#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
ROBO4	54538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	124756934	124756934	+	Missense_Mutation	SNP	C	C	T	rs371875012		TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr11:124756934C>T	ENST00000306534.3	-	15	2859	c.2374G>A	c.(2374-2376)Gtg>Atg	p.V792M	RP11-664I21.5_ENST00000524453.1_RNA|ROBO4_ENST00000533054.1_Missense_Mutation_p.V647M	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	792					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GGGGTCAGCACGCTGTCTTGA	0.592																																																0									MET/VAL	0,4402		0,0,2201	61.0	62.0	62.0		2374	4.8	1.0	11		62	1,8597	1.2+/-3.3	0,1,4298	no	missense	ROBO4	NM_019055.5	21	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	792/1008	124756934	1,12999	2201	4299	6500	SO:0001583	missense	54538			AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.2374G>A	11.37:g.124756934C>T	ENSP00000304945:p.Val792Met	Somatic		WXS	Illumina GAIIx	Phase_I	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Missense_Mutation	SNP	ENST00000306534.3	37	CCDS8455.1	.	.	.	.	.	.	.	.	.	.	c	17.31	3.358154	0.61403	0.0	1.16E-4	ENSG00000154133	ENST00000306534;ENST00000374963;ENST00000533054	T;T	0.65732	-0.17;0.14	4.81	4.81	0.61882	.	0.000000	0.31554	N	0.007455	T	0.76104	0.3941	M	0.71581	2.175	0.22858	N	0.998641	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.74674	0.967;0.984;0.965	T	0.68243	-0.5460	10	0.49607	T	0.09	.	13.1804	0.59651	0.0:0.8386:0.1613:0.0	.	792;682;792	Q8WZ75-2;Q8WZ75-3;Q8WZ75	.;.;ROBO4_HUMAN	M	792;682;647	ENSP00000304945:V792M;ENSP00000437129:V647M	ENSP00000304945:V792M	V	-	1	0	ROBO4	124262144	0.814000	0.29104	0.999000	0.59377	0.784000	0.44337	1.846000	0.39289	2.220000	0.72140	0.558000	0.71614	GTG		0.592	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055		32	38	32	38
PZP	5858	hgsc.bcm.edu;broad.mit.edu	37	12	9304243	9304243	+	Missense_Mutation	SNP	C	C	T	rs199878433		TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr12:9304243C>T	ENST00000261336.2	-	33	4266	c.4238G>A	c.(4237-4239)cGg>cAg	p.R1413Q	PZP_ENST00000381997.2_Missense_Mutation_p.R1199Q	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	1413					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						CACTTCTGTCCGGCTCACAGA	0.443													C|||	1	0.000199681	0.0	0.0	5008	,	,		-128	0.001		0.0	False		,,,				2504	0.0				Melanoma(125;1402 1695 4685 34487 38571)											0													81.0	64.0	70.0					12																	9304243		2203	4300	6503	SO:0001583	missense	5858			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.4238G>A	12.37:g.9304243C>T	ENSP00000261336:p.Arg1413Gln	Somatic		WXS	Illumina GAIIx	Phase_I	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	18.24	3.580077	0.65992	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.25912	1.77;1.77	3.47	3.47	0.39725	Alpha-macroglobulin, receptor-binding (3);	0.076525	0.43260	U	0.000591	T	0.53222	0.1783	M	0.87328	2.875	0.26396	N	0.9765	D;D	0.89917	1.0;1.0	D;D	0.78314	0.989;0.991	T	0.47983	-0.9074	10	0.56958	D	0.05	.	12.72	0.57137	0.0:1.0:0.0:0.0	.	1199;1413	P20742-2;P20742	.;PZP_HUMAN	Q	1413;1199	ENSP00000261336:R1413Q;ENSP00000371427:R1199Q	ENSP00000261336:R1413Q	R	-	2	0	PZP	9195510	0.000000	0.05858	0.282000	0.24776	0.635000	0.38103	0.504000	0.22626	2.249000	0.74217	0.462000	0.41574	CGG		0.443	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864		4	43	4	43
SACS	26278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	23907744	23907744	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr13:23907744C>T	ENST00000382292.3	-	9	10544	c.10271G>A	c.(10270-10272)gGa>gAa	p.G3424E	SACS_ENST00000382298.3_Missense_Mutation_p.G3424E|SACS_ENST00000402364.1_Missense_Mutation_p.G2674E			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3424					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TCCAAATTTTCCAATGCTTAC	0.358																																																0													107.0	107.0	107.0					13																	23907744		2203	4298	6501	SO:0001583	missense	26278			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.10271G>A	13.37:g.23907744C>T	ENSP00000371729:p.Gly3424Glu	Somatic		WXS	Illumina GAIIx	Phase_I	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	9.954	1.220885	0.22457	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.86956	-2.02;-2.19;-2.02	5.94	4.21	0.49690	.	0.237133	0.42294	D	0.000734	T	0.73536	0.3599	N	0.08118	0	0.25791	N	0.984612	B	0.18166	0.026	B	0.15870	0.014	T	0.50825	-0.8782	10	0.07644	T	0.81	.	16.9274	0.86180	0.0:0.2419:0.7581:0.0	.	3424	Q9NZJ4	SACS_HUMAN	E	3424;2674;3424	ENSP00000371729:G3424E;ENSP00000385844:G2674E;ENSP00000371735:G3424E	ENSP00000371729:G3424E	G	-	2	0	SACS	22805744	1.000000	0.71417	0.996000	0.52242	0.894000	0.52154	2.418000	0.44662	0.850000	0.35239	-0.228000	0.12330	GGA		0.358	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363		35	89	35	89
OR4N2	390429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	20296476	20296476	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr14:20296476G>A	ENST00000315947.1	+	1	869	c.869G>A	c.(868-870)cGc>cAc	p.R290H	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TATACCCTTCGCAACCAGGAA	0.403																																																0													47.0	50.0	49.0					14																	20296476		2203	4296	6499	SO:0001583	missense	390429				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.869G>A	14.37:g.20296476G>A	ENSP00000319601:p.Arg290His	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	ENST00000315947.1	37	CCDS32022.1	.	.	.	.	.	.	.	.	.	.	.	7.943	0.743201	0.15642	.	.	ENSG00000176294	ENST00000315947	T	0.41065	1.01	4.57	2.73	0.32206	.	0.000000	0.39909	N	0.001237	T	0.49372	0.1553	M	0.93462	3.42	0.19945	N	0.999941	B	0.32302	0.363	B	0.27715	0.082	T	0.53844	-0.8381	10	0.87932	D	0	-6.4057	8.7854	0.34818	0.1889:0.0:0.8111:0.0	.	290	Q8NGD1	OR4N2_HUMAN	H	290	ENSP00000319601:R290H	ENSP00000319601:R290H	R	+	2	0	OR4N2	19366316	0.173000	0.23056	0.675000	0.29917	0.112000	0.19704	2.979000	0.49313	0.651000	0.30788	0.591000	0.81541	CGC		0.403	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2			20	44	20	44
RPL10L	140801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	47120456	47120456	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr14:47120456G>A	ENST00000298283.3	-	1	572	c.484C>T	c.(484-486)Cgc>Tgc	p.R162C		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	162					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)	p.R162S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						ATCTTCTGGCGTCCAGGGAAC	0.502																																																1	Substitution - Missense(1)	lung(1)											93.0	93.0	93.0					14																	47120456		2203	4300	6503	SO:0001583	missense	140801			AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.484C>T	14.37:g.47120456G>A	ENSP00000298283:p.Arg162Cys	Somatic		WXS	Illumina GAIIx	Phase_I	Q8IUD1	Missense_Mutation	SNP	ENST00000298283.3	37	CCDS32071.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.580442	0.46006	.	.	ENSG00000165496	ENST00000298283	T	0.74106	-0.81	4.57	2.77	0.32553	Ribosomal protein L10e/L16 (2);	0.109105	0.64402	N	0.000005	T	0.80798	0.4692	H	0.95950	3.745	0.80722	D	1	B	0.09022	0.002	B	0.21360	0.034	T	0.80004	-0.1564	10	0.87932	D	0	-30.0537	9.3276	0.38001	0.1767:0.0:0.8233:0.0	.	162	Q96L21	RL10L_HUMAN	C	162	ENSP00000298283:R162C	ENSP00000298283:R162C	R	-	1	0	RPL10L	46190206	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	4.813000	0.62620	0.876000	0.35872	-0.126000	0.14955	CGC		0.502	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349819.1			49	91	49	91
NEK9	91754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	75574067	75574067	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr14:75574067C>T	ENST00000238616.5	-	11	1464	c.1306G>A	c.(1306-1308)Gat>Aat	p.D436N		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	436					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		ACAGTGAAATCATCACCACAT	0.468																																																0													231.0	164.0	187.0					14																	75574067		2203	4300	6503	SO:0001583	missense	91754			AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.1306G>A	14.37:g.75574067C>T	ENSP00000238616:p.Asp436Asn	Somatic		WXS	Illumina GAIIx	Phase_I	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Missense_Mutation	SNP	ENST00000238616.5	37	CCDS9839.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.926562	0.92319	.	.	ENSG00000119638	ENST00000238616;ENST00000540227	D	0.84800	-1.9	5.3	5.3	0.74995	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.85265	0.5657	N	0.12887	0.27	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	D	0.84042	0.0365	10	0.23302	T	0.38	.	18.9521	0.92644	0.0:1.0:0.0:0.0	.	436	Q8TD19	NEK9_HUMAN	N	436;418	ENSP00000238616:D436N	ENSP00000238616:D436N	D	-	1	0	NEK9	74643820	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.070000	0.71220	2.472000	0.83506	0.655000	0.94253	GAT		0.468	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415021.1	NM_033116		31	65	31	65
NEK9	91754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	75574125	75574125	+	Silent	SNP	C	C	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr14:75574125C>T	ENST00000238616.5	-	11	1406	c.1248G>A	c.(1246-1248)caG>caA	p.Q416Q		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	416					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		CATGCTTTGGCTGTCGATAGG	0.453																																																0													204.0	141.0	163.0					14																	75574125		2203	4300	6503	SO:0001819	synonymous_variant	91754			AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.1248G>A	14.37:g.75574125C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Silent	SNP	ENST00000238616.5	37	CCDS9839.1																																																																																				0.453	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415021.1	NM_033116		13	34	13	34
AK7	122481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	96875258	96875258	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr14:96875258C>T	ENST00000267584.4	+	4	522	c.478C>T	c.(478-480)Cgc>Tgc	p.R160C	AK7_ENST00000554313.1_3'UTR	NM_152327.3	NP_689540.2	Q96M32	KAD7_HUMAN	adenylate kinase 7	160					axoneme assembly (GO:0035082)|brain development (GO:0007420)|epithelial cilium movement (GO:0003351)|inflammatory response to antigenic stimulus (GO:0002437)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			breast(2)|cervix(2)|endometrium(3)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		GACTTGGGCGCGCTCCAAAGC	0.473																																																0													84.0	82.0	83.0					14																	96875258		2203	4300	6503	SO:0001583	missense	122481			AK057426	CCDS9945.1	14q32.31	2012-08-15			ENSG00000140057	ENSG00000140057		"""Adenylate kinases"""	20091	protein-coding gene	gene with protein product		615364					Standard	NM_152327		Approved	FLJ32864	uc001yfn.3	Q96M32	OTTHUMG00000171421	ENST00000267584.4:c.478C>T	14.37:g.96875258C>T	ENSP00000267584:p.Arg160Cys	Somatic		WXS	Illumina GAIIx	Phase_I	Q8IYP6	Missense_Mutation	SNP	ENST00000267584.4	37	CCDS9945.1	.	.	.	.	.	.	.	.	.	.	C	13.02	2.111582	0.37242	.	.	ENSG00000140057	ENST00000267584	T	0.57107	0.42	5.1	3.2	0.36748	NAD(P)-binding domain (1);	0.675264	0.14346	N	0.325382	T	0.51193	0.1660	M	0.71581	2.175	0.80722	D	1	B	0.26775	0.159	B	0.18561	0.022	T	0.51655	-0.8678	10	0.87932	D	0	-13.3972	11.6219	0.51124	0.3348:0.6652:0.0:0.0	.	160	Q96M32	KAD7_HUMAN	C	160	ENSP00000267584:R160C	ENSP00000267584:R160C	R	+	1	0	AK7	95945011	0.001000	0.12720	0.117000	0.21633	0.043000	0.13939	0.237000	0.17985	0.602000	0.29896	-0.152000	0.13540	CGC		0.473	AK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413340.1			14	32	14	32
