#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
SFTPA1	653509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	81373779	81373779	+	Silent	SNP	G	G	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr10:81373779G>A	ENST00000398636.3	+	6	795	c.657G>A	c.(655-657)cgG>cgA	p.R219R	SFTPA1_ENST00000428376.2_Silent_p.R219R|SFTPA1_ENST00000372308.3_Silent_p.R219R|SFTPA1_ENST00000372313.5_Silent_p.R160R|SFTPA1_ENST00000419470.2_Silent_p.R234R	NM_001164644.1|NM_001164646.1|NM_005411.4	NP_001158116.1|NP_001158118.1|NP_005402.3	Q8IWL2	SFTA1_HUMAN	surfactant protein A1	219	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.		R -> W (associated with susceptibility to idiopathic pulmonary fibrosis in smokers; allele 6A(4) and allele 6A(5); dbSNP:rs4253527). {ECO:0000269|PubMed:13680361, ECO:0000269|PubMed:19100526, ECO:0000269|PubMed:20693318, ECO:0000269|Ref.5}.		lipid transport (GO:0006869)|respiratory gaseous exchange (GO:0007585)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|lipid transporter activity (GO:0005319)			endometrium(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			CCGCAGGTCGGGGAAAAGAGC	0.562																																																0													178.0	172.0	174.0					10																	81373779		2203	4296	6499	SO:0001819	synonymous_variant	653509			BC026229	CCDS44444.1, CCDS44445.1, CCDS44444.2	10q22.3	2012-11-02	2008-08-26			ENSG00000122852		"""Collectins"""	10798	protein-coding gene	gene with protein product	"""surfactant, pulmonary-associated protein A1A"""	178630	"""surfactant, pulmonary-associated protein A1"""	SFTP1			Standard	NM_001093770		Approved	SP-A, SP-A1, COLEC4	uc009xry.3	Q8IWL2		ENST00000398636.3:c.657G>A	10.37:g.81373779G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A8K3T8|B7ZW50|E3VLD8|E3VLD9|E3VLE0|E3VLE1|G5E9J3|P07714|Q14DV4|Q5RIR5|Q5RIR7|Q6PIT0|Q8TC19	Silent	SNP	ENST00000398636.3	37	CCDS44445.1																																																																																				0.562	SFTPA1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_005411		92	86	92	86
PTEN	5728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	89717727	89717727	+	Missense_Mutation	SNP	G	G	C			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr10:89717727G>C	ENST00000371953.3	+	7	2109	c.752G>C	c.(751-753)gGt>gCt	p.G251A	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	251	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.		G -> C (loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G251D(2)|p.G165_*404del(1)|p.?(1)|p.G251V(1)|p.G251fs*6(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CCTGTGTGTGGTGATATCAAA	0.398		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	52	Whole gene deletion(37)|Deletion - Frameshift(9)|Substitution - Missense(3)|Deletion - In frame(1)|Insertion - Frameshift(1)|Unknown(1)	prostate(16)|central_nervous_system(11)|skin(7)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|endometrium(2)|urinary_tract(2)|soft_tissue(1)											122.0	108.0	113.0					10																	89717727		2203	4300	6503	SO:0001583	missense	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.752G>C	10.37:g.89717727G>C	ENSP00000361021:p.Gly251Ala	Somatic		WXS	Illumina GAIIx	Phase_I	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	37	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.919163	0.92249	.	.	ENSG00000171862	ENST00000371953	D	0.96300	-3.97	5.15	5.15	0.70609	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.100158	0.64402	D	0.000002	D	0.97876	0.9302	M	0.84846	2.72	0.80722	D	1	D	0.62365	0.991	P	0.58721	0.844	D	0.98208	1.0471	9	.	.	.	-10.5796	18.6161	0.91303	0.0:0.0:1.0:0.0	.	251	P60484	PTEN_HUMAN	A	251	ENSP00000361021:G251A	.	G	+	2	0	PTEN	89707707	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.429000	0.97481	2.380000	0.81148	0.585000	0.79938	GGT		0.398	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314		22	20	22	20
PKD2L1	9033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	102057297	102057297	+	Silent	SNP	G	G	A	rs200290739	byFrequency	TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr10:102057297G>A	ENST00000318222.3	-	5	1180	c.798C>T	c.(796-798)agC>agT	p.S266S	PKD2L1_ENST00000353274.3_Silent_p.S266S|PKD2L1_ENST00000338519.3_Intron	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	266					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		AGCCACCTCCGCTGTAGCTTG	0.627													G|||	3	0.000599042	0.0023	0.0	5008	,	,		14345	0.0		0.0	False		,,,				2504	0.0															0								G		1,4405	2.1+/-5.4	0,1,2202	54.0	49.0	51.0		798	-3.2	1.0	10		51	0,8600		0,0,4300	no	coding-synonymous	PKD2L1	NM_016112.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		266/806	102057297	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9033			AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.798C>T	10.37:g.102057297G>A		Somatic		WXS	Illumina GAIIx	Phase_I	O75972|Q5W039|Q9UP35|Q9UPA2	Silent	SNP	ENST00000318222.3	37	CCDS7492.1																																																																																				0.627	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049863.2	NM_016112		21	27	21	27
MUC6	4588	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	1025338	1025338	+	Silent	SNP	G	G	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr11:1025338G>A	ENST00000421673.2	-	23	2879	c.2829C>T	c.(2827-2829)aaC>aaT	p.N943N		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	943	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGACCGTGTAGTTTCTGTCCG	0.677																																																0													48.0	56.0	53.0					11																	1025338		2045	4202	6247	SO:0001819	synonymous_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.2829C>T	11.37:g.1025338G>A		Somatic		WXS	Illumina GAIIx	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																				0.677	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540		55	106	55	106
OR8J3	81168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	55904779	55904779	+	Missense_Mutation	SNP	C	C	T	rs373232843		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr11:55904779C>T	ENST00000301529.1	-	1	415	c.416G>A	c.(415-417)cGg>cAg	p.R139Q		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	139						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R139L(1)|p.R139Q(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					GAGGCAGAGCCGCCGAGACAC	0.473																																																2	Substitution - Missense(2)	kidney(2)						C	GLN/ARG	0,4402		0,0,2201	111.0	107.0	109.0		416	-2.9	0.0	11		109	1,8591	1.2+/-3.3	0,1,4295	no	missense	OR8J3	NM_001004064.1	43	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	benign	139/316	55904779	1,12993	2201	4296	6497	SO:0001583	missense	81168				CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.416G>A	11.37:g.55904779C>T	ENSP00000301529:p.Arg139Gln	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	37	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.417544	0.42918	0.0	1.16E-4	ENSG00000167822	ENST00000301529	T	0.41758	0.99	3.26	-2.86	0.05717	GPCR, rhodopsin-like superfamily (1);	1.003870	0.08023	N	0.992227	T	0.26521	0.0648	L	0.28458	0.855	0.09310	N	1	B	0.15719	0.014	B	0.14578	0.011	T	0.32981	-0.9886	10	0.12430	T	0.62	.	9.911	0.41406	0.0:0.4758:0.0:0.5242	.	139	Q8NGG0	OR8J3_HUMAN	Q	139	ENSP00000301529:R139Q	ENSP00000301529:R139Q	R	-	2	0	OR8J3	55661355	0.000000	0.05858	0.000000	0.03702	0.705000	0.40729	-1.311000	0.02723	-0.450000	0.07107	0.289000	0.19496	CGG		0.473	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064		33	86	33	86
OR10G4	390264	hgsc.bcm.edu;broad.mit.edu	37	11	123886716	123886716	+	Silent	SNP	C	C	T	rs144654389		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr11:123886716C>T	ENST00000320891.4	+	1	435	c.435C>T	c.(433-435)acC>acT	p.T145T		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TCCTGGCCACCGGCACTTGGC	0.547													c|||	1	0.000199681	0.0	0.0	5008	,	,		24221	0.0		0.001	False		,,,				2504	0.0															0													158.0	159.0	159.0					11																	123886716		2201	4299	6500	SO:0001819	synonymous_variant	390264			AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.435C>T	11.37:g.123886716C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q6IEW0	Silent	SNP	ENST00000320891.4	37	CCDS31702.1																																																																																				0.547	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387268.1	NM_001004462		106	243	106	243
ATF7IP	55729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	14576907	14576907	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr12:14576907G>A	ENST00000540793.1	+	1	213	c.58G>A	c.(58-60)Gtg>Atg	p.V20M	ATF7IP_ENST00000261168.4_Missense_Mutation_p.V20M|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000543189.1_Missense_Mutation_p.V20M|ATF7IP_ENST00000544627.1_Missense_Mutation_p.V28M|ATF7IP_ENST00000536444.1_Missense_Mutation_p.V20M			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	20					DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						AACGATGAGAGTGAGTGATCG	0.358																																																0													77.0	69.0	72.0					12																	14576907		2203	4300	6503	SO:0001583	missense	55729			AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.58G>A	12.37:g.14576907G>A	ENSP00000444589:p.Val20Met	Somatic		WXS	Illumina GAIIx	Phase_I	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	ENST00000540793.1	37	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.018773	0.75275	.	.	ENSG00000171681	ENST00000261168;ENST00000545723;ENST00000543189;ENST00000536444;ENST00000542967;ENST00000534828;ENST00000535132;ENST00000544627;ENST00000542991;ENST00000541056;ENST00000539057;ENST00000545769;ENST00000428217;ENST00000396279;ENST00000542514;ENST00000536279;ENST00000542508;ENST00000540793	T;T;T;T;T;T	0.28895	1.95;1.95;1.94;1.95;1.59;1.95	5.44	5.44	0.79542	.	0.363987	0.23175	N	0.051090	T	0.43366	0.1244	L	0.40543	1.245	0.25832	N	0.984157	D;D;D;D;D	0.63880	0.993;0.993;0.986;0.986;0.986	P;P;P;P;P	0.61592	0.891;0.891;0.814;0.814;0.8	T	0.28396	-1.0045	10	0.62326	D	0.03	-2.0529	13.8794	0.63674	0.0733:0.0:0.9267:0.0	.	28;20;20;20;20	B4E2A2;B4DRL6;G3V1U0;Q6VMQ6;Q6VMQ6-2	.;.;.;MCAF1_HUMAN;.	M	20;20;20;20;20;20;20;28;20;20;20;20;20;20;20;20;20;20	ENSP00000261168:V20M;ENSP00000443179:V20M;ENSP00000445955:V20M;ENSP00000440440:V28M;ENSP00000379575:V20M;ENSP00000444589:V20M	ENSP00000261168:V20M	V	+	1	0	ATF7IP	14468174	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.308000	0.51896	2.707000	0.92482	0.563000	0.77884	GTG		0.358	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179		23	50	23	50
ARHGDIB	397	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	15103604	15103604	+	Missense_Mutation	SNP	C	C	T	rs149654565		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr12:15103604C>T	ENST00000228945.4	-	2	187	c.43G>A	c.(43-45)Gat>Aat	p.D15N	ARHGDIB_ENST00000541644.1_Missense_Mutation_p.D15N|ARHGDIB_ENST00000541546.1_Missense_Mutation_p.D15N|ARHGDIB_ENST00000539131.1_5'Flank	NM_001175.4	NP_001166.3	P52566	GDIR2_HUMAN	Rho GDP dissociation inhibitor (GDI) beta	15					actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of cell adhesion (GO:0007162)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)|Rho GDP-dissociation inhibitor activity (GO:0005094)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	15						AGCTCATCATCATCATCCTCC	0.438																																																0								C	ASN/ASP	1,4405		0,1,2202	155.0	143.0	147.0		43	0.6	0.0	12	dbSNP_134	147	2,8598	2.2+/-6.3	0,2,4298	no	missense	ARHGDIB	NM_001175.4	23	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	benign	15/202	15103604	3,13003	2203	4300	6503	SO:0001583	missense	397			L07916	CCDS8671.1	12p12.3	2014-01-30				ENSG00000111348		"""Endogenous ligands"""	679	protein-coding gene	gene with protein product		602843		RAP1GN1, GDIA2, GDID4		8434008, 8356058	Standard	NM_001175		Approved	Ly-GDI, RhoGDI2	uc001rcq.1	P52566		ENST00000228945.4:c.43G>A	12.37:g.15103604C>T	ENSP00000228945:p.Asp15Asn	Somatic		WXS	Illumina GAIIx	Phase_I	B5BU79	Missense_Mutation	SNP	ENST00000228945.4	37	CCDS8671.1	.	.	.	.	.	.	.	.	.	.	C	0.024	-1.386555	0.01194	2.27E-4	2.33E-4	ENSG00000111348	ENST00000228945;ENST00000541644;ENST00000541546;ENST00000545895;ENST00000541380;ENST00000542276	.	.	.	0.603	0.603	0.17541	Immunoglobulin E-set (1);	0.512553	0.20968	N	0.082445	T	0.28566	0.0707	L	0.39898	1.24	0.09310	N	0.999999	B	0.02656	0.0	B	0.09377	0.004	T	0.15723	-1.0427	8	0.33940	T	0.23	-0.6847	.	.	.	.	15	P52566	GDIR2_HUMAN	N	15	.	ENSP00000228945:D15N	D	-	1	0	ARHGDIB	14994871	0.236000	0.23804	0.002000	0.10522	0.103000	0.19146	0.441000	0.21611	0.585000	0.29608	0.591000	0.81541	GAT		0.438	ARHGDIB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400871.1	NM_001175		39	67	39	67
ABCC9	10060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	22001088	22001088	+	Silent	SNP	G	G	A	rs2291550	byFrequency	TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr12:22001088G>A	ENST00000261201.4	-	23	2861	c.2862C>T	c.(2860-2862)gaC>gaT	p.D954D	ABCC9_ENST00000261200.4_Silent_p.D954D|RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000345162.2_Silent_p.D918D	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	954					defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	ATCTACCTTCGTCTTCGTCCT	0.433													G|||	9	0.00179712	0.0008	0.0	5008	,	,		19609	0.0079		0.0	False		,,,				2504	0.0															0								G	,	1,4405	2.1+/-5.4	0,1,2202	137.0	127.0	131.0		2862,2862	-1.7	1.0	12	dbSNP_100	131	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ABCC9	NM_005691.2,NM_020297.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	954/1550,954/1550	22001088	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10060			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2862C>T	12.37:g.22001088G>A		Somatic		WXS	Illumina GAIIx	Phase_I	O60707	Silent	SNP	ENST00000261201.4	37	CCDS8694.1																																																																																				0.433	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691		25	38	25	38
ACVRL1	94	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	52309035	52309035	+	Missense_Mutation	SNP	C	C	T	rs148640185		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr12:52309035C>T	ENST00000388922.4	+	7	1082	c.799C>T	c.(799-801)Cgc>Tgc	p.R267C	ACVRL1_ENST00000419526.2_Missense_Mutation_p.R93C|ACVRL1_ENST00000550683.1_Missense_Mutation_p.R281C	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	267	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	CATGACCTCCCGCAACTCGAG	0.612																																																0								C	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	63.0	55.0	57.0		799,799	5.4	1.0	12	dbSNP_134	57	0,8600		0,0,4300	no	missense,missense	ACVRL1	NM_000020.2,NM_001077401.1	180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	267/504,267/504	52309035	1,13005	2203	4300	6503	SO:0001583	missense	94			L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.799C>T	12.37:g.52309035C>T	ENSP00000373574:p.Arg267Cys	Somatic		WXS	Illumina GAIIx	Phase_I	A6NGA8	Missense_Mutation	SNP	ENST00000388922.4	37	CCDS31804.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.241813	0.79912	2.27E-4	0.0	ENSG00000139567	ENST00000388922;ENST00000267008;ENST00000550683;ENST00000548659;ENST00000419526	D;D;D	0.93659	-3.26;-3.26;-3.26	5.44	5.44	0.79542	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45126	D	0.000385	D	0.93776	0.8010	L	0.28504	0.86	0.80722	D	1	D;D	0.89917	1.0;1.0	P;D	0.85130	0.895;0.997	D	0.93560	0.6894	10	0.72032	D	0.01	.	11.9421	0.52907	0.2811:0.7189:0.0:0.0	.	93;267	E7EN07;P37023	.;ACVL1_HUMAN	C	267;267;281;93;93	ENSP00000373574:R267C;ENSP00000447884:R281C;ENSP00000392492:R93C	ENSP00000267008:R267C	R	+	1	0	ACVRL1	50595302	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.319000	0.59197	2.824000	0.97209	0.655000	0.94253	CGC		0.612	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404520.2			18	69	18	69
