#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
ANK3	288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	61835813	61835813	+	Missense_Mutation	SNP	G	G	A	rs148024054	byFrequency	TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr10:61835813G>A	ENST00000280772.2	-	37	5017	c.4826C>T	c.(4825-4827)aCg>aTg	p.T1609M	ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1609	Ser-rich.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTTTAAGGGCGTAGCTTCCGT	0.473													G|||	6	0.00119808	0.0038	0.0	5008	,	,		19100	0.0		0.0	False		,,,				2504	0.001															0								G	,,,MET/THR	6,4400	11.4+/-27.6	0,6,2197	112.0	109.0	110.0		,,,4826	2.7	0.1	10	dbSNP_134	110	1,8599	1.2+/-3.3	0,1,4299	yes	intron,intron,intron,missense	ANK3	NM_001149.3,NM_001204403.1,NM_001204404.1,NM_020987.3	,,,81	0,7,6496	AA,AG,GG		0.0116,0.1362,0.0538	,,,probably-damaging	,,,1609/4378	61835813	7,12999	2203	4300	6503	SO:0001583	missense	288			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.4826C>T	10.37:g.61835813G>A	ENSP00000280772:p.Thr1609Met	Somatic		WXS	Illumina GAIIx	Phase_I	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	6.778	0.512395	0.12944	0.001362	1.16E-4	ENSG00000151150	ENST00000280772	T	0.64085	-0.08	5.79	2.69	0.31865	.	1.215670	0.06388	N	0.716462	T	0.57257	0.2041	L	0.44542	1.39	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.49670	-0.8915	10	0.59425	D	0.04	.	11.1778	0.48610	0.204:0.0:0.796:0.0	.	1609	Q12955	ANK3_HUMAN	M	1609	ENSP00000280772:T1609M	ENSP00000280772:T1609M	T	-	2	0	ANK3	61505819	0.995000	0.38212	0.059000	0.19551	0.962000	0.63368	3.181000	0.50903	0.281000	0.22233	0.591000	0.81541	ACG		0.473	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987		54	24	54	24
HBD	3045	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	5255603	5255603	+	Missense_Mutation	SNP	C	C	T	rs369305779	byFrequency	TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr11:5255603C>T	ENST00000380299.3	-	1	275	c.61G>A	c.(61-63)Gtg>Atg	p.V21M	HBD_ENST00000292901.3_Missense_Mutation_p.V21M	NM_000519.3	NP_000510.1	P02042	HBD_HUMAN	hemoglobin, delta	21			V -> E (in Roosevelt; dbSNP:rs34093840). {ECO:0000269|PubMed:952968}.		blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	16		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACTGCATCCACGTTCACTTTG	0.507													C|||	8	0.00159744	0.0	0.0	5008	,	,		22904	0.0		0.0	False		,,,				2504	0.0082															0								C	MET/VAL	0,4402		0,0,2201	177.0	150.0	159.0		61	2.7	0.0	11		159	1,8595	1.2+/-3.3	0,1,4297	no	missense	HBD	NM_000519.3	21	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	21/148	5255603	1,12997	2201	4298	6499	SO:0001583	missense	3045			AY034468	CCDS31376.1	11p15.5	2012-10-02			ENSG00000223609	ENSG00000223609			4829	protein-coding gene	gene with protein product		142000				2649166	Standard	NM_000519		Approved		uc001maf.1	P02042	OTTHUMG00000066674	ENST00000380299.3:c.61G>A	11.37:g.5255603C>T	ENSP00000369654:p.Val21Met	Somatic		WXS	Illumina GAIIx	Phase_I	Q3Y5H3|Q8WXT7	Missense_Mutation	SNP	ENST00000380299.3	37	CCDS31376.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.994853	0.35226	0.0	1.16E-4	ENSG00000223609	ENST00000292901;ENST00000380299;ENST00000417377;ENST00000429817	D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46	4.61	2.68	0.31781	Globin-like (1);Globin, structural domain (1);	0.538297	0.19269	N	0.118464	D	0.84179	0.5415	M	0.77313	2.365	0.09310	N	1	P	0.44776	0.843	B	0.31337	0.128	T	0.77895	-0.2417	10	0.87932	D	0	5.7425	6.6476	0.22945	0.3204:0.5958:0.0:0.0839	.	21	P02042	HBD_HUMAN	M	21	ENSP00000292901:V21M;ENSP00000369654:V21M;ENSP00000414741:V21M;ENSP00000393810:V21M	ENSP00000292901:V21M	V	-	1	0	HBD	5212179	0.000000	0.05858	0.001000	0.08648	0.113000	0.19764	0.033000	0.13754	0.627000	0.30340	0.591000	0.81541	GTG		0.507	HBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142970.1	NM_000519		24	42	24	42
OR5M1	390168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	56380663	56380663	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr11:56380663C>T	ENST00000526538.1	-	1	315	c.316G>A	c.(316-318)Gcc>Acc	p.A106T		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	106						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A106T(2)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						ATCACCAGGGCGATGAAGAGA	0.448																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)											175.0	160.0	165.0					11																	56380663		1987	4163	6150	SO:0001583	missense	390168			AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.316G>A	11.37:g.56380663C>T	ENSP00000435416:p.Ala106Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IF60|Q96RB6	Missense_Mutation	SNP	ENST00000526538.1	37	CCDS53631.1	.	.	.	.	.	.	.	.	.	.	C	6.124	0.391105	0.11581	.	.	ENSG00000255012	ENST00000526538	T	0.02140	4.43	3.71	0.674	0.17946	GPCR, rhodopsin-like superfamily (1);	0.403660	0.18179	N	0.149211	T	0.01592	0.0051	N	0.20530	0.585	0.09310	N	1	B	0.19073	0.033	B	0.15052	0.012	T	0.48068	-0.9067	10	0.25751	T	0.34	-20.489	7.8354	0.29368	0.0:0.6151:0.0:0.3849	.	106	Q8NGP8	OR5M1_HUMAN	T	106	ENSP00000435416:A106T	ENSP00000435416:A106T	A	-	1	0	OR5M1	56137239	0.000000	0.05858	0.994000	0.49952	0.854000	0.48673	-2.965000	0.00670	0.293000	0.22520	0.280000	0.19369	GCC		0.448	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391610.1	NM_001004740		20	32	20	32
TUBA3C	7278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	19752430	19752430	+	Missense_Mutation	SNP	C	C	T	rs140107190		TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr13:19752430C>T	ENST00000400113.3	-	3	435	c.331G>A	c.(331-333)Ggc>Agc	p.G111S		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	111					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.G111S(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		ATCTCCTTGCCGATGGTGTAA	0.542																																																1	Substitution - Missense(1)	prostate(1)						C	SER/GLY	2,4404	4.2+/-10.8	0,2,2201	221.0	188.0	199.0		331	1.5	1.0	13	dbSNP_134	199	0,8600		0,0,4300	no	missense	TUBA3C	NM_006001.2	56	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	111/451	19752430	2,13004	2203	4300	6503	SO:0001583	missense	7278			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.331G>A	13.37:g.19752430C>T	ENSP00000382982:p.Gly111Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	ENST00000400113.3	37	CCDS9284.1	.	.	.	.	.	.	.	.	.	.	c	15.92	2.974183	0.53720	4.54E-4	0.0	ENSG00000198033	ENST00000400113;ENST00000360801	T	0.75050	-0.9	1.53	1.53	0.23141	.	0.000000	0.48286	U	0.000197	T	0.77909	0.4201	.	.	.	0.46927	D	0.999252	.	.	.	.	.	.	T	0.78991	-0.1985	7	0.87932	D	0	.	9.0464	0.36349	0.0:1.0:0.0:0.0	.	.	.	.	S	111	ENSP00000382982:G111S	ENSP00000354037:G111S	G	-	1	0	TUBA3C	18650430	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.331000	0.72929	1.161000	0.42604	0.423000	0.28283	GGC		0.542	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001		51	94	51	94
OR4N2	390429	hgsc.bcm.edu;ucsc.edu	37	14	20295845	20295845	+	Missense_Mutation	SNP	C	C	T	rs201593869		TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr14:20295845C>T	ENST00000315947.1	+	1	238	c.238C>T	c.(238-240)Cgg>Tgg	p.R80W	OR4N2_ENST00000568211.1_Missense_Mutation_p.R80W	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGTGGCTCCCCGGATGTTGGT	0.517																																																0								C	TRP/ARG	0,4406		0,0,2203	148.0	172.0	164.0		238	3.2	1.0	14		164	1,8599		0,1,4299	no	missense	OR4N2	NM_001004723.1	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	80/308	20295845	1,13005	2203	4300	6503	SO:0001583	missense	390429				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.238C>T	14.37:g.20295845C>T	ENSP00000319601:p.Arg80Trp	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	ENST00000315947.1	37	CCDS32022.1	.	.	.	.	.	.	.	.	.	.	.	15.38	2.815239	0.50527	0.0	1.16E-4	ENSG00000176294	ENST00000557677;ENST00000315947	T;T	0.00417	7.5;7.5	4.3	3.15	0.36227	GPCR, rhodopsin-like superfamily (1);	0.116446	0.39146	N	0.001448	T	0.00998	0.0033	M	0.85777	2.775	0.25506	N	0.987507	D	0.69078	0.997	P	0.61132	0.884	T	0.29671	-1.0004	10	0.87932	D	0	-11.9333	9.4066	0.38466	0.8174:0.1826:0.0:0.0	.	80	Q8NGD1	OR4N2_HUMAN	W	80	ENSP00000452022:R80W;ENSP00000319601:R80W	ENSP00000319601:R80W	R	+	1	2	OR4N2	19365685	0.015000	0.18098	1.000000	0.80357	0.931000	0.56810	2.707000	0.47143	0.788000	0.33755	-0.335000	0.08231	CGG		0.517	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409821.2			80	205	80	205
TMEM229B	161145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	67940541	67940541	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr14:67940541C>T	ENST00000557006.1	-	4	382	c.100G>A	c.(100-102)Gtg>Atg	p.V34M	TMEM229B_ENST00000357461.2_Missense_Mutation_p.V34M			Q8NBD8	T229B_HUMAN	transmembrane protein 229B	34						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5						AAGTTCACCACGAACTCCCAG	0.617																																																0													52.0	32.0	38.0					14																	67940541		2203	4300	6503	SO:0001583	missense	161145			AK090706	CCDS9783.1	14q23.3-q24.1	2009-09-22	2009-09-22	2009-09-22	ENSG00000198133	ENSG00000198133			20130	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 83"""	C14orf83			Standard	NM_182526		Approved	FLJ33387	uc001xjk.3	Q8NBD8		ENST00000557006.1:c.100G>A	14.37:g.67940541C>T	ENSP00000451774:p.Val34Met	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000557006.1	37	CCDS9783.1	.	.	.	.	.	.	.	.	.	.	c	21.5	4.162251	0.78226	.	.	ENSG00000198133	ENST00000557006;ENST00000357461;ENST00000554278;ENST00000554480;ENST00000555994;ENST00000557779	.	.	.	4.8	3.91	0.45181	.	0.060032	0.64402	D	0.000003	T	0.73560	0.3602	M	0.66939	2.045	0.58432	D	0.999998	D	0.71674	0.998	D	0.63033	0.91	T	0.74777	-0.3550	9	0.51188	T	0.08	-22.5971	12.8299	0.57740	0.0:0.9205:0.0:0.0795	.	34	Q8NBD8	T229B_HUMAN	M	34	.	ENSP00000350050:V34M	V	-	1	0	TMEM229B	67010294	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.917000	0.69989	1.029000	0.39812	0.450000	0.29827	GTG		0.617	TMEM229B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412718.2	NM_182526		13	14	13	14