AHNAK2	113146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	105415522	105415522	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr14:105415522G>A	ENST00000333244.5	-	7	6385	c.6266C>T	c.(6265-6267)cCc>cTc	p.P2089L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2089						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GTCCACCTGGGGGCCCTTGAG	0.617																																																0													122.0	84.0	98.0					14																	105415522		1808	2989	4797	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6266C>T	14.37:g.105415522G>A	ENSP00000353114:p.Pro2089Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	-	21.3	4.124109	0.77436	.	.	ENSG00000185567	ENST00000333244	T	0.05717	3.4	4.37	4.37	0.52481	.	.	.	.	.	T	0.35219	0.0924	M	0.93507	3.425	0.49051	D	0.999741	D	0.89917	1.0	D	0.97110	1.0	T	0.52895	-0.8514	9	0.56958	D	0.05	-21.3342	16.9566	0.86261	0.0:0.0:1.0:0.0	.	2089	Q8IVF2	AHNK2_HUMAN	L	2089	ENSP00000353114:P2089L	ENSP00000353114:P2089L	P	-	2	0	AHNAK2	104486567	1.000000	0.71417	0.024000	0.17045	0.007000	0.05969	4.784000	0.62411	1.996000	0.58369	0.485000	0.47835	CCC		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		70	176	70	176
ZNF106	64397	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	42742995	42742995	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr15:42742995G>A	ENST00000263805.4	-	2	1732	c.1406C>T	c.(1405-1407)cCa>cTa	p.P469L	ZNF106_ENST00000565380.1_Intron|ZNF106_ENST00000565611.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	469					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GATATTCTTTGGATCTTGCTT	0.398																																																0													197.0	195.0	195.0					15																	42742995		2203	4299	6502	SO:0001583	missense	64397			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.1406C>T	15.37:g.42742995G>A	ENSP00000263805:p.Pro469Leu	Somatic		WXS	Illumina GAIIx	Phase_I	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	ENST00000263805.4	37	CCDS32208.1	.	.	.	.	.	.	.	.	.	.	G	6.075	0.382224	0.11524	.	.	ENSG00000103994	ENST00000263805	T	0.53423	0.62	5.05	1.8	0.24995	.	1.132480	0.06568	N	0.748005	T	0.20251	0.0487	N	0.01352	-0.895	0.49582	D	0.999805	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.06499	-1.0823	10	0.46703	T	0.11	2.0517	5.1673	0.15092	0.273:0.1434:0.5835:0.0	.	252;469	B4DGC7;Q9H2Y7	.;ZF106_HUMAN	L	469	ENSP00000263805:P469L	ENSP00000263805:P469L	P	-	2	0	ZFP106	40530287	0.739000	0.28196	0.579000	0.28588	0.713000	0.41058	0.872000	0.28037	0.169000	0.19679	0.306000	0.20318	CCA		0.398	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473		69	171	69	171
FBN1	2200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	48902974	48902974	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr15:48902974C>T	ENST00000316623.5	-	4	752	c.297G>A	c.(295-297)atG>atA	p.M99I		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	99	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GGCAAGTGCACATATTTGGCC	0.428																																																0													74.0	70.0	71.0					15																	48902974		2197	4296	6493	SO:0001583	missense	2200			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.297G>A	15.37:g.48902974C>T	ENSP00000325527:p.Met99Ile	Somatic		WXS	Illumina GAIIx	Phase_I	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.602562	0.66445	.	.	ENSG00000166147	ENST00000316623;ENST00000544030;ENST00000537463	T;T	0.80909	-1.43;0.15	5.14	5.14	0.70334	.	0.045705	0.85682	D	0.000000	D	0.85940	0.5814	L	0.53249	1.67	0.80722	D	1	P	0.45126	0.851	P	0.58391	0.838	T	0.82348	-0.0502	10	0.24483	T	0.36	.	18.9709	0.92715	0.0:1.0:0.0:0.0	.	99	P35555	FBN1_HUMAN	I	99	ENSP00000325527:M99I;ENSP00000440294:M99I	ENSP00000325527:M99I	M	-	3	0	FBN1	46690266	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.353000	0.79414	2.573000	0.86826	0.655000	0.94253	ATG		0.428	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1			16	40	16	40
ALPK3	57538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	85383197	85383197	+	Silent	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr15:85383197G>A	ENST00000258888.5	+	5	1460	c.1293G>A	c.(1291-1293)ggG>ggA	p.G431G		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	431					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G431G(2)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GATTGAGCGGGGCTCAAGCGC	0.672																																																2	Substitution - coding silent(2)	lung(2)											21.0	23.0	23.0					15																	85383197		2202	4297	6499	SO:0001819	synonymous_variant	57538			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.1293G>A	15.37:g.85383197G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q9P2L6	Silent	SNP	ENST00000258888.5	37	CCDS10333.1																																																																																				0.672	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778		12	19	12	19
ST8SIA2	8128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	92973307	92973307	+	Missense_Mutation	SNP	T	T	G			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr15:92973307T>G	ENST00000268164.3	+	2	364	c.127T>G	c.(127-129)Tca>Gca	p.S43A	ST8SIA2_ENST00000539113.1_Intron	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	43					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			TACAATCAGATCAGCTGTGAA	0.388																																																0													146.0	137.0	140.0					15																	92973307		2198	4298	6496	SO:0001583	missense	8128			U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.127T>G	15.37:g.92973307T>G	ENSP00000268164:p.Ser43Ala	Somatic		WXS	Illumina GAIIx	Phase_I	Q4VAZ0|Q92470|Q92746	Missense_Mutation	SNP	ENST00000268164.3	37	CCDS10372.1	.	.	.	.	.	.	.	.	.	.	T	17.51	3.407999	0.62399	.	.	ENSG00000140557	ENST00000268164;ENST00000555434	T;T	0.25250	2.31;1.81	5.55	4.42	0.53409	.	0.340418	0.28865	N	0.013900	T	0.15912	0.0383	L	0.29908	0.895	0.80722	D	1	P	0.35328	0.495	B	0.33750	0.169	T	0.02683	-1.1124	10	0.07175	T	0.84	2.8301	11.2946	0.49272	0.0:0.0713:0.0:0.9287	.	43	Q92186	SIA8B_HUMAN	A	43	ENSP00000268164:S43A;ENSP00000450851:S43A	ENSP00000268164:S43A	S	+	1	0	ST8SIA2	90774311	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.306000	0.65756	0.933000	0.37291	0.533000	0.62120	TCA		0.388	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313526.1	NM_006011		23	38	23	38
KCNJ12	3768	hgsc.bcm.edu;broad.mit.edu	37	17	21319552	21319552	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr17:21319552G>A	ENST00000583088.1	+	3	1793	c.898G>A	c.(898-900)Gaa>Aaa	p.E300K	KCNJ12_ENST00000331718.5_Missense_Mutation_p.E300K	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	300					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	GGTCATCCTGGAAGGCATGGT	0.617										Prostate(3;0.18)																																						0													97.0	92.0	94.0					17																	21319552		2203	4298	6501	SO:0001583	missense	3768			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.898G>A	17.37:g.21319552G>A	ENSP00000463778:p.Glu300Lys	Somatic		WXS	Illumina GAIIx	Phase_I	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	G	32	5.169239	0.94768	.	.	ENSG00000184185	ENST00000331718	D	0.92495	-3.05	5.44	5.44	0.79542	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.97685	0.9241	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98824	1.0748	10	0.87932	D	0	.	19.2719	0.94013	0.0:0.0:1.0:0.0	.	300	Q14500	IRK12_HUMAN	K	300	ENSP00000328150:E300K	ENSP00000328150:E300K	E	+	1	0	KCNJ12	21260145	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.698000	0.98700	2.561000	0.86390	0.561000	0.74099	GAA		0.617	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012		9	100	9	100
NF1	4763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	29654857	29654857	+	Splice_Site	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr17:29654857G>A	ENST00000358273.4	+	38	5992	c.5609G>A	c.(5608-5610)cGg>cAg	p.R1870Q	NF1_ENST00000581113.2_3'UTR|NF1_ENST00000356175.3_Splice_Site_p.R1849Q	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1870					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.S1871fs*13(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CCGAGTTTACGGTAGGTTTTT	0.378			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	12	Whole gene deletion(8)|Unknown(3)|Complex - frameshift(1)	soft_tissue(8)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	GRCh37	CS000055	NF1	S							51.0	53.0	53.0					17																	29654857		2203	4300	6503	SO:0001630	splice_region_variant	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5609+1G>A	17.37:g.29654857G>A		Somatic		WXS	Illumina GAIIx	Phase_I	O00662|Q14284|Q14930|Q14931|Q9UMK3	Splice_Site	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	34	5.309335	0.95629	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.50001	0.76;0.76;0.76	5.8	5.8	0.92144	Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	T	0.75421	0.3847	M	0.89287	3.02	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.998	D;D;D	0.97110	1.0;0.964;0.965	T	0.79495	-0.1780	10	0.87932	D	0	.	19.049	0.93034	0.0:0.0:1.0:0.0	.	899;1849;1870	Q59FX3;P21359-2;P21359	.;.;NF1_HUMAN	Q	1870;1849;1515	ENSP00000351015:R1870Q;ENSP00000348498:R1849Q;ENSP00000389907:R1515Q	ENSP00000348498:R1849Q	R	+	2	0	NF1	26678983	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	9.434000	0.97515	2.733000	0.93635	0.650000	0.86243	CGG		0.378	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	Missense_Mutation	11	46	11	46
CLTC	1213	hgsc.bcm.edu;broad.mit.edu	37	17	57746287	57746287	+	Missense_Mutation	SNP	A	A	C			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr17:57746287A>C	ENST00000269122.3	+	14	2552	c.2278A>C	c.(2278-2280)Aag>Cag	p.K760Q	CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Missense_Mutation_p.K760Q	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	760	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TGAGCGAGTCAAGAATTTTCT	0.373			T	"""ALK, TFE3"""	"""ALCL, renal """																																		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	0													94.0	98.0	97.0					17																	57746287		2203	4300	6503	SO:0001583	missense	1213			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.2278A>C	17.37:g.57746287A>C	ENSP00000269122:p.Lys760Gln	Somatic		WXS	Illumina GAIIx	Phase_I	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.831771	0.91036	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.20069	2.1;2.1	5.42	5.42	0.78866	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.56949	0.2020	M	0.92219	3.285	0.80722	D	1	D;D	0.76494	0.999;0.993	D;D	0.91635	0.999;0.975	T	0.68808	-0.5311	10	0.87932	D	0	.	15.7534	0.78005	1.0:0.0:0.0:0.0	.	760;760	Q00610;Q00610-2	CLH1_HUMAN;.	Q	760	ENSP00000269122:K760Q;ENSP00000376763:K760Q	ENSP00000269122:K760Q	K	+	1	0	CLTC	55101069	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.287000	0.95975	2.184000	0.69523	0.383000	0.25322	AAG		0.373	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859		5	84	5	84
