#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
VAX1	11023	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	118896039	118896039	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr10:118896039C>T	ENST00000369206.5	-	2	372	c.373G>A	c.(373-375)Gtg>Atg	p.V125M	VAX1_ENST00000277905.2_Missense_Mutation_p.V125M	NM_001112704.1	NP_001106175.1	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1	125					axon guidance (GO:0007411)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|palate development (GO:0060021)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(8)|ovary(2)	12				all cancers(201;0.0108)		CGGCCCACCACGTACTGGCAG	0.667																																																0													38.0	38.0	38.0					10																	118896039		2203	4300	6503	SO:0001583	missense	11023			AK127095	CCDS7597.1, CCDS44483.1	10q26.11	2011-06-20			ENSG00000148704	ENSG00000148704		"""Homeoboxes / ANTP class : NKL subclass"""	12660	protein-coding gene	gene with protein product		604294				9636075, 10485894	Standard	NM_199131		Approved		uc009xyx.3	Q5SQQ9	OTTHUMG00000019117	ENST00000369206.5:c.373G>A	10.37:g.118896039C>T	ENSP00000358207:p.Val125Met	Somatic		WXS	Illumina GAIIx	Phase_I	B1AVW5|Q6ZSX0	Missense_Mutation	SNP	ENST00000369206.5	37	CCDS44483.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.478466	0.63849	.	.	ENSG00000148704	ENST00000277905;ENST00000369206	D;D	0.96265	-3.96;-3.96	3.88	3.88	0.44766	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000001	D	0.96182	0.8755	L	0.31526	0.94	0.53688	D	0.999978	D;D	0.89917	0.999;1.0	D;D	0.71870	0.954;0.975	D	0.95912	0.8924	10	0.40728	T	0.16	-7.2586	16.0214	0.80499	0.0:1.0:0.0:0.0	.	125;125	Q5SQQ9;Q5SQQ9-2	VAX1_HUMAN;.	M	125	ENSP00000277905:V125M;ENSP00000358207:V125M	ENSP00000277905:V125M	V	-	1	0	VAX1	118886029	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.571000	0.67404	1.996000	0.58369	0.455000	0.32223	GTG		0.667	VAX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050559.3	XM_301242		17	54	17	54
C11orf42	160298	hgsc.bcm.edu;broad.mit.edu	37	11	6231500	6231500	+	Missense_Mutation	SNP	G	G	C			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr11:6231500G>C	ENST00000316375.2	+	2	543	c.493G>C	c.(493-495)Gtc>Ctc	p.V165L	FAM160A2_ENST00000529360.1_5'Flank	NM_173525.2	NP_775796.2	Q8N5U0	CK042_HUMAN	chromosome 11 open reading frame 42	165										endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|soft_tissue(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.95e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CATCTACCAGGTCTTCTCTTG	0.587																																																0													104.0	106.0	105.0					11																	6231500		2201	4296	6497	SO:0001583	missense	0			BC031612	CCDS7759.1	11p15.4	2012-08-09			ENSG00000180878	ENSG00000180878			28541	protein-coding gene	gene with protein product						12477932	Standard	NM_173525		Approved	MGC34805	uc001mcj.3	Q8N5U0	OTTHUMG00000133377	ENST00000316375.2:c.493G>C	11.37:g.6231500G>C	ENSP00000321021:p.Val165Leu	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000316375.2	37	CCDS7759.1	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830524	0.32329	.	.	ENSG00000180878	ENST00000316375	T	0.55234	0.53	5.35	4.44	0.53790	.	0.000000	0.50627	D	0.000104	T	0.37237	0.0996	N	0.24115	0.695	0.30555	N	0.765105	P	0.35348	0.496	B	0.34242	0.178	T	0.47573	-0.9107	10	0.66056	D	0.02	-11.1753	9.9372	0.41559	0.0918:0.0:0.9082:0.0	.	165	Q8N5U0	CK042_HUMAN	L	165	ENSP00000321021:V165L	ENSP00000321021:V165L	V	+	1	0	C11orf42	6188076	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.416000	0.44644	1.491000	0.48482	0.585000	0.79938	GTC		0.587	C11orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257227.2	NM_173525		11	182	11	182
UEVLD	55293	hgsc.bcm.edu;broad.mit.edu	37	11	18568522	18568522	+	Missense_Mutation	SNP	T	T	A			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr11:18568522T>A	ENST00000396197.3	-	8	819	c.791A>T	c.(790-792)gAt>gTt	p.D264V	UEVLD_ENST00000541984.1_Intron|UEVLD_ENST00000540666.1_5'UTR|UEVLD_ENST00000535484.1_Missense_Mutation_p.D226V|UEVLD_ENST00000320750.6_Missense_Mutation_p.D242V|UEVLD_ENST00000543987.1_Missense_Mutation_p.D264V|UEVLD_ENST00000379387.4_Missense_Mutation_p.D242V	NM_001040697.2|NM_001261384.1	NP_001035787.1|NP_001248313.1			UEV and lactate/malate dehyrogenase domains											endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						CTGTACCACATCAAGGTACGA	0.458																																																0													150.0	135.0	140.0					11																	18568522		2199	4293	6492	SO:0001583	missense	55293			AF503350	CCDS7843.1, CCDS41624.1, CCDS58122.1, CCDS58123.1, CCDS58124.1, CCDS58125.1, CCDS73266.1	11p15.1	2006-07-14			ENSG00000151116	ENSG00000151116			30866	protein-coding gene	gene with protein product		610985				12427560	Standard	NM_001040697		Approved	Attp, UEV3	uc001mot.4	Q8IX04	OTTHUMG00000167729	ENST00000396197.3:c.791A>T	11.37:g.18568522T>A	ENSP00000379500:p.Asp264Val	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000396197.3	37	CCDS41624.1	.	.	.	.	.	.	.	.	.	.	T	17.02	3.281171	0.59758	.	.	ENSG00000151116	ENST00000543987;ENST00000535484;ENST00000396197;ENST00000320750;ENST00000379387;ENST00000540110	D;D;D;D;D	0.92099	-2.97;-2.97;-2.97;-2.97;-2.97	5.75	5.75	0.90469	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.145437	0.64402	D	0.000006	D	0.94453	0.8215	M	0.84585	2.705	0.80722	D	1	P;B;B;P	0.37781	0.608;0.442;0.027;0.608	P;B;B;P	0.48795	0.59;0.132;0.031;0.59	D	0.94700	0.7882	10	0.87932	D	0	-9.6078	10.4059	0.44256	0.0:0.0723:0.0:0.9277	.	242;242;264;264	B4DL43;Q8IX04-3;Q8IX04-2;Q8IX04	.;.;.;UEVLD_HUMAN	V	264;226;264;242;242;41	ENSP00000442974:D264V;ENSP00000441092:D226V;ENSP00000379500:D264V;ENSP00000323353:D242V;ENSP00000368697:D242V	ENSP00000323353:D242V	D	-	2	0	UEVLD	18525098	1.000000	0.71417	0.898000	0.35279	0.935000	0.57460	2.604000	0.46274	2.201000	0.70794	0.533000	0.62120	GAT		0.458	UEVLD-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395923.2	NM_018314		10	112	10	112
OR4A16	81327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	55111416	55111416	+	Missense_Mutation	SNP	T	T	C			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr11:55111416T>C	ENST00000314721.2	+	1	790	c.740T>C	c.(739-741)cTc>cCc	p.L247P		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						GTGGTTGCCCTCGTTTTTGTT	0.398																																																0													166.0	155.0	159.0					11																	55111416		2201	4296	6497	SO:0001583	missense	81327			AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.740T>C	11.37:g.55111416T>C	ENSP00000325128:p.Leu247Pro	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IFL3	Missense_Mutation	SNP	ENST00000314721.2	37	CCDS31499.1	.	.	.	.	.	.	.	.	.	.	t	9.719	1.159246	0.21454	.	.	ENSG00000181961	ENST00000314721	T	0.00302	8.2	2.86	2.86	0.33363	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01156	0.0038	H	0.98295	4.195	0.20489	N	0.999897	D	0.89917	1.0	D	0.87578	0.998	T	0.23833	-1.0177	9	0.87932	D	0	.	9.1065	0.36701	0.0:0.0:0.0:1.0	.	247	Q8NH70	O4A16_HUMAN	P	247	ENSP00000325128:L247P	ENSP00000325128:L247P	L	+	2	0	OR4A16	54867992	0.023000	0.18921	0.665000	0.29768	0.241000	0.25554	2.238000	0.43070	1.312000	0.45043	0.346000	0.21813	CTC		0.398	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274		19	48	19	48
CUX2	23316	hgsc.bcm.edu;broad.mit.edu	37	12	111729277	111729277	+	Silent	SNP	C	C	T	rs372694667		TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr12:111729277C>T	ENST00000261726.6	+	5	511	c.357C>T	c.(355-357)ccC>ccT	p.P119P		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	119					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						TGCAGCCCCCCAGCTTTGACC	0.617																																																0													50.0	56.0	54.0					12																	111729277		1958	4145	6103	SO:0001819	synonymous_variant	23316			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.357C>T	12.37:g.111729277C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A7E2Y4	Silent	SNP	ENST00000261726.6	37	CCDS41837.1																																																																																				0.617	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267		8	125	8	125