LTBP2	4053	hgsc.bcm.edu;broad.mit.edu	37	14	75022287	75022287	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr14:75022287C>T	ENST00000261978.4	-	4	1326	c.940G>A	c.(940-942)Gcc>Acc	p.A314T	LTBP2_ENST00000556690.1_Missense_Mutation_p.A314T|CTD-2207P18.1_ENST00000554552.1_lincRNA|LTBP2_ENST00000557425.1_Intron	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	314					protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GGGGGCAGGGCGTTGGAAGAG	0.652																																																0													78.0	70.0	72.0					14																	75022287		2203	4300	6503	SO:0001583	missense	4053				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.940G>A	14.37:g.75022287C>T	ENSP00000261978:p.Ala314Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	37	CCDS9831.1	.	.	.	.	.	.	.	.	.	.	C	9.076	0.998015	0.19043	.	.	ENSG00000119681	ENST00000261978;ENST00000556690	T;T	0.78924	-1.22;-1.22	4.98	4.08	0.47627	.	0.197004	0.24750	U	0.035905	T	0.60894	0.2304	L	0.36672	1.1	0.33502	D	0.590038	D	0.58620	0.983	B	0.37239	0.244	T	0.66416	-0.5929	10	0.16420	T	0.52	.	9.2179	0.37360	0.0:0.774:0.1465:0.0795	.	314	Q14767	LTBP2_HUMAN	T	314	ENSP00000261978:A314T;ENSP00000451477:A314T	ENSP00000261978:A314T	A	-	1	0	LTBP2	74092040	0.996000	0.38824	0.996000	0.52242	0.021000	0.10359	2.647000	0.46639	1.278000	0.44430	-0.492000	0.04666	GCC		0.652	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428		10	113	10	113
ESRRB	2103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	76905888	76905888	+	Silent	SNP	C	C	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr14:76905888C>T	ENST00000509242.1	+	3	290	c.192C>T	c.(190-192)ggC>ggT	p.G64G	ESRRB_ENST00000507951.1_3'UTR|ESRRB_ENST00000380887.2_Silent_p.G64G|ESRRB_ENST00000556177.1_Silent_p.G64G|ESRRB_ENST00000261532.7_Silent_p.G64G	NM_004452.3	NP_004443.3	O95718	ERR2_HUMAN	estrogen-related receptor beta	64					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|trophectodermal cell proliferation (GO:0001834)|trophectodermal cellular morphogenesis (GO:0001831)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(234;0.0213)		TGTTTGCAGGCGCCGGGCTGG	0.677																																																0													38.0	37.0	37.0					14																	76905888		2203	4299	6502	SO:0001819	synonymous_variant	2103			X51417	CCDS9850.1, CCDS9850.2	14q24.3	2013-01-16				ENSG00000119715		"""Nuclear hormone receptors"""	3473	protein-coding gene	gene with protein product		602167	"""deafness, autosomal recessive 35"""	ESRL2, DFNB35		3267207, 9344655, 18179891	Standard	NM_004452		Approved	ERR2, ERRbeta, NR3B2, ERRb	uc001xsr.3	O95718		ENST00000509242.1:c.192C>T	14.37:g.76905888C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A2VDJ2|B6ZGU4|Q5F0P7|Q5F0P8|Q9HCB4	Silent	SNP	ENST00000509242.1	37	CCDS9850.2																																																																																				0.677	ESRRB-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360663.1			20	65	20	65
HS3ST6	64711	hgsc.bcm.edu;broad.mit.edu	37	16	1962140	1962140	+	Silent	SNP	C	C	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr16:1962140C>T	ENST00000293937.3	-	2	479	c.480G>A	c.(478-480)acG>acA	p.T160T	HS3ST6_ENST00000454677.2_Silent_p.T177T|HS3ST6_ENST00000443547.1_Silent_p.T129T			Q96QI5	HS3S6_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 6	160					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			endometrium(2)|lung(2)	4						GGGCCTCTCGCGTCACGAAGT	0.672																																																0													15.0	18.0	17.0					16																	1962140		2193	4295	6488	SO:0001819	synonymous_variant	64711					16p13.3	2008-10-30	2003-06-11	2003-06-13	ENSG00000162040	ENSG00000162040		"""Sulfotransferases, membrane-bound"""	14178	protein-coding gene	gene with protein product			"""heparan sulfate (glucosamine) 3-O-sulfotransferase 5"""	HS3ST5		11157797	Standard	NM_001009606		Approved		uc002cnf.3	Q96QI5	OTTHUMG00000047860	ENST00000293937.3:c.480G>A	16.37:g.1962140C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q96RX7	Silent	SNP	ENST00000293937.3	37																																																																																					0.672	HS3ST6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001009606		17	23	17	23
NFAT5	10725	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	69689703	69689703	+	Splice_Site	SNP	G	G	A			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr16:69689703G>A	ENST00000354436.2	+	5	1460		c.e5+1		NFAT5_ENST00000567239.1_Splice_Site|NFAT5_ENST00000349945.1_Splice_Site|NFAT5_ENST00000432919.1_Splice_Site|NFAT5_ENST00000566899.1_Splice_Site|NFAT5_ENST00000393742.2_Splice_Site	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive						cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						TGACACTGGCGTAAGTACTTA	0.353																																																0													83.0	79.0	80.0					16																	69689703		2198	4300	6498	SO:0001630	splice_region_variant	10725			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.1142+1G>A	16.37:g.69689703G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Splice_Site	SNP	ENST00000354436.2	37	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765524	0.90020	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5696	0.95406	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NFAT5	68247204	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.763000	0.98947	2.638000	0.89438	0.467000	0.42956	.		0.353	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714	Intron	17	27	17	27
TMEM99	147184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	38991040	38991040	+	Nonsense_Mutation	SNP	T	T	A			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr17:38991040T>A	ENST00000301665.3	+	3	576	c.272T>A	c.(271-273)tTg>tAg	p.L91*		NM_001195386.1|NM_001195387.1|NM_145274.3	NP_001182315.1|NP_001182316.1|NP_660317.2	Q8N816	TMM99_HUMAN	transmembrane protein 99	91						integral component of membrane (GO:0016021)				cervix(1)|large_intestine(1)|lung(5)|skin(2)|urinary_tract(1)	10		Breast(137;0.000301)				GGTCATCGGTTGAGAGAAGGA	0.458																																																0													215.0	213.0	214.0					17																	38991040		1933	4144	6077	SO:0001587	stop_gained	147184			AK097454	CCDS42319.1	17q21.2	2008-11-06			ENSG00000167920	ENSG00000167920			28305	protein-coding gene	gene with protein product						12477932	Standard	NM_001195386		Approved	MGC21518	uc021txc.1	Q8N816	OTTHUMG00000133579	ENST00000301665.3:c.272T>A	17.37:g.38991040T>A	ENSP00000301665:p.Leu91*	Somatic		WXS	Illumina GAIIx	Phase_I	B4DQ34|Q96BP9	Nonsense_Mutation	SNP	ENST00000301665.3	37	CCDS42319.1	.	.	.	.	.	.	.	.	.	.	T	11.22	1.574069	0.28092	.	.	ENSG00000167920	ENST00000436612;ENST00000301665	.	.	.	0.235	0.235	0.15431	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	91	.	ENSP00000301665:L91X	L	+	2	0	TMEM99	36244566	0.014000	0.17966	0.028000	0.17463	0.029000	0.11900	0.286000	0.18902	0.263000	0.21812	0.260000	0.18958	TTG		0.458	TMEM99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257681.1	NM_145274		79	100	79	100
ACE	1636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	61557154	61557154	+	Missense_Mutation	SNP	C	C	T	rs374910265		TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr17:61557154C>T	ENST00000290866.4	+	4	560	c.536C>T	c.(535-537)tCg>tTg	p.S179L	ACE_ENST00000584529.1_3'UTR|ACE_ENST00000428043.1_Missense_Mutation_p.S179L|ACE_ENST00000538928.1_Missense_Mutation_p.S179L	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	179	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	CTGGCTTCCTCGCGAAGCTAC	0.602																																																0								C	LEU/SER	0,4406		0,0,2203	122.0	87.0	99.0		536	3.9	0.1	17		99	1,8599	2.2+/-6.3	0,1,4299	no	missense	ACE	NM_000789.3	145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	179/1307	61557154	1,13005	2203	4300	6503	SO:0001583	missense	1636			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.536C>T	17.37:g.61557154C>T	ENSP00000290866:p.Ser179Leu	Somatic		WXS	Illumina GAIIx	Phase_I	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	37	CCDS11637.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.997283	0.93167	0.0	1.16E-4	ENSG00000159640	ENST00000538928;ENST00000290866;ENST00000428043	T;T;T	0.47869	0.83;0.83;0.83	3.88	3.88	0.44766	.	0.088369	0.53938	N	0.000043	T	0.78654	0.4317	H	0.97103	3.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.99;0.993	D	0.87222	0.2254	10	0.87932	D	0	-2.0513	16.0326	0.80588	0.0:1.0:0.0:0.0	.	179;179	F5H1K1;P12821	.;ACE_HUMAN	L	179	ENSP00000439591:S179L;ENSP00000290866:S179L;ENSP00000397593:S179L	ENSP00000290866:S179L	S	+	2	0	ACE	58910886	1.000000	0.71417	0.121000	0.21740	0.843000	0.47879	7.609000	0.82925	2.000000	0.58554	0.561000	0.74099	TCG		0.602	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2			35	62	35	62
DSG3	1830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	29038477	29038477	+	Missense_Mutation	SNP	C	C	A			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr18:29038477C>A	ENST00000257189.4	+	4	369	c.286C>A	c.(286-288)Cct>Act	p.P96T		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	96	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CGATCAGCCGCCTTTTGGAAT	0.443																																																0													97.0	95.0	96.0					18																	29038477		2203	4300	6503	SO:0001583	missense	1830			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.286C>A	18.37:g.29038477C>A	ENSP00000257189:p.Pro96Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A8K2V2	Missense_Mutation	SNP	ENST00000257189.4	37	CCDS11898.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.574521	0.86542	.	.	ENSG00000134757	ENST00000257189	T	0.61980	0.06	5.76	5.76	0.90799	Cadherin (4);Cadherin-like (1);	0.000000	0.48767	D	0.000164	D	0.85013	0.5600	M	0.93106	3.38	0.52099	D	0.999946	D	0.89917	1.0	D	0.97110	1.0	D	0.87527	0.2450	10	0.87932	D	0	.	19.9381	0.97149	0.0:1.0:0.0:0.0	.	96	P32926	DSG3_HUMAN	T	96	ENSP00000257189:P96T	ENSP00000257189:P96T	P	+	1	0	DSG3	27292475	0.998000	0.40836	1.000000	0.80357	0.958000	0.62258	5.915000	0.69973	2.880000	0.98712	0.650000	0.86243	CCT		0.443	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944		18	34	18	34
