#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
UHRF1BP1L	23074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	100502164	100502164	+	Splice_Site	SNP	C	C	T			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr12:100502164C>T	ENST00000279907.7	-	2	419	c.207G>A	c.(205-207)agG>agA	p.R69R	UHRF1BP1L_ENST00000356828.3_Splice_Site_p.R69R	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	69										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						AAAGTCTCACCCTAATGGACG	0.338																																																0													96.0	91.0	92.0					12																	100502164		2203	4300	6503	SO:0001630	splice_region_variant	23074				CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.207+1G>A	12.37:g.100502164C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Splice_Site	SNP	ENST00000279907.7	37	CCDS31882.1																																																																																				0.338	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947	Silent	29	76	29	76
PTPN11	5781	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	112888139	112888139	+	Missense_Mutation	SNP	C	C	G	rs397507503		TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr12:112888139C>G	ENST00000351677.2	+	3	353	c.155C>G	c.(154-156)aCc>aGc	p.T52S	PTPN11_ENST00000392597.1_Missense_Mutation_p.T52S	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	52	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.T52S(2)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GGAGCTGTCACCCACATCAAG	0.433			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																														Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)											121.0	115.0	117.0					12																	112888139		2203	4300	6503	SO:0001583	missense	5781	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.155C>G	12.37:g.112888139C>G	ENSP00000340944:p.Thr52Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A8K1D9|Q96HD7	Missense_Mutation	SNP	ENST00000351677.2	37	CCDS9163.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.597446	0.87055	.	.	ENSG00000179295	ENST00000392597;ENST00000351677;ENST00000392596	D;D	0.88431	-2.38;-2.38	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.89605	0.6763	N	0.25825	0.765	0.80722	D	1	P;D	0.53745	0.926;0.962	P;P	0.56514	0.68;0.8	D	0.89566	0.3810	10	0.46703	T	0.11	.	19.6978	0.96034	0.0:1.0:0.0:0.0	.	52;52	Q06124-2;Q06124-3	.;.	S	52	ENSP00000376376:T52S;ENSP00000340944:T52S	ENSP00000340944:T52S	T	+	2	0	PTPN11	111372522	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.481000	0.81124	2.649000	0.89929	0.650000	0.86243	ACC		0.433	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2			60	103	60	103
CCDC113	29070	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	58296338	58296338	+	Missense_Mutation	SNP	A	A	G			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr16:58296338A>G	ENST00000219299.4	+	6	756	c.677A>G	c.(676-678)aAg>aGg	p.K226R	CCDC113_ENST00000443128.2_Missense_Mutation_p.K172R	NM_014157.3	NP_054876.2	Q9H0I3	CC113_HUMAN	coiled-coil domain containing 113	226						cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)				large_intestine(4)|lung(6)|ovary(1)|urinary_tract(1)	12						CAGCAGTTGAAGATAGAGAAC	0.428																																																0													173.0	154.0	161.0					16																	58296338		2198	4300	6498	SO:0001583	missense	29070			AL136785	CCDS10795.1, CCDS45497.1	16q21	2008-02-05			ENSG00000103021	ENSG00000103021			25002	protein-coding gene	gene with protein product						11230166, 11042152	Standard	NM_014157		Approved	HSPC065, DKFZp434N1418	uc002ene.3	Q9H0I3	OTTHUMG00000133489	ENST00000219299.4:c.677A>G	16.37:g.58296338A>G	ENSP00000219299:p.Lys226Arg	Somatic		WXS	Illumina GAIIx	Phase_I	B2RAQ7|B4DR20|Q9NZX2	Missense_Mutation	SNP	ENST00000219299.4	37	CCDS10795.1	.	.	.	.	.	.	.	.	.	.	A	16.49	3.137551	0.56936	.	.	ENSG00000103021	ENST00000443128;ENST00000219299	T;T	0.42131	1.05;0.98	5.49	5.49	0.81192	.	0.458723	0.22657	N	0.057246	T	0.41650	0.1168	L	0.56340	1.77	0.43172	D	0.994973	B;B	0.24258	0.056;0.1	B;B	0.26202	0.067;0.067	T	0.34875	-0.9811	10	0.54805	T	0.06	-18.4026	13.522	0.61574	1.0:0.0:0.0:0.0	.	172;226	B4DR20;Q9H0I3	.;CC113_HUMAN	R	172;226	ENSP00000402588:K172R;ENSP00000219299:K226R	ENSP00000219299:K226R	K	+	2	0	CCDC113	56853839	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	6.757000	0.74924	2.092000	0.63282	0.523000	0.50628	AAG		0.428	CCDC113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257387.2	NM_014157		62	87	62	87
NUP88	4927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	5312118	5312118	+	Silent	SNP	T	T	A			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr17:5312118T>A	ENST00000573584.1	-	5	1301	c.792A>T	c.(790-792)gcA>gcT	p.A264A		NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	264					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						ACAGTGGGTATGCCACTACTT	0.448																																																0													149.0	129.0	135.0					17																	5312118		2203	4300	6503	SO:0001819	synonymous_variant	4927			Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.792A>T	17.37:g.5312118T>A		Somatic		WXS	Illumina GAIIx	Phase_I	D3DTM2|Q9BWE5	Silent	SNP	ENST00000573584.1	37	CCDS11070.1																																																																																				0.448	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216918.3	NM_002532		32	97	32	97