PRKD1	5587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	30105555	30105555	+	Silent	SNP	G	G	A			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr14:30105555G>A	ENST00000331968.5	-	7	1360	c.1131C>T	c.(1129-1131)aaC>aaT	p.N377N	PRKD1_ENST00000415220.2_Silent_p.N385N|PRKD1_ENST00000551644.1_5'Flank	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	377					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		CGCCACTGTCGTTCTGGCACT	0.542																																																0													380.0	283.0	316.0					14																	30105555		2203	4300	6503	SO:0001819	synonymous_variant	5587				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.1131C>T	14.37:g.30105555G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A6NL64|B2RAF6	Silent	SNP	ENST00000331968.5	37	CCDS9637.1																																																																																				0.542	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742		118	224	118	224
NAGPA	51172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	5081777	5081777	+	Silent	SNP	T	T	C			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr16:5081777T>C	ENST00000312251.3	-	3	670	c.651A>G	c.(649-651)caA>caG	p.Q217Q	NAGPA_ENST00000381955.3_Silent_p.Q217Q|RP11-165E7.1_ENST00000588778.1_RNA|ALG1_ENST00000588623.1_5'Flank|NAGPA_ENST00000564922.1_5'Flank	NM_016256.3	NP_057340.2	Q9UK23	NAGPA_HUMAN	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase	217					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|lysosome organization (GO:0007040)|protein glycosylation (GO:0006486)|protein targeting to lysosome (GO:0006622)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity (GO:0003944)			endometrium(4)|large_intestine(4)|lung(3)|urinary_tract(1)	12					N-Acetyl-D-glucosamine(DB00141)	ACTCTGTGGCTTGGCTCTCGT	0.572																																																0													241.0	210.0	220.0					16																	5081777		2197	4300	6497	SO:0001819	synonymous_variant	51172			AF187072	CCDS10527.1	16p13.3	2008-02-05			ENSG00000103174	ENSG00000103174	3.1.4.45		17378	protein-coding gene	gene with protein product		607985				10551838, 12058031	Standard	NM_016256		Approved	APAA, UCE	uc002cyg.3	Q9UK23	OTTHUMG00000090515	ENST00000312251.3:c.651A>G	16.37:g.5081777T>C		Somatic		WXS	Illumina GAIIx	Phase_I	B2RAS1|Q96EJ8	Silent	SNP	ENST00000312251.3	37	CCDS10527.1																																																																																				0.572	NAGPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207003.1	NM_016256		184	270	184	270
PDP2	57546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	66919576	66919576	+	Silent	SNP	C	C	T			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr16:66919576C>T	ENST00000311765.2	+	2	1723	c.1389C>T	c.(1387-1389)ctC>ctT	p.L463L	RP11-61A14.2_ENST00000561475.1_lincRNA|PDP2_ENST00000568720.1_Intron	NM_020786.2	NP_065837.1	Q9P2J9	PDP2_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 2	463					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|magnesium-dependent protein serine/threonine phosphatase activity (GO:0004724)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		CCAGCGGGCTCCACGAGGCTG	0.617																																																0													32.0	32.0	32.0					16																	66919576		2200	4300	6500	SO:0001819	synonymous_variant	57546			AB037769	CCDS10822.1	16q22.1	2012-04-17			ENSG00000172840	ENSG00000172840		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	30263	protein-coding gene	gene with protein product	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit 2"""	615499				9651365	Standard	NM_020786		Approved	KIAA1348, PPM2C2	uc002eqk.2	Q9P2J9	OTTHUMG00000137512	ENST00000311765.2:c.1389C>T	16.37:g.66919576C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A8K924	Silent	SNP	ENST00000311765.2	37	CCDS10822.1																																																																																				0.617	PDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268831.2	NM_020786		9	12	9	12
MINK1	50488	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	4797498	4797498	+	Silent	SNP	T	T	C			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr17:4797498T>C	ENST00000355280.6	+	23	2896	c.2700T>C	c.(2698-2700)caT>caC	p.H900H	MINK1_ENST00000453408.3_Silent_p.H880H|MINK1_ENST00000347992.7_Silent_p.H871H	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2			misshapen-like kinase 1											central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						ACCTGCTGCATGCTGACAGCA	0.622																																																0													91.0	101.0	98.0					17																	4797498		2167	4262	6429	SO:0001819	synonymous_variant	50488			AY775058	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2011-04-14	2010-06-24		ENSG00000141503	ENSG00000141503			17565	protein-coding gene	gene with protein product	"""misshapen/NIK-related kinase"""	609426	"""misshapen-like kinase 1 (zebrafish)"""			10708748, 12087176	Standard	NM_015716		Approved	B55, MINK, ZC3, MAP4K6, YSK2	uc010vsl.2	Q8N4C8		ENST00000355280.6:c.2700T>C	17.37:g.4797498T>C		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000355280.6	37	CCDS45588.1																																																																																				0.622	MINK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439801.1	NM_015716		46	123	46	123
MYOM1	8736	hgsc.bcm.edu;broad.mit.edu	37	18	3135615	3135615	+	Silent	SNP	G	G	A			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr18:3135615G>A	ENST00000356443.4	-	15	2472	c.2139C>T	c.(2137-2139)cgC>cgT	p.R713R	MYOM1_ENST00000400569.3_Silent_p.R713R|MYOM1_ENST00000261606.7_Silent_p.R713R	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	713	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						AATTAGAACAGCGGACACGGA	0.512																																																0													46.0	49.0	48.0					18																	3135615		1941	4138	6079	SO:0001819	synonymous_variant	8736			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.2139C>T	18.37:g.3135615G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q14BD6|Q6H969|Q6ZUU0	Silent	SNP	ENST00000356443.4	37	CCDS45824.1																																																																																				0.512	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803		3	58	3	58
GAREM	64762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	29848207	29848207	+	Missense_Mutation	SNP	T	T	C			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr18:29848207T>C	ENST00000269209.6	-	6	2261	c.2258A>G	c.(2257-2259)gAa>gGa	p.E753G	GAREM_ENST00000399218.4_Missense_Mutation_p.E752G			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	753					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										CTTGGGGTCTTCCTCAGCACC	0.522																																																0													76.0	75.0	75.0					18																	29848207		2203	4300	6503	SO:0001583	missense	64762			AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.2258A>G	18.37:g.29848207T>C	ENSP00000269209:p.Glu753Gly	Somatic		WXS	Illumina GAIIx	Phase_I	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	37	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	T	10.70	1.424618	0.25639	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.15139	2.45;2.45	5.32	5.32	0.75619	.	0.360549	0.33023	N	0.005366	T	0.10766	0.0263	N	0.08118	0	0.42745	D	0.993758	B;B	0.17268	0.002;0.021	B;B	0.15484	0.004;0.013	T	0.11131	-1.0600	10	0.48119	T	0.1	-18.2788	15.3194	0.74109	0.0:0.0:0.0:1.0	.	753;752	Q9H706;Q9H706-3	FA59A_HUMAN;.	G	752;753	ENSP00000382165:E752G;ENSP00000269209:E753G	ENSP00000269209:E753G	E	-	2	0	FAM59A	28102205	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.437000	0.34991	2.011000	0.59026	0.529000	0.55759	GAA		0.522	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751		41	55	41	55