ZNF560	147741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	9578276	9578276	+	Silent	SNP	T	T	A			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr19:9578276T>A	ENST00000301480.4	-	10	1560	c.1347A>T	c.(1345-1347)ggA>ggT	p.G449G		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						CTCTCAAATGTCCAAAAAGAG	0.398																																																0													134.0	147.0	143.0					19																	9578276		2203	4300	6503	SO:0001819	synonymous_variant	147741			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.1347A>T	19.37:g.9578276T>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q495S9|Q495T1	Silent	SNP	ENST00000301480.4	37	CCDS12214.1																																																																																				0.398	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476		42	50	42	50
CRTC1	23373	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	18888133	18888133	+	Missense_Mutation	SNP	C	C	A			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr19:18888133C>A	ENST00000321949.8	+	14	1872	c.1846C>A	c.(1846-1848)Ccc>Acc	p.P616T	CRTC1_ENST00000594658.1_Missense_Mutation_p.P575T|CRTC1_ENST00000338797.6_Missense_Mutation_p.P632T|CRTC1_ENST00000601916.1_Missense_Mutation_p.P374T	NM_015321.2	NP_056136.2			CREB regulated transcription coactivator 1										CRTC1/MAML2(516)	NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	19						GCTCAACGACCCCGACATGGT	0.682																																																0													195.0	205.0	202.0					19																	18888133		2203	4300	6503	SO:0001583	missense	23373			AY040323	CCDS32963.1, CCDS42525.1	19p13	2012-07-31	2005-11-24	2005-11-24					16062	protein-coding gene	gene with protein product	"""transducer of regulated cAMP response element-binding protein"""	607536	"""mucoepidermoid carcinoma translocated 1"""	MECT1		12539049, 14536081, 14506290	Standard	NM_015321		Approved	KIAA0616, FLJ14027, TORC1	uc010ebv.3	Q6UUV9		ENST00000321949.8:c.1846C>A	19.37:g.18888133C>A	ENSP00000323332:p.Pro616Thr	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000321949.8	37	CCDS32963.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.465094	0.84425	.	.	ENSG00000105662	ENST00000338797;ENST00000321949	T;T	0.20463	2.07;2.11	3.67	3.67	0.42095	Transducer of regulated CREB activity, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.39989	0.1099	L	0.52905	1.665	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.991	T	0.17137	-1.0379	9	.	.	.	-14.2344	14.5495	0.68057	0.0:1.0:0.0:0.0	.	632;616	Q6UUV9-2;Q6UUV9	.;CRTC1_HUMAN	T	632;616	ENSP00000345001:P632T;ENSP00000323332:P616T	.	P	+	1	0	CRTC1	18749133	1.000000	0.71417	0.985000	0.45067	0.959000	0.62525	7.323000	0.79105	1.898000	0.54952	0.467000	0.42956	CCC		0.682	CRTC1-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465151.3	NM_025021		176	325	176	325
ZNF681	148213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	23926730	23926730	+	Missense_Mutation	SNP	T	T	A			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr19:23926730T>A	ENST00000402377.3	-	4	1763	c.1622A>T	c.(1621-1623)aAa>aTa	p.K541I	ZNF681_ENST00000395385.3_Missense_Mutation_p.K472I	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	541					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GTTAAAGGCTTTGCCACATTC	0.393																																																0													47.0	50.0	49.0					19																	23926730		2202	4298	6500	SO:0001583	missense	148213			AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1622A>T	19.37:g.23926730T>A	ENSP00000384000:p.Lys541Ile	Somatic		WXS	Illumina GAIIx	Phase_I	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	37	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	10.71	1.426590	0.25726	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.28255	1.62;1.62	1.51	1.51	0.23008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57169	0.2035	M	0.89968	3.075	0.29426	N	0.860199	D	0.76494	0.999	D	0.85130	0.997	T	0.51647	-0.8679	9	0.87932	D	0	.	6.6698	0.23062	0.0:0.0:0.0:1.0	.	541	Q96N22	ZN681_HUMAN	I	541;472	ENSP00000384000:K541I;ENSP00000378783:K472I	ENSP00000378783:K472I	K	-	2	0	ZNF681	23718570	0.999000	0.42202	0.723000	0.30687	0.098000	0.18820	3.791000	0.55469	0.663000	0.31027	0.260000	0.18958	AAA		0.393	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286		13	13	13	13
GPR32	2854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	51274118	51274118	+	Silent	SNP	C	C	T	rs375835721		TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr19:51274118C>T	ENST00000270590.4	+	1	398	c.261C>T	c.(259-261)gcC>gcT	p.A87A		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	87					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		TGGCCCTTGCCGATTTCATGC	0.562													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20379	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(113;152 1581 5732 15840 44398)											0								C		2,4404	4.2+/-10.8	0,2,2201	166.0	130.0	143.0		261	0.1	0.0	19		143	0,8600		0,0,4300	no	coding-synonymous	GPR32	NM_001506.1		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		87/357	51274118	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	2854			AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.261C>T	19.37:g.51274118C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q502U7|Q6NWS5	Silent	SNP	ENST00000270590.4	37	CCDS12801.1																																																																																				0.562	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1			26	48	26	48
LILRB2	10288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	54778558	54778558	+	Silent	SNP	G	G	A			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr19:54778558G>A	ENST00000391749.4	-	14	2047	c.1776C>T	c.(1774-1776)taC>taT	p.Y592Y	LILRB2_ENST00000434421.1_Silent_p.Y476Y|LILRB2_ENST00000314446.5_Silent_p.Y591Y|LILRB2_ENST00000391748.1_Silent_p.Y591Y|LILRB2_ENST00000391746.1_3'UTR	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	592					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCAGGGTGGCGTAGATGCTGG	0.617																																																0													117.0	101.0	106.0					19																	54778558		2203	4300	6503	SO:0001819	synonymous_variant	10288			AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.1776C>T	19.37:g.54778558G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Silent	SNP	ENST00000391749.4	37	CCDS12886.1																																																																																				0.617	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1			37	72	37	72
LILRB2	10288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	54780127	54780127	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr19:54780127C>A	ENST00000391749.4	-	12	1859	c.1588G>T	c.(1588-1590)Gaa>Taa	p.E530*	LILRB2_ENST00000434421.1_Nonsense_Mutation_p.E414*|LILRB2_ENST00000314446.5_Nonsense_Mutation_p.E529*|LILRB2_ENST00000391748.1_Nonsense_Mutation_p.E529*|LILRB2_ENST00000391746.1_Missense_Mutation_p.K504N	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	530					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CAGAGGTTTTCTTCCTGGGCG	0.627																																																0													70.0	84.0	79.0					19																	54780127		2203	4300	6503	SO:0001587	stop_gained	10288			AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.1588G>T	19.37:g.54780127C>A	ENSP00000375629:p.Glu530*	Somatic		WXS	Illumina GAIIx	Phase_I	A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Nonsense_Mutation	SNP	ENST00000391749.4	37	CCDS12886.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.816105|5.816105	0.96982|0.96982	.|.	.|.	ENSG00000131042|ENSG00000131042	ENST00000391748;ENST00000314446;ENST00000391749;ENST00000434421|ENST00000391746	.|T	.|0.00502	.|6.95	1.82|1.82	-0.771|-0.771	0.11002|0.11002	.|.	.|.	.|.	.|.	.|.	.|T	.|0.00356	.|0.0011	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|B	.|0.16802	.|0.019	.|B	.|0.04013	.|0.001	.|T	.|0.18461	.|-1.0336	.|7	0.87932|0.51188	D|T	0|0.08	.|.	7.4805|7.4805	0.27402|0.27402	0.0:0.4723:0.5277:0.0|0.0:0.4723:0.5277:0.0	.|.	.|504	.|A8MU67	.|.	X|N	529;529;530;414|504	.|ENSP00000375626:K504N	ENSP00000319960:E529X|ENSP00000375626:K504N	E|K	-|-	1|3	0|2	LILRB2|LILRB2	59471939|59471939	0.003000|0.003000	0.15002|0.15002	0.001000|0.001000	0.08648|0.08648	0.028000|0.028000	0.11728|0.11728	0.630000|0.630000	0.24553|0.24553	-0.049000|-0.049000	0.13379|0.13379	0.297000|0.297000	0.19635|0.19635	GAA|AAG		0.627	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1			18	120	18	120
EMC1	23065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	19563721	19563721	+	Silent	SNP	C	C	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr1:19563721C>T	ENST00000477853.1	-	12	1266	c.1224G>A	c.(1222-1224)caG>caA	p.Q408Q	RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375208.3_Silent_p.Q386Q|EMC1_ENST00000375199.3_Silent_p.Q407Q	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	408						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											TCAAGAACACCTGGATATACA	0.502																																																0													177.0	169.0	172.0					1																	19563721		2203	4300	6503	SO:0001819	synonymous_variant	23065				CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.1224G>A	1.37:g.19563721C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Silent	SNP	ENST00000477853.1	37	CCDS190.1	.	.	.	.	.	.	.	.	.	.	C	9.278	1.047351	0.19827	.	.	ENSG00000127463	ENST00000375197	.	.	.	6.07	4.19	0.49359	.	.	.	.	.	T	0.60856	0.2301	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59263	-0.7487	4	.	.	.	-25.2842	10.6732	0.45770	0.0:0.8488:0.0:0.1512	.	.	.	.	S	142	.	.	G	-	1	0	KIAA0090	19436308	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	0.534000	0.23098	1.581000	0.49865	0.655000	0.94253	GGT		0.502	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2	NM_015047		47	87	47	87
