ENST00000301331.5_Missense_Mutation_p.A82T|CYHR1_ENST00000424149.2_5'Flank|CYHR1_ENST00000306145.5_5'Flank	NM_145754.2	NP_665697.1	Q96AC6	KIFC2_HUMAN	kinesin family member C2	334					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(3)|prostate(3)|skin(2)|urinary_tract(1)	19	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			TGGGCAGCTGGCAGGTAAGGG	0.652																																																0													38.0	44.0	42.0					8																	145694030		2203	4300	6503	SO:0001583	missense	90990			AY007121	CCDS6427.1	8q24.3	2007-02-13			ENSG00000167702	ENSG00000167702		"""Kinesins"""	29530	protein-coding gene	gene with protein product						9115737	Standard	NM_145754		Approved		uc003zcz.3	Q96AC6	OTTHUMG00000165133	ENST00000301332.2:c.1000G>A	8.37:g.145694030G>A	ENSP00000301332:p.Ala334Thr	Somatic		WXS	Illumina GAIIx	Phase_I	E9PHB2|Q96NN6	Missense_Mutation	SNP	ENST00000301332.2	37	CCDS6427.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.8|23.8	4.455773|4.455773	0.84209|0.84209	.|.	.|.	ENSG00000167702|ENSG00000167702	ENST00000301332;ENST00000301331|ENST00000528415	T;T|.	0.80653|.	-0.69;-1.4|.	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	0.000000|.	0.34133|.	N|.	0.004226|.	T|T	0.44767|0.44767	0.1309|0.1309	N|N	0.19112|0.19112	0.55|0.55	0.37364|0.37364	D|D	0.911346|0.911346	D|.	0.53885|.	0.963|.	P|.	0.58130|.	0.833|.	T|T	0.47761|0.47761	-0.9092|-0.9092	10|5	0.35671|.	T|.	0.21|.	-1.9415|-1.9415	13.4347|13.4347	0.61077|0.61077	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	334|.	Q96AC6|.	KIFC2_HUMAN|.	T|D	334;82|154	ENSP00000301332:A334T;ENSP00000301331:A82T|.	ENSP00000301331:A82T|.	A|G	+|+	1|2	0|0	KIFC2|KIFC2	145664838|145664838	0.981000|0.981000	0.34729|0.34729	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	1.859000|1.859000	0.39418|0.39418	2.240000|2.240000	0.73641|0.73641	0.561000|0.561000	0.74099|0.74099	GCA|GGC		0.652	KIFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382052.2	NM_145754		8	29	8	29
DCAF8L1	139425	broad.mit.edu;ucsc.edu	37	X	27998600	27998600	+	Missense_Mutation	SNP	C	C	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chrX:27998600C>A	ENST00000441525.1	-	1	966	c.852G>T	c.(850-852)aaG>aaT	p.K284N		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	284										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						GTCCCCTGTGCTTGGCCACAC	0.517																																																0													87.0	75.0	79.0					X																	27998600		2202	4300	6502	SO:0001583	missense	139425				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.852G>T	X.37:g.27998600C>A	ENSP00000405222:p.Lys284Asn	Somatic		WXS	Illumina GAIIx	Phase_I	B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	CCDS35222.1	.	.	.	.	.	.	.	.	.	.	C	8.329	0.825980	0.16749	.	.	ENSG00000226372	ENST00000441525	T	0.80994	-1.44	0.842	-0.268	0.12934	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.135320	0.50627	D	0.000102	T	0.65112	0.2660	L	0.35542	1.07	0.31817	N	0.626465	B	0.13145	0.007	B	0.12156	0.007	T	0.55335	-0.8157	10	0.45353	T	0.12	-4.443	5.0986	0.14747	0.0:0.7401:0.0:0.2599	.	284	A6NGE4	DC8L1_HUMAN	N	284	ENSP00000405222:K284N	ENSP00000405222:K284N	K	-	3	2	DCAF8L1	27908521	1.000000	0.71417	0.048000	0.18961	0.050000	0.14768	0.908000	0.28545	-0.168000	0.10853	0.284000	0.19432	AAG		0.517	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690		16	63	16	63