GATA6	2627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	19751547	19751547	+	Missense_Mutation	SNP	T	T	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr18:19751547T>A	ENST00000269216.3	+	2	719	c.442T>A	c.(442-444)Tac>Aac	p.Y148N	GATA6-AS1_ENST00000583490.1_lincRNA|GATA6_ENST00000581694.1_Missense_Mutation_p.Y148N	NM_005257.4	NP_005248.2	Q92908	GATA6_HUMAN	GATA binding protein 6	148					blood coagulation (GO:0007596)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cellular response to BMP stimulus (GO:0071773)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to hypoxia (GO:0071456)|Clara cell differentiation (GO:0060486)|endodermal cell fate determination (GO:0007493)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|liver development (GO:0001889)|lung saccule development (GO:0060430)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta1 production (GO:0032911)|negative regulation of transforming growth factor beta2 production (GO:0032912)|organ formation (GO:0048645)|outflow tract septum morphogenesis (GO:0003148)|pancreatic A cell differentiation (GO:0003310)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to growth factor (GO:0070848)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)|tube morphogenesis (GO:0035239)|type B pancreatic cell differentiation (GO:0003309)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	18	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			GGAGGAGATGTACCAGACCCT	0.736																																					Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)											0													13.0	17.0	16.0					18																	19751547		2171	4260	6431	SO:0001583	missense	2627			U66075	CCDS11872.1	18q11-q12	2013-01-25	2001-11-28		ENSG00000141448	ENSG00000141448		"""GATA zinc finger domain containing"""	4174	protein-coding gene	gene with protein product		601656	"""GATA-binding protein 6"""			8975704	Standard	XM_005258248		Approved		uc002ktt.2	Q92908	OTTHUMG00000131767	ENST00000269216.3:c.442T>A	18.37:g.19751547T>A	ENSP00000269216:p.Tyr148Asn	Somatic		WXS	Illumina GAIIx	Phase_I	B0YJ17|P78327	Missense_Mutation	SNP	ENST00000269216.3	37	CCDS11872.1	.	.	.	.	.	.	.	.	.	.	t	22.4	4.284862	0.80803	.	.	ENSG00000141448	ENST00000269216	D	0.99462	-5.94	2.98	2.98	0.34508	GATA-type transcription activator, N-terminal (1);	1.698460	0.03159	N	0.169032	D	0.99426	0.9797	M	0.76328	2.33	0.53688	D	0.999975	D	0.69078	0.997	P	0.62089	0.898	D	0.96848	0.9623	10	0.87932	D	0	-6.1429	10.9343	0.47237	0.0:0.0:0.0:1.0	.	148	Q92908	GATA6_HUMAN	N	148	ENSP00000269216:Y148N	ENSP00000269216:Y148N	Y	+	1	0	GATA6	18005545	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	5.767000	0.68850	1.219000	0.43474	0.370000	0.22315	TAC		0.736	GATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254696.1	NM_005257		14	26	14	26
ATCAY	85300	hgsc.bcm.edu;broad.mit.edu	37	19	3907776	3907776	+	Missense_Mutation	SNP	G	G	A	rs377183590		TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr19:3907776G>A	ENST00000450849.2	+	5	870	c.403G>A	c.(403-405)Gcg>Acg	p.A135T	ATCAY_ENST00000301260.6_Missense_Mutation_p.A135T|ATCAY_ENST00000398448.3_Missense_Mutation_p.A141T|ATCAY_ENST00000600960.1_Missense_Mutation_p.A135T	NM_033064.4	NP_149053.1	Q86WG3	ATCAY_HUMAN	ataxia, cerebellar, Cayman type	135					apoptotic process (GO:0006915)|mitochondrion distribution (GO:0048311)|negative regulation of glutamate metabolic process (GO:2000212)|neuron projection development (GO:0031175)|regulation of protein localization (GO:0032880)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|synapse (GO:0045202)	kinesin binding (GO:0019894)			breast(1)|endometrium(2)|kidney(2)|lung(2)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		CGGGGACAGCGCGGATCTATT	0.657																																																0								G	THR/ALA	0,4170		0,0,2085	47.0	55.0	53.0		403	5.3	0.9	19		53	1,8431		0,1,4215	no	missense	ATCAY	NM_033064.4	58	0,1,6300	AA,AG,GG		0.0119,0.0,0.0079	benign	135/372	3907776	1,12601	2085	4216	6301	SO:0001583	missense	85300				CCDS45923.1	19p13.3	2014-06-24	2008-07-18		ENSG00000167654	ENSG00000167654			779	protein-coding gene	gene with protein product	"""Cayman ataxia"", ""caytaxin"""	608179				8845847, 14556008	Standard	NM_033064		Approved		uc002lyy.4	Q86WG3	OTTHUMG00000181836	ENST00000450849.2:c.403G>A	19.37:g.3907776G>A	ENSP00000390941:p.Ala135Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q8NAQ2|Q8TAQ3|Q96HC6|Q96JF5	Missense_Mutation	SNP	ENST00000450849.2	37	CCDS45923.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.519310	0.64634	0.0	1.19E-4	ENSG00000167654	ENST00000450849;ENST00000301260;ENST00000357694;ENST00000398448;ENST00000539301	T;T;T	0.38722	1.14;1.14;1.12	5.27	5.27	0.74061	.	0.184831	0.45361	D	0.000362	T	0.34164	0.0888	L	0.29908	0.895	0.37078	D	0.898845	P;P	0.52061	0.95;0.918	B;B	0.40782	0.34;0.34	T	0.34079	-0.9843	10	0.37606	T	0.19	-5.314	17.9134	0.88942	0.0:0.0:1.0:0.0	.	141;135	B4DS11;Q86WG3	.;ATCAY_HUMAN	T	135;135;135;141;113	ENSP00000390941:A135T;ENSP00000301260:A135T;ENSP00000381466:A141T	ENSP00000301260:A135T	A	+	1	0	ATCAY	3858776	1.000000	0.71417	0.898000	0.35279	0.528000	0.34623	5.673000	0.68109	2.478000	0.83669	0.638000	0.83543	GCG		0.657	ATCAY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457872.2			6	59	6	59
PRR12	57479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	50098329	50098329	+	Missense_Mutation	SNP	A	A	G			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr19:50098329A>G	ENST00000418929.2	+	4	749	c.737A>G	c.(736-738)aAc>aGc	p.N246S		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0	Pro-rich.						DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		ACTCAGTTCAACCTGCTGGCT	0.697																																																0													10.0	12.0	11.0					19																	50098329		1897	3998	5895	SO:0001583	missense	57479			AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.737A>G	19.37:g.50098329A>G	ENSP00000394510:p.Asn246Ser	Somatic		WXS	Illumina GAIIx	Phase_I	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	37	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	A	12.31	1.899164	0.33535	.	.	ENSG00000126464	ENST00000418929	.	.	.	3.63	3.63	0.41609	.	.	.	.	.	T	0.54967	0.1891	.	.	.	0.36843	D	0.88747	D	0.67145	0.996	D	0.77557	0.99	T	0.54761	-0.8245	7	0.05525	T	0.97	.	11.6579	0.51328	1.0:0.0:0.0:0.0	.	246	Q9ULL5-3	.	S	246	.	ENSP00000394510:N246S	N	+	2	0	PRR12	54790141	0.901000	0.30685	0.997000	0.53966	0.939000	0.58152	1.963000	0.40452	1.671000	0.50874	0.460000	0.39030	AAC		0.697	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719		5	17	5	17
EPHA8	2046	hgsc.bcm.edu;ucsc.edu	37	1	22915717	22915717	+	Intron	SNP	G	G	A	rs199679973		TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr1:22915717G>A	ENST00000166244.3	+	5	1387				EPHA8_ENST00000538803.1_Missense_Mutation_p.V445I|EPHA8_ENST00000374644.4_Missense_Mutation_p.V445I	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.V445I(1)		breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GAGAAACTCCGTCCCGCAGCG	0.667																																																1	Substitution - Missense(1)	large_intestine(1)											35.0	35.0	35.0					1																	22915717		2203	4300	6503	SO:0001627	intron_variant	2046			BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.1315+18G>A	1.37:g.22915717G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	37	CCDS225.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.450212	0.26074	.	.	ENSG00000070886	ENST00000374644;ENST00000538803	T;T	0.01304	5.03;5.03	4.52	0.0827	0.14430	.	.	.	.	.	T	0.00845	0.0028	.	.	.	0.09310	N	1	B	0.26935	0.164	B	0.14023	0.01	T	0.48479	-0.9032	7	.	.	.	.	2.9702	0.05920	0.1737:0.1401:0.5431:0.1431	.	445	P29322-2	.	I	445	ENSP00000363775:V445I;ENSP00000440274:V445I	.	V	+	1	0	EPHA8	22788304	0.000000	0.05858	0.006000	0.13384	0.026000	0.11368	0.211000	0.17474	0.225000	0.20959	0.436000	0.28706	GTC		0.667	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526		15	31	15	31
SRRM1	10250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	24977940	24977940	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr1:24977940C>T	ENST00000323848.9	+	6	877	c.562C>T	c.(562-564)Cct>Tct	p.P188S	SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000537199.1_Intron|SRRM1_ENST00000374389.4_Missense_Mutation_p.P188S|SRRM1_ENST00000447431.2_Missense_Mutation_p.P188S	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	188	Arg-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		ACGATCTTCCCCTGTCAGGAG	0.463																																					Ovarian(68;897 1494 3282 17478)											0													51.0	54.0	53.0					1																	24977940		2203	4300	6503	SO:0001583	missense	10250			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.562C>T	1.37:g.24977940C>T	ENSP00000326261:p.Pro188Ser	Somatic		WXS	Illumina GAIIx	Phase_I	O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	37	CCDS255.1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764373	0.69878	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	T;T;T	0.44881	0.93;0.92;0.91	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000011	T	0.61590	0.2359	L	0.55481	1.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.992	T	0.51980	-0.8636	10	0.27082	T	0.32	-3.4593	20.0684	0.97708	0.0:1.0:0.0:0.0	.	188;188	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	S	188	ENSP00000326261:P188S;ENSP00000391430:P188S;ENSP00000363510:P188S	ENSP00000326261:P188S	P	+	1	0	SRRM1	24850527	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.969000	0.76092	2.734000	0.93682	0.650000	0.86243	CCT		0.463	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839		16	20	16	20
MAST2	23139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	46499563	46499563	+	Missense_Mutation	SNP	G	G	C			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr1:46499563G>C	ENST00000361297.2	+	27	3910	c.3627G>C	c.(3625-3627)aaG>aaC	p.K1209N	MAST2_ENST00000372009.2_Missense_Mutation_p.K1116N	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					ACAAGGCCAAGATGGCCCGAA	0.572																																																0													38.0	43.0	42.0					1																	46499563		2072	4217	6289	SO:0001583	missense	23139			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.3627G>C	1.37:g.46499563G>C	ENSP00000354671:p.Lys1209Asn	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000361297.2	37	CCDS41326.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.996050	0.74703	.	.	ENSG00000086015	ENST00000361297;ENST00000372009	T;T	0.70869	-0.52;-0.43	4.08	4.08	0.47627	.	0.107189	0.64402	D	0.000010	D	0.82412	0.5031	M	0.85299	2.745	0.54753	D	0.999989	D;P	0.76494	0.999;0.955	D;P	0.64144	0.922;0.821	D	0.84864	0.0821	10	0.87932	D	0	-13.7138	10.5155	0.44887	0.0902:0.0:0.9098:0.0	.	1116;1209	E7ERL6;Q6P0Q8	.;MAST2_HUMAN	N	1209;1116	ENSP00000354671:K1209N;ENSP00000361079:K1116N	ENSP00000354671:K1209N	K	+	3	2	MAST2	46272150	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.537000	0.45702	2.261000	0.74972	0.557000	0.71058	AAG		0.572	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112		14	23	14	23
NDC1	55706	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	54266521	54266521	+	Splice_Site	SNP	C	C	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr1:54266521C>A	ENST00000371429.3	-	11	1665	c.1067G>T	c.(1066-1068)gGt>gTt	p.G356V	NDC1_ENST00000537333.1_Splice_Site_p.G21V|NDC1_ENST00000540001.1_Splice_Site_p.G356V|NDC1_ENST00000234725.8_Splice_Site_p.G241V	NM_001168551.1|NM_018087.4	NP_001162023.1|NP_060557.3	Q9BTX1	NDC1_HUMAN	NDC1 transmembrane nucleoporin	356					mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore distribution (GO:0031081)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)										GGGATGTCCACCTAGGAGGTC	0.403																																																0													77.0	75.0	75.0					1																	54266521		2203	4300	6503	SO:0001630	splice_region_variant	55706			AL354613	CCDS583.1	1p32.3	2014-01-28	2013-05-23	2013-05-23	ENSG00000058804	ENSG00000058804			25525	protein-coding gene	gene with protein product	"""nuclear division cycle 1 homolog (S. cerevisiae)"""	610115	"""transmembrane protein 48"""	TMEM48		16779818, 12958361	Standard	NR_033142		Approved	FLJ10407, NET3		Q9BTX1	OTTHUMG00000008073	ENST00000371429.3:c.1067-1G>T	1.37:g.54266521C>A		Somatic		WXS	Illumina GAIIx	Phase_I	B4DHA3|B4DQQ5|G3XA81|Q8NB76|Q9H9T6|Q9NSG3|Q9NSG4|Q9NVZ7	Splice_Site	SNP	ENST00000371429.3	37	CCDS583.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.081030	0.76528	.	.	ENSG00000058804	ENST00000371429;ENST00000360494;ENST00000540001;ENST00000537333;ENST00000234725	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.69797	0.3151	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.72915	-0.4147	10	0.66056	D	0.02	.	18.1348	0.89616	0.0:1.0:0.0:0.0	.	316;356	B4DHA3;Q9BTX1	.;NDC1_HUMAN	V	356;356;356;21;241	ENSP00000360483:G356V;ENSP00000440873:G356V;ENSP00000439947:G21V;ENSP00000234725:G241V	ENSP00000234725:G241V	G	-	2	0	TMEM48	54039109	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.968000	0.70413	2.629000	0.89072	0.558000	0.71614	GGT		0.403	NDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022101.1	NM_018087	Missense_Mutation	23	42	23	42
