#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
PRF1	5551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	72358728	72358728	+	Missense_Mutation	SNP	G	G	A			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr10:72358728G>A	ENST00000441259.1	-	3	909	c.749C>T	c.(748-750)aCg>aTg	p.T250M	PRF1_ENST00000373209.2_Missense_Mutation_p.T250M	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	250	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						CTCGTTGTCCGTGAGCCCTTC	0.637			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																													yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	0													113.0	82.0	93.0					10																	72358728		2203	4300	6503	SO:0001583	missense	5551	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.749C>T	10.37:g.72358728G>A	ENSP00000398568:p.Thr250Met	Somatic		WXS	Illumina GAIIx	Phase_I	B2R6X4|Q59F57|Q86WX7	Missense_Mutation	SNP	ENST00000441259.1	37	CCDS7305.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.140163	0.37825	.	.	ENSG00000180644	ENST00000373209;ENST00000441259;ENST00000318971	D;D	0.85013	-1.93;-1.93	5.83	4.85	0.62838	Membrane attack complex component/perforin (MACPF) domain (3);	0.430669	0.25060	N	0.033458	D	0.92163	0.7515	M	0.83012	2.62	0.26575	N	0.973497	D	0.89917	1.0	D	0.68765	0.96	D	0.86411	0.1748	10	0.87932	D	0	-15.497	15.2421	0.73480	0.0:0.0:0.85:0.15	.	250	P14222	PERF_HUMAN	M	250	ENSP00000362305:T250M;ENSP00000398568:T250M	ENSP00000316746:T250M	T	-	2	0	PRF1	72028734	0.980000	0.34600	0.964000	0.40570	0.160000	0.22226	1.819000	0.39022	2.741000	0.93983	0.655000	0.94253	ACG		0.637	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2	NM_005041		35	36	35	36
BTRC	8945	hgsc.bcm.edu;broad.mit.edu	37	10	103281443	103281443	+	Silent	SNP	G	G	A			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr10:103281443G>A	ENST00000370187.3	+	5	490	c.372G>A	c.(370-372)cgG>cgA	p.R124R	BTRC_ENST00000393441.4_Silent_p.R83R|BTRC_ENST00000408038.2_Silent_p.R88R	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	124					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		CCAAGCAACGGAAACTCTCAG	0.388																																																0													100.0	92.0	95.0					10																	103281443		2203	4300	6503	SO:0001819	synonymous_variant	8945			Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.372G>A	10.37:g.103281443G>A		Somatic		WXS	Illumina GAIIx	Phase_I	B5MD49|Q5W141|Q5W142|Q9Y213	Silent	SNP	ENST00000370187.3	37	CCDS7512.1																																																																																				0.388	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637		5	70	5	70
MS4A8	83661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	60476228	60476228	+	Missense_Mutation	SNP	G	G	A	rs201478139		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr11:60476228G>A	ENST00000300226.2	+	5	711	c.508G>A	c.(508-510)Gac>Aac	p.D170N		NM_031457.1	NP_113645.1	Q9BY19	M4A8_HUMAN	membrane-spanning 4-domains, subfamily A, member 8	170						integral component of membrane (GO:0016021)											TGCCTACCCCGACTATTATCC	0.463																																																0													146.0	127.0	134.0					11																	60476228		2203	4300	6503	SO:0001583	missense	83661			AF237905	CCDS7990.1	11q12	2013-03-01	2013-03-01	2013-03-01	ENSG00000166959	ENSG00000166959			13380	protein-coding gene	gene with protein product		606549	"""membrane-spanning 4-domains, subfamily A, member 8B"""	MS4A8B		11245982, 11401424	Standard	NM_031457		Approved	MS4A4, CD20L5	uc001npv.3	Q9BY19	OTTHUMG00000167686	ENST00000300226.2:c.508G>A	11.37:g.60476228G>A	ENSP00000300226:p.Asp170Asn	Somatic		WXS	Illumina GAIIx	Phase_I	Q8TCA5	Missense_Mutation	SNP	ENST00000300226.2	37	CCDS7990.1	.	.	.	.	.	.	.	.	.	.	A	3.910	-0.020261	0.07634	.	.	ENSG00000166959	ENST00000300226	T	0.02446	4.29	3.83	-7.66	0.01277	.	2.563350	0.02059	N	0.050653	T	0.02807	0.0084	L	0.46670	1.46	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.38001	-0.9681	10	0.17369	T	0.5	-0.2745	5.2848	0.15696	0.3068:0.0994:0.4953:0.0984	.	170	Q9BY19	M4A8B_HUMAN	N	170	ENSP00000300226:D170N	ENSP00000300226:D170N	D	+	1	0	MS4A8B	60232804	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-3.635000	0.00408	-3.193000	0.00219	-1.301000	0.01330	GAC		0.463	MS4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395605.1			18	98	18	98
P2RY2	5029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	72945337	72945337	+	Missense_Mutation	SNP	G	G	A			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr11:72945337G>A	ENST00000311131.2	+	3	600	c.133G>A	c.(133-135)Gtg>Atg	p.V45M	P2RY2_ENST00000393596.2_Missense_Mutation_p.V45M|P2RY2_ENST00000393597.2_Missense_Mutation_p.V45M	NM_002564.2|NM_176072.1	NP_002555|NP_788086	P41231	P2RY2_HUMAN	purinergic receptor P2Y, G-protein coupled, 2	45					cellular ion homeostasis (GO:0006873)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of mucus secretion (GO:0070257)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25					Suramin(DB04786)	CGTGGTGTGCGTGCCTGGGCT	0.587																																																0													253.0	206.0	222.0					11																	72945337		2200	4293	6493	SO:0001583	missense	5029			U07225	CCDS8219.1	11q13.5-q14.1	2012-08-08				ENSG00000175591		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8541	protein-coding gene	gene with protein product		600041				8159738, 9286708	Standard	NM_002564		Approved	P2U	uc001otj.4	P41231		ENST00000311131.2:c.133G>A	11.37:g.72945337G>A	ENSP00000310305:p.Val45Met	Somatic		WXS	Illumina GAIIx	Phase_I	B2R9W3|Q96EM8	Missense_Mutation	SNP	ENST00000311131.2	37	CCDS8219.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.746094	0.49151	.	.	ENSG00000175591	ENST00000393597;ENST00000311131;ENST00000393596	T;T;T	0.41758	0.99;0.99;0.99	5.28	3.41	0.39046	.	0.292269	0.32287	N	0.006319	T	0.38692	0.1050	L	0.61218	1.895	0.39314	D	0.965134	D	0.54207	0.965	P	0.44673	0.457	T	0.32666	-0.9898	10	0.44086	T	0.13	.	5.7851	0.18329	0.1616:0.0:0.6827:0.1556	.	45	P41231	P2RY2_HUMAN	M	45	ENSP00000377222:V45M;ENSP00000310305:V45M;ENSP00000377221:V45M	ENSP00000310305:V45M	V	+	1	0	P2RY2	72622985	1.000000	0.71417	0.995000	0.50966	0.464000	0.32679	3.271000	0.51608	1.234000	0.43709	-0.216000	0.12614	GTG		0.587	P2RY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397336.1	NM_176072		19	166	19	166
CEP164	22897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	117266823	117266823	+	Missense_Mutation	SNP	T	T	C			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr11:117266823T>C	ENST00000278935.3	+	25	3290	c.3143T>C	c.(3142-3144)gTt>gCt	p.V1048A	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	1048					cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		GAAGTGACAGTTGAGGAAAAT	0.552																																																0													104.0	107.0	106.0					11																	117266823		2201	4296	6497	SO:0001583	missense	22897			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.3143T>C	11.37:g.117266823T>C	ENSP00000278935:p.Val1048Ala	Somatic		WXS	Illumina GAIIx	Phase_I	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	CCDS31683.1	.	.	.	.	.	.	.	.	.	.	T	0.024	-1.389740	0.01185	.	.	ENSG00000110274	ENST00000278935;ENST00000529538	T	0.26957	1.7	5.15	0.167	0.15006	.	0.466494	0.18071	N	0.152610	T	0.08537	0.0212	N	0.03324	-0.35	0.09310	N	1	B;B;B;B	0.06786	0.0;0.001;0.001;0.001	B;B;B;B	0.08055	0.001;0.003;0.003;0.003	T	0.38908	-0.9639	10	0.07325	T	0.83	-0.0257	8.8697	0.35309	0.0:0.6076:0.0:0.3924	.	1022;822;1048;1051	E9PI34;Q9NTH6;Q9UPV0;Q9UPV0-2	.;.;CE164_HUMAN;.	A	1048;1022	ENSP00000278935:V1048A	ENSP00000278935:V1048A	V	+	2	0	CEP164	116772033	0.000000	0.05858	0.000000	0.03702	0.153000	0.21895	-0.260000	0.08708	0.002000	0.14630	0.482000	0.46254	GTT		0.552	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956		57	200	57	200
ITPR2	3709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	26752943	26752943	+	Missense_Mutation	SNP	G	G	C			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr12:26752943G>C	ENST00000381340.3	-	29	4194	c.3778C>G	c.(3778-3780)Ctg>Gtg	p.L1260V		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1260					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AACAAATTCAGATGTTTATGA	0.328																																																0													92.0	85.0	87.0					12																	26752943		1820	4068	5888	SO:0001583	missense	3709			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.3778C>G	12.37:g.26752943G>C	ENSP00000370744:p.Leu1260Val	Somatic		WXS	Illumina GAIIx	Phase_I	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	G	13.52	2.261817	0.39995	.	.	ENSG00000123104	ENST00000381340	T	0.79033	-1.23	4.24	3.26	0.37387	Intracellular calcium-release channel (1);	0.068093	0.64402	D	0.000011	T	0.81245	0.4782	L	0.41356	1.27	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.80336	-0.1425	10	0.44086	T	0.13	.	12.1863	0.54241	0.0:0.0:0.7236:0.2764	.	1260	Q14571	ITPR2_HUMAN	V	1260	ENSP00000370744:L1260V	ENSP00000370744:L1260V	L	-	1	2	ITPR2	26644210	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.725000	0.54970	2.365000	0.80145	0.650000	0.86243	CTG		0.328	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		11	40	11	40
MTUS2	23281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	29600162	29600162	+	Missense_Mutation	SNP	A	A	G	rs201572486		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr13:29600162A>G	ENST00000431530.3	+	1	1415	c.1357A>G	c.(1357-1359)Aat>Gat	p.N453D		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	443						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						TATTCCTAATAATCTGACTGA	0.473																																																0													61.0	61.0	61.0					13																	29600162		1923	4128	6051	SO:0001583	missense	23281			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.1357A>G	13.37:g.29600162A>G	ENSP00000392057:p.Asn453Asp	Somatic		WXS	Illumina GAIIx	Phase_I	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	a	0.568	-0.842385	0.02671	.	.	ENSG00000132938	ENST00000431530	T	0.10960	2.82	5.82	-2.63	0.06133	.	1.399460	0.04533	N	0.386663	T	0.02807	0.0084	N	0.00677	-1.265	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42032	-0.9475	9	.	.	.	.	6.5945	0.22666	0.4694:0.22:0.3106:0.0	.	443	Q5JR59	MTUS2_HUMAN	D	453	ENSP00000392057:N453D	.	N	+	1	0	MTUS2	28498162	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.106000	0.15354	-0.208000	0.10171	-1.338000	0.01255	AAT		0.473	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270		19	57	19	57
TCF12	6938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	57543547	57543547	+	Splice_Site	SNP	G	G	A			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr15:57543547G>A	ENST00000267811.5	+	14	1418		c.e14-1		TCF12_ENST00000537840.1_Splice_Site|TCF12_ENST00000452095.2_Splice_Site|TCF12_ENST00000559710.1_Splice_Site|TCF12_ENST00000333725.5_Splice_Site|TCF12_ENST00000560764.1_Splice_Site|TCF12_ENST00000543579.1_Splice_Site|TCF12_ENST00000343827.3_Splice_Site|TCF12_ENST00000557843.1_Splice_Site|TCF12_ENST00000438423.2_Splice_Site|TCF12_ENST00000559703.1_Splice_Site	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12						immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		GGTTTTAACAGGTACCAGTCA	0.423			T	TEC	extraskeletal myxoid chondrosarcoma																																		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	0													113.0	92.0	99.0					15																	57543547		2192	4292	6484	SO:0001630	splice_region_variant	6938			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.1115-1G>A	15.37:g.57543547G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q7Z3D9|Q86TC1|Q86VM2	Splice_Site	SNP	ENST00000267811.5	37	CCDS10159.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606670	0.66558	.	.	ENSG00000140262	ENST00000543236;ENST00000267811;ENST00000438423;ENST00000452095;ENST00000333725;ENST00000543579;ENST00000537840;ENST00000343827	.	.	.	5.74	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7002	0.85348	0.0:0.0:0.8692:0.1308	.	.	.	.	.	-1	.	.	.	+	.	.	TCF12	55330839	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	9.516000	0.98017	1.584000	0.49913	-0.217000	0.12591	.		0.423	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255069.3	NM_003205	Intron	21	30	21	30
