#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
OR4D10	390197	hgsc.bcm.edu;broad.mit.edu	37	11	59245678	59245678	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr11:59245678C>T	ENST00000530162.1	+	1	833	c.776C>T	c.(775-777)gCc>gTc	p.A259V		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TATGTCTATGCCCGGCCCTTC	0.562																																																0													199.0	177.0	185.0					11																	59245678		2201	4295	6496	SO:0001583	missense	390197			AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.776C>T	11.37:g.59245678C>T	ENSP00000436424:p.Ala259Val	Somatic		WXS	Illumina GAIIx	Phase_I	B2RNH6	Missense_Mutation	SNP	ENST00000530162.1	37	CCDS53636.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940173	0.52972	.	.	ENSG00000254466	ENST00000530162	T	0.35789	1.29	4.52	3.53	0.40419	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.15609	0.0376	N	0.11064	0.09	0.25680	N	0.985809	B	0.19935	0.04	B	0.24006	0.05	T	0.36089	-0.9762	9	0.02654	T	1	.	5.8629	0.18759	0.0:0.6953:0.1986:0.1061	.	259	Q8NGI6	OR4DA_HUMAN	V	259	ENSP00000436424:A259V	ENSP00000436424:A259V	A	+	2	0	OR4D10	59002254	0.000000	0.05858	0.986000	0.45419	0.806000	0.45545	-0.572000	0.05881	2.202000	0.70862	0.650000	0.86243	GCC		0.562	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394235.1	NM_001004705		18	354	18	354
PTPRO	5800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	15654567	15654567	+	Silent	SNP	T	T	C			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr12:15654567T>C	ENST00000281171.4	+	5	1005	c.675T>C	c.(673-675)ccT>ccC	p.P225P	PTPRO_ENST00000348962.2_Silent_p.P225P|PTPRO_ENST00000543886.1_Silent_p.P225P	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	225					axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				CTTATCCACCTCAAAATATTT	0.348																																																0													43.0	45.0	44.0					12																	15654567		2200	4298	6498	SO:0001819	synonymous_variant	5800			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.675T>C	12.37:g.15654567T>C		Somatic		WXS	Illumina GAIIx	Phase_I	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Silent	SNP	ENST00000281171.4	37	CCDS8675.1																																																																																				0.348	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1			19	43	19	43
RGS6	9628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	72961928	72961928	+	Missense_Mutation	SNP	C	C	A			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr14:72961928C>A	ENST00000553530.1	+	13	1130	c.923C>A	c.(922-924)cCt>cAt	p.P308H	RGS6_ENST00000406236.4_Missense_Mutation_p.P308H|RGS6_ENST00000402788.2_Missense_Mutation_p.P308H|RGS6_ENST00000554782.1_Missense_Mutation_p.P169H|RGS6_ENST00000555571.1_Missense_Mutation_p.P308H|RGS6_ENST00000343854.6_Intron|RGS6_ENST00000556437.1_Missense_Mutation_p.P308H|RGS6_ENST00000553525.1_Missense_Mutation_p.P308H|RGS6_ENST00000407322.4_Missense_Mutation_p.P308H|RGS6_ENST00000404301.2_Missense_Mutation_p.P308H|RGS6_ENST00000355512.6_Missense_Mutation_p.P308H|RGS6_ENST00000434263.2_Missense_Mutation_p.P239H	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	308	G protein gamma.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		CCATCCAACCCTTGGATCAGC	0.443																																					Ovarian(143;1926 2468 21071 48641)											0													237.0	208.0	218.0					14																	72961928		2203	4300	6503	SO:0001583	missense	9628			AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.923C>A	14.37:g.72961928C>A	ENSP00000452331:p.Pro308His	Somatic		WXS	Illumina GAIIx	Phase_I	C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Missense_Mutation	SNP	ENST00000553530.1	37	CCDS9808.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676072	0.88445	.	.	ENSG00000182732	ENST00000553525;ENST00000555571;ENST00000553530;ENST00000556437;ENST00000355512;ENST00000404301;ENST00000406236;ENST00000407322;ENST00000402788;ENST00000453330;ENST00000434263;ENST00000554782;ENST00000535521	T;T;T;T;T;T;T;T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48;-0.48;-0.48;-0.48;-0.48;-0.48;-0.48;-0.48	5.81	5.81	0.92471	G-protein gamma domain (4);	0.000000	0.85682	D	0.000000	D	0.88043	0.6331	M	0.91510	3.215	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.89667	0.3881	10	0.66056	D	0.02	-7.3769	18.854	0.92244	0.0:1.0:0.0:0.0	.	239;308;313;308	B7Z7N5;P49758-2;Q59FJ8;P49758	.;.;.;RGS6_HUMAN	H	308;308;308;308;308;308;308;308;308;280;239;169;169	ENSP00000451030:P308H;ENSP00000450936:P308H;ENSP00000452331:P308H;ENSP00000451855:P308H;ENSP00000347699:P308H;ENSP00000385243:P308H;ENSP00000384218:P308H;ENSP00000384612:P308H;ENSP00000383953:P308H;ENSP00000412144:P239H;ENSP00000451912:P169H	ENSP00000347699:P308H	P	+	2	0	RGS6	72031681	1.000000	0.71417	0.994000	0.49952	0.969000	0.65631	6.792000	0.75125	2.746000	0.94184	0.655000	0.94253	CCT		0.443	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2			144	192	144	192
ATP8B4	79895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	50189590	50189590	+	Missense_Mutation	SNP	A	A	C			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr15:50189590A>C	ENST00000284509.6	-	23	2737	c.2596T>G	c.(2596-2598)Tat>Gat	p.Y866D	ATP8B4_ENST00000559829.1_Missense_Mutation_p.Y866D	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	866						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		ATTCGGAAATAAGACCACCTT	0.413																																																0													170.0	182.0	178.0					15																	50189590		2196	4295	6491	SO:0001583	missense	79895			AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.2596T>G	15.37:g.50189590A>C	ENSP00000284509:p.Tyr866Asp	Somatic		WXS	Illumina GAIIx	Phase_I	Q9H727	Missense_Mutation	SNP	ENST00000284509.6	37	CCDS32238.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.617187	0.87359	.	.	ENSG00000104043	ENST00000284509	T	0.64085	-0.08	5.71	5.71	0.89125	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.85995	0.5827	H	0.97564	4.03	0.58432	D	0.999997	D;D	0.76494	0.999;0.985	D;P	0.77557	0.99;0.728	D	0.90629	0.4565	10	0.87932	D	0	.	13.9413	0.64057	1.0:0.0:0.0:0.0	.	86;866	B3KVY8;Q8TF62	.;AT8B4_HUMAN	D	866	ENSP00000284509:Y866D	ENSP00000284509:Y866D	Y	-	1	0	ATP8B4	47976882	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.281000	0.95811	2.180000	0.69256	0.533000	0.62120	TAT		0.413	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418100.1	NM_024837		116	131	116	131