CACNA1E	777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	181708361	181708361	+	Missense_Mutation	SNP	G	G	A	rs376915340	byFrequency	TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr1:181708361G>A	ENST00000367573.2	+	25	3691	c.3691G>A	c.(3691-3693)Gtt>Att	p.V1231I	CACNA1E_ENST00000357570.5_Missense_Mutation_p.V1182I|CACNA1E_ENST00000358338.5_Missense_Mutation_p.V1163I|CACNA1E_ENST00000360108.3_Missense_Mutation_p.V1212I|CACNA1E_ENST00000367570.1_Missense_Mutation_p.V1231I|CACNA1E_ENST00000526775.1_Missense_Mutation_p.V1212I|CACNA1E_ENST00000367567.4_Missense_Mutation_p.V838I	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1231	Poly-Val.				calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TGTGGTGGTCGTTGGCGCATT	0.502													G|||	2	0.000399361	0.0015	0.0	5008	,	,		22609	0.0		0.0	False		,,,				2504	0.0															0								G	ILE/VAL,ILE/VAL,ILE/VAL	1,4247		0,1,2123	341.0	355.0	350.0		3691,3691,3634	5.0	1.0	1		350	3,8473		0,3,4235	no	missense,missense,missense	CACNA1E	NM_000721.3,NM_001205293.1,NM_001205294.1	29,29,29	0,4,6358	AA,AG,GG		0.0354,0.0235,0.0314	possibly-damaging,possibly-damaging,possibly-damaging	1231/2271,1231/2314,1212/2252	181708361	4,12720	2124	4238	6362	SO:0001583	missense	777			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.3691G>A	1.37:g.181708361G>A	ENSP00000356545:p.Val1231Ile	Somatic		WXS	Illumina GAIIx	Phase_I	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.424398	0.62733	2.35E-4	3.54E-4	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98264	-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83	5.01	5.01	0.66863	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.95258	0.8462	N	0.02842	-0.48	0.58432	D	0.999999	D;D;D	0.67145	0.97;0.995;0.996	P;P;P	0.56788	0.757;0.806;0.772	D	0.92965	0.6392	10	0.06365	T	0.9	.	18.2808	0.90097	0.0:0.0:1.0:0.0	.	1212;1231;1231	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	I	1231;1212;1182;1163;838;1212;1231	ENSP00000356542:V1231I;ENSP00000434814:V1212I;ENSP00000350183:V1182I;ENSP00000351101:V1163I;ENSP00000356539:V838I;ENSP00000353222:V1212I;ENSP00000356545:V1231I	ENSP00000350183:V1182I	V	+	1	0	CACNA1E	179974984	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	6.663000	0.74431	2.475000	0.83589	0.561000	0.74099	GTT		0.502	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		65	104	65	104
KCNT2	343450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	196197431	196197431	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr1:196197431G>A	ENST00000294725.9	-	28	4246	c.3331C>T	c.(3331-3333)Cca>Tca	p.P1111S	KCNT2_ENST00000367433.5_Missense_Mutation_p.P1087S|KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000367431.4_Missense_Mutation_p.P1045S|KCNT2_ENST00000609185.1_Missense_Mutation_p.P1044S|KCNT2_ENST00000498426.1_5'UTR			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	1111					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TCACTGTTTGGAAGGTAGGCC	0.353																																																0													71.0	69.0	70.0					1																	196197431		2203	4300	6503	SO:0001583	missense	343450			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.3331C>T	1.37:g.196197431G>A	ENSP00000294725:p.Pro1111Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.947138	0.53186	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.19105	2.17;2.18;2.43	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000009	T	0.18509	0.0444	N	0.22421	0.69	0.80722	D	1	B;B;B	0.15473	0.007;0.013;0.007	B;B;B	0.15484	0.013;0.013;0.009	T	0.02901	-1.1096	10	0.41790	T	0.15	-16.0671	19.4708	0.94962	0.0:0.0:1.0:0.0	.	1087;1044;1111	Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;KCNT2_HUMAN	S	1087;1045;1111	ENSP00000356403:P1087S;ENSP00000356401:P1045S;ENSP00000294725:P1111S	ENSP00000294725:P1111S	P	-	1	0	KCNT2	194464054	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.551000	0.73909	2.699000	0.92147	0.650000	0.86243	CCA		0.353	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503		13	41	13	41
C20orf194	25943	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	3236735	3236735	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr20:3236735G>A	ENST00000252032.9	-	34	3245	c.3178C>T	c.(3178-3180)Cag>Tag	p.Q1060*	C20orf194_ENST00000453730.2_3'UTR	NM_001009984.2	NP_001009984.1	Q5TEA3	CT194_HUMAN	chromosome 20 open reading frame 194	1060										NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	39						CACTCCTGCTGCCCGCTGCTG	0.557																																																0													106.0	111.0	109.0					20																	3236735		2112	4235	6347	SO:0001587	stop_gained	0			AL110249	CCDS42851.1	20p13	2012-10-30			ENSG00000088854	ENSG00000088854			17721	protein-coding gene	gene with protein product		614146					Standard	NM_001009984		Approved	DKFZp434N061	uc002wii.3	Q5TEA3	OTTHUMG00000031742	ENST00000252032.9:c.3178C>T	20.37:g.3236735G>A	ENSP00000252032:p.Gln1060*	Somatic		WXS	Illumina GAIIx	Phase_I	Q66K86|Q6P2R9|Q9UFX9	Nonsense_Mutation	SNP	ENST00000252032.9	37	CCDS42851.1	.	.	.	.	.	.	.	.	.	.	G	41	8.573685	0.98868	.	.	ENSG00000088854	ENST00000252032	.	.	.	5.62	5.62	0.85841	.	0.227346	0.38272	N	0.001753	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	19.6747	0.95926	0.0:0.0:1.0:0.0	.	.	.	.	X	1060	.	ENSP00000252032:Q1060X	Q	-	1	0	C20orf194	3184735	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	6.255000	0.72466	2.654000	0.90174	0.643000	0.83706	CAG		0.557	C20orf194-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077734.1	NM_001009984		9	77	9	77
SCP2D1	140856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	18794627	18794627	+	Silent	SNP	G	G	A	rs143971555		TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr20:18794627G>A	ENST00000377428.2	+	1	258	c.168G>A	c.(166-168)agG>agA	p.R56R	C20orf78_ENST00000463425.1_5'Flank|C20orf78_ENST00000278779.4_Intron	NM_178483.2	NP_848578.1	Q9UJQ7	SCP2D_HUMAN	SCP2 sterol-binding domain containing 1	56	SCP2.							p.R56R(1)									TTCACATCAGGGAAGTGGGAG	0.478																																																1	Substitution - coding silent(1)	skin(1)											117.0	104.0	108.0					20																	18794627		2203	4300	6503	SO:0001819	synonymous_variant	140856			AL035563	CCDS13139.1	20p11.23	2012-10-29	2012-10-29	2012-10-29	ENSG00000132631	ENSG00000132631			16211	protein-coding gene	gene with protein product	"""sterol carrier protein 2-like protein"""		"""chromosome 20 open reading frame 79"""	C20orf79		16501878	Standard	NM_178483		Approved	dJ1068E13.2, HSD22	uc002wrk.3	Q9UJQ7	OTTHUMG00000031983	ENST00000377428.2:c.168G>A	20.37:g.18794627G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q548A4	Silent	SNP	ENST00000377428.2	37	CCDS13139.1																																																																																				0.478	SCP2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078193.1	NM_178483		22	50	22	50
MCM3AP	8888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	21	47700424	47700424	+	Silent	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr21:47700424G>A	ENST00000397708.1	-	4	1763	c.1509C>T	c.(1507-1509)caC>caT	p.H503H	MCM3AP_ENST00000291688.1_Silent_p.H503H			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	503	DNA primase.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					TTTTCTTCCTGTGCCAAAAGA	0.363																																																0													70.0	75.0	73.0					21																	47700424		2203	4300	6503	SO:0001819	synonymous_variant	8888			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.1509C>T	21.37:g.47700424G>A		Somatic		WXS	Illumina GAIIx	Phase_I	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Silent	SNP	ENST00000397708.1	37	CCDS13734.1																																																																																				0.363	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906		32	51	32	51
TMPRSS6	164656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	22	37462868	37462868	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr22:37462868G>A	ENST00000346753.3	-	17	2391	c.2275C>T	c.(2275-2277)Cag>Tag	p.Q759*	TMPRSS6_ENST00000381792.2_Nonsense_Mutation_p.Q772*|TMPRSS6_ENST00000406856.1_Nonsense_Mutation_p.Q772*|TMPRSS6_ENST00000406725.1_Nonsense_Mutation_p.Q750*	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	759	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						GGACTCACCTGACAGGCATCC	0.617																																																0													107.0	83.0	91.0					22																	37462868		2203	4300	6503	SO:0001587	stop_gained	164656			AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.2275C>T	22.37:g.37462868G>A	ENSP00000334962:p.Gln759*	Somatic		WXS	Illumina GAIIx	Phase_I	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Nonsense_Mutation	SNP	ENST00000346753.3	37	CCDS13941.1	.	.	.	.	.	.	.	.	.	.	G	40	7.916982	0.98560	.	.	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856	.	.	.	4.72	4.72	0.59763	.	0.362205	0.26075	N	0.026499	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.6779	0.88235	0.0:0.0:1.0:0.0	.	.	.	.	X	772;759;750;772	.	ENSP00000334962:Q759X	Q	-	1	0	TMPRSS6	35792814	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.561000	0.98142	2.151000	0.67156	0.591000	0.81541	CAG		0.617	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609		16	46	16	46
SBF1	6305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	22	50900448	50900448	+	Missense_Mutation	SNP	A	A	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr22:50900448A>T	ENST00000390679.3	-	20	2681	c.2497T>A	c.(2497-2499)Ttt>Att	p.F833I	SBF1_ENST00000348911.6_Missense_Mutation_p.F834I|SBF1_ENST00000380817.3_Missense_Mutation_p.F833I			O95248	MTMR5_HUMAN	SET binding factor 1	833					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		TTGTCCACAAAGCGGTTGATG	0.622																																																0													107.0	123.0	117.0					22																	50900448		2138	4231	6369	SO:0001583	missense	6305			U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.2497T>A	22.37:g.50900448A>T	ENSP00000375097:p.Phe833Ile	Somatic		WXS	Illumina GAIIx	Phase_I	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	37		.	.	.	.	.	.	.	.	.	.	A	21.5	4.158159	0.78114	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000356279;ENST00000337034;ENST00000390679	D;D;D	0.90676	-2.68;-2.71;-2.71	4.26	4.26	0.50523	.	0.000000	0.85682	D	0.000000	D	0.94496	0.8228	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.996	D;D;D	0.83275	0.993;0.996;0.99	D	0.95016	0.8156	10	0.87932	D	0	.	13.204	0.59785	1.0:0.0:0.0:0.0	.	833;834;833	O95248;G5E933;O95248-4	MTMR5_HUMAN;.;.	I	833;834;844;843;833	ENSP00000370196:F833I;ENSP00000252027:F834I;ENSP00000375097:F833I	ENSP00000336522:F843I	F	-	1	0	SBF1	49247314	1.000000	0.71417	1.000000	0.80357	0.439000	0.31926	7.045000	0.76585	1.798000	0.52647	0.533000	0.62120	TTT		0.622	SBF1-201	KNOWN	basic	protein_coding	protein_coding				43	90	43	90