SLTM	79811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	59186365	59186365	+	Missense_Mutation	SNP	T	T	C			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr15:59186365T>C	ENST00000380516.2	-	11	1492	c.1405A>G	c.(1405-1407)Atg>Gtg	p.M469V	SLTM_ENST00000536328.1_Missense_Mutation_p.M38V|AC025918.2_ENST00000452467.1_RNA	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	469					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TCTTTCTTCATTTCTTTCTTA	0.294																																																0													85.0	80.0	82.0					15																	59186365		2188	4289	6477	SO:0001583	missense	79811			BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.1405A>G	15.37:g.59186365T>C	ENSP00000369887:p.Met469Val	Somatic		WXS	Illumina GAIIx	Phase_I	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000380516.2	37	CCDS10168.2	.	.	.	.	.	.	.	.	.	.	T	11.67	1.708574	0.30322	.	.	ENSG00000137776	ENST00000380516;ENST00000432750;ENST00000536328;ENST00000249736	D;T	0.86956	-2.19;2.86	5.46	0.551	0.17225	.	0.132360	0.33610	N	0.004722	T	0.69214	0.3086	N	0.14661	0.345	0.22737	N	0.998798	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.51957	-0.8639	10	0.10636	T	0.68	.	5.9184	0.19067	0.2961:0.0:0.3918:0.3121	.	469;38	Q9NWH9;A8K5V8	SLTM_HUMAN;.	V	469;62;38;451	ENSP00000369887:M469V;ENSP00000249736:M451V	ENSP00000249736:M451V	M	-	1	0	SLTM	56973657	0.052000	0.20516	0.988000	0.46212	0.993000	0.82548	0.155000	0.16362	-0.156000	0.11079	0.528000	0.53228	ATG		0.294	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157124.1	NM_024755		5	44	5	44
VPS13C	54832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	62254029	62254029	+	Missense_Mutation	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr15:62254029C>T	ENST00000261517.5	-	35	3740	c.3667G>A	c.(3667-3669)Gaa>Aaa	p.E1223K	VPS13C_ENST00000395898.3_Missense_Mutation_p.E1180K|VPS13C_ENST00000249837.3_Missense_Mutation_p.E1180K|VPS13C_ENST00000395896.4_Missense_Mutation_p.E1223K	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GCAGCCCTTTCTGCAGCCTGG	0.448																																																0													59.0	61.0	60.0					15																	62254029		2203	4300	6503	SO:0001583	missense	54832			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.3667G>A	15.37:g.62254029C>T	ENSP00000261517:p.Glu1223Lys	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644464	0.87859	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.14266	2.52;2.52;2.52	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.31857	0.0810	M	0.83223	2.63	0.58432	D	0.999999	P;P;D;D	0.55800	0.926;0.926;0.957;0.973	P;P;P;P	0.51415	0.518;0.574;0.669;0.468	T	0.08534	-1.0717	10	0.66056	D	0.02	.	15.2477	0.73517	0.0:0.8601:0.1399:0.0	.	1180;1223;1180;1223	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	K	1180;1223;1223;1223	ENSP00000249837:E1180K;ENSP00000261517:E1223K;ENSP00000379233:E1223K	ENSP00000249837:E1180K	E	-	1	0	VPS13C	60041321	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.696000	0.68287	2.649000	0.89929	0.563000	0.77884	GAA		0.448	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684		18	80	18	80
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R273C|TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000359597.4_Missense_Mutation_p.R273C|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343						65.0	56.0	59.0					17																	7577121		2203	4300	6503	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys	Somatic		WXS	Illumina GAIIx	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		35	9	35	9
CDK12	51755	hgsc.bcm.edu;broad.mit.edu	37	17	37627827	37627827	+	Missense_Mutation	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr17:37627827C>T	ENST00000447079.4	+	2	1775	c.1742C>T	c.(1741-1743)aCt>aTt	p.T581I	CDK12_ENST00000430627.2_Missense_Mutation_p.T581I	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	581					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						GCTTCCAGTACTTCAACTTTG	0.507			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																													Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	0													180.0	171.0	174.0					17																	37627827		2203	4300	6503	SO:0001583	missense	51755			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.1742C>T	17.37:g.37627827C>T	ENSP00000398880:p.Thr581Ile	Somatic		WXS	Illumina GAIIx	Phase_I	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.461179	0.43736	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.42131	0.98;0.98	5.89	3.88	0.44766	.	0.407307	0.20971	N	0.082386	T	0.39708	0.1088	L	0.36672	1.1	0.34850	D	0.74154	B;B;B	0.20459	0.026;0.026;0.045	B;B;B	0.30943	0.057;0.057;0.122	T	0.50311	-0.8843	10	0.62326	D	0.03	-2.1457	15.8203	0.78633	0.0:0.7424:0.2576:0.0	.	580;581;581	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	I	581	ENSP00000407720:T581I;ENSP00000398880:T581I	ENSP00000407720:T581I	T	+	2	0	CDK12	34881353	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	3.285000	0.51716	0.810000	0.34279	0.655000	0.94253	ACT		0.507	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507		14	272	14	272
GH1	2688	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	61995729	61995729	+	Missense_Mutation	SNP	C	C	T	rs544949394		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr17:61995729C>T	ENST00000323322.5	-	2	190	c.148G>A	c.(148-150)Gcc>Acc	p.A50T	GH1_ENST00000351388.4_Missense_Mutation_p.A50T|GH1_ENST00000458650.2_Missense_Mutation_p.A50T|GH1_ENST00000342364.4_Missense_Mutation_p.A50T|CSHL1_ENST00000392824.4_Intron	NM_000515.3	NP_000506.2	P01241	SOMA_HUMAN	growth hormone 1	50					bone maturation (GO:0070977)|glucose transport (GO:0015758)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|growth hormone receptor binding (GO:0005131)|metal ion binding (GO:0046872)|prolactin receptor binding (GO:0005148)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	19						GTGTCAAAGGCCAGCTGGTGC	0.582																																																0													163.0	173.0	170.0					17																	61995729		2203	4300	6503	SO:0001583	missense	2688			M13438	CCDS11653.1, CCDS11654.1, CCDS45760.1	17q22-q24	2014-01-30				ENSG00000259384		"""Endogenous ligands"""	4261	protein-coding gene	gene with protein product	"""pituitary growth hormone"", ""somatotropin"""	139250				6306568	Standard	XM_005257218		Approved	GH-N, GHN, GH, hGH-N	uc002jdj.3	P01241		ENST00000323322.5:c.148G>A	17.37:g.61995729C>T	ENSP00000312673:p.Ala50Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A6NEF6|Q14405|Q16631|Q5EB53|Q9HBZ1|Q9UMJ7|Q9UNL5	Missense_Mutation	SNP	ENST00000323322.5	37	CCDS11653.1	.	.	.	.	.	.	.	.	.	.	c	15.18	2.758094	0.49468	.	.	ENSG00000204414	ENST00000323322;ENST00000458650;ENST00000351388;ENST00000342364	D;T;D;D	0.91740	-2.9;0.77;-2.9;-2.9	2.86	2.86	0.33363	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.168698	0.51477	D	0.000085	D	0.96476	0.8850	H	0.94964	3.605	0.23762	N	0.996911	D;P;D;D;D	0.89917	0.999;0.921;0.999;1.0;1.0	D;B;D;D;D	0.97110	0.993;0.443;0.987;1.0;1.0	D	0.89580	0.3820	10	0.87932	D	0	.	9.3531	0.38151	0.0:1.0:0.0:0.0	.	50;50;50;50;50	C9JYZ1;B1A4G9;A6NEF6;P01241;B1A4G7	.;.;.;SOMA_HUMAN;.	T	50	ENSP00000312673:A50T;ENSP00000408486:A50T;ENSP00000343791:A50T;ENSP00000339278:A50T	ENSP00000312673:A50T	A	-	1	0	GH1	59349461	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	4.196000	0.58407	1.594000	0.50039	0.298000	0.19748	GCC		0.582	GH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417708.1	NM_000515		68	281	68	281
GALR1	2587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	74980584	74980584	+	Missense_Mutation	SNP	C	C	G			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr18:74980584C>G	ENST00000299727.3	+	3	776	c.776C>G	c.(775-777)tCc>tGc	p.S259C		NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	259					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		TTTGGAATCTCCTGGCTGCCG	0.567																																																0													130.0	131.0	130.0					18																	74980584		2203	4300	6503	SO:0001583	missense	2587			U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.776C>G	18.37:g.74980584C>G	ENSP00000299727:p.Ser259Cys	Somatic		WXS	Illumina GAIIx	Phase_I	Q4VBL7	Missense_Mutation	SNP	ENST00000299727.3	37	CCDS12012.1	.	.	.	.	.	.	.	.	.	.	C	0.512	-0.866018	0.02590	.	.	ENSG00000166573	ENST00000299727	T	0.25912	1.77	4.74	4.74	0.60224	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.09862	0.0242	N	0.01482	-0.84	0.80722	D	1	B	0.14012	0.009	B	0.20955	0.032	T	0.17899	-1.0354	10	0.02654	T	1	.	17.3364	0.87282	0.0:1.0:0.0:0.0	.	259	P47211	GALR1_HUMAN	C	259	ENSP00000299727:S259C	ENSP00000299727:S259C	S	+	2	0	GALR1	73109572	1.000000	0.71417	0.997000	0.53966	0.087000	0.18053	7.535000	0.82014	2.189000	0.69895	0.563000	0.77884	TCC		0.567	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256362.1			42	204	42	204
ABCA7	10347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	1044692	1044692	+	Silent	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr19:1044692C>T	ENST00000263094.6	+	11	1395	c.1164C>T	c.(1162-1164)gaC>gaT	p.D388D	ABCA7_ENST00000435683.2_Silent_p.D250D|ABCA7_ENST00000433129.1_Silent_p.D388D	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	388					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGGCAGGACGCACACGCTG	0.667																																																0													45.0	46.0	46.0					19																	1044692		2201	4298	6499	SO:0001819	synonymous_variant	10347			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1164C>T	19.37:g.1044692C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																				0.667	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112		11	46	11	46
PRR19	284338	hgsc.bcm.edu;broad.mit.edu	37	19	42813898	42813898	+	Silent	SNP	G	G	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr19:42813898G>T	ENST00000499536.2	+	1	973	c.162G>T	c.(160-162)gtG>gtT	p.V54V	PRR19_ENST00000598490.1_Silent_p.V54V|PRR19_ENST00000341747.3_Silent_p.V54V			A6NJB7	PRR19_HUMAN	proline rich 19	54										NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	10		Prostate(69;0.00682)				ATCCACCTGTGGTCCCTACTG	0.622																																																0													68.0	77.0	74.0					19																	42813898		2203	4300	6503	SO:0001819	synonymous_variant	284338			AK124116	CCDS33036.1	19q13.2	2007-12-17				ENSG00000188368			33728	protein-coding gene	gene with protein product							Standard	NM_199285		Approved	MGC70924	uc002oti.3	A6NJB7		ENST00000499536.2:c.162G>T	19.37:g.42813898G>T		Somatic		WXS	Illumina GAIIx	Phase_I	A8K663|B3KW48|Q6P584	Silent	SNP	ENST00000499536.2	37	CCDS33036.1																																																																																				0.622	PRR19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463735.1	NM_199285		9	138	9	138
ZNF613	79898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	52447902	52447902	+	Missense_Mutation	SNP	G	G	A			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr19:52447902G>A	ENST00000293471.6	+	6	1445	c.766G>A	c.(766-768)Gga>Aga	p.G256R	ZNF613_ENST00000391794.4_Missense_Mutation_p.G220R	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	256					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		AAACCACACAGGAGAGAAACC	0.458																																																0													84.0	91.0	88.0					19																	52447902		2203	4300	6503	SO:0001583	missense	79898			AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.766G>A	19.37:g.52447902G>A	ENSP00000293471:p.Gly256Arg	Somatic		WXS	Illumina GAIIx	Phase_I	Q96SS9	Missense_Mutation	SNP	ENST00000293471.6	37	CCDS33089.1	.	.	.	.	.	.	.	.	.	.	G	5.078	0.200058	0.09652	.	.	ENSG00000176024	ENST00000293471;ENST00000391794	T;T	0.26223	1.75;1.75	3.1	-0.895	0.10560	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.951568	0.08515	N	0.934368	T	0.22205	0.0535	L	0.42529	1.33	0.26392	N	0.976551	B	0.29646	0.253	B	0.34722	0.188	T	0.37979	-0.9682	10	0.40728	T	0.16	.	6.5687	0.22527	0.1143:0.3671:0.5186:0.0	.	256	Q6PF04	ZN613_HUMAN	R	256;220	ENSP00000293471:G256R;ENSP00000375671:G220R	ENSP00000293471:G256R	G	+	1	0	ZNF613	57139714	0.737000	0.28175	0.006000	0.13384	0.026000	0.11368	1.420000	0.34804	-0.200000	0.10300	-0.211000	0.12701	GGA		0.458	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461104.2	NM_024840		49	109	49	109
LRIG2	9860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	113637236	113637236	+	Missense_Mutation	SNP	A	A	G			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr1:113637236A>G	ENST00000361127.5	+	6	860	c.662A>G	c.(661-663)gAa>gGa	p.E221G		NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	221					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TGTTAAAGGGAACTTAAAAGA	0.303																																																0													58.0	63.0	61.0					1																	113637236		2200	4296	6496	SO:0001583	missense	9860			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.662A>G	1.37:g.113637236A>G	ENSP00000355396:p.Glu221Gly	Somatic		WXS	Illumina GAIIx	Phase_I	Q9NSN2	Missense_Mutation	SNP	ENST00000361127.5	37	CCDS30808.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.657167	0.88154	.	.	ENSG00000198799	ENST00000361127	T	0.25085	1.82	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.32852	0.0843	L	0.42529	1.33	0.80722	D	1	D	0.63046	0.992	D	0.63703	0.917	T	0.06588	-1.0818	10	0.62326	D	0.03	.	16.3985	0.83631	1.0:0.0:0.0:0.0	.	221	O94898	LRIG2_HUMAN	G	221	ENSP00000355396:E221G	ENSP00000355396:E221G	E	+	2	0	LRIG2	113438759	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.281000	0.95811	2.274000	0.75844	0.519000	0.50382	GAA		0.303	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813		23	76	23	76
