#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count
API5	8539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	43343605	43343605	+	Silent	SNP	C	C	T			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr11:43343605C>T	ENST00000531273.1	+	5	601	c.462C>T	c.(460-462)ttC>ttT	p.F154F	API5_ENST00000378852.3_Silent_p.F154F|API5_ENST00000455725.2_Silent_p.F143F|API5_ENST00000534695.1_Intron|API5_ENST00000534600.1_Silent_p.F154F|API5_ENST00000420461.2_Silent_p.F100F			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5	154	ARM-like and Heat-like helical repeats.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						CAATTAAATTCCTTTCTACAA	0.378																																					Pancreas(1;98 122 5625 20895 49453)											0													109.0	110.0	109.0					11																	43343605		2203	4300	6503	SO:0001819	synonymous_variant	8539			U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	ENST00000531273.1:c.462C>T	11.37:g.43343605C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Silent	SNP	ENST00000531273.1	37	CCDS44572.1																																																																																				0.378	API5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389545.1	NM_006595		21	52	21	52
OR4X1	390113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	48285528	48285528	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr11:48285528G>A	ENST00000320048.1	+	1	116	c.116G>A	c.(115-117)gGc>gAc	p.G39D		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						GTTGTGCTGGGCAATGGCCTC	0.463																																																0													178.0	160.0	166.0					11																	48285528		2201	4298	6499	SO:0001583	missense	390113			AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.116G>A	11.37:g.48285528G>A	ENSP00000321506:p.Gly39Asp	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IF74	Missense_Mutation	SNP	ENST00000320048.1	37	CCDS31487.1	.	.	.	.	.	.	.	.	.	.	G	12.19	1.864152	0.32977	.	.	ENSG00000176567	ENST00000320048	T	0.00538	6.71	4.15	4.15	0.48705	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.03178	0.0093	H	0.96301	3.8	0.18873	N	0.999985	D	0.76494	0.999	D	0.64144	0.922	T	0.16928	-1.0386	9	0.87932	D	0	.	9.5157	0.39104	0.0:0.0:0.7894:0.2106	.	39	Q8NH49	OR4X1_HUMAN	D	39	ENSP00000321506:G39D	ENSP00000321506:G39D	G	+	2	0	OR4X1	48242104	0.948000	0.32251	0.998000	0.56505	0.111000	0.19643	3.673000	0.54591	2.270000	0.75569	0.563000	0.77884	GGC		0.463	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383373.1	NM_001004726		11	31	11	31
MYO7A	4647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	76873968	76873968	+	Missense_Mutation	SNP	A	A	G			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr11:76873968A>G	ENST00000409709.3	+	14	1896	c.1624A>G	c.(1624-1626)Aag>Gag	p.K542E	MYO7A_ENST00000458637.2_Missense_Mutation_p.K542E|MYO7A_ENST00000409893.1_Missense_Mutation_p.K542E|MYO7A_ENST00000409619.2_Missense_Mutation_p.K531E	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	542	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CATCCCCCCCAAGAACAACCA	0.567																																																0													208.0	230.0	223.0					11																	76873968		2101	4216	6317	SO:0001583	missense	4647			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.1624A>G	11.37:g.76873968A>G	ENSP00000386331:p.Lys542Glu	Somatic		WXS	Illumina GAIIx	Phase_I	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	37	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.560238	0.86335	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000343419	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	5.02	5.02	0.67125	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.83339	0.5233	M	0.84433	2.695	0.80722	D	1	P;D;P	0.58620	0.911;0.983;0.798	P;P;P	0.59357	0.7;0.856;0.676	D	0.86674	0.1912	10	0.87932	D	0	.	14.8886	0.70590	1.0:0.0:0.0:0.0	.	542;542;542	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	E	542;542;542;531;541;541;541	ENSP00000386331:K542E;ENSP00000386689:K542E;ENSP00000392185:K542E;ENSP00000386635:K531E	ENSP00000340325:K541E	K	+	1	0	MYO7A	76551616	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	8.761000	0.91691	2.107000	0.64212	0.402000	0.26972	AAG		0.567	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260		98	165	98	165