LRRC4B	94030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	51022537	51022537	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr19:51022537G>A	ENST00000599957.1	-	3	630	c.433C>T	c.(433-435)Cgg>Tgg	p.R145W	LRRC4B_ENST00000389201.3_Missense_Mutation_p.R145W			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	145					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		GTGGTCAGCCGGTTGTCAAAA	0.622																																																0													52.0	57.0	55.0					19																	51022537		2200	4298	6498	SO:0001583	missense	94030			BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.433C>T	19.37:g.51022537G>A	ENSP00000471502:p.Arg145Trp	Somatic		WXS	Illumina GAIIx	Phase_I	Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	37	CCDS42595.1	.	.	.	.	.	.	.	.	.	.	G	14.81	2.645346	0.47258	.	.	ENSG00000131409	ENST00000389201;ENST00000535879	D	0.91631	-2.88	3.96	3.96	0.45880	.	0.000000	0.64402	U	0.000011	D	0.94440	0.8211	M	0.85777	2.775	0.52501	D	0.999959	D	0.62365	0.991	P	0.53649	0.731	D	0.94339	0.7569	10	0.45353	T	0.12	.	13.9104	0.63864	0.0:0.0:1.0:0.0	.	145	Q9NT99	LRC4B_HUMAN	W	145	ENSP00000373853:R145W	ENSP00000373853:R145W	R	-	1	2	LRRC4B	55714349	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.902000	0.56310	2.235000	0.73313	0.491000	0.48974	CGG		0.622	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457		49	31	49	31
HIVEP3	59269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	42050151	42050151	+	Silent	SNP	C	C	T	rs371696795		TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr1:42050151C>T	ENST00000372583.1	-	4	1203	c.318G>A	c.(316-318)tcG>tcA	p.S106S	HIVEP3_ENST00000372584.1_Silent_p.S106S|HIVEP3_ENST00000247584.5_Silent_p.S106S|HIVEP3_ENST00000429157.2_Silent_p.S106S	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	106					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GTTTGCCAGGCGACATGAATG	0.617																																																0								C	,	0,4406		0,0,2203	144.0	152.0	149.0		318,318	-9.1	0.1	1		149	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	HIVEP3	NM_001127714.2,NM_024503.4	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	106/2406,106/2407	42050151	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	59269			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.318G>A	1.37:g.42050151C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	37	CCDS463.1																																																																																				0.617	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503		119	55	119	55
TNN	63923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	175116175	175116175	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr1:175116175C>T	ENST00000239462.4	+	19	3981	c.3868C>T	c.(3868-3870)Cgg>Tgg	p.R1290W		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	1290					axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CAGAAAGAAGCGGACGCTGAG	0.592											OREG0013992	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0													59.0	55.0	56.0					1																	175116175		2203	4300	6503	SO:0001583	missense	63923			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.3868C>T	1.37:g.175116175C>T	ENSP00000239462:p.Arg1290Trp	Somatic	1921	WXS	Illumina GAIIx	Phase_I	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.089186	0.76756	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.29655	1.56	5.47	-2.48	0.06423	.	0.058763	0.64402	D	0.000004	T	0.52108	0.1714	M	0.77820	2.39	0.39951	D	0.974549	D	0.89917	1.0	D	0.66979	0.948	T	0.65117	-0.6246	10	0.87932	D	0	.	17.3221	0.87238	0.8225:0.1775:0.0:0.0	.	1290	Q9UQP3	TENN_HUMAN	W	1290;1113	ENSP00000239462:R1290W	ENSP00000239462:R1290W	R	+	1	2	TNN	173382798	0.973000	0.33851	0.145000	0.22337	0.823000	0.46562	0.274000	0.18680	-0.261000	0.09405	-0.247000	0.11927	CGG		0.592	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		17	29	17	29
CACNA1S	779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	201042735	201042735	+	Missense_Mutation	SNP	G	G	A	rs147112322		TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr1:201042735G>A	ENST00000362061.3	-	15	2325	c.2099C>T	c.(2098-2100)aCg>aTg	p.T700M	CACNA1S_ENST00000367338.3_Missense_Mutation_p.T700M	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	700					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CTTGGCCATCGTTGACTTCTC	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		21114	0.0		0.001	False		,,,				2504	0.0															0								G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	380.0	361.0	368.0		2099	-1.4	0.0	1	dbSNP_134	368	0,8600		0,0,4300	yes	missense	CACNA1S	NM_000069.2	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	700/1874	201042735	1,13005	2203	4300	6503	SO:0001583	missense	779			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.2099C>T	1.37:g.201042735G>A	ENSP00000355192:p.Thr700Met	Somatic		WXS	Illumina GAIIx	Phase_I	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	G	4.026	0.002315	0.07819	2.27E-4	0.0	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.96104	-3.91;-3.84	4.39	-1.38	0.09027	.	86.564400	0.05806	U	0.613207	T	0.81837	0.4907	N	0.00182	-1.905	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.71354	-0.4618	10	0.45353	T	0.12	.	10.866	0.46856	0.5244:0.0:0.4756:0.0	.	700	Q13698	CAC1S_HUMAN	M	700	ENSP00000355192:T700M;ENSP00000356307:T700M	ENSP00000355192:T700M	T	-	2	0	CACNA1S	199309358	0.000000	0.05858	0.000000	0.03702	0.387000	0.30353	-0.625000	0.05534	-0.602000	0.05775	-1.050000	0.02344	ACG		0.542	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069		69	653	69	653
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu	37	1	228432192	228432192	+	Missense_Mutation	SNP	C	C	A			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr1:228432192C>A	ENST00000422127.1	+	11	3445	c.3401C>A	c.(3400-3402)cCa>cAa	p.P1134Q	OBSCN_ENST00000570156.2_Missense_Mutation_p.P1226Q|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.P1134Q	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1134	Ig-like 11.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CTGGTGCTGCCACAGGCGGGC	0.587																																																0													73.0	81.0	78.0					1																	228432192		2055	4201	6256	SO:0001583	missense	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.3401C>A	1.37:g.228432192C>A	ENSP00000409493:p.Pro1134Gln	Somatic		WXS	Illumina GAIIx	Phase_I	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	.	0.026	-1.370001	0.01225	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.64618	-0.11;-0.11	3.44	-0.429	0.12303	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.559890	0.17711	N	0.164576	T	0.25901	0.0631	N	0.02391	-0.57	0.50171	D	0.999856	B;B	0.09022	0.002;0.001	B;B	0.11329	0.006;0.002	T	0.04178	-1.0971	10	0.13108	T	0.6	.	2.8084	0.05434	0.5105:0.2768:0.0798:0.1329	.	1134;1134	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	Q	1134	ENSP00000284548:P1134Q;ENSP00000409493:P1134Q	ENSP00000284548:P1134Q	P	+	2	0	OBSCN	226498815	0.001000	0.12720	0.988000	0.46212	0.000000	0.00434	1.113000	0.31184	-0.295000	0.08960	-3.581000	0.00029	CCA		0.587	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		10	120	10	120