KRT83	3889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	52714809	52714809	+	Missense_Mutation	SNP	G	G	A	rs201909879		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr12:52714809G>A	ENST00000293670.3	-	1	373	c.311C>T	c.(310-312)gCg>gTg	p.A104V		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	104	Head.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CACGCACTGCGCGTTGGGGTC	0.627																																					GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)											0													178.0	161.0	167.0					12																	52714809		2203	4300	6503	SO:0001583	missense	3889			X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.311C>T	12.37:g.52714809G>A	ENSP00000293670:p.Ala104Val	Somatic		WXS	Illumina GAIIx	Phase_I	A1A4S9|B2RC21|Q6NT21|Q9NSB3	Missense_Mutation	SNP	ENST00000293670.3	37	CCDS8823.1	.	.	.	.	.	.	.	.	.	.	G	11.65	1.702237	0.30232	.	.	ENSG00000170523	ENST00000293670	T	0.75154	-0.91	4.69	4.69	0.59074	.	0.000000	0.37437	N	0.002094	T	0.57858	0.2082	L	0.49640	1.575	0.33274	D	0.561452	P	0.41345	0.746	B	0.30495	0.116	T	0.67841	-0.5566	10	0.38643	T	0.18	.	3.6396	0.08162	0.2025:0.0:0.5901:0.2074	.	104	P78385	KRT83_HUMAN	V	104	ENSP00000293670:A104V	ENSP00000293670:A104V	A	-	2	0	KRT83	51001076	0.889000	0.30405	1.000000	0.80357	0.997000	0.91878	4.210000	0.58500	2.588000	0.87417	0.650000	0.86243	GCG		0.627	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1	NM_002282		110	202	110	202
SART3	9733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	108919286	108919286	+	Missense_Mutation	SNP	T	T	C			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr12:108919286T>C	ENST00000228284.3	-	17	2705	c.2471A>G	c.(2470-2472)cAt>cGt	p.H824R	FICD_ENST00000546448.1_Intron|SART3_ENST00000431469.2_Missense_Mutation_p.H788R	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	824	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						CACGGTGCCATGAGCCTTACA	0.507									Porokeratosis																																							0													140.0	118.0	126.0					12																	108919286		2203	4300	6503	SO:0001583	missense	9733	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.2471A>G	12.37:g.108919286T>C	ENSP00000228284:p.His824Arg	Somatic		WXS	Illumina GAIIx	Phase_I	A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Missense_Mutation	SNP	ENST00000228284.3	37	CCDS9117.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.895757	0.91962	.	.	ENSG00000075856	ENST00000228284;ENST00000431469;ENST00000535329;ENST00000547397	T;T;T	0.35789	2.37;1.29;1.29	5.7	5.7	0.88788	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.093695	0.64402	D	0.000001	T	0.58438	0.2122	M	0.79011	2.435	0.80722	D	1	D;D	0.67145	0.996;0.996	P;D	0.66847	0.894;0.947	T	0.57359	-0.7825	10	0.27785	T	0.31	-27.4222	14.5409	0.67995	0.0:0.0:0.0:1.0	.	788;824	B7ZKM0;Q15020	.;SART3_HUMAN	R	824;788;389;63	ENSP00000228284:H824R;ENSP00000414453:H788R;ENSP00000447875:H63R	ENSP00000228284:H824R	H	-	2	0	SART3	107443416	1.000000	0.71417	0.950000	0.38849	0.987000	0.75469	7.698000	0.84413	2.183000	0.69458	0.533000	0.62120	CAT		0.507	SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404094.1			23	62	23	62
PTPN11	5781	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	112888199	112888199	+	Missense_Mutation	SNP	C	C	A	rs121918454		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr12:112888199C>A	ENST00000351677.2	+	3	413	c.215C>A	c.(214-216)gCc>gAc	p.A72D	PTPN11_ENST00000392597.1_Missense_Mutation_p.A72D	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	72	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.		A -> G (in NS1). {ECO:0000269|PubMed:11704759, ECO:0000269|PubMed:11992261, ECO:0000269|PubMed:12960218}.|A -> S (in NS1). {ECO:0000269|PubMed:11704759, ECO:0000269|PubMed:12161469, ECO:0000269|PubMed:12634870}.|A -> T (in JMML). {ECO:0000269|PubMed:12717436}.|A -> V (in JMML). {ECO:0000269|PubMed:12717436}.		abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.A72V(35)|p.A72D(3)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GAGAAATTTGCCACTTTGGCT	0.418			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																														Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	38	Substitution - Missense(38)	haematopoietic_and_lymphoid_tissue(38)	GRCh37	CM013417	PTPN11	M	rs121918454						154.0	142.0	146.0					12																	112888199		2203	4300	6503	SO:0001583	missense	5781	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.215C>A	12.37:g.112888199C>A	ENSP00000340944:p.Ala72Asp	Somatic		WXS	Illumina GAIIx	Phase_I	A8K1D9|Q96HD7	Missense_Mutation	SNP	ENST00000351677.2	37	CCDS9163.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.940643	0.92526	.	.	ENSG00000179295	ENST00000392597;ENST00000351677;ENST00000392596	D;D	0.96073	-3.9;-3.9	5.9	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.95828	0.8642	L	0.33624	1.015	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.71184	0.938;0.972	D	0.96297	0.9218	10	0.62326	D	0.03	.	14.8021	0.69924	0.0:0.9312:0.0:0.0688	.	72;72	Q06124-2;Q06124-3	.;.	D	72	ENSP00000376376:A72D;ENSP00000340944:A72D	ENSP00000340944:A72D	A	+	2	0	PTPN11	111372582	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.811000	0.86092	1.496000	0.48567	0.650000	0.86243	GCC		0.418	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2			42	88	42	88
MORN3	283385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	122091089	122091089	+	Silent	SNP	G	G	A	rs200057950		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr12:122091089G>A	ENST00000355329.3	-	4	710	c.540C>T	c.(538-540)caC>caT	p.H180H		NM_173855.4	NP_776254.3	Q6PF18	MORN3_HUMAN	MORN repeat containing 3	180						nucleus (GO:0005634)				breast(2)|large_intestine(1)|lung(4)|skin(1)|stomach(1)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000409)|Epithelial(86;0.00145)		ACAGCTGGCCGTGGTCCAGAT	0.607																																																0													69.0	59.0	63.0					12																	122091089		2203	4300	6503	SO:0001819	synonymous_variant	283385			BC057760	CCDS31917.1	12q24.31	2006-01-17			ENSG00000139714	ENSG00000139714			29807	protein-coding gene	gene with protein product							Standard	NM_173855		Approved		uc001uax.3	Q6PF18	OTTHUMG00000169075	ENST00000355329.3:c.540C>T	12.37:g.122091089G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q86YQ9	Silent	SNP	ENST00000355329.3	37	CCDS31917.1																																																																																				0.607	MORN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402154.1	NM_173855		31	77	31	77
FANCM	57697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	45623200	45623200	+	Silent	SNP	A	A	G			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr14:45623200A>G	ENST00000267430.5	+	6	1213	c.1128A>G	c.(1126-1128)caA>caG	p.Q376Q	FANCM_ENST00000556036.1_Silent_p.Q376Q|FANCM_ENST00000542564.2_Silent_p.Q350Q	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	376					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TATTGCAGCAAATGGGAATGA	0.284								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																							0													138.0	141.0	140.0					14																	45623200		2203	4299	6502	SO:0001819	synonymous_variant	57697	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.1128A>G	14.37:g.45623200A>G		Somatic		WXS	Illumina GAIIx	Phase_I	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	ENST00000267430.5	37	CCDS32070.1																																																																																				0.284	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128		29	68	29	68
HCN4	10021	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	73616057	73616057	+	Missense_Mutation	SNP	T	T	C			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr15:73616057T>C	ENST00000261917.3	-	8	3370	c.2377A>G	c.(2377-2379)Ata>Gta	p.I793V		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	793					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GTGAGGGCTATGGCCACAGAA	0.697																																																0													25.0	29.0	27.0					15																	73616057		2197	4295	6492	SO:0001583	missense	10021			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.2377A>G	15.37:g.73616057T>C	ENSP00000261917:p.Ile793Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	37	CCDS10248.1	.	.	.	.	.	.	.	.	.	.	T	7.721	0.697227	0.15106	.	.	ENSG00000138622	ENST00000261917	T	0.80393	-1.37	3.45	2.29	0.28610	.	.	.	.	.	T	0.71626	0.3362	L	0.52364	1.645	0.35702	D	0.81573	B	0.26744	0.158	B	0.22880	0.042	T	0.66300	-0.5958	9	0.22706	T	0.39	.	9.7188	0.40291	0.0:0.0:0.1749:0.8251	.	793	Q9Y3Q4	HCN4_HUMAN	V	793	ENSP00000261917:I793V	ENSP00000261917:I793V	I	-	1	0	HCN4	71403110	1.000000	0.71417	0.979000	0.43373	0.777000	0.43975	0.784000	0.26816	0.391000	0.25143	0.254000	0.18369	ATA		0.697	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477		19	33	19	33
ADAMTS17	170691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	100657167	100657167	+	Silent	SNP	G	G	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr15:100657167G>A	ENST00000268070.4	-	13	1878	c.1773C>T	c.(1771-1773)gtC>gtT	p.V591V		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	591	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		GGTTCTCGCAGACCGCATGTT	0.627																																																0													51.0	41.0	44.0					15																	100657167		2203	4300	6503	SO:0001819	synonymous_variant	170691			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.1773C>T	15.37:g.100657167G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q2I7G4|Q6ZN75	Silent	SNP	ENST00000268070.4	37	CCDS10383.1																																																																																				0.627	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057		20	29	20	29
TNRC6A	27327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	24817937	24817937	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr16:24817937C>T	ENST00000395799.3	+	17	4501	c.4372C>T	c.(4372-4374)Cgt>Tgt	p.R1458C	TNRC6A_ENST00000432286.2_5'Flank|TNRC6A_ENST00000315183.7_Missense_Mutation_p.R1409C|CTD-2515A14.1_ENST00000568895.1_RNA	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1458					cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		GCAACAATCTCGTCAACTTGA	0.443																																																0													147.0	133.0	138.0					16																	24817937		2197	4300	6497	SO:0001583	missense	27327			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.4372C>T	16.37:g.24817937C>T	ENSP00000379144:p.Arg1458Cys	Somatic		WXS	Illumina GAIIx	Phase_I	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.81|18.81	3.702920|3.702920	0.68501|0.68501	.|.	.|.	ENSG00000090905|ENSG00000090905	ENST00000315183;ENST00000395799|ENST00000450465	T;T|.	0.15017|.	2.5;2.46|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71702|0.71702	0.3371|0.3371	M|M	0.77313|0.77313	2.365|2.365	0.80722|0.80722	D|D	1|1	B;B;B;B|.	0.30664|.	0.219;0.271;0.238;0.289|.	B;B;B;B|.	0.22601|.	0.034;0.03;0.04;0.032|.	T|T	0.65364|0.65364	-0.6186|-0.6186	10|6	0.49607|0.11794	T|T	0.09|0.64	-8.6644|-8.6644	14.9398|14.9398	0.70983|0.70983	0.0:0.9325:0.0:0.0675|0.0:0.9325:0.0:0.0675	.|.	125;597;1409;1458|.	B3KSX2;C9JA83;Q8NDV7-6;Q8NDV7|.	.;.;.;TNR6A_HUMAN|.	C|L	1409;1458|348	ENSP00000326900:R1409C;ENSP00000379144:R1458C|.	ENSP00000326900:R1409C|ENSP00000404278:S348L	R|S	+|+	1|2	0|0	TNRC6A|TNRC6A	24725438|24725438	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.997000|0.997000	0.91878|0.91878	4.512000|4.512000	0.60469|0.60469	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	CGT|TCG		0.443	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847		55	77	55	77
KCTD19	146212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	67327473	67327473	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr16:67327473C>T	ENST00000304372.5	-	12	2247	c.2192G>A	c.(2191-2193)tGg>tAg	p.W731*		NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	731					protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		CTGCTTGCTCCAGTCCTTCAG	0.547																																																0													107.0	113.0	111.0					16																	67327473		2014	4175	6189	SO:0001587	stop_gained	146212			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.2192G>A	16.37:g.67327473C>T	ENSP00000305702:p.Trp731*	Somatic		WXS	Illumina GAIIx	Phase_I	B4DZ49|Q8N804	Nonsense_Mutation	SNP	ENST00000304372.5	37	CCDS42179.1	.	.	.	.	.	.	.	.	.	.	C	38	6.784942	0.97837	.	.	ENSG00000168676	ENST00000304372	.	.	.	5.86	4.86	0.63082	.	0.255835	0.28482	N	0.015192	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.369	11.4614	0.50213	0.1793:0.8207:0.0:0.0	.	.	.	.	X	731	.	ENSP00000305702:W731X	W	-	2	0	KCTD19	65884974	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	2.243000	0.43115	2.779000	0.95612	0.563000	0.77884	TGG		0.547	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422061.1	XM_085367		17	186	17	186
GRAP	10750	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	18927576	18927576	+	Silent	SNP	G	G	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr17:18927576G>A	ENST00000284154.5	-	4	1130	c.420C>T	c.(418-420)atC>atT	p.I140I	GRAP_ENST00000395635.1_Silent_p.I111I|GRAP_ENST00000573099.1_Intron	NM_006613.3	NP_006604.1	Q13588	GRAP_HUMAN	GRB2-related adaptor protein	140	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)			large_intestine(1)|urinary_tract(1)	2	all_cancers(12;0.0183)					GCTTCTTGGCGATGGTGGTGG	0.622																																																0													40.0	31.0	34.0					17																	18927576		2203	4297	6500	SO:0001819	synonymous_variant	10750			U52518	CCDS11202.1	17p11.2	2013-02-14			ENSG00000154016	ENSG00000154016		"""SH2 domain containing"""	4562	protein-coding gene	gene with protein product		604330				8647802, 8995379	Standard	NM_006613		Approved		uc002guy.3	Q13588	OTTHUMG00000059436	ENST00000284154.5:c.420C>T	17.37:g.18927576G>A		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000284154.5	37	CCDS11202.1																																																																																				0.622	GRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132176.2	NM_006613		6	19	6	19
NF1	4763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	29664446	29664446	+	Nonsense_Mutation	SNP	T	T	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr17:29664446T>A	ENST00000358273.4	+	43	6871	c.6488T>A	c.(6487-6489)tTg>tAg	p.L2163*	NF1_ENST00000417592.2_5'Flank|NF1_ENST00000444181.2_5'Flank|NF1_ENST00000356175.3_Nonsense_Mutation_p.L2142*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2163					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AAATTTTACTTGCTGTTTGGC	0.423			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											110.0	96.0	101.0					17																	29664446		2203	4300	6503	SO:0001587	stop_gained	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6488T>A	17.37:g.29664446T>A	ENSP00000351015:p.Leu2163*	Somatic		WXS	Illumina GAIIx	Phase_I	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	T	49	15.755996	0.99844	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.9917	0.80211	0.0:0.0:0.0:1.0	.	.	.	.	X	2163;2142;1808	.	ENSP00000348498:L2142X	L	+	2	0	NF1	26688572	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.540000	0.82074	2.222000	0.72286	0.533000	0.62120	TTG		0.423	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		22	38	22	38
NF1	4763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	29664466	29664466	+	Missense_Mutation	SNP	G	G	C			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr17:29664466G>C	ENST00000358273.4	+	43	6891	c.6508G>C	c.(6508-6510)Gtc>Ctc	p.V2170L	NF1_ENST00000417592.2_5'Flank|NF1_ENST00000444181.2_5'Flank|NF1_ENST00000356175.3_Missense_Mutation_p.V2149L	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2170					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CATTAGCAAAGTCAAGTCAGC	0.443			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											134.0	116.0	122.0					17																	29664466		2203	4300	6503	SO:0001583	missense	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6508G>C	17.37:g.29664466G>C	ENSP00000351015:p.Val2170Leu	Somatic		WXS	Illumina GAIIx	Phase_I	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.979471	0.92982	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;D;D	0.85339	-1.97;-1.97;-1.97	5.55	5.55	0.83447	Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	D	0.91737	0.7387	M	0.76574	2.34	0.80722	D	1	P;D	0.53151	0.902;0.958	D;P	0.64595	0.927;0.867	D	0.89521	0.3778	10	0.32370	T	0.25	.	19.8683	0.96840	0.0:0.0:1.0:0.0	.	2149;2170	P21359-2;P21359	.;NF1_HUMAN	L	2170;2149;1815	ENSP00000351015:V2170L;ENSP00000348498:V2149L;ENSP00000389907:V1815L	ENSP00000348498:V2149L	V	+	1	0	NF1	26688592	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.274000	0.95731	2.753000	0.94483	0.655000	0.94253	GTC		0.443	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		26	44	26	44