HEATR5B	54497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	37217840	37217840	+	Missense_Mutation	SNP	T	T	C			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr2:37217840T>C	ENST00000233099.5	-	34	5743	c.5648A>G	c.(5647-5649)aAt>aGt	p.N1883S	HEATR5B_ENST00000354531.2_Missense_Mutation_p.N1794S	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1883						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				CATGCAGCCATTCTGTAATGA	0.388																																																0													131.0	119.0	123.0					2																	37217840		2203	4300	6503	SO:0001583	missense	54497			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.5648A>G	2.37:g.37217840T>C	ENSP00000233099:p.Asn1883Ser	Somatic		WXS	Illumina GAIIx	Phase_I	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	37	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	T	10.38	1.332923	0.24167	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	T;T	0.63913	-0.07;-0.07	5.52	1.73	0.24493	Armadillo-like helical (1);Armadillo-type fold (1);	0.142736	0.64402	N	0.000006	T	0.46268	0.1384	L	0.46157	1.445	0.21105	N	0.999785	B;B	0.16166	0.007;0.016	B;B	0.19666	0.012;0.026	T	0.29701	-1.0003	10	0.08837	T	0.75	-10.6879	6.5385	0.22367	0.0:0.1381:0.1311:0.7308	.	1883;1883	Q9P2D3;B9EK47	HTR5B_HUMAN;.	S	1883;1794	ENSP00000233099:N1883S;ENSP00000346531:N1794S	ENSP00000233099:N1883S	N	-	2	0	HEATR5B	37071344	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	2.749000	0.47492	0.058000	0.16222	0.533000	0.62120	AAT		0.388	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024		12	67	12	67
NEK10	152110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	27352499	27352499	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr3:27352499G>A	ENST00000429845.2	-	10	939	c.577C>T	c.(577-579)Caa>Taa	p.Q193*	NEK10_ENST00000341435.5_Nonsense_Mutation_p.Q193*			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	193					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GCAAGTTTTTGAAAAATATCT	0.468																																																0													100.0	94.0	96.0					3																	27352499		1568	3582	5150	SO:0001587	stop_gained	152110			AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.577C>T	3.37:g.27352499G>A	ENSP00000395849:p.Gln193*	Somatic		WXS	Illumina GAIIx	Phase_I	A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Nonsense_Mutation	SNP	ENST00000429845.2	37		.	.	.	.	.	.	.	.	.	.	G	39	7.324396	0.98214	.	.	ENSG00000163491	ENST00000341435;ENST00000396636	.	.	.	5.45	5.45	0.79879	.	0.143381	0.47852	D	0.000214	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	18.6433	0.91402	0.0:0.0:1.0:0.0	.	.	.	.	X	193	.	ENSP00000343847:Q193X	Q	-	1	0	NEK10	27327503	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	7.911000	0.87458	2.725000	0.93324	0.655000	0.94253	CAA		0.468	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000438156.1	NM_152534		20	62	20	62
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	178936095	178936095	+	Missense_Mutation	SNP	A	A	C	rs397517201		TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr3:178936095A>C	ENST00000263967.3	+	10	1794	c.1637A>C	c.(1636-1638)cAg>cCg	p.Q546P		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	546	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		Q -> E (in BC; unknown pathological significance). {ECO:0000269|PubMed:15520168}.|Q -> K (in OC; unknown pathological significance). {ECO:0000269|PubMed:15520168}.|Q -> P (found in an anaplastic astrocytoma sample; unknown pathological significance). {ECO:0000269|PubMed:15289301}.|Q -> R (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.Q546R(30)|p.Q546P(18)|p.Q546L(5)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	ATCACTGAGCAGGAGAAAGAT	0.363		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	53	Substitution - Missense(53)	endometrium(18)|breast(17)|large_intestine(10)|central_nervous_system(3)|prostate(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)											61.0	61.0	61.0					3																	178936095		1813	4072	5885	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1637A>C	3.37:g.178936095A>C	ENSP00000263967:p.Gln546Pro	Somatic		WXS	Illumina GAIIx	Phase_I	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.039935	0.75732	.	.	ENSG00000121879	ENST00000263967	T	0.64260	-0.09	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76673	0.4020	M	0.64404	1.975	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.78687	-0.2107	10	0.66056	D	0.02	-14.2064	16.1026	0.81194	1.0:0.0:0.0:0.0	.	546	P42336	PK3CA_HUMAN	P	546	ENSP00000263967:Q546P	ENSP00000263967:Q546P	Q	+	2	0	PIK3CA	180418789	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	8.962000	0.93254	2.198000	0.70561	0.383000	0.25322	CAG		0.363	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			12	29	12	29
EIF4G1	1981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	184043126	184043126	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr3:184043126C>T	ENST00000346169.2	+	19	3197	c.2926C>T	c.(2926-2928)Cgc>Tgc	p.R976C	EIF4G1_ENST00000427845.1_Missense_Mutation_p.R890C|EIF4G1_ENST00000319274.6_Missense_Mutation_p.R976C|EIF4G1_ENST00000434061.2_Missense_Mutation_p.R781C|EIF4G1_ENST00000352767.3_Missense_Mutation_p.R983C|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000435046.2_Missense_Mutation_p.R780C|EIF4G1_ENST00000424196.1_Missense_Mutation_p.R983C|EIF4G1_ENST00000342981.4_Missense_Mutation_p.R977C|EIF4G1_ENST00000350481.5_Missense_Mutation_p.R812C|EIF4G1_ENST00000382330.3_Missense_Mutation_p.R983C|EIF4G1_ENST00000411531.1_Missense_Mutation_p.R937C|EIF4G1_ENST00000441154.1_Missense_Mutation_p.R813C|EIF4G1_ENST00000392537.2_Missense_Mutation_p.R889C|SNORD66_ENST00000390856.1_RNA|EIF4G1_ENST00000414031.1_Missense_Mutation_p.R936C	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	976	eIF3/EIF4A-binding.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ATCCCGCATCCGCTTTATGCT	0.527																																																0													114.0	111.0	112.0					3																	184043126		2203	4300	6503	SO:0001583	missense	1981			D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.2926C>T	3.37:g.184043126C>T	ENSP00000316879:p.Arg976Cys	Somatic		WXS	Illumina GAIIx	Phase_I	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	ENST00000346169.2	37	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.428331	0.83667	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000382330;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000441154;ENST00000434061;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52	5.53	5.53	0.82687	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.062166	0.64402	D	0.000001	T	0.58906	0.2155	M	0.83692	2.655	0.80722	D	1	D;P;D;D	0.89917	1.0;0.948;0.988;0.974	D;P;P;P	0.91635	0.999;0.671;0.811;0.756	T	0.63875	-0.6538	10	0.87932	D	0	-8.8405	14.3107	0.66415	0.1484:0.8516:0.0:0.0	.	983;977;976;983	E9PFM1;D3DNT2;Q04637;B2RU10	.;.;IF4G1_HUMAN;.	C	976;936;889;983;812;983;890;977;976;983;937;813;781;780	ENSP00000316879:R976C;ENSP00000391935:R936C;ENSP00000376320:R889C;ENSP00000371767:R983C;ENSP00000317600:R812C;ENSP00000338020:R983C;ENSP00000407682:R890C;ENSP00000343450:R977C;ENSP00000323737:R976C;ENSP00000416255:R983C;ENSP00000395974:R937C;ENSP00000399858:R813C;ENSP00000411826:R781C;ENSP00000404754:R780C	ENSP00000323737:R976C	R	+	1	0	EIF4G1	185525820	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.764000	0.62264	2.613000	0.88420	0.555000	0.69702	CGC		0.527	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917		40	76	40	76
MAEA	10296	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	1316242	1316242	+	Missense_Mutation	SNP	C	C	G			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr4:1316242C>G	ENST00000303400.4	+	4	593	c.530C>G	c.(529-531)aCc>aGc	p.T177S	MAEA_ENST00000452175.2_Missense_Mutation_p.T98S|MAEA_ENST00000264750.6_Intron|MAEA_ENST00000510794.1_Missense_Mutation_p.T176S|MAEA_ENST00000514708.1_Intron|MAEA_ENST00000505839.1_Missense_Mutation_p.T129S|MAEA_ENST00000505177.2_Missense_Mutation_p.T177S	NM_001017405.1	NP_001017405.1	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher	177	CTLH. {ECO:0000255|PROSITE- ProRule:PRU00058}.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cytoskeleton organization (GO:0007010)|enucleate erythrocyte development (GO:0048822)|erythrocyte maturation (GO:0043249)|negative regulation of myeloid cell apoptotic process (GO:0033033)|regulation of mitotic cell cycle (GO:0007346)	actomyosin contractile ring (GO:0005826)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(23;0.0201)		WF10(DB05389)	GAGACGGCCACCTGCCTGGCC	0.617																																																0													77.0	77.0	77.0					4																	1316242		2203	4300	6503	SO:0001583	missense	10296			AF084928	CCDS33936.1, CCDS33937.1, CCDS75090.1	4p16.3	2012-07-20			ENSG00000090316	ENSG00000090316			13731	protein-coding gene	gene with protein product	"""GID complex subunit 9, FYV10 homolog (S. cerevisiae)"""	606801				9763581	Standard	XM_005272243		Approved	EMP, GID9	uc003gda.3	Q7L5Y9	OTTHUMG00000160169	ENST00000303400.4:c.530C>G	4.37:g.1316242C>G	ENSP00000302830:p.Thr177Ser	Somatic		WXS	Illumina GAIIx	Phase_I	O95285|Q5JB54|Q6ZRD6|Q9BQ11|Q9H9V6|Q9H9Z4|Q9NW84	Missense_Mutation	SNP	ENST00000303400.4	37	CCDS33936.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658094	0.67586	.	.	ENSG00000090316	ENST00000303400;ENST00000505177;ENST00000503653;ENST00000539495;ENST00000502558;ENST00000452175;ENST00000510794;ENST00000505839	T;T;T;T;T;T	0.43688	0.99;0.99;0.94;0.99;1.01;0.99	5.94	5.94	0.96194	CTLH, C-terminal LisH motif (2);	0.000000	0.85682	D	0.000000	T	0.40815	0.1132	N	0.16790	0.44	0.80722	D	1	P;P;B	0.49307	0.922;0.785;0.166	P;P;B	0.48873	0.525;0.593;0.105	T	0.23655	-1.0182	10	0.48119	T	0.1	-12.4696	20.3544	0.98835	0.0:1.0:0.0:0.0	.	176;177;177	B4DVN3;E7ESC7;Q7L5Y9	.;.;MAEA_HUMAN	S	177;177;177;156;109;98;176;129	ENSP00000302830:T177S;ENSP00000422215:T177S;ENSP00000421644:T177S;ENSP00000426903:T109S;ENSP00000411415:T98S;ENSP00000426807:T176S	ENSP00000302830:T177S	T	+	2	0	MAEA	1306242	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.674000	0.68117	2.817000	0.96982	0.655000	0.94253	ACC		0.617	MAEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359511.1	NM_005882		17	80	17	80
KDR	3791	hgsc.bcm.edu;broad.mit.edu	37	4	55976872	55976872	+	Missense_Mutation	SNP	C	C	T	rs551579207		TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr4:55976872C>T	ENST00000263923.4	-	8	1335	c.1040G>A	c.(1039-1041)cGt>cAt	p.R347H		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	347	Ig-like C2-type 4.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.R347H(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GATTCTGACACGCTCCCCCAC	0.418			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)			C|||	1	0.000199681	0.0	0.0	5008	,	,		15405	0.001		0.0	False		,,,				2504	0.0						Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											76.0	84.0	81.0					4																	55976872		2203	4300	6503	SO:0001583	missense	3791			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.1040G>A	4.37:g.55976872C>T	ENSP00000263923:p.Arg347His	Somatic		WXS	Illumina GAIIx	Phase_I	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885575	0.33255	.	.	ENSG00000128052	ENST00000263923	T	0.67865	-0.29	5.65	2.02	0.26589	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.765736	0.13043	N	0.418394	T	0.53498	0.1800	L	0.49126	1.545	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.06405	0.002;0.002	T	0.47114	-0.9142	10	0.44086	T	0.13	.	1.7969	0.03063	0.1238:0.4397:0.1346:0.3019	.	347;347	P35968-2;P35968	.;VGFR2_HUMAN	H	347	ENSP00000263923:R347H	ENSP00000263923:R347H	R	-	2	0	KDR	55671629	0.000000	0.05858	0.000000	0.03702	0.956000	0.61745	-0.620000	0.05565	0.064000	0.16427	0.563000	0.77884	CGT		0.418	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1			9	120	9	120