POSTN	10631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	38171320	38171320	+	Splice_Site	SNP	C	C	T			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr13:38171320C>T	ENST00000379747.4	-	2	336		c.e2+1		POSTN_ENST00000379743.4_Splice_Site|POSTN_ENST00000379742.4_Splice_Site|POSTN_ENST00000541481.1_Splice_Site|POSTN_ENST00000379749.4_Splice_Site|POSTN_ENST00000541179.1_Splice_Site	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor						cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		AAGAGACTTACGTTTTCTGTC	0.378																																																0													90.0	88.0	89.0					13																	38171320		2203	4300	6503	SO:0001630	splice_region_variant	10631			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.218+1G>A	13.37:g.38171320C>T		Somatic		WXS	Illumina GAIIx	Phase_I	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Splice_Site	SNP	ENST00000379747.4	37	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.013700	0.75161	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8424	0.96695	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	POSTN	37069320	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	7.433000	0.80362	2.764000	0.94973	0.655000	0.94253	.		0.378	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	Intron	12	14	12	14
PPL	5493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	4944606	4944606	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr16:4944606C>T	ENST00000345988.2	-	12	1345	c.1256G>A	c.(1255-1257)cGg>cAg	p.R419Q	PPL_ENST00000590782.2_Missense_Mutation_p.R417Q	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	419					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						GCTGTAGCCCCGCGAGATCAG	0.647																																																0													82.0	65.0	71.0					16																	4944606		2197	4300	6497	SO:0001583	missense	5493			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.1256G>A	16.37:g.4944606C>T	ENSP00000340510:p.Arg419Gln	Somatic		WXS	Illumina GAIIx	Phase_I	O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	37	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407678	0.83340	.	.	ENSG00000118898	ENST00000345988	T	0.74842	-0.88	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.82572	0.5066	L	0.43923	1.385	0.58432	D	0.999997	D	0.89917	1.0	D	0.79108	0.992	T	0.82675	-0.0340	10	0.54805	T	0.06	.	19.1278	0.93393	0.0:1.0:0.0:0.0	.	419	O60437	PEPL_HUMAN	Q	419	ENSP00000340510:R419Q	ENSP00000340510:R419Q	R	-	2	0	PPL	4884607	1.000000	0.71417	0.861000	0.33841	0.385000	0.30292	7.182000	0.77689	2.756000	0.94617	0.561000	0.74099	CGG		0.647	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705		19	52	19	52
CDYL2	124359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	80718589	80718589	+	Silent	SNP	G	G	A	rs140729164		TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr16:80718589G>A	ENST00000570137.2	-	2	617	c.462C>T	c.(460-462)aaC>aaT	p.N154N	CDYL2_ENST00000566173.1_Silent_p.N154N|CDYL2_ENST00000562812.1_Silent_p.N154N|CDYL2_ENST00000563890.1_Silent_p.N154N|CDYL2_ENST00000562753.1_5'UTR	NM_152342.2	NP_689555.2	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	154						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	21						TTTCCATCCCGTTCTGAGACT	0.532																																																0								G		0,4406		0,0,2203	98.0	103.0	101.0		462	-5.1	0.0	16	dbSNP_134	101	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CDYL2	NM_152342.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		154/507	80718589	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	124359			AK096185	CCDS32493.1	16q23.2	2008-02-05	2003-09-12			ENSG00000166446			23030	protein-coding gene	gene with protein product			"""chromodomain Y-like protein 2"""			12837688	Standard	NM_152342		Approved	FLJ38866	uc002ffs.3	Q8N8U2		ENST00000570137.2:c.462C>T	16.37:g.80718589G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q7Z5I8	Silent	SNP	ENST00000570137.2	37	CCDS32493.1																																																																																				0.532	CDYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434727.2	NM_152342		24	78	24	78