ZNF688	146542	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	30581515	30581515	+	Missense_Mutation	SNP	A	A	T			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr16:30581515A>T	ENST00000223459.6	-	3	1657	c.553T>A	c.(553-555)Tgc>Agc	p.C185S	AC002310.7_ENST00000492040.1_RNA|AC002310.7_ENST00000486926.1_RNA|ZNF688_ENST00000395219.1_Missense_Mutation_p.C171S	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	185					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						CAGTCCGTGCACACGTGGCGC	0.687																																																0													17.0	21.0	20.0					16																	30581515		2193	4295	6488	SO:0001583	missense	146542			AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.553T>A	16.37:g.30581515A>T	ENSP00000223459:p.Cys185Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	ENST00000223459.6	37	CCDS10684.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.144595	0.77888	.	.	ENSG00000229809	ENST00000395219;ENST00000223459	T;T	0.60040	0.22;0.22	4.26	4.26	0.50523	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.70945	0.3282	M	0.66939	2.045	0.44728	D	0.997728	D;D	0.89917	1.0;0.981	D;D	0.80764	0.994;0.966	T	0.73691	-0.3903	9	0.87932	D	0	.	9.9179	0.41446	1.0:0.0:0.0:0.0	.	185;171	P0C7X2;A8MV39	ZN688_HUMAN;.	S	171;185	ENSP00000378645:C171S;ENSP00000223459:C185S	ENSP00000223459:C185S	C	-	1	0	ZNF688	30489016	1.000000	0.71417	0.987000	0.45799	0.624000	0.37722	6.005000	0.70716	1.909000	0.55274	0.377000	0.23210	TGC		0.687	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255544.2	NM_145271		11	14	11	14
HOXB8	3218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	46691864	46691864	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr17:46691864G>A	ENST00000239144.4	-	1	437	c.203C>T	c.(202-204)cCc>cTc	p.P68L	HOXB8_ENST00000576562.1_Missense_Mutation_p.P68L|HOXB7_ENST00000567101.2_Intron	NM_024016.3	NP_076921.1	P17481	HXB8_HUMAN	homeobox B8	68					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|dorsal spinal cord development (GO:0021516)|embryonic skeletal system morphogenesis (GO:0048704)|grooming behavior (GO:0007625)|negative regulation of myeloid cell differentiation (GO:0045638)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(8)|urinary_tract(2)	11						CTGCTGGTAGGGAGCCGTGGA	0.672																																																0													40.0	41.0	41.0					17																	46691864		2202	4298	6500	SO:0001583	missense	3218				CCDS11533.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120068	ENSG00000120068		"""Homeoboxes / ANTP class : HOXL subclass"""	5119	protein-coding gene	gene with protein product		142963	"""homeo box B8"""	HOX2, HOX2D		1973146, 1358459	Standard	XM_005257286		Approved		uc002inw.3	P17481	OTTHUMG00000159904	ENST00000239144.4:c.203C>T	17.37:g.46691864G>A	ENSP00000239144:p.Pro68Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q9H1I2	Missense_Mutation	SNP	ENST00000239144.4	37	CCDS11533.1	.	.	.	.	.	.	.	.	.	.	g	7.960	0.746830	0.15710	.	.	ENSG00000120068	ENST00000239144	T	0.43688	0.94	2.81	1.82	0.25136	.	0.000000	0.64402	U	0.000019	T	0.35856	0.0946	L	0.56769	1.78	0.49582	D	0.999809	B	0.02656	0.0	B	0.04013	0.001	T	0.17289	-1.0374	10	0.36615	T	0.2	.	9.8318	0.40946	0.1064:0.0:0.8936:0.0	.	68	P17481	HXB8_HUMAN	L	68	ENSP00000239144:P68L	ENSP00000239144:P68L	P	-	2	0	HOXB8	44046863	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.275000	0.58927	0.535000	0.28714	0.290000	0.19541	CCC		0.672	HOXB8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358092.3			23	29	23	29
DCC	1630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	50731664	50731664	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr18:50731664C>T	ENST00000442544.2	+	10	2268	c.1652C>T	c.(1651-1653)cCt>cTt	p.P551L	DCC_ENST00000581580.1_Missense_Mutation_p.P206L|DCC_ENST00000412726.1_Missense_Mutation_p.P399L	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	551	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TGGGAACCCCCTGCCTATGCA	0.458																																																0													196.0	191.0	193.0					18																	50731664		2203	4300	6503	SO:0001583	missense	1630			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1652C>T	18.37:g.50731664C>T	ENSP00000389140:p.Pro551Leu	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.346634	0.41599	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T;T	0.62498	0.02;0.1;0.02	5.78	5.78	0.91487	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81767	0.4892	M	0.87097	2.86	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.79254	-0.1879	10	0.25106	T	0.35	.	18.7793	0.91925	0.0:1.0:0.0:0.0	.	399;399;551	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	L	551;484;399	ENSP00000389140:P551L;ENSP00000304146:P484L;ENSP00000397322:P399L	ENSP00000304146:P484L	P	+	2	0	DCC	48985662	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.458000	0.73509	2.722000	0.93159	0.655000	0.94253	CCT		0.458	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215		70	191	70	191
ELANE	1991	hgsc.bcm.edu;ucsc.edu	37	19	852344	852344	+	Nonsense_Mutation	SNP	C	C	T	rs182347433	byFrequency	TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr19:852344C>T	ENST00000590230.1	+	2	157	c.16C>T	c.(16-18)Cga>Tga	p.R6*	ELANE_ENST00000263621.1_Nonsense_Mutation_p.R6*			P08246	ELNE_HUMAN	elastase, neutrophil expressed	6					acute inflammatory response to antigenic stimulus (GO:0002438)|cellular calcium ion homeostasis (GO:0006874)|collagen catabolic process (GO:0030574)|defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of chemotaxis (GO:0050922)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil mediated killing of fungus (GO:0070947)|phagocytosis (GO:0006909)|positive regulation of immune response (GO:0050778)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)|response to UV (GO:0009411)|response to yeast (GO:0001878)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|transcriptional repressor complex (GO:0017053)	cytokine binding (GO:0019955)|endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|RNA polymerase II transcription corepressor activity (GO:0001106)|serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(1)|lung(4)|pancreas(1)	13					Alpha-1-proteinase inhibitor(DB00058)|Filgrastim(DB00099)|Pegfilgrastim(DB00019)	CCTCGGCCGCCGACTCGCGTG	0.677																																																0													40.0	41.0	41.0					19																	852344		2202	4300	6502	SO:0001587	stop_gained	1991				CCDS12045.1	19p13.3	2014-09-17	2009-05-05	2009-05-05	ENSG00000197561	ENSG00000197561	3.4.21.37		3309	protein-coding gene	gene with protein product	"""neutrophil elastase"", ""leukocyte elastase"", ""medullasin"""	130130	"""elastase 2, neutrophil"""	ELA2		2902087	Standard	XM_005259517		Approved	NE, HNE, HLE	uc002lqb.3	P08246		ENST00000590230.1:c.16C>T	19.37:g.852344C>T	ENSP00000466090:p.Arg6*	Somatic		WXS	Illumina GAIIx	Phase_I	P09649|Q6B0D9|Q6LDP5	Nonsense_Mutation	SNP	ENST00000590230.1	37	CCDS12045.