TRPC3	7222	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	122853813	122853813	+	Missense_Mutation	SNP	G	G	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr4:122853813G>T	ENST00000379645.3	-	2	673	c.600C>A	c.(598-600)ttC>ttA	p.F200L	TRPC3_ENST00000513531.1_Missense_Mutation_p.F127L|TRPC3_ENST00000264811.5_Missense_Mutation_p.F127L	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	115					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TGCTGGCCGCGAAGCCAGGGT	0.637																																																0													76.0	67.0	70.0					4																	122853813		2203	4300	6503	SO:0001583	missense	7222			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.600C>A	4.37:g.122853813G>T	ENSP00000368966:p.Phe200Leu	Somatic		WXS	Illumina GAIIx	Phase_I	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	37	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829394	0.71258	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	T;T;T	0.69926	-0.44;-0.44;-0.44	5.81	4.06	0.47325	.	0.000000	0.85682	D	0.000000	T	0.65575	0.2704	L	0.29908	0.895	0.48830	D	0.999716	D;D	0.89917	0.98;1.0	D;D	0.97110	0.93;1.0	T	0.62224	-0.6899	10	0.18710	T	0.47	0.0025	5.2366	0.15450	0.3935:0.0:0.6065:0.0	.	127;200	E9PCJ9;Q5G1L5	.;.	L	127;200;127	ENSP00000264811:F127L;ENSP00000368966:F200L;ENSP00000426899:F127L	ENSP00000264811:F127L	F	-	3	2	TRPC3	123073263	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	1.721000	0.38032	1.423000	0.47198	0.655000	0.94253	TTC		0.637	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305		12	41	12	41
RBM46	166863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	155719190	155719190	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr4:155719190C>T	ENST00000281722.3	+	3	614	c.379C>T	c.(379-381)Cga>Tga	p.R127*	RBM46_ENST00000510397.1_Nonsense_Mutation_p.R127*|RBM46_ENST00000514866.1_Nonsense_Mutation_p.R127*	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	127	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				TTATGAAATTCGACCAGGGAA	0.338																																																0													82.0	90.0	87.0					4																	155719190		2203	4300	6503	SO:0001587	stop_gained	166863			BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.379C>T	4.37:g.155719190C>T	ENSP00000281722:p.Arg127*	Somatic		WXS	Illumina GAIIx	Phase_I	B3KWU8|B4DZ27	Nonsense_Mutation	SNP	ENST00000281722.3	37	CCDS3790.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938892	0.73557	.	.	ENSG00000151962	ENST00000514866;ENST00000281722;ENST00000510397;ENST00000512640	.	.	.	5.9	2.09	0.27110	.	0.054398	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.4395	11.936	0.52874	0.3485:0.5395:0.112:0.0	.	.	.	.	X	127	.	ENSP00000281722:R127X	R	+	1	2	RBM46	155938640	1.000000	0.71417	0.990000	0.47175	0.992000	0.81027	2.556000	0.45862	0.067000	0.16545	0.563000	0.77884	CGA		0.338	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365259.1	NM_144979		18	52	18	52
NPR3	4883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	32712556	32712556	+	Missense_Mutation	SNP	A	A	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr5:32712556A>T	ENST00000265074.8	+	1	1017	c.674A>T	c.(673-675)cAg>cTg	p.Q225L	NPR3_ENST00000415685.2_Intron|NPR3_ENST00000415167.2_Missense_Mutation_p.Q225L|NPR3_ENST00000434067.2_Intron	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	225					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	GAGGTCTTCCAGGAGGAGGGT	0.582																																																0													77.0	86.0	83.0					5																	32712556		2041	4197	6238	SO:0001583	missense	4883				CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.674A>T	5.37:g.32712556A>T	ENSP00000265074:p.Gln225Leu	Somatic		WXS	Illumina GAIIx	Phase_I	A2RRD1|B4DT84|E7EPG9	Missense_Mutation	SNP	ENST00000265074.8	37	CCDS56357.1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.262747	0.39995	.	.	ENSG00000113389	ENST00000265074;ENST00000415167	D;D	0.84223	-1.82;-1.82	4.88	4.88	0.63580	Extracellular ligand-binding receptor (1);	0.325554	0.34088	N	0.004267	T	0.78629	0.4313	L	0.36672	1.1	0.80722	D	1	B;B	0.25743	0.133;0.133	B;B	0.19148	0.024;0.024	T	0.76375	-0.2982	10	0.46703	T	0.11	-15.6924	13.8203	0.63315	1.0:0.0:0.0:0.0	.	225;225	P17342;Q60I31	ANPRC_HUMAN;.	L	225	ENSP00000265074:Q225L;ENSP00000398028:Q225L	ENSP00000265074:Q225L	Q	+	2	0	NPR3	32748313	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.006000	0.49529	2.059000	0.61396	0.454000	0.30748	CAG		0.582	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317550.3	NM_000908		10	103	10	103
SLCO4C1	353189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	101583042	101583042	+	Silent	SNP	C	C	T	rs574597658		TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr5:101583042C>T	ENST00000310954.6	-	10	2011	c.1725G>A	c.(1723-1725)gcG>gcA	p.A575A		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TGGGCAGTTTCGCACAATGAG	0.353													C|||	1	0.000199681	0.0	0.0	5008	,	,		18979	0.0		0.0	False		,,,				2504	0.001															0													122.0	131.0	128.0					5																	101583042		2203	4300	6503	SO:0001819	synonymous_variant	353189			AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.1725G>A	5.37:g.101583042C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000310954.6	37	CCDS34205.1																																																																																				0.353	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370332.1	NM_180991		59	105	59	105
MEGF10	84466	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	126790302	126790302	+	Splice_Site	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr5:126790302G>A	ENST00000274473.6	+	24	3292	c.3025G>A	c.(3025-3027)Gac>Aac	p.D1009N	MEGF10_ENST00000510828.1_3'UTR|MEGF10_ENST00000503335.2_Splice_Site_p.D1009N	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	1009	Necessary for formation of large intracellular vacuoles.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ATCCTTAAAAGGTATCATGTA	0.323																																																0													67.0	69.0	68.0					5																	126790302		2203	4300	6503	SO:0001630	splice_region_variant	84466			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.3025+1G>A	5.37:g.126790302G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q68DE5|Q8WUL3	Splice_Site	SNP	ENST00000274473.6	37	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.385890	0.82902	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	T;T	0.81078	-1.45;-1.45	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.80019	0.4547	M	0.65498	2.005	0.58432	D	0.999997	P	0.42827	0.791	B	0.35114	0.196	T	0.82356	-0.0498	10	0.66056	D	0.02	-28.9132	20.5568	0.99304	0.0:0.0:1.0:0.0	.	1009	Q96KG7	MEG10_HUMAN	N	1009	ENSP00000423354:D1009N;ENSP00000274473:D1009N	ENSP00000274473:D1009N	D	+	1	0	MEGF10	126818201	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	8.067000	0.89488	2.861000	0.98227	0.655000	0.94253	GAC		0.323	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	Missense_Mutation	13	34	13	34
PCDHGA5	56110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	140746124	140746124	+	Missense_Mutation	SNP	G	G	A	rs376762797		TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr5:140746124G>A	ENST00000518069.1	+	1	2227	c.2227G>A	c.(2227-2229)Gtg>Atg	p.V743M	PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	743					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTGTGGGCGTGGATGGGGT	0.632																																																0													81.0	91.0	87.0					5																	140746124		2203	4300	6503	SO:0001583	missense	56110			AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.2227G>A	5.37:g.140746124G>A	ENSP00000429834:p.Val743Met	Somatic		WXS	Illumina GAIIx	Phase_I	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	37	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	9.329	1.059973	0.19987	.	.	ENSG00000253485	ENST00000518069	T	0.51325	0.71	5.17	-2.7	0.06004	.	.	.	.	.	T	0.46833	0.1413	M	0.83483	2.645	0.09310	N	0.999998	B;B	0.17667	0.014;0.023	B;B	0.23018	0.03;0.043	T	0.51474	-0.8701	9	0.52906	T	0.07	.	6.7457	0.23460	0.5728:0.0:0.3079:0.1192	.	743;743	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	M	743	ENSP00000429834:V743M	ENSP00000429834:V743M	V	+	1	0	PCDHGA5	140726308	0.003000	0.15002	0.466000	0.27168	0.296000	0.27459	0.110000	0.15437	-0.368000	0.08040	-1.155000	0.01812	GTG		0.632	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918		57	87	57	87
PAK1IP1	55003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	10707679	10707679	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr6:10707679G>A	ENST00000379568.3	+	8	1063	c.772G>A	c.(772-774)Gag>Aag	p.E258K		NM_017906.2	NP_060376.2	Q9NWT1	PK1IP_HUMAN	PAK1 interacting protein 1	258					cell proliferation (GO:0008283)|negative regulation of signal transduction (GO:0009968)|palate development (GO:0060021)	nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E258Q(1)		kidney(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.117)				TGAAATTCCAGAGCATCATGT	0.328																																																1	Substitution - Missense(1)	lung(1)											234.0	215.0	222.0					6																	10707679		2203	4300	6503	SO:0001583	missense	55003			AF283303	CCDS34339.1	6p24.1	2013-05-21			ENSG00000111845	ENSG00000111845		"""WD repeat domain containing"""	20882	protein-coding gene	gene with protein product		607811				11371639	Standard	XM_005249204		Approved	FLJ20624, hPIP1, PIP1, bA421M1.5, MAK11, WDR84	uc003mzg.3	Q9NWT1	OTTHUMG00000014245	ENST00000379568.3:c.772G>A	6.37:g.10707679G>A	ENSP00000368887:p.Glu258Lys	Somatic		WXS	Illumina GAIIx	Phase_I	Q5T4J2|Q96QJ8|Q96T87	Missense_Mutation	SNP	ENST00000379568.3	37	CCDS34339.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292566	0.59976	.	.	ENSG00000111845	ENST00000379568	T	0.35048	1.33	5.76	4.89	0.63831	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.146447	0.64402	D	0.000010	T	0.18341	0.0440	L	0.43152	1.355	0.39683	D	0.970939	B	0.24258	0.1	B	0.25759	0.063	T	0.05022	-1.0911	10	0.49607	T	0.09	-13.749	12.783	0.57487	0.0792:0.0:0.9208:0.0	.	258	Q9NWT1	PK1IP_HUMAN	K	258	ENSP00000368887:E258K	ENSP00000368887:E258K	E	+	1	0	PAK1IP1	10815665	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	6.120000	0.71596	1.431000	0.47355	0.655000	0.94253	GAG		0.328	PAK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039835.1	NM_017906		40	153	40	153
GPRC6A	222545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	117130650	117130650	+	Missense_Mutation	SNP	C	C	T	rs199585628		TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr6:117130650C>T	ENST00000310357.3	-	2	346	c.325G>A	c.(325-327)Gca>Aca	p.A109T	GPRC6A_ENST00000530250.1_Missense_Mutation_p.A109T|GPRC6A_ENST00000368549.3_Missense_Mutation_p.A109T	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	109					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		GCTGCCATTGCCACTGTGACT	0.428													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17297	0.0		0.0	False		,,,				2504	0.0															0													88.0	82.0	84.0					6																	117130650		2203	4300	6503	SO:0001583	missense	222545			AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.325G>A	6.37:g.117130650C>T	ENSP00000309493:p.Ala109Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	CCDS5112.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	24.5	4.539924	0.85917	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	D;D;D	0.90504	-2.68;-2.68;-2.68	4.81	4.81	0.61882	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000002	D	0.92609	0.7652	M	0.66939	2.045	0.28416	N	0.91797	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.974;0.999	D	0.86936	0.2076	10	0.23891	T	0.37	.	18.0766	0.89428	0.0:1.0:0.0:0.0	.	109;109;109	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	T	109	ENSP00000309493:A109T;ENSP00000357537:A109T;ENSP00000433465:A109T	ENSP00000309493:A109T	A	-	1	0	GPRC6A	117237343	0.999000	0.42202	1.000000	0.80357	0.981000	0.71138	4.496000	0.60360	2.491000	0.84063	0.650000	0.86243	GCA		0.428	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			15	25	15	25