ZBTB18	10472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	244218515	244218515	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr1:244218515G>A	ENST00000358704.4	+	2	1588	c.1439G>A	c.(1438-1440)tGc>tAc	p.C480Y		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	471					cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TGCAAGTGGTGCGAGCGCAGG	0.597																																																0													63.0	62.0	62.0					1																	244218515		2203	4300	6503	SO:0001583	missense	10472			U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.1439G>A	1.37:g.244218515G>A	ENSP00000351539:p.Cys480Tyr	Somatic		WXS	Illumina GAIIx	Phase_I	A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Missense_Mutation	SNP	ENST00000358704.4	37	CCDS1622.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429873	0.62844	.	.	ENSG00000179456	ENST00000358704	D	0.85861	-2.04	5.78	5.78	0.91487	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94155	0.8125	M	0.90252	3.1	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.81914	0.995;0.991	D	0.94582	0.7780	10	0.87932	D	0	.	20.0124	0.97464	0.0:0.0:1.0:0.0	.	471;480	Q99592;Q99592-2	ZN238_HUMAN;.	Y	480	ENSP00000351539:C480Y	ENSP00000351539:C480Y	C	+	2	0	ZNF238	242285138	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.869000	0.99810	2.749000	0.94314	0.655000	0.94253	TGC		0.597	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096513.2	NM_205768		28	53	28	53
DEFB119	245932	hgsc.bcm.edu;broad.mit.edu	37	20	29976970	29976970	+	Intron	SNP	C	C	T			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr20:29976970C>T	ENST00000376321.3	-	1	181				DEFB119_ENST00000339144.3_Intron|DEFB119_ENST00000376315.2_Missense_Mutation_p.R42H|DEFB119_ENST00000492344.1_Intron	NM_153289.3	NP_695021.2	Q8N690	DB119_HUMAN	defensin, beta 119						defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				large_intestine(2)|lung(1)|prostate(1)	4	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			ATTTCGGCAGCGTATGATGCT	0.453																																																0													214.0	182.0	193.0					20																	29976970		2203	4300	6503	SO:0001627	intron_variant	245932			AA939044	CCDS13178.1, CCDS33455.1	20q11.21	2007-02-19	2003-10-06		ENSG00000180483	ENSG00000180483		"""Defensins, beta"""	18099	protein-coding gene	gene with protein product			"""defensin, beta 120"""	DEFB120		11854508	Standard	NM_153289		Approved	DEFB-19, DEFB-20	uc002wvu.2	Q8N690	OTTHUMG00000032172	ENST00000376321.3:c.61+1255G>A	20.37:g.29976970C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q5GRG1|Q5JWP1|Q5TH42|Q8N689	Missense_Mutation	SNP	ENST00000376321.3	37	CCDS13178.1	.	.	.	.	.	.	.	.	.	.	C	33	5.208032	0.95033	.	.	ENSG00000180483	ENST00000376315	T	0.11385	2.78	3.71	3.71	0.42584	.	1.313780	0.05190	N	0.502908	T	0.32071	0.0817	.	.	.	0.25537	N	0.987212	D	0.89917	1.0	D	0.71870	0.975	T	0.17107	-1.0380	9	0.87932	D	0	-17.3563	11.2726	0.49148	0.0:1.0:0.0:0.0	.	42	Q8N690-2	.	H	42	ENSP00000365492:R42H	ENSP00000365492:R42H	R	-	2	0	DEFB119	29440631	0.394000	0.25246	0.799000	0.32177	0.909000	0.53808	0.854000	0.27791	2.377000	0.81083	0.563000	0.77884	CGC		0.453	DEFB119-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078514.1	NM_153289		16	208	16	208
CSTF1	1477	hgsc.bcm.edu;broad.mit.edu	37	20	54974333	54974333	+	Missense_Mutation	SNP	A	A	G			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr20:54974333A>G	ENST00000217109.4	+	5	1308	c.956A>G	c.(955-957)aAa>aGa	p.K319R	CSTF1_ENST00000493039.1_3'UTR	NM_001033521.1|NM_001324.2	NP_001028693.1|NP_001315.1	Q05048	CSTF1_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa	319					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	15			Colorectal(105;0.202)			AAAAATTCTAAATACATTCTC	0.388																																																0													104.0	101.0	102.0					20																	54974333		2203	4300	6503	SO:0001583	missense	1477				CCDS13452.1	20q13.31	2013-01-10	2002-08-29		ENSG00000101138	ENSG00000101138		"""WD repeat domain containing"""	2483	protein-coding gene	gene with protein product		600369	"""cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kD"""			1358884, 11257228	Standard	NM_001033521		Approved		uc002xxl.1	Q05048	OTTHUMG00000032791	ENST00000217109.4:c.956A>G	20.37:g.54974333A>G	ENSP00000217109:p.Lys319Arg	Somatic		WXS	Illumina GAIIx	Phase_I	Q5QPD8	Missense_Mutation	SNP	ENST00000217109.4	37	CCDS13452.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.122632	0.77436	.	.	ENSG00000101138	ENST00000415828;ENST00000217109;ENST00000425890;ENST00000452950	T;T;T	0.81247	-1.47;-1.47;-1.47	5.93	5.93	0.95920	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.78007	0.4216	L	0.56769	1.78	0.80722	D	1	B	0.29716	0.255	B	0.27796	0.083	T	0.74976	-0.3480	10	0.34782	T	0.22	-12.3028	16.3943	0.83563	1.0:0.0:0.0:0.0	.	319	Q05048	CSTF1_HUMAN	R	319;319;306;319	ENSP00000387968:K319R;ENSP00000217109:K319R;ENSP00000409035:K319R	ENSP00000217109:K319R	K	+	2	0	CSTF1	54407740	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	9.143000	0.94623	2.281000	0.76405	0.533000	0.62120	AAA		0.388	CSTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079794.2	NM_001033521		6	93	6	93
TIAM1	7074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	21	32589897	32589897	+	Missense_Mutation	SNP	T	T	C			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr21:32589897T>C	ENST00000286827.3	-	10	2585	c.2114A>G	c.(2113-2115)aAg>aGg	p.K705R	TIAM1_ENST00000541036.1_Missense_Mutation_p.K705R|TIAM1_ENST00000469412.1_5'UTR	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	705					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						TCCCTGCTTCTTTTTGGAGGT	0.522																																																0													185.0	165.0	172.0					21																	32589897		2203	4300	6503	SO:0001583	missense	7074				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.2114A>G	21.37:g.32589897T>C	ENSP00000286827:p.Lys705Arg	Somatic		WXS	Illumina GAIIx	Phase_I	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	T	16.52	3.145706	0.57044	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.42131	0.98;0.98	5.41	5.41	0.78517	.	0.213846	0.47852	D	0.000209	T	0.46308	0.1386	N	0.14661	0.345	0.58432	D	0.999997	B;D;B;D	0.69078	0.025;0.997;0.034;0.997	B;D;B;D	0.75020	0.022;0.985;0.012;0.985	T	0.42682	-0.9437	10	0.27785	T	0.31	.	15.6039	0.76646	0.0:0.0:0.0:1.0	.	705;705;546;705	F5GZ53;B7ZLR6;E9PD83;Q13009	.;.;.;TIAM1_HUMAN	R	705;546;705	ENSP00000286827:K705R;ENSP00000441570:K705R	ENSP00000286827:K705R	K	-	2	0	TIAM1	31511768	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.783000	0.85696	2.261000	0.74972	0.533000	0.62120	AAG		0.522	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253		98	120	98	120
MYT1L	23040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	1926215	1926215	+	Silent	SNP	C	C	T			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr2:1926215C>T	ENST00000399161.2	-	10	2073	c.1326G>A	c.(1324-1326)acG>acA	p.T442T	MYT1L_ENST00000428368.2_Silent_p.T442T	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	442					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TTGCTCTTTCCGTTTCCAAAG	0.547																																																0													159.0	155.0	156.0					2																	1926215		2018	4163	6181	SO:0001819	synonymous_variant	23040			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1326G>A	2.37:g.1926215C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	37																																																																																					0.547	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025		80	128	80	128