AGL	178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	100361871	100361871	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr1:100361871C>T	ENST00000294724.4	+	25	3767	c.3289C>T	c.(3289-3291)Cgc>Tgc	p.R1097C	AGL_ENST00000361915.3_Missense_Mutation_p.R1097C|AGL_ENST00000370165.3_Missense_Mutation_p.R1097C|AGL_ENST00000361522.4_Missense_Mutation_p.R1080C|AGL_ENST00000361302.3_Missense_Mutation_p.R1081C|AGL_ENST00000370161.2_Missense_Mutation_p.R1081C|AGL_ENST00000370163.3_Missense_Mutation_p.R1097C	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	1097					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		TGGTATTTTCCGCTGCTGGGG	0.373																																																0													230.0	204.0	213.0					1																	100361871		2203	4300	6503	SO:0001583	missense	178			BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.3289C>T	1.37:g.100361871C>T	ENSP00000294724:p.Arg1097Cys	Somatic		WXS	Illumina GAIIx	Phase_I	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	37	CCDS759.1	.	.	.	.	.	.	.	.	.	.	C	34	5.348586	0.95807	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	T;T;T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49	5.94	5.94	0.96194	Six-hairpin glycosidase-like (1);	0.048779	0.85682	D	0.000000	D	0.88526	0.6460	M	0.94142	3.5	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.90453	0.4440	10	0.87932	D	0	.	20.3736	0.98901	0.0:1.0:0.0:0.0	.	1080;1081;1097	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	C	1097;1097;1097;1097;1081;1081;1080	ENSP00000355106:R1097C;ENSP00000359184:R1097C;ENSP00000359182:R1097C;ENSP00000294724:R1097C;ENSP00000354971:R1081C;ENSP00000359180:R1081C;ENSP00000354635:R1080C	ENSP00000294724:R1097C	R	+	1	0	AGL	100134459	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.766000	0.68843	2.820000	0.97059	0.650000	0.86243	CGC		0.373	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028		31	48	31	48
OR2M7	391196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	248487786	248487786	+	Missense_Mutation	SNP	A	A	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr1:248487786A>T	ENST00000317965.2	-	1	113	c.85T>A	c.(85-87)Ttt>Att	p.F29I		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGACCAGAAAGAAGAGGAAG	0.502																																																0													220.0	223.0	222.0					1																	248487786		2203	4300	6503	SO:0001583	missense	391196			BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.85T>A	1.37:g.248487786A>T	ENSP00000324557:p.Phe29Ile	Somatic		WXS	Illumina GAIIx	Phase_I	B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	A	6.121	0.390594	0.11581	.	.	ENSG00000177186	ENST00000317965	T	0.00631	6.09	1.55	-2.48	0.06423	.	0.561270	0.13373	U	0.392738	T	0.00356	0.0011	N	0.04245	-0.25	0.09310	N	1	B	0.23591	0.088	B	0.23275	0.045	T	0.41070	-0.9529	10	0.10902	T	0.67	.	9.1151	0.36753	0.401:0.5989:0.0:0.0	.	29	Q8NG81	OR2M7_HUMAN	I	29	ENSP00000324557:F29I	ENSP00000324557:F29I	F	-	1	0	OR2M7	246554409	0.000000	0.05858	0.246000	0.24233	0.537000	0.34900	-1.516000	0.02250	-0.131000	0.11578	0.163000	0.16589	TTT		0.502	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691		115	136	115	136
GNAS	2778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	57428501	57428501	+	Missense_Mutation	SNP	G	G	A	rs587778390		TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr20:57428501G>A	ENST00000371100.4	+	1	733	c.181G>A	c.(181-183)Gtc>Atc	p.V61I	GNAS_ENST00000371075.3_Intron|GNAS-AS1_ENST00000598163.1_RNA|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000306120.3_5'Flank|GNAS_ENST00000371099.2_Missense_Mutation_p.V61I|GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371102.4_Missense_Mutation_p.V61I	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCCCATCCCCGTCGAGAATGA	0.642			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													21.0	24.0	23.0					20																	57428501		1883	4116	5999	SO:0001583	missense	2778			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.181G>A	20.37:g.57428501G>A	ENSP00000360141:p.Val61Ile	Somatic		WXS	Illumina GAIIx	Phase_I	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371100.4	37	CCDS46622.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.343714	0.00222	.	.	ENSG00000087460	ENST00000371099;ENST00000371100;ENST00000371102	D;D	0.88431	-2.38;-2.38	4.42	-8.85	0.00799	.	.	.	.	.	T	0.70500	0.3231	N	0.03115	-0.41	0.42993	D	0.994497	B	0.02656	0.0	B	0.01281	0.0	T	0.51857	-0.8652	9	0.33940	T	0.23	.	12.2115	0.54381	0.2247:0.2022:0.5731:0.0	.	61	Q5JWF2	GNAS1_HUMAN	I	61	ENSP00000360141:V61I;ENSP00000360143:V61I	ENSP00000360140:V61I	V	+	1	0	GNAS	56861896	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	-3.235000	0.00546	-3.510000	0.00150	-2.264000	0.00278	GTC		0.642	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080417.3	NM_000516		12	16	12	16
TEF	7008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	22	41791868	41791868	+	Silent	SNP	C	C	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr22:41791868C>T	ENST00000266304.4	+	4	932	c.816C>T	c.(814-816)aaC>aaT	p.N272N	TEF_ENST00000406644.3_Silent_p.N242N	NM_003216.3	NP_003207.1	Q10587	TEF_HUMAN	thyrotrophic embryonic factor	272	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)	6						AGAAGGAGAACACAGCCCTGC	0.587																																																0													123.0	106.0	112.0					22																	41791868		2203	4300	6503	SO:0001819	synonymous_variant	7008				CCDS14014.1, CCDS46716.1	22q13.2	2013-01-10			ENSG00000167074	ENSG00000167074		"""basic leucine zipper proteins"""	11722	protein-coding gene	gene with protein product		188595				7835883, 15665112	Standard	NM_001145398		Approved	KIAA1655	uc003azy.4	Q10587	OTTHUMG00000150968	ENST00000266304.4:c.816C>T	22.37:g.41791868C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B0QYS8|B2RC22|Q15729|Q7Z3J7|Q8IU94|Q96TG4	Silent	SNP	ENST00000266304.4	37	CCDS14014.1																																																																																				0.587	TEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320692.1	NM_003216		57	90	57	90
QPCT	25797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	37594451	37594451	+	Missense_Mutation	SNP	C	C	G			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr2:37594451C>G	ENST00000338415.3	+	4	781	c.623C>G	c.(622-624)tCt>tGt	p.S208C	QPCT_ENST00000537448.1_Missense_Mutation_p.S159C	NM_012413.3	NP_036545.1	Q16769	QPCT_HUMAN	glutaminyl-peptide cyclotransferase	208					cellular protein modification process (GO:0006464)|peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase (GO:0017186)	extracellular vesicular exosome (GO:0070062)	glutaminyl-peptide cyclotransferase activity (GO:0016603)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|stomach(2)	17		Ovarian(717;0.051)|all_hematologic(82;0.21)				CTTCACTGGTCTCCTCAAGAT	0.488																																																0													118.0	114.0	115.0					2																	37594451		2203	4300	6503	SO:0001583	missense	25797			X71125	CCDS1790.1	2p22	2008-07-31	2008-07-31		ENSG00000115828	ENSG00000115828	2.3.2.5		9753	protein-coding gene	gene with protein product	"""glutaminyl cyclase"""	607065				7999256	Standard	NM_012413		Approved	QC, GCT	uc002rqg.3	Q16769	OTTHUMG00000100963	ENST00000338415.3:c.623C>G	2.37:g.37594451C>G	ENSP00000344829:p.Ser208Cys	Somatic		WXS	Illumina GAIIx	Phase_I	Q16770|Q3KRG6|Q53TR4	Missense_Mutation	SNP	ENST00000338415.3	37	CCDS1790.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.870071	0.91587	.	.	ENSG00000115828	ENST00000338415;ENST00000404976;ENST00000537448	T;T;T	0.23552	1.9;1.9;1.9	5.61	5.61	0.85477	Peptidase M28 (1);	0.051257	0.85682	D	0.000000	T	0.61375	0.2342	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.978;0.987	T	0.68819	-0.5308	10	0.72032	D	0.01	-14.6594	19.6372	0.95737	0.0:1.0:0.0:0.0	.	159;208	Q16769-2;Q16769	.;QPCT_HUMAN	C	208;159;159	ENSP00000344829:S208C;ENSP00000385391:S159C;ENSP00000441606:S159C	ENSP00000344829:S208C	S	+	2	0	QPCT	37447955	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	7.687000	0.84139	2.642000	0.89623	0.561000	0.74099	TCT		0.488	QPCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218572.2			28	50	28	50
COL6A3	1293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	238249144	238249144	+	Silent	SNP	G	G	A	rs375442243		TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr2:238249144G>A	ENST00000295550.4	-	38	8867	c.8415C>T	c.(8413-8415)aaC>aaT	p.N2805N	COL6A3_ENST00000353578.4_Silent_p.N2599N|COL6A3_ENST00000472056.1_Silent_p.N2198N|COL6A3_ENST00000346358.4_Silent_p.N2605N|COL6A3_ENST00000347401.3_Silent_p.N2604N|COL6A3_ENST00000409809.1_Silent_p.N2599N	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2805	Nonhelical region.|VWFA 12. {ECO:0000255|PROSITE- ProRule:PRU00219}.		N -> T (in dbSNP:rs35848091).		axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AAGGCTCCTCGTTGAGCTCGG	0.557																																																0								G	,,	0,4406		0,0,2203	88.0	79.0	82.0		8415,6594,7797	0.8	1.0	2		82	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	COL6A3	NM_004369.3,NM_057166.4,NM_057167.3	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	2805/3178,2198/2571,2599/2972	238249144	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.8415C>T	2.37:g.238249144G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																				0.557	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		38	49	38	49