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.298094	0.60086	.	.	ENSG00000197561	ENST00000263621	.	.	.	2.11	1.0	0.19881	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	5.7975	0.18396	0.345:0.655:0.0:0.0	.	.	.	.	X	6	.	ENSP00000263621:R6X	R	+	1	2	ELANE	803344	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.849000	0.04322	0.384000	0.24942	0.491000	0.48974	CGA		0.677	ELANE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457890.2	NM_001972		34	40	34	40
FEM1A	55527	hgsc.bcm.edu;broad.mit.edu	37	19	4792851	4792851	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr19:4792851C>T	ENST00000269856.3	+	1	1124	c.985C>T	c.(985-987)Cgt>Tgt	p.R329C	AC005523.2_ENST00000601192.1_RNA|AC005523.3_ENST00000598782.1_lincRNA|AC005523.2_ENST00000596170.1_RNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)	329					negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		CATGGAGCTGCGTCACCAGGG	0.607																																																0													39.0	43.0	42.0					19																	4792851		2203	4298	6501	SO:0001583	missense	55527			BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.985C>T	19.37:g.4792851C>T	ENSP00000269856:p.Arg329Cys	Somatic		WXS	Illumina GAIIx	Phase_I	B2RDI3|Q711P8|Q9NPN7|Q9NPW8	Missense_Mutation	SNP	ENST00000269856.3	37	CCDS12135.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.317499	0.60524	.	.	ENSG00000141965	ENST00000269856	T	0.63580	-0.05	4.73	4.73	0.59995	.	0.000000	0.64402	U	0.000001	D	0.84192	0.5418	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87291	0.2299	10	0.42905	T	0.14	-4.998	17.7154	0.88335	0.0:1.0:0.0:0.0	.	329	Q9BSK4	FEM1A_HUMAN	C	329	ENSP00000269856:R329C	ENSP00000269856:R329C	R	+	1	0	FEM1A	4743851	1.000000	0.71417	0.977000	0.42913	0.979000	0.70002	2.861000	0.48380	2.178000	0.69098	0.491000	0.48974	CGT		0.607	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459000.1			22	35	22	35
KXD1	79036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	18679431	18679431	+	Missense_Mutation	SNP	C	C	T	rs200331878		TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr19:18679431C>T	ENST00000602094.1	+	5	1981	c.521C>T	c.(520-522)aCg>aTg	p.T174M	AC005253.4_ENST00000593791.1_RNA|KXD1_ENST00000595073.1_Missense_Mutation_p.T174M|KXD1_ENST00000601630.1_Missense_Mutation_p.T193M|KXD1_ENST00000599319.1_Missense_Mutation_p.T174M|KXD1_ENST00000540691.1_Missense_Mutation_p.T174M|KXD1_ENST00000539106.1_Missense_Mutation_p.T174M|KXD1_ENST00000222307.4_Missense_Mutation_p.T174M			Q9BQD3	KXDL1_HUMAN	KxDL motif containing 1	174					vesicle-mediated transport (GO:0016192)	BLOC-1 complex (GO:0031083)											GAGGAGATGACGGGCGAATAG	0.652																																																0								C	MET/THR,MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	48.0	47.0	47.0		521,521,521	-6.2	0.0	19		47	0,8600		0,0,4300	no	missense,missense,missense	C19orf50	NM_001171948.1,NM_001171949.1,NM_024069.3	81,81,81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign	174/177,174/177,174/177	18679431	1,13005	2203	4300	6503	SO:0001583	missense	79036			AK098346	CCDS12381.1	19p13.11	2011-11-24	2011-11-24	2011-11-24	ENSG00000105700	ENSG00000105700			28420	protein-coding gene	gene with protein product		615178	"""chromosome 19 open reading frame 50"""	C19orf50		21159114	Standard	NM_001171948		Approved	FLJ25480, MGC2749, KXDL	uc002njo.3	Q9BQD3		ENST00000602094.1:c.521C>T	19.37:g.18679431C>T	ENSP00000472836:p.Thr174Met	Somatic		WXS	Illumina GAIIx	Phase_I	O76098	Missense_Mutation	SNP	ENST00000602094.1	37	CCDS12381.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.577317	0.28092	2.27E-4	0.0	ENSG00000105700	ENST00000540691;ENST00000539106;ENST00000222307	T;T;T	0.45276	0.9;0.9;0.9	4.55	-6.18	0.02085	.	1.484110	0.03926	N	0.284414	T	0.17704	0.0425	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.14671	-1.0464	10	0.54805	T	0.06	-5.6078	0.3732	0.00383	0.2229:0.2828:0.1753:0.319	.	174	Q9BQD3	CS050_HUMAN	M	174	ENSP00000443549:T174M;ENSP00000438903:T174M;ENSP00000222307:T174M	ENSP00000222307:T174M	T	+	2	0	C19orf50	18540431	0.000000	0.05858	0.001000	0.08648	0.038000	0.13279	-1.073000	0.03430	-0.500000	0.06614	-0.350000	0.07774	ACG		0.652	KXD1-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465107.1	NM_024069		16	36	16	36
ERICH3	127254	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	75038852	75038852	+	Missense_Mutation	SNP	C	C	A			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr1:75038852C>A	ENST00000326665.5	-	14	2760	c.2542G>T	c.(2542-2544)Gtc>Ttc	p.V848F	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		848	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						AGCCTTCTGACCCCTTCTGCT	0.532																																																0													119.0	113.0	115.0					1																	75038852		2203	4300	6503	SO:0001583	missense	0																														ENST00000326665.5:c.2542G>T	1.37:g.75038852C>A	ENSP00000322609:p.Val848Phe	Somatic		WXS	Illumina GAIIx	Phase_I	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	C	11.16	1.555525	0.27739	.	.	ENSG00000178965	ENST00000326665	T	0.12672	2.66	5.37	2.4	0.29515	.	.	.	.	.	T	0.02610	0.0079	N	0.08118	0	0.09310	N	0.999999	B	0.23490	0.086	B	0.28139	0.086	T	0.45011	-0.9290	9	0.56958	D	0.05	.	9.5745	0.39450	0.0:0.7562:0.0:0.2438	.	848	Q5RHP9	CA173_HUMAN	F	848	ENSP00000322609:V848F	ENSP00000322609:V848F	V	-	1	0	C1orf173	74811440	0.000000	0.05858	0.004000	0.12327	0.114000	0.19823	0.058000	0.14301	0.617000	0.30160	0.563000	0.77884	GTC		0.532	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			27	28	27	28