PTGFRN	5738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	117504195	117504195	+	Missense_Mutation	SNP	G	G	C			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr1:117504195G>C	ENST00000393203.2	+	5	1691	c.1544G>C	c.(1543-1545)tGt>tCt	p.C515S	RNA5SP55_ENST00000516701.1_RNA	NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	515	Ig-like C2-type 4.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		AATTATTACTGTGTTGTGTCT	0.453																																																0													79.0	76.0	77.0					1																	117504195		2203	4300	6503	SO:0001583	missense	5738			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.1544G>C	1.37:g.117504195G>C	ENSP00000376899:p.Cys515Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q5VVU9|Q8N2K6	Missense_Mutation	SNP	ENST00000393203.2	37	CCDS890.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221522	0.79464	.	.	ENSG00000134247	ENST00000393203;ENST00000544471	T	0.64991	-0.13	5.35	5.35	0.76521	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73628	0.3611	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76716	-0.2857	10	0.87932	D	0	-18.5685	16.5508	0.84472	0.0:0.0:1.0:0.0	.	515	Q9P2B2	FPRP_HUMAN	S	515;374	ENSP00000376899:C515S	ENSP00000376899:C515S	C	+	2	0	PTGFRN	117305718	1.000000	0.71417	0.969000	0.41365	0.901000	0.52897	7.842000	0.86851	2.514000	0.84764	0.305000	0.20034	TGT		0.453	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033271.1	NM_020440		33	67	33	67
WARS2	10352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	119683216	119683216	+	Missense_Mutation	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr1:119683216C>T	ENST00000235521.4	-	1	78	c.52G>A	c.(52-54)Gca>Aca	p.A18T	RP11-418J17.1_ENST00000440150.1_RNA|RP11-418J17.1_ENST00000413531.1_RNA|RP11-418J17.1_ENST00000418015.1_RNA|WARS2_ENST00000497761.1_5'UTR|WARS2_ENST00000537870.1_5'Flank|RP11-418J17.1_ENST00000425884.1_RNA|WARS2_ENST00000369426.5_Missense_Mutation_p.A18T|RP11-418J17.1_ENST00000457043.1_RNA	NM_015836.3|NM_201263.2	NP_056651.1|NP_957715.1	Q9UGM6	SYWM_HUMAN	tryptophanyl tRNA synthetase 2, mitochondrial	18					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)|vasculogenesis (GO:0001570)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(2)	15	all_neural(166;0.187)	all_lung(203;2.48e-06)|Lung NSC(69;1.74e-05)|all_epithelial(167;0.000564)		Lung(183;0.0629)	L-Tryptophan(DB00150)	TTATGAAGTGCCCGGATGAAG	0.597																																																0													46.0	47.0	47.0					1																	119683216		2203	4300	6503	SO:0001583	missense	10352			BC021722	CCDS900.1, CCDS30817.1	1p12	2011-07-01	2007-02-23		ENSG00000116874	ENSG00000116874	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12730	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 2, mitochondrial"""	604733				10072595, 10828066	Standard	NM_201263		Approved	TrpRS	uc001ehn.3	Q9UGM6	OTTHUMG00000012335	ENST00000235521.4:c.52G>A	1.37:g.119683216C>T	ENSP00000235521:p.Ala18Thr	Somatic		WXS	Illumina GAIIx	Phase_I	B1ALR1|B2R9D4|Q53FT4|Q5VUD2|Q86TQ0	Missense_Mutation	SNP	ENST00000235521.4	37	CCDS900.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372938	0.82573	.	.	ENSG00000116874	ENST00000369426;ENST00000235521	T;T	0.46819	0.86;1.86	6.04	6.04	0.98038	.	0.197788	0.44902	D	0.000409	T	0.46776	0.1410	L	0.31065	0.9	0.80722	D	1	D;D;B;D	0.89917	1.0;1.0;0.001;1.0	D;D;B;D	0.83275	0.996;0.996;0.002;0.996	T	0.23440	-1.0188	10	0.22706	T	0.39	-17.0199	16.0793	0.80989	0.0:1.0:0.0:0.0	.	18;18;18;18	B7Z448;B7Z6G7;Q9UGM6;B1ALR1	.;.;SYWM_HUMAN;.	T	18	ENSP00000358434:A18T;ENSP00000235521:A18T	ENSP00000235521:A18T	A	-	1	0	WARS2	119484739	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	3.549000	0.53681	2.873000	0.98535	0.561000	0.74099	GCA		0.597	WARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034362.1	NM_015836		21	42	21	42
LRRN2	10446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	204587235	204587235	+	Missense_Mutation	SNP	G	G	A			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr1:204587235G>A	ENST00000367175.1	-	1	4098	c.1886C>T	c.(1885-1887)cCt>cTt	p.P629L	RP11-430C7.4_ENST00000453895.1_RNA|LRRN2_ENST00000367176.3_Missense_Mutation_p.P629L|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367177.3_Missense_Mutation_p.P629L			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	629					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			AATGAGCCCAGGACGGTCCCC	0.627																																																0													44.0	47.0	46.0					1																	204587235		2203	4300	6503	SO:0001583	missense	10446			AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.1886C>T	1.37:g.204587235G>A	ENSP00000356143:p.Pro629Leu	Somatic		WXS	Illumina GAIIx	Phase_I	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	ENST00000367175.1	37	CCDS1448.1	.	.	.	.	.	.	.	.	.	.	G	0.039	-1.293850	0.01375	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.59083	0.29;0.29;0.29	5.6	4.5	0.54988	.	0.211961	0.23777	N	0.044678	T	0.42675	0.1213	L	0.38175	1.15	0.20764	N	0.999854	B	0.06786	0.001	B	0.04013	0.001	T	0.12528	-1.0544	10	0.16896	T	0.51	.	9.4506	0.38723	0.0854:0.0:0.7321:0.1826	.	629	O75325	LRRN2_HUMAN	L	629	ENSP00000356144:P629L;ENSP00000356145:P629L;ENSP00000356143:P629L	ENSP00000356143:P629L	P	-	2	0	LRRN2	202853858	0.549000	0.26481	0.593000	0.28771	0.084000	0.17831	1.542000	0.36137	2.640000	0.89533	0.655000	0.94253	CCT		0.627	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	NM_006338		6	33	6	33
PM20D1	148811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	205819185	205819185	+	Missense_Mutation	SNP	C	C	A			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr1:205819185C>A	ENST00000367136.4	-	1	60	c.16G>T	c.(16-18)Gtt>Ttt	p.V6F	PM20D1_ENST00000460624.1_5'UTR	NM_152491.4	NP_689704.4	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1	6					negative regulation of neuron death (GO:1901215)|regulation of defense response to virus by host (GO:0050691)|regulation of viral process (GO:0050792)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|peptidase activity (GO:0008233)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)	28	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			AGCACGCAAACGCACCGCTGA	0.602																																																0													72.0	66.0	68.0					1																	205819185		2203	4300	6503	SO:0001583	missense	148811				CCDS1460.1	1q32.1	2008-02-05			ENSG00000162877	ENSG00000162877			26518	protein-coding gene	gene with protein product							Standard	NM_152491		Approved	FLJ32569, Cps1	uc001hdj.3	Q6GTS8	OTTHUMG00000035999	ENST00000367136.4:c.16G>T	1.37:g.205819185C>A	ENSP00000356104:p.Val6Phe	Somatic		WXS	Illumina GAIIx	Phase_I	Q6P4E3|Q96DM4	Missense_Mutation	SNP	ENST00000367136.4	37	CCDS1460.1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.298366	0.23650	.	.	ENSG00000162877	ENST00000367136	T	0.07800	3.16	4.18	-0.002	0.14031	.	1.379330	0.04474	N	0.376701	T	0.07773	0.0195	L	0.43152	1.355	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.40421	-0.9564	10	0.24483	T	0.36	.	3.7828	0.08687	0.2962:0.4846:0.1312:0.088	.	6	Q6GTS8	P20D1_HUMAN	F	6	ENSP00000356104:V6F	ENSP00000356104:V6F	V	-	1	0	PM20D1	204085808	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.693000	0.05121	-0.212000	0.10109	-0.795000	0.03280	GTT		0.602	PM20D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087736.1	NM_152491		13	48	13	48
USP25	29761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	21	17250117	17250117	+	Silent	SNP	A	A	G			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr21:17250117A>G	ENST00000285679.6	+	23	3171	c.2802A>G	c.(2800-2802)aaA>aaG	p.K934K	USP25_ENST00000351097.5_Silent_p.K329K|USP25_ENST00000400183.2_Silent_p.K1004K|USP25_ENST00000285681.2_Silent_p.K966K	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	934					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)	p.K934K(1)		breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		GCATTAAGAAATTAAATGAGC	0.313																																																1	Substitution - coding silent(1)	endometrium(1)											56.0	57.0	57.0					21																	17250117		2203	4299	6502	SO:0001819	synonymous_variant	29761			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.2802A>G	21.37:g.17250117A>G		Somatic		WXS	Illumina GAIIx	Phase_I	C0LSZ0|Q6DHZ9|Q9H9W1	Silent	SNP	ENST00000285679.6	37	CCDS33515.1																																																																																				0.313	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1			6	9	6	9
TEF	7008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	22	41783620	41783620	+	Silent	SNP	A	A	G			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr22:41783620A>G	ENST00000266304.4	+	2	539	c.423A>G	c.(421-423)ccA>ccG	p.P141P	TEF_ENST00000406644.3_Silent_p.P111P	NM_003216.3	NP_003207.1	Q10587	TEF_HUMAN	thyrotrophic embryonic factor	141					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)	6						CAGCATCCCCACCATCCTCCT	0.612																																																0													86.0	62.0	70.0					22																	41783620		2203	4300	6503	SO:0001819	synonymous_variant	7008				CCDS14014.1, CCDS46716.1	22q13.2	2013-01-10			ENSG00000167074	ENSG00000167074		"""basic leucine zipper proteins"""	11722	protein-coding gene	gene with protein product		188595				7835883, 15665112	Standard	NM_001145398		Approved	KIAA1655	uc003azy.4	Q10587	OTTHUMG00000150968	ENST00000266304.4:c.423A>G	22.37:g.41783620A>G		Somatic		WXS	Illumina GAIIx	Phase_I	B0QYS8|B2RC22|Q15729|Q7Z3J7|Q8IU94|Q96TG4	Silent	SNP	ENST00000266304.4	37	CCDS14014.1	.	.	.	.	.	.	.	.	.	.	a	8.178	0.793190	0.16327	.	.	ENSG00000167074	ENST00000413942	.	.	.	5.34	-4.06	0.03986	.	.	.	.	.	T	0.39279	0.1072	.	.	.	0.50813	D	0.999895	.	.	.	.	.	.	T	0.30534	-0.9975	4	.	.	.	-3.9108	2.9105	0.05736	0.3123:0.2925:0.3002:0.095	.	.	.	.	R	107	.	.	H	+	2	0	TEF	40113566	0.003000	0.15002	0.337000	0.25536	0.930000	0.56654	-1.023000	0.03607	-1.409000	0.02038	-0.359000	0.07587	CAC		0.612	TEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320692.1	NM_003216		26	45	26	45
CNGA3	1261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	99006190	99006190	+	Silent	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr2:99006190C>T	ENST00000272602.2	+	5	558	c.519C>T	c.(517-519)acC>acT	p.T173T	CNGA3_ENST00000393504.1_Silent_p.T173T|CNGA3_ENST00000409937.1_Silent_p.T177T|CNGA3_ENST00000436404.2_Silent_p.T155T			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	173					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						GCTGGCTGACCGCCATCGCCC	0.557																																																0													127.0	113.0	118.0					2																	99006190		2203	4300	6503	SO:0001819	synonymous_variant	1261			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.519C>T	2.37:g.99006190C>T		Somatic		WXS	Illumina GAIIx	Phase_I	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Silent	SNP	ENST00000272602.2	37	CCDS2034.1																																																																																				0.557	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298		16	121	16	121
IL1B	3553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	113591147	113591147	+	Silent	SNP	G	G	A			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr2:113591147G>A	ENST00000263341.2	-	4	315	c.105C>T	c.(103-105)tcC>tcT	p.S35S	IL1B_ENST00000491056.1_5'UTR	NM_000576.2	NP_000567.1	P01584	IL1B_HUMAN	interleukin 1, beta	35					activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|cellular response to drug (GO:0035690)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|cellular response to organic substance (GO:0071310)|cytokine-mediated signaling pathway (GO:0019221)|ectopic germ cell programmed cell death (GO:0035234)|embryo implantation (GO:0007566)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fever generation (GO:0001660)|hyaluronan biosynthetic process (GO:0030213)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-1 beta production (GO:0032611)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|monocyte aggregation (GO:0070487)|negative regulation of adiponectin secretion (GO:0070164)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of MAP kinase activity (GO:0043407)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion molecule production (GO:0060355)|positive regulation of cell division (GO:0051781)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fever generation (GO:0031622)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mitosis (GO:0045840)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of myosin light chain kinase activity (GO:0035505)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell mediated immunity (GO:0002711)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein kinase B signaling (GO:0043491)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of insulin secretion (GO:0050796)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|sequestering of triglyceride (GO:0030730)|signal transduction (GO:0007165)|smooth muscle adaptation (GO:0014805)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule (GO:0030141)	cytokine activity (GO:0005125)|interleukin-1 receptor binding (GO:0005149)|protein domain specific binding (GO:0019904)			breast(2)|central_nervous_system(1)|large_intestine(1)|lung(8)	12					Canakinumab(DB06168)|Gallium nitrate(DB05260)|Minocycline(DB01017)|Rilonacept(DB06372)	GGTCCTGGAAGGAGCACTGCG	0.597																																																0													61.0	59.0	59.0					2																	113591147		2203	4300	6503	SO:0001819	synonymous_variant	3553			M15330	CCDS2102.1	2q14	2014-01-30			ENSG00000125538	ENSG00000125538		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	5992	protein-coding gene	gene with protein product		147720				2954882, 2989698	Standard	NM_000576		Approved	IL1F2, IL-1B, IL1-BETA	uc002tii.1	P01584	OTTHUMG00000131344	ENST00000263341.2:c.105C>T	2.37:g.113591147G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q53X59|Q53XX2|Q7M4S7|Q7RU01|Q96HE5|Q9UCT6	Silent	SNP	ENST00000263341.2	37	CCDS2102.1																																																																																				0.597	IL1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254125.2	NM_000576		25	82	25	82