TEX14	56155	hgsc.bcm.edu;broad.mit.edu	37	17	56690826	56690826	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr17:56690826C>T	ENST00000240361.8	-	9	1064	c.979G>A	c.(979-981)Gag>Aag	p.E327K	TEX14_ENST00000349033.5_Missense_Mutation_p.E321K|TEX14_ENST00000389934.3_Missense_Mutation_p.E321K			Q8IWB6	TEX14_HUMAN	testis expressed 14	327	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)	p.E321K(1)		breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GTGATGCGCTCGTACACAAGG	0.502																																																1	Substitution - Missense(1)	stomach(1)											179.0	150.0	160.0					17																	56690826		2203	4300	6503	SO:0001583	missense	56155			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.979G>A	17.37:g.56690826C>T	ENSP00000240361:p.Glu327Lys	Somatic		WXS	Illumina GAIIx	Phase_I	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	37	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.288759	0.59976	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.61158	0.13;0.13;0.13	5.68	4.7	0.59300	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.172514	0.40469	N	0.001096	T	0.80093	0.4560	M	0.89785	3.06	0.44366	D	0.997262	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.994;0.994	D	0.84932	0.0860	10	0.87932	D	0	-16.3205	15.2735	0.73723	0.0:0.859:0.141:0.0	.	327;321;321	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	K	327;321;321	ENSP00000240361:E327K;ENSP00000374584:E321K;ENSP00000268910:E321K	ENSP00000240361:E327K	E	-	1	0	TEX14	54045825	0.992000	0.36948	0.870000	0.34147	0.013000	0.08279	3.030000	0.49720	1.372000	0.46190	0.561000	0.74099	GAG		0.502	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1			9	166	9	166
QTRT1	81890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	10823935	10823935	+	Missense_Mutation	SNP	A	A	T			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr19:10823935A>T	ENST00000250237.5	+	10	1211	c.1201A>T	c.(1201-1203)Aca>Tca	p.T401S		NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	401					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)			large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			TGTGGGAATCACACTGGGCTG	0.577																																																0													50.0	47.0	48.0					19																	10823935		2203	4299	6502	SO:0001583	missense	81890			AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.1201A>T	19.37:g.10823935A>T	ENSP00000250237:p.Thr401Ser	Somatic		WXS	Illumina GAIIx	Phase_I	B4DFM7|Q96BQ4|Q9BXQ9	Missense_Mutation	SNP	ENST00000250237.5	37	CCDS12248.1	.	.	.	.	.	.	.	.	.	.	A	5.068	0.198216	0.09652	.	.	ENSG00000213339	ENST00000250237	.	.	.	4.34	0.777	0.18538	.	1.195700	0.06700	U	0.771268	T	0.18215	0.0437	N	0.16368	0.405	0.20074	N	0.999937	B	0.02656	0.0	B	0.01281	0.0	T	0.28038	-1.0056	9	0.10636	T	0.68	-1.8661	3.2896	0.06944	0.6423:0.137:0.0871:0.1336	.	401	Q9BXR0	TGT_HUMAN	S	401	.	ENSP00000250237:T401S	T	+	1	0	QTRT1	10684935	0.145000	0.22656	0.378000	0.26068	0.145000	0.21501	0.967000	0.29344	0.548000	0.28955	0.477000	0.44152	ACA		0.577	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452086.1	NM_031209		42	74	42	74
CIC	23152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	42791728	42791728	+	Missense_Mutation	SNP	A	A	G			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr19:42791728A>G	ENST00000575354.2	+	5	654	c.614A>G	c.(613-615)aAt>aGt	p.N205S	CIC_ENST00000160740.3_Missense_Mutation_p.N205S|CIC_ENST00000572681.2_Missense_Mutation_p.N1114S	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	205					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				CGGCCCATGAATGCCTTCATG	0.627			"""Mis, F, S"""		oligodendroglioma																																		Rec	yes		19	19q13.2	23152	capicua homolog		O	0													67.0	69.0	68.0					19																	42791728		2203	4300	6503	SO:0001583	missense	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.614A>G	19.37:g.42791728A>G	ENSP00000458663:p.Asn205Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.827590	0.50845	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.39	4.39	0.52855	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	.	.	.	.	T	0.71031	0.3292	M	0.62154	1.92	0.58432	D	0.999991	D	0.69078	0.997	D	0.80764	0.994	T	0.74259	-0.3723	8	0.87932	D	0	-10.4181	11.626	0.51145	1.0:0.0:0.0:0.0	.	205	Q96RK0	CIC_HUMAN	S	205	.	ENSP00000160740:N205S	N	+	2	0	CIC	47483568	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.768000	0.91737	1.853000	0.53794	0.454000	0.30748	AAT		0.627	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2			15	95	15	95