FAM135B	51059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	139149434	139149434	+	Missense_Mutation	SNP	G	G	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr8:139149434G>T	ENST00000395297.1	-	19	4141	c.3971C>A	c.(3970-3972)gCc>gAc	p.A1324D		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1324										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TTCAATCCTGGCTGAATGAAA	0.388										HNSCC(54;0.14)																																						0													162.0	160.0	161.0					8																	139149434		1879	4113	5992	SO:0001583	missense	51059			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3971C>A	8.37:g.139149434G>T	ENSP00000378710:p.Ala1324Asp	Somatic		WXS	Illumina GAIIx	Phase_I	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	G	34	5.342338	0.95783	.	.	ENSG00000147724	ENST00000395297	T	0.50001	0.76	5.93	5.93	0.95920	Domain of unknown function DUF676, lipase-like (1);	0.062950	0.64402	D	0.000007	T	0.79058	0.4382	H	0.94462	3.54	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84074	0.0381	10	0.87932	D	0	-15.7201	19.3249	0.94258	0.0:0.0:1.0:0.0	.	1324	Q49AJ0	F135B_HUMAN	D	1324	ENSP00000378710:A1324D	ENSP00000378710:A1324D	A	-	2	0	FAM135B	139218616	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.787000	0.99055	2.805000	0.96524	0.655000	0.94253	GCC		0.388	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		41	65	41	65
TSNARE1	203062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	143427185	143427185	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr8:143427185G>A	ENST00000307180.3	-	3	274	c.157C>T	c.(157-159)Cag>Tag	p.Q53*	TSNARE1_ENST00000519651.1_Intron|TSNARE1_ENST00000520166.1_Nonsense_Mutation_p.Q53*|TSNARE1_ENST00000524325.1_Nonsense_Mutation_p.Q53*	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	53					intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CAGCGGTTCTGCAGCTTGCTC	0.597																																																0													114.0	94.0	101.0					8																	143427185		2203	4300	6503	SO:0001587	stop_gained	203062					8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.157C>T	8.37:g.143427185G>A	ENSP00000303437:p.Gln53*	Somatic		WXS	Illumina GAIIx	Phase_I	B7ZLB0|Q14D03	Nonsense_Mutation	SNP	ENST00000307180.3	37	CCDS6384.1	.	.	.	.	.	.	.	.	.	.	G	17.51	3.406785	0.62399	.	.	ENSG00000171045	ENST00000524325;ENST00000307180;ENST00000520166;ENST00000520462;ENST00000518720	.	.	.	2.62	1.74	0.24563	.	0.586407	0.12796	U	0.438402	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-4.8049	5.4895	0.16769	0.157:0.0:0.843:0.0	.	.	.	.	X	53;53;53;53;69	.	ENSP00000303437:Q53X	Q	-	1	0	TSNARE1	143425092	0.009000	0.17119	0.007000	0.13788	0.570000	0.35934	1.429000	0.34903	0.672000	0.31204	0.650000	0.86243	CAG		0.597	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_145003		18	40	18	40
FBP2	8789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	97355890	97355890	+	Missense_Mutation	SNP	G	G	A	rs557921747		TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr9:97355890G>A	ENST00000375337.3	-	1	185	c.119C>T	c.(118-120)aCg>aTg	p.T40M		NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	40					carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				TTTGATGGCCGTCAGCATTGA	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		17558	0.0		0.0	False		,,,				2504	0.001															0													120.0	95.0	103.0					9																	97355890		2203	4300	6503	SO:0001583	missense	8789			Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.119C>T	9.37:g.97355890G>A	ENSP00000364486:p.Thr40Met	Somatic		WXS	Illumina GAIIx	Phase_I	Q17R39|Q6FI53	Missense_Mutation	SNP	ENST00000375337.3	37	CCDS6711.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.509788	0.85282	.	.	ENSG00000130957	ENST00000375337	T	0.72394	-0.65	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.83408	0.5248	M	0.69463	2.115	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80774	-0.1232	10	0.35671	T	0.21	-4.0503	19.8405	0.96681	0.0:0.0:1.0:0.0	.	40	O00757	F16P2_HUMAN	M	40	ENSP00000364486:T40M	ENSP00000364486:T40M	T	-	2	0	FBP2	96395711	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	9.622000	0.98378	2.692000	0.91855	0.655000	0.94253	ACG		0.632	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053189.1	NM_003837		16	23	16	23
SEC16A	9919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	139354230	139354230	+	Missense_Mutation	SNP	C	C	G			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr9:139354230C>G	ENST00000371706.3	-	13	4669	c.4636G>C	c.(4636-4638)Gct>Cct	p.A1546P	SEC16A_ENST00000290037.6_Missense_Mutation_p.A1546P|SEC16A_ENST00000313050.7_Missense_Mutation_p.A1724P|SEC16A_ENST00000431893.2_Missense_Mutation_p.A1546P			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1546					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CCCATGGTAGCCATCGTCCTG	0.587																																																0													49.0	52.0	51.0					9																	139354230		2079	4214	6293	SO:0001583	missense	9919			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.4636G>C	9.37:g.139354230C>G	ENSP00000360771:p.Ala1546Pro	Somatic		WXS	Illumina GAIIx	Phase_I	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	37		.	.	.	.	.	.	.	.	.	.	C	18.75	3.689645	0.68271	.	.	ENSG00000148396	ENST00000313050;ENST00000277537;ENST00000453963;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925	T;T;T;T;T;T	0.46819	1.86;0.86;1.46;1.86;1.86;1.85	5.55	2.69	0.31865	.	0.477928	0.25272	N	0.031877	T	0.54319	0.1851	L	0.46157	1.445	0.80722	D	1	D;D;D;D	0.76494	0.966;0.999;0.999;0.999	P;D;D;D	0.68621	0.837;0.952;0.952;0.959	T	0.50566	-0.8813	10	0.56958	D	0.05	-2.6027	5.8725	0.18810	0.0:0.6384:0.1387:0.223	.	1724;1546;1546;1114	F1T0I1;O15027-5;O15027-4;A4QN19	.;.;.;.	P	1724;118;446;1546;1546;1546;1114	ENSP00000325827:A1724P;ENSP00000277537:A118P;ENSP00000403525:A446P;ENSP00000360771:A1546P;ENSP00000290037:A1546P;ENSP00000387583:A1546P	ENSP00000277537:A118P	A	-	1	0	SEC16A	138474051	1.000000	0.71417	0.515000	0.27774	0.799000	0.45148	0.812000	0.27211	0.290000	0.22444	0.561000	0.74099	GCT		0.587	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459		5	5	5	5
TBC1D25	4943	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	48418954	48418954	+	Missense_Mutation	SNP	C	C	G			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chrX:48418954C>G	ENST00000376771.4	+	6	1999	c.1658C>G	c.(1657-1659)tCc>tGc	p.S553C	TBC1D25_ENST00000537536.1_Missense_Mutation_p.S299C|snoU13_ENST00000459609.1_RNA	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	553					autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						CTGCTCTCCTCCTTTTCCCAC	0.582																																																0													102.0	91.0	95.0					X																	48418954		2203	4300	6503	SO:0001583	missense	4943			L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.1658C>G	X.37:g.48418954C>G	ENSP00000365962:p.Ser553Cys	Somatic		WXS	Illumina GAIIx	Phase_I	Q08AN9|Q3MII4|Q8TAR9	Missense_Mutation	SNP	ENST00000376771.4	37	CCDS35242.1	.	.	.	.	.	.	.	.	.	.	C	10.32	1.317422	0.23908	.	.	ENSG00000068354	ENST00000376771;ENST00000537536	T;T	0.15487	2.43;2.42	5.24	5.24	0.73138	Rab-GAP/TBC domain (1);	0.818706	0.11213	N	0.587538	T	0.16257	0.0391	L	0.38175	1.15	0.80722	D	1	B;B;B	0.27732	0.042;0.07;0.187	B;B;B	0.30105	0.054;0.111;0.078	T	0.06180	-1.0841	10	0.66056	D	0.02	-15.6938	8.9782	0.35948	0.0:0.8971:0.0:0.1029	.	557;495;553	B4DF03;B4DGU3;Q3MII6	.;.;TBC25_HUMAN	C	553;299	ENSP00000365962:S553C;ENSP00000444091:S299C	ENSP00000365962:S553C	S	+	2	0	TBC1D25	48303898	0.006000	0.16342	1.000000	0.80357	0.950000	0.60333	2.097000	0.41748	2.183000	0.69458	0.436000	0.28706	TCC		0.582	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060764.2	NM_002536		75	114	75	114
THOC2	57187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	122747329	122747329	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chrX:122747329G>C	ENST00000245838.8	-	36	4629	c.4598C>G	c.(4597-4599)tCa>tGa	p.S1533*	THOC2_ENST00000491737.1_Nonsense_Mutation_p.S1418*|THOC2_ENST00000355725.4_Nonsense_Mutation_p.S1533*|THOC2_ENST00000497887.1_5'UTR	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	1533	Lys-rich.				mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						TGAAGATTTTGACTTATTTTT	0.323																																																0													90.0	77.0	81.0					X																	122747329		1797	4051	5848	SO:0001587	stop_gained	57187			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.4598C>G	X.37:g.122747329G>C	ENSP00000245838:p.Ser1533*	Somatic		WXS	Illumina GAIIx	Phase_I	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Nonsense_Mutation	SNP	ENST00000245838.8	37	CCDS43988.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.9|26.9	4.781720|4.781720	0.90282|0.90282	.|.	.|.	ENSG00000125676|ENSG00000125676	ENST00000448128;ENST00000441692|ENST00000245838;ENST00000455053;ENST00000355725;ENST00000416618;ENST00000491737	.|.	.|.	.|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	.|0.000000	.|0.53938	.|D	.|0.000060	T|.	0.73118|.	0.3546|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.69202|.	-0.5207|.	3|.	.|0.30854	.|T	.|0.27	-5.9379|-5.9379	18.891|18.891	0.92403|0.92403	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|X	129;328|1533;26;1533;122;1418	.|.	.|ENSP00000245838:S1533X	Q|S	-|-	1|2	0|0	THOC2|THOC2	122575010|122575010	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.011000|8.011000	0.88624|0.88624	2.409000|2.409000	0.81822|0.81822	0.544000|0.544000	0.68410|0.68410	CAA|TCA		0.323	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3			36	69	36	69
GPC3	2719	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	133087087	133087087	+	Silent	SNP	C	C	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chrX:133087087C>T	ENST00000370818.3	-	2	772	c.327G>A	c.(325-327)gcG>gcA	p.A109A	GPC3_ENST00000394299.2_Silent_p.A109A|GPC3_ENST00000543339.1_Intron	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	109					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					CTTGGAAAACCGCAGCATTCT	0.378			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																													yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	0													172.0	159.0	164.0					X																	133087087		2203	4300	6503	SO:0001819	synonymous_variant	2719	Familial Cancer Database	SGBS	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.327G>A	X.37:g.133087087C>T		Somatic		WXS	Illumina GAIIx	Phase_I	C9JLE3|G3V1R0|Q2L880|Q2L882	Silent	SNP	ENST00000370818.3	37	CCDS14638.1																																																																																				0.378	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1	NM_004484		70	177	70	177
PPARG	5468	broad.mit.edu;ucsc.edu	37	3	12421382	12421382	+	Missense_Mutation	SNP	C	C	G			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr3:12421382C>G	ENST00000287820.6	+	2	383	c.262C>G	c.(262-264)Cca>Gca	p.P88A	PPARG_ENST00000397015.2_Missense_Mutation_p.P60A|PPARG_ENST00000397000.1_Missense_Mutation_p.P60A|PPARG_ENST00000397026.2_Missense_Mutation_p.P66A|PPARG_ENST00000397010.2_Missense_Mutation_p.P60A|PPARG_ENST00000309576.6_Missense_Mutation_p.P60A|PPARG_ENST00000397012.2_Missense_Mutation_p.P60A|PPARG_ENST00000539812.1_Missense_Mutation_p.P58A	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	88					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	AAGAACAGATCCAGTGGTTGC	0.398			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																																Dom	yes		3	3p25	5468	"""peroxisome proliferative activated receptor, gamma"""	yes	E	0													146.0	142.0	143.0					3																	12421382		2203	4300	6503	SO:0001583	missense	5468			X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.262C>G	3.37:g.12421382C>G	ENSP00000287820:p.Pro88Ala	Somatic		WXS	Illumina GAIIx	Phase_I	A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Missense_Mutation	SNP	ENST00000287820.6	37	CCDS2609.1	.	.	.	.	.	.	.	.	.	.	C	12.31	1.899091	0.33535	.	.	ENSG00000132170	ENST00000397010;ENST00000397029;ENST00000309576;ENST00000397015;ENST00000397012;ENST00000397026;ENST00000438682;ENST00000397000;ENST00000539812;ENST00000287820	T;T;T;T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02	5.8	5.8	0.92144	Peroxisome proliferator-activated receptor gamma, N-terminal (1);	0.252020	0.36234	N	0.002715	T	0.41442	0.1159	N	0.19112	0.55	0.43435	D	0.995603	B;P;B	0.50819	0.101;0.939;0.019	B;P;B	0.48770	0.089;0.589;0.038	T	0.28586	-1.0039	10	0.51188	T	0.08	.	20.0716	0.97726	0.0:1.0:0.0:0.0	.	88;74;60	P37231;Q4W4C7;E9PFX5	PPARG_HUMAN;.;.	A	60;60;60;60;60;66;60;60;58;88	ENSP00000380205:P60A;ENSP00000380224:P60A;ENSP00000312472:P60A;ENSP00000380210:P60A;ENSP00000380207:P60A;ENSP00000380221:P66A;ENSP00000392285:P60A;ENSP00000380196:P60A;ENSP00000438940:P58A;ENSP00000287820:P88A	ENSP00000287820:P88A	P	+	1	0	PPARG	12396382	0.631000	0.27164	0.960000	0.40013	0.126000	0.20510	4.373000	0.59537	2.741000	0.93983	0.585000	0.79938	CCA		0.398	PPARG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251979.2	NM_005037		29	87	29	87