DPP10	57628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	116538514	116538514	+	Missense_Mutation	SNP	A	A	G			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr2:116538514A>G	ENST00000410059.1	+	16	1906	c.1426A>G	c.(1426-1428)Aca>Gca	p.T476A	DPP10_ENST00000409163.1_Missense_Mutation_p.T426A|DPP10_ENST00000310323.8_Missense_Mutation_p.T469A|DPP10_ENST00000393147.2_Missense_Mutation_p.T480A	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	476						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						AGAACAATGTACATATTTTGA	0.284																																																0													114.0	112.0	112.0					2																	116538514		2202	4295	6497	SO:0001583	missense	57628			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1426A>G	2.37:g.116538514A>G	ENSP00000386565:p.Thr476Ala	Somatic		WXS	Illumina GAIIx	Phase_I	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	A	14.27	2.484523	0.44147	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	5.86	4.71	0.59529	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.167341	0.48286	D	0.000196	T	0.26557	0.0649	L	0.37507	1.11	0.41269	D	0.986832	B;B;B;B	0.25007	0.095;0.076;0.116;0.116	B;B;B;B	0.32211	0.087;0.109;0.142;0.142	T	0.06127	-1.0844	10	0.42905	T	0.14	-11.1346	9.7899	0.40699	0.9227:0.0:0.0773:0.0	.	469;480;472;476	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	A	476;426;480;469;426	ENSP00000386565:T476A;ENSP00000387038:T426A;ENSP00000376855:T480A;ENSP00000309066:T469A	ENSP00000309066:T469A	T	+	1	0	DPP10	116254984	0.999000	0.42202	0.994000	0.49952	0.984000	0.73092	3.273000	0.51623	1.054000	0.40438	-0.250000	0.11733	ACA		0.284	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868		32	64	32	64
CCDC93	54520	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	118731539	118731539	+	Missense_Mutation	SNP	A	A	G	rs374241278		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr2:118731539A>G	ENST00000376300.2	-	11	970	c.833T>C	c.(832-834)aTt>aCt	p.I278T	CCDC93_ENST00000319432.5_Missense_Mutation_p.I277T|CCDC93_ENST00000460781.1_5'UTR	NM_019044.4	NP_061917.3	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	278										breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(2)	29						GAGTCCCACAATCTGGCCCAC	0.537																																																0								A	THR/ILE	0,4406		0,0,2203	61.0	56.0	58.0		833	5.2	1.0	2		58	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCDC93	NM_019044.4	89	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging	278/632	118731539	1,13005	2203	4300	6503	SO:0001583	missense	54520			BC028609	CCDS2121.2	2q14.1	2008-02-05			ENSG00000125633	ENSG00000125633			25611	protein-coding gene	gene with protein product						12477932	Standard	NM_019044		Approved	FLJ10996	uc002tlj.3	Q567U6	OTTHUMG00000058517	ENST00000376300.2:c.833T>C	2.37:g.118731539A>G	ENSP00000365477:p.Ile278Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A8K3V7|Q4LE78|Q53TJ2|Q8TBX5|Q9H6R5|Q9NV15	Missense_Mutation	SNP	ENST00000376300.2	37	CCDS2121.2	.	.	.	.	.	.	.	.	.	.	A	20.5	3.993461	0.74703	0.0	1.16E-4	ENSG00000125633	ENST00000376300;ENST00000319432	T;T	0.21361	2.01;2.02	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.34366	0.0895	M	0.65498	2.005	0.48288	D	0.999622	D	0.60160	0.987	P	0.55455	0.776	T	0.09862	-1.0655	10	0.14252	T	0.57	-13.8756	13.7185	0.62712	1.0:0.0:0.0:0.0	.	278	Q567U6	CCD93_HUMAN	T	278;277	ENSP00000365477:I278T;ENSP00000324135:I277T	ENSP00000324135:I277T	I	-	2	0	CCDC93	118448009	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	6.589000	0.74080	2.156000	0.67533	0.533000	0.62120	ATT		0.537	CCDC93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000129615.1	NM_019044		18	11	18	11
NEB	4703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	152376199	152376199	+	Missense_Mutation	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr2:152376199C>T	ENST00000172853.10	-	126	17607	c.17460G>A	c.(17458-17460)atG>atA	p.M5820I	NEB_ENST00000397345.3_Missense_Mutation_p.M7521I|NEB_ENST00000409198.1_Missense_Mutation_p.M5820I|NEB_ENST00000604864.1_Missense_Mutation_p.M7521I|NEB_ENST00000427231.2_Missense_Mutation_p.M7521I|NEB_ENST00000603639.1_Missense_Mutation_p.M7521I			P20929	NEBU_HUMAN	nebulin	5820					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TAGCATCTTTCATGACTTTGT	0.323																																																0													270.0	245.0	253.0					2																	152376199		1847	4094	5941	SO:0001583	missense	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.17460G>A	2.37:g.152376199C>T	ENSP00000172853:p.Met5820Ile	Somatic		WXS	Illumina GAIIx	Phase_I	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	C	19.57	3.851789	0.71719	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.05996	3.48;3.47;3.48;3.36;3.48	6.16	6.16	0.99307	.	0.090030	0.85682	D	0.000000	T	0.06917	0.0176	L	0.36672	1.1	0.80722	D	1	B;B;P	0.42785	0.032;0.251;0.79	B;B;B	0.39217	0.041;0.176;0.294	T	0.47262	-0.9131	10	0.21014	T	0.42	.	15.5636	0.76269	0.1378:0.8622:0.0:0.0	.	5820;7521;2251	P20929;F8WCP0;Q14215	NEBU_HUMAN;.;.	I	5820;7521;7521;1869;2251;5820	ENSP00000386259:M5820I;ENSP00000380505:M7521I;ENSP00000416578:M7521I;ENSP00000410961:M2251I;ENSP00000172853:M5820I	ENSP00000172853:M5820I	M	-	3	0	NEB	152084445	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.447000	0.52936	2.937000	0.99478	0.650000	0.86243	ATG		0.323	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		13	140	13	140
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	C	T	rs121913500		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr2:209113112C>T	ENST00000415913.1	-	4	776	c.395G>A	c.(394-396)cGt>cAt	p.R132H	IDH1_ENST00000345146.2_Missense_Mutation_p.R132H|IDH1_ENST00000446179.1_Missense_Mutation_p.R132H	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132H(2774)|p.R132L(59)|p.R132V(1)|p.G131_R132>VL(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	2835	Substitution - Missense(2834)|Complex - compound substitution(1)	central_nervous_system(2579)|haematopoietic_and_lymphoid_tissue(205)|bone(43)|prostate(4)|biliary_tract(2)|urinary_tract(1)|skin(1)											79.0	73.0	75.0					2																	209113112		2203	4300	6503	SO:0001583	missense	3417				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.395G>A	2.37:g.209113112C>T	ENSP00000390265:p.Arg132His	Somatic		WXS	Illumina GAIIx	Phase_I	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657324	0.88154	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	4.69	0.59074	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	H	0.99379	4.54	0.80722	D	1	B	0.25486	0.127	B	0.25405	0.06	D	0.92324	0.5868	10	0.87932	D	0	-20.0399	14.3783	0.66895	0.0:0.9288:0.0:0.0712	.	132	O75874	IDHC_HUMAN	H	132	ENSP00000260985:R132H;ENSP00000410513:R132H;ENSP00000390265:R132H;ENSP00000391075:R132H	ENSP00000260985:R132H	R	-	2	0	IDH1	208821357	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.088000	0.71371	1.356000	0.45884	0.555000	0.69702	CGT		0.393	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			27	72	27	72
TMCC1	23023	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	129389499	129389499	+	Silent	SNP	T	T	C	rs368776883		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr3:129389499T>C	ENST00000393238.3	-	4	1525	c.1185A>G	c.(1183-1185)gaA>gaG	p.E395E	TMCC1_ENST00000329333.5_Silent_p.E216E|TMCC1_ENST00000432054.2_Silent_p.E71E|TMCC1_ENST00000426664.2_Silent_p.E281E	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	395						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CCACTTGCCCTTCCTCTAAAG	0.478																																																0								T	,	1,4405	2.1+/-5.4	0,1,2202	80.0	77.0	78.0		1185,843	2.8	1.0	3		78	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TMCC1	NM_001017395.3,NM_001128224.2	,	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	,	395/654,281/540	129389499	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23023			AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1185A>G	3.37:g.129389499T>C		Somatic		WXS	Illumina GAIIx	Phase_I	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Silent	SNP	ENST00000393238.3	37	CCDS33855.1																																																																																				0.478	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008		11	107	11	107
RNF168	165918	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	196229803	196229803	+	Missense_Mutation	SNP	T	T	C			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr3:196229803T>C	ENST00000318037.3	-	1	836	c.242A>G	c.(241-243)cAa>cGa	p.Q81R		NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	81					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		ATAGTGTTTTTGAATTATCGT	0.512																																																0													96.0	85.0	89.0					3																	196229803		2203	4300	6503	SO:0001583	missense	165918			AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.242A>G	3.37:g.196229803T>C	ENSP00000320898:p.Gln81Arg	Somatic		WXS	Illumina GAIIx	Phase_I	Q8NA67|Q96NS4	Missense_Mutation	SNP	ENST00000318037.3	37	CCDS3317.1	.	.	.	.	.	.	.	.	.	.	T	14.16	2.453114	0.43531	.	.	ENSG00000163961	ENST00000318037	T	0.09073	3.02	6.0	6.0	0.97389	.	0.000000	0.64402	D	0.000016	T	0.13927	0.0337	L	0.58810	1.83	0.58432	D	0.999998	P	0.39060	0.657	B	0.40410	0.328	T	0.00855	-1.1539	10	0.46703	T	0.11	-23.9701	16.56	0.84537	0.0:0.0:0.0:1.0	.	81	Q8IYW5	RN168_HUMAN	R	81	ENSP00000320898:Q81R	ENSP00000320898:Q81R	Q	-	2	0	RNF168	197714200	1.000000	0.71417	0.986000	0.45419	0.081000	0.17604	6.248000	0.72418	2.313000	0.78055	0.454000	0.30748	CAA		0.512	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340778.1	NM_152617		32	58	32	58
PDHA2	5161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	96762461	96762461	+	Missense_Mutation	SNP	T	T	C			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr4:96762461T>C	ENST00000295266.4	+	1	1223	c.1160T>C	c.(1159-1161)gTc>gCc	p.V387A		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	387					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		TTTAAGTCCGTCAGTTAAAGG	0.398																																																0													84.0	78.0	80.0					4																	96762461		2203	4300	6503	SO:0001583	missense	5161				CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.1160T>C	4.37:g.96762461T>C	ENSP00000295266:p.Val387Ala	Somatic		WXS	Illumina GAIIx	Phase_I	B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	ENST00000295266.4	37	CCDS3644.1	.	.	.	.	.	.	.	.	.	.	T	7.752	0.703555	0.15172	.	.	ENSG00000163114	ENST00000295266	D	0.97731	-4.51	4.72	3.51	0.40186	.	0.785486	0.11944	N	0.514349	D	0.93828	0.8026	L	0.34521	1.04	0.20307	N	0.999919	B	0.02656	0.0	B	0.06405	0.002	D	0.87239	0.2265	10	0.45353	T	0.12	-27.282	4.2587	0.10730	0.1768:0.0938:0.0:0.7294	.	387	P29803	ODPAT_HUMAN	A	387	ENSP00000295266:V387A	ENSP00000295266:V387A	V	+	2	0	PDHA2	96981484	0.402000	0.25311	0.081000	0.20488	0.269000	0.26545	2.325000	0.43840	0.911000	0.36747	0.379000	0.24179	GTC		0.398	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1			47	70	47	70