DHRS11	79154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	34958397	34958397	+	IGR	SNP	T	T	C			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr17:34958397T>C	ENST00000251312.5	+	0	1598				MRM1_ENST00000585770.1_5'UTR|MRM1_ENST00000250156.7_Missense_Mutation_p.F53S	NM_024308.3	NP_077284.2	Q6UWP2	DHR11_HUMAN	dehydrogenase/reductase (SDR family) member 11							extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			endometrium(1)|lung(4)	5						GAGCTTCTGTTTGGCATGACC	0.692																																																0													70.0	71.0	70.0					17																	34958397		2203	4300	6503	SO:0001628	intergenic_variant	79922				CCDS11315.2	17q12	2014-05-06			ENSG00000108272	ENSG00000278535		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	28639	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 24C, member 1"""					12975309, 19027726	Standard	NM_024308		Approved	MGC4172, SDR24C1	uc002hnd.3	Q6UWP2	OTTHUMG00000188442		17.37:g.34958397T>C		Somatic		WXS	Illumina GAIIx	Phase_I	B2RDZ3|Q9BUC7|Q9H674	Missense_Mutation	SNP	ENST00000251312.5	37	CCDS11315.2	.	.	.	.	.	.	.	.	.	.	T	20.4	3.979428	0.74360	.	.	ENSG00000129282	ENST00000250156	T	0.32515	1.45	4.79	2.36	0.29203	RNA 2-O ribose methyltransferase, substrate binding (2);	0.055963	0.64402	D	0.000001	T	0.51024	0.1650	M	0.77486	2.375	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.45220	-0.9276	10	0.54805	T	0.06	-7.5845	8.0404	0.30519	0.3939:0.0:0.0:0.6061	.	53	Q6IN84	MRM1_HUMAN	S	53	ENSP00000250156:F53S	ENSP00000250156:F53S	F	+	2	0	MRM1	32032510	1.000000	0.71417	0.985000	0.45067	0.738000	0.42128	4.941000	0.63540	0.295000	0.22570	0.454000	0.30748	TTT		0.692	DHRS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256681.2	NM_024308		48	105	48	105
PLIN4	729359	hgsc.bcm.edu;ucsc.edu	37	19	4512847	4512847	+	Silent	SNP	G	G	A	rs61730743	byFrequency	TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr19:4512847G>A	ENST00000301286.3	-	3	1082	c.1083C>T	c.(1081-1083)acC>acT	p.T361T		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	361	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						TCACGGCACCGGTCACCCCAC	0.577													T|||	244	0.048722	0.1725	0.0072	5008	,	,		18609	0.0		0.001	False		,,,				2504	0.0102															0								G		224,3154		20,184,1485	40.0	67.0	59.0		1083	-9.2	0.0	19	dbSNP_129	59	7,8229		0,7,4111	no	coding-synonymous	PLIN4	NM_001080400.1		20,191,5596	AA,AG,GG		0.085,6.6311,1.989		361/1358	4512847	231,11383	1689	4118	5807	SO:0001819	synonymous_variant	729359			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.1083C>T	19.37:g.4512847G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A6NEI2	Silent	SNP	ENST00000301286.3	37	CCDS45927.1																																																																																				0.577	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901		41	80	41	80
CBLC	23624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	45284225	45284225	+	Silent	SNP	C	C	T			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr19:45284225C>T	ENST00000270279.3	+	2	480	c.417C>T	c.(415-417)ttC>ttT	p.F139F	CBLC_ENST00000341505.4_Silent_p.F139F	NM_012116.3	NP_036248.3	Q9ULV8	CBLC_HUMAN	Cbl proto-oncogene C, E3 ubiquitin protein ligase	139	4H.|Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of MAP kinase activity (GO:0043407)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|ligase activity (GO:0016874)|phosphotyrosine binding (GO:0001784)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(6)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				ACGCACTCTTCCCCGGGGGAA	0.617			M		AML																																		Rec	yes		19	19q13.2	23624	Cas-Br-M (murine) ecotropic retroviral transforming sequence c		L	0													77.0	70.0	73.0					19																	45284225		2203	4300	6503	SO:0001819	synonymous_variant	23624			AB028645	CCDS12643.1, CCDS46109.1	19q13.2	2013-07-09	2013-07-09		ENSG00000142273	ENSG00000142273		"""RING-type (C3HC4) zinc fingers"""	15961	protein-coding gene	gene with protein product		608453	"""Cas-Br-M (murine) ectropic retroviral transforming sequence c"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence c"""			10362357, 10571044	Standard	NM_012116		Approved	CBL-3, CBL-SL, RNF57	uc002ozs.3	Q9ULV8	OTTHUMG00000150715	ENST00000270279.3:c.417C>T	19.37:g.45284225C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q8N1E5|Q9Y5Z2|Q9Y5Z3	Silent	SNP	ENST00000270279.3	37	CCDS12643.1																																																																																				0.617	CBLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319732.2	NM_012116		28	35	28	35