NUP210L	91181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	154062058	154062058	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr1:154062058G>A	ENST00000368559.3	-	16	2271	c.2200C>T	c.(2200-2202)Cga>Tga	p.R734*	NUP210L_ENST00000271854.3_Nonsense_Mutation_p.R734*	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	734					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TTTCCAATTCGGAATGTGAGA	0.423																																																0													74.0	75.0	75.0					1																	154062058		1891	4124	6015	SO:0001587	stop_gained	91181			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2200C>T	1.37:g.154062058G>A	ENSP00000357547:p.Arg734*	Somatic		WXS	Illumina GAIIx	Phase_I	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Nonsense_Mutation	SNP	ENST00000368559.3	37	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	G	39	7.522494	0.98335	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	.	.	.	4.57	4.57	0.56435	.	0.150747	0.30752	N	0.008943	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	-27.8864	15.3044	0.73982	0.0:0.0:1.0:0.0	.	.	.	.	X	734	.	ENSP00000271854:R734X	R	-	1	2	NUP210L	152328682	0.996000	0.38824	0.954000	0.39281	0.941000	0.58515	4.027000	0.57239	2.363000	0.80096	0.467000	0.42956	CGA		0.423	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308		32	68	32	68
ELFN2	114794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	22	37770047	37770047	+	Missense_Mutation	SNP	C	C	T	rs143903281	byFrequency	TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr22:37770047C>T	ENST00000402918.2	-	3	2313	c.1528G>A	c.(1528-1530)Ggc>Agc	p.G510S	RP1-63G5.5_ENST00000430883.1_RNA|ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.8_ENST00000609322.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	510					negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					CCGTCCCCGCCGGCGCCTGTG	0.662																																																0								C	SER/GLY	0,4406		0,0,2203	50.0	52.0	51.0		1528	3.8	0.0	22	dbSNP_134	51	3,8593	3.0+/-9.4	0,3,4295	yes	missense	ELFN2	NM_052906.3	56	0,3,6498	TT,TC,CC		0.0349,0.0,0.0231	benign	510/821	37770047	3,12999	2203	4298	6501	SO:0001583	missense	114794			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.1528G>A	22.37:g.37770047C>T	ENSP00000385277:p.Gly510Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q96PY3	Missense_Mutation	SNP	ENST00000402918.2	37	CCDS33642.1	.	.	.	.	.	.	.	.	.	.	C	4.770	0.143134	0.09083	0.0	3.49E-4	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.29142	1.58;1.58	4.79	3.76	0.43208	.	0.305004	0.35739	N	0.003004	T	0.22322	0.0538	L	0.45581	1.43	0.21499	N	0.999662	B	0.32620	0.378	B	0.18561	0.022	T	0.12142	-1.0559	10	0.38643	T	0.18	-3.2369	9.6962	0.40158	0.0:0.8382:0.0:0.1618	.	510	Q5R3F8	PPR29_HUMAN	S	510	ENSP00000300147:G510S;ENSP00000385277:G510S	ENSP00000300147:G510S	G	-	1	0	ELFN2	36099993	0.990000	0.36364	0.032000	0.17829	0.136000	0.21042	4.836000	0.62789	0.984000	0.38629	0.511000	0.50034	GGC		0.662	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318900.2	NM_052906		35	56	35	56
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	179435704	179435704	+	Missense_Mutation	SNP	C	C	T	rs542720402		TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr2:179435704C>T	ENST00000591111.1	-	276	70456	c.70232G>A	c.(70231-70233)cGt>cAt	p.R23411H	TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R16179H|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R22484H|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R16112H|TTN_ENST00000460472.2_Missense_Mutation_p.R15987H|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R25052H|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23411	Fibronectin type-III 70. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCATCCAACGGCCCTCAGG	0.408													C|||	1	0.000199681	0.0	0.0	5008	,	,		21633	0.001		0.0	False		,,,				2504	0.0															0													170.0	172.0	172.0					2																	179435704		1863	4094	5957	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.70232G>A	2.37:g.179435704C>T	ENSP00000465570:p.Arg23411His	Somatic		WXS	Illumina GAIIx	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	15.29	2.789247	0.49997	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.52	5.52	0.82312	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71467	0.3343	M	0.63208	1.945	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.69824	0.966;0.966;0.966;0.95	T	0.72947	-0.4137	9	0.87932	D	0	.	19.799	0.96497	0.0:1.0:0.0:0.0	.	15987;16112;16179;23411	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	22484;15987;16179;16112;15985	ENSP00000343764:R22484H;ENSP00000434586:R15987H;ENSP00000340554:R16179H;ENSP00000352154:R16112H	ENSP00000340554:R16179H	R	-	2	0	TTN	179143950	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	7.776000	0.85560	2.746000	0.94184	0.650000	0.86243	CGT		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		102	157	102	157
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	C	T	rs121913500		TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr2:209113112C>T	ENST00000415913.1	-	4	776	c.395G>A	c.(394-396)cGt>cAt	p.R132H	IDH1_ENST00000345146.2_Missense_Mutation_p.R132H|IDH1_ENST00000446179.1_Missense_Mutation_p.R132H	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132H(2774)|p.R132L(59)|p.R132V(1)|p.G131_R132>VL(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	2835	Substitution - Missense(2834)|Complex - compound substitution(1)	central_nervous_system(2579)|haematopoietic_and_lymphoid_tissue(205)|bone(43)|prostate(4)|biliary_tract(2)|urinary_tract(1)|skin(1)											79.0	73.0	75.0					2																	209113112		2203	4300	6503	SO:0001583	missense	3417				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.395G>A	2.37:g.209113112C>T	ENSP00000390265:p.Arg132His	Somatic		WXS	Illumina GAIIx	Phase_I	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657324	0.88154	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	4.69	0.59074	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	H	0.99379	4.54	0.80722	D	1	B	0.25486	0.127	B	0.25405	0.06	D	0.92324	0.5868	10	0.87932	D	0	-20.0399	14.3783	0.66895	0.0:0.9288:0.0:0.0712	.	132	O75874	IDHC_HUMAN	H	132	ENSP00000260985:R132H;ENSP00000410513:R132H;ENSP00000390265:R132H;ENSP00000391075:R132H	ENSP00000260985:R132H	R	-	2	0	IDH1	208821357	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.088000	0.71371	1.356000	0.45884	0.555000	0.69702	CGT		0.393	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			39	74	39	74