ATP13A3	79572	broad.mit.edu;ucsc.edu	37	3	194181443	194181443	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr3:194181443C>T	ENST00000439040.1	-	4	960	c.169G>A	c.(169-171)Gcg>Acg	p.A57T	ATP13A3_ENST00000256031.4_Missense_Mutation_p.A57T			Q9H7F0	AT133_HUMAN	ATPase type 13A3	57						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		ACACAGGTCGCTTTCACCCGC	0.448																																																0													82.0	85.0	84.0					3																	194181443		1921	4147	6068	SO:0001583	missense	79572			AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.169G>A	3.37:g.194181443C>T	ENSP00000416508:p.Ala57Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q8NC11|Q96KS1	Missense_Mutation	SNP	ENST00000439040.1	37	CCDS43187.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.076025	0.76415	.	.	ENSG00000133657	ENST00000439040;ENST00000256031;ENST00000457986	T;T;T	0.24538	1.85;1.85;1.85	6.16	6.16	0.99307	.	0.164421	0.53938	D	0.000046	T	0.44371	0.1290	L	0.60455	1.87	0.50467	D	0.999879	P	0.37015	0.578	P	0.51550	0.673	T	0.01600	-1.1315	10	0.21540	T	0.41	-13.8671	20.8598	0.99761	0.0:1.0:0.0:0.0	.	57	Q9H7F0	AT133_HUMAN	T	57	ENSP00000416508:A57T;ENSP00000256031:A57T;ENSP00000406234:A57T	ENSP00000256031:A57T	A	-	1	0	ATP13A3	195662732	1.000000	0.71417	0.993000	0.49108	0.655000	0.38815	2.716000	0.47219	2.937000	0.99478	0.650000	0.86243	GCG		0.448	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342799.2	NM_024524		31	57	31	57
SEMG2	6407	broad.mit.edu;ucsc.edu	37	20	43851148	43851148	+	Missense_Mutation	SNP	G	G	A	rs145586123	byFrequency	TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr20:43851148G>A	ENST00000372769.3	+	2	965	c.875G>A	c.(874-876)cGt>cAt	p.R292H		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	292	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)	p.R292H(1)|p.R292L(1)		autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				CCGTCTTCACGTACAGAAGAA	0.398																																																2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)						G	HIS/ARG	0,4406	2.1+/-5.4	0,0,2203	94.0	88.0	90.0		875	-0.9	0.0	20	dbSNP_134	90	4,8596	3.7+/-12.6	0,4,4296	yes	missense	SEMG2	NM_003008.2	29	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	benign	292/583	43851148	4,13002	2203	4300	6503	SO:0001583	missense	6407				CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.875G>A	20.37:g.43851148G>A	ENSP00000361855:p.Arg292His	Somatic		WXS	Illumina GAIIx	Phase_I	Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	ENST00000372769.3	37	CCDS13346.1	.	.	.	.	.	.	.	.	.	.	G	5.553	0.286965	0.10513	0.0	4.65E-4	ENSG00000124157	ENST00000372769	T	0.06449	3.3	1.28	-0.886	0.10590	.	.	.	.	.	T	0.03477	0.0100	N	0.14661	0.345	0.09310	N	1	B;B;B	0.14438	0.005;0.01;0.01	B;B;B	0.12156	0.007;0.007;0.007	T	0.42224	-0.9464	9	0.48119	T	0.1	.	4.015	0.09639	0.4624:0.0:0.5376:0.0	.	292;292;292	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	H	292	ENSP00000361855:R292H	ENSP00000361855:R292H	R	+	2	0	SEMG2	43284562	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.964000	0.03833	-0.275000	0.09219	-0.194000	0.12790	CGT		0.398	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008		30	61	30	61
FBN3	84467	broad.mit.edu;ucsc.edu	37	19	8152978	8152978	+	Silent	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr19:8152978G>A	ENST00000600128.1	-	52	6876	c.6462C>T	c.(6460-6462)gaC>gaT	p.D2154D	FBN3_ENST00000601739.1_Silent_p.D2154D|FBN3_ENST00000270509.2_Silent_p.D2154D			Q75N90	FBN3_HUMAN	fibrillin 3	2154	EGF-like 34; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GCTCAAAGCCGTCAGCACAGG	0.617																																																0													116.0	94.0	101.0					19																	8152978		2203	4300	6503	SO:0001819	synonymous_variant	84467				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.6462C>T	19.37:g.8152978G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	ENST00000600128.1	37	CCDS12196.1																																																																																				0.617	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447		29	54	29	54
FAM199X	139231	broad.mit.edu;ucsc.edu	37	X	103411604	103411604	+	Silent	SNP	C	C	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chrX:103411604C>T	ENST00000493442.1	+	1	304	c.138C>T	c.(136-138)ttC>ttT	p.F46F		NM_207318.3	NP_997201.1	Q6PEV8	F199X_HUMAN	family with sequence similarity 199, X-linked	46								p.F46F(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)	11						TCAGCGACTTCGGCTGCCAGC	0.657																																																1	Substitution - coding silent(1)	breast(1)											36.0	31.0	33.0					X																	103411604		2203	4299	6502	SO:0001819	synonymous_variant	139231			BC016683	CCDS35364.1	Xq22	2010-02-11	2010-02-11	2010-02-11	ENSG00000123575	ENSG00000123575			25195	protein-coding gene	gene with protein product			"""chromosome X open reading frame 39"""	CXorf39			Standard	NM_207318		Approved		uc004elw.3	Q6PEV8	OTTHUMG00000022126	ENST00000493442.1:c.138C>T	X.37:g.103411604C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q8WVP6|Q96AV3	Silent	SNP	ENST00000493442.1	37	CCDS35364.1																																																																																				0.657	FAM199X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057764.1	NM_207318		5	40	5	40
PKD1L2	114780	broad.mit.edu;ucsc.edu	37	16	81157276	81157276	+	RNA	SNP	G	G	A			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr16:81157276G>A	ENST00000534142.1	-	0	851				PKD1L2_ENST00000533478.1_RNA|PKD1L2_ENST00000525539.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GGTCTCTAGCGTCAGCGTGAC	0.592																																																0													119.0	119.0	119.0					16																	81157276		2056	4200	6256			114780			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81157276G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	SNP	ENST00000534142.1	37																																																																																					0.592	PKD1L2-009	PUTATIVE	basic|exp_conf	processed_transcript	polymorphic_pseudogene	OTTHUMT00000387969.1			32	88	32	88
TRBV10-1	28585	broad.mit.edu;ucsc.edu	37	7	142231794	142231794	+	RNA	SNP	C	C	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr7:142231794C>T	ENST00000390364.3	-	0	190									T cell receptor beta variable 10-1(gene/pseudogene)																		TCTGGTGACACGCCAAGGTCA	0.488																																																0													151.0	145.0	147.0					7																	142231794		2033	4188	6221			28585			U17050		7q34	2012-02-07	2008-09-12		ENSG00000211717	ENSG00000211717		"""T cell receptors / TRB locus"""	12177	other	T cell receptor gene			"""T cell receptor beta variable 10-1"""			8650574	Standard	NG_001333		Approved	TRBV101, TCRBV10S1, TCRBV12S2A1T, TCRBV12S2			OTTHUMG00000158514		7.37:g.142231794C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000390364.3	37																																																																																					0.488	TRBV10-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TR_V_gene	OTTHUMT00000351220.2	NG_001333		35	150	35	150
MMP20	9313	broad.mit.edu;ucsc.edu	37	11	102477309	102477309	+	Missense_Mutation	SNP	C	C	T	rs148818720	byFrequency	TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chr11:102477309C>T	ENST00000260228.2	-	6	922	c.910G>A	c.(910-912)Gct>Act	p.A304T	RP11-817J15.2_ENST00000542119.1_RNA|RP11-817J15.2_ENST00000544115.1_RNA|MMP20_ENST00000544938.1_5'UTR	NM_004771.3	NP_004762.2	Q9NPA2	MMP25_HUMAN	matrix metallopeptidase 20	323					hard palate development (GO:0060022)|inflammatory response (GO:0006954)|proteolysis (GO:0006508)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)	Marimastat(DB00786)	ATTGTCACAGCGTCAAAGGAT	0.577													C|||	7	0.00139776	0.0015	0.0	5008	,	,		19807	0.001		0.003	False		,,,				2504	0.001															0								C	THR/ALA	2,4404	4.2+/-10.8	0,2,2201	127.0	111.0	116.0		910	5.4	1.0	11	dbSNP_134	116	25,8573	17.9+/-57.8	0,25,4274	yes	missense	MMP20	NM_004771.3	58	0,27,6475	TT,TC,CC		0.2908,0.0454,0.2076	probably-damaging	304/484	102477309	27,12977	2203	4299	6502	SO:0001583	missense	9313			Y12779	CCDS8318.1	11q22.3	2008-05-22	2008-05-22			ENSG00000137674			7167	protein-coding gene	gene with protein product	"""enamelysin"""	604629	"""matrix metalloproteinase 20 (enamelysin)"""			9398237	Standard	NM_004771		Approved		uc001phc.3	O60882		ENST00000260228.2:c.910G>A	11.37:g.102477309C>T	ENSP00000260228:p.Ala304Thr	Somatic		WXS	Illumina GAIIx	Phase_I	D3DUA8|Q9H3Q0	Missense_Mutation	SNP	ENST00000260228.2	37	CCDS8318.1	3	0.0013736263736263737	0	0.0	0	0.0	1	0.0017482517482517483	2	0.002638522427440633	C	18.12	3.552726	0.65425	4.54E-4	0.002908	ENSG00000137674	ENST00000260228	T	0.28666	1.6	5.45	5.45	0.79879	Hemopexin/matrixin (2);	0.110120	0.64402	D	0.000010	T	0.51160	0.1658	L	0.55213	1.73	0.54753	D	0.999986	D	0.89917	1.0	D	0.91635	0.999	T	0.48768	-0.9006	10	0.87932	D	0	.	15.0533	0.71891	0.1424:0.8576:0.0:0.0	.	304	O60882	MMP20_HUMAN	T	304	ENSP00000260228:A304T	ENSP00000260228:A304T	A	-	1	0	MMP20	101982519	1.000000	0.71417	0.998000	0.56505	0.192000	0.23643	2.487000	0.45268	2.835000	0.97688	0.650000	0.86243	GCT		0.577	MMP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398012.1			4	34	4	34
OGT	8473	broad.mit.edu;ucsc.edu	37	X	70784541	70784541	+	Missense_Mutation	SNP	G	G	T			TCGA-DU-7006-01A-11D-2024-08	TCGA-DU-7006-10A-01D-2024-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	75d5d3ef-38e4-4cf0-af03-698bb4e86544	f1e2e051-e9aa-48e8-a1f8-4a041025d940	g.chrX:70784541G>T	ENST00000373719.3	+	19	2744	c.2527G>T	c.(2527-2529)Gta>Tta	p.V843L	OGT_ENST00000373701.3_Missense_Mutation_p.V833L	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	843					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)	p.V833I(1)|p.V843I(1)		breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					AGATGCCATCGTATACTGTAA	0.403																																																2	Substitution - Missense(2)	kidney(2)											133.0	110.0	118.0					X																	70784541		2203	4300	6503	SO:0001583	missense	8473			U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.2527G>T	X.37:g.70784541G>T	ENSP00000362824:p.Val843Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	ENST00000373719.3	37	CCDS14414.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.788952	0.70337	.	.	ENSG00000147162	ENST00000373719;ENST00000373701	T;T	0.15718	2.4;2.4	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.48660	0.1512	M	0.87682	2.9	0.80722	D	1	D;D;P	0.67145	0.992;0.996;0.774	D;D;B	0.74348	0.983;0.98;0.413	T	0.54463	-0.8290	10	0.48119	T	0.1	.	18.2254	0.89915	0.0:0.0:1.0:0.0	.	717;833;843	Q548W1;O15294-3;O15294	.;.;OGT1_HUMAN	L	843;833	ENSP00000362824:V843L;ENSP00000362805:V833L	ENSP00000362805:V833L	V	+	1	0	OGT	70701266	1.000000	0.71417	0.995000	0.50966	0.065000	0.16274	9.778000	0.99011	2.329000	0.79093	0.600000	0.82982	GTA		0.403	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3	NM_003605, NM_181672		21	51	21	51