EGF	1950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	110895897	110895897	+	Missense_Mutation	SNP	G	G	A	rs554205393		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr4:110895897G>A	ENST00000265171.5	+	12	2208	c.1763G>A	c.(1762-1764)cGt>cAt	p.R588H	EGF_ENST00000509793.1_Missense_Mutation_p.R546H|EGF_ENST00000503392.1_Missense_Mutation_p.R588H	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	588					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	AATGGGAAACGTTCCAAAATA	0.353													G|||	1	0.000199681	0.0	0.0	5008	,	,		18164	0.0		0.0	False		,,,				2504	0.001															0													103.0	97.0	99.0					4																	110895897		2203	4300	6503	SO:0001583	missense	1950			X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1763G>A	4.37:g.110895897G>A	ENSP00000265171:p.Arg588His	Somatic		WXS	Illumina GAIIx	Phase_I	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	ENST00000265171.5	37	CCDS3689.1	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.990370	0.00439	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.95412	-3.7;-3.7;-3.7	4.85	0.913	0.19354	Six-bladed beta-propeller, TolB-like (1);	0.543217	0.22515	N	0.059056	T	0.78329	0.4266	N	0.00554	-1.385	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.72459	-0.4287	10	0.13470	T	0.59	.	4.8636	0.13596	0.7034:0.0:0.1589:0.1378	.	588;546;588	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	H	546;588;588	ENSP00000424316:R546H;ENSP00000265171:R588H;ENSP00000421384:R588H	ENSP00000265171:R588H	R	+	2	0	EGF	111115346	0.016000	0.18221	0.009000	0.14445	0.229000	0.25112	2.713000	0.47194	0.002000	0.14630	-0.238000	0.12139	CGT		0.353	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1			17	40	17	40
TNXB	7148	hgsc.bcm.edu;ucsc.edu	37	6	32038129	32038129	+	Missense_Mutation	SNP	G	G	C	rs560219178		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr6:32038129G>C	ENST00000375244.3	-	14	5254	c.5053C>G	c.(5053-5055)Ccc>Gcc	p.P1685A	TNXB_ENST00000375247.2_Missense_Mutation_p.P1685A			P22105	TENX_HUMAN	tenascin XB	1767	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TCTGGGGTGGGGTCTGTCACC	0.602																																																0													16.0	18.0	17.0					6																	32038129		1924	4117	6041	SO:0001583	missense	7148			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5053C>G	6.37:g.32038129G>C	ENSP00000364393:p.Pro1685Ala	Somatic		WXS	Illumina GAIIx	Phase_I	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	G	8.969	0.972538	0.18736	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.55930	0.49;0.49	5.16	4.27	0.50696	.	0.270973	0.26035	N	0.026739	T	0.20414	0.0491	L	0.31752	0.955	0.20403	N	0.999902	B	0.21520	0.057	B	0.27887	0.084	T	0.11665	-1.0578	10	0.33940	T	0.23	.	8.6025	0.33754	0.0:0.1672:0.6598:0.173	.	1685	P22105-3	.	A	1685	ENSP00000364393:P1685A;ENSP00000364396:P1685A	ENSP00000364393:P1685A	P	-	1	0	TNXB	32146107	0.423000	0.25482	0.857000	0.33713	0.677000	0.39632	0.479000	0.22228	1.134000	0.42165	0.655000	0.94253	CCC		0.602	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105		5	43	5	43
SDK1	221935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	4026875	4026875	+	Silent	SNP	C	C	T	rs550278515		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr7:4026875C>T	ENST00000404826.2	+	14	2191	c.2052C>T	c.(2050-2052)caC>caT	p.H684H	SDK1_ENST00000389531.3_Silent_p.H684H	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	684	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CCCACAGCCACGCCGTGGTGC	0.458																																																0													155.0	150.0	152.0					7																	4026875		2203	4300	6503	SO:0001819	synonymous_variant	221935			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2052C>T	7.37:g.4026875C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	37	CCDS34590.1																																																																																				0.458	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744		21	177	21	177
CDHR3	222256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	105669001	105669001	+	Silent	SNP	G	G	A	rs267601221		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr7:105669001G>A	ENST00000317716.9	+	17	2357	c.2277G>A	c.(2275-2277)acG>acA	p.T759T	CDHR3_ENST00000343407.5_Missense_Mutation_p.E262K|CDHR3_ENST00000470188.1_3'UTR|CDHR3_ENST00000478080.1_Silent_p.T671T|CDHR3_ENST00000542731.1_Silent_p.T759T	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	759					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						CTGCAGAAACGAAGACTGCAG	0.537																																																0													64.0	64.0	64.0					7																	105669001		1948	4149	6097	SO:0001819	synonymous_variant	222256			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.2277G>A	7.37:g.105669001G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q8TCI7	Missense_Mutation	SNP	ENST00000317716.9	37	CCDS47684.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.376366	0.61735	.	.	ENSG00000128536	ENST00000343407;ENST00000466045	T;T	0.77098	-1.07;-0.44	6.08	3.03	0.35002	.	.	.	.	.	T	0.68668	0.3026	.	.	.	0.20563	N	0.999888	B	0.28667	0.219	B	0.23716	0.048	T	0.61436	-0.7063	8	0.87932	D	0	-1.9056	10.642	0.45598	0.0775:0.3165:0.606:0.0	.	260	Q6ZTQ4-2	.	K	262;301	ENSP00000341510:E262K;ENSP00000419017:E301K	ENSP00000341510:E262K	E	+	1	0	CDHR3	105456237	0.204000	0.23447	0.462000	0.27118	0.464000	0.32679	0.642000	0.24735	0.810000	0.34279	0.655000	0.94253	GAA		0.537	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349025.2	NM_152750		24	37	24	37
ZC3HAV1L	92092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	138711561	138711561	+	Missense_Mutation	SNP	G	G	C			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr7:138711561G>C	ENST00000275766.1	-	4	790	c.779C>G	c.(778-780)aCt>aGt	p.T260S		NM_080660.3	NP_542391.2	Q96H79	ZCCHL_HUMAN	zinc finger CCCH-type, antiviral 1-like	260										NS(2)|endometrium(2)|large_intestine(1)|lung(4)|skin(1)	10						TGAATGCTCAGTCGAAGGTGA	0.517																																																0													72.0	75.0	74.0					7																	138711561		2203	4300	6503	SO:0001583	missense	92092			BC008842	CCDS5850.1	7q34	2006-07-03	2006-07-03	2006-07-03	ENSG00000146858	ENSG00000146858			22423	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 39"""	C7orf39			Standard	NM_080660		Approved	MGC14289	uc003vum.1	Q96H79	OTTHUMG00000157229	ENST00000275766.1:c.779C>G	7.37:g.138711561G>C	ENSP00000275766:p.Thr260Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q8WUD9	Missense_Mutation	SNP	ENST00000275766.1	37	CCDS5850.1	.	.	.	.	.	.	.	.	.	.	G	1.185	-0.636984	0.03557	.	.	ENSG00000146858	ENST00000275766	T	0.30182	1.54	3.93	3.05	0.35203	.	0.899723	0.09304	N	0.820478	T	0.15825	0.0381	N	0.14661	0.345	0.09310	N	1	B	0.19200	0.034	B	0.17098	0.017	T	0.28618	-1.0038	10	0.07482	T	0.82	.	7.6096	0.28122	0.1137:0.0:0.8863:0.0	.	260	Q96H79	ZCCHL_HUMAN	S	260	ENSP00000275766:T260S	ENSP00000275766:T260S	T	-	2	0	ZC3HAV1L	138362101	0.105000	0.21958	0.095000	0.20976	0.042000	0.13812	1.357000	0.34090	1.237000	0.43756	0.561000	0.74099	ACT		0.517	ZC3HAV1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348090.1	NM_080660		9	56	9	56
DLC1	10395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	12946019	12946019	+	Silent	SNP	A	A	C			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:12946019A>C	ENST00000276297.4	-	16	4678	c.4269T>G	c.(4267-4269)ccT>ccG	p.P1423P	DLC1_ENST00000520226.1_Silent_p.P912P|DLC1_ENST00000512044.2_Silent_p.P1020P|DLC1_ENST00000358919.2_Silent_p.P986P|DLC1_ENST00000510318.1_5'UTR	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1423	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						AGTCTCGAGCAGGATGAGGTG	0.423																																																0													138.0	125.0	130.0					8																	12946019		2203	4300	6503	SO:0001819	synonymous_variant	10395			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.4269T>G	8.37:g.12946019A>C		Somatic		WXS	Illumina GAIIx	Phase_I	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Silent	SNP	ENST00000276297.4	37	CCDS5989.1																																																																																				0.423	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094		19	100	19	100
MTUS1	57509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	17581236	17581236	+	Silent	SNP	T	T	G			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:17581236T>G	ENST00000262102.6	-	4	2618	c.2394A>C	c.(2392-2394)ggA>ggC	p.G798G	MTUS1_ENST00000519263.1_Intron|MTUS1_ENST00000381869.3_Intron|MTUS1_ENST00000381861.3_5'Flank|MTUS1_ENST00000544260.1_5'Flank	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	798					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		AGGGGGTGCTTCCTGTCCTCC	0.483																																																0													120.0	115.0	116.0					8																	17581236		1946	4134	6080	SO:0001819	synonymous_variant	57509			AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.2394A>C	8.37:g.17581236T>G		Somatic		WXS	Illumina GAIIx	Phase_I	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Silent	SNP	ENST00000262102.6	37	CCDS43717.1																																																																																				0.483	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031		14	120	14	120
PSD3	23362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	18393458	18393458	+	Missense_Mutation	SNP	T	T	C			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:18393458T>C	ENST00000327040.8	-	16	3041	c.2939A>G	c.(2938-2940)tAt>tGt	p.Y980C	PSD3_ENST00000523619.1_Missense_Mutation_p.Y915C|PSD3_ENST00000286485.8_Missense_Mutation_p.Y446C|PSD3_ENST00000440756.2_Missense_Mutation_p.Y982C|PSD3_ENST00000428502.2_Missense_Mutation_p.Y309C	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	981					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		ATACATTTCATAGCGGGTTTT	0.483																																																0													84.0	76.0	79.0					8																	18393458		2203	4300	6503	SO:0001583	missense	23362			AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.2939A>G	8.37:g.18393458T>C	ENSP00000324127:p.Tyr980Cys	Somatic		WXS	Illumina GAIIx	Phase_I	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Missense_Mutation	SNP	ENST00000327040.8	37	CCDS43720.1	.	.	.	.	.	.	.	.	.	.	T	15.25	2.778358	0.49786	.	.	ENSG00000156011	ENST00000327040;ENST00000440756;ENST00000381690;ENST00000286485;ENST00000428502;ENST00000523619	T;T;T;T	0.28255	2.15;2.17;1.62;2.15	5.8	5.8	0.92144	.	0.000000	0.41823	U	0.000802	T	0.59142	0.2172	M	0.83312	2.635	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.91635	0.997;0.997;0.999;0.954	T	0.65121	-0.6245	10	0.87932	D	0	.	14.0873	0.64964	0.0:0.0:0.0:1.0	.	980;981;446;309	E9KL50;Q9NYI0;Q9NYI0-3;B4DKF8	.;PSD3_HUMAN;.;.	C	980;982;202;446;309;915	ENSP00000324127:Y980C;ENSP00000401704:Y982C;ENSP00000286485:Y446C;ENSP00000430640:Y915C	ENSP00000286485:Y446C	Y	-	2	0	PSD3	18437738	1.000000	0.71417	0.700000	0.30305	0.332000	0.28634	6.367000	0.73099	2.205000	0.71048	0.533000	0.62120	TAT		0.483	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1	NM_015310		13	97	13	97
UNC5D	137970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	35406823	35406823	+	Silent	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:35406823C>T	ENST00000404895.2	+	2	445	c.117C>T	c.(115-117)ggC>ggT	p.G39G	UNC5D_ENST00000287272.2_Silent_p.G39G|UNC5D_ENST00000416672.1_Silent_p.G39G|UNC5D_ENST00000420357.1_Silent_p.G39G|UNC5D_ENST00000453357.2_Silent_p.G34G	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	39					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.G34G(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CTGACAATGGCGAAGCCCTTC	0.468																																																1	Substitution - coding silent(1)	large_intestine(1)											56.0	55.0	55.0					8																	35406823		2203	4300	6503	SO:0001819	synonymous_variant	137970			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.117C>T	8.37:g.35406823C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q8WYP7	Silent	SNP	ENST00000404895.2	37	CCDS6093.2																																																																																				0.468	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			27	55	27	55
RBM12B	389677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	94747027	94747027	+	Missense_Mutation	SNP	C	C	G			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:94747027C>G	ENST00000399300.2	-	3	1825	c.1612G>C	c.(1612-1614)Gat>Cat	p.D538H	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Missense_Mutation_p.D538H|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	538							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TTGAAGTTATCCAGTTGCCTC	0.493																																																0													104.0	101.0	102.0					8																	94747027		1880	4108	5988	SO:0001583	missense	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.1612G>C	8.37:g.94747027C>G	ENSP00000382239:p.Asp538His	Somatic		WXS	Illumina GAIIx	Phase_I	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.149997	0.37923	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.06849	3.25;3.25	4.98	4.11	0.48088	.	0.428461	0.22121	N	0.064321	T	0.08088	0.0202	N	0.19112	0.55	0.09310	N	1	P	0.41313	0.745	B	0.44224	0.444	T	0.15780	-1.0425	10	0.62326	D	0.03	-12.0989	11.2395	0.48962	0.0:0.9112:0.0:0.0888	.	538	Q8IXT5	RB12B_HUMAN	H	538	ENSP00000382239:D538H;ENSP00000427729:D538H	ENSP00000382239:D538H	D	-	1	0	RBM12B	94816203	0.008000	0.16893	0.077000	0.20336	0.979000	0.70002	1.518000	0.35877	1.456000	0.47831	0.655000	0.94253	GAT		0.493	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		20	132	20	132