SETD2	29072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	47155394	47155394	+	Missense_Mutation	SNP	C	C	G			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr3:47155394C>G	ENST00000409792.3	-	5	4729	c.4687G>C	c.(4687-4689)Ggc>Cgc	p.G1563R		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1563	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GCTCTCAAGCCCCAGCCTTTC	0.428			"""N, F, S, Mis"""		clear cell renal carcinoma																																		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													130.0	132.0	132.0					3																	47155394		2203	4300	6503	SO:0001583	missense	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4687G>C	3.37:g.47155394C>G	ENSP00000386759:p.Gly1563Arg	Somatic		WXS	Illumina GAIIx	Phase_I	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	26.1	4.709249	0.89018	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.91894	-2.93	5.06	5.06	0.68205	SET domain (3);	0.000000	0.56097	D	0.000028	D	0.98194	0.9403	H	0.99732	4.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.968;0.992	D	0.99833	1.1055	10	0.87932	D	0	.	18.776	0.91911	0.0:1.0:0.0:0.0	.	1563;1563	F2Z317;Q9BYW2	.;SETD2_HUMAN	R	1563	ENSP00000386759:G1563R	ENSP00000386759:G1563R	G	-	1	0	SETD2	47130398	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.424000	0.80242	2.518000	0.84900	0.585000	0.79938	GGC		0.428	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159		25	54	25	54
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	178928079	178928079	+	Missense_Mutation	SNP	G	G	A			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr3:178928079G>A	ENST00000263967.3	+	8	1514	c.1357G>A	c.(1357-1359)Gaa>Aaa	p.E453K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	453	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.		E -> Q (in CRC; likely involved in disease pathogenesis; shows an increase in lipid kinase activity; may disrupt the interaction of the C2 PI3K-type domain with the iSH2 region of the p85 regulatory subunit).|Missing (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E453K(11)|p.E453Q(5)|p.H450fs*9(1)|p.G451_L456>V(1)|p.P449_L455del(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCATGGATTAGAAGATTTGCT	0.348		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	19	Substitution - Missense(16)|Complex - frameshift(1)|Complex - deletion inframe(1)|Deletion - In frame(1)	endometrium(8)|breast(6)|lung(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)											137.0	130.0	132.0					3																	178928079		1829	4090	5919	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1357G>A	3.37:g.178928079G>A	ENSP00000263967:p.Glu453Lys	Somatic		WXS	Illumina GAIIx	Phase_I	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	32	5.164616	0.94727	.	.	ENSG00000121879	ENST00000263967	T	0.71103	-0.54	5.64	5.64	0.86602	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.77130	0.4085	M	0.68317	2.08	0.80722	D	1	P	0.50528	0.936	P	0.50970	0.655	T	0.72500	-0.4274	10	0.20046	T	0.44	-22.2286	19.6973	0.96031	0.0:0.0:1.0:0.0	.	453	P42336	PK3CA_HUMAN	K	453	ENSP00000263967:E453K	ENSP00000263967:E453K	E	+	1	0	PIK3CA	180410773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.448000	0.97600	2.674000	0.91012	0.655000	0.94253	GAA		0.348	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			44	68	44	68
IGJ	3512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	71527853	71527853	+	Silent	SNP	G	G	A			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr4:71527853G>A	ENST00000254801.4	-	2	313	c.144C>T	c.(142-144)tcC>tcT	p.S48S	IGJ_ENST00000543780.1_Silent_p.S64S|ENAM_ENST00000472903.1_3'UTR	NM_144646.3	NP_653247.1	P01591	IGJ_HUMAN	immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides	48					adaptive immune response (GO:0002250)|antibacterial humoral response (GO:0019731)|glomerular filtration (GO:0003094)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of respiratory burst (GO:0060267)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|dimeric IgA immunoglobulin complex (GO:0071750)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|monomeric IgA immunoglobulin complex (GO:0071748)|pentameric IgM immunoglobulin complex (GO:0071756)|secretory dimeric IgA immunoglobulin complex (GO:0071752)|secretory IgA immunoglobulin complex (GO:0071751)	antigen binding (GO:0003823)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7			Lung(101;0.235)			TAGGATCTTCGGAAGAACGGA	0.393																																																0													138.0	132.0	134.0					4																	71527853		2203	4300	6503	SO:0001819	synonymous_variant	3512			M12759	CCDS3545.1	4q21	2012-10-02			ENSG00000132465	ENSG00000132465		"""Immunoglobulins / IGJ linker"""	5713	protein-coding gene	gene with protein product	"""immunoglobulin J chain"", ""IgJ chain"""	147790				3016707, 2984306	Standard	NM_144646		Approved	IGCJ, JCH	uc003hfn.4	P01591	OTTHUMG00000129909	ENST00000254801.4:c.144C>T	4.37:g.71527853G>A		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000254801.4	37	CCDS3545.1																																																																																				0.393	IGJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252160.1	NM_144646		49	93	49	93
SOWAHB	345079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	77818021	77818021	+	Missense_Mutation	SNP	A	A	C			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr4:77818021A>C	ENST00000334306.2	-	1	981	c.982T>G	c.(982-984)Tgg>Ggg	p.W328G		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	328																	AGCACCGACCAGGCGCGGATA	0.652																																																0													31.0	39.0	37.0					4																	77818021		2203	4299	6502	SO:0001583	missense	345079				CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.982T>G	4.37:g.77818021A>C	ENSP00000334879:p.Trp328Gly	Somatic		WXS	Illumina GAIIx	Phase_I	B2RP29	Missense_Mutation	SNP	ENST00000334306.2	37	CCDS34017.1	.	.	.	.	.	.	.	.	.	.	A	16.12	3.032595	0.54790	.	.	ENSG00000186212	ENST00000334306	T	0.07021	3.23	4.34	4.34	0.51931	.	.	.	.	.	T	0.13329	0.0323	L	0.29908	0.895	0.33418	D	0.579551	D	0.76494	0.999	D	0.66084	0.941	T	0.01684	-1.1296	9	0.07030	T	0.85	-9.8484	12.6495	0.56753	1.0:0.0:0.0:0.0	.	328	A6NEL2	ANR56_HUMAN	G	328	ENSP00000334879:W328G	ENSP00000334879:W328G	W	-	1	0	ANKRD56	78037045	0.937000	0.31787	0.998000	0.56505	0.822000	0.46500	1.989000	0.40707	1.815000	0.52974	0.459000	0.35465	TGG		0.652	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870		17	32	17	32