TNFRSF11A	8792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	60052048	60052048	+	Silent	SNP	C	C	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr18:60052048C>T	ENST00000586569.1	+	10	1670	c.1632C>T	c.(1630-1632)ggC>ggT	p.G544G	TNFRSF11A_ENST00000269485.7_Silent_p.G227G	NM_001270949.1|NM_003839.3	NP_001257878.1|NP_003830.1	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily, member 11a, NFKB activator	544					adaptive immune response (GO:0002250)|cell-cell signaling (GO:0007267)|circadian temperature homeostasis (GO:0060086)|lymph node development (GO:0048535)|mammary gland alveolus development (GO:0060749)|monocyte chemotaxis (GO:0002548)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|response to cytokine (GO:0034097)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to radiation (GO:0009314)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(13)|skin(3)|upper_aerodigestive_tract(1)	29		Colorectal(73;0.188)				ACTTCAAGGGCGACATCATCG	0.652																																																0													44.0	35.0	38.0					18																	60052048		2203	4300	6503	SO:0001819	synonymous_variant	8792			AF018253	CCDS11980.1, CCDS59324.1, CCDS74227.1, CCDS74228.1	18q22.1	2014-09-17			ENSG00000141655	ENSG00000141655		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11908	protein-coding gene	gene with protein product		603499	"""tumor necrosis factor receptor superfamily, member 11a, activator of NFKB"", ""Paget disease of bone 2"", ""loss of heterozygosity, 18, chromosomal region 1"""	PDB2, LOH18CR1		9367155, 10615125	Standard	NM_001270951		Approved	RANK, CD265, FEO	uc002lin.4	Q9Y6Q6	OTTHUMG00000132779	ENST00000586569.1:c.1632C>T	18.37:g.60052048C>T		Somatic		WXS	Illumina GAIIx	Phase_I	I4EC36|I4EC38|I4EC39|I7JE63|N0GVH0|Q59EP9	Silent	SNP	ENST00000586569.1	37	CCDS11980.1																																																																																				0.652	TNFRSF11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256186.2			12	30	12	30
LMNB2	84823	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	2433894	2433894	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr19:2433894G>A	ENST00000582871.1	-	8	1438	c.1352C>T	c.(1351-1353)tCg>tTg	p.S451L	LMNB2_ENST00000325327.3_Missense_Mutation_p.S471L|LMNB2_ENST00000475819.1_5'Flank	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	451	LTD.|Tail.			LEVEEPLGSGPSVLGTGTGGSGGFHLAQQASASGSVS -> WRWRSPWQRPKRPGHGHGWQRWLPPGPAGLGLGQRH (in Ref. 5; AAA80979). {ECO:0000305}.		lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACGCTACCCGAGGCCGAGGC	0.667																																																0													59.0	57.0	58.0					19																	2433894		2201	4300	6501	SO:0001583	missense	84823			M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.1352C>T	19.37:g.2433894G>A	ENSP00000462730:p.Ser451Leu	Somatic		WXS	Illumina GAIIx	Phase_I	O75292|Q14734|Q96DF6	Missense_Mutation	SNP	ENST00000582871.1	37		.	.	.	.	.	.	.	.	.	.	G	13.93	2.383762	0.42308	.	.	ENSG00000176619	ENST00000325327	.	.	.	4.27	0.743	0.18347	Intermediate filament, C-terminal (1);	0.387129	0.26048	N	0.026656	T	0.32102	0.0818	L	0.42744	1.35	0.09310	N	0.999999	P	0.45768	0.866	P	0.47744	0.556	T	0.14364	-1.0475	9	0.59425	D	0.04	.	5.6338	0.17526	0.1769:0.0:0.6671:0.156	.	451	Q03252	LMNB2_HUMAN	L	451	.	ENSP00000327054:S451L	S	-	2	0	LMNB2	2384894	0.951000	0.32395	0.002000	0.10522	0.756000	0.42949	1.615000	0.36922	-0.035000	0.13691	-0.291000	0.09656	TCG		0.667	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032737		49	143	49	143
KHSRP	8570	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	6416895	6416895	+	Splice_Site	SNP	T	T	G			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr19:6416895T>G	ENST00000398148.3	-	13	1275		c.e13-2		MIR3940_ENST00000579148.1_RNA	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein						gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						GGGACCACTCTGCAAGACAAG	0.687																																					Colon(55;593 1006 2067 9135 22980)											0													20.0	24.0	23.0					19																	6416895		1945	4122	6067	SO:0001630	splice_region_variant	8570			U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.1183-2A>C	19.37:g.6416895T>G		Somatic		WXS	Illumina GAIIx	Phase_I	O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Splice_Site	SNP	ENST00000398148.3	37	CCDS45936.1	.	.	.	.	.	.	.	.	.	.	T	15.16	2.750859	0.49257	.	.	ENSG00000088247	ENST00000398148;ENST00000201886	.	.	.	5.53	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7733	0.40603	0.0:0.0837:0.0:0.9162	.	.	.	.	.	-1	.	.	.	-	.	.	KHSRP	6367895	1.000000	0.71417	0.978000	0.43139	0.531000	0.34715	4.604000	0.61112	0.939000	0.37446	0.533000	0.62120	.		0.687	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1		Intron	25	65	25	65
STXBP2	6813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	7705819	7705819	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr19:7705819G>A	ENST00000221283.5	+	6	390	c.359G>A	c.(358-360)cGc>cAc	p.R120H	STXBP2_ENST00000441779.2_Missense_Mutation_p.R131H|CTD-3214H19.4_ENST00000595866.1_3'UTR|STXBP2_ENST00000414284.2_Missense_Mutation_p.R117H	NM_006949.2	NP_008880.2	Q15833	STXB2_HUMAN	syntaxin binding protein 2	120					leukocyte mediated cytotoxicity (GO:0001909)|neutrophil degranulation (GO:0043312)|protein transport (GO:0015031)|regulation of mast cell degranulation (GO:0043304)|vesicle docking involved in exocytosis (GO:0006904)	azurophil granule (GO:0042582)|cytolytic granule (GO:0044194)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin-3 binding (GO:0030348)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	23						GAGCTAGGCCGCTCTCGTCTG	0.662																																																0													85.0	81.0	82.0					19																	7705819		2203	4300	6503	SO:0001583	missense	6813			U63533	CCDS12181.1, CCDS45948.1, CCDS62522.1	19p13.3-p13.2	2014-09-17				ENSG00000076944			11445	protein-coding gene	gene with protein product		601717				8921365	Standard	NM_001127396		Approved	UNC18B, Hunc18b	uc010xjr.3	Q15833		ENST00000221283.5:c.359G>A	19.37:g.7705819G>A	ENSP00000221283:p.Arg120His	Somatic		WXS	Illumina GAIIx	Phase_I	B4E175|E7EQD5|Q9BU65	Missense_Mutation	SNP	ENST00000221283.5	37	CCDS12181.1	.	.	.	.	.	.	.	.	.	.	G	10.07	1.248345	0.22880	.	.	ENSG00000076944	ENST00000221283;ENST00000414284;ENST00000441779;ENST00000543902;ENST00000320400	T;T;T	0.80393	-1.37;-1.37;-1.37	4.58	1.1	0.20463	.	0.264028	0.34853	N	0.003622	T	0.69860	0.3158	L	0.53249	1.67	0.30270	N	0.792329	B;B;B	0.28900	0.227;0.19;0.064	B;B;B	0.24701	0.055;0.022;0.037	T	0.65833	-0.6072	10	0.62326	D	0.03	-12.0825	4.2177	0.10542	0.2861:0.1704:0.5435:0.0	.	131;117;120	E7EQD5;Q15833-2;Q15833	.;.;STXB2_HUMAN	H	120;117;131;120;310	ENSP00000221283:R120H;ENSP00000409471:R117H;ENSP00000413606:R131H	ENSP00000221283:R120H	R	+	2	0	STXBP2	7611819	0.999000	0.42202	0.951000	0.38953	0.142000	0.21351	3.475000	0.53136	0.554000	0.29061	-0.148000	0.13756	CGC		0.662	STXBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460963.1	NM_006949		58	201	58	201
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	9063480	9063480	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr19:9063480G>A	ENST00000397910.4	-	3	24169	c.23966C>T	c.(23965-23967)aCa>aTa	p.T7989I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7991	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T7989R(2)|p.T3622R(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTCTGGTAATGTGGAGGAAAC	0.468																																																3	Substitution - Missense(3)	lung(3)											92.0	88.0	89.0					19																	9063480		2004	4176	6180	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.23966C>T	19.37:g.9063480G>A	ENSP00000381008:p.Thr7989Ile	Somatic		WXS	Illumina GAIIx	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	3.613	-0.079149	0.07141	.	.	ENSG00000181143	ENST00000397910	T	0.28069	1.63	2.62	-1.11	0.09840	.	.	.	.	.	T	0.29061	0.0722	M	0.61703	1.905	.	.	.	B	0.27594	0.182	B	0.35607	0.206	T	0.46048	-0.9219	8	0.87932	D	0	.	2.1371	0.03765	0.3281:0.0:0.4213:0.2506	.	7989	B5ME49	.	I	7989	ENSP00000381008:T7989I	ENSP00000381008:T7989I	T	-	2	0	MUC16	8924480	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.012000	0.12699	-0.146000	0.11274	-0.362000	0.07510	ACA		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		23	67	23	67
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	9065959	9065959	+	Missense_Mutation	SNP	G	G	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr19:9065959G>T	ENST00000397910.4	-	3	21690	c.21487C>A	c.(21487-21489)Ctg>Atg	p.L7163M		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7165	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCAGTGGTCAGTCTCTCATCT	0.512																																																0													188.0	173.0	178.0					19																	9065959		2096	4229	6325	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.21487C>A	19.37:g.9065959G>T	ENSP00000381008:p.Leu7163Met	Somatic		WXS	Illumina GAIIx	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.699	-0.271425	0.05716	.	.	ENSG00000181143	ENST00000397910	T	0.26957	1.7	2.39	0.0656	0.14357	.	.	.	.	.	T	0.20820	0.0501	L	0.55481	1.735	.	.	.	B	0.14438	0.01	B	0.18263	0.021	T	0.29610	-1.0006	8	0.87932	D	0	.	2.8495	0.05553	0.173:0.0:0.5085:0.3185	.	7163	B5ME49	.	M	7163	ENSP00000381008:L7163M	ENSP00000381008:L7163M	L	-	1	2	MUC16	8926959	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.285000	0.08410	0.071000	0.16664	0.394000	0.25966	CTG		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		54	110	54	110
AP1M2	10053	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	10687903	10687903	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr19:10687903C>T	ENST00000250244.6	-	9	1100	c.1018G>A	c.(1018-1020)Gtc>Atc	p.V340I	AP1M2_ENST00000590923.1_Missense_Mutation_p.V342I	NM_005498.4	NP_005489.2	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit	340	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein targeting (GO:0006605)|regulation of defense response to virus by virus (GO:0050690)|vesicle targeting (GO:0006903)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				endometrium(4)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	9			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			CAAATCACGACGTTTCTCTCC	0.597																																																0													48.0	46.0	46.0					19																	10687903		1958	4154	6112	SO:0001583	missense	10053			AF020797	CCDS45964.1	19p13.2	2008-10-07				ENSG00000129354			558	protein-coding gene	gene with protein product		607309				10338135	Standard	NM_005498		Approved	HSMU1B, mu2, AP1-mu2	uc002mpc.3	Q9Y6Q5		ENST00000250244.6:c.1018G>A	19.37:g.10687903C>T	ENSP00000250244:p.Val340Ile	Somatic		WXS	Illumina GAIIx	Phase_I	B2RDV5|Q9BSI8	Missense_Mutation	SNP	ENST00000250244.6	37	CCDS45964.1	.	.	.	.	.	.	.	.	.	.	c	8.991	0.977710	0.18812	.	.	ENSG00000129354	ENST00000250244	T	0.20200	2.09	5.24	1.8	0.24995	Clathrin adaptor, mu subunit, C-terminal (3);	0.506841	0.20514	N	0.090827	T	0.12732	0.0309	L	0.31804	0.96	0.27565	N	0.950078	B;P	0.35456	0.084;0.502	B;B	0.29663	0.015;0.105	T	0.11567	-1.0582	10	0.52906	T	0.07	-15.1146	8.784	0.34809	0.0:0.7274:0.0:0.2726	.	342;340	Q9Y6Q5-2;Q9Y6Q5	.;AP1M2_HUMAN	I	340	ENSP00000250244:V340I	ENSP00000250244:V340I	V	-	1	0	AP1M2	10548903	0.000000	0.05858	0.056000	0.19401	0.080000	0.17528	0.122000	0.15687	0.517000	0.28361	0.555000	0.69702	GTC		0.597	AP1M2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452034.1			7	33	7	33
MAST1	22983	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	12977541	12977541	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr19:12977541C>T	ENST00000251472.4	+	18	2143	c.2104C>T	c.(2104-2106)Cgc>Tgc	p.R702C		NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						CGTGGAAATCCGCCAGTTCTC	0.622																																																0													86.0	57.0	67.0					19																	12977541		2203	4300	6503	SO:0001583	missense	22983			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.2104C>T	19.37:g.12977541C>T	ENSP00000251472:p.Arg702Cys	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000251472.4	37	CCDS32921.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.183731	0.78677	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.25085	1.82	4.84	4.84	0.62591	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.162179	0.41097	D	0.000952	T	0.47637	0.1456	M	0.79805	2.47	0.50467	D	0.999876	D	0.89917	1.0	P	0.62184	0.899	T	0.49925	-0.8887	10	0.56958	D	0.05	-28.4494	10.9883	0.47534	0.1866:0.8134:0.0:0.0	.	702	Q9Y2H9	MAST1_HUMAN	C	702	ENSP00000251472:R702C	ENSP00000251472:R702C	R	+	1	0	MAST1	12838541	0.012000	0.17670	1.000000	0.80357	0.997000	0.91878	0.222000	0.17699	2.405000	0.81733	0.557000	0.71058	CGC		0.622	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2	NM_014975		13	35	13	35
MED26	9441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	16687579	16687579	+	Silent	SNP	C	C	T	rs199699902	byFrequency	TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr19:16687579C>T	ENST00000263390.3	-	3	1324	c.1062G>A	c.(1060-1062)ccG>ccA	p.P354P	CTD-3222D19.2_ENST00000409035.1_Silent_p.P362P|CTC-429P9.4_ENST00000593962.1_5'Flank	NM_004831.3	NP_004822.2	O95402	MED26_HUMAN	mediator complex subunit 26	354					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	8						CCTTGCAGCCCGGCCCCGCCA	0.706													C|||	2	0.000399361	0.0	0.0029	5008	,	,		11105	0.0		0.0	False		,,,				2504	0.0															0													10.0	11.0	11.0					19																	16687579		2196	4287	6483	SO:0001819	synonymous_variant	9441			AF104253	CCDS12347.1	19p13.11	2008-02-05	2007-07-30	2007-07-30		ENSG00000105085			2376	protein-coding gene	gene with protein product		605043	"""cofactor required for Sp1 transcriptional activation, subunit 7, 70kDa"""	CRSP7		9989412	Standard	NM_004831		Approved	CRSP70	uc002nen.1	O95402		ENST00000263390.3:c.1062G>A	19.37:g.16687579C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A1A4S3|Q0VGB6	Silent	SNP	ENST00000263390.3	37	CCDS12347.1																																																																																				0.706	MED26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461178.1	NM_004831		13	27	13	27
ACTN4	81	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	39212280	39212280	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr19:39212280C>T	ENST00000252699.2	+	12	1470	c.1394C>T	c.(1393-1395)gCg>gTg	p.A465V	ACTN4_ENST00000424234.2_Intron|ACTN4_ENST00000390009.3_Missense_Mutation_p.A246V	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	465					actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GACCTGGCTGCGCACCAGGAC	0.617																																					Colon(168;199 1940 10254 46213 46384)											0													107.0	82.0	90.0					19																	39212280		2203	4300	6503	SO:0001583	missense	81			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.1394C>T	19.37:g.39212280C>T	ENSP00000252699:p.Ala465Val	Somatic		WXS	Illumina GAIIx	Phase_I	A4K467|D6PXK4|O76048	Missense_Mutation	SNP	ENST00000252699.2	37	CCDS12518.1	.	.	.	.	.	.	.	.	.	.	C	33	5.288827	0.95517	.	.	ENSG00000130402	ENST00000252699;ENST00000445727;ENST00000390009	T;T	0.50001	0.76;0.76	4.21	4.21	0.49690	.	0.000000	0.64402	D	0.000001	T	0.72112	0.3420	M	0.86651	2.83	0.80722	D	1	D;D	0.76494	0.998;0.999	D;P	0.78314	0.991;0.869	T	0.78904	-0.2020	10	0.87932	D	0	.	15.8417	0.78852	0.0:1.0:0.0:0.0	.	465;465	E7EV83;O43707	.;ACTN4_HUMAN	V	465;465;246	ENSP00000252699:A465V;ENSP00000439497:A246V	ENSP00000252699:A465V	A	+	2	0	ACTN4	43904120	1.000000	0.71417	0.822000	0.32727	0.963000	0.63663	7.651000	0.83577	2.340000	0.79590	0.462000	0.41574	GCG		0.617	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268091.1			32	106	32	106
IRGC	56269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	44222962	44222962	+	Silent	SNP	G	G	A	rs571682513		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr19:44222962G>A	ENST00000244314.5	+	2	451	c.252G>A	c.(250-252)gcG>gcA	p.A84A		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	84	IRG-type G.					membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)	p.A84A(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				ACCCTGGCGCGGCTCTCACGG	0.682													G|||	1	0.000199681	0.0	0.0	5008	,	,		14655	0.0		0.001	False		,,,				2504	0.0				Colon(189;350 2037 11447 13433 38914)											1	Substitution - coding silent(1)	lung(1)											39.0	40.0	39.0					19																	44222962		2203	4298	6501	SO:0001819	synonymous_variant	56269			BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.252G>A	19.37:g.44222962G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q05BR8	Silent	SNP	ENST00000244314.5	37	CCDS12629.1																																																																																				0.682	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336191.1	NM_019612		51	174	51	174