C2orf43	60526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	21001131	21001131	+	Missense_Mutation	SNP	C	C	G			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr2:21001131C>G	ENST00000237822.3	-	2	172	c.93G>C	c.(91-93)tgG>tgC	p.W31C	C2orf43_ENST00000381090.3_Missense_Mutation_p.W31C|C2orf43_ENST00000440866.2_Missense_Mutation_p.W31C|C2orf43_ENST00000541941.1_Intron|C2orf43_ENST00000435420.2_Missense_Mutation_p.W31C|C2orf43_ENST00000403006.2_Intron|C2orf43_ENST00000419825.2_Missense_Mutation_p.W31C	NM_001282721.1|NM_021925.2	NP_001269650.1|NP_068744.1	Q9H6V9	CB043_HUMAN	chromosome 2 open reading frame 43	31										endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAGGTCTGTCCAGGGCCCAC	0.423																																																0													96.0	96.0	96.0					2																	21001131		2203	4300	6503	SO:0001583	missense	0			AK025473	CCDS1702.1, CCDS62864.1, CCDS74488.1, CCDS74489.1	2p24.1	2014-02-07			ENSG00000118961	ENSG00000118961			26145	protein-coding gene	gene with protein product		613570				17135363, 24357060	Standard	NM_001282723		Approved	FLJ21820	uc002rec.3	Q9H6V9	OTTHUMG00000122097	ENST00000237822.3:c.93G>C	2.37:g.21001131C>G	ENSP00000237822:p.Trp31Cys	Somatic		WXS	Illumina GAIIx	Phase_I	B7ZA47|B7ZAJ5|D6W530|E7ESN0|Q53T37|Q53T58	Missense_Mutation	SNP	ENST00000237822.3	37	CCDS1702.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.437532	0.43224	.	.	ENSG00000118961	ENST00000381090;ENST00000237822;ENST00000435420;ENST00000440866;ENST00000412261;ENST00000402479;ENST00000419825	.	.	.	5.93	5.06	0.68205	.	0.000000	0.64402	D	0.000004	T	0.75064	0.3799	L	0.55481	1.735	0.80722	D	1	B;B;B;D;B;B	0.89917	0.275;0.023;0.246;1.0;0.088;0.179	B;B;B;D;B;B	0.85130	0.108;0.031;0.088;0.997;0.045;0.076	T	0.74665	-0.3589	9	0.39692	T	0.17	-9.1214	16.231	0.82343	0.0:0.8668:0.1332:0.0	.	31;31;31;31;31;31	B4DS38;B4DRG3;B7ZAJ5;B4DWE2;Q9H6V9;B5MDU6	.;.;.;.;CB043_HUMAN;.	C	31	.	ENSP00000237822:W31C	W	-	3	0	C2orf43	20864612	1.000000	0.71417	1.000000	0.80357	0.298000	0.27526	4.748000	0.62148	1.520000	0.48965	0.555000	0.69702	TGG		0.423	C2orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242861.1	NM_021925		52	106	52	106
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	C	T	rs121913500		TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr2:209113112C>T	ENST00000415913.1	-	4	776	c.395G>A	c.(394-396)cGt>cAt	p.R132H	IDH1_ENST00000345146.2_Missense_Mutation_p.R132H|IDH1_ENST00000446179.1_Missense_Mutation_p.R132H	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132H(2774)|p.R132L(59)|p.R132V(1)|p.G131_R132>VL(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	2835	Substitution - Missense(2834)|Complex - compound substitution(1)	central_nervous_system(2579)|haematopoietic_and_lymphoid_tissue(205)|bone(43)|prostate(4)|biliary_tract(2)|urinary_tract(1)|skin(1)											79.0	73.0	75.0					2																	209113112		2203	4300	6503	SO:0001583	missense	3417				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.395G>A	2.37:g.209113112C>T	ENSP00000390265:p.Arg132His	Somatic		WXS	Illumina GAIIx	Phase_I	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657324	0.88154	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	4.69	0.59074	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	H	0.99379	4.54	0.80722	D	1	B	0.25486	0.127	B	0.25405	0.06	D	0.92324	0.5868	10	0.87932	D	0	-20.0399	14.3783	0.66895	0.0:0.9288:0.0:0.0712	.	132	O75874	IDHC_HUMAN	H	132	ENSP00000260985:R132H;ENSP00000410513:R132H;ENSP00000390265:R132H;ENSP00000391075:R132H	ENSP00000260985:R132H	R	-	2	0	IDH1	208821357	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.088000	0.71371	1.356000	0.45884	0.555000	0.69702	CGT		0.393	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			66	92	66	92
CNTN3	5067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	74383984	74383984	+	Missense_Mutation	SNP	G	G	T			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr3:74383984G>T	ENST00000263665.6	-	12	1597	c.1570C>A	c.(1570-1572)Caa>Aaa	p.Q524K		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	524	Ig-like C2-type 6.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		GGGTCATGTTGTACCTGGCAG	0.418																																																0													124.0	116.0	119.0					3																	74383984		2203	4300	6503	SO:0001583	missense	5067			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1570C>A	3.37:g.74383984G>T	ENSP00000263665:p.Gln524Lys	Somatic		WXS	Illumina GAIIx	Phase_I	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.962319	0.34659	.	.	ENSG00000113805	ENST00000263665	T	0.65916	-0.18	5.25	4.36	0.52297	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.528270	0.20864	N	0.084291	T	0.35998	0.0951	N	0.05230	-0.09	0.09310	N	0.999999	B	0.02656	0.0	B	0.08055	0.003	T	0.16689	-1.0394	10	0.16896	T	0.51	.	8.5734	0.33583	0.076:0.0:0.7706:0.1534	.	524	Q9P232	CNTN3_HUMAN	K	524	ENSP00000263665:Q524K	ENSP00000263665:Q524K	Q	-	1	0	CNTN3	74466674	0.439000	0.25610	0.994000	0.49952	0.979000	0.70002	1.172000	0.31908	1.182000	0.42928	0.655000	0.94253	CAA		0.418	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872		45	71	45	71
OR5K3	403277	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	98109669	98109669	+	Missense_Mutation	SNP	C	C	T	rs150899692		TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr3:98109669C>T	ENST00000383695.1	+	1	160	c.160C>T	c.(160-162)Cgt>Tgt	p.R54C	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005516.1	NP_001005516.1	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K, member 3	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|prostate(1)|skin(1)|urinary_tract(1)	27						TATAGAGCAACGTCTTCACAC	0.413																																																0													290.0	273.0	279.0					3																	98109669		2203	4300	6503	SO:0001583	missense	403277				CCDS33803.1	3q11.2	2013-09-23			ENSG00000206536	ENSG00000206536		"""GPCR / Class A : Olfactory receptors"""	31290	protein-coding gene	gene with protein product							Standard	NM_001005516		Approved		uc011bgw.2	A6NET4	OTTHUMG00000160077	ENST00000383695.1:c.160C>T	3.37:g.98109669C>T	ENSP00000373194:p.Arg54Cys	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000383695.1	37	CCDS33803.1	.	.	.	.	.	.	.	.	.	.	C	6.653	0.488949	0.12641	.	.	ENSG00000206536	ENST00000383695	T	0.01152	5.26	5.35	4.48	0.54585	GPCR, rhodopsin-like superfamily (1);	0.369644	0.19791	N	0.105984	T	0.01730	0.0055	L	0.55017	1.72	0.09310	N	1	B	0.28552	0.215	B	0.20955	0.032	T	0.39583	-0.9607	10	0.49607	T	0.09	-2.0386	12.2011	0.54326	0.0:0.916:0.0:0.084	.	54	A6NET4	OR5K3_HUMAN	C	54	ENSP00000373194:R54C	ENSP00000373194:R54C	R	+	1	0	OR5K3	99592359	0.000000	0.05858	0.024000	0.17045	0.155000	0.21991	0.715000	0.25822	1.371000	0.46172	0.603000	0.83216	CGT		0.413	OR5K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359110.1			113	224	113	224
ANKRD17	26057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	73942823	73942823	+	Splice_Site	SNP	T	T	C			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr4:73942823T>C	ENST00000358602.4	-	33	7704		c.e33-2		ANKRD17_ENST00000330838.6_Splice_Site|ANKRD17_ENST00000509867.2_Splice_Site	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17						blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGGCATACCCTTAAAAAAGGA	0.388																																																0													49.0	46.0	47.0					4																	73942823		2202	4300	6502	SO:0001630	splice_region_variant	26057			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.7588-2A>G	4.37:g.73942823T>C		Somatic		WXS	Illumina GAIIx	Phase_I	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Splice_Site	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	T	15.94	2.980260	0.53827	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867	.	.	.	4.76	4.76	0.60689	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2255	0.48882	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANKRD17	74161687	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	6.698000	0.74608	2.081000	0.62600	0.383000	0.25322	.		0.388	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	Intron	7	39	7	39