PGAM2	5224	broad.mit.edu;ucsc.edu	37	7	44102503	44102503	+	Missense_Mutation	SNP	G	G	C			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr7:44102503G>C	ENST00000297283.3	-	3	679	c.622C>G	c.(622-624)Ctg>Gtg	p.L208V	AC017116.11_ENST00000445938.1_RNA	NM_000290.3	NP_000281.2	P15259	PGAM2_HUMAN	phosphoglycerate mutase 2 (muscle)	208					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|response to mercury ion (GO:0046689)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|striated muscle contraction (GO:0006941)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase activity (GO:0046538)|bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|cofactor binding (GO:0048037)|phosphoglycerate mutase activity (GO:0004619)			large_intestine(2)|lung(4)|ovary(1)|stomach(1)	8						GGCAGGTTCAGCTCCATGATC	0.557																																																0													145.0	117.0	127.0					7																	44102503		2203	4300	6503	SO:0001583	missense	5224				CCDS34624.1	7p13-p12	2008-11-17			ENSG00000164708	ENSG00000164708	5.4.2.1, 3.1.3.13, 5.4.2.4		8889	protein-coding gene	gene with protein product		612931					Standard	NM_000290		Approved	PGAM-M	uc003tjs.3	P15259	OTTHUMG00000155355	ENST00000297283.3:c.622C>G	7.37:g.44102503G>C	ENSP00000297283:p.Leu208Val	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000297283.3	37	CCDS34624.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.578567	0.46006	.	.	ENSG00000164708	ENST00000297283	D	0.81908	-1.55	4.82	3.94	0.45596	.	0.000000	0.64402	D	0.000001	T	0.82089	0.4961	M	0.80746	2.51	0.58432	D	0.999999	B	0.23591	0.088	B	0.21360	0.034	T	0.79647	-0.1716	10	0.46703	T	0.11	-22.6509	11.0571	0.47925	0.0922:0.0:0.9077:0.0	.	208	P15259	PGAM2_HUMAN	V	208	ENSP00000297283:L208V	ENSP00000297283:L208V	L	-	1	2	PGAM2	44069028	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.679000	0.74513	1.187000	0.43000	0.456000	0.33151	CTG		0.557	PGAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339614.1			8	46	8	46
ACTL9	284382	broad.mit.edu;ucsc.edu	37	19	8808420	8808420	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr19:8808420C>T	ENST00000324436.3	-	1	752	c.632G>A	c.(631-633)gGc>gAc	p.G211D		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	211						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						CAGGTTGTAGCCCTGGAAGAC	0.682																																																0													49.0	46.0	47.0					19																	8808420		2203	4300	6503	SO:0001583	missense	284382				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.632G>A	19.37:g.8808420C>T	ENSP00000316674:p.Gly211Asp	Somatic		WXS	Illumina GAIIx	Phase_I	A8K893|Q6X960	Missense_Mutation	SNP	ENST00000324436.3	37	CCDS12207.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471868	0.84533	.	.	ENSG00000181786	ENST00000324436	D	0.97430	-4.38	4.37	3.33	0.38152	.	0.000000	0.47093	D	0.000254	D	0.97829	0.9287	M	0.92367	3.3	0.51767	D	0.999932	P	0.36974	0.576	P	0.46452	0.517	D	0.98543	1.0633	10	0.87932	D	0	.	11.4261	0.50012	0.0:0.9098:0.0:0.0902	.	211	Q8TC94	ACTL9_HUMAN	D	211	ENSP00000316674:G211D	ENSP00000316674:G211D	G	-	2	0	ACTL9	8669420	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.435000	0.66532	1.208000	0.43306	0.462000	0.41574	GGC		0.682	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459953.1	NM_178525		27	22	27	22
GALNTL5	168391	broad.mit.edu;ucsc.edu	37	7	151711757	151711757	+	Missense_Mutation	SNP	T	T	A			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr7:151711757T>A	ENST00000392800.2	+	8	1309	c.1055T>A	c.(1054-1056)aTa>aAa	p.I352K	GALNTL5_ENST00000431418.2_Missense_Mutation_p.I352K	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	352	Catalytic subdomain B.				spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		CAACTCTTTATAATCCCCTGC	0.393																																																0													138.0	124.0	129.0					7																	151711757		2203	4300	6503	SO:0001583	missense	168391			AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.1055T>A	7.37:g.151711757T>A	ENSP00000376548:p.Ile352Lys	Somatic		WXS	Illumina GAIIx	Phase_I	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	ENST00000392800.2	37	CCDS5929.1	.	.	.	.	.	.	.	.	.	.	T	19.93	3.918101	0.73098	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.66995	-0.24;-0.24	3.73	3.73	0.42828	.	0.366998	0.20002	N	0.101317	D	0.84848	0.5563	H	0.95224	3.64	0.58432	D	0.999999	D;P	0.71674	0.998;0.952	D;P	0.71656	0.974;0.694	D	0.87298	0.2303	10	0.87932	D	0	.	9.9236	0.41478	0.0:0.0:0.0:1.0	.	103;352	A8MZD3;Q7Z4T8	.;GLTL5_HUMAN	K	352	ENSP00000392582:I352K;ENSP00000376548:I352K	ENSP00000376548:I352K	I	+	2	0	GALNTL5	151342690	1.000000	0.71417	0.384000	0.26145	0.984000	0.73092	6.519000	0.73768	1.571000	0.49722	0.402000	0.26972	ATA		0.393	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348395.1	NM_145292		47	65	47	65