RUVBL2	10856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	49518835	49518835	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr19:49518835G>A	ENST00000595090.1	+	14	1722	c.1258G>A	c.(1258-1260)Gaa>Aaa	p.E420K	RUVBL2_ENST00000601968.1_Silent_p.Q331Q|CTB-60B18.10_ENST00000600007.1_lincRNA|RUVBL2_ENST00000413176.2_Missense_Mutation_p.E375K	NM_006666.1	NP_006657.1	Q9Y230	RUVB2_HUMAN	RuvB-like AAA ATPase 2	420					ATP catabolic process (GO:0006200)|cellular response to estradiol stimulus (GO:0071392)|cellular response to UV (GO:0034644)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|establishment of protein localization to chromatin (GO:0071169)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of estrogen receptor binding (GO:0071899)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein folding (GO:0006457)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)|transcriptional activation by promoter-enhancer looping (GO:0071733)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Ino80 complex (GO:0031011)|intracellular (GO:0005622)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent DNA helicase activity (GO:0004003)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|unfolded protein binding (GO:0051082)			large_intestine(1)|upper_aerodigestive_tract(1)	2		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		CCAGGGTACAGAAGTGCAGGT	0.602																																																0													75.0	81.0	79.0					19																	49518835		2110	4226	6336	SO:0001583	missense	10856			AF155138	CCDS42588.1	19q13.3	2013-09-12	2013-09-12					"""INO80 complex subunits"", ""ATPases / AAA-type"""	10475	protein-coding gene	gene with protein product	"""reptin"", ""INO80 complex subunit J"""	604788	"""RuvB (E coli homolog)-like 2"", ""RuvB-like 2 (E. coli)"""			10428817, 10998447	Standard	XM_005258426		Approved	RVB2, TIP48, TIP49b, Reptin52, ECP51, TIH2, INO80J, Rvb2	uc002plr.1	Q9Y230		ENST00000595090.1:c.1258G>A	19.37:g.49518835G>A	ENSP00000473172:p.Glu420Lys	Somatic		WXS	Illumina GAIIx	Phase_I	B3KQ59|E7ETE5|Q6FIB9|Q6PK27|Q9Y361	Missense_Mutation	SNP	ENST00000595090.1	37	CCDS42588.1	.	.	.	.	.	.	.	.	.	.	G	17.10	3.302970	0.60195	.	.	ENSG00000183207	ENST00000221413;ENST00000413176	T	0.44881	0.91	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.42494	0.1205	M	0.63169	1.94	0.80722	D	1	B	0.17038	0.02	B	0.09377	0.004	T	0.25433	-1.0132	10	0.33141	T	0.24	-36.6508	16.4412	0.83901	0.0:0.0:1.0:0.0	.	420	Q9Y230	RUVB2_HUMAN	K	420;375	ENSP00000413890:E375K	ENSP00000221413:E420K	E	+	1	0	RUVBL2	54210647	1.000000	0.71417	0.969000	0.41365	0.940000	0.58332	8.731000	0.91529	2.550000	0.86006	0.561000	0.74099	GAA		0.602	RUVBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466235.1			42	124	42	124
MYBPC2	4606	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	50939931	50939931	+	Missense_Mutation	SNP	C	C	T	rs369957056		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr19:50939931C>T	ENST00000357701.5	+	5	454	c.403C>T	c.(403-405)Cgc>Tgc	p.R135C		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	135	Ig-like C2-type 1.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		TGGGTATTACCGCCTCGAGGT	0.612																																																0								C	CYS/ARG	0,4108		0,0,2054	107.0	107.0	107.0		403	3.2	1.0	19		107	1,8339		0,1,4169	no	missense	MYBPC2	NM_004533.3	180	0,1,6223	TT,TC,CC		0.012,0.0,0.0080	probably-damaging	135/1142	50939931	1,12447	2054	4170	6224	SO:0001583	missense	4606				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.403C>T	19.37:g.50939931C>T	ENSP00000350332:p.Arg135Cys	Somatic		WXS	Illumina GAIIx	Phase_I	A1L4G9	Missense_Mutation	SNP	ENST00000357701.5	37	CCDS46152.1	.	.	.	.	.	.	.	.	.	.	.	18.72	3.685151	0.68157	0.0	1.2E-4	ENSG00000086967	ENST00000357701	T	0.44482	0.92	3.24	3.24	0.37175	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.29660	U	0.011540	T	0.63082	0.2481	M	0.82517	2.595	0.58432	D	0.999997	D	0.89917	1.0	D	0.76071	0.987	T	0.67776	-0.5583	10	0.87932	D	0	.	9.8626	0.41123	0.2054:0.7945:0.0:0.0	.	135	Q14324	MYPC2_HUMAN	C	135	ENSP00000350332:R135C	ENSP00000350332:R135C	R	+	1	0	MYBPC2	55631743	1.000000	0.71417	0.998000	0.56505	0.860000	0.49131	3.005000	0.49521	2.142000	0.66516	0.450000	0.29827	CGC		0.612	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533		50	175	50	175
NLRP5	126206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	56539531	56539531	+	Silent	SNP	C	C	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr19:56539531C>T	ENST00000390649.3	+	7	1932	c.1932C>T	c.(1930-1932)gaC>gaT	p.D644D		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	644					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TGAGCGAAGACGTAAGGAGGC	0.552																																																0													61.0	63.0	62.0					19																	56539531		1976	4149	6125	SO:0001819	synonymous_variant	126206			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1932C>T	19.37:g.56539531C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A8MTY4|Q86W29	Silent	SNP	ENST00000390649.3	37	CCDS12938.1																																																																																				0.552	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447		37	118	37	118
GRHL3	57822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	24671385	24671385	+	Splice_Site	SNP	A	A	C			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr1:24671385A>C	ENST00000350501.5	+	12	1546		c.e12-1		GRHL3_ENST00000361548.4_Splice_Site|GRHL3_ENST00000342072.4_Splice_Site|GRHL3_ENST00000236255.4_Splice_Site|GRHL3_ENST00000356046.2_Splice_Site	NM_198174.2	NP_937817.3	Q8TE85	GRHL3_HUMAN	grainyhead-like 3 (Drosophila)						central nervous system development (GO:0007417)|cochlea morphogenesis (GO:0090103)|ectoderm development (GO:0007398)|epidermis development (GO:0008544)|establishment of planar polarity (GO:0001736)|eyelid development in camera-type eye (GO:0061029)|pattern specification process (GO:0007389)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		ACTTCATTGCAGGCAGCCCCC	0.572																																																0													106.0	106.0	106.0					1																	24671385		2203	4300	6503	SO:0001630	splice_region_variant	57822			AY231161	CCDS251.1, CCDS252.1, CCDS44088.1, CCDS252.2, CCDS53284.1	1p36	2008-02-05	2005-07-11	2005-07-11	ENSG00000158055	ENSG00000158055			25839	protein-coding gene	gene with protein product		608317	"""transcription factor CP2-like 4"""	TFCP2L4		12549979	Standard	NM_021180		Approved	SOM	uc021oiw.1	Q8TE85	OTTHUMG00000003040	ENST00000350501.5:c.1420-1A>C	1.37:g.24671385A>C		Somatic		WXS	Illumina GAIIx	Phase_I	A2A297|B2RCL1|G3XAF0|Q5TH78|Q86Y06|Q8N407	Splice_Site	SNP	ENST00000350501.5	37	CCDS252.2	.	.	.	.	.	.	.	.	.	.	A	12.79	2.044867	0.36085	.	.	ENSG00000158055	ENST00000361548;ENST00000342072;ENST00000350501;ENST00000356046;ENST00000236255	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.73	0.51730	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRHL3	24543972	0.571000	0.26659	1.000000	0.80357	0.324000	0.28378	0.637000	0.24659	2.202000	0.70862	0.533000	0.62120	.		0.572	GRHL3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000009047.2	NM_021180	Intron	25	55	25	55
CFAP57	149465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	43675514	43675514	+	Missense_Mutation	SNP	G	G	A	rs181283378	byFrequency	TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr1:43675514G>A	ENST00000372492.4	+	11	2180	c.1856G>A	c.(1855-1857)cGt>cAt	p.R619H	WDR65_ENST00000528956.1_Missense_Mutation_p.R619H	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		619										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGAACCATTCGTGCCATGAAG	0.552													g|||	6	0.00119808	0.0	0.0	5008	,	,		19298	0.006		0.0	False		,,,				2504	0.0															0													176.0	145.0	155.0					1																	43675514		2203	4300	6503	SO:0001583	missense	149465																														ENST00000372492.4:c.1856G>A	1.37:g.43675514G>A	ENSP00000361570:p.Arg619His	Somatic		WXS	Illumina GAIIx	Phase_I	A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	ENST00000372492.4	37		2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	g	32	5.130458	0.94473	.	.	ENSG00000243710	ENST00000372492;ENST00000528956	T;T	0.48836	0.8;3.26	5.75	5.75	0.90469	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.132801	0.50627	D	0.000103	T	0.71736	0.3375	M	0.81802	2.56	0.47009	D	0.999282	D;D	0.89917	1.0;1.0	D;D	0.76575	0.985;0.988	T	0.69781	-0.5052	10	0.38643	T	0.18	.	19.9425	0.97170	0.0:0.0:1.0:0.0	.	619;619	Q96MR6;Q96MR6-2	WDR65_HUMAN;.	H	619	ENSP00000361570:R619H;ENSP00000435310:R619H	ENSP00000361570:R619H	R	+	2	0	WDR65	43448101	1.000000	0.71417	0.995000	0.50966	0.970000	0.65996	7.301000	0.78850	2.721000	0.93114	0.543000	0.68304	CGT		0.552	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1			38	67	38	67
TTC4	7268	hgsc.bcm.edu;ucsc.edu	37	1	55181589	55181589	+	Missense_Mutation	SNP	A	A	G	rs552735985	byFrequency	TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr1:55181589A>G	ENST00000371281.3	+	1	95	c.8A>G	c.(7-9)cAa>cGa	p.Q3R	MROH7-TTC4_ENST00000414150.2_Intron|TTC4_ENST00000371284.5_3'UTR	NM_004623.4	NP_004614.3	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4	3										breast(2)|endometrium(3)|kidney(1)|lung(2)|stomach(1)	9						GCTATGGAACAACCTGGGCAG	0.642																																																0													54.0	40.0	45.0					1																	55181589		2203	4299	6502	SO:0001583	missense	7268				CCDS596.1	1p32	2013-01-11			ENSG00000243725	ENSG00000243725		"""Tetratricopeptide (TTC) repeat domain containing"""	12394	protein-coding gene	gene with protein product		606753				9933562	Standard	NM_004623		Approved	MGC5097, FLJ41930	uc001cxx.4	O95801	OTTHUMG00000009914	ENST00000371281.3:c.8A>G	1.37:g.55181589A>G	ENSP00000360329:p.Gln3Arg	Somatic		WXS	Illumina GAIIx	Phase_I	Q53Y95|Q5TA96|Q9H3I2	Missense_Mutation	SNP	ENST00000371281.3	37	CCDS596.1	.	.	.	.	.	.	.	.	.	.	A	7.184	0.590184	0.13812	.	.	ENSG00000243725	ENST00000371281	T	0.13420	2.59	4.83	-9.66	0.00534	.	.	.	.	.	T	0.03651	0.0104	N	0.03050	-0.425	0.20563	N	0.99989	B	0.02656	0.0	B	0.01281	0.0	T	0.39522	-0.9610	9	0.10636	T	0.68	.	8.2361	0.31627	0.4825:0.3731:0.1444:0.0	.	3	O95801	TTC4_HUMAN	R	3	ENSP00000360329:Q3R	ENSP00000360329:Q3R	Q	+	2	0	TTC4	54954177	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.443000	0.01013	-2.479000	0.00524	-1.272000	0.01410	CAA		0.642	TTC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027432.1	NM_004623		8	17	8	17
LCE2A	353139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	152671462	152671462	+	Nonsense_Mutation	SNP	C	C	T	rs200493380		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr1:152671462C>T	ENST00000368779.1	+	2	136	c.85C>T	c.(85-87)Cga>Tga	p.R29*		NM_178428.3	NP_848515.1	Q5TA79	LCE2A_HUMAN	late cornified envelope 2A	29	Cys-rich.				keratinization (GO:0031424)					breast(1)|large_intestine(1)|liver(2)|lung(4)	8	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCAAAGTGCCGACCTCAGTG	0.637																																																0													71.0	86.0	81.0					1																	152671462		2203	4300	6503	SO:0001587	stop_gained	353139				CCDS1021.1	1q21.3	2008-02-05			ENSG00000187173	ENSG00000187173		"""Late cornified envelopes"""	29469	protein-coding gene	gene with protein product		612609				11698679	Standard	NM_178428		Approved	LEP9	uc001faj.3	Q5TA79	OTTHUMG00000012392	ENST00000368779.1:c.85C>T	1.37:g.152671462C>T	ENSP00000357768:p.Arg29*	Somatic		WXS	Illumina GAIIx	Phase_I	A4QMZ9	Nonsense_Mutation	SNP	ENST00000368779.1	37	CCDS1021.1	.	.	.	.	.	.	.	.	.	.	c	11.83	1.756424	0.31137	.	.	ENSG00000187173	ENST00000368779	.	.	.	4.66	0.581	0.17407	.	.	.	.	.	.	.	.	.	.	.	0.36171	D	0.848779	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	3.6239	0.08105	0.1729:0.5349:0.0:0.2922	.	.	.	.	X	29	.	ENSP00000357768:R29X	R	+	1	2	LCE2A	150938086	0.000000	0.05858	0.000000	0.03702	0.153000	0.21895	-1.119000	0.03276	-0.175000	0.10725	-0.175000	0.13238	CGA		0.637	LCE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034512.1	NM_178428		71	128	71	128
DDR2	4921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	162746049	162746049	+	Silent	SNP	C	C	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr1:162746049C>A	ENST00000367922.3	+	17	2610	c.2172C>A	c.(2170-2172)atC>atA	p.I724I	RN7SL861P_ENST00000473793.2_RNA|DDR2_ENST00000367921.3_Silent_p.I724I	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	724	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	ACTACACAATCAAGATAGCTG	0.488																																					NSCLC(161;314 2006 8283 19651 23192)											0													144.0	142.0	143.0					1																	162746049		2203	4300	6503	SO:0001819	synonymous_variant	4921			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.2172C>A	1.37:g.162746049C>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q7Z730	Silent	SNP	ENST00000367922.3	37	CCDS1241.1																																																																																				0.488	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182		72	172	72	172
PTPRC	5788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	198687263	198687263	+	Silent	SNP	A	A	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr1:198687263A>T	ENST00000367376.2	+	14	1656	c.1485A>T	c.(1483-1485)tcA>tcT	p.S495S	PTPRC_ENST00000348564.6_Silent_p.S336S|PTPRC_ENST00000352140.3_Silent_p.S447S|PTPRC_ENST00000594404.1_Silent_p.S334S|PTPRC_ENST00000442510.2_Silent_p.S497S	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	495	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						CCATGACATCAGATAATAGTA	0.388																																																0													76.0	72.0	73.0					1																	198687263		2203	4300	6503	SO:0001819	synonymous_variant	5788			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1485A>T	1.37:g.198687263A>T		Somatic		WXS	Illumina GAIIx	Phase_I	A8K7W6|Q16614|Q9H0Y6	Silent	SNP	ENST00000367376.2	37																																																																																					0.388	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				26	40	26	40
PLXNA2	5362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	208272302	208272302	+	Missense_Mutation	SNP	C	C	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr1:208272302C>A	ENST00000367033.3	-	6	2377	c.1620G>T	c.(1618-1620)agG>agT	p.R540S		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	540					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GGCATTTGTCCCTGCGGGAGC	0.557																																																0													63.0	51.0	55.0					1																	208272302		2203	4300	6503	SO:0001583	missense	5362			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.1620G>T	1.37:g.208272302C>A	ENSP00000356000:p.Arg540Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	C	14.45	2.539258	0.45176	.	.	ENSG00000076356	ENST00000367033	T	0.17370	2.28	4.42	3.21	0.36854	.	0.094116	0.64402	D	0.000001	T	0.22975	0.0555	M	0.82132	2.575	0.54753	D	0.999986	B	0.22346	0.068	B	0.22753	0.041	T	0.05500	-1.0881	10	0.87932	D	0	.	9.9109	0.41406	0.0:0.8713:0.0:0.1287	.	540	O75051	PLXA2_HUMAN	S	540	ENSP00000356000:R540S	ENSP00000356000:R540S	R	-	3	2	PLXNA2	206338925	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.124000	0.31320	0.748000	0.32831	0.561000	0.74099	AGG		0.557	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179		13	20	13	20