RBM12B	389677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	94747336	94747336	+	Missense_Mutation	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:94747336C>T	ENST00000399300.2	-	3	1516	c.1303G>A	c.(1303-1305)Gat>Aat	p.D435N	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Missense_Mutation_p.D435N|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	435	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			CCTTTGTCATCATAAAGCAAG	0.373																																																0													137.0	128.0	131.0					8																	94747336		1862	4095	5957	SO:0001583	missense	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.1303G>A	8.37:g.94747336C>T	ENSP00000382239:p.Asp435Asn	Somatic		WXS	Illumina GAIIx	Phase_I	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.317984	0.60524	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.10288	2.89;2.89	5.36	3.57	0.40892	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.172021	0.40640	N	0.001051	T	0.25232	0.0613	M	0.64567	1.98	0.58432	D	0.999998	D	0.61697	0.99	D	0.65573	0.936	T	0.00909	-1.1518	10	0.28530	T	0.3	-23.1483	12.0058	0.53259	0.0:0.8591:0.0:0.1409	.	435	Q8IXT5	RB12B_HUMAN	N	435	ENSP00000382239:D435N;ENSP00000427729:D435N	ENSP00000382239:D435N	D	-	1	0	RBM12B	94816512	1.000000	0.71417	0.995000	0.50966	0.945000	0.59286	7.445000	0.80570	0.760000	0.33108	-0.229000	0.12294	GAT		0.373	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		32	173	32	173
RBM12B	389677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	94747712	94747712	+	Silent	SNP	C	C	G			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:94747712C>G	ENST00000399300.2	-	3	1140	c.927G>C	c.(925-927)ctG>ctC	p.L309L	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Silent_p.L309L|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	309	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			GTTCATCAGTCAGATCAGTAC	0.343																																																0													60.0	59.0	59.0					8																	94747712		1808	4072	5880	SO:0001819	synonymous_variant	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.927G>C	8.37:g.94747712C>G		Somatic		WXS	Illumina GAIIx	Phase_I	A8MYB5	Silent	SNP	ENST00000399300.2	37	CCDS43755.1																																																																																				0.343	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		12	70	12	70
RBM12B	389677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	94747854	94747854	+	Missense_Mutation	SNP	C	C	G			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:94747854C>G	ENST00000399300.2	-	3	998	c.785G>C	c.(784-786)aGa>aCa	p.R262T	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Missense_Mutation_p.R262T|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	262							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TCGAAAATGTCTATCATTAAT	0.398																																																0													120.0	111.0	114.0					8																	94747854		1854	4098	5952	SO:0001583	missense	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.785G>C	8.37:g.94747854C>G	ENSP00000382239:p.Arg262Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	14.93	2.683665	0.47991	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.07908	3.15;3.17	5.36	3.45	0.39498	.	0.368879	0.25564	N	0.029809	T	0.05914	0.0154	L	0.36672	1.1	0.29260	N	0.871381	P	0.43231	0.801	B	0.34180	0.177	T	0.15896	-1.0421	10	0.51188	T	0.08	-19.504	8.7596	0.34667	0.1245:0.5255:0.3499:0.0	.	262	Q8IXT5	RB12B_HUMAN	T	262	ENSP00000382239:R262T;ENSP00000427729:R262T	ENSP00000382239:R262T	R	-	2	0	RBM12B	94817030	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.750000	0.38329	2.672000	0.90937	0.591000	0.81541	AGA		0.398	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		12	112	12	112
RBM12B	389677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	94747893	94747893	+	Missense_Mutation	SNP	C	C	T	rs533252158	byFrequency	TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:94747893C>T	ENST00000399300.2	-	3	959	c.746G>A	c.(745-747)aGa>aAa	p.R249K	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Missense_Mutation_p.R249K|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	249							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TTCTTCAGATCTCCTAAGAAC	0.398																																																0													144.0	134.0	137.0					8																	94747893		1885	4124	6009	SO:0001583	missense	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.746G>A	8.37:g.94747893C>T	ENSP00000382239:p.Arg249Lys	Somatic		WXS	Illumina GAIIx	Phase_I	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	12.48	1.952067	0.34471	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.06768	3.26;3.27	5.11	5.11	0.69529	.	0.097942	0.44285	D	0.000478	T	0.06962	0.0177	N	0.25647	0.755	0.25328	N	0.989056	B	0.22683	0.073	B	0.26094	0.066	T	0.25572	-1.0128	10	0.35671	T	0.21	-8.366	9.9428	0.41591	0.0:0.9068:0.0:0.0932	.	249	Q8IXT5	RB12B_HUMAN	K	249	ENSP00000382239:R249K;ENSP00000427729:R249K	ENSP00000382239:R249K	R	-	2	0	RBM12B	94817069	0.958000	0.32768	0.874000	0.34290	0.385000	0.30292	1.624000	0.37018	2.551000	0.86045	0.585000	0.79938	AGA		0.398	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		13	145	13	145
RBM12B	389677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	94747940	94747940	+	Missense_Mutation	SNP	C	C	A			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:94747940C>A	ENST00000399300.2	-	3	912	c.699G>T	c.(697-699)tgG>tgT	p.W233C	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Missense_Mutation_p.W233C|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	233							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			CAAACTCAATCCACTGTTGTT	0.373																																																0													167.0	155.0	159.0					8																	94747940		1918	4124	6042	SO:0001583	missense	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.699G>T	8.37:g.94747940C>A	ENSP00000382239:p.Trp233Cys	Somatic		WXS	Illumina GAIIx	Phase_I	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.214237	0.58452	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.29397	1.57;1.57	5.35	5.35	0.76521	.	0.000000	0.56097	D	0.000028	T	0.53610	0.1807	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.54002	-0.8358	10	0.87932	D	0	-16.0119	19.0393	0.92992	0.0:1.0:0.0:0.0	.	233	Q8IXT5	RB12B_HUMAN	C	233	ENSP00000382239:W233C;ENSP00000427729:W233C	ENSP00000382239:W233C	W	-	3	0	RBM12B	94817116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.842000	0.48230	2.667000	0.90743	0.585000	0.79938	TGG		0.373	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		23	149	23	149
RBM12B	389677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	94747956	94747956	+	Missense_Mutation	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:94747956C>T	ENST00000399300.2	-	3	896	c.683G>A	c.(682-684)gGa>gAa	p.G228E	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Missense_Mutation_p.G228E|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	228	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TTGTTCTGATCCTTGCATTAC	0.383																																																0													165.0	154.0	158.0					8																	94747956		1919	4122	6041	SO:0001583	missense	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.683G>A	8.37:g.94747956C>T	ENSP00000382239:p.Gly228Glu	Somatic		WXS	Illumina GAIIx	Phase_I	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345830	0.41599	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.29397	1.57;1.57	5.35	4.42	0.53409	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.203306	0.34268	N	0.004108	T	0.16769	0.0403	N	0.08118	0	0.30067	N	0.810383	B	0.31125	0.309	B	0.25140	0.058	T	0.14896	-1.0456	10	0.66056	D	0.02	-11.532	14.4094	0.67106	0.0:0.7718:0.2282:0.0	.	228	Q8IXT5	RB12B_HUMAN	E	228	ENSP00000382239:G228E;ENSP00000427729:G228E	ENSP00000382239:G228E	G	-	2	0	RBM12B	94817132	0.781000	0.28676	1.000000	0.80357	0.998000	0.95712	1.028000	0.30128	2.667000	0.90743	0.585000	0.79938	GGA		0.383	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		23	158	23	158
RBM12B	389677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	94748053	94748053	+	Missense_Mutation	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:94748053C>T	ENST00000399300.2	-	3	799	c.586G>A	c.(586-588)Gat>Aat	p.D196N	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Missense_Mutation_p.D196N|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	196	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			ACTATGGCATCACCATTATTT	0.363																																																0													145.0	134.0	137.0					8																	94748053		1910	4148	6058	SO:0001583	missense	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.586G>A	8.37:g.94748053C>T	ENSP00000382239:p.Asp196Asn	Somatic		WXS	Illumina GAIIx	Phase_I	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.706047	0.30232	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.09073	3.02;3.02	5.35	4.47	0.54385	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.093191	0.46758	D	0.000275	T	0.06872	0.0175	L	0.27053	0.805	0.34016	D	0.652048	B	0.30326	0.276	B	0.36378	0.223	T	0.30621	-0.9972	10	0.13853	T	0.58	-23.4506	9.5472	0.39288	0.0:0.7804:0.1441:0.0755	.	196	Q8IXT5	RB12B_HUMAN	N	196	ENSP00000382239:D196N;ENSP00000427729:D196N	ENSP00000382239:D196N	D	-	1	0	RBM12B	94817229	0.362000	0.24980	1.000000	0.80357	0.992000	0.81027	0.857000	0.27831	1.362000	0.46000	0.585000	0.79938	GAT		0.363	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		19	159	19	159
RBM12B	389677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	94748131	94748131	+	Missense_Mutation	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:94748131C>T	ENST00000399300.2	-	3	721	c.508G>A	c.(508-510)Gat>Aat	p.D170N	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Missense_Mutation_p.D170N|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	170	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			ACACGTACATCATCTTCATTT	0.393																																																0													114.0	109.0	111.0					8																	94748131		1952	4146	6098	SO:0001583	missense	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.508G>A	8.37:g.94748131C>T	ENSP00000382239:p.Asp170Asn	Somatic		WXS	Illumina GAIIx	Phase_I	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704593	0.68615	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.12255	2.7;2.7	5.66	5.66	0.87406	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.097986	0.45126	D	0.000399	T	0.39809	0.1092	M	0.79693	2.465	0.51767	D	0.999939	D	0.69078	0.997	P	0.62491	0.903	T	0.14364	-1.0475	10	0.51188	T	0.08	-32.0679	19.3556	0.94412	0.0:1.0:0.0:0.0	.	170	Q8IXT5	RB12B_HUMAN	N	170	ENSP00000382239:D170N;ENSP00000427729:D170N	ENSP00000382239:D170N	D	-	1	0	RBM12B	94817307	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.731000	0.68554	2.672000	0.90937	0.591000	0.81541	GAT		0.393	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		11	76	11	76
UNC13B	10497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	35366984	35366984	+	Missense_Mutation	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr9:35366984C>T	ENST00000378495.3	+	11	1430	c.1208C>T	c.(1207-1209)cCg>cTg	p.P403L	UNC13B_ENST00000396787.1_Missense_Mutation_p.P415L|UNC13B_ENST00000378496.4_Missense_Mutation_p.P403L	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	403					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			CAGTGGCTCCCGGAAGGGTAA	0.448																																																0													121.0	112.0	115.0					9																	35366984		2203	4300	6503	SO:0001583	missense	10497			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.1208C>T	9.37:g.35366984C>T	ENSP00000367756:p.Pro403Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q5VYM8	Missense_Mutation	SNP	ENST00000378495.3	37	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.741120	0.30865	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496	D;D;D	0.83335	-1.58;-1.51;-1.71	5.87	4.92	0.64577	.	0.311253	0.31335	N	0.007827	T	0.55210	0.1906	N	0.03608	-0.345	0.44694	D	0.997685	P;P	0.43352	0.512;0.804	B;B	0.31101	0.054;0.124	T	0.64706	-0.6344	10	0.07813	T	0.8	-12.1465	11.9154	0.52763	0.2664:0.7336:0.0:0.0	.	403;403	F8W8M9;O14795	.;UN13B_HUMAN	L	415;403;403	ENSP00000380006:P415L;ENSP00000367756:P403L;ENSP00000367757:P403L	ENSP00000367756:P403L	P	+	2	0	UNC13B	35356984	0.996000	0.38824	0.995000	0.50966	0.792000	0.44763	3.558000	0.53749	2.785000	0.95823	0.655000	0.94253	CCG		0.448	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377		44	57	44	57