NLRP5	126206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	56515295	56515295	+	Silent	SNP	C	C	T			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr19:56515295C>T	ENST00000390649.3	+	2	276	c.276C>T	c.(274-276)acC>acT	p.T92T		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	92	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CAGAATCGACCACATGCTCTA	0.453																																																0													89.0	86.0	87.0					19																	56515295		1965	4165	6130	SO:0001819	synonymous_variant	126206			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.276C>T	19.37:g.56515295C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A8MTY4|Q86W29	Silent	SNP	ENST00000390649.3	37	CCDS12938.1																																																																																				0.453	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447		17	18	17	18
INTS3	65123	hgsc.bcm.edu;broad.mit.edu	37	1	153730172	153730172	+	Missense_Mutation	SNP	A	A	G			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr1:153730172A>G	ENST00000318967.2	+	10	1650	c.1082A>G	c.(1081-1083)aAt>aGt	p.N361S	INTS3_ENST00000456435.1_Missense_Mutation_p.N155S|INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000435409.2_Missense_Mutation_p.N361S|INTS3_ENST00000512605.1_Missense_Mutation_p.N155S	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	362					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CACCCTTCTAATGAAGTACTG	0.527																																																0													135.0	112.0	120.0					1																	153730172		2203	4300	6503	SO:0001583	missense	65123			BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.1082A>G	1.37:g.153730172A>G	ENSP00000318641:p.Asn361Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	ENST00000318967.2	37	CCDS1052.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.571025	0.86542	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.76513	0.3998	M	0.89414	3.03	0.58432	D	0.999991	D;D;D	0.69078	0.996;0.997;0.996	D;D;D	0.74348	0.971;0.983;0.971	T	0.81642	-0.0840	9	0.72032	D	0.01	.	12.232	0.54492	1.0:0.0:0.0:0.0	.	155;362;361	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	S	361;155;361;155	.	ENSP00000318641:N361S	N	+	2	0	INTS3	151996796	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.082000	0.89513	1.994000	0.58287	0.374000	0.22700	AAT		0.527	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015		7	94	7	94
SPTA1	6708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	158612230	158612230	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr1:158612230C>T	ENST00000368147.4	-	33	4888	c.4708G>A	c.(4708-4710)Gct>Act	p.A1570T		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1570				Missing (in Ref. 1; AAA60577/AAA60994 and 7; AAA60569). {ECO:0000305}.	actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CCATCACAAGCGCTACACTCA	0.453																																																0													106.0	106.0	106.0					1																	158612230		1972	4169	6141	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4708G>A	1.37:g.158612230C>T	ENSP00000357129:p.Ala1570Thr	Somatic		WXS	Illumina GAIIx	Phase_I	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	9.726	1.160890	0.21538	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.35789	1.29;1.35	5.26	4.35	0.52113	.	0.571149	0.13226	N	0.403989	T	0.22126	0.0533	L	0.36672	1.1	0.25252	N	0.989664	P	0.47962	0.903	P	0.49477	0.612	T	0.15723	-1.0427	10	0.22109	T	0.4	.	15.8535	0.78956	0.0:0.9269:0.0:0.0731	.	1570	P02549	SPTA1_HUMAN	T	1570	ENSP00000357130:A1570T;ENSP00000357129:A1570T	ENSP00000357129:A1570T	A	-	1	0	SPTA1	156878854	1.000000	0.71417	0.045000	0.18777	0.001000	0.01503	5.127000	0.64727	0.806000	0.34183	-0.797000	0.03246	GCT		0.453	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		21	81	21	81