BPIFB3	359710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	31654682	31654682	+	Splice_Site	SNP	A	A	G			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr20:31654682A>G	ENST00000375494.3	+	9	977	c.977A>G	c.(976-978)gAg>gGg	p.E326G		NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	326					innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										TTGCTCCCTGAGGTGAGTGAC	0.522																																																0													180.0	142.0	155.0					20																	31654682		2203	4300	6503	SO:0001630	splice_region_variant	359710			AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.978+1A>G	20.37:g.31654682A>G		Somatic		WXS	Illumina GAIIx	Phase_I	Q5TDX7	Splice_Site	SNP	ENST00000375494.3	37	CCDS13212.1	.	.	.	.	.	.	.	.	.	.	A	17.71	3.456695	0.63401	.	.	ENSG00000186190	ENST00000375494	T	0.09445	2.98	5.45	3.1	0.35709	.	0.212620	0.33057	N	0.005334	T	0.12646	0.0307	M	0.72894	2.215	0.33807	D	0.627428	B	0.17465	0.022	B	0.19946	0.027	T	0.06303	-1.0834	10	0.72032	D	0.01	-27.5709	5.5934	0.17313	0.7393:0.172:0.0888:0.0	.	326	P59826	BPIB3_HUMAN	G	326	ENSP00000364643:E326G	ENSP00000364643:E326G	E	+	2	0	BPIFB3	31118343	1.000000	0.71417	1.000000	0.80357	0.657000	0.38888	1.625000	0.37029	1.092000	0.41356	0.459000	0.35465	GAG		0.522	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2	NM_182658	Missense_Mutation	27	116	27	116
PFDN4	5203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	52831957	52831957	+	Missense_Mutation	SNP	A	A	C			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr20:52831957A>C	ENST00000371419.2	+	3	505	c.251A>C	c.(250-252)cAa>cCa	p.Q84P	PFDN4_ENST00000487129.1_3'UTR	NM_002623.3	NP_002614.2	Q9NQP4	PFD4_HUMAN	prefoldin subunit 4	84					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chaperone binding (GO:0051087)			endometrium(1)|kidney(2)	3	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		Colorectal(105;0.124)|STAD - Stomach adenocarcinoma(23;0.206)			GAAGAAACGCAAGAAATGTTA	0.313																																																0													84.0	79.0	81.0					20																	52831957		2203	4300	6503	SO:0001583	missense	5203			U41816	CCDS13445.1	20q13.2	2008-07-02	2006-02-24		ENSG00000101132	ENSG00000101132			8868	protein-coding gene	gene with protein product		604898	"""prefoldin 4"""			9630229, 8744932	Standard	NM_002623		Approved	PFD4, C-1, C1	uc002xwx.3	Q9NQP4	OTTHUMG00000032775	ENST00000371419.2:c.251A>C	20.37:g.52831957A>C	ENSP00000360473:p.Gln84Pro	Somatic		WXS	Illumina GAIIx	Phase_I	Q5TD11|Q92779	Missense_Mutation	SNP	ENST00000371419.2	37	CCDS13445.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.167820	0.78339	.	.	ENSG00000101132	ENST00000371419	T	0.44881	0.91	5.27	5.27	0.74061	Prefoldin beta-like (1);Prefoldin (1);	0.000000	0.85682	D	0.000000	T	0.65933	0.2739	M	0.86502	2.82	0.80722	D	1	D	0.67145	0.996	D	0.63381	0.914	T	0.70114	-0.4961	10	0.41790	T	0.15	-18.6702	14.6758	0.68978	1.0:0.0:0.0:0.0	.	84	Q9NQP4	PFD4_HUMAN	P	84	ENSP00000360473:Q84P	ENSP00000360473:Q84P	Q	+	2	0	PFDN4	52265364	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.554000	0.90689	2.122000	0.65172	0.533000	0.62120	CAA		0.313	PFDN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079771.2	NM_002623		14	47	14	47
FAM210B	116151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	54941327	54941327	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr20:54941327C>T	ENST00000371384.3	+	3	654	c.563C>T	c.(562-564)cCa>cTa	p.P188L		NM_080821.2	NP_543011.2	Q96KR6	F210B_HUMAN	family with sequence similarity 210, member B	188	DUF1279.					integral component of membrane (GO:0016021)											TTTAAACCTCCAGCTGCAAAA	0.398																																																0													98.0	98.0	98.0					20																	54941327		2203	4300	6503	SO:0001583	missense	116151			AL121914	CCDS13450.1	20q13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000124098	ENSG00000124098			16102	protein-coding gene	gene with protein product	"""hypothetical protein LOC116151"""		"""chromosome 20 open reading frame 108"""	C20orf108		11780052	Standard	NM_080821		Approved	dJ1167H4.1, DKFZP434A1114	uc002xxc.3	Q96KR6	OTTHUMG00000032793	ENST00000371384.3:c.563C>T	20.37:g.54941327C>T	ENSP00000360437:p.Pro188Leu	Somatic		WXS	Illumina GAIIx	Phase_I	B2RBQ9|E1P5Y7|Q8WVN2|Q9BYL6|Q9H418	Missense_Mutation	SNP	ENST00000371384.3	37	CCDS13450.1	.	.	.	.	.	.	.	.	.	.	C	32	5.175309	0.94807	.	.	ENSG00000124098	ENST00000371384	T	0.36699	1.24	5.56	5.56	0.83823	.	0.123452	0.56097	D	0.000038	T	0.62829	0.2460	M	0.74389	2.26	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.63703	-0.6577	10	0.54805	T	0.06	-4.1184	19.5255	0.95203	0.0:1.0:0.0:0.0	.	188	Q96KR6	CT108_HUMAN	L	188	ENSP00000360437:P188L	ENSP00000360437:P188L	P	+	2	0	C20orf108	54374734	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	5.658000	0.68003	2.595000	0.87683	0.650000	0.86243	CCA		0.398	FAM210B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079800.2	NM_080821		24	100	24	100
HRH3	11255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	60793682	60793682	+	Silent	SNP	G	G	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr20:60793682G>A	ENST00000340177.5	-	2	566	c.282C>T	c.(280-282)taC>taT	p.Y94Y	HRH3_ENST00000317393.6_Silent_p.Y94Y	NM_007232.2	NP_009163.2	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	94					brain development (GO:0007420)|drinking behavior (GO:0042756)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of serotonin secretion (GO:0014063)|neurotransmitter secretion (GO:0007269)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of norepinephrine secretion (GO:0014061)|response to organic cyclic compound (GO:0014070)	integral component of plasma membrane (GO:0005887)|myelin sheath (GO:0043209)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|histamine receptor activity (GO:0004969)			breast(1)|endometrium(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Betahistine(DB06698)|Histamine Phosphate(DB00667)|Mirtazapine(DB00370)	CTGTCAGCACGTAGGGTACAT	0.632																																																0													46.0	37.0	40.0					20																	60793682		2202	4300	6502	SO:0001819	synonymous_variant	11255			AF140538	CCDS13493.1	20q13.33	2013-09-19			ENSG00000101180	ENSG00000101180		"""GPCR / Class A : Histamine receptors"""	5184	protein-coding gene	gene with protein product		604525				10347254	Standard	NM_007232		Approved	GPCR97	uc002ycf.2	Q9Y5N1	OTTHUMG00000032899	ENST00000340177.5:c.282C>T	20.37:g.60793682G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q4QRI7|Q9GZX2|Q9H4K8	Silent	SNP	ENST00000340177.5	37	CCDS13493.1																																																																																				0.632	HRH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079994.1	NM_007232		16	55	16	55
TMPRSS3	64699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	21	43810090	43810090	+	Missense_Mutation	SNP	T	T	C			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr21:43810090T>C	ENST00000291532.3	-	3	1106	c.151A>G	c.(151-153)Atc>Gtc	p.I51V	TMPRSS3_ENST00000398397.3_Missense_Mutation_p.I51V|TMPRSS3_ENST00000474596.1_5'Flank|TMPRSS3_ENST00000398405.1_Missense_Mutation_p.I49V|TMPRSS3_ENST00000380399.1_Missense_Mutation_p.I135V|TMPRSS3_ENST00000433957.2_Missense_Mutation_p.I51V	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	51				LKFFPIIVI -> FEVFSQSSSL (in Ref. 1; AAG37012). {ECO:0000305}.	cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						ATGACGATGATTGGAAAAAAC	0.433																																																0													103.0	90.0	95.0					21																	43810090		2203	4300	6503	SO:0001583	missense	64699			AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.151A>G	21.37:g.43810090T>C	ENSP00000291532:p.Ile51Val	Somatic		WXS	Illumina GAIIx	Phase_I	D3DSJ6|Q5USC7|Q6ZMC3	Missense_Mutation	SNP	ENST00000291532.3	37	CCDS13686.1	.	.	.	.	.	.	.	.	.	.	T	4.738	0.137172	0.09032	.	.	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399;ENST00000398397	D;D;D;D;D	0.88431	-2.34;-2.28;-2.36;-2.36;-2.38	5.08	-0.0207	0.13955	.	0.424990	0.22466	N	0.059687	T	0.72162	0.3426	N	0.12182	0.205	0.19575	N	0.999961	B;B;B	0.20887	0.049;0.004;0.002	B;B;B	0.17433	0.018;0.006;0.003	T	0.57087	-0.7871	9	.	.	.	.	4.3205	0.11015	0.1905:0.3502:0.0:0.4593	.	51;51;51	P57727-3;P57727-5;P57727	.;.;TMPS3_HUMAN	V	51;51;49;135;51	ENSP00000291532:I51V;ENSP00000411013:I51V;ENSP00000381442:I49V;ENSP00000369762:I135V;ENSP00000381434:I51V	.	I	-	1	0	TMPRSS3	42683159	0.641000	0.27251	0.118000	0.21660	0.187000	0.23431	0.613000	0.24299	-0.014000	0.14175	0.459000	0.35465	ATC		0.433	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1			28	66	28	66
C2orf71	388939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	29295046	29295046	+	Silent	SNP	G	G	A	rs376411163		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr2:29295046G>A	ENST00000331664.5	-	1	2081	c.2082C>T	c.(2080-2082)gaC>gaT	p.D694D		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	694					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TGCCTTGTTCGTCCTCAGGAT	0.532																																																0								G		1,4153		0,1,2076	129.0	125.0	126.0		2082	-10.5	0.0	2		126	0,8452		0,0,4226	no	coding-synonymous	C2orf71	NM_001029883.1		0,1,6302	AA,AG,GG		0.0,0.0241,0.0079		694/1289	29295046	1,12605	2077	4226	6303	SO:0001819	synonymous_variant	0				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.2082C>T	2.37:g.29295046G>A		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000331664.5	37	CCDS42669.1																																																																																				0.532	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883		45	99	45	99
EHBP1	23301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	63182658	63182658	+	Silent	SNP	T	T	C			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr2:63182658T>C	ENST00000263991.5	+	15	2910	c.2428T>C	c.(2428-2430)Ttg>Ctg	p.L810L	EHBP1_ENST00000405015.3_Silent_p.L775L|EHBP1_ENST00000431489.1_Silent_p.L775L|EHBP1_ENST00000405289.1_Silent_p.L775L|EHBP1_ENST00000354487.3_Silent_p.L775L	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	810						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TAAGCATCGATTGTTATCTAG	0.358																																																0													73.0	69.0	70.0					2																	63182658		2203	4300	6503	SO:0001819	synonymous_variant	23301			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.2428T>C	2.37:g.63182658T>C		Somatic		WXS	Illumina GAIIx	Phase_I	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Silent	SNP	ENST00000263991.5	37	CCDS1872.1	.	.	.	.	.	.	.	.	.	.	T	9.183	1.024196	0.19433	.	.	ENSG00000115504	ENST00000444311	.	.	.	5.73	3.32	0.38043	.	.	.	.	.	T	0.61874	0.2382	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56938	-0.7896	4	.	.	.	.	11.3991	0.49860	0.7566:0.0:0.0:0.2434	.	.	.	.	T	34	.	.	I	+	2	0	EHBP1	63036162	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.875000	0.48491	0.498000	0.27948	-0.275000	0.10095	ATT		0.358	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251616.1	NM_015252		7	17	7	17
ZNF638	27332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	71576931	71576931	+	Missense_Mutation	SNP	T	T	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr2:71576931T>A	ENST00000409544.1	+	2	1477	c.847T>A	c.(847-849)Tcc>Acc	p.S283T	ZNF638_ENST00000264447.4_Missense_Mutation_p.S283T|ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000377802.2_Missense_Mutation_p.S283T|ZNF638_ENST00000355812.3_Missense_Mutation_p.S283T	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	283					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						CAATAATCGGTCCTTTTTCTC	0.428																																																0													141.0	137.0	139.0					2																	71576931		2203	4300	6503	SO:0001583	missense	27332			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.847T>A	2.37:g.71576931T>A	ENSP00000386433:p.Ser283Thr	Somatic		WXS	Illumina GAIIx	Phase_I	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	T	14.42	2.531447	0.45073	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544	T;T;T;T;T;T	0.73152	-0.13;-0.72;0.45;-0.11;1.45;1.45	5.77	2.19	0.27852	.	0.456975	0.24007	N	0.042411	T	0.66317	0.2777	N	0.24115	0.695	0.29962	N	0.819279	D;D;D;D;D	0.61697	0.982;0.982;0.99;0.982;0.982	D;D;D;D;D	0.72982	0.961;0.961;0.979;0.952;0.961	T	0.59799	-0.7386	10	0.12430	T	0.62	-0.4382	6.5136	0.22236	0.0:0.2734:0.0:0.7266	.	389;283;283;283;283	F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;ZN638_HUMAN;.	T	283;389;283;283;283;283	ENSP00000386669:S283T;ENSP00000438189:S389T;ENSP00000348066:S283T;ENSP00000367033:S283T;ENSP00000264447:S283T;ENSP00000386433:S283T	ENSP00000264447:S283T	S	+	1	0	ZNF638	71430439	0.989000	0.36119	0.992000	0.48379	0.953000	0.61014	0.744000	0.26245	0.461000	0.27071	0.533000	0.62120	TCC		0.428	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497		62	133	62	133
SNRNP200	23020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	96962796	96962796	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr2:96962796C>T	ENST00000323853.5	-	12	1467	c.1390G>A	c.(1390-1392)Gtg>Atg	p.V464M	SNRNP200_ENST00000349783.5_Missense_Mutation_p.V464M	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	464					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						AGCTTTTCCACTGGAAGCAGT	0.483																																																0													61.0	62.0	62.0					2																	96962796		2203	4300	6503	SO:0001583	missense	23020			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.1390G>A	2.37:g.96962796C>T	ENSP00000317123:p.Val464Met	Somatic		WXS	Illumina GAIIx	Phase_I	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	CCDS2020.1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.763630	0.69878	.	.	ENSG00000144028	ENST00000323853;ENST00000349783;ENST00000540328	T;T	0.37235	1.21;1.21	5.74	5.74	0.90152	.	0.056675	0.64402	D	0.000001	T	0.42291	0.1196	M	0.72894	2.215	0.58432	D	0.999994	P	0.37061	0.58	B	0.34180	0.177	T	0.46775	-0.9167	10	0.87932	D	0	-18.8641	18.6945	0.91596	0.0:1.0:0.0:0.0	.	464	O75643	U520_HUMAN	M	464;464;139	ENSP00000317123:V464M;ENSP00000326937:V464M	ENSP00000317123:V464M	V	-	1	0	SNRNP200	96326523	1.000000	0.71417	0.990000	0.47175	0.809000	0.45718	4.171000	0.58236	2.717000	0.92951	0.655000	0.94253	GTG		0.483	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014		32	46	32	46
CNGA3	1261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	98999852	98999852	+	Splice_Site	SNP	G	G	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr2:98999852G>A	ENST00000272602.2	+	4	436	c.397G>A	c.(397-399)Gcc>Acc	p.A133T	CNGA3_ENST00000436404.2_Intron|CNGA3_ENST00000393504.1_Splice_Site_p.A133T|CNGA3_ENST00000409937.1_Splice_Site_p.A137T			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	133					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						TTCCCGCAGCGCCTGGCCCCT	0.587																																																0													104.0	93.0	97.0					2																	98999852		2203	4300	6503	SO:0001630	splice_region_variant	1261			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.396-1G>A	2.37:g.98999852G>A		Somatic		WXS	Illumina GAIIx	Phase_I	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Splice_Site	SNP	ENST00000272602.2	37	CCDS2034.1	.	.	.	.	.	.	.	.	.	.	g	5.864	0.343634	0.11126	.	.	ENSG00000144191	ENST00000393504;ENST00000272602;ENST00000409937	D;D;D	0.97480	-4.27;-4.27;-4.4	4.76	2.01	0.26516	.	1.357460	0.04976	N	0.464775	D	0.91257	0.7244	N	0.14661	0.345	0.09310	N	1	B;B	0.26318	0.001;0.146	B;B	0.17098	0.001;0.017	D	0.83488	0.0068	10	0.14252	T	0.57	.	5.5645	0.17163	0.2727:0.1383:0.589:0.0	.	137;133	E9PF93;Q16281	.;CNGA3_HUMAN	T	133;133;137	ENSP00000377140:A133T;ENSP00000272602:A133T;ENSP00000386761:A137T	ENSP00000272602:A133T	A	+	1	0	CNGA3	98366284	0.003000	0.15002	0.029000	0.17559	0.018000	0.09664	0.914000	0.28624	0.015000	0.14971	-1.978000	0.00458	GCC		0.587	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	Missense_Mutation	22	63	22	63
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	179577501	179577501	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr2:179577501G>T	ENST00000591111.1	-	92	26524	c.26300C>A	c.(26299-26301)tCa>tAa	p.S8767*	TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.S7840*|TTN_ENST00000589042.1_Nonsense_Mutation_p.S9084*|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12923	Ig-like 70.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCACTTTGTGATGTATCTAC	0.423																																																0													89.0	85.0	87.0					2																	179577501		1922	4118	6040	SO:0001587	stop_gained	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.26300C>A	2.37:g.179577501G>T	ENSP00000465570:p.Ser8767*	Somatic		WXS	Illumina GAIIx	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	59	37.137888	0.99984	.	.	ENSG00000155657	ENST00000342992	.	.	.	5.48	3.67	0.42095	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.0056	0.30323	0.269:0.0:0.731:0.0	.	.	.	.	X	7840	.	ENSP00000343764:S7840X	S	-	2	0	TTN	179285746	0.997000	0.39634	0.273000	0.24645	0.967000	0.64934	3.654000	0.54453	1.449000	0.47699	0.655000	0.94253	TCA		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		13	39	13	39