CIC	23152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	42791796	42791796	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr19:42791796C>T	ENST00000575354.2	+	5	722	c.682C>T	c.(682-684)Cgg>Tgg	p.R228W	CIC_ENST00000160740.3_Missense_Mutation_p.R228W|CIC_ENST00000572681.2_Missense_Mutation_p.R1137W	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	228					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				CCAGGACAACCGGACCGTCAG	0.622			"""Mis, F, S"""		oligodendroglioma																																		Rec	yes		19	19q13.2	23152	capicua homolog		O	0													81.0	75.0	77.0					19																	42791796		2203	4300	6503	SO:0001583	missense	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.682C>T	19.37:g.42791796C>T	ENSP00000458663:p.Arg228Trp	Somatic		WXS	Illumina GAIIx	Phase_I	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.820231	0.50633	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.39	3.34	0.38264	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	.	.	.	.	T	0.80325	0.4602	M	0.88640	2.97	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	T	0.83021	-0.0167	8	0.87932	D	0	-14.5772	11.3477	0.49569	0.1828:0.8172:0.0:0.0	.	228	Q96RK0	CIC_HUMAN	W	228	.	ENSP00000160740:R228W	R	+	1	2	CIC	47483636	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.318000	0.43779	1.041000	0.40125	0.555000	0.69702	CGG		0.622	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2			14	87	14	87
CIC	23152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	42798848	42798848	+	Missense_Mutation	SNP	G	G	C			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr19:42798848G>C	ENST00000575354.2	+	19	4460	c.4420G>C	c.(4420-4422)Gtc>Ctc	p.V1474L	CIC_ENST00000160740.3_Missense_Mutation_p.V1472L|CIC_ENST00000572681.2_Missense_Mutation_p.V2380L	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	1474					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V1474F(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				CCGGGCCCTGGTCATGCAGCT	0.602			"""Mis, F, S"""		oligodendroglioma																																		Rec	yes		19	19q13.2	23152	capicua homolog		O	1	Substitution - Missense(1)	central_nervous_system(1)											77.0	76.0	76.0					19																	42798848		2203	4300	6503	SO:0001583	missense	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.4420G>C	19.37:g.42798848G>C	ENSP00000458663:p.Val1474Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070783	0.76301	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.59	3.56	0.40772	.	.	.	.	.	T	0.60248	0.2254	L	0.29908	0.895	0.42164	D	0.991613	P	0.50156	0.932	P	0.61592	0.891	T	0.62623	-0.6815	8	0.87932	D	0	-24.5058	10.4757	0.44663	0.0982:0.0:0.9018:0.0	.	1474	Q96RK0	CIC_HUMAN	L	1474	.	ENSP00000160740:V1474L	V	+	1	0	CIC	47490688	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.459000	0.66685	2.570000	0.86706	0.491000	0.48974	GTC		0.602	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2			7	75	7	75
ZBTB45	84878	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	59028924	59028924	+	Missense_Mutation	SNP	A	A	C			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr19:59028924A>C	ENST00000594051.1	-	2	597	c.117T>G	c.(115-117)atT>atG	p.I39M	ZBTB45_ENST00000354590.3_Missense_Mutation_p.I39M|ZBTB45_ENST00000600990.1_Missense_Mutation_p.I39M			Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	39	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|lung(5)|urinary_tract(1)	11		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		AAGCTTCACGAATGCGCACAG	0.602											OREG0025700	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(164;1383 2017 5233 27540 46677)											0													63.0	66.0	65.0					19																	59028924		2203	4300	6503	SO:0001583	missense	84878			AK027392	CCDS12984.1	19q13.43	2013-10-10	2006-09-19	2006-09-19	ENSG00000119574	ENSG00000119574		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23715	protein-coding gene	gene with protein product			"""zinc finger protein 499"""	ZNF499			Standard	NM_032792		Approved	FLJ14486	uc002qtd.3	Q96K62	OTTHUMG00000183545	ENST00000594051.1:c.117T>G	19.37:g.59028924A>C	ENSP00000469089:p.Ile39Met	Somatic	1035	WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000594051.1	37	CCDS12984.1	.	.	.	.	.	.	.	.	.	.	a	14.46	2.541797	0.45280	.	.	ENSG00000119574	ENST00000354590	T	0.24538	1.85	3.92	-1.66	0.08265	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.080560	0.45867	U	0.000327	T	0.47154	0.1430	M	0.82823	2.61	0.28366	N	0.920234	D	0.76494	0.999	D	0.79108	0.992	T	0.44283	-0.9338	10	0.87932	D	0	.	10.3146	0.43729	0.2634:0.0:0.7366:0.0	.	39	Q96K62	ZBT45_HUMAN	M	39	ENSP00000346603:I39M	ENSP00000346603:I39M	I	-	3	3	ZBTB45	63720736	1.000000	0.71417	0.978000	0.43139	0.430000	0.31655	0.917000	0.28665	-0.182000	0.10602	0.254000	0.18369	ATT		0.602	ZBTB45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467067.1	NM_032792		8	46	8	46
CRYBB2	1415	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	22	25625545	25625545	+	Splice_Site	SNP	C	C	T	rs4049504	byFrequency	TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr22:25625545C>T	ENST00000398215.2	+	5	620	c.449C>T	c.(448-450)aCg>aTg	p.T150M		NM_000496.2	NP_000487.1	P43320	CRBB2_HUMAN	crystallin, beta B2	150	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|response to stimulus (GO:0050896)|visual perception (GO:0007601)		identical protein binding (GO:0042802)|structural constituent of eye lens (GO:0005212)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)	10						CAGAGTGGCACGTAAGTGCGT	0.572													C|||	4	0.000798722	0.0008	0.0	5008	,	,		21535	0.002		0.0	False		,,,				2504	0.001															0													73.0	55.0	61.0					22																	25625545		2203	4300	6503	SO:0001630	splice_region_variant	1415				CCDS13831.1	22q11.23	2008-06-10			ENSG00000244752	ENSG00000244752			2398	protein-coding gene	gene with protein product		123620		CCA2, CRYB2A, CRYB2		9158139, 8224918	Standard	XM_006724141		Approved		uc003abp.1	P43320	OTTHUMG00000150905	ENST00000398215.2:c.449+1C>T	22.37:g.25625545C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q9UCM8	Splice_Site	SNP	ENST00000398215.2	37	CCDS13831.1	.	