KCNH8	131096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	19575087	19575087	+	Silent	SNP	C	C	T	rs151258565	byFrequency	TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr3:19575087C>T	ENST00000328405.2	+	16	3086	c.2820C>T	c.(2818-2820)ggC>ggT	p.G940G		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	940					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						TGCAAACAGGCGGGGCTGCTT	0.542													C|||	3	0.000599042	0.0008	0.0014	5008	,	,		18580	0.0		0.001	False		,,,				2504	0.0				NSCLC(124;1625 1765 8018 24930 42026)											0								C		2,4404	4.2+/-10.8	0,2,2201	81.0	79.0	79.0		2820	-7.2	0.0	3	dbSNP_134	79	0,8600		0,0,4300	no	coding-synonymous	KCNH8	NM_144633.2		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		940/1108	19575087	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	131096			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2820C>T	3.37:g.19575087C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B7Z2I7|Q59GQ6	Silent	SNP	ENST00000328405.2	37	CCDS2632.1																																																																																				0.542	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		33	44	33	44
PLD1	5337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	171330202	171330202	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr3:171330202G>A	ENST00000351298.4	-	25	2875	c.2749C>T	c.(2749-2751)Cgc>Tgc	p.R917C	PLD1_ENST00000356327.5_Missense_Mutation_p.R879C|PLD1_ENST00000340989.4_Missense_Mutation_p.R917C|PLD1_ENST00000342215.6_3'UTR	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	917	Catalytic.|PLD phosphodiesterase 2. {ECO:0000255|PROSITE-ProRule:PRU00153}.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	AGCATGCTGCGGTCATTTATG	0.493																																					NSCLC(149;2174 3517 34058)											0													107.0	93.0	98.0					3																	171330202		2203	4300	6503	SO:0001583	missense	5337			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.2749C>T	3.37:g.171330202G>A	ENSP00000342793:p.Arg917Cys	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000351298.4	37	CCDS3216.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.120228	0.77323	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000340989	T;T;T	0.32023	1.47;1.47;1.47	5.57	4.61	0.57282	Phospholipase D/Transphosphatidylase (2);	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	H	0.98682	4.3	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.84180	0.0439	10	0.87932	D	0	-12.4302	17.1449	0.86764	0.0:0.0:0.8651:0.1349	.	917;902;917	Q13393-4;Q59EA4;Q13393	.;.;PLD1_HUMAN	C	879;917;917	ENSP00000348681:R879C;ENSP00000342793:R917C;ENSP00000340326:R917C	ENSP00000340326:R917C	R	-	1	0	PLD1	172812896	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	3.060000	0.49955	2.606000	0.88127	0.650000	0.86243	CGC		0.493	PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662		7	56	7	56
QDPR	5860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	17513644	17513644	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr4:17513644G>A	ENST00000281243.5	-	1	213	c.34C>T	c.(34-36)Cgg>Tgg	p.R12W	QDPR_ENST00000428702.2_Missense_Mutation_p.R12W|QDPR_ENST00000513615.1_Missense_Mutation_p.R12W|QDPR_ENST00000508623.1_Missense_Mutation_p.R12W	NM_000320.2	NP_000311.2	P09417	DHPR_HUMAN	quinoid dihydropteridine reductase	12					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|dihydrobiopterin metabolic process (GO:0051066)|L-phenylalanine catabolic process (GO:0006559)|liver development (GO:0001889)|response to aluminum ion (GO:0010044)|response to glucagon (GO:0033762)|response to lead ion (GO:0010288)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	6,7-dihydropteridine reductase activity (GO:0004155)|electron carrier activity (GO:0009055)|NADH binding (GO:0070404)|NADPH binding (GO:0070402)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	13						ACCAGCACCCGGCGCGCCTCG	0.756																																																0													9.0	14.0	12.0					4																	17513644		1890	3850	5740	SO:0001583	missense	5860			AB053170	CCDS3421.1	4p15.31	2014-04-01			ENSG00000151552	ENSG00000151552	1.5.1.34	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	9752	protein-coding gene	gene with protein product	"""6,7-dihydropteridine reductase"", ""short chain dehydrogenase/reductase family 33C, member 1"""	612676				19027726	Standard	NM_000320		Approved	DHPR, PKU2, SDR33C1	uc003gpd.3	P09417	OTTHUMG00000128537	ENST00000281243.5:c.34C>T	4.37:g.17513644G>A	ENSP00000281243:p.Arg12Trp	Somatic		WXS	Illumina GAIIx	Phase_I	A8K158|B3KW71|Q53F52|Q9H3M5	Missense_Mutation	SNP	ENST00000281243.5	37	CCDS3421.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996329	0.54147	.	.	ENSG00000151552	ENST00000513615;ENST00000281243;ENST00000428702;ENST00000508623	D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63	4.01	1.11	0.20524	NAD(P)-binding domain (1);	0.125442	0.50627	D	0.000112	D	0.96682	0.8917	M	0.86343	2.81	0.51233	D	0.999913	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.924	D	0.95396	0.8486	10	0.66056	D	0.02	-10.1967	9.1494	0.36953	0.0:0.121:0.4054:0.4736	.	12;12	B3KW71;P09417	.;DHPR_HUMAN	W	12	ENSP00000422759:R12W;ENSP00000281243:R12W;ENSP00000390944:R12W;ENSP00000426377:R12W	ENSP00000281243:R12W	R	-	1	2	QDPR	17122742	1.000000	0.71417	0.998000	0.56505	0.301000	0.27625	1.463000	0.35277	0.347000	0.23924	-0.127000	0.14921	CGG		0.756	QDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250372.1	NM_000320		22	23	22	23
TECRL	253017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	65180375	65180375	+	Missense_Mutation	SNP	G	G	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr4:65180375G>T	ENST00000381210.3	-	5	652	c.542C>A	c.(541-543)cCa>cAa	p.P181Q	TECRL_ENST00000507440.1_Missense_Mutation_p.P181Q|TECRL_ENST00000513125.1_5'UTR	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	181					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						CTGTACCACTGGGTGGCGTAA	0.438																																																0													93.0	86.0	89.0					4																	65180375		2203	4300	6503	SO:0001583	missense	253017			AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.542C>A	4.37:g.65180375G>T	ENSP00000370607:p.Pro181Gln	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000381210.3	37	CCDS33990.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.077401	0.36662	.	.	ENSG00000205678	ENST00000507440;ENST00000381210	T;T	0.40476	1.03;1.03	5.7	4.86	0.63082	.	0.254563	0.39210	N	0.001435	T	0.45115	0.1326	L	0.49571	1.57	0.36869	D	0.888806	P;P	0.48503	0.911;0.8	P;P	0.50896	0.653;0.467	T	0.47935	-0.9078	10	0.20519	T	0.43	-0.5415	11.737	0.51771	0.0823:0.0:0.9177:0.0	.	181;181	Q6IN47;Q5HYJ1	.;TECRL_HUMAN	Q	181	ENSP00000426043:P181Q;ENSP00000370607:P181Q	ENSP00000370607:P181Q	P	-	2	0	TECRL	64862970	1.000000	0.71417	0.953000	0.39169	0.498000	0.33706	3.129000	0.50500	1.411000	0.46957	0.591000	0.81541	CCA		0.438	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874		7	18	7	18
CSN3	1448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	71114862	71114862	+	Missense_Mutation	SNP	A	A	G			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr4:71114862A>G	ENST00000304954.3	+	4	321	c.235A>G	c.(235-237)Aca>Gca	p.T79A		NM_005212.2	NP_005203.2	Q9UNS2	CSN3_HUMAN	casein kappa	0					cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						TGTGCCTCGCACATATTATGC	0.448																																																0													122.0	111.0	115.0					4																	71114862		2203	4300	6503	SO:0001583	missense	1448			U51899	CCDS3538.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000171209	ENSG00000171209			2446	protein-coding gene	gene with protein product		601695	"""casein, kappa"""	CSN10		8863730, 9050925	Standard	NM_005212		Approved		uc003hfe.4	P07498	OTTHUMG00000129399	ENST00000304954.3:c.235A>G	4.37:g.71114862A>G	ENSP00000304822:p.Thr79Ala	Somatic		WXS	Illumina GAIIx	Phase_I	B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	ENST00000304954.3	37	CCDS3538.1	.	.	.	.	.	.	.	.	.	.	A	9.821	1.185876	0.21870	.	.	ENSG00000171209	ENST00000304954	T	0.21734	1.99	4.51	0.484	0.16825	.	0.977836	0.08396	N	0.952140	T	0.11110	0.0271	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.32798	-0.9893	10	0.72032	D	0.01	-24.2922	7.7706	0.29006	0.4759:0.3825:0.1416:0.0	.	79	P07498	CASK_HUMAN	A	79	ENSP00000304822:T79A	ENSP00000304822:T79A	T	+	1	0	CSN3	71149451	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.097000	0.11042	0.057000	0.16193	-1.301000	0.01330	ACA		0.448	CSN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251555.1	NM_005212		29	34	29	34
BTC	685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	75673309	75673309	+	Missense_Mutation	SNP	G	G	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr4:75673309G>T	ENST00000395743.3	-	5	839	c.479C>A	c.(478-480)aCt>aAt	p.T160N		NM_001729.2	NP_001720.1	P35070	BTC_HUMAN	betacellulin	160					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitosis (GO:0045840)|positive regulation of urine volume (GO:0035810)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	10			Lung(101;0.219)			TTTACCCAGAGTTTCCATTTC	0.353																																																0													143.0	144.0	144.0					4																	75673309		2202	4299	6501	SO:0001583	missense	685			S55606	CCDS3566.1	4q13.3	2012-09-20			ENSG00000174808	ENSG00000174808			1121	protein-coding gene	gene with protein product		600345				8439318, 11522793	Standard	NM_001729		Approved		uc003hig.2	P35070	OTTHUMG00000130107	ENST00000395743.3:c.479C>A	4.37:g.75673309G>T	ENSP00000379092:p.Thr160Asn	Somatic		WXS	Illumina GAIIx	Phase_I	Q96F48	Missense_Mutation	SNP	ENST00000395743.3	37	CCDS3566.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.728|8.728	0.915867|0.915867	0.17907|0.17907	.|.	.|.	ENSG00000174808|ENSG00000174808	ENST00000512743|ENST00000395743	.|T	.|0.10099	.|2.91	4.84|4.84	3.98|3.98	0.46160|0.46160	.|.	.|0.434135	.|0.23930	.|N	.|0.043150	T|T	0.08088|0.08088	0.0202|0.0202	L|L	0.29908|0.29908	0.895|0.895	0.32294|0.32294	N|N	0.565932|0.565932	.|B	.|0.19073	.|0.033	.|B	.|0.19946	.|0.027	T|T	0.14420|0.14420	-1.0473|-1.0473	5|10	.|0.15952	.|T	.|0.53	-14.5819|-14.5819	11.0113|11.0113	0.47665|0.47665	0.0:0.0:0.8128:0.1872|0.0:0.0:0.8128:0.1872	.|.	.|160	.|P35070	.|BTC_HUMAN	I|N	90|160	.|ENSP00000379092:T160N	.|ENSP00000379092:T160N	L|T	-|-	1|2	0|0	BTC|BTC	75892333|75892333	0.910000|0.910000	0.30920|0.30920	0.971000|0.971000	0.41717|0.41717	0.133000|0.133000	0.20885|0.20885	0.877000|0.877000	0.28106|0.28106	1.305000|1.305000	0.44909|0.44909	0.655000|0.655000	0.94253|0.94253	CTC|ACT		0.353	BTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252413.1			7	13	7	13