DENND1A	57706	broad.mit.edu;ucsc.edu	37	9	126319963	126319963	+	Silent	SNP	C	C	T			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr9:126319963C>T	ENST00000373624.2	-	13	1080	c.879G>A	c.(877-879)ctG>ctA	p.L293L	DENND1A_ENST00000394215.2_Silent_p.L263L|DENND1A_ENST00000373620.3_Silent_p.L293L|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000373618.1_Silent_p.L261L|DENND1A_ENST00000394219.3_Silent_p.L261L|DENND1A_ENST00000542603.1_Intron	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	293					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						GCCTGTTCTTCAGGGAAGAGA	0.537																																																0													77.0	64.0	69.0					9																	126319963		2203	4300	6503	SO:0001819	synonymous_variant	57706			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.879G>A	9.37:g.126319963C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Silent	SNP	ENST00000373624.2	37	CCDS35133.1																																																																																				0.537	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820		5	26	5	26
CIC	23152	broad.mit.edu;hgsc.bcm.edu	37	19	42793381	42793381	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chr19:42793381delT	ENST00000575354.2	+	8	1223	c.1183delT	c.(1183-1185)tatfs	p.Y395fs	CIC_ENST00000160740.3_Frame_Shift_Del_p.Y395fs|CIC_ENST00000572681.2_Frame_Shift_Del_p.Y1304fs	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	395					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				TTCTACCCAGTATGGAGCTCC	0.657			"""Mis, F, S"""		oligodendroglioma																																		Rec	yes		19	19q13.2	23152	capicua homolog		O	0													61.0	66.0	64.0					19																	42793381		2203	4300	6503	SO:0001589	frameshift_variant	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.1183delT	19.37:g.42793381delT	ENSP00000458663:p.Tyr395fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q7LGI1|Q9UEG5|Q9Y6T1	Frame_Shift_Del	DEL	ENST00000575354.2	37	CCDS12601.1																																																																																				0.657	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2			37	26	37	26
TBC1D8B	54885	broad.mit.edu;hgsc.bcm.edu	37	X	106046201	106046201	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DU-6400-01A-12D-1705-08	TCGA-DU-6400-10A-01D-1705-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	44fb8d94-aa0a-4da3-bf17-322889da1fb2	e2693558-ff23-4532-9d26-b6fe815e9934	g.chrX:106046201delG	ENST00000357242.5	+	1	292	c.118delG	c.(118-120)gggfs	p.G41fs	TBC1D8B_ENST00000276175.3_Frame_Shift_Del_p.G41fs|TBC1D8B_ENST00000481617.2_Frame_Shift_Del_p.G41fs|TBC1D8B_ENST00000310452.2_Frame_Shift_Del_p.G41fs	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	41							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GGAAGGCGGAGGGGGGCTCAC	0.577																																																0													42.0	34.0	37.0					X																	106046201		2203	4300	6503	SO:0001589	frameshift_variant	54885			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.118delG	X.37:g.106046201delG	ENSP00000349781:p.Gly41fs	Somatic		WXS	Illumina GAIIx	Phase_I	B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Frame_Shift_Del	DEL	ENST00000357242.5	37	CCDS14522.1																																																																																				0.577	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057807.2	NM_017752		15	23	15	23