ROR2	4920	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	94495542	94495542	+	Missense_Mutation	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr9:94495542C>T	ENST00000375708.3	-	6	997	c.799G>A	c.(799-801)Gag>Aag	p.E267K	ROR2_ENST00000375715.1_Missense_Mutation_p.E127K|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	267	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						ATGGTGTACTCCTGGCGGCAC	0.672																																																0													45.0	40.0	42.0					9																	94495542		2203	4300	6503	SO:0001583	missense	4920			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.799G>A	9.37:g.94495542C>T	ENSP00000364860:p.Glu267Lys	Somatic		WXS	Illumina GAIIx	Phase_I	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	ENST00000375708.3	37	CCDS6691.1	.	.	.	.	.	.	.	.	.	.	C	35	5.428656	0.96131	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	T;T	0.76448	-1.02;-1.02	4.44	4.44	0.53790	Frizzled domain (2);Kringle (1);	0.000000	0.42420	D	0.000717	D	0.88112	0.6349	M	0.78456	2.415	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.995;1.0	D	0.90021	0.4128	10	0.87932	D	0	.	17.2815	0.87129	0.0:1.0:0.0:0.0	.	267;267;127	A1L4F5;Q01974;B1APY4	.;ROR2_HUMAN;.	K	127;267	ENSP00000364867:E127K;ENSP00000364860:E267K	ENSP00000364860:E267K	E	-	1	0	ROR2	93535363	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	7.560000	0.82277	2.306000	0.77630	0.561000	0.74099	GAG		0.672	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1			9	29	9	29
RGS3	5998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	116358026	116358026	+	Missense_Mutation	SNP	C	C	T	rs144334750		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr9:116358026C>T	ENST00000374140.2	+	25	3601	c.3392C>T	c.(3391-3393)gCg>gTg	p.A1131V	RGS3_ENST00000462143.1_Missense_Mutation_p.A452V|RGS3_ENST00000342620.5_Missense_Mutation_p.A101V|RGS3_ENST00000462403.1_Missense_Mutation_p.A244V|RGS3_ENST00000374134.3_Missense_Mutation_p.A452V|RGS3_ENST00000350696.5_Missense_Mutation_p.A1131V|RGS3_ENST00000394646.3_Missense_Mutation_p.A524V|RGS3_ENST00000343817.5_Missense_Mutation_p.A850V	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	1131	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						GAATACATCGCGATCCAGGCA	0.567																																																0								C	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	2,4404	4.2+/-10.8	0,2,2201	180.0	144.0	156.0		1355,2549,302,3392,731	5.5	0.5	9	dbSNP_134	156	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense,missense,missense	RGS3	NM_021106.3,NM_130795.2,NM_134427.1,NM_144488.4,NM_144489.2	64,64,64,64,64	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	452/520,850/918,101/169,1131/1199,244/312	116358026	3,13003	2203	4300	6503	SO:0001583	missense	5998			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.3392C>T	9.37:g.116358026C>T	ENSP00000363255:p.Ala1131Val	Somatic		WXS	Illumina GAIIx	Phase_I	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	ENST00000374140.2	37	CCDS43869.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103554	0.76983	4.54E-4	1.16E-4	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000343817;ENST00000394646;ENST00000474719;ENST00000462143;ENST00000342620;ENST00000374134;ENST00000462403	T;T;T;T;T;T;T;T	0.02323	4.34;4.34;4.34;4.34;4.34;4.34;4.34;4.34	5.46	5.46	0.80206	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.64402	D	0.000001	T	0.13457	0.0326	M	0.62266	1.93	0.80722	D	1	D;P;D;D;D;D	0.89917	0.993;0.899;0.996;1.0;1.0;0.997	P;B;P;D;D;P	0.72625	0.488;0.245;0.636;0.966;0.978;0.57	T	0.00804	-1.1559	10	0.39692	T	0.17	.	18.3694	0.90402	0.0:1.0:0.0:0.0	.	524;244;1027;850;1021;1131	B3KUB2;Q5VZ06;P49796-6;P49796-4;B3KWG8;P49796	.;.;.;.;.;RGS3_HUMAN	V	1131;1131;850;524;299;452;101;452;244	ENSP00000363255:A1131V;ENSP00000259406:A1131V;ENSP00000340284:A850V;ENSP00000378141:A524V;ENSP00000420356:A452V;ENSP00000343359:A101V;ENSP00000363249:A452V;ENSP00000436168:A244V	ENSP00000343359:A101V	A	+	2	0	RGS3	115397847	1.000000	0.71417	0.507000	0.27676	0.603000	0.37013	5.778000	0.68940	2.564000	0.86499	0.456000	0.33151	GCG		0.567	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055561.3	NM_017790		29	56	29	56
TRIM32	22954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	119461244	119461244	+	Missense_Mutation	SNP	G	G	A	rs183136193		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr9:119461244G>A	ENST00000450136.1	+	2	1384	c.1223G>A	c.(1222-1224)cGc>cAc	p.R408H	ASTN2_ENST00000361209.2_Intron|TRIM32_ENST00000373983.2_Missense_Mutation_p.R408H|ASTN2_ENST00000373996.3_Intron|ASTN2_ENST00000361477.3_Intron|ASTN2_ENST00000313400.4_Intron	NM_001099679.1|NM_012210.3	NP_001093149.1|NP_036342.2	Q13049	TRI32_HUMAN	tripartite motif containing 32	408			R -> C (in dbSNP:rs3747835).		fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of proteolysis (GO:0045862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of type I interferon production (GO:0032479)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|striated muscle myosin thick filament (GO:0005863)	ligase activity (GO:0016874)|myosin binding (GO:0017022)|protein self-association (GO:0043621)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|translation initiation factor binding (GO:0031369)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	26						AAGGAAATCCGCCGCAGCCCC	0.517																																					Esophageal Squamous(92;212 1916 19711 26951)											0													97.0	104.0	102.0					9																	119461244		2203	4300	6503	SO:0001583	missense	22954			U18543	CCDS6817.1	9q33.1	2014-09-17	2011-01-25		ENSG00000119401	ENSG00000119401		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16380	protein-coding gene	gene with protein product		602290	"""limb girdle muscular dystrophy 2H (autosomal recessive)"", ""tripartite motif-containing 32"""	LGMD2H		11331580, 7778269, 16606853	Standard	NM_001099679		Approved	HT2A, TATIP, BBS11	uc004bjx.2	Q13049	OTTHUMG00000021026	ENST00000450136.1:c.1223G>A	9.37:g.119461244G>A	ENSP00000408292:p.Arg408His	Somatic		WXS	Illumina GAIIx	Phase_I	Q9NQP8	Missense_Mutation	SNP	ENST00000450136.1	37	CCDS6817.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	16.19	3.051909	0.55218	.	.	ENSG00000119401	ENST00000450136;ENST00000373983	D;D	0.90444	-2.67;-2.67	5.47	5.47	0.80525	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.83519	0.5272	N	0.24115	0.695	0.80722	D	1	B	0.30709	0.291	B	0.13407	0.009	T	0.80369	-0.1411	9	.	.	.	-19.2882	19.3288	0.94275	0.0:0.0:1.0:0.0	.	408	Q13049	TRI32_HUMAN	H	408	ENSP00000408292:R408H;ENSP00000363095:R408H	.	R	+	2	0	TRIM32	118501065	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.592000	0.82676	2.551000	0.86045	0.650000	0.86243	CGC		0.517	TRIM32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055466.2	NM_012210		86	103	86	103
ANAPC2	29882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	140079392	140079392	+	Missense_Mutation	SNP	T	T	C			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr9:140079392T>C	ENST00000323927.2	-	4	1025	c.1021A>G	c.(1021-1023)Atc>Gtc	p.I341V		NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	341					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		AGCTCCTCGATGCGCAGGCTG	0.701																																																0													57.0	50.0	52.0					9																	140079392		2201	4299	6500	SO:0001583	missense	29882			AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1021A>G	9.37:g.140079392T>C	ENSP00000314004:p.Ile341Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	ENST00000323927.2	37	CCDS7033.1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.581603	0.65992	.	.	ENSG00000176248	ENST00000323927	T	0.02787	4.16	4.38	3.24	0.37175	.	0.053176	0.85682	N	0.000000	T	0.06371	0.0164	M	0.70275	2.135	0.58432	D	0.999997	D;D	0.57571	0.966;0.98	B;P	0.49047	0.395;0.599	T	0.28650	-1.0037	10	0.42905	T	0.14	-15.0472	7.7573	0.28932	0.0:0.1024:0.0:0.8976	.	341;341	Q9UJX6;Q9UJX6-2	ANC2_HUMAN;.	V	341	ENSP00000314004:I341V	ENSP00000314004:I341V	I	-	1	0	ANAPC2	139199213	1.000000	0.71417	0.982000	0.44146	0.979000	0.70002	5.827000	0.69300	0.569000	0.29329	0.379000	0.24179	ATC		0.701	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055315.1	NM_013366		7	54	7	54
GDPD2	54857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	69652495	69652495	+	Missense_Mutation	SNP	A	A	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chrX:69652495A>T	ENST00000374382.3	+	14	1773	c.1522A>T	c.(1522-1524)Acc>Tcc	p.T508S	GDPD2_ENST00000453994.2_Missense_Mutation_p.T559S|GDPD2_ENST00000472623.1_3'UTR|GDPD2_ENST00000536730.1_Missense_Mutation_p.T429S|GDPD2_ENST00000538649.1_Missense_Mutation_p.T429S	NM_017711.3	NP_060181.2	Q9HCC8	GDPD2_HUMAN	glycerophosphodiester phosphodiesterase domain containing 2	508					glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol inositolphosphodiesterase activity (GO:0047394)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(6)|large_intestine(8)|lung(3)|ovary(2)	22	Renal(35;0.156)					GCTTTTGTGGACCTTCCTCCT	0.488																																																0													169.0	140.0	150.0					X																	69652495		2203	4300	6503	SO:0001583	missense	54857			AK000214	CCDS14402.1, CCDS55437.1, CCDS55438.1	Xq13.1	2011-01-25			ENSG00000130055	ENSG00000130055			25974	protein-coding gene	gene with protein product	"""osteoblast differentiation promoting factor"""					12975309	Standard	NM_017711		Approved	OBDPF, FLJ20207, GDE3	uc011mpk.2	Q9HCC8	OTTHUMG00000021776	ENST00000374382.3:c.1522A>T	X.37:g.69652495A>T	ENSP00000363503:p.Thr508Ser	Somatic		WXS	Illumina GAIIx	Phase_I	B4DRH4|B4DVC9|Q9NXJ6	Missense_Mutation	SNP	ENST00000374382.3	37	CCDS14402.1	.	.	.	.	.	.	.	.	.	.	A	9.523	1.108708	0.20714	.	.	ENSG00000130055	ENST00000453994;ENST00000536730;ENST00000538649;ENST00000374382	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	4.77	2.26	0.28386	.	0.823945	0.11366	N	0.571428	T	0.34135	0.0887	L	0.44542	1.39	0.09310	N	0.999999	B;B	0.16166	0.016;0.004	B;B	0.12156	0.007;0.002	T	0.23261	-1.0193	9	.	.	.	-1.4126	3.409	0.07351	0.5423:0.2:0.2577:0.0	.	559;508	B4DVC9;Q9HCC8	.;GDPD2_HUMAN	S	559;429;429;508	ENSP00000414019:T559S;ENSP00000445982:T429S;ENSP00000444601:T429S;ENSP00000363503:T508S	.	T	+	1	0	GDPD2	69569220	0.857000	0.29778	0.729000	0.30791	0.589000	0.36550	0.813000	0.27225	0.651000	0.30788	0.381000	0.24937	ACC		0.488	GDPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057070.1	NM_017711		32	180	32	180
ATRX	546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	76939496	76939496	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chrX:76939496G>A	ENST00000373344.5	-	9	1466	c.1252C>T	c.(1252-1254)Cga>Tga	p.R418*	ATRX_ENST00000395603.3_Nonsense_Mutation_p.R380*|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	418					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TCCATCGCTCGAAACTCGGAA	0.373			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											163.0	162.0	162.0					X																	76939496		2203	4295	6498	SO:0001587	stop_gained	546			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.1252C>T	X.37:g.76939496G>A	ENSP00000362441:p.Arg418*	Somatic		WXS	Illumina GAIIx	Phase_I	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	g	17.75	3.465931	0.63625	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	5.06	3.23	0.37069	.	0.919132	0.09194	N	0.835594	.	.	.	.	.	.	0.31534	N	0.660867	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	3.1135	9.6724	0.40019	0.0:0.1335:0.5848:0.2817	.	.	.	.	X	418;380;374	.	ENSP00000362441:R418X	R	-	1	2	ATRX	76826152	0.353000	0.24904	0.102000	0.21198	0.011000	0.07611	1.048000	0.30379	0.334000	0.23590	0.509000	0.49947	CGA		0.373	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		188	184	188	184
TENM1	10178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	123785888	123785888	+	Silent	SNP	G	G	A			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chrX:123785888G>A	ENST00000371130.3	-	8	1518	c.1455C>T	c.(1453-1455)aaC>aaT	p.N485N	TENM1_ENST00000422452.2_Silent_p.N485N	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	485					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TTAAGATCAGGTTCCGAGGGG	0.433																																																0													152.0	135.0	141.0					X																	123785888		2203	4300	6503	SO:0001819	synonymous_variant	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.1455C>T	X.37:g.123785888G>A		Somatic		WXS	Illumina GAIIx	Phase_I	B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	CCDS14609.1																																																																																				0.433	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		8	59	8	59