PDGFC	56034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	157689077	157689077	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr4:157689077C>T	ENST00000502773.1	-	5	1259	c.769G>A	c.(769-771)Gtg>Atg	p.V257M	PDGFC_ENST00000422544.2_Intron|PDGFC_ENST00000542208.1_Missense_Mutation_p.V102M|PDGFC_ENST00000541126.1_Missense_Mutation_p.V94M|PDGFC_ENST00000504672.1_Intron	NM_016205.2	NP_057289.1	Q9NRA1	PDGFC_HUMAN	platelet derived growth factor C	257					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cellular response to amino acid stimulus (GO:0071230)|central nervous system development (GO:0007417)|organ morphogenesis (GO:0009887)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		CTTATGGACACTGAGAAGTTA	0.428																																																0													189.0	174.0	179.0					4																	157689077		2203	4300	6503	SO:0001583	missense	56034			AF091434	CCDS3795.1	4q32	2008-02-05			ENSG00000145431	ENSG00000145431			8801	protein-coding gene	gene with protein product		608452				10858496, 10858548	Standard	NM_016205		Approved	SCDGF, fallotein	uc003iph.2	Q9NRA1	OTTHUMG00000161803	ENST00000502773.1:c.769G>A	4.37:g.157689077C>T	ENSP00000422464:p.Val257Met	Somatic		WXS	Illumina GAIIx	Phase_I	B4DU34|B9EGR8|Q4W5M9|Q9UL22	Missense_Mutation	SNP	ENST00000502773.1	37	CCDS3795.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.944361	0.92593	.	.	ENSG00000145431	ENST00000502773;ENST00000541126;ENST00000542208	T;T;T	0.63096	1.35;0.02;-0.02	5.35	5.35	0.76521	Platelet-derived growth factor (PDGF) (3);	0.000000	0.85682	D	0.000000	T	0.80768	0.4686	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.91635	0.999;0.947	T	0.83041	-0.0157	10	0.87932	D	0	-9.9365	19.0757	0.93161	0.0:1.0:0.0:0.0	.	102;257	B4E3A5;Q9NRA1	.;PDGFC_HUMAN	M	257;94;102	ENSP00000422464:V257M;ENSP00000442943:V94M;ENSP00000439728:V102M	ENSP00000422464:V257M	V	-	1	0	PDGFC	157908527	1.000000	0.71417	0.967000	0.41034	0.979000	0.70002	7.772000	0.85439	2.505000	0.84491	0.655000	0.94253	GTG		0.428	PDGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366123.1			17	203	17	203
ARSK	153642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	94918892	94918892	+	Missense_Mutation	SNP	G	G	T			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr5:94918892G>T	ENST00000380009.4	+	4	894	c.689G>T	c.(688-690)tGg>tTg	p.W230L		NM_198150.2	NP_937793.1	Q6UWY0	ARSK_HUMAN	arylsulfatase family, member K	230					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(1)	16		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		TCTCTTTATTGGCTTGAAAAA	0.313																																																0													56.0	57.0	57.0					5																	94918892		2203	4298	6501	SO:0001583	missense	153642				CCDS4073.1	5q15	2013-02-14	2006-03-07		ENSG00000164291	ENSG00000164291		"""Arylsulfatase family"""	25239	protein-coding gene	gene with protein product		610011	"""arylsulfatase K"""			12975309, 16174644	Standard	NM_198150		Approved	DKFZp313G1735, TSULF	uc003kld.3	Q6UWY0	OTTHUMG00000121166	ENST00000380009.4:c.689G>T	5.37:g.94918892G>T	ENSP00000369346:p.Trp230Leu	Somatic		WXS	Illumina GAIIx	Phase_I	A2BDE3|B4E1I4|Q3ZCW3|Q8N3Q8	Missense_Mutation	SNP	ENST00000380009.4	37	CCDS4073.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.320971	0.81580	.	.	ENSG00000164291	ENST00000380009	D	0.99885	-7.51	5.81	5.81	0.92471	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.99880	0.9943	M	0.89968	3.075	0.80722	D	1	D	0.59357	0.985	D	0.63793	0.918	D	0.99979	1.2425	10	0.10636	T	0.68	-6.8963	20.0795	0.97766	0.0:0.0:1.0:0.0	.	230	Q6UWY0	ARSK_HUMAN	L	230	ENSP00000369346:W230L	ENSP00000369346:W230L	W	+	2	0	ARSK	94944648	1.000000	0.71417	1.000000	0.80357	0.699000	0.40488	8.960000	0.93117	2.747000	0.94245	0.650000	0.86243	TGG		0.313	ARSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241652.2	NM_198150		14	38	14	38
TENM2	57451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	167674704	167674704	+	Missense_Mutation	SNP	A	A	G			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr5:167674704A>G	ENST00000518659.1	+	27	6799	c.6760A>G	c.(6760-6762)Ata>Gta	p.I2254V	TENM2_ENST00000519204.1_Missense_Mutation_p.I2133V|TENM2_ENST00000520394.1_Missense_Mutation_p.I2015V|TENM2_ENST00000545108.1_Missense_Mutation_p.I2253V|TENM2_ENST00000403607.2_Missense_Mutation_p.I2078V	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2254					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CCGGGATCGGATAACCAGACT	0.527																																																0													54.0	55.0	55.0					5																	167674704		2135	4243	6378	SO:0001583	missense	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.6760A>G	5.37:g.167674704A>G	ENSP00000429430:p.Ile2254Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	A	14.83	2.651041	0.47362	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.90197	-2.16;-2.15;-2.26;-2.59;-2.63	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.93387	0.7891	L	0.50333	1.59	0.48696	D	0.999698	D;D;P	0.71674	0.998;0.996;0.826	D;D;P	0.85130	0.997;0.992;0.811	D	0.92217	0.5781	10	0.30854	T	0.27	.	15.7601	0.78073	1.0:0.0:0.0:0.0	.	2253;2254;2015	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	V	2254;2253;2133;2015;2078	ENSP00000429430:I2254V;ENSP00000438635:I2253V;ENSP00000428964:I2133V;ENSP00000427874:I2015V;ENSP00000384905:I2078V	ENSP00000384905:I2078V	I	+	1	0	ODZ2	167607282	1.000000	0.71417	0.989000	0.46669	0.971000	0.66376	5.411000	0.66386	2.130000	0.65690	0.459000	0.35465	ATA		0.527	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		30	61	30	61