.	.	.	.	.	.	.	.	.	c	21.2	4.113532	0.77210	.	.	ENSG00000244752	ENST00000398215	T	0.76186	-1.0	5.0	5.0	0.66597	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.048613	0.85682	D	0.000000	D	0.88426	0.6433	M	0.90252	3.1	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.89423	0.3711	10	0.42905	T	0.14	.	17.3593	0.87345	0.0:1.0:0.0:0.0	rs4049504	150	P43320	CRBB2_HUMAN	M	150	ENSP00000381273:T150M	ENSP00000381273:T150M	T	+	2	0	CRYBB2	23955545	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.275000	0.58927	2.317000	0.78254	0.650000	0.86243	ACG		0.572	CRYBB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320350.1	NM_000496	Missense_Mutation	10	48	10	48
TNFAIP6	7130	hgsc.bcm.edu;broad.mit.edu	37	2	152226605	152226605	+	Missense_Mutation	SNP	G	G	A			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr2:152226605G>A	ENST00000243347.3	+	4	541	c.466G>A	c.(466-468)Gaa>Aaa	p.E156K	MIR4773-1_ENST00000585225.1_RNA|RN7SL124P_ENST00000498656.2_RNA	NM_007115.3	NP_009046.2	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6	156	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)		hyaluronic acid binding (GO:0005540)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.131)	Hyaluronan(DB08818)	AAATGAGTACGAAGATAACCA	0.388																																																0													153.0	153.0	153.0					2																	152226605		2203	4300	6503	SO:0001583	missense	7130				CCDS2193.1	2q23.3	2008-11-18			ENSG00000123610	ENSG00000123610			11898	protein-coding gene	gene with protein product		600410				1730767, 8568267, 15060082	Standard	NM_007115		Approved	TSG6, TSG-6	uc002txk.3	P98066	OTTHUMG00000131884	ENST00000243347.3:c.466G>A	2.37:g.152226605G>A	ENSP00000243347:p.Glu156Lys	Somatic		WXS	Illumina GAIIx	Phase_I	Q53TI7|Q8WWI9	Missense_Mutation	SNP	ENST00000243347.3	37	CCDS2193.1	.	.	.	.	.	.	.	.	.	.	G	10.85	1.466654	0.26335	.	.	ENSG00000123610	ENST00000243347	T	0.28069	1.63	5.49	5.49	0.81192	CUB (5);	0.268996	0.41823	D	0.000805	T	0.26122	0.0637	N	0.17872	0.535	0.42002	D	0.990891	B	0.21309	0.054	B	0.23716	0.048	T	0.05338	-1.0891	10	0.54805	T	0.06	.	19.3531	0.94398	0.0:0.0:1.0:0.0	.	156	P98066	TSG6_HUMAN	K	156	ENSP00000243347:E156K	ENSP00000243347:E156K	E	+	1	0	TNFAIP6	151934851	1.000000	0.71417	0.961000	0.40146	0.863000	0.49368	4.803000	0.62546	2.563000	0.86464	0.555000	0.69702	GAA		0.388	TNFAIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254834.2	NM_007115		11	147	11	147
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	C	T	rs121913500		TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr2:209113112C>T	ENST00000415913.1	-	4	776	c.395G>A	c.(394-396)cGt>cAt	p.R132H	IDH1_ENST00000345146.2_Missense_Mutation_p.R132H|IDH1_ENST00000446179.1_Missense_Mutation_p.R132H	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132H(2774)|p.R132L(59)|p.R132V(1)|p.G131_R132>VL(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	2835	Substitution - Missense(2834)|Complex - compound substitution(1)	central_nervous_system(2579)|haematopoietic_and_lymphoid_tissue(205)|bone(43)|prostate(4)|biliary_tract(2)|urinary_tract(1)|skin(1)											79.0	73.0	75.0					2																	209113112		2203	4300	6503	SO:0001583	missense	3417				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.395G>A	2.37:g.209113112C>T	ENSP00000390265:p.Arg132His	Somatic		WXS	Illumina GAIIx	Phase_I	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657324	0.88154	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	4.69	0.59074	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	H	0.99379	4.54	0.80722	D	1	B	0.25486	0.127	B	0.25405	0.06	D	0.92324	0.5868	10	0.87932	D	0	-20.0399	14.3783	0.66895	0.0:0.9288:0.0:0.0712	.	132	O75874	IDHC_HUMAN	H	132	ENSP00000260985:R132H;ENSP00000410513:R132H;ENSP00000390265:R132H;ENSP00000391075:R132H	ENSP00000260985:R132H	R	-	2	0	IDH1	208821357	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.088000	0.71371	1.356000	0.45884	0.555000	0.69702	CGT		0.393	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			42	110	42	110
EPHA4	2043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	222321395	222321395	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr2:222321395C>T	ENST00000281821.2	-	7	1582	c.1541G>A	c.(1540-1542)cGa>cAa	p.R514Q	EPHA4_ENST00000409854.1_Missense_Mutation_p.R514Q|EPHA4_ENST00000392071.4_Missense_Mutation_p.R463Q|EPHA4_ENST00000409938.1_Missense_Mutation_p.R514Q	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	514	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TGTCCTGGCTCGCACGTGGAA	0.512																																																0													140.0	124.0	129.0					2																	222321395		2203	4300	6503	SO:0001583	missense	2043			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.1541G>A	2.37:g.222321395C>T	ENSP00000281821:p.Arg514Gln	Somatic		WXS	Illumina GAIIx	Phase_I	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	37	CCDS2447.1	.	.	.	.	.	.	.	.	.	.	C	33	5.260587	0.95368	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.91	5.91	0.95273	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.75162	0.3812	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73733	-0.3890	10	0.46703	T	0.11	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	514	P54764	EPHA4_HUMAN	Q	514;514;514;463	ENSP00000281821:R514Q;ENSP00000386276:R514Q;ENSP00000386829:R514Q;ENSP00000375923:R463Q	ENSP00000281821:R514Q	R	-	2	0	EPHA4	222029639	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.456000	0.80751	2.793000	0.96121	0.655000	0.94253	CGA		0.512	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3			15	116	15	116