CDC73	79577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	193111017	193111017	+	Missense_Mutation	SNP	G	G	C			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr1:193111017G>C	ENST00000367435.3	+	7	734	c.550G>C	c.(550-552)Gca>Cca	p.A184P		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	184				AIKA -> CNQT (in Ref. 2; BAB15608). {ECO:0000305}.	cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						AAAAATTGCTGCAATCAAAGC	0.348																																																0													51.0	47.0	48.0					1																	193111017		2203	4300	6503	SO:0001583	missense	79577			AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.550G>C	1.37:g.193111017G>C	ENSP00000356405:p.Ala184Pro	Somatic		WXS	Illumina GAIIx	Phase_I	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	ENST00000367435.3	37	CCDS1382.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.576953	0.86645	.	.	ENSG00000134371	ENST00000367435;ENST00000445394	D	0.86865	-2.18	6.03	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.92652	0.7665	M	0.77616	2.38	0.80722	D	1	D	0.63046	0.992	D	0.63488	0.915	D	0.92472	0.5986	10	0.42905	T	0.14	-17.1651	16.5522	0.84475	0.0:0.0:0.8684:0.1316	.	184	Q6P1J9	CDC73_HUMAN	P	184	ENSP00000356405:A184P	ENSP00000356405:A184P	A	+	1	0	CDC73	191377640	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.623000	0.98386	1.515000	0.48885	0.655000	0.94253	GCA		0.348	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529		10	13	10	13
URB2	9816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	229772950	229772950	+	Missense_Mutation	SNP	A	A	G			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr1:229772950A>G	ENST00000258243.2	+	4	2726	c.2590A>G	c.(2590-2592)Ata>Gta	p.I864V		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	864						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						ACCCGAAGGTATAGAACCTAG	0.502																																																0													87.0	90.0	89.0					1																	229772950		2203	4300	6503	SO:0001583	missense	9816			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.2590A>G	1.37:g.229772950A>G	ENSP00000258243:p.Ile864Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	37	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-2.006860	0.00426	.	.	ENSG00000135763	ENST00000258243	T	0.28895	1.59	4.95	-9.32	0.00643	.	1.541840	0.03467	N	0.213099	T	0.07954	0.0199	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16660	-1.0395	9	.	.	.	0.577	3.4998	0.07669	0.5121:0.1474:0.191:0.1495	.	864	Q14146	URB2_HUMAN	V	864	ENSP00000258243:I864V	.	I	+	1	0	URB2	227839573	0.000000	0.05858	0.000000	0.03702	0.078000	0.17371	-0.635000	0.05471	-1.843000	0.01179	-3.003000	0.00076	ATA		0.502	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777		41	78	41	78
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	C	T	rs121913500		TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr2:209113112C>T	ENST00000415913.1	-	4	776	c.395G>A	c.(394-396)cGt>cAt	p.R132H	IDH1_ENST00000446179.1_Missense_Mutation_p.R132H|IDH1_ENST00000345146.2_Missense_Mutation_p.R132H	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132H(2774)|p.R132L(59)|p.R132V(1)|p.G131_R132>VL(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	2835	Substitution - Missense(2834)|Complex - compound substitution(1)	central_nervous_system(2579)|haematopoietic_and_lymphoid_tissue(205)|bone(43)|prostate(4)|biliary_tract(2)|urinary_tract(1)|skin(1)											79.0	73.0	75.0					2																	209113112		2203	4300	6503	SO:0001583	missense	3417				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.395G>A	2.37:g.209113112C>T	ENSP00000390265:p.Arg132His	Somatic		WXS	Illumina GAIIx	Phase_I	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657324	0.88154	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	4.69	0.59074	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93145	0.7817	H	0.99379	4.54	0.80722	D	1	B	0.25486	0.127	B	0.25405	0.06	D	0.92324	0.5868	10	0.87932	D	0	-20.0399	14.3783	0.66895	0.0:0.9288:0.0:0.0712	.	132	O75874	IDHC_HUMAN	H	132	ENSP00000260985:R132H;ENSP00000410513:R132H;ENSP00000390265:R132H;ENSP00000391075:R132H	ENSP00000260985:R132H	R	-	2	0	IDH1	208821357	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.088000	0.71371	1.356000	0.45884	0.555000	0.69702	CGT		0.393	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1			22	39	22	39