PCDHGB4	8641	broad.mit.edu;ucsc.edu	37	5	140769361	140769361	+	Missense_Mutation	SNP	G	G	A			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr5:140769361G>A	ENST00000519479.1	+	1	1910	c.1910G>A	c.(1909-1911)cGc>cAc	p.R637H	PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA7_ENST00000518325.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	637	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGCCGTCCGCCAGCGCCTT	0.692																																																0													42.0	46.0	44.0					5																	140769361		2109	4211	6320	SO:0001583	missense	8641			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1910G>A	5.37:g.140769361G>A	ENSP00000428288:p.Arg637His	Somatic		WXS	Illumina GAIIx	Phase_I	O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	ENST00000519479.1	37	CCDS54928.1	.	.	.	.	.	.	.	.	.	.	.	13.64	2.298946	0.40694	.	.	ENSG00000253953	ENST00000519479	T	0.52754	0.65	5.05	5.05	0.67936	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.61565	0.2357	L	0.51422	1.61	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.53085	-0.8488	9	0.87932	D	0	.	10.4579	0.44561	0.1256:0.0:0.8744:0.0	.	637;637	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	H	637	ENSP00000428288:R637H	ENSP00000428288:R637H	R	+	2	0	PCDHGB4	140749545	0.000000	0.05858	0.574000	0.28523	0.026000	0.11368	1.121000	0.31283	2.503000	0.84419	0.563000	0.77884	CGC		0.692	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736		19	48	19	48
SIGLEC16	400709	broad.mit.edu;ucsc.edu	37	19	50475156	50475156	+	RNA	SNP	G	G	A	rs574295570		TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr19:50475156G>A	ENST00000602139.1	+	0	1102							A6NMB1	SIG16_HUMAN	sialic acid binding Ig-like lectin 16 (gene/pseudogene)						cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|lung(6)	10						GCCAAAGCCTGCGTCTGGTCT	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		16607	0.001		0.0	False		,,,				2504	0.0															0																																												400709			BC030222		19q13.33	2014-03-20	2008-08-04	2008-08-04	ENSG00000161643	ENSG00000161643		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	24851	protein-coding gene	gene with protein product			"""sialic acid binding Ig-like lectin, pseudogene 16"""	SIGLECP16		11986327, 18629938	Standard	NR_002825		Approved	Siglec-P16	uc002prf.3	A6NMB1	OTTHUMG00000183074		19.37:g.50475156G>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000602139.1	37																																																																																					0.662	SIGLEC16-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000464979.1	NR_002825		5	35	5	35
OR5H2	79310	broad.mit.edu;ucsc.edu	37	3	98002530	98002530	+	Missense_Mutation	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr3:98002530C>T	ENST00000355273.2	+	1	799	c.799C>T	c.(799-801)Cct>Tct	p.P267S	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	267						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						GTATTTGCGCCCTGCATCTCC	0.398																																																0													86.0	82.0	83.0					3																	98002530		2203	4300	6503	SO:0001583	missense	79310				CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.799C>T	3.37:g.98002530C>T	ENSP00000347418:p.Pro267Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IF87	Missense_Mutation	SNP	ENST00000355273.2	37	CCDS33801.1	.	.	.	.	.	.	.	.	.	.	C	7.793	0.711900	0.15306	.	.	ENSG00000197938	ENST00000355273	T	0.00262	8.4	3.03	2.15	0.27550	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39407	U	0.001366	T	0.00328	0.0010	M	0.77103	2.36	0.09310	N	1	P	0.39551	0.678	P	0.48304	0.573	T	0.20273	-1.0280	10	0.72032	D	0.01	.	7.844	0.29414	0.0:0.8682:0.0:0.1318	.	267	Q8NGV7	OR5H2_HUMAN	S	267	ENSP00000347418:P267S	ENSP00000347418:P267S	P	+	1	0	OR5H2	99485220	0.202000	0.23423	0.003000	0.11579	0.007000	0.05969	1.215000	0.32431	0.608000	0.30000	0.411000	0.27672	CCT		0.398	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359113.2			12	86	12	86
RGMA	56963	broad.mit.edu;ucsc.edu	37	15	93595609	93595609	+	Missense_Mutation	SNP	G	G	A			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr15:93595609G>A	ENST00000329082.7	-	3	530	c.259C>T	c.(259-261)Cgg>Tgg	p.R87W	RGMA_ENST00000542321.2_Missense_Mutation_p.R71W|RGMA_ENST00000538818.1_5'UTR|RGMA_ENST00000556658.1_5'UTR|RGMA_ENST00000555584.1_5'UTR|RGMA_ENST00000557301.1_Missense_Mutation_p.R95W|RGMA_ENST00000425933.2_Missense_Mutation_p.R71W|RGMA_ENST00000557420.1_Intron|RGMA_ENST00000543599.1_Missense_Mutation_p.R71W|RGMA_ENST00000556087.1_Missense_Mutation_p.R71W	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	87					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			GCCGTCCGCCGCGTGCACAGG	0.677																																																0													12.0	14.0	14.0					15																	93595609		2126	4197	6323	SO:0001583	missense	56963			AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.259C>T	15.37:g.93595609G>A	ENSP00000330005:p.Arg87Trp	Somatic		WXS	Illumina GAIIx	Phase_I	B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Missense_Mutation	SNP	ENST00000329082.7	37	CCDS45357.1	.	.	.	.	.	.	.	.	.	.	G	31	5.076724	0.94000	.	.	ENSG00000182175	ENST00000543599;ENST00000425933;ENST00000329082;ENST00000542321;ENST00000557301;ENST00000555598	D;D;D;D;D;D	0.97752	-4.52;-4.52;-4.52;-4.52;-4.52;-4.52	5.15	5.15	0.70609	Repulsive guidance molecule, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98495	0.9498	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.67725	0.921;0.953	D	0.99813	1.1042	10	0.87932	D	0	-0.7563	18.2064	0.89855	0.0:0.0:1.0:0.0	.	95;87	G3V518;Q96B86	.;RGMA_HUMAN	W	71;71;87;71;95;71	ENSP00000442498:R71W;ENSP00000404442:R71W;ENSP00000330005:R87W;ENSP00000440025:R71W;ENSP00000452126:R95W;ENSP00000451709:R71W	ENSP00000330005:R87W	R	-	1	2	RGMA	91396613	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	4.399000	0.59703	2.409000	0.81822	0.462000	0.41574	CGG		0.677	RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415091.1	NM_020211		4	29	4	29
TMEM131	23505	broad.mit.edu;ucsc.edu	37	2	98388789	98388789	+	Silent	SNP	C	C	T			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr2:98388789C>T	ENST00000186436.5	-	33	4647	c.4419G>A	c.(4417-4419)aaG>aaA	p.K1473K		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1473	Lys-rich.					integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GGATTTCTTTCTTAATATTTA	0.363																																																0													188.0	174.0	178.0					2																	98388789		1799	4066	5865	SO:0001819	synonymous_variant	23505			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.4419G>A	2.37:g.98388789C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000186436.5	37	CCDS46368.1																																																																																				0.363	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	XM_371542		5	153	5	153
RBM12B	389677	broad.mit.edu;ucsc.edu	37	8	94747221	94747221	+	Missense_Mutation	SNP	C	C	G			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr8:94747221C>G	ENST00000399300.2	-	3	1631	c.1418G>C	c.(1417-1419)aGa>aCa	p.R473T	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Missense_Mutation_p.R473T|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	473	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			AGATATAAGTCTTAATAACAC	0.423																																																0													144.0	140.0	141.0					8																	94747221		1855	4094	5949	SO:0001583	missense	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.1418G>C	8.37:g.94747221C>G	ENSP00000382239:p.Arg473Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064931	0.55432	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.06068	3.35;3.35	5.22	5.22	0.72569	RNA recognition motif domain (2);	0.000000	0.64402	D	0.000001	T	0.10423	0.0255	L	0.35854	1.095	0.48395	D	0.999645	P	0.48911	0.917	P	0.47206	0.541	T	0.11251	-1.0595	10	0.35671	T	0.21	-17.8501	19.1358	0.93428	0.0:1.0:0.0:0.0	.	473	Q8IXT5	RB12B_HUMAN	T	473	ENSP00000382239:R473T;ENSP00000427729:R473T	ENSP00000382239:R473T	R	-	2	0	RBM12B	94816397	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.565000	0.60836	2.584000	0.87258	0.591000	0.81541	AGA		0.423	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		35	225	35	225
OR13G1	441933	broad.mit.edu;ucsc.edu	37	1	247835572	247835572	+	Missense_Mutation	SNP	G	G	T	rs117404602	byFrequency	TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr1:247835572G>T	ENST00000359688.2	-	1	793	c.772C>A	c.(772-774)Cgc>Agc	p.R258S	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GAAGCAGGGCGGATATAGGTG	0.463																																																0													138.0	124.0	128.0					1																	247835572		2203	4300	6503	SO:0001583	missense	441933			AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.772C>A	1.37:g.247835572G>T	ENSP00000352717:p.Arg258Ser	Somatic		WXS	Illumina GAIIx	Phase_I	B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	ENST00000359688.2	37	CCDS31094.1	.	.	.	.	.	.	.	.	.	.	G	4.672	0.124927	0.08931	.	.	ENSG00000197437	ENST00000359688	T	0.36520	1.25	4.2	1.2	0.21068	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43416	D	0.000580	T	0.16300	0.0392	N	0.11000	0.08	0.09310	N	0.999996	B	0.16802	0.019	B	0.21546	0.035	T	0.15235	-1.0444	10	0.30854	T	0.27	-14.7377	5.0552	0.14529	0.1892:0.0:0.6441:0.1667	.	258	Q8NGZ3	O13G1_HUMAN	S	258	ENSP00000352717:R258S	ENSP00000352717:R258S	R	-	1	0	OR13G1	245902195	0.000000	0.05858	0.007000	0.13788	0.965000	0.64279	0.235000	0.17948	0.148000	0.19059	0.563000	0.77884	CGC		0.463	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096869.1	NM_001005487		44	51	44	51
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu	37	3	52595944	52595944	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr3:52595944delC	ENST00000296302.7	-	25	4128	c.4127delG	c.(4126-4128)ggcfs	p.G1376fs	PBRM1_ENST00000394830.3_Frame_Shift_Del_p.G1324fs|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.G1376fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.G1391fs|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.G1351fs|PBRM1_ENST00000409767.1_Frame_Shift_Del_p.G1391fs|PBRM1_ENST00000356770.4_Frame_Shift_Del_p.G1344fs|RNU6ATAC16P_ENST00000408591.1_RNA|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.G1376fs			Q86U86	PB1_HUMAN	polybromo 1	1376					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CCGTTTGGAGCCTTCCTTCTT	0.463			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																		Rec	yes		3	3p21	55193	polybromo 1		E	0													167.0	166.0	166.0					3																	52595944		2203	4300	6503	SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.4127delG	3.37:g.52595944delC	ENSP00000296302:p.Gly1376fs	Somatic		WXS	Illumina GAIIx	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	37																																																																																					0.463	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165		82	100	82	100
RASA1	5921	broad.mit.edu;hgsc.bcm.edu	37	5	86627234	86627238	+	Frame_Shift_Del	DEL	TTATC	TTATC	-	rs377014568	byFrequency	TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr5:86627234_86627238delTTATC	ENST00000274376.6	+	2	1173_1177	c.609_613delTTATC	c.(607-615)agttatcttfs	p.YL204fs	RASA1_ENST00000456692.2_Frame_Shift_Del_p.YL27fs|RASA1_ENST00000512763.1_Frame_Shift_Del_p.YL37fs|RASA1_ENST00000506290.1_Frame_Shift_Del_p.YL38fs	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	204	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		AGTCTGGCAGTTATCTTATAAGAGA	0.415																																																0			GRCh37	CD084202	RASA1	D																																				SO:0001589	frameshift_variant	5921				CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.609_613delTTATC	5.37:g.86627234_86627238delTTATC	ENSP00000274376:p.Tyr204fs	Somatic		WXS	Illumina GAIIx	Phase_I	B2R6W3|Q9UDI1	Frame_Shift_Del	DEL	ENST00000274376.6	37	CCDS34200.1																																																																																				0.415	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890		14	69	14	69
DENND4C	55667	broad.mit.edu;hgsc.bcm.edu	37	9	19360274	19360274	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E1-5307-01A-01D-1893-08	TCGA-E1-5307-10A-01D-1893-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b93592-7b90-4aab-9a5b-497b9d865c78	b9089424-6298-495f-afc9-604a38eddf01	g.chr9:19360274delT	ENST00000380432.2	+	24	4371	c.4338delT	c.(4336-4338)cctfs	p.P1446fs	DENND4C_ENST00000602925.1_Frame_Shift_Del_p.P1682fs|DENND4C_ENST00000434457.2_Frame_Shift_Del_p.P1731fs			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	1446					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						ATCCTCCCCCTGTTTCTGTGC	0.353																																																0													107.0	109.0	108.0					9																	19360274		2203	4300	6503	SO:0001589	frameshift_variant	55667			AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.4338delT	9.37:g.19360274delT	ENSP00000369797:p.Pro1446fs	Somatic		WXS	Illumina GAIIx	Phase_I	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Frame_Shift_Del	DEL	ENST00000380432.2	37																																																																																					0.353	DENND4C-201	KNOWN	basic	protein_coding	protein_coding		NM_017925		28	113	28	113