ALDH1L1	10840	hgsc.bcm.edu;broad.mit.edu	37	3	125831636	125831636	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr3:125831636C>T	ENST00000393434.2	-	19	2519	c.2170G>A	c.(2170-2172)Gtg>Atg	p.V724M	ALDH1L1_ENST00000472186.1_Missense_Mutation_p.V724M|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.V623M|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.V734M|ALDH1L1_ENST00000393431.2_3'UTR	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	724	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	ACTCTCCGCACGAACTCATCA	0.577																																																0													118.0	112.0	114.0					3																	125831636		2203	4300	6503	SO:0001583	missense	10840			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.2170G>A	3.37:g.125831636C>T	ENSP00000377083:p.Val724Met	Somatic		WXS	Illumina GAIIx	Phase_I	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	ENST00000393434.2	37	CCDS3034.1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.247549	0.39697	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434	T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26	4.37	4.37	0.52481	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.068449	0.56097	D	0.000025	D	0.86460	0.5938	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76071	0.979;0.987;0.948	D	0.88182	0.2871	10	0.87932	D	0	.	14.4325	0.67259	0.0:1.0:0.0:0.0	.	623;259;724	E9PBX3;Q6ZV71;O75891	.;.;AL1L1_HUMAN	M	734;724;623;724	ENSP00000273450:V734M;ENSP00000420293:V724M;ENSP00000395881:V623M;ENSP00000377083:V724M	ENSP00000273450:V734M	V	-	1	0	ALDH1L1	127314326	1.000000	0.71417	0.993000	0.49108	0.278000	0.26855	2.257000	0.43240	2.261000	0.74972	0.313000	0.20887	GTG		0.577	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190		11	158	11	158
HTRA3	94031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	8293208	8293208	+	Missense_Mutation	SNP	G	G	A	rs369645804		TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr4:8293208G>A	ENST00000307358.2	+	4	1024	c.820G>A	c.(820-822)Gtc>Atc	p.V274I	HTRA3_ENST00000382512.3_Missense_Mutation_p.V274I	NM_053044.3	NP_444272.1	P83110	HTRA3_HUMAN	HtrA serine peptidase 3	274	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|prostate(1)|urinary_tract(1)	18						AACGGGCATCGTCAGCACTGC	0.632																																																0													58.0	53.0	55.0					4																	8293208		2203	4299	6502	SO:0001583	missense	94031			AY040094	CCDS3400.1, CCDS75105.1	4p16.1	2008-02-05			ENSG00000170801	ENSG00000170801			30406	protein-coding gene	gene with protein product	"""pregnancy-related serine protease"""	608785				12513693, 14500695	Standard	XM_005248040		Approved	Tasp, Prsp	uc003gla.3	P83110	OTTHUMG00000090561	ENST00000307358.2:c.820G>A	4.37:g.8293208G>A	ENSP00000303766:p.Val274Ile	Somatic		WXS	Illumina GAIIx	Phase_I	Q7Z7A2	Missense_Mutation	SNP	ENST00000307358.2	37	CCDS3400.1	.	.	.	.	.	.	.	.	.	.	g	19.93	3.917294	0.73098	.	.	ENSG00000170801	ENST00000307358;ENST00000382512	D;D	0.89617	-2.54;-2.54	4.19	4.19	0.49359	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.000000	0.64402	D	0.000001	D	0.90219	0.6942	N	0.25647	0.755	0.80722	D	1	D;D	0.76494	0.973;0.999	P;D	0.81914	0.897;0.995	D	0.90000	0.4114	10	0.36615	T	0.2	-7.1994	16.5492	0.84464	0.0:0.0:1.0:0.0	.	274;274	P83110;P83110-2	HTRA3_HUMAN;.	I	274	ENSP00000303766:V274I;ENSP00000371952:V274I	ENSP00000303766:V274I	V	+	1	0	HTRA3	8344108	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	7.311000	0.78958	1.911000	0.55334	0.454000	0.30748	GTC		0.632	HTRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092669.1	NM_053044		30	52	30	52
FRAS1	80144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	79421075	79421075	+	Splice_Site	SNP	G	G	A			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr4:79421075G>A	ENST00000264895.6	+	61	9756	c.9316G>A	c.(9316-9318)Ggt>Agt	p.G3106S		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3102	Calx-beta 5.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GTTCAGTCCCGGTAATTGAAT	0.443																																																0													107.0	100.0	102.0					4																	79421075		1878	4130	6008	SO:0001630	splice_region_variant	80144			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.9316+1G>A	4.37:g.79421075G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Splice_Site	SNP	ENST00000264895.6	37	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.7|23.7	4.452936|4.452936	0.84209|0.84209	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000264895|ENST00000512123	T|.	0.43688|.	0.94|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.057345|.	0.64402|.	D|.	0.000001|.	D|D	0.82342|0.82342	0.5016|0.5016	M|M	0.81614|0.81614	2.55|2.55	0.80722|0.80722	D|D	1|1	B;D|.	0.76494|.	0.01;0.999|.	B;P|.	0.61477|.	0.002;0.889|.	T|T	0.81693|0.81693	-0.0817|-0.0817	10|5	0.72032|.	D|.	0.01|.	.|.	20.2983|20.2983	0.98569|0.98569	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	3105;3106|.	Q86XX4-2;E9PHH6|.	.;.|.	S|Q	3106|1334	ENSP00000264895:G3106S|.	ENSP00000264895:G3106S|.	G|R	+|+	1|2	0|0	FRAS1|FRAS1	79640099|79640099	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.150000|0.150000	0.21749|0.21749	9.727000|9.727000	0.98787|0.98787	2.802000|2.802000	0.96397|0.96397	0.655000|0.655000	0.94253|0.94253	GGT|CGG		0.443	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			Missense_Mutation	20	214	20	214