STK36	27148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	219544418	219544418	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr2:219544418C>T	ENST00000295709.3	+	8	1193	c.914C>T	c.(913-915)gCc>gTc	p.A305V	STK36_ENST00000440309.1_Missense_Mutation_p.A305V|STK36_ENST00000392105.3_Missense_Mutation_p.A305V|STK36_ENST00000392106.2_Missense_Mutation_p.A305V	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		TTGACTCAGGCCTATAAACGC	0.557																																																0													51.0	55.0	53.0					2																	219544418		2203	4300	6503	SO:0001583	missense	27148			AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.914C>T	2.37:g.219544418C>T	ENSP00000295709:p.Ala305Val	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000295709.3	37	CCDS2421.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.034137	0.54896	.	.	ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74	5.38	5.38	0.77491	.	0.000000	0.45126	D	0.000386	T	0.70962	0.3284	L	0.29908	0.895	0.58432	D	0.999996	P;P	0.45594	0.633;0.862	B;P	0.46208	0.206;0.507	T	0.74825	-0.3533	10	0.72032	D	0.01	-16.5973	17.5021	0.87734	0.0:1.0:0.0:0.0	.	305;305	Q9NRP7-2;Q9NRP7	.;STK36_HUMAN	V	305	ENSP00000295709:A305V;ENSP00000375955:A305V;ENSP00000375954:A305V;ENSP00000394095:A305V	ENSP00000295709:A305V	A	+	2	0	STK36	219252662	1.000000	0.71417	0.977000	0.42913	0.295000	0.27426	3.487000	0.53222	2.802000	0.96397	0.655000	0.94253	GCC		0.557	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2			21	50	21	50
ARMC9	80210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	232135764	232135764	+	Missense_Mutation	SNP	G	G	C			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr2:232135764G>C	ENST00000349938.4	+	13	1383	c.1189G>C	c.(1189-1191)Gct>Cct	p.A397P	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	397						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		GCTCATCAATGCTTTTGCGTC	0.493																																																0													103.0	84.0	90.0					2																	232135764		2203	4300	6503	SO:0001583	missense	80210			BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.1189G>C	2.37:g.232135764G>C	ENSP00000258417:p.Ala397Pro	Somatic		WXS	Illumina GAIIx	Phase_I	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Missense_Mutation	SNP	ENST00000349938.4	37	CCDS2484.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.8|25.8	4.676073|4.676073	0.88445|0.88445	.|.	.|.	ENSG00000135931|ENSG00000135931	ENST00000349938;ENST00000359743;ENST00000436339;ENST00000446447|ENST00000424740	T;T;T|.	0.53423|.	0.62;0.62;0.62|.	4.56|4.56	4.56|4.56	0.56223|0.56223	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.054255|.	0.64402|.	D|.	0.000001|.	T|T	0.72985|0.72985	0.3529|0.3529	M|M	0.70275|0.70275	2.135|2.135	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.76494|.	0.999|.	D|.	0.72338|.	0.977|.	T|T	0.73304|0.73304	-0.4025|-0.4025	10|5	0.72032|.	D|.	0.01|.	-17.0194|-17.0194	15.1191|15.1191	0.72429|0.72429	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	397|.	Q7Z3E5|.	ARMC9_HUMAN|.	P|I	397;397;114;39|99	ENSP00000258417:A397P;ENSP00000392086:A114P;ENSP00000411778:A39P|.	ENSP00000258417:A397P|.	A|M	+|+	1|3	0|0	ARMC9|ARMC9	231844008|231844008	1.000000|1.000000	0.71417|0.71417	0.470000|0.470000	0.27216|0.27216	0.989000|0.989000	0.77384|0.77384	8.963000|8.963000	0.93385|0.93385	2.469000|2.469000	0.83416|0.83416	0.650000|0.650000	0.86243|0.86243	GCT|ATG		0.493	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	NM_025139		12	37	12	37
CD96	10225	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	111319659	111319659	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr3:111319659C>T	ENST00000283285.5	+	8	1164	c.1033C>T	c.(1033-1035)Cca>Tca	p.P345S	CD96_ENST00000352690.4_Missense_Mutation_p.P329S|CD96_ENST00000438817.2_Missense_Mutation_p.P329S	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	345	Ig-like C2-type.				cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						TAGTAATAAACCAGCCCAATC	0.378									Opitz Trigonocephaly syndrome																																							0													114.0	114.0	114.0					3																	111319659		2203	4300	6503	SO:0001583	missense	10225	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.1033C>T	3.37:g.111319659C>T	ENSP00000283285:p.Pro345Ser	Somatic		WXS	Illumina GAIIx	Phase_I	Q5JPB3	Missense_Mutation	SNP	ENST00000283285.5	37	CCDS2959.1	.	.	.	.	.	.	.	.	.	.	C	3.290	-0.145105	0.06627	.	.	ENSG00000153283	ENST00000352690;ENST00000283285;ENST00000438817	T;T;T	0.64085	-0.06;-0.08;-0.07	5.04	0.888	0.19206	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.578294	0.16707	N	0.202880	T	0.38453	0.1041	N	0.17082	0.46	0.09310	N	1	B;B;B;B	0.30179	0.271;0.23;0.058;0.058	B;B;B;B	0.32805	0.153;0.094;0.056;0.056	T	0.17349	-1.0372	10	0.21540	T	0.41	-1.1036	4.0208	0.09665	0.1664:0.5227:0.0:0.3109	.	329;329;345;329	E9PEJ1;P40200-2;P40200;Q8WUE2	.;.;TACT_HUMAN;.	S	329;345;329	ENSP00000342040:P329S;ENSP00000283285:P345S;ENSP00000389801:P329S	ENSP00000283285:P345S	P	+	1	0	CD96	112802349	0.000000	0.05858	0.239000	0.24122	0.408000	0.30992	-0.532000	0.06164	0.178000	0.19917	0.650000	0.86243	CCA		0.378	CD96-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354312.2			18	44	18	44