FCHSD1	89848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	141023973	141023973	+	Missense_Mutation	SNP	C	C	T	rs199678864		TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr5:141023973C>T	ENST00000435817.2	-	17	1725	c.1675G>A	c.(1675-1677)Gga>Aga	p.G559R	FCHSD1_ENST00000522783.1_Missense_Mutation_p.G485R|FCHSD1_ENST00000523856.1_5'UTR|FCHSD1_ENST00000522126.1_3'UTR	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	559	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.								FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACTCTGTCCGGTGTAGCTG	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		16351	0.0		0.001	False		,,,				2504	0.0															0								C	ARG/GLY	0,3932		0,0,1966	33.0	36.0	35.0		1675	5.4	0.3	5		35	2,8320		0,2,4159	yes	missense	FCHSD1	NM_033449.2	125	0,2,6125	TT,TC,CC		0.024,0.0,0.0163	probably-damaging	559/691	141023973	2,12252	1966	4161	6127	SO:0001583	missense	89848			AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.1675G>A	5.37:g.141023973C>T	ENSP00000399259:p.Gly559Arg	Somatic		WXS	Illumina GAIIx	Phase_I	Q6UX75|Q86Y77|Q9NXX8	Missense_Mutation	SNP	ENST00000435817.2	37	CCDS47295.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	26.9	4.778900	0.90195	0.0	2.4E-4	ENSG00000197948	ENST00000435817;ENST00000522783	T;T	0.51325	0.71;0.71	5.41	5.41	0.78517	Src homology-3 domain (3);Variant SH3 (1);	0.209985	0.37809	N	0.001926	T	0.66479	0.2793	L	0.55213	1.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.67288	-0.5708	10	0.87932	D	0	-22.1406	19.0358	0.92978	0.0:1.0:0.0:0.0	.	239;559	Q86WN1-2;Q86WN1	.;FCSD1_HUMAN	R	559;485	ENSP00000399259:G559R;ENSP00000428677:G485R	ENSP00000399259:G559R	G	-	1	0	FCHSD1	141004157	0.893000	0.30496	0.340000	0.25575	0.971000	0.66376	7.200000	0.77838	2.833000	0.97629	0.650000	0.86243	GGA		0.622	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375282.2	NM_033449		23	30	23	30
CLINT1	9685	hgsc.bcm.edu;ucsc.edu	37	5	157241220	157241220	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr5:157241220G>A	ENST00000411809.2	-	4	529	c.325C>T	c.(325-327)Cga>Tga	p.R109*	CLINT1_ENST00000523094.1_Nonsense_Mutation_p.R91*|CLINT1_ENST00000523908.1_Nonsense_Mutation_p.R109*|CLINT1_ENST00000296951.5_Nonsense_Mutation_p.R91*|CLINT1_ENST00000530742.1_Nonsense_Mutation_p.R91*	NM_014666.3	NP_055481.1	Q14677	EPN4_HUMAN	clathrin interactor 1	109	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|lipid binding (GO:0008289)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|urinary_tract(1)	21	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCAGGGATCGTAAATCATAA	0.388																																					Colon(22;427 587 2170 6147 14291)											0													85.0	80.0	81.0					5																	157241220		1852	4101	5953	SO:0001587	stop_gained	9685			AF434813	CCDS47330.1, CCDS56388.1, CCDS56389.1	5q33.3	2006-06-13			ENSG00000113282	ENSG00000113282			23186	protein-coding gene	gene with protein product		607265				12213833, 12429846	Standard	NM_014666		Approved	ENTH, KIAA0171, EPNR, CLINT	uc011ddv.2	Q14677	OTTHUMG00000163527	ENST00000411809.2:c.325C>T	5.37:g.157241220G>A	ENSP00000388340:p.Arg109*	Somatic		WXS	Illumina GAIIx	Phase_I	B7Z6F8|D3DQJ6|Q8NAF1|Q96E05	Nonsense_Mutation	SNP	ENST00000411809.2	37	CCDS47330.1	.	.	.	.	.	.	.	.	.	.	G	37	6.108892	0.97291	.	.	ENSG00000113282	ENST00000523094;ENST00000530742;ENST00000411809;ENST00000296951;ENST00000523908	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-0.5192	20.0966	0.97849	0.0:0.0:1.0:0.0	.	.	.	.	X	91;91;109;91;109	.	ENSP00000296951:R91X	R	-	1	2	CLINT1	157173798	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.397000	0.66302	2.751000	0.94390	0.650000	0.86243	CGA		0.388	CLINT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374001.1	NM_014666		4	39	4	39
HLA-DOA	3111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	32975227	32975227	+	Silent	SNP	C	C	T			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr6:32975227C>T	ENST00000229829.5	-	3	549	c.474G>A	c.(472-474)gtG>gtA	p.V158V	HLA-DOA_ENST00000495532.1_5'UTR|HLA-DOA_ENST00000450833.2_Silent_p.V128V	NM_002119.3	NP_002110.1	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO alpha	158	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	9						TGGTCTGGGCCACTCCCTCAG	0.577																																																0													188.0	178.0	182.0					6																	32975227		1511	2709	4220	SO:0001819	synonymous_variant	3111			M31525	CCDS4763.1	6p21.3	2013-01-11		2001-10-05	ENSG00000204252	ENSG00000204252		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4936	protein-coding gene	gene with protein product		142930		HLA-DZA, HLA-DNA		2370084	Standard	XM_005272804		Approved	HLA-D0-alpha	uc003ocr.3	P06340	OTTHUMG00000031211	ENST00000229829.5:c.474G>A	6.37:g.32975227C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q58HU0|Q58HU1|Q5STC7|Q9TQC6|Q9TQC7|Q9TQC8|Q9TQC9|Q9TQD0|Q9TQD1|Q9TQD2|Q9TQD3	Silent	SNP	ENST00000229829.5	37	CCDS4763.1																																																																																				0.577	HLA-DOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076426.2	NM_002119		104	229	104	229
AHI1	54806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	135787392	135787392	+	Silent	SNP	G	G	A			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr6:135787392G>A	ENST00000367800.4	-	5	525	c.309C>T	c.(307-309)aaC>aaT	p.N103N	AHI1_ENST00000327035.6_Silent_p.N103N|AHI1_ENST00000457866.2_Silent_p.N103N	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	103					cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		CTAACTGTGTGTTCCTCAATT	0.393																																																0													245.0	225.0	231.0					6																	135787392		1900	4126	6026	SO:0001819	synonymous_variant	54806			AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.309C>T	6.37:g.135787392G>A		Somatic		WXS	Illumina GAIIx	Phase_I	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Silent	SNP	ENST00000367800.4	37	CCDS47483.1																																																																																				0.393	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651		94	108	94	108
PKD1L1	168507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	47933628	47933628	+	Missense_Mutation	SNP	C	C	G			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr7:47933628C>G	ENST00000289672.2	-	15	2350	c.2300G>C	c.(2299-2301)aGc>aCc	p.S767T		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	767	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						ACAGTAGTTGCTGTACACCAC	0.572																																																0													90.0	68.0	75.0					7																	47933628		2203	4300	6503	SO:0001583	missense	168507			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.2300G>C	7.37:g.47933628C>G	ENSP00000289672:p.Ser767Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	c	16.77	3.215128	0.58452	.	.	ENSG00000158683	ENST00000289672	T	0.68765	-0.35	5.23	4.35	0.52113	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	0.104209	0.42682	D	0.000675	T	0.78604	0.4309	M	0.63843	1.955	0.25474	N	0.987794	D	0.89917	1.0	D	0.91635	0.999	T	0.71407	-0.4602	10	0.54805	T	0.06	-11.3743	13.6843	0.62506	0.0:0.8439:0.1561:0.0	.	767	Q8TDX9	PK1L1_HUMAN	T	767	ENSP00000289672:S767T	ENSP00000289672:S767T	S	-	2	0	PKD1L1	47900153	1.000000	0.71417	0.179000	0.23059	0.558000	0.35554	3.411000	0.52672	1.197000	0.43143	0.543000	0.68304	AGC		0.572	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		41	83	41	83
MUC17	140453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	100679973	100679973	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr7:100679973C>T	ENST00000306151.4	+	3	5340	c.5276C>T	c.(5275-5277)aCg>aTg	p.T1759M		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1759	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTCAGCACCACGCCGGTACTC	0.502																																																0													285.0	298.0	294.0					7																	100679973		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5276C>T	7.37:g.100679973C>T	ENSP00000302716:p.Thr1759Met	Somatic		WXS	Illumina GAIIx	Phase_I	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-2.930901	0.00053	.	.	ENSG00000169876	ENST00000306151	T	0.02032	4.49	0.0465	-0.093	0.13652	.	.	.	.	.	T	0.01156	0.0038	N	0.14661	0.345	0.09310	N	1	D	0.59357	0.985	B	0.37451	0.25	T	0.46428	-0.9192	8	0.49607	T	0.09	.	.	.	.	.	1759	Q685J3	MUC17_HUMAN	M	1759	ENSP00000302716:T1759M	ENSP00000302716:T1759M	T	+	2	0	MUC17	100466693	0.009000	0.17119	0.001000	0.08648	0.001000	0.01503	0.219000	0.17641	-3.552000	0.00142	-3.604000	0.00028	ACG		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		270	446	270	446