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	13766101	13766101	+	Missense_Mutation	SNP	A	A	G			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr5:13766101A>G	ENST00000265104.4	-	59	10189	c.10085T>C	c.(10084-10086)tTt>tCt	p.F3362S	DNAH5_ENST00000504001.3_Intron	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3362	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GTTCTGTAAAAAGTTCCCTGC	0.413									Kartagener syndrome																																							0													116.0	118.0	117.0					5																	13766101		2203	4300	6503	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.10085T>C	5.37:g.13766101A>G	ENSP00000265104:p.Phe3362Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.525945	0.85600	.	.	ENSG00000039139	ENST00000265104	T	0.62105	0.05	5.63	5.63	0.86233	Dynein heavy chain, coiled coil stalk (1);	0.101562	0.64402	D	0.000002	D	0.86644	0.5982	H	0.98155	4.16	0.80722	D	1	P	0.51933	0.949	D	0.67103	0.949	D	0.91506	0.5223	10	0.87932	D	0	.	15.8854	0.79244	1.0:0.0:0.0:0.0	.	3362	Q8TE73	DYH5_HUMAN	S	3362	ENSP00000265104:F3362S	ENSP00000265104:F3362S	F	-	2	0	DNAH5	13819101	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.093000	0.94163	2.150000	0.67090	0.456000	0.33151	TTT		0.413	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		86	122	86	122
PCDHB5	26167	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	140516689	140516689	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr5:140516689C>T	ENST00000231134.5	+	1	1890	c.1673C>T	c.(1672-1674)cCc>cTc	p.P558L		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	558	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GACAACTCGCCCTTCGTGCTG	0.716																																																0													28.0	33.0	31.0					5																	140516689		2199	4294	6493	SO:0001583	missense	26167			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1673C>T	5.37:g.140516689C>T	ENSP00000231134:p.Pro558Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.10|17.10	3.301970|3.301970	0.60195|0.60195	.|.	.|.	ENSG00000113209|ENSG00000113209	ENST00000231134|ENST00000537936	T|.	0.72394|.	-0.65|.	4.42|4.42	4.42|4.42	0.53409|0.53409	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	D|D	0.90484|0.90484	0.7019|0.7019	H|H	0.98682|0.98682	4.3|4.3	0.58432|0.58432	D|D	0.999995|0.999995	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.94596|0.94596	0.7792|0.7792	9|6	0.87932|0.87932	D|D	0|0	.|.	17.4339|17.4339	0.87546|0.87546	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	558|.	Q9Y5E4|.	PCDB5_HUMAN|.	L|S	558|342	ENSP00000231134:P558L|.	ENSP00000231134:P558L|ENSP00000446220:P342S	P|P	+|+	2|1	0|0	PCDHB5|PCDHB5	140496873|140496873	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.544000|0.544000	0.35116|0.35116	7.666000|7.666000	0.83877|0.83877	2.195000|2.195000	0.70347|0.70347	0.194000|0.194000	0.17425|0.17425	CCC|CCT		0.716	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669		14	51	14	51
MAS1L	116511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	29454624	29454624	+	Silent	SNP	G	G	A	rs148359929	byFrequency	TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr6:29454624G>A	ENST00000377127.3	-	1	1114	c.1056C>T	c.(1054-1056)atC>atT	p.I352I		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	352					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						CCATTGGGTCGATGCCAGCTG	0.517													G|||	8	0.00159744	0.0061	0.0	5008	,	,		17553	0.0		0.0	False		,,,				2504	0.0				NSCLC(153;755 1987 3859 11251 32945)											0								G		20,4386	27.2+/-55.0	0,20,2183	175.0	168.0	170.0		1056	-1.4	0.0	6	dbSNP_134	170	0,8600		0,0,4300	no	coding-synonymous	MAS1L	NM_052967.1		0,20,6483	AA,AG,GG		0.0,0.4539,0.1538		352/379	29454624	20,12986	2203	4300	6503	SO:0001819	synonymous_variant	116511			S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.1056C>T	6.37:g.29454624G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q5SUN5	Silent	SNP	ENST00000377127.3	37	CCDS4661.1																																																																																				0.517	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076126.2	NM_052967		104	145	104	145