SLIT2	9353	hgsc.bcm.edu;broad.mit.edu	37	4	20618726	20618726	+	Silent	SNP	G	G	A			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr4:20618726G>A	ENST00000504154.1	+	35	4293	c.4041G>A	c.(4039-4041)caG>caA	p.Q1347Q	SLIT2_ENST00000273739.5_Silent_p.Q1360Q|SLIT2_ENST00000503837.1_Silent_p.Q1343Q|SLIT2_ENST00000503823.1_Silent_p.Q1339Q	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1347	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GCACATGCCAGCCCAGCAGCC	0.577																																																0													56.0	55.0	55.0					4																	20618726		2203	4300	6503	SO:0001819	synonymous_variant	9353			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.4041G>A	4.37:g.20618726G>A		Somatic		WXS	Illumina GAIIx	Phase_I	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	37	CCDS3426.1																																																																																				0.577	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			7	75	7	75
ATP8A1	10396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	42414962	42414962	+	Missense_Mutation	SNP	T	T	C			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr4:42414962T>C	ENST00000381668.5	-	37	3697	c.3466A>G	c.(3466-3468)Acc>Gcc	p.T1156A	ATP8A1_ENST00000264449.10_Missense_Mutation_p.T1141A	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	1156					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	TGTTTCGTGGTATCATATGCT	0.463																																																0													167.0	122.0	138.0					4																	42414962		2203	4300	6503	SO:0001583	missense	10396			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.3466A>G	4.37:g.42414962T>C	ENSP00000371084:p.Thr1156Ala	Somatic		WXS	Illumina GAIIx	Phase_I	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	37	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.857908	0.91433	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.62232	0.06;0.04	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.80116	0.4564	M	0.86502	2.82	0.80722	D	1	D;D;D	0.69078	0.997;0.989;0.989	P;P;P	0.60949	0.839;0.881;0.881	D	0.84188	0.0443	10	0.87932	D	0	.	15.9839	0.80133	0.0:0.0:0.0:1.0	.	1141;1156;1148	Q32M35;Q9Y2Q0;E7EUK4	.;AT8A1_HUMAN;.	A	1156;1141	ENSP00000371084:T1156A;ENSP00000264449:T1141A	ENSP00000264449:T1141A	T	-	1	0	ATP8A1	42109719	1.000000	0.71417	0.989000	0.46669	0.955000	0.61496	7.418000	0.80167	2.171000	0.68590	0.482000	0.46254	ACC		0.463	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095		10	47	10	47
FAT4	79633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	126373545	126373545	+	Missense_Mutation	SNP	C	C	T	rs201859188		TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr4:126373545C>T	ENST00000394329.3	+	9	11387	c.11374C>T	c.(11374-11376)Cgg>Tgg	p.R3792W	FAT4_ENST00000335110.5_Missense_Mutation_p.R2090W	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3792					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GATCCTTCTCCGGCAGAGTGG	0.483																																																0								C	TRP/ARG	0,4406		0,0,2203	69.0	68.0	68.0		11374	2.8	0.3	4		68	1,8599	1.2+/-3.3	0,1,4299	no	missense	FAT4	NM_024582.4	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	3792/4982	126373545	1,13005	2203	4300	6503	SO:0001583	missense	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.11374C>T	4.37:g.126373545C>T	ENSP00000377862:p.Arg3792Trp	Somatic		WXS	Illumina GAIIx	Phase_I	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	15.68	2.904362	0.52333	0.0	1.16E-4	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.76186	-0.86;-1.0	5.66	2.85	0.33270	.	0.000000	0.31747	U	0.007130	T	0.78679	0.4321	L	0.40543	1.245	0.46798	D	0.999203	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.987;0.994	T	0.77088	-0.2717	10	0.72032	D	0.01	.	10.3233	0.43780	0.3927:0.4807:0.1265:0.0	.	2090;3792;3792	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	W	3792;2090	ENSP00000377862:R3792W;ENSP00000335169:R2090W	ENSP00000335169:R2090W	R	+	1	2	FAT4	126592995	0.998000	0.40836	0.311000	0.25182	0.850000	0.48378	1.403000	0.34612	0.270000	0.21984	0.561000	0.74099	CGG		0.483	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		18	61	18	61