PPEF2	5470	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	76787356	76787356	+	Missense_Mutation	SNP	G	G	T	rs539493453	byFrequency	TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr4:76787356G>T	ENST00000286719.7	-	15	2262	c.1906C>A	c.(1906-1908)Caa>Aaa	p.Q636K		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	636					detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CGACTCAGTTGTTCCTTGGCC	0.493													G|||	8	0.00159744	0.0	0.0	5008	,	,		21576	0.0		0.0	False		,,,				2504	0.0082				NSCLC(105;1359 1603 15961 44567 47947)											0													263.0	217.0	233.0					4																	76787356		2203	4300	6503	SO:0001583	missense	5470			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.1906C>A	4.37:g.76787356G>T	ENSP00000286719:p.Gln636Lys	Somatic		WXS	Illumina GAIIx	Phase_I	O14831	Missense_Mutation	SNP	ENST00000286719.7	37	CCDS34013.1	.	.	.	.	.	.	.	.	.	.	G	0.037	-1.303960	0.01353	.	.	ENSG00000156194	ENST00000286719	T	0.41400	1.0	4.67	3.82	0.43975	.	0.237586	0.34507	U	0.003910	T	0.22704	0.0548	N	0.13098	0.295	0.18873	N	0.999988	B	0.09022	0.002	B	0.06405	0.002	T	0.15378	-1.0439	10	0.08179	T	0.78	-9.2524	11.9221	0.52797	0.0:0.0:0.8249:0.1751	.	636	O14830	PPE2_HUMAN	K	636	ENSP00000286719:Q636K	ENSP00000286719:Q636K	Q	-	1	0	PPEF2	77006380	0.776000	0.28616	0.071000	0.20095	0.637000	0.38172	1.612000	0.36889	1.168000	0.42723	0.491000	0.48974	CAA		0.493	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362929.1	NM_006239		73	95	73	95
SPEF2	79925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	35692734	35692734	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr5:35692734G>A	ENST00000356031.3	+	12	1961	c.1807G>A	c.(1807-1809)Gac>Aac	p.D603N	SPEF2_ENST00000509059.1_Missense_Mutation_p.D603N|SPEF2_ENST00000440995.2_Missense_Mutation_p.D603N|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	603					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGCATTTCATGACAATGAAAA	0.343																																																0													91.0	95.0	94.0					5																	35692734		1835	4076	5911	SO:0001583	missense	79925			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.1807G>A	5.37:g.35692734G>A	ENSP00000348314:p.Asp603Asn	Somatic		WXS	Illumina GAIIx	Phase_I	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.401624	0.25291	.	.	ENSG00000152582	ENST00000356031;ENST00000509059;ENST00000440995;ENST00000504054	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	5.81	0.394	0.16299	.	0.684388	0.14217	N	0.333670	T	0.16642	0.0400	N	0.19112	0.55	0.09310	N	1	B;B;B	0.14438	0.006;0.01;0.007	B;B;B	0.11329	0.002;0.006;0.005	T	0.31696	-0.9934	10	0.10111	T	0.7	.	10.89	0.46990	0.3516:0.0:0.6484:0.0	.	603;603;603	D6REZ4;Q9C093-2;Q9C093	.;.;SPEF2_HUMAN	N	603;603;603;114	ENSP00000348314:D603N;ENSP00000421593:D603N;ENSP00000412125:D603N;ENSP00000421744:D114N	ENSP00000348314:D603N	D	+	1	0	SPEF2	35728491	0.392000	0.25229	0.045000	0.18777	0.904000	0.53231	0.329000	0.19698	0.111000	0.17947	0.585000	0.79938	GAC		0.343	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722		27	34	27	34
FAT2	2196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	150948306	150948306	+	Missense_Mutation	SNP	C	C	T	rs201874812		TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr5:150948306C>T	ENST00000261800.5	-	1	199	c.187G>A	c.(187-189)Gcg>Acg	p.A63T		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	63	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGTGGCTCCGCGAGGTAGATG	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		21738	0.0		0.001	False		,,,				2504	0.0															0													155.0	156.0	156.0					5																	150948306		2203	4300	6503	SO:0001583	missense	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.187G>A	5.37:g.150948306C>T	ENSP00000261800:p.Ala63Thr	Somatic		WXS	Illumina GAIIx	Phase_I	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	0.065	-1.213866	0.01555	.	.	ENSG00000086570	ENST00000261800	T	0.69806	-0.43	5.36	2.53	0.30540	Cadherin (3);Cadherin-like (1);	0.469539	0.21631	N	0.071488	T	0.31040	0.0784	N	0.02985	-0.445	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.25117	-1.0141	10	0.06236	T	0.91	.	3.6824	0.08316	0.1633:0.4542:0.0:0.3825	.	63	Q9NYQ8	FAT2_HUMAN	T	63	ENSP00000261800:A63T	ENSP00000261800:A63T	A	-	1	0	FAT2	150928499	0.000000	0.05858	0.001000	0.08648	0.930000	0.56654	-0.025000	0.12413	0.214000	0.20742	-0.314000	0.08810	GCG		0.493	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		56	106	56	106
CCDC170	80129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	151914325	151914325	+	Silent	SNP	C	C	T	rs113968720	byFrequency	TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr6:151914325C>T	ENST00000239374.7	+	8	1476	c.1377C>T	c.(1375-1377)gaC>gaT	p.D459D	CCDC170_ENST00000367290.5_Silent_p.D459D	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	459								p.D459E(1)									TGCGGCTGGACGTGGTTTTAG	0.453													C|||	2	0.000399361	0.0008	0.0	5008	,	,		18458	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	urinary_tract(1)						C		1,3849		0,1,1924	102.0	95.0	97.0		1377	-3.0	0.3	6	dbSNP_132	97	0,8292		0,0,4146	no	coding-synonymous	C6orf97	NM_025059.3		0,1,6070	TT,TC,CC		0.0,0.026,0.0082		459/716	151914325	1,12141	1925	4146	6071	SO:0001819	synonymous_variant	80129			AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.1377C>T	6.37:g.151914325C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Silent	SNP	ENST00000239374.7	37	CCDS43515.1																																																																																				0.453	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042727.2	NM_025059		25	36	25	36
TNRC18	84629	hgsc.bcm.edu;broad.mit.edu	37	7	5372548	5372548	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr7:5372548C>T	ENST00000430969.1	-	19	6200	c.5852G>A	c.(5851-5853)cGc>cAc	p.R1951H	TNRC18_ENST00000399537.4_Missense_Mutation_p.R1951H	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1951							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GTCGGGACCGCGGGCGCCAGG	0.751																																																0													3.0	4.0	4.0					7																	5372548		1380	3142	4522	SO:0001583	missense	84629			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5852G>A	7.37:g.5372548C>T	ENSP00000395538:p.Arg1951His	Somatic		WXS	Illumina GAIIx	Phase_I	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	.	2.720	-0.266842	0.05754	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544	T;T	0.12879	2.64;2.64	3.86	2.84	0.33178	.	0.573708	0.13191	N	0.406756	T	0.09949	0.0244	L	0.36672	1.1	0.09310	N	1	B	0.16166	0.016	B	0.06405	0.002	T	0.17592	-1.0364	10	0.56958	D	0.05	.	3.9891	0.09529	0.3665:0.4955:0.0:0.138	.	1951	O15417	TNC18_HUMAN	H	1951;1951;1006	ENSP00000382452:R1951H;ENSP00000395538:R1951H	ENSP00000382452:R1951H	R	-	2	0	TNRC18	5339074	1.000000	0.71417	0.039000	0.18376	0.064000	0.16182	1.682000	0.37628	1.694000	0.51137	0.313000	0.20887	CGC		0.751	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				6	24	6	24
VWC2	375567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	49842318	49842318	+	Silent	SNP	C	C	T	rs201624892		TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr7:49842318C>T	ENST00000340652.4	+	3	1264	c.708C>T	c.(706-708)tgC>tgT	p.C236C		NM_198570.3	NP_940972.2	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	236	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|basement membrane (GO:0005604)|cell junction (GO:0030054)|extracellular space (GO:0005615)|interstitial matrix (GO:0005614)|synapse (GO:0045202)				cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8						TGTCTCCATGCGAGAGGTGTC	0.507																																																0								C		0,4406		0,0,2203	235.0	190.0	205.0		708	-2.6	0.9	7		205	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	VWC2	NM_198570.3		0,3,6500	TT,TC,CC		0.0349,0.0,0.0231		236/326	49842318	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	375567			AY358393	CCDS5508.1	7p12.3-p12.2	2007-07-19			ENSG00000188730	ENSG00000188730			30200	protein-coding gene	gene with protein product	"""brorin"", ""brain-specific chordin-like"""	611108				17400546	Standard	NM_198570		Approved	PSST739, UNQ739	uc003tot.1	Q2TAL6	OTTHUMG00000129265	ENST00000340652.4:c.708C>T	7.37:g.49842318C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q6UXE2	Silent	SNP	ENST00000340652.4	37	CCDS5508.1																																																																																				0.507	VWC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251375.2	NM_198570		38	200	38	200
COBL	23242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	51097053	51097053	+	Silent	SNP	C	C	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr7:51097053C>T	ENST00000265136.7	-	10	1905	c.1740G>A	c.(1738-1740)gcG>gcA	p.A580A	COBL_ENST00000395542.2_Silent_p.A662A	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	580					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					CTTGAAGTGGCGCCAGGGAGT	0.552																																					NSCLC(189;2119 2138 12223 30818 34679)											0													63.0	52.0	56.0					7																	51097053		2203	4300	6503	SO:0001819	synonymous_variant	23242			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.1740G>A	7.37:g.51097053C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Silent	SNP	ENST00000265136.7	37	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	C	5.692	0.312205	0.10789	.	.	ENSG00000106078	ENST00000452534	T	0.21932	1.98	5.73	-9.42	0.00610	.	1.771380	0.03110	N	0.162290	T	0.06872	0.0175	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20075	-1.0286	7	0.09338	T	0.73	.	4.5312	0.12006	0.0729:0.2147:0.2641:0.4482	.	.	.	.	T	556	ENSP00000405059:A556T	ENSP00000405059:A556T	A	-	1	0	COBL	51064547	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.030000	0.01429	-2.206000	0.00741	-0.781000	0.03364	GCC		0.552	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198		19	64	19	64