AK8	158067	hgsc.bcm.edu;broad.mit.edu	37	9	135730311	135730311	+	Splice_Site	SNP	G	G	A			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr9:135730311G>A	ENST00000298545.3	-	5	856	c.335C>T	c.(334-336)aCa>aTa	p.T112I	AK8_ENST00000477396.1_5'UTR|RNU6-357P_ENST00000515914.1_RNA	NM_152572.2	NP_689785.1	Q96MA6	KAD8_HUMAN	adenylate kinase 8	112	Adenylate kinase 1.|NMPbind 1. {ECO:0000250}.				nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			NS(1)|kidney(2)|large_intestine(4)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(2)	23						GCTGGGAACTGTCTGAAGGAA	0.567																																																0													114.0	89.0	97.0					9																	135730311		2203	4300	6503	SO:0001630	splice_region_variant	158067			AK093446	CCDS6954.1	9q34.13	2013-04-29	2010-12-07	2010-12-07	ENSG00000165695	ENSG00000165695	2.7.4.3	"""Adenylate kinases"""	26526	protein-coding gene	gene with protein product		615365	"""chromosome 9 open reading frame 98"""	C9orf98		21080915	Standard	NM_152572		Approved	FLJ32704	uc004cbu.1	Q96MA6	OTTHUMG00000021009	ENST00000298545.3:c.334-1C>T	9.37:g.135730311G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A8K821|Q8N9W9	Splice_Site	SNP	ENST00000298545.3	37	CCDS6954.1	.	.	.	.	.	.	.	.	.	.	G	4.766	0.142460	0.09083	.	.	ENSG00000165695	ENST00000298545	T	0.74632	-0.86	3.49	-6.99	0.01605	.	1.563310	0.04102	N	0.313039	T	0.53932	0.1827	N	0.25485	0.75	0.09310	N	1	B	0.13145	0.007	B	0.17979	0.02	T	0.35649	-0.9780	10	0.39692	T	0.17	-0.1219	0.6199	0.00776	0.2645:0.1993:0.1265:0.4097	.	112	Q96MA6	KAD8_HUMAN	I	112	ENSP00000298545:T112I	ENSP00000298545:T112I	T	-	2	0	AK8	134720132	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-2.427000	0.01026	-2.746000	0.00377	-0.424000	0.05967	ACA		0.567	AK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055413.1	NM_152572	Missense_Mutation	4	73	4	73
RALGDS	5900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	135979652	135979652	+	Missense_Mutation	SNP	T	T	C			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr9:135979652T>C	ENST00000372050.3	-	10	1690	c.1669A>G	c.(1669-1671)Acg>Gcg	p.T557A	RALGDS_ENST00000469972.1_5'UTR|RALGDS_ENST00000393160.3_Missense_Mutation_p.T502A|RALGDS_ENST00000372062.3_Missense_Mutation_p.T528A|RALGDS_ENST00000372047.3_Missense_Mutation_p.T545A|RALGDS_ENST00000542690.1_Missense_Mutation_p.T628A|RALGDS_ENST00000393157.3_Missense_Mutation_p.T556A	NM_006266.2	NP_006257.1	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	557	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		ACTCTCACCGTCTCCTTCGGC	0.657			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																Melanoma(189;762 2088 15384 21931 52515)		Dom	yes		9	9q34.3	5900	ral guanine nucleotide dissociation stimulator		L	0													76.0	70.0	72.0					9																	135979652		2203	4300	6503	SO:0001583	missense	5900			AB037729	CCDS6959.1, CCDS43897.1, CCDS65172.1, CCDS65173.1, CCDS65174.1	9q34.3	2009-04-08			ENSG00000160271	ENSG00000160271			9842	protein-coding gene	gene with protein product		601619				7972015	Standard	NM_006266		Approved	RGF, RalGEF, RGDS	uc004ccr.3	Q12967	OTTHUMG00000020858	ENST00000372050.3:c.1669A>G	9.37:g.135979652T>C	ENSP00000361120:p.Thr557Ala	Somatic		WXS	Illumina GAIIx	Phase_I	B7Z753|E7ER93|E7ERZ0|Q5T7V4|Q6KH11|Q6PCE1|Q6ZSD5|Q9HAX7|Q9HAY1|Q9HCT1|Q9P2N8	Missense_Mutation	SNP	ENST00000372050.3	37	CCDS6959.1	.	.	.	.	.	.	.	.	.	.	T	0.043	-1.274960	0.01410	.	.	ENSG00000160271	ENST00000372050;ENST00000372047;ENST00000393160;ENST00000372051;ENST00000393157;ENST00000542690;ENST00000372062;ENST00000424572	T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64	4.56	0.731	0.18277	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.503297	0.19029	N	0.124612	T	0.09818	0.0241	N	0.04787	-0.16	0.28203	N	0.927255	B;B;B;B;B;B;B;B	0.27416	0.0;0.009;0.178;0.018;0.002;0.074;0.074;0.044	B;B;B;B;B;B;B;B	0.20955	0.002;0.017;0.032;0.03;0.017;0.02;0.02;0.017	T	0.30327	-0.9982	10	0.08599	T	0.76	.	4.3035	0.10935	0.3466:0.0924:0.0:0.561	.	628;528;557;545;502;556;545;557	F5H6M6;E7ER93;Q12967-2;Q8TEK9;Q6KH11;E7ERZ0;Q6PCE1;Q12967	.;.;.;.;.;.;.;GNDS_HUMAN	A	557;545;502;254;556;628;528;117	ENSP00000361120:T557A;ENSP00000361117:T545A;ENSP00000376867:T502A;ENSP00000376864:T556A;ENSP00000437518:T628A;ENSP00000361132:T528A;ENSP00000391814:T117A	ENSP00000361117:T545A	T	-	1	0	RALGDS	134969473	0.999000	0.42202	0.045000	0.18777	0.042000	0.13812	0.336000	0.19823	0.016000	0.14998	0.482000	0.46254	ACG		0.657	RALGDS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054837.1	NM_006266		33	42	33	42
IL13RA1	3597	hgsc.bcm.edu;broad.mit.edu	37	X	117900529	117900529	+	Missense_Mutation	SNP	A	A	G			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chrX:117900529A>G	ENST00000371666.3	+	7	932	c.865A>G	c.(865-867)Aga>Gga	p.R289G	IL13RA1_ENST00000481868.1_3'UTR	NM_001560.2	NP_001551.1	P78552	I13R1_HUMAN	interleukin 13 receptor, alpha 1	289	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin production (GO:0002639)	interleukin-13 receptor complex (GO:0005898)|plasma membrane (GO:0005886)	interleukin-13 receptor activity (GO:0016515)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)	12						AGAATTTGAGAGAAATGTGGA	0.338																																																0													94.0	89.0	90.0					X																	117900529		2203	4300	6503	SO:0001583	missense	3597			U62858	CCDS14573.1	Xq24	2008-02-05			ENSG00000131724	ENSG00000131724		"""Interleukins and interleukin receptors"", ""CD molecules"""	5974	protein-coding gene	gene with protein product	"""IL13 receptor alpha-1 chain"", ""CD213a1 antigen"""	300119				8910586, 9013879	Standard	NM_001560		Approved	IL-13Ra, NR4, CD213a1	uc004eqs.3	P78552	OTTHUMG00000022258	ENST00000371666.3:c.865A>G	X.37:g.117900529A>G	ENSP00000360730:p.Arg289Gly	Somatic		WXS	Illumina GAIIx	Phase_I	O95646|Q5JSL4|Q99656|Q9UDY5	Missense_Mutation	SNP	ENST00000371666.3	37	CCDS14573.1	.	.	.	.	.	.	.	.	.	.	A	2.627	-0.287240	0.05605	.	.	ENSG00000131724	ENST00000371666	D	0.89939	-2.59	4.16	3.18	0.36537	Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.221100	0.05659	N	0.586519	T	0.79423	0.4443	N	0.22421	0.69	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.62623	-0.6815	10	0.15499	T	0.54	0.0203	3.1441	0.06466	0.3727:0.0:0.6273:0.0	.	289;289	Q5JSL4;P78552	.;I13R1_HUMAN	G	289	ENSP00000360730:R289G	ENSP00000360730:R289G	R	+	1	2	IL13RA1	117784557	1.000000	0.71417	0.239000	0.24122	0.568000	0.35870	1.286000	0.33273	0.570000	0.29347	0.412000	0.27726	AGA		0.338	IL13RA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058009.1	NM_001560		6	71	6	71
SH3GL2	6456	broad.mit.edu;ucsc.edu	37	9	17795580	17795580	+	Missense_Mutation	SNP	G	G	A	rs139383722		TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr9:17795580G>A	ENST00000380607.4	+	9	1018	c.898G>A	c.(898-900)Gac>Aac	p.D300N	SH3GL2_ENST00000537391.1_Missense_Mutation_p.D253N	NM_003026.2	NP_003017.1	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	300	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of receptor internalization (GO:0002090)|signal transduction (GO:0007165)|synaptic vesicle endocytosis (GO:0048488)	clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)	p.D300N(1)		NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		AGCTCTGTACGACTTTGAACC	0.463																																																1	Substitution - Missense(1)	skin(1)											97.0	92.0	93.0					9																	17795580		2203	4300	6503	SO:0001583	missense	6456			X99657	CCDS6483.1	9p22	2008-02-05			ENSG00000107295	ENSG00000107295			10831	protein-coding gene	gene with protein product		604465				9169142	Standard	XM_005251549		Approved	SH3P4, SH3D2A, CNSA2, EEN-B1	uc003zna.3	Q99962	OTTHUMG00000019601	ENST00000380607.4:c.898G>A	9.37:g.17795580G>A	ENSP00000369981:p.Asp300Asn	Somatic		WXS	Illumina GAIIx	Phase_I	B2R618|Q9NQK5	Missense_Mutation	SNP	ENST00000380607.4	37	CCDS6483.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664370	0.88251	.	.	ENSG00000107295	ENST00000541215;ENST00000380607;ENST00000537391	T;T	0.56776	0.44;0.44	5.7	4.81	0.61882	Src homology-3 domain (4);Spectrin alpha chain, SH3 domain (1);Variant SH3 (1);	0.276491	0.37715	N	0.001970	T	0.67192	0.2867	M	0.73217	2.22	0.80722	D	1	D	0.61697	0.99	P	0.58577	0.841	T	0.70934	-0.4737	10	0.56958	D	0.05	.	14.7852	0.69796	0.0693:0.0:0.9307:0.0	.	300	Q99962	SH3G2_HUMAN	N	129;300;253	ENSP00000369981:D300N;ENSP00000443365:D253N	ENSP00000369981:D300N	D	+	1	0	SH3GL2	17785580	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.937000	0.87672	1.419000	0.47118	0.561000	0.74099	GAC		0.463	SH3GL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051796.1	NM_003026		29	43	29	43