RHAG	6005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	49583402	49583402	+	Missense_Mutation	SNP	G	G	T			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr6:49583402G>T	ENST00000371175.4	-	4	601	c.575C>A	c.(574-576)tCt>tAt	p.S192Y	RHAG_ENST00000229810.7_Missense_Mutation_p.S192Y	NM_000324.2	NP_000315.2	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	192					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|carbon dioxide transport (GO:0015670)|cellular ion homeostasis (GO:0006873)|erythrocyte development (GO:0048821)|multicellular organismal iron ion homeostasis (GO:0060586)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	39	Lung NSC(77;0.0255)					TCTCAGTCCAGATCGATACAA	0.453																																					Ovarian(176;476 2003 7720 43408 44749)											0													142.0	129.0	134.0					6																	49583402		2203	4300	6503	SO:0001583	missense	6005				CCDS4927.1	6p12.3	2014-07-19	2006-02-23		ENSG00000112077	ENSG00000112077		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	10006	protein-coding gene	gene with protein product		180297	"""Rhesus blood group-associated glycoprotein"""			9479501	Standard	NM_000324		Approved	RH50A, CD241, SLC42A1	uc003ozk.4	Q02094	OTTHUMG00000016377	ENST00000371175.4:c.575C>A	6.37:g.49583402G>T	ENSP00000360217:p.Ser192Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	B2R8T8|O43514|O43515|Q7L8L3|Q9H454	Missense_Mutation	SNP	ENST00000371175.4	37	CCDS4927.1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.289487	0.40494	.	.	ENSG00000112077	ENST00000371175;ENST00000229810;ENST00000418071;ENST00000539403	T;T	0.23950	1.88;1.88	5.76	4.89	0.63831	Ammonium transporter AmtB-like (3);	0.347849	0.38058	N	0.001824	T	0.22820	0.0551	M	0.66939	2.045	0.09310	N	1	P;B;B	0.38535	0.635;0.407;0.407	B;B;B	0.43916	0.436;0.436;0.436	T	0.08659	-1.0711	10	0.87932	D	0	-0.0281	15.9539	0.79865	0.0:0.1351:0.8649:0.0	.	192;192;192	O43515;Q9UHG9;Q02094	.;.;RHAG_HUMAN	Y	192	ENSP00000360217:S192Y;ENSP00000229810:S192Y	ENSP00000229810:S192Y	S	-	2	0	RHAG	49691361	0.999000	0.42202	0.004000	0.12327	0.053000	0.15095	7.579000	0.82511	1.432000	0.47375	0.655000	0.94253	TCT		0.453	RHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043806.1			54	92	54	92
PARP12	64761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	139734111	139734111	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr7:139734111C>T	ENST00000263549.3	-	8	2218	c.1345G>A	c.(1345-1347)Gtc>Atc	p.V449I	PARP12_ENST00000470515.1_5'UTR	NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	449	WWE 2. {ECO:0000255|PROSITE- ProRule:PRU00248}.			VQKNLVY -> MGGFGQH (in Ref. 4). {ECO:0000305}.		nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					GTGCCATAGACCAGGTTTTTC	0.418																																																0													67.0	62.0	64.0					7																	139734111		2203	4300	6503	SO:0001583	missense	64761			AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.1345G>A	7.37:g.139734111C>T	ENSP00000263549:p.Val449Ile	Somatic		WXS	Illumina GAIIx	Phase_I	Q9H610|Q9NP36|Q9NTI3	Missense_Mutation	SNP	ENST00000263549.3	37	CCDS5857.1	.	.	.	.	.	.	.	.	.	.	C	34	5.330739	0.95733	.	.	ENSG00000059378	ENST00000263549;ENST00000489809	T;T	0.44881	1.56;0.91	5.84	-1.31	0.09230	WWE domain (1);	0.823455	0.11360	N	0.572006	T	0.28067	0.0692	L	0.38531	1.155	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.22103	-1.0226	10	0.33141	T	0.24	.	7.0213	0.24916	0.128:0.3131:0.4837:0.0752	.	449	Q9H0J9	PAR12_HUMAN	I	449;87	ENSP00000263549:V449I;ENSP00000417606:V87I	ENSP00000263549:V449I	V	-	1	0	PARP12	139380580	0.000000	0.05858	0.198000	0.23420	0.994000	0.84299	-0.030000	0.12308	0.081000	0.16988	0.555000	0.69702	GTC		0.418	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348413.1	NM_022750		16	32	16	32
MCPH1	79648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	6479212	6479212	+	Splice_Site	SNP	G	G	A			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr8:6479212G>A	ENST00000344683.5	+	13	2528	c.2452G>A	c.(2452-2454)Gat>Aat	p.D818N	CTD-2541M15.1_ENST00000522897.1_RNA|MCPH1_ENST00000521175.1_3'UTR|CTD-2541M15.1_ENST00000515608.1_RNA	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	818	BRCT 3. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		ATGGGTCTTAGGTAAGAATCC	0.597																																					Colon(95;1448 1467 8277 34473 35819)											0													66.0	75.0	72.0					8																	6479212		2070	4197	6267	SO:0001630	splice_region_variant	79648			AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.2452+1G>A	8.37:g.6479212G>A		Somatic		WXS	Illumina GAIIx	Phase_I	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Splice_Site	SNP	ENST00000344683.5	37	CCDS43689.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.292819	0.80914	.	.	ENSG00000147316	ENST00000344683	D	0.92699	-3.09	5.13	5.13	0.70059	BRCT (3);	0.139772	0.44902	D	0.000401	D	0.96303	0.8794	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96912	0.9668	10	0.87932	D	0	-10.4036	16.0819	0.81010	0.0:0.0:1.0:0.0	.	818	Q8NEM0	MCPH1_HUMAN	N	818	ENSP00000342924:D818N	ENSP00000342924:D818N	D	+	1	0	MCPH1	6466620	1.000000	0.71417	1.000000	0.80357	0.318000	0.28184	6.700000	0.74619	2.402000	0.81655	0.462000	0.41574	GAT		0.597	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	Missense_Mutation	14	158	14	158