ZNF679	168417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	63726330	63726330	+	Missense_Mutation	SNP	C	C	G			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr7:63726330C>G	ENST00000421025.1	+	5	588	c.319C>G	c.(319-321)Ctc>Gtc	p.L107V	ZNF679_ENST00000255746.4_Missense_Mutation_p.L107V	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	107					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						AAAAGATTCACTCCAAAAAGT	0.378																																																0													110.0	95.0	99.0					7																	63726330		692	1591	2283	SO:0001583	missense	168417			BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.319C>G	7.37:g.63726330C>G	ENSP00000416809:p.Leu107Val	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000421025.1	37	CCDS47592.1	.	.	.	.	.	.	.	.	.	.	C	5.630	0.300923	0.10678	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.06294	3.32;3.32	0.819	0.819	0.18785	.	.	.	.	.	T	0.12860	0.0312	L	0.40543	1.245	0.09310	N	1	D	0.69078	0.997	D	0.72625	0.978	T	0.17684	-1.0361	9	0.66056	D	0.02	.	4.7943	0.13265	0.0:1.0:0.0:0.0	.	107	Q8IYX0	ZN679_HUMAN	V	107	ENSP00000416809:L107V;ENSP00000255746:L107V	ENSP00000255746:L107V	L	+	1	0	ZNF679	63363765	0.000000	0.05858	0.032000	0.17829	0.032000	0.12392	-0.812000	0.04496	0.191000	0.20236	0.194000	0.17425	CTC		0.378	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363		8	20	8	20
DLC1	10395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	12957837	12957837	+	Missense_Mutation	SNP	C	C	G	rs574001055		TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr8:12957837C>G	ENST00000276297.4	-	9	2418	c.2009G>C	c.(2008-2010)cGg>cCg	p.R670P	DLC1_ENST00000358919.2_Missense_Mutation_p.R233P|DLC1_ENST00000520226.1_Missense_Mutation_p.R159P|DLC1_ENST00000512044.2_Missense_Mutation_p.R267P	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	670					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						GCTCTCCATCCGTTTCAGCAG	0.562																																																0													124.0	113.0	117.0					8																	12957837		2203	4300	6503	SO:0001583	missense	10395			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.2009G>C	8.37:g.12957837C>G	ENSP00000276297:p.Arg670Pro	Somatic		WXS	Illumina GAIIx	Phase_I	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407574	0.83340	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000512044;ENST00000520226	T;T;T;T	0.13089	2.9;2.64;2.62;2.63	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.42921	0.1224	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.80764	0.985;0.988;0.994	T	0.46005	-0.9222	10	0.87932	D	0	.	18.5404	0.91025	0.0:1.0:0.0:0.0	.	670;267;233	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	P	670;233;267;159	ENSP00000276297:R670P;ENSP00000351797:R233P;ENSP00000422595:R267P;ENSP00000428028:R159P	ENSP00000276297:R670P	R	-	2	0	DLC1	13002208	1.000000	0.71417	0.729000	0.30791	0.997000	0.91878	5.879000	0.69690	2.683000	0.91414	0.655000	0.94253	CGG		0.562	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094		107	93	107	93
RRAGA	10670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	19049841	19049841	+	Missense_Mutation	SNP	G	G	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr9:19049841G>T	ENST00000380527.1	+	1	470	c.184G>T	c.(184-186)Gac>Tac	p.D62Y		NM_006570.4	NP_006561.1			Ras-related GTP binding A											endometrium(1)|large_intestine(1)|lung(1)	3						GAACCTGTGGGACTGTGGCGG	0.542																																																0													70.0	64.0	66.0					9																	19049841		2203	4300	6503	SO:0001583	missense	10670			BC006433	CCDS6488.1	9p21.3	2008-02-05			ENSG00000155876	ENSG00000155876			16963	protein-coding gene	gene with protein product		612194				7499430, 8995684	Standard	NM_006570		Approved	RAGA, FIP-1	uc003znj.3	Q7L523	OTTHUMG00000019621	ENST00000380527.1:c.184G>T	9.37:g.19049841G>T	ENSP00000369899:p.Asp62Tyr	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000380527.1	37	CCDS6488.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937397	0.73557	.	.	ENSG00000155876	ENST00000380527	D	0.83163	-1.69	4.31	4.31	0.51392	.	0.000000	0.85682	D	0.000000	D	0.94295	0.8167	H	0.97918	4.105	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95812	0.8842	10	0.87932	D	0	0.1484	15.0921	0.72204	0.0:0.0:1.0:0.0	.	62	Q7L523	RRAGA_HUMAN	Y	62	ENSP00000369899:D62Y	ENSP00000369899:D62Y	D	+	1	0	RRAGA	19039841	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.197000	0.94985	2.700000	0.92200	0.561000	0.74099	GAC		0.542	RRAGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051824.1	NM_006570		17	8	17	8
RUSC2	9853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	35560371	35560371	+	Missense_Mutation	SNP	A	A	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr9:35560371A>T	ENST00000455600.1	+	10	4303	c.3734A>T	c.(3733-3735)gAg>gTg	p.E1245V	FAM166B_ENST00000492890.1_5'Flank	NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1245	Poly-Glu.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			gaggaagaagaggagacagaa	0.682																																																0													23.0	29.0	27.0					9																	35560371		2199	4289	6488	SO:0001583	missense	9853			AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.3734A>T	9.37:g.35560371A>T	ENSP00000393922:p.Glu1245Val	Somatic		WXS	Illumina GAIIx	Phase_I	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	ENST00000455600.1	37	CCDS35008.1	.	.	.	.	.	.	.	.	.	.	A	7.609	0.674408	0.14841	.	.	ENSG00000198853	ENST00000361226;ENST00000455600	T;T	0.24350	1.86;1.86	4.88	3.7	0.42460	.	0.562162	0.15364	N	0.266216	T	0.13243	0.0321	N	0.14661	0.345	0.09310	N	1	B	0.31153	0.31	B	0.28638	0.092	T	0.17745	-1.0359	10	0.42905	T	0.14	-6.1482	5.5333	0.16997	0.5695:0.3406:0.0899:0.0	.	1245	Q8N2Y8	RUSC2_HUMAN	V	1245	ENSP00000355177:E1245V;ENSP00000393922:E1245V	ENSP00000355177:E1245V	E	+	2	0	RUSC2	35550371	0.835000	0.29415	0.105000	0.21289	0.878000	0.50629	0.348000	0.20031	0.684000	0.31448	0.254000	0.18369	GAG		0.682	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462		25	38	25	38
OR13C3	138803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	107298219	107298219	+	Silent	SNP	C	C	T	rs145221004	byFrequency	TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr9:107298219C>T	ENST00000374781.2	-	1	918	c.876G>A	c.(874-876)ccG>ccA	p.P292P		NM_001001961.1	NP_001001961.1	Q8NGS6	O13C3_HUMAN	olfactory receptor, family 13, subfamily C, member 3	292						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(7)|lung(7)|pancreas(1)|prostate(1)|skin(1)	19						CTTGAGACTTCGGTTTCGCAT	0.438													c|||	8	0.00159744	0.0	0.0	5008	,	,		20758	0.0		0.0	False		,,,				2504	0.0082				GBM(86;1248 1274 14222 15028 46219)											0								C		0,4406		0,0,2203	142.0	134.0	137.0		876	-1.6	0.1	9	dbSNP_134	137	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OR13C3	NM_001001961.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		292/348	107298219	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	138803				CCDS35089.1	9q31.1	2013-09-24			ENSG00000204246	ENSG00000204246		"""GPCR / Class A : Olfactory receptors"""	14704	protein-coding gene	gene with protein product							Standard	NM_001001961		Approved		uc004bcb.1	Q8NGS6	OTTHUMG00000020406	ENST00000374781.2:c.876G>A	9.37:g.107298219C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q5VVG1|Q6IF52	Silent	SNP	ENST00000374781.2	37	CCDS35089.1																																																																																				0.438	OR13C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053477.2			39	70	39	70
MAGEB16	139604	hgsc.bcm.edu;broad.mit.edu	37	X	35821247	35821247	+	Missense_Mutation	SNP	G	G	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chrX:35821247G>T	ENST00000399989.1	+	2	1213	c.934G>T	c.(934-936)Gct>Tct	p.A312S	MAGEB16_ENST00000399987.1_Missense_Mutation_p.A312S|MAGEB16_ENST00000399988.1_Missense_Mutation_p.A312S|MAGEB16_ENST00000399992.1_Missense_Mutation_p.A344S|MAGEB16_ENST00000399985.1_Missense_Mutation_p.A312S	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	312	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						GTATGCGGAAGCTCTGAAAGA	0.488																																																0													19.0	20.0	19.0					X																	35821247		2168	4283	6451	SO:0001583	missense	139604				CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.934G>T	X.37:g.35821247G>T	ENSP00000382871:p.Ala312Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A8MU30	Missense_Mutation	SNP	ENST00000399989.1	37	CCDS43927.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.873013	0.33069	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.03889	3.87;3.77;3.87;3.87;3.87	3.13	3.13	0.36017	.	0.055325	0.64402	D	0.000001	T	0.24470	0.0593	M	0.92833	3.35	0.09310	N	1	D	0.59357	0.985	D	0.76071	0.987	T	0.03296	-1.1051	10	0.62326	D	0.03	.	9.0295	0.36249	0.0:0.0:1.0:0.0	.	312	A2A368	MAGBG_HUMAN	S	312;344;312;312;312	ENSP00000382870:A312S;ENSP00000382874:A344S;ENSP00000382869:A312S;ENSP00000382871:A312S;ENSP00000382867:A312S	ENSP00000382867:A312S	A	+	1	0	MAGEB16	35731168	0.855000	0.29742	0.019000	0.16419	0.103000	0.19146	2.163000	0.42377	1.864000	0.54056	0.521000	0.50471	GCT		0.488	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251034.1			5	1	5	1