UGT1A4	54657	hgsc.bcm.edu;ucsc.edu	37	2	234627498	234627498	+	Missense_Mutation	SNP	G	G	A	rs149314940		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr2:234627498G>A	ENST00000373409.3	+	1	75	c.32G>A	c.(31-33)cGg>cAg	p.R11Q	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A5_ENST00000373414.3_Intron	NM_007120.2	NP_009051.1	P22310	UD14_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A4	11			R -> W (in dbSNP:rs3892221).		cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	26		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Asenapine(DB06216)|Clozapine(DB00363)|Ezogabine(DB04953)|Lamotrigine(DB00555)|Midazolam(DB00683)|Paricalcitol(DB00910)|Tamoxifen(DB00675)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)	CCCCTGCCGCGGCTGGCCACA	0.627											OREG0003834	type=REGULATORY REGION|Gene=UGT1A4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	G|||	1	0.000199681	0.0	0.0	5008	,	,		17489	0.001		0.0	False		,,,				2504	0.0				Melanoma(99;1011 1962 13201 26492)											0								G	,GLN/ARG,,,,,,	0,4406		0,0,2203	47.0	46.0	46.0		,32,,,,,,	-8.9	0.0	2	dbSNP_134	46	1,8599	2.2+/-6.3	0,1,4299	no	intron,missense,intron,intron,intron,intron,intron,intron	UGT1A10,UGT1A8,UGT1A7,UGT1A6,UGT1A5,UGT1A9,UGT1A4	NM_001072.3,NM_007120.2,NM_019075.2,NM_019076.4,NM_019077.2,NM_019078.1,NM_021027.2,NM_205862.1	,43,,,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,,,,	,11/535,,,,,,	234627498	1,13005	2203	4300	6503	SO:0001583	missense	54657			M84128	CCDS33405.1	2q37.1	2014-01-10	2005-07-20		ENSG00000244474	ENSG00000244474		"""UDP glucuronosyltransferases"""	12536	other	complex locus constituent		606429	"""UDP glycosyltransferase 1 family, polypeptide A4"""			9295054, 1339448	Standard	NM_007120		Approved	HUG-BR2, UGT1D	uc002vux.3	P22310	OTTHUMG00000059119	ENST00000373409.3:c.32G>A	2.37:g.234627498G>A	ENSP00000362508:p.Arg11Gln	Somatic	2375	WXS	Illumina GAIIx	Phase_I	B2R937|B8K288|Q5DT00	Missense_Mutation	SNP	ENST00000373409.3	37	CCDS33405.1	.	.	.	.	.	.	.	.	.	.	G	2.874	-0.233262	0.05983	0.0	1.16E-4	ENSG00000244474	ENST00000373409	T	0.58940	0.3	4.44	-8.88	0.00789	.	.	.	.	.	T	0.33818	0.0876	L	0.38175	1.15	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.13045	-1.0524	9	0.19147	T	0.46	.	1.8113	0.03091	0.1928:0.2095:0.4234:0.1743	.	11;11	B8K288;P22310	.;UD14_HUMAN	Q	11	ENSP00000362508:R11Q	ENSP00000362508:R11Q	R	+	2	0	UGT1A4	234292237	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.988000	0.01482	-5.410000	0.00015	-3.859000	0.00018	CGG		0.627	UGT1A4-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130984.1	NM_007120		24	67	24	67
IQCF1	132141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	51929217	51929217	+	Missense_Mutation	SNP	G	G	A	rs200134435		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr3:51929217G>A	ENST00000310914.5	-	4	369	c.307C>T	c.(307-309)Cgg>Tgg	p.R103W		NM_152397.2	NP_689610.2	Q8N6M8	IQCF1_HUMAN	IQ motif containing F1	103										central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGTATCAGCCGCCACCAGCAC	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		17108	0.0		0.001	False		,,,				2504	0.0															0								G	TRP/ARG	0,4406		0,0,2203	43.0	43.0	43.0		307	2.7	0.6	3		43	4,8596	3.0+/-9.4	0,4,4296	yes	missense	IQCF1	NM_152397.2	101	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	probably-damaging	103/206	51929217	4,13002	2203	4300	6503	SO:0001583	missense	132141			BC029595	CCDS2836.1	3p21.31	2008-02-05			ENSG00000173389	ENSG00000173389			28607	protein-coding gene	gene with protein product						12477932	Standard	NM_152397		Approved	MGC39725	uc003dbv.3	Q8N6M8	OTTHUMG00000156908	ENST00000310914.5:c.307C>T	3.37:g.51929217G>A	ENSP00000307958:p.Arg103Trp	Somatic		WXS	Illumina GAIIx	Phase_I	Q8N711	Missense_Mutation	SNP	ENST00000310914.5	37	CCDS2836.1	.	.	.	.	.	.	.	.	.	.	G	18.77	3.694212	0.68386	0.0	4.65E-4	ENSG00000173389	ENST00000310914	D	0.87029	-2.2	4.75	2.74	0.32292	.	0.391809	0.22113	N	0.064442	D	0.91556	0.7333	M	0.73598	2.24	0.29020	N	0.886334	D	0.89917	1.0	D	0.72625	0.978	D	0.85858	0.1408	10	0.87932	D	0	-17.6743	9.417	0.38528	0.0:0.0:0.4667:0.5333	.	103	Q8N6M8	IQCF1_HUMAN	W	103	ENSP00000307958:R103W	ENSP00000307958:R103W	R	-	1	2	IQCF1	51904257	0.864000	0.29904	0.638000	0.29380	0.953000	0.61014	0.921000	0.28718	0.572000	0.29383	0.549000	0.68633	CGG		0.637	IQCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346568.1	NM_152397		59	86	59	86
ST3GAL6	10402	hgsc.bcm.edu;broad.mit.edu	37	3	98503881	98503881	+	Missense_Mutation	SNP	T	T	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr3:98503881T>A	ENST00000483910.1	+	6	717	c.428T>A	c.(427-429)aTa>aAa	p.I143K	ST3GAL6_ENST00000265261.6_Intron|ST3GAL6_ENST00000394162.1_Missense_Mutation_p.I143K|ST3GAL6_ENST00000462152.1_3'UTR	NM_001271146.1	NP_001258075.1	Q9Y274	SIA10_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 6	143					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|cellular response to interleukin-6 (GO:0071354)|glycolipid metabolic process (GO:0006664)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,3-sialyltransferase activity (GO:0052798)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(1)	19						GATGTAATAATAAGGTAAATA	0.348																																																0													58.0	63.0	61.0					3																	98503881		2203	4300	6503	SO:0001583	missense	10402			AF119391	CCDS2933.1, CCDS59452.1, CCDS74968.1	3q12.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000064225	ENSG00000064225		"""Sialyltransferases"""	18080	protein-coding gene	gene with protein product		607156	"""sialyltransferase 10 (alpha-2,3-sialyltransferase VI)"""	SIAT10		10206952	Standard	NM_006100		Approved	ST3GALVI	uc010hpd.4	Q9Y274	OTTHUMG00000159047	ENST00000483910.1:c.428T>A	3.37:g.98503881T>A	ENSP00000417376:p.Ile143Lys	Somatic		WXS	Illumina GAIIx	Phase_I	B2RCH2|B3KMI1|D3DN39|F8W6U0	Missense_Mutation	SNP	ENST00000483910.1	37	CCDS2933.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.283073	0.80803	.	.	ENSG00000064225	ENST00000483910;ENST00000486334;ENST00000394162;ENST00000492254;ENST00000477574;ENST00000485145	T;T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13;1.13	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.71108	0.3301	M	0.91717	3.235	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.995;0.996	T	0.78336	-0.2243	10	0.87932	D	0	-8.8464	13.9323	0.64003	0.0:0.0:0.0:1.0	.	166;143	C9J480;Q9Y274	.;SIA10_HUMAN	K	143;143;143;166;108;57	ENSP00000417376:I143K;ENSP00000418896:I143K;ENSP00000377717:I143K;ENSP00000417201:I166K;ENSP00000419987:I108K;ENSP00000419202:I57K	ENSP00000377717:I143K	I	+	2	0	ST3GAL6	99986571	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.461000	0.66699	2.225000	0.72522	0.528000	0.53228	ATA		0.348	ST3GAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353013.2	NM_006100		14	24	14	24
TRIM42	287015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	140401985	140401985	+	Silent	SNP	C	C	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr3:140401985C>T	ENST00000286349.3	+	2	1214	c.1023C>T	c.(1021-1023)atC>atT	p.I341I		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	341						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TCAGCGCCATCGCCAAGTTCA	0.542																																																0													116.0	110.0	112.0					3																	140401985		2203	4300	6503	SO:0001819	synonymous_variant	287015			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1023C>T	3.37:g.140401985C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A1L4B4|Q8N832|Q8NDL3	Silent	SNP	ENST00000286349.3	37	CCDS3113.1																																																																																				0.542	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616		24	59	24	59
PCDH7	5099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	30725552	30725552	+	Missense_Mutation	SNP	C	C	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr4:30725552C>A	ENST00000361762.2	+	1	3516	c.2508C>A	c.(2506-2508)caC>caA	p.H836Q	PCDH7_ENST00000543491.1_Missense_Mutation_p.H836Q	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	836	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						CTCTGGTGCACGTGTTTGTCA	0.493																																																0													68.0	66.0	66.0					4																	30725552		2203	4300	6503	SO:0001583	missense	5099			AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2508C>A	4.37:g.30725552C>A	ENSP00000355243:p.His836Gln	Somatic		WXS	Illumina GAIIx	Phase_I	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.87|12.87	2.067347|2.067347	0.36470|0.36470	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135|ENST00000511884	T;T|.	0.50277|.	0.75;0.75|.	4.96|4.96	0.651|0.651	0.17817|0.17817	Cadherin (4);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	T|T	0.59390|0.59390	0.2190|0.2190	L|L	0.58969|0.58969	1.84|1.84	0.41768|0.41768	D|D	0.989752|0.989752	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	T|T	0.55592|0.55592	-0.8117|-0.8117	9|5	0.72032|.	D|.	0.01|.	.|.	9.6776|9.6776	0.40050|0.40050	0.0:0.3001:0.0:0.6999|0.0:0.3001:0.0:0.6999	.|.	836;789;836|.	F5GWJ1;O60245-3;O60245|.	.;.;PCDH7_HUMAN|.	Q|S	836;836;789|526	ENSP00000355243:H836Q;ENSP00000441802:H836Q|.	ENSP00000330302:H789Q|.	H|R	+|+	3|1	2|0	PCDH7|PCDH7	30334650|30334650	0.711000|0.711000	0.27906|0.27906	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	-0.168000|-0.168000	0.09925|0.09925	0.283000|0.283000	0.22279|0.22279	-0.294000|-0.294000	0.09567|0.09567	CAC|CGT		0.493	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589		24	34	24	34
SPEF2	79925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	35697831	35697831	+	Silent	SNP	T	T	C			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr5:35697831T>C	ENST00000356031.3	+	15	2231	c.2077T>C	c.(2077-2079)Ttg>Ctg	p.L693L	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000509059.1_Silent_p.L688L|SPEF2_ENST00000440995.2_Silent_p.L688L	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	693					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATCAGAACAGTTGCTGAAGAA	0.353																																																0													132.0	125.0	127.0					5																	35697831		1927	4125	6052	SO:0001819	synonymous_variant	79925			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.2077T>C	5.37:g.35697831T>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Silent	SNP	ENST00000356031.3	37	CCDS43309.1																																																																																				0.353	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		28	50	28	50
SRFBP1	153443	hgsc.bcm.edu;ucsc.edu	37	5	121355961	121355961	+	Silent	SNP	G	G	C	rs55708726	byFrequency	TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr5:121355961G>C	ENST00000339397.4	+	6	603	c.531G>C	c.(529-531)gcG>gcC	p.A177A		NM_152546.2	NP_689759.2			serum response factor binding protein 1											central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|skin(1)	15		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		AAATATTGGCGAAGAAACCAA	0.343																																																0													112.0	103.0	106.0					5																	121355961		1862	4087	5949	SO:0001819	synonymous_variant	153443			AK058015	CCDS43354.1	5q23.1	2006-12-21				ENSG00000151304			26333	protein-coding gene	gene with protein product	"""BUD22 homolog (S. cerevisiae)"""	610479				15492011	Standard	NM_152546		Approved	FLJ25286, p49, STRAP, BUD22, Rlb1	uc003kst.1	Q8NEF9		ENST00000339397.4:c.531G>C	5.37:g.121355961G>C		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000339397.4	37	CCDS43354.1																																																																																				0.343	SRFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371200.1	NM_152546		25	57	25	57
APBB3	10307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	139941733	139941733	+	Missense_Mutation	SNP	T	T	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr5:139941733T>A	ENST00000357560.4	-	6	1021	c.578A>T	c.(577-579)cAg>cTg	p.Q193L	APBB3_ENST00000356738.2_Missense_Mutation_p.Q193L|APBB3_ENST00000358580.5_Missense_Mutation_p.Q193L|APBB3_ENST00000508496.2_5'UTR|SLC35A4_ENST00000514199.1_5'Flank|APBB3_ENST00000511201.2_Missense_Mutation_p.Q193L|APBB3_ENST00000412920.3_Missense_Mutation_p.Q193L|APBB3_ENST00000354402.5_Missense_Mutation_p.Q193L|SLC35A4_ENST00000323146.3_5'Flank|APBB3_ENST00000507279.1_5'Flank	NM_006051.3|NM_133173.2	NP_006042.3|NP_573419.2	O95704	APBB3_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 3	193	PID 1. {ECO:0000255|PROSITE- ProRule:PRU00148}.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACCAGAGGCTGGCAGTGGAT	0.602																																																0													79.0	73.0	75.0					5																	139941733		2203	4300	6503	SO:0001583	missense	10307			AB018247	CCDS4227.1, CCDS4228.1, CCDS4229.1, CCDS47279.1	5q31	2008-02-05			ENSG00000113108	ENSG00000113108			20708	protein-coding gene	gene with protein product		602711				9407065	Standard	NM_133172		Approved	FE65L2	uc003lgd.1	O95704	OTTHUMG00000129504	ENST00000357560.4:c.578A>T	5.37:g.139941733T>A	ENSP00000350171:p.Gln193Leu	Somatic		WXS	Illumina GAIIx	Phase_I	B3KQN9|Q08AG4|Q96Q18|Q9BYD4|Q9NYX6|Q9NYX7|Q9NYX8	Missense_Mutation	SNP	ENST00000357560.4	37	CCDS4229.1	.	.	.	.	.	.	.	.	.	.	T	19.72	3.879619	0.72294	.	.	ENSG00000113108	ENST00000358580;ENST00000356738;ENST00000354402;ENST00000357560;ENST00000412920;ENST00000511201	T;T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07;2.07	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.47340	0.1440	M	0.80422	2.495	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.48927	-0.8991	9	.	.	.	-5.674	11.7792	0.52003	0.0:0.0699:0.0:0.9301	.	193;193	O95704-2;O95704-3	.;.	L	193	ENSP00000351389:Q193L;ENSP00000349177:Q193L;ENSP00000346378:Q193L;ENSP00000350171:Q193L;ENSP00000402591:Q193L;ENSP00000424317:Q193L	.	Q	-	2	0	APBB3	139921917	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.924000	0.56476	2.164000	0.68074	0.533000	0.62120	CAG		0.602	APBB3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251677.2	NM_006051		28	59	28	59
HAVCR1	26762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	156476111	156476111	+	Missense_Mutation	SNP	G	G	A	rs201642411		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr5:156476111G>A	ENST00000339252.3	-	4	1251	c.719C>T	c.(718-720)aCg>aTg	p.T240M	HAVCR1_ENST00000523175.1_Missense_Mutation_p.T240M|HAVCR1_ENST00000517644.1_5'UTR|HAVCR1_ENST00000522693.1_Missense_Mutation_p.T240M|HAVCR1_ENST00000544197.1_Missense_Mutation_p.T240M|HAVCR1_ENST00000425854.1_Missense_Mutation_p.T240M	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	235					viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTGCAGTGTCGTAGGGTGGGT	0.483													g|||	1	0.000199681	0.0	0.0	5008	,	,		17628	0.001		0.0	False		,,,				2504	0.0															0								A	MET/THR,MET/THR,MET/THR	3,4075		0,3,2036	222.0	217.0	218.0		719,719,719	-1.9	0.0	5		218	1,8387		0,1,4193	yes	missense,missense,missense	HAVCR1	NM_012206.2,NM_001173393.1,NM_001099414.1	81,81,81	0,4,6229	AA,AG,GG		0.0119,0.0736,0.0321	benign,benign,benign	240/365,240/365,240/365	156476111	4,12462	2039	4194	6233	SO:0001583	missense	26762			AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.719C>T	5.37:g.156476111G>A	ENSP00000344844:p.Thr240Met	Somatic		WXS	Illumina GAIIx	Phase_I	O43656	Missense_Mutation	SNP	ENST00000339252.3	37	CCDS43392.1	.	.	.	.	.	.	.	.	.	.	g	2.773	-0.255306	0.05829	7.36E-4	1.19E-4	ENSG00000113249	ENST00000522693;ENST00000523175;ENST00000339252;ENST00000425854;ENST00000544197	T;T;T;T;T	0.16597	2.33;2.41;2.41;2.33;2.41	3.43	-1.85	0.07784	.	.	.	.	.	T	0.07593	0.0191	N	0.19112	0.55	0.09310	N	1	B;B;B	0.30146	0.166;0.27;0.27	B;B;B	0.16289	0.007;0.015;0.015	T	0.33497	-0.9866	9	0.25106	T	0.35	0.0046	5.0107	0.14312	0.3864:0.0:0.4571:0.1565	.	240;235;235	E9PFX0;F1CME6;Q96D42	.;.;HAVR1_HUMAN	M	240	ENSP00000428524:T240M;ENSP00000427898:T240M;ENSP00000344844:T240M;ENSP00000403333:T240M;ENSP00000440258:T240M	ENSP00000344844:T240M	T	-	2	0	HAVCR1	156408689	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.904000	0.04080	-0.780000	0.04553	-2.811000	0.00111	ACG		0.483	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1			53	103	53	103