HIST1H4B	8366	hgsc.bcm.edu;broad.mit.edu	37	6	26027273	26027273	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr6:26027273C>T	ENST00000377364.3	-	1	207	c.208G>A	c.(208-210)Gcc>Acc	p.A70T		NM_003544.2	NP_003535.1	P62805	H4_HUMAN	histone cluster 1, H4b	70					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.A70S(1)		large_intestine(4)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	13						TAGGTCACGGCGTCCCGGATC	0.577											OREG0017238	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	lung(1)											107.0	90.0	96.0					6																	26027273		2203	4300	6503	SO:0001583	missense	8366			X67081	CCDS4572.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124529	ENSG00000278705		"""Histones / Replication-dependent"""	4789	protein-coding gene	gene with protein product		602829	"""H4 histone family, member I"", ""histone 1, H4b"""	H4FI		9119399, 12408966	Standard	NM_003544		Approved	H4/I	uc003nfr.3	P62805	OTTHUMG00000014417	ENST00000377364.3:c.208G>A	6.37:g.26027273C>T	ENSP00000366581:p.Ala70Thr	Somatic	783	WXS	Illumina GAIIx	Phase_I	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377364.3	37	CCDS4572.1	.	.	.	.	.	.	.	.	.	.	c	19.89	3.911744	0.72983	.	.	ENSG00000124529	ENST00000377364	T	0.80994	-1.44	4.65	4.65	0.58169	.	0.000000	0.52532	U	0.000066	D	0.85617	0.5738	.	.	.	0.48288	D	0.999623	.	.	.	.	.	.	D	0.86572	0.1848	7	0.56958	D	0.05	.	17.4106	0.87484	0.0:1.0:0.0:0.0	.	.	.	.	T	70	ENSP00000366581:A70T	ENSP00000366581:A70T	A	-	1	0	HIST1H4B	26135252	1.000000	0.71417	0.998000	0.56505	0.041000	0.13682	7.393000	0.79851	2.506000	0.84524	0.563000	0.77884	GCC		0.577	HIST1H4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040079.2	NM_003544		4	64	4	64
SCUBE3	222663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	35208200	35208200	+	Missense_Mutation	SNP	C	C	G			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr6:35208200C>G	ENST00000274938.7	+	9	1002	c.1002C>G	c.(1000-1002)aaC>aaG	p.N334K	SCUBE3_ENST00000394681.1_Missense_Mutation_p.N350K	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						TATGTGTCAACACACCAGGAA	0.507																																																0													199.0	156.0	171.0					6																	35208200		2203	4300	6503	SO:0001583	missense	222663			AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.1002C>G	6.37:g.35208200C>G	ENSP00000274938:p.Asn334Lys	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000274938.7	37	CCDS4800.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.510541	0.64522	.	.	ENSG00000146197	ENST00000394681;ENST00000274938	D;D	0.98792	-5.14;-5.14	5.73	3.97	0.46021	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.087548	0.85682	D	0.000000	D	0.99402	0.9789	H	0.98542	4.26	0.58432	D	0.999999	B;D	0.71674	0.204;0.998	B;D	0.77557	0.237;0.99	D	0.98609	1.0662	10	0.87932	D	0	.	12.0378	0.53435	0.0:0.8622:0.0:0.1378	.	350;334	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	K	350;334	ENSP00000378174:N350K;ENSP00000274938:N334K	ENSP00000274938:N334K	N	+	3	2	SCUBE3	35316178	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	2.180000	0.42537	0.796000	0.33947	0.555000	0.69702	AAC		0.507	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753		8	85	8	85
LRFN2	57497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	40400680	40400680	+	Missense_Mutation	SNP	C	C	T			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr6:40400680C>T	ENST00000338305.6	-	2	715	c.173G>A	c.(172-174)cGc>cAc	p.R58H		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	58						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GCCGCCCAGGCGCAGCTCCAC	0.602																																																0													50.0	52.0	52.0					6																	40400680		2203	4300	6503	SO:0001583	missense	57497			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.173G>A	6.37:g.40400680C>T	ENSP00000345985:p.Arg58His	Somatic		WXS	Illumina GAIIx	Phase_I	A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.634016	0.87660	.	.	ENSG00000156564	ENST00000338305	T	0.57273	0.41	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.52837	0.1759	N	0.20685	0.6	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.56595	-0.7953	10	0.49607	T	0.09	.	18.5214	0.90954	0.0:1.0:0.0:0.0	.	58	Q9ULH4	LRFN2_HUMAN	H	58	ENSP00000345985:R58H	ENSP00000345985:R58H	R	-	2	0	LRFN2	40508658	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.736000	0.93811	0.655000	0.94253	CGC		0.602	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372		42	50	42	50
MEP1A	4224	hgsc.bcm.edu;broad.mit.edu	37	6	46801256	46801256	+	Silent	SNP	G	G	A			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr6:46801256G>A	ENST00000230588.4	+	11	1599	c.1590G>A	c.(1588-1590)tcG>tcA	p.S530S		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	530	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S530S(1)		NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			TCACTACCTCGAAGTCGCACA	0.517																																																1	Substitution - coding silent(1)	endometrium(1)											84.0	86.0	86.0					6																	46801256		2203	4300	6503	SO:0001819	synonymous_variant	4224				CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.1590G>A	6.37:g.46801256G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Silent	SNP	ENST00000230588.4	37	CCDS4918.1																																																																																				0.517	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040803.1	NM_005588		17	174	17	174
FANCC	2176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	98009714	98009714	+	Splice_Site	SNP	C	C	T			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr9:98009714C>T	ENST00000289081.3	-	3	504	c.250G>A	c.(250-252)Gat>Aat	p.D84N	FANCC_ENST00000375305.1_Splice_Site_p.D84N	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	84					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				TGATTCTTACCATATGCTAAA	0.323			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	0													116.0	126.0	123.0					9																	98009714		2203	4299	6502	SO:0001630	splice_region_variant	2176	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.250+1G>A	9.37:g.98009714C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B1ALR8	Splice_Site	SNP	ENST00000289081.3	37	CCDS35071.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.381103	0.61845	.	.	ENSG00000158169	ENST00000289081;ENST00000375305;ENST00000433829	T;T;T	0.56776	0.44;0.44;0.44	5.49	5.49	0.81192	.	0.268916	0.40385	N	0.001105	T	0.67970	0.2950	L	0.59436	1.845	0.44289	D	0.997157	D;D	0.63880	0.993;0.993	D;D	0.65323	0.934;0.934	T	0.64659	-0.6355	9	.	.	.	-18.1462	17.7853	0.88535	0.0:1.0:0.0:0.0	.	84;84	B1ALR7;Q00597	.;FANCC_HUMAN	N	84	ENSP00000289081:D84N;ENSP00000364454:D84N;ENSP00000406908:D84N	.	D	-	1	0	FANCC	97049535	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	5.259000	0.65485	2.873000	0.98535	0.644000	0.83932	GAT		0.323	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053219.1	NM_000136	Missense_Mutation	24	81	24	81