STAG2	10735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	123179197	123179197	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chrX:123179197C>T	ENST00000371160.1	+	8	936	c.646C>T	c.(646-648)Cga>Tga	p.R216*	STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Nonsense_Mutation_p.R216*|STAG2_ENST00000371157.3_Nonsense_Mutation_p.R216*|STAG2_ENST00000354548.5_Nonsense_Mutation_p.R147*|STAG2_ENST00000371144.3_Nonsense_Mutation_p.R216*|STAG2_ENST00000371145.3_Nonsense_Mutation_p.R216*	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	216					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						CAGAGCATTTCGACATACAAG	0.343																																																0													133.0	126.0	129.0					X																	123179197		2203	4300	6503	SO:0001587	stop_gained	10735			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.646C>T	X.37:g.123179197C>T	ENSP00000360202:p.Arg216*	Somatic		WXS	Illumina GAIIx	Phase_I	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Nonsense_Mutation	SNP	ENST00000371160.1	37	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	C	37	6.052955	0.97241	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	.	.	.	4.95	4.03	0.46877	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.371	14.3204	0.66482	0.1482:0.8518:0.0:0.0	.	.	.	.	X	216;216;147;216;216;216;216	.	ENSP00000218089:R216X	R	+	1	2	STAG2	123006878	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.163000	0.50763	2.167000	0.68274	0.422000	0.28245	CGA		0.343	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603		46	18	46	18
RAP1GDS1	5910	broad.mit.edu;ucsc.edu	37	4	99300314	99300314	+	Splice_Site	SNP	G	G	A			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr4:99300314G>A	ENST00000408927.3	+	5	621	c.508G>A	c.(508-510)Gat>Aat	p.D170N	RAP1GDS1_ENST00000512857.1_Intron|RAP1GDS1_ENST00000453712.2_Splice_Site_p.D171N|RAP1GDS1_ENST00000380158.4_Intron|RAP1GDS1_ENST00000339360.5_Splice_Site_p.D171N|RAP1GDS1_ENST00000408900.3_Intron|RAP1GDS1_ENST00000264572.7_Intron	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	170					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		CAATGAGAATGGTAAACAAAA	0.333			T	NUP98	T-ALL																																		Dom	yes		4	4q21-q25	5910	"""RAP1, GTP-GDP dissociation stimulator 1"""		L	0													148.0	141.0	143.0					4																	99300314		1860	4094	5954	SO:0001630	splice_region_variant	5910				CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.508+1G>A	4.37:g.99300314G>A		Somatic		WXS	Illumina GAIIx	Phase_I	E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Splice_Site	SNP	ENST00000408927.3	37	CCDS43253.1	.	.	.	.	.	.	.	.	.	.	G	19.58	3.853728	0.71719	.	.	ENSG00000138698	ENST00000508213;ENST00000408927;ENST00000453712;ENST00000511212;ENST00000339360	T;T;T;T;T	0.69435	0.7;-0.4;-0.4;0.7;-0.4	5.4	5.4	0.78164	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75287	0.3829	L	0.36672	1.1	0.80722	D	1	D;B;P;B	0.69078	0.997;0.446;0.944;0.446	D;B;P;B	0.77004	0.989;0.289;0.548;0.195	T	0.71097	-0.4691	10	0.29301	T	0.29	-13.8944	19.5251	0.95201	0.0:0.0:1.0:0.0	.	170;171;171;170	P52306;Q4QQI8;G5E9P9;B3KNU0	GDS1_HUMAN;.;.;.	N	129;170;171;129;171	ENSP00000426096:D129N;ENSP00000386153:D170N;ENSP00000407157:D171N;ENSP00000421599:D129N;ENSP00000340454:D171N	ENSP00000340454:D171N	D	+	1	0	RAP1GDS1	99519337	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.678000	0.91216	0.655000	0.94253	GAT		0.333	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363273.2	NM_001100426	Missense_Mutation	23	52	23	52
DOCK8	81704	broad.mit.edu;ucsc.edu	37	9	463659	463659	+	Missense_Mutation	SNP	C	C	A			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr9:463659C>A	ENST00000453981.1	+	47	6323	c.6211C>A	c.(6211-6213)Cca>Aca	p.P2071T	DOCK8_ENST00000469391.1_Missense_Mutation_p.P1971T|RP11-165F24.3_ENST00000591577.1_RNA|RP11-165F24.3_ENST00000585819.1_RNA|RP11-165F24.3_ENST00000592805.1_RNA|RP11-165F24.3_ENST00000589287.1_RNA|RP11-165F24.3_ENST00000588474.1_RNA|RP11-165F24.3_ENST00000588989.1_RNA|RP11-165F24.3_ENST00000590518.1_RNA|RP11-165F24.3_ENST00000593137.1_RNA|DOCK8_ENST00000432829.2_Missense_Mutation_p.P2003T|DOCK8_ENST00000382329.1_Missense_Mutation_p.P1538T|RP11-165F24.3_ENST00000586805.1_RNA|RP11-165F24.3_ENST00000415004.2_RNA|RP11-165F24.3_ENST00000589387.1_RNA|RP11-165F24.3_ENST00000608617.1_RNA			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	2071					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ACTGTACAAGCCAATATTCAG	0.478																																																0													52.0	54.0	54.0					9																	463659		2203	4300	6503	SO:0001583	missense	81704			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.6211C>A	9.37:g.463659C>A	ENSP00000408464:p.Pro2071Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	37	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	C	15.59	2.877175	0.51801	.	.	ENSG00000107099	ENST00000453981;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.67345	2.6;2.6;2.63;-0.26	5.16	5.16	0.70880	.	0.112689	0.64402	D	0.000008	T	0.60495	0.2273	L	0.46157	1.445	0.58432	D	0.999994	B;B;B	0.19706	0.038;0.008;0.008	B;B;B	0.19148	0.024;0.024;0.024	T	0.59920	-0.7363	10	0.59425	D	0.04	.	13.5753	0.61870	0.1556:0.8444:0.0:0.0	.	1971;1538;2071	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	T	2071;2003;1971;1538	ENSP00000408464:P2071T;ENSP00000394888:P2003T;ENSP00000419438:P1971T;ENSP00000371766:P1538T	ENSP00000371766:P1538T	P	+	1	0	DOCK8	453659	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.310000	0.59141	2.577000	0.86979	0.655000	0.94253	CCA		0.478	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307		4	32	4	32
CREBBP	1387	broad.mit.edu;hgsc.bcm.edu	37	16	3828795	3828795	+	Frame_Shift_Del	DEL	G	G	-			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr16:3828795delG	ENST00000262367.5	-	9	2656	c.1847delC	c.(1846-1848)cctfs	p.P616fs	CREBBP_ENST00000382070.3_Frame_Shift_Del_p.P578fs	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	616	KIX. {ECO:0000255|PROSITE- ProRule:PRU00311}.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.P616R(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TGCGGGATCAGGTGTTGGGAA	0.468			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	1	Substitution - Missense(1)	lung(1)											170.0	155.0	160.0					16																	3828795		2197	4300	6497	SO:0001589	frameshift_variant	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.1847delC	16.37:g.3828795delG	ENSP00000262367:p.Pro616fs	Somatic		WXS	Illumina GAIIx	Phase_I	D3DUC9|O00147|Q16376|Q4LE28	Frame_Shift_Del	DEL	ENST00000262367.5	37	CCDS10509.1																																																																																				0.468	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380		46	86	46	86
TCF12	6938	broad.mit.edu	37	15	57554314	57554315	+	Frame_Shift_Ins	INS	-	-	T			TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr15:57554314_57554315insT	ENST00000267811.5	+	16	1722_1723	c.1418_1419insT	c.(1417-1422)tctgtcfs	p.V474fs	TCF12_ENST00000559710.1_Frame_Shift_Ins_p.V108fs|TCF12_ENST00000343827.3_Frame_Shift_Ins_p.V304fs|TCF12_ENST00000438423.2_Frame_Shift_Ins_p.V498fs|TCF12_ENST00000557843.1_Frame_Shift_Ins_p.V474fs|TCF12_ENST00000559703.1_Frame_Shift_Ins_p.V132fs|TCF12_ENST00000537840.1_Frame_Shift_Ins_p.V238fs|TCF12_ENST00000333725.5_Frame_Shift_Ins_p.V498fs|TCF12_ENST00000452095.2_Frame_Shift_Ins_p.V494fs|TCF12_ENST00000543579.1_Frame_Shift_Ins_p.V328fs	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	474					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)	p.S497fs*12(1)	TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		CGGGAAGACTCTGTCAGTCTCA	0.351			T	TEC	extraskeletal myxoid chondrosarcoma																																		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	1	Deletion - Frameshift(1)	central_nervous_system(1)																																								SO:0001589	frameshift_variant	6938			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.1419dupT	15.37:g.57554315_57554315dupT	ENSP00000267811:p.Val474fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q7Z3D9|Q86TC1|Q86VM2	Frame_Shift_Ins	INS	ENST00000267811.5	37	CCDS10159.1																																																																																				0.351	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255069.3	NM_003205		6	10	6	10
PTEN	5728	broad.mit.edu	37	10	89685307	89685307	+	Missense_Mutation	SNP	T	T	C	rs398123317		TCGA-HT-8011-01A-11D-2395-08	TCGA-HT-8011-10A-01D-2396-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bbe11ade-61db-4377-80b8-085c8a012162	8f7801c3-5cc4-41ac-a7db-4969f6ea56b7	g.chr10:89685307T>C	ENST00000371953.3	+	3	1559	c.202T>C	c.(202-204)Tac>Cac	p.Y68H		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	68	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.		Y -> H (in CWS1 and BRRS; loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3; retains the ability to bind phospholipid membranes). {ECO:0000269|PubMed:10400993, ECO:0000269|PubMed:11494117, ECO:0000269|PubMed:9600246}.		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.Y68H(8)|p.?(6)|p.R55fs*1(5)|p.Y68N(2)|p.Y68fs*5(2)|p.Y27fs*1(2)|p.I67_Y68insY(1)|p.V54fs*29(1)|p.R55_L70>S(1)|p.F56fs*2(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTACAAGATATACAATCTGTA	0.274		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	66	Whole gene deletion(37)|Deletion - Frameshift(11)|Substitution - Missense(10)|Unknown(6)|Insertion - In frame(1)|Complex - deletion inframe(1)	prostate(16)|central_nervous_system(15)|skin(7)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|lung(5)|ovary(4)|urinary_tract(2)|breast(2)|large_intestine(1)|soft_tissue(1)|kidney(1)|pancreas(1)	GRCh37	CM061927|CM981667	PTEN	M							41.0	42.0	42.0					10																	89685307		2186	4275	6461	SO:0001583	missense	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.202T>C	10.37:g.89685307T>C	ENSP00000361021:p.Tyr68His	Somatic		WXS	Illumina GAIIx	Phase_I	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	37	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.403642	0.83230	.	.	ENSG00000171862	ENST00000371953	D	0.98633	-5.04	5.46	5.46	0.80206	Phosphatase tensin type (1);	0.000000	0.85682	D	0.000000	D	0.99399	0.9788	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98514	1.0620	9	.	.	.	-6.2149	15.5246	0.75894	0.0:0.0:0.0:1.0	.	68	P60484	PTEN_HUMAN	H	68	ENSP00000361021:Y68H	.	Y	+	1	0	PTEN	89675287	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.448000	0.80631	2.072000	0.62099	0.533000	0.62120	TAC		0.274	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314		2	2	2	2