TFAP2D	83741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	50683145	50683145	+	Missense_Mutation	SNP	C	C	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr6:50683145C>A	ENST00000008391.3	+	2	584	c.356C>A	c.(355-357)gCg>gAg	p.A119E		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					CTGCACAATGCGCGGGCGCTC	0.622																																																0													83.0	81.0	82.0					6																	50683145		2203	4300	6503	SO:0001583	missense	83741			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.356C>A	6.37:g.50683145C>A	ENSP00000008391:p.Ala119Glu	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000008391.3	37	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.749480	0.49257	.	.	ENSG00000008197	ENST00000008391	D	0.97089	-4.24	5.21	5.21	0.72293	.	0.115877	0.64402	D	0.000018	D	0.95121	0.8419	N	0.08118	0	0.80722	D	1	D	0.69078	0.997	D	0.74348	0.983	D	0.94732	0.7910	10	0.27785	T	0.31	-18.5246	19.1268	0.93388	0.0:1.0:0.0:0.0	.	119	Q7Z6R9	AP2D_HUMAN	E	119	ENSP00000008391:A119E	ENSP00000008391:A119E	A	+	2	0	TFAP2D	50791104	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.604000	0.82830	2.590000	0.87494	0.655000	0.94253	GCG		0.622	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238		60	113	60	113
MACC1	346389	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	20198442	20198442	+	Silent	SNP	G	G	T	rs149661432	byFrequency	TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr7:20198442G>T	ENST00000400331.5	-	5	1850	c.1542C>A	c.(1540-1542)ctC>ctA	p.L514L	MACC1_ENST00000332878.4_Silent_p.L514L|MACC1_ENST00000589011.1_Silent_p.L514L	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	514					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						GCAGATTCGAGAGTCTTTTTA	0.393																																																0													102.0	110.0	108.0					7																	20198442		2203	4300	6503	SO:0001819	synonymous_variant	346389				CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.1542C>A	7.37:g.20198442G>T		Somatic		WXS	Illumina GAIIx	Phase_I	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Silent	SNP	ENST00000400331.5	37	CCDS5369.1																																																																																				0.393	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762		58	153	58	153
KEL	3792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	142658923	142658923	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr7:142658923G>A	ENST00000355265.2	-	2	514	c.40C>T	c.(40-42)Cgc>Tgc	p.R14C	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	14					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					GCCTGGCTGCGTTCCCTCGGC	0.542																																																0													259.0	220.0	233.0					7																	142658923		2203	4300	6503	SO:0001583	missense	3792			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.40C>T	7.37:g.142658923G>A	ENSP00000347409:p.Arg14Cys	Somatic		WXS	Illumina GAIIx	Phase_I	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	CCDS34766.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.93|11.93	1.785412|1.785412	0.31593|0.31593	.|.	.|.	ENSG00000197993|ENSG00000197993	ENST00000355265;ENST00000476829|ENST00000460479	D;T|.	0.83335|.	-1.71;0.78|.	4.67|4.67	0.533|0.533	0.17121|0.17121	.|.	5.372630|.	0.00508|.	N|.	0.000168|.	T|T	0.14442|0.14442	0.0349|0.0349	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	P|.	0.36616|.	0.561|.	B|.	0.31547|.	0.132|.	T|T	0.24440|0.24440	-1.0160|-1.0160	10|5	0.38643|.	T|.	0.18|.	22.4756|22.4756	2.9706|2.9706	0.05922|0.05922	0.0964:0.3194:0.4006:0.1836|0.0964:0.3194:0.4006:0.1836	.|.	14|.	P23276|.	KELL_HUMAN|.	C|M	14|24	ENSP00000347409:R14C;ENSP00000419889:R14C|.	ENSP00000347409:R14C|.	R|T	-|-	1|2	0|0	KEL|KEL	142369045|142369045	0.007000|0.007000	0.16637|0.16637	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	1.289000|1.289000	0.33307|0.33307	-0.082000|-0.082000	0.12640|0.12640	0.650000|0.650000	0.86243|0.86243	CGC|ACG		0.542	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420		122	393	122	393
NOBOX	135935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	144096940	144096940	+	Missense_Mutation	SNP	C	C	T	rs201947677		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr7:144096940C>T	ENST00000467773.1	-	6	1063	c.1064G>A	c.(1063-1065)cGc>cAc	p.R355H	NOBOX_ENST00000483238.1_Missense_Mutation_p.R323H|NOBOX_ENST00000223140.5_Missense_Mutation_p.R238H	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	355			R -> H (in POF5). {ECO:0000269|PubMed:17701902}.		oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					CTTGGCCCGGCGATTCTGGAA	0.542																																																0			GRCh37	CM073237	NOBOX	M							73.0	76.0	75.0					7																	144096940		1955	4147	6102	SO:0001583	missense	135935					7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.1064G>A	7.37:g.144096940C>T	ENSP00000419457:p.Arg355His	Somatic		WXS	Illumina GAIIx	Phase_I	A6NCD3|A8MZN5	Missense_Mutation	SNP	ENST00000467773.1	37		.	.	.	.	.	.	.	.	.	.	C	22.2	4.257133	0.80246	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140;ENST00000555556	D;D;D	0.97553	-4.43;-4.42;-4.43	5.55	4.67	0.58626	Homeodomain-related (1);Homeobox (2);	0.060082	0.64402	D	0.000006	D	0.98695	0.9562	M	0.93241	3.395	0.40731	A	0.982749	D	0.89917	1.0	D	0.87578	0.998	D	0.99930	1.1311	9	0.87932	D	0	-29.6398	12.3015	0.54876	0.0:0.918:0.0:0.082	.	355	O60393	NOBOX_HUMAN	H	323;355;238;112	ENSP00000419565:R323H;ENSP00000419457:R355H;ENSP00000223140:R238H	ENSP00000223140:R238H	R	-	2	0	NOBOX	143727873	1.000000	0.71417	0.967000	0.41034	0.995000	0.86356	5.277000	0.65586	1.352000	0.45808	0.650000	0.86243	CGC		0.542	NOBOX-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000350095.1	XM_001134420		10	26	10	26
MSR1	4481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	16026364	16026364	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr8:16026364C>T	ENST00000262101.5	-	4	354	c.233G>A	c.(232-234)tGg>tAg	p.W78*	MSR1_ENST00000350896.3_Nonsense_Mutation_p.W78*|MSR1_ENST00000536385.1_Intron|MSR1_ENST00000355282.2_Nonsense_Mutation_p.W78*|MSR1_ENST00000381998.4_Nonsense_Mutation_p.W78*|MSR1_ENST00000445506.2_Nonsense_Mutation_p.W96*			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	78	Spacer. {ECO:0000305}.				cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)			haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		CTTCGTTTCCCACTTCAGGAG	0.388																																																0													113.0	107.0	109.0					8																	16026364		2203	4300	6503	SO:0001587	stop_gained	4481			D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.233G>A	8.37:g.16026364C>T	ENSP00000262101:p.Trp78*	Somatic		WXS	Illumina GAIIx	Phase_I	D3DSP3|O60505|P21759|Q45F10	Nonsense_Mutation	SNP	ENST00000262101.5	37	CCDS5995.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.135481	0.77662	.	.	ENSG00000038945	ENST00000350896;ENST00000262101;ENST00000445506;ENST00000355282;ENST00000381998	.	.	.	5.05	2.06	0.26882	.	0.308076	0.24343	N	0.039341	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	5.0299	0.14404	0.3776:0.5246:0.0:0.0978	.	.	.	.	X	78;78;96;78;78	.	ENSP00000262101:W78X	W	-	2	0	MSR1	16070735	0.644000	0.27277	0.989000	0.46669	0.188000	0.23474	0.855000	0.27805	1.263000	0.44181	0.650000	0.86243	TGG		0.388	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211627.2			27	56	27	56
PSD3	23362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	18490301	18490301	+	Silent	SNP	T	T	C			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr8:18490301T>C	ENST00000327040.8	-	11	2334	c.2232A>G	c.(2230-2232)aaA>aaG	p.K744K	PSD3_ENST00000440756.2_Silent_p.K746K|PSD3_ENST00000286485.8_Silent_p.K210K|PSD3_ENST00000523619.1_Silent_p.K679K|PSD3_ENST00000428502.2_Silent_p.K73K	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	745					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		GAGACTTTTTTTTCTCTTCAT	0.358																																																0													125.0	103.0	110.0					8																	18490301		2203	4300	6503	SO:0001819	synonymous_variant	23362			AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.2232A>G	8.37:g.18490301T>C		Somatic		WXS	Illumina GAIIx	Phase_I	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Silent	SNP	ENST00000327040.8	37	CCDS43720.1																																																																																				0.358	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1	NM_015310		21	25	21	25
TNFRSF10C	8794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	22969288	22969288	+	Missense_Mutation	SNP	T	T	C	rs569858474		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr8:22969288T>C	ENST00000356864.3	+	2	648	c.116T>C	c.(115-117)gTg>gCg	p.V39A	TNFRSF10C_ENST00000540813.1_Intron|TNFRSF10C_ENST00000520607.1_3'UTR	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain	39					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		CAGCAGACAGTGGCCCCACAG	0.507																																																0													82.0	69.0	73.0					8																	22969288		2203	4300	6503	SO:0001583	missense	8794			AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.116T>C	8.37:g.22969288T>C	ENSP00000349324:p.Val39Ala	Somatic		WXS	Illumina GAIIx	Phase_I	O14755|Q08AS6|Q6FH98|Q6UXM5	Missense_Mutation	SNP	ENST00000356864.3	37	CCDS6037.1	.	.	.	.	.	.	.	.	.	.	T	1.601	-0.526510	0.04141	.	.	ENSG00000173535	ENST00000356864;ENST00000544885	T	0.61510	0.1	1.63	-0.405	0.12392	.	3.247740	0.03328	U	0.192904	T	0.35711	0.0941	N	0.25890	0.77	0.09310	N	1	B	0.29862	0.259	B	0.19666	0.026	T	0.09930	-1.0652	10	0.06494	T	0.89	.	3.8876	0.09105	0.0:0.5201:0.0:0.4799	.	39	O14798	TR10C_HUMAN	A	39	ENSP00000349324:V39A	ENSP00000349324:V39A	V	+	2	0	TNFRSF10C	23025233	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.020000	0.12525	-0.133000	0.11537	-0.548000	0.04221	GTG		0.507	TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215134.3			30	59	30	59
ARSD	414	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	2836028	2836028	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chrX:2836028G>A	ENST00000381154.1	-	5	755	c.680C>T	c.(679-681)gCg>gTg	p.A227V	ARSD_ENST00000217890.6_5'UTR	NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D	227					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GACTGCTCTCGCGGAGACAGA	0.622																																																0													19.0	23.0	22.0					X																	2836028		2203	4300	6503	SO:0001583	missense	414			X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.680C>T	X.37:g.2836028G>A	ENSP00000370546:p.Ala227Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q9UHJ8	Missense_Mutation	SNP	ENST00000381154.1	37	CCDS35196.1	.	.	.	.	.	.	.	.	.	.	g	6.938	0.542850	0.13250	.	.	ENSG00000006756	ENST00000381154;ENST00000217890	D	0.93547	-3.24	3.47	0.53	0.17102	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.531871	0.16718	U	0.202361	D	0.84665	0.5522	L	0.27053	0.805	0.09310	N	1	P;B	0.38420	0.63;0.107	B;B	0.32805	0.153;0.069	T	0.74028	-0.3796	10	0.36615	T	0.2	.	7.9101	0.29785	0.0:0.6096:0.2989:0.0915	.	227;227	E9PAW5;P51689	.;ARSD_HUMAN	V	227	ENSP00000370546:A227V	ENSP00000217890:A227V	A	-	2	0	ARSD	2846028	0.752000	0.28338	0.000000	0.03702	0.002000	0.02628	1.798000	0.38814	-0.348000	0.08286	-1.853000	0.00566	GCG		0.622	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1			9	23	9	23
MAGEB2	4113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	30237647	30237647	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chrX:30237647C>T	ENST00000378988.4	+	2	1051	c.950C>T	c.(949-951)gCc>gTc	p.A317V		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	317										breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						GAAGAGAAAGCCGGAGTCTGA	0.498																																																0													35.0	39.0	38.0					X																	30237647		2201	4299	6500	SO:0001583	missense	4113			AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.950C>T	X.37:g.30237647C>T	ENSP00000368273:p.Ala317Val	Somatic		WXS	Illumina GAIIx	Phase_I	O75860	Missense_Mutation	SNP	ENST00000378988.4	37	CCDS14219.1	.	.	.	.	.	.	.	.	.	.	C	10.75	1.439431	0.25900	.	.	ENSG00000099399	ENST00000378988	T	0.01685	4.69	3.27	0.762	0.18454	.	0.976288	0.08383	N	0.954275	T	0.02494	0.0076	L	0.60012	1.86	0.09310	N	1	P	0.42735	0.788	B	0.37239	0.244	T	0.45366	-0.9266	10	0.66056	D	0.02	.	7.1447	0.25577	0.5096:0.4904:0.0:0.0	.	317	O15479	MAGB2_HUMAN	V	317	ENSP00000368273:A317V	ENSP00000368273:A317V	A	+	2	0	MAGEB2	30147568	0.001000	0.12720	0.002000	0.10522	0.001000	0.01503	-0.450000	0.06803	0.059000	0.16252	-0.568000	0.04159	GCC		0.498	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1	NM_002364		25	47	25	47
DDX26B	203522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	134715064	134715064	+	Missense_Mutation	SNP	G	G	A	rs143980255		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chrX:134715064G>A	ENST00000370752.4	+	16	2807	c.2473G>A	c.(2473-2475)Gca>Aca	p.A825T	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	825										large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					CAAGGAAGCCGCAAGGTAGGT	0.383																																																0								G	THR/ALA	1,3832		0,1,1631,569	34.0	32.0	33.0		2473	3.6	1.0	X	dbSNP_134	33	0,6728		0,0,2428,1872	no	missense	DDX26B	NM_182540.4	58	0,1,4059,2441	AA,AG,GG,G		0.0,0.0261,0.0095	possibly-damaging	825/862	134715064	1,10560	2201	4300	6501	SO:0001583	missense	203522			AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.2473G>A	X.37:g.134715064G>A	ENSP00000359788:p.Ala825Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Missense_Mutation	SNP	ENST00000370752.4	37	CCDS35401.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.630511	0.28978	2.61E-4	0.0	ENSG00000165359	ENST00000370752	T	0.33654	1.4	4.5	3.61	0.41365	.	0.098474	0.64402	D	0.000001	T	0.26122	0.0637	L	0.45137	1.4	0.42879	D	0.994164	P;B	0.51351	0.944;0.343	B;B	0.38755	0.281;0.052	T	0.05273	-1.0895	10	0.13853	T	0.58	-10.1692	12.5492	0.56218	0.0:0.0:0.8319:0.1681	.	825;825	B9EIK3;Q5JSJ4	.;DX26B_HUMAN	T	825	ENSP00000359788:A825T	ENSP00000359788:A825T	A	+	1	0	DDX26B	134542730	1.000000	0.71417	0.982000	0.44146	0.060000	0.15804	4.205000	0.58466	0.933000	0.37291	0.594000	0.82650	GCA		0.383	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058420.1	NM_182540		8	13	8	13
AVPR2	554	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	153172155	153172155	+	Silent	SNP	C	C	T			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chrX:153172155C>T	ENST00000358927.2	+	4	1298	c.1089C>T	c.(1087-1089)tcC>tcT	p.S363S	AVPR2_ENST00000370049.1_3'UTR|AVPR2_ENST00000337474.5_Silent_p.S363S|ARHGAP4_ENST00000467421.1_5'Flank			P30518	V2R_HUMAN	arginine vasopressin receptor 2	363					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|excretion (GO:0007588)|hemostasis (GO:0007599)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-gamma production (GO:0032609)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of systemic arterial blood pressure (GO:0003084)|response to cytokine (GO:0034097)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	vasopressin receptor activity (GO:0005000)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	26	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Desmopressin(DB00035)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	CCGCCAGCTCCTCCCTGGCCA	0.642																																																0													36.0	35.0	35.0					X																	153172155		2203	4300	6503	SO:0001819	synonymous_variant	554			Z11687	CCDS14735.1, CCDS55539.1	Xq28	2014-09-17	2008-08-01		ENSG00000126895	ENSG00000126895		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	897	protein-coding gene	gene with protein product	"""nephrogenic diabetes insipidus"""	300538		DIR3, DIR		1324225	Standard	NM_000054		Approved	V2R	uc004fjh.4	P30518	OTTHUMG00000024227	ENST00000358927.2:c.1089C>T	X.37:g.153172155C>T		Somatic		WXS	Illumina GAIIx	Phase_I	C5HF20|O43192|Q3MJD3|Q9UCV9	Silent	SNP	ENST00000358927.2	37	CCDS14735.1	.	.	.	.	.	.	.	.	.	.	c	17.40	3.379798	0.61845	.	.	ENSG00000126895	ENST00000430697	T	0.77620	-1.11	4.16	3.29	0.37713	.	.	.	.	.	D	0.82346	0.5017	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.82402	-0.0475	6	0.87932	D	0	-12.4993	10.4059	0.44256	0.0:0.8964:0.0:0.1036	.	.	.	.	L	334	ENSP00000393513:P334L	ENSP00000393513:P334L	P	+	2	0	AVPR2	152825349	1.000000	0.71417	0.997000	0.53966	0.688000	0.40055	1.714000	0.37961	0.698000	0.31739	0.418000	0.28097	CCT		0.642	AVPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061127.2			20	72	20	72