NIPSNAP3B	55335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	107531159	107531159	+	Missense_Mutation	SNP	G	G	A	rs141198887	byFrequency	TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr9:107531159G>A	ENST00000374762.3	+	3	358	c.287G>A	c.(286-288)cGa>cAa	p.R96Q	NIPSNAP3B_ENST00000461177.1_3'UTR	NM_018376.2	NP_060846.2	Q9BS92	NPS3B_HUMAN	nipsnap homolog 3B (C. elegans)	96										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	11						TTTGCTCATCGAGCTGAAGTT	0.343																																																0								G	GLN/ARG	0,4406		0,0,2203	71.0	68.0	69.0		287	3.8	0.7	9	dbSNP_134	69	4,8596	3.7+/-12.6	0,4,4296	yes	missense	NIPSNAP3B	NM_018376.2	43	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	probably-damaging	96/248	107531159	4,13002	2203	4300	6503	SO:0001583	missense	55335			BC017914	CCDS6761.1	9q31.3	2003-11-27			ENSG00000165028	ENSG00000165028			23641	protein-coding gene	gene with protein product		608872				12477932	Standard	NM_018376		Approved	FLJ11275	uc004bci.3	Q9BS92	OTTHUMG00000020414	ENST00000374762.3:c.287G>A	9.37:g.107531159G>A	ENSP00000363894:p.Arg96Gln	Somatic		WXS	Illumina GAIIx	Phase_I	Q5VX30|Q9NUM2	Missense_Mutation	SNP	ENST00000374762.3	37	CCDS6761.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.977024	0.74360	0.0	4.65E-4	ENSG00000165028	ENST00000374762	T	0.61510	0.1	3.77	3.77	0.43336	Dimeric alpha-beta barrel (1);	0.000000	0.64402	U	0.000001	T	0.77651	0.4162	M	0.88979	2.995	0.44323	D	0.997208	D	0.89917	1.0	D	0.85130	0.997	T	0.80502	-0.1354	10	0.45353	T	0.12	-7.6378	12.9916	0.58622	0.0:0.0:1.0:0.0	.	96	Q9BS92	NPS3B_HUMAN	Q	96	ENSP00000363894:R96Q	ENSP00000363894:R96Q	R	+	2	0	NIPSNAP3B	106570980	0.997000	0.39634	0.659000	0.29680	0.913000	0.54294	2.191000	0.42640	2.088000	0.63022	0.650000	0.86243	CGA		0.343	NIPSNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053486.1	NM_018376		8	37	8	37
CYP4Z2P	163720	broad.mit.edu;ucsc.edu	37	1	47333730	47333730	+	RNA	SNP	G	G	A			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr1:47333730G>A	ENST00000505841.1	-	0	958					NR_002788.2		Q8N1L4	CP4Z2_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 2, pseudogene							integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)										AGCAGTAGTTGTGGTGTCATG	0.438																																																0																																												0			AY262057		1p33	2013-07-25	2013-05-03		ENSG00000154198	ENSG00000154198		"""Cytochrome P450s"""	24426	pseudogene	pseudogene						15059886	Standard	NR_002788		Approved	FLJ40054	uc031pmm.1	Q8N1L4	OTTHUMG00000008024		1.37:g.47333730G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q66ZJ5	RNA	SNP	ENST00000505841.1	37																																																																																					0.438	CYP4Z2P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000361094.1	NR_002788		18	15	18	15
PTCD1	26024	broad.mit.edu;ucsc.edu	37	7	99022522	99022522	+	Missense_Mutation	SNP	C	C	A			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr7:99022522C>A	ENST00000292478.4	-	6	1883	c.1633G>T	c.(1633-1635)Gtc>Ttc	p.V545F	PTCD1_ENST00000555673.1_Missense_Mutation_p.V594F|ATP5J2-PTCD1_ENST00000413834.1_Missense_Mutation_p.V594F	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	545					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TTTGCCAGGACCGGCAACAGC	0.597																																																0													72.0	69.0	70.0					7																	99022522		2203	4300	6503	SO:0001583	missense	26024			AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1633G>T	7.37:g.99022522C>A	ENSP00000292478:p.Val545Phe	Somatic		WXS	Illumina GAIIx	Phase_I	Q3ZB78|Q66K60|Q9UDV2	Missense_Mutation	SNP	ENST00000292478.4	37	CCDS34691.1	.	.	.	.	.	.	.	.	.	.	C	11.17	1.561180	0.27915	.	.	ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000248919	ENST00000292478;ENST00000438524;ENST00000555673;ENST00000413834	T;T;T	0.64085	-0.08;-0.07;-0.07	5.91	2.08	0.27032	.	0.368494	0.30464	N	0.009579	T	0.54791	0.1880	L	0.59436	1.845	0.24457	N	0.994455	P;P	0.49090	0.919;0.893	B;B	0.43575	0.424;0.165	T	0.51371	-0.8714	10	0.56958	D	0.05	-16.8561	6.4201	0.21738	0.0:0.5286:0.1392:0.3322	.	594;545	G3V325;O75127	.;PTCD1_HUMAN	F	545;327;594;594	ENSP00000292478:V545F;ENSP00000450995:V594F;ENSP00000400168:V594F	ENSP00000400168:V594F	V	-	1	0	ATP5J2-PTCD1;PTCD1	98860458	0.555000	0.26530	0.998000	0.56505	0.068000	0.16541	0.912000	0.28597	0.574000	0.29417	0.462000	0.41574	GTC		0.597	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545		27	34	27	34
FUBP1	8880	broad.mit.edu;hgsc.bcm.edu	37	1	78430888	78430888	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DU-8164-01A-11D-2253-08	TCGA-DU-8164-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	67139b71-a2d8-4a49-a684-51a4804e294a	79381346-232e-46b8-a3fa-c93df24692ca	g.chr1:78430888delA	ENST00000370768.2	-	8	582	c.501delT	c.(499-501)attfs	p.I167fs	FUBP1_ENST00000370767.1_Frame_Shift_Del_p.I167fs|FUBP1_ENST00000436586.2_Frame_Shift_Del_p.I188fs	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	167					positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						CTTTTTCAACAATCTGGTCCA	0.393			"""F, N"""		oligodendroglioma																																		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	0													113.0	109.0	110.0					1																	78430888		2203	4300	6503	SO:0001589	frameshift_variant	8880			U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.501delT	1.37:g.78430888delA	ENSP00000359804:p.Ile167fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q12828	Frame_Shift_Del	DEL	ENST00000370768.2	37	CCDS683.1																																																																																				0.393	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902		53	7	53	7