OPN5	221391	broad.mit.edu;ucsc.edu	37	6	47775993	47775993	+	Missense_Mutation	SNP	T	T	A			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr6:47775993T>A	ENST00000371211.2	+	5	888	c.860T>A	c.(859-861)cTc>cAc	p.L287H	OPN5_ENST00000393699.2_Missense_Mutation_p.L287H|OPN5_ENST00000489301.2_Missense_Mutation_p.L287H|OPN5_ENST00000244799.4_3'UTR	NM_181744.3	NP_859528.1	Q6U736	OPN5_HUMAN	opsin 5	287					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|large_intestine(3)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	29						CCCATACAGCTCTCTGTGGTG	0.463																																					Melanoma(28;740 973 10870 42660 45347)											0													289.0	258.0	268.0					6																	47775993		2203	4300	6503	SO:0001583	missense	221391			AY288419	CCDS4923.1	6p12.3	2012-08-08	2004-01-23		ENSG00000124818	ENSG00000124818		"""GPCR / Class A : Opsin receptors"""	19992	protein-coding gene	gene with protein product	"""neuropsin"""	609042	"""transmembrane protein 13"""	TMEM13		14623103, 14623098	Standard	NR_033806		Approved	neuropsin, dJ402H5.1	uc003ozc.3	Q6U736	OTTHUMG00000014803	ENST00000371211.2:c.860T>A	6.37:g.47775993T>A	ENSP00000360255:p.Leu287His	Somatic		WXS	Illumina GAIIx	Phase_I	A0AV33|Q5T5B9|Q5T886|Q7Z603|Q86SL5	Missense_Mutation	SNP	ENST00000371211.2	37	CCDS4923.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.758229	0.89843	.	.	ENSG00000124818	ENST00000489301;ENST00000371211;ENST00000393699	T;T;T	0.41065	1.01;1.01;1.01	5.3	5.3	0.74995	GPCR, rhodopsin-like superfamily (1);	0.165679	0.53938	D	0.000046	T	0.39462	0.1079	L	0.39898	1.24	0.42735	D	0.993724	D	0.59767	0.986	P	0.56343	0.796	T	0.21999	-1.0229	10	0.44086	T	0.13	.	15.5564	0.76196	0.0:0.0:0.0:1.0	.	287	Q6U736	OPN5_HUMAN	H	287	ENSP00000426991:L287H;ENSP00000360255:L287H;ENSP00000377302:L287H	ENSP00000360255:L287H	L	+	2	0	OPN5	47883952	0.984000	0.35163	0.998000	0.56505	0.990000	0.78478	4.722000	0.61958	2.137000	0.66172	0.533000	0.62120	CTC		0.463	OPN5-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359451.1	NM_181744		66	128	66	128
MIR7162	102466227	broad.mit.edu;ucsc.edu	37	15	62539227	62539227	+	RNA	SNP	C	C	T	rs185744405	byFrequency	TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr15:62539227C>T	ENST00000570077.1	-	0	362																											AGCTTACCCACCTGGTTCCTT	0.577													.|||	6	0.00119808	0.003	0.0	5008	,	,		18657	0.001		0.0	False		,,,				2504	0.001															0																																												0																															15.37:g.62539227C>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000570077.1	37		2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	T	3.428	-0.116756	0.06838	.	.	ENSG00000166104	ENST00000429274	.	.	.	1.85	0.681	0.17986	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.465	0.11685	0.0:0.363:0.0:0.637	.	.	.	.	.	-1	.	.	.	-	.	.	AC126323.1	60326519	0.000000	0.05858	0.053000	0.19242	0.015000	0.08874	-0.885000	0.04161	-0.189000	0.10482	-2.160000	0.00327	.		0.577	hsa-mir-7162.1-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000422143.1			8	54	8	54
PCDHB17	54661	broad.mit.edu;ucsc.edu	37	5	140537080	140537080	+	Missense_Mutation	SNP	G	G	T			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr5:140537080G>T	ENST00000539533.1	+	1	1504	c.1504G>T	c.(1504-1506)Gcc>Tcc	p.A502S						protocadherin beta 17 pseudogene																		CCTGCCCCTCGCCTCCCTGGT	0.652																																																0																																										SO:0001583	missense	54661			AF152527		5q31	2010-01-26				ENSG00000255622		"""Cadherins / Protocadherins : Clustered"""	14547	pseudogene	pseudogene						10380929	Standard	NR_001280		Approved	PCDH-psi1	uc003lis.3			ENST00000539533.1:c.1504G>T	5.37:g.140537080G>T	ENSP00000438685:p.Ala502Ser	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000539533.1	37		.	.	.	.	.	.	.	.	.	.	G	0.027	-1.365346	0.01235	.	.	ENSG00000255622	ENST00000539533	T	0.51325	0.71	4.78	1.74	0.24563	.	.	.	.	.	T	0.18467	0.0443	.	.	.	.	.	.	B	0.31859	0.343	B	0.22152	0.038	T	0.34976	-0.9807	7	0.02654	T	1	.	7.387	0.26888	0.1515:0.0:0.6538:0.1947	.	502	Q96T98	.	S	502	ENSP00000438685:A502S	ENSP00000438685:A502S	A	+	1	0	AC005754.1	140517264	0.000000	0.05858	0.028000	0.17463	0.237000	0.25408	-0.819000	0.04462	0.529000	0.28599	0.556000	0.70494	GCC		0.652	PCDHB17-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				108	197	108	197
ZNF292	23036	broad.mit.edu;hgsc.bcm.edu	37	6	87968456	87968457	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr6:87968456_87968457delAG	ENST00000369577.3	+	8	5152_5153	c.5109_5110delAG	c.(5107-5112)aaagagfs	p.E1704fs	ZNF292_ENST00000339907.4_Frame_Shift_Del_p.E1699fs	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1704						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		CTGATGTAAAAGAGAATTTCAA	0.327																																																0																																										SO:0001589	frameshift_variant	23036			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.5109_5110delAG	6.37:g.87968458_87968459delAG	ENSP00000358590:p.Glu1704fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Frame_Shift_Del	DEL	ENST00000369577.3	37	CCDS47457.1																																																																																				0.327	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021		12	31	12	31
OR2A14	135941	broad.mit.edu;hgsc.bcm.edu	37	7	143826799	143826799	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr7:143826799delC	ENST00000408899.2	+	1	649	c.594delC	c.(592-594)atcfs	p.I198fs		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	198						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					AGGTGGTCATCTTTGCAGCCT	0.577																																																0													157.0	163.0	161.0					7																	143826799		2026	4189	6215	SO:0001589	frameshift_variant	135941				CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.594delC	7.37:g.143826799delC	ENSP00000386137:p.Ile198fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IF41|Q8NGT8	Frame_Shift_Del	DEL	ENST00000408899.2	37	CCDS43672.1																																																																																				0.577	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1			184	243	184	243
DDX5	1655	broad.mit.edu;hgsc.bcm.edu	37	17	62500099	62500102	+	Splice_Site	DEL	ACAG	ACAG	-			TCGA-HT-7687-01A-11D-2253-08	TCGA-HT-7687-10A-01D-2253-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e34b8386-87a8-421b-a6bd-508c451d5300	4172944b-df65-47bc-8567-9748e088836a	g.chr17:62500099_62500102delACAG	ENST00000225792.5	-	4	841_843	c.440_442delCTGT	c.(439-444)tctgta>tta	p.SV147fs	DDX5_ENST00000580026.1_5'Flank|DDX5_ENST00000578804.1_Splice_Site_p.SV147fs|CEP95_ENST00000556440.2_5'Flank|DDX5_ENST00000450599.2_Intron|MIR5047_ENST00000579212.1_RNA	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	147	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			TCCCAAACTTACAGACAATGTTTT	0.397			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	0																																										SO:0001630	splice_region_variant	1655			AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.441+1CTGT>-	17.37:g.62500099_62500102delACAG		Somatic		WXS	Illumina GAIIx	Phase_I	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Splice_Site	DEL	ENST00000225792.5	37	CCDS11659.1																																																																																				0.397	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444030.1	NM_004396	Frame_Shift_Del	118	244	118	244