PKD1L2	114780	broad.mit.edu;ucsc.edu	37	16	81171126	81171126	+	RNA	SNP	C	C	T	rs371765077		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr16:81171126C>T	ENST00000534142.1	-	0	0				PKD1L2_ENST00000525539.1_RNA|PKD1L2_ENST00000533478.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						AAGAAAGCAGCGAATCCCAGC	0.577													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19490	0.0		0.0	False		,,,				2504	0.0															0								C	THR/ALA	0,4030		0,0,2015	61.0	63.0	63.0		5635	5.6	0.9	16		63	1,8367		0,1,4183	no	missense	PKD1L2	NM_052892.3	58	0,1,6198	TT,TC,CC		0.012,0.0,0.0081	probably-damaging	1879/2460	81171126	1,12397	2015	4184	6199			114780			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81171126C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	SNP	ENST00000534142.1	37																																																																																					0.577	PKD1L2-009	PUTATIVE	basic|exp_conf	processed_transcript	polymorphic_pseudogene	OTTHUMT00000387969.1			7	10	7	10
MED14	9282	broad.mit.edu;ucsc.edu	37	X	40518771	40518771	+	Missense_Mutation	SNP	T	T	C			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chrX:40518771T>C	ENST00000324817.1	-	27	3891	c.3773A>G	c.(3772-3774)aAc>aGc	p.N1258S		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	1258					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AAGCGTTTGGTTGGTTTTGGG	0.398																																																0													196.0	170.0	179.0					X																	40518771		2203	4300	6503	SO:0001583	missense	9282			AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.3773A>G	X.37:g.40518771T>C	ENSP00000323720:p.Asn1258Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	37	CCDS14254.1	.	.	.	.	.	.	.	.	.	.	T	15.15	2.747865	0.49257	.	.	ENSG00000180182	ENST00000324817;ENST00000433003	T;T	0.53640	0.61;0.61	5.37	5.37	0.77165	.	0.044715	0.85682	D	0.000000	T	0.25005	0.0607	N	0.03608	-0.345	0.49299	D	0.999779	B;B	0.28470	0.213;0.213	B;B	0.23852	0.049;0.049	T	0.11518	-1.0584	10	0.23302	T	0.38	.	14.4515	0.67389	0.0:0.0:0.0:1.0	.	1258;1258	A8KAK5;O60244	.;MED14_HUMAN	S	1258;157	ENSP00000323720:N1258S;ENSP00000411357:N157S	ENSP00000323720:N1258S	N	-	2	0	MED14	40403715	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.763000	0.68818	1.792000	0.52537	0.486000	0.48141	AAC		0.398	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1	NM_004229		37	63	37	63
PCDHGC5	56097	broad.mit.edu;ucsc.edu	37	5	140869027	140869027	+	Missense_Mutation	SNP	T	T	C			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr5:140869027T>C	ENST00000252087.1	+	1	220	c.220T>C	c.(220-222)Tat>Cat	p.Y74H	PCDHGA12_ENST00000252085.3_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	74	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAATGGGCGCTATTTTTCCCT	0.562																																																0													94.0	97.0	96.0					5																	140869027		2203	4300	6503	SO:0001583	missense	56097			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.220T>C	5.37:g.140869027T>C	ENSP00000252087:p.Tyr74His	Somatic		WXS	Illumina GAIIx	Phase_I	Q9Y5C2	Missense_Mutation	SNP	ENST00000252087.1	37	CCDS4263.1	.	.	.	.	.	.	.	.	.	.	T	7.429	0.638343	0.14386	.	.	ENSG00000240764	ENST00000252087	T	0.30182	1.54	5.53	4.35	0.52113	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	0.158118	0.30043	N	0.010556	T	0.39436	0.1078	M	0.70787	2.145	0.32703	N	0.512577	P;P	0.41008	0.661;0.735	B;P	0.48598	0.338;0.583	T	0.51849	-0.8653	10	0.37606	T	0.19	.	7.0692	0.25169	0.1335:0.0732:0.0:0.7932	.	74;74	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	H	74	ENSP00000252087:Y74H	ENSP00000252087:Y74H	Y	+	1	0	PCDHGC5	140849211	1.000000	0.71417	0.998000	0.56505	0.039000	0.13416	3.398000	0.52579	0.898000	0.36418	-0.333000	0.08304	TAT		0.562	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929		57	58	57	58
GBP1P1	400759	broad.mit.edu;ucsc.edu	37	1	89889882	89889882	+	RNA	SNP	A	A	G			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr1:89889882A>G	ENST00000513638.1	+	0	623					NR_003133.2				guanylate binding protein 1, interferon-inducible pseudogene 1																		GCAAAGAAAGAATGAGCAGAT	0.453																																																0																																												400759					1p22.2	2011-03-09			ENSG00000225492	ENSG00000225492			39561	pseudogene	pseudogene							Standard	NR_003133		Approved		uc009wcy.1		OTTHUMG00000010128		1.37:g.89889882A>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000513638.1	37																																																																																					0.453	GBP1P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000360073.1	NR_003133		166	343	166	343
MYH8	4626	broad.mit.edu;ucsc.edu	37	17	10318643	10318643	+	Missense_Mutation	SNP	G	G	C			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr17:10318643G>C	ENST00000403437.2	-	8	801	c.707C>G	c.(706-708)gCc>gGc	p.A236G	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	236	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CACAGTTTTGGCATTGCCAAA	0.483									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																							0													134.0	137.0	136.0					17																	10318643		2203	4300	6503	SO:0001583	missense	4626	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.707C>G	17.37:g.10318643G>C	ENSP00000384330:p.Ala236Gly	Somatic		WXS	Illumina GAIIx	Phase_I	Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.441942	0.83993	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.83992	-1.79	4.44	4.44	0.53790	Myosin head, motor domain (3);	0.000000	0.41396	U	0.000883	D	0.93180	0.7828	H	0.97611	4.04	0.80722	D	1	B	0.29646	0.253	P	0.46850	0.529	D	0.94446	0.7663	10	0.87932	D	0	.	17.2389	0.87007	0.0:0.0:1.0:0.0	.	236	P13535	MYH8_HUMAN	G	236	ENSP00000384330:A236G	ENSP00000252173:A236G	A	-	2	0	MYH8	10259368	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.488000	0.97947	2.308000	0.77769	0.591000	0.81541	GCC		0.483	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		59	122	59	122
PKD1L2	114780	broad.mit.edu;ucsc.edu	37	16	81155301	81155301	+	RNA	SNP	C	C	T	rs543579504		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr16:81155301C>T	ENST00000534142.1	-	0	889				PKD1L2_ENST00000525539.1_RNA|PKD1L2_ENST00000533478.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						TGCAGGGCCGCGTGCGTAAAA	0.597													c|||	1	0.000199681	0.0	0.0	5008	,	,		18038	0.0		0.0	False		,,,				2504	0.001															0													47.0	59.0	55.0					16																	81155301		2025	4155	6180			114780			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81155301C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	SNP	ENST00000534142.1	37																																																																																					0.597	PKD1L2-009	PUTATIVE	basic|exp_conf	processed_transcript	polymorphic_pseudogene	OTTHUMT00000387969.1			4	13	4	13
PPIP5K2	23262	broad.mit.edu;ucsc.edu	37	5	102513667	102513667	+	Missense_Mutation	SNP	C	C	G			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr5:102513667C>G	ENST00000358359.3	+	23	3249	c.2740C>G	c.(2740-2742)Cca>Gca	p.P914A	PPIP5K2_ENST00000414217.1_Missense_Mutation_p.P914A|PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000321521.9_Missense_Mutation_p.P914A	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	914					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TGGATATAGACCAGCTTCCAG	0.378																																																0													78.0	77.0	78.0					5																	102513667		2201	4297	6498	SO:0001583	missense	23262			AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.2740C>G	5.37:g.102513667C>G	ENSP00000351126:p.Pro914Ala	Somatic		WXS	Illumina GAIIx	Phase_I	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	37		.	.	.	.	.	.	.	.	.	.	C	26.9	4.785625	0.90282	.	.	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217;ENST00000509597	T;T;T;T	0.26660	2.44;2.44;2.44;1.72	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000001	T	0.50411	0.1614	M	0.77486	2.375	0.80722	D	1	B;P;D	0.55172	0.023;0.938;0.97	B;P;P	0.56700	0.073;0.804;0.77	T	0.51301	-0.8723	10	0.72032	D	0.01	.	20.1338	0.98010	0.0:1.0:0.0:0.0	.	929;914;914	E9PGM8;O43314-2;O43314	.;.;VIP2_HUMAN	A	914;914;929;914;188	ENSP00000313070:P914A;ENSP00000351126:P914A;ENSP00000416016:P914A;ENSP00000424948:P188A	ENSP00000313070:P914A	P	+	1	0	PPIP5K2	102541566	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.768000	0.85345	2.770000	0.95276	0.655000	0.94253	CCA		0.378	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216		23	82	23	82
HSPA8	3312	broad.mit.edu;ucsc.edu	37	11	122928498	122928498	+	Missense_Mutation	SNP	C	C	G			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr11:122928498C>G	ENST00000532636.1	-	9	2004	c.1885G>C	c.(1885-1887)Gga>Cga	p.G629R	SNORD14E_ENST00000364009.1_RNA|HSPA8_ENST00000526110.1_Missense_Mutation_p.G610R|HSPA8_ENST00000533540.1_Missense_Mutation_p.G483R|HSPA8_ENST00000526862.1_5'Flank|HSPA8_ENST00000534624.1_Missense_Mutation_p.G629R|HSPA8_ENST00000227378.3_Missense_Mutation_p.G629R|HSPA8_ENST00000453788.2_Missense_Mutation_p.G476R|SNORD14C_ENST00000365382.1_RNA|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000534319.1_Missense_Mutation_p.G393R			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	629					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GGAGGAGCTCCACCACCAGGA	0.512																																					Colon(21;486 594 5900 6733 14272)											0													101.0	106.0	104.0					11																	122928498		2202	4299	6501	SO:0001583	missense	3312			Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.1885G>C	11.37:g.122928498C>G	ENSP00000437125:p.Gly629Arg	Somatic		WXS	Illumina GAIIx	Phase_I	Q9H3R6	Missense_Mutation	SNP	ENST00000532636.1	37	CCDS8440.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.666600	0.88251	.	.	ENSG00000109971	ENST00000532636;ENST00000533540;ENST00000534624;ENST00000453788;ENST00000227378;ENST00000534319;ENST00000526110;ENST00000524552	T;T;T;T;T;T;T;T	0.03889	5.32;4.74;5.32;4.63;5.32;4.33;5.34;3.77	4.65	4.65	0.58169	.	0.065683	0.64402	D	0.000019	T	0.26702	0.0653	M	0.86805	2.84	0.80722	D	1	D;D;D	0.69078	0.994;0.997;0.994	D;D;D	0.77557	0.953;0.979;0.99	T	0.11397	-1.0589	10	0.66056	D	0.02	-14.1654	17.8802	0.88838	0.0:1.0:0.0:0.0	.	629;476;629	Q53GZ6;P11142-2;P11142	.;.;HSP7C_HUMAN	R	629;483;629;476;629;393;610;220	ENSP00000437125:G629R;ENSP00000437189:G483R;ENSP00000432083:G629R;ENSP00000404372:G476R;ENSP00000227378:G629R;ENSP00000433316:G393R;ENSP00000433584:G610R;ENSP00000435908:G220R	ENSP00000227378:G629R	G	-	1	0	HSPA8	122433708	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.122000	0.77169	2.285000	0.76669	0.561000	0.74099	GGA		0.512	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387515.1			51	101	51	101
GPR124	25960	broad.mit.edu;ucsc.edu	37	8	37686441	37686441	+	Missense_Mutation	SNP	C	C	T	rs567572116		TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr8:37686441C>T	ENST00000412232.2	+	3	387	c.374C>T	c.(373-375)cCg>cTg	p.P125L	GPR124_ENST00000315215.7_Missense_Mutation_p.P125L	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	125					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			ACAGTGCAGCCGGGCGCCTTC	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		10191	0.0		0.0	False		,,,				2504	0.001															0													64.0	62.0	62.0					8																	37686441		2203	4300	6503	SO:0001583	missense	25960			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.374C>T	8.37:g.37686441C>T	ENSP00000406367:p.Pro125Leu	Somatic		WXS	Illumina GAIIx	Phase_I	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	C	21.6	4.172690	0.78452	.	.	ENSG00000020181	ENST00000428068;ENST00000416514;ENST00000315215;ENST00000412232	T;T;T	0.60424	0.19;0.19;0.19	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.79015	0.4375	M	0.87617	2.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81640	-0.0841	10	0.66056	D	0.02	-15.5061	14.7945	0.69868	0.1434:0.8566:0.0:0.0	.	125;125	Q96PE1-2;Q96PE1	.;GP124_HUMAN	L	83;118;125;125	ENSP00000400860:P83L;ENSP00000323508:P125L;ENSP00000406367:P125L	ENSP00000323508:P125L	P	+	2	0	GPR124	37805599	1.000000	0.71417	0.964000	0.40570	0.532000	0.34746	6.533000	0.73829	2.771000	0.95319	0.561000	0.74099	CCG		0.682	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2			40	70	40	70
PWWP2A	114825	broad.mit.edu;hgsc.bcm.edu	37	5	159546021	159546022	+	Frame_Shift_Ins	INS	-	-	G			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr5:159546021_159546022insG	ENST00000307063.7	-	1	408_409	c.374_375insC	c.(373-375)ccgfs	p.P125fs	PWWP2A_ENST00000523662.1_Frame_Shift_Ins_p.P125fs|PWWP2A_ENST00000456329.3_Frame_Shift_Ins_p.P125fs	NM_001130864.1	NP_001124336.1	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A	125	Pro-rich.									kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCTCGGGAGCCGGGGGCTGCTC	0.748																																																0																																										SO:0001589	frameshift_variant	114825				CCDS47331.1, CCDS47332.1, CCDS58990.1	5q33.3	2011-03-23			ENSG00000170234	ENSG00000170234			29406	protein-coding gene	gene with protein product							Standard	NM_052927		Approved	KIAA1935	uc011ded.2	Q96N64	OTTHUMG00000163546	ENST00000307063.7:c.375dupC	5.37:g.159546026_159546026dupG	ENSP00000305151:p.Pro125fs	Somatic		WXS	Illumina GAIIx	Phase_I	G5EA07|Q2HJJ2|Q8IYR3|Q96PV3	Frame_Shift_Ins	INS	ENST00000307063.7	37	CCDS47332.1																																																																																				0.748	PWWP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374092.1			14	36	14	36
NF1	4763	broad.mit.edu;hgsc.bcm.edu	37	17	29483060	29483064	+	Frame_Shift_Del	DEL	GGAAT	GGAAT	-			TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr17:29483060_29483064delGGAAT	ENST00000358273.4	+	2	503_507	c.120_124delGGAAT	c.(118-126)aaggaatgtfs	p.EC41fs	NF1_ENST00000356175.3_Frame_Shift_Del_p.EC41fs|NF1_ENST00000431387.4_Frame_Shift_Del_p.EC41fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	41					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AGCACAACAAGGAATGTCTAATCAA	0.332			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)																																								SO:0001589	frameshift_variant	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.120_124delGGAAT	17.37:g.29483060_29483064delGGAAT	ENSP00000351015:p.Glu41fs	Somatic		WXS	Illumina GAIIx	Phase_I	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	CCDS42292.1																																																																																				0.332	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		13	32	13	32
KANSL1	284058	broad.mit.edu;hgsc.bcm.edu	37	17	44110778	44110780	+	In_Frame_Del	DEL	CTC	CTC	-	rs551968687	byFrequency	TCGA-HT-7860-01A-11D-2395-08	TCGA-HT-7860-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9a21c24-8e23-47d9-addd-e601b3f2e2c9	b10e61aa-2481-454d-bcfd-308c8fbc82bc	g.chr17:44110778_44110780delCTC	ENST00000262419.6	-	12	3183_3185	c.2713_2715delGAG	c.(2713-2715)gagdel	p.E905del	RP11-669E14.6_ENST00000570454.1_RNA|KANSL1_ENST00000393476.3_In_Frame_Del_p.E199del|KANSL1_ENST00000574590.1_In_Frame_Del_p.E905del|KANSL1_ENST00000432791.1_In_Frame_Del_p.E905del|KANSL1_ENST00000575318.1_In_Frame_Del_p.E841del|KANSL1_ENST00000572904.1_In_Frame_Del_p.E905del	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	905	Sufficient for interaction with KAT8.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CCTCTTCATTCTCCTCATCAGGA	0.483														10	0.00199681	0.0076	0.0	5008	,	,		22321	0.0		0.0	False		,,,				2504	0.0															0									,,	13,4251		0,13,2119					,,	5.7	1.0			66	0,8254		0,0,4127	no	coding,coding,coding	KIAA1267	NM_015443.3,NM_001193466.1,NM_001193465.1	,,	0,13,6246	A1A1,A1R,RR		0.0,0.3049,0.1039	,,	,,		13,12505				SO:0001651	inframe_deletion	284058			BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.2713_2715delGAG	17.37:g.44110781_44110783delCTC	ENSP00000262419:p.Glu905del	Somatic		WXS	Illumina GAIIx	Phase_I	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	In_Frame_Del	DEL	ENST00000262419.6	37	CCDS11503.1																																																																																				0.483	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443		19	68	19	68