KCNB2	9312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	73480147	73480147	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr8:73480147C>T	ENST00000523207.1	+	2	766	c.178C>T	c.(178-180)Cgc>Tgc	p.R60C		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	60					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GCCCAGGACGCGCCTGGGGAA	0.542																																																0													66.0	68.0	67.0					8																	73480147		2203	4300	6503	SO:0001583	missense	9312			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.178C>T	8.37:g.73480147C>T	ENSP00000430846:p.Arg60Cys	Somatic		WXS	Illumina GAIIx	Phase_I	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048690	0.75846	.	.	ENSG00000182674	ENST00000523207	T	0.78481	-1.18	5.71	4.84	0.62591	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	.	.	.	.	D	0.90703	0.7083	H	0.95950	3.745	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91904	0.5534	9	0.87932	D	0	.	9.6813	0.40072	0.1398:0.7897:0.0:0.0705	.	60	Q92953	KCNB2_HUMAN	C	60	ENSP00000430846:R60C	ENSP00000430846:R60C	R	+	1	0	KCNB2	73642701	0.996000	0.38824	0.635000	0.29338	0.985000	0.73830	3.471000	0.53107	1.432000	0.47375	0.655000	0.94253	CGC		0.542	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770		17	134	17	134
VCAN	1462	broad.mit.edu;ucsc.edu	37	5	82849281	82849281	+	Missense_Mutation	SNP	C	C	T			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr5:82849281C>T	ENST00000265077.3	+	11	10157	c.9592C>T	c.(9592-9594)Cgt>Tgt	p.R3198C	VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000512590.2_Missense_Mutation_p.R1396C|VCAN_ENST00000502527.2_Missense_Mutation_p.R457C|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000343200.5_Missense_Mutation_p.R2211C|VCAN_ENST00000342785.4_Missense_Mutation_p.R1444C	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	3198	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.R3198S(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	ACGGGAATGCCGTCTGCAGGG	0.473																																																1	Substitution - Missense(1)	lung(1)											159.0	136.0	144.0					5																	82849281		2203	4300	6503	SO:0001583	missense	1462			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.9592C>T	5.37:g.82849281C>T	ENSP00000265077:p.Arg3198Cys	Somatic		WXS	Illumina GAIIx	Phase_I	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	C	36	5.676137	0.96764	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000512590;ENST00000502527	T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06	6.06	6.06	0.98353	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.64402	D	0.000007	T	0.62048	0.2396	H	0.94925	3.6	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	0.999;0.997;0.995;1.0	T	0.70927	-0.4739	10	0.72032	D	0.01	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	1444;457;2211;3198	P13611-3;P13611-4;P13611-2;P13611	.;.;.;CSPG2_HUMAN	C	3198;2211;1444;1396;457	ENSP00000265077:R3198C;ENSP00000340062:R2211C;ENSP00000342768:R1444C;ENSP00000425959:R1396C;ENSP00000421362:R457C	ENSP00000265077:R3198C	R	+	1	0	VCAN	82885037	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	CGT		0.473	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385		72	180	72	180
TMC6	11322	broad.mit.edu;ucsc.edu	37	17	76109646	76109646	+	Silent	SNP	C	C	T			TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr17:76109646C>T	ENST00000590602.1	-	19	2496	c.2337G>A	c.(2335-2337)gaG>gaA	p.E779E	TMC6_ENST00000322933.4_Silent_p.E358E|TMC6_ENST00000306591.7_Silent_p.E428E|TMC6_ENST00000392467.3_Silent_p.E779E|TNRC6C-AS1_ENST00000589217.1_RNA|TMC6_ENST00000322914.3_Silent_p.E779E|TMC6_ENST00000592076.1_5'UTR|TMC6_ENST00000591436.1_Silent_p.E358E			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	779					ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TCTCCTCCCTCTCCTTCCTCT	0.567																																																0													131.0	115.0	120.0					17																	76109646		2203	4300	6503	SO:0001819	synonymous_variant	11322			AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.2337G>A	17.37:g.76109646C>T		Somatic		WXS	Illumina GAIIx	Phase_I	O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Silent	SNP	ENST00000590602.1	37	CCDS32748.1																																																																																				0.567	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437146.1			22	120	22	120
DCANP1	140947	broad.mit.edu;ucsc.edu	37	5	134782790	134782790	+	Silent	SNP	G	G	A	rs113239442		TCGA-FG-7641-01B-11D-2253-08	TCGA-FG-7641-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	739e3612-208f-4004-a714-d0839f9b5e24	4e9b5d71-7edb-4c2f-b79f-eed7aff5a455	g.chr5:134782790G>A	ENST00000503143.2	-	1	248	c.9C>T	c.(7-9)taC>taT	p.Y3Y	TIFAB_ENST00000537858.1_3'UTR	NM_130848.2	NP_570900.1	Q8TF63	DCNP1_HUMAN		3						nucleus (GO:0005634)				endometrium(1)|lung(1)|prostate(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTGCTGCTCCGTAATGCATAG	0.527																																																0								G		0,4406		0,0,2203	44.0	46.0	46.0		9	-2.3	0.0	5	dbSNP_132	46	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C5orf20	NM_130848.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		3/245	134782790	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000503143.2:c.9C>T	5.37:g.134782790G>A		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000503143.2	37	CCDS4186.1																																																																																				0.527	C5orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372531.1			5	50	5	50