KIF4B	285643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	154395557	154395557	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr5:154395557G>A	ENST00000435029.4	+	1	2298	c.2138G>A	c.(2137-2139)cGa>cAa	p.R713Q		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	713	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.G748V(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GCCAACAAGCGACTCAAGGAT	0.483																																																2	Substitution - Missense(2)	ovary(2)											88.0	89.0	88.0					5																	154395557		2203	4300	6503	SO:0001583	missense	285643			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2138G>A	5.37:g.154395557G>A	ENSP00000387875:p.Arg713Gln	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000435029.4	37	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	g	18.39	3.613083	0.66672	.	.	ENSG00000226650	ENST00000435029	T	0.12984	2.63	2.54	2.54	0.30619	.	.	.	.	.	T	0.32102	0.0818	M	0.73372	2.23	0.52099	D	0.999948	D	0.89917	1.0	D	0.97110	1.0	T	0.03184	-1.1063	9	0.37606	T	0.19	.	10.7682	0.46305	0.0:0.0:1.0:0.0	.	713	Q2VIQ3	KIF4B_HUMAN	Q	713	ENSP00000387875:R713Q	ENSP00000387875:R713Q	R	+	2	0	KIF4B	154375750	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	4.386000	0.59620	1.138000	0.42230	0.563000	0.77884	CGA		0.483	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			29	72	29	72
GPRC6A	222545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	117130562	117130562	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr6:117130562G>A	ENST00000310357.3	-	2	434	c.413C>T	c.(412-414)cCa>cTa	p.P138L	GPRC6A_ENST00000368549.3_Missense_Mutation_p.P138L|GPRC6A_ENST00000530250.1_Missense_Mutation_p.P138L	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	138					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		CTTAACTCTTGGCATGTAGCT	0.443																																																0													96.0	91.0	93.0					6																	117130562		2203	4300	6503	SO:0001583	missense	222545			AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.413C>T	6.37:g.117130562G>A	ENSP00000309493:p.Pro138Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.543375	0.86022	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	D;D;D	0.86297	-2.1;-2.1;-2.1	4.86	4.86	0.63082	Extracellular ligand-binding receptor (1);	0.303270	0.28946	N	0.013636	D	0.93035	0.7783	M	0.81682	2.555	0.45806	D	0.998687	D;D;D	0.89917	0.998;0.999;1.0	D;D;D	0.85130	0.959;0.964;0.997	D	0.93612	0.6940	10	0.72032	D	0.01	.	18.182	0.89781	0.0:0.0:1.0:0.0	.	138;138;138	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	L	138	ENSP00000309493:P138L;ENSP00000357537:P138L;ENSP00000433465:P138L	ENSP00000309493:P138L	P	-	2	0	GPRC6A	117237255	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	8.467000	0.90390	2.531000	0.85337	0.585000	0.79938	CCA		0.443	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			13	39	13	39
CLIP2	7461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	73770855	73770855	+	Missense_Mutation	SNP	G	G	A			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr7:73770855G>A	ENST00000395060.1	+	4	919	c.919G>A	c.(919-921)Ggt>Agt	p.G307S	CLIP2_ENST00000223398.6_Missense_Mutation_p.G307S|CLIP2_ENST00000361545.5_Missense_Mutation_p.G307S			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	307						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						TATGGCCATGGGTGTGTCAGC	0.617																																																0													112.0	90.0	97.0					7																	73770855		2203	4300	6503	SO:0001583	missense	7461			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.919G>A	7.37:g.73770855G>A	ENSP00000378500:p.Gly307Ser	Somatic		WXS	Illumina GAIIx	Phase_I	O14527|O43611	Missense_Mutation	SNP	ENST00000395060.1	37	CCDS5569.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.959703	0.92791	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	T;T;T	0.72615	-0.67;-0.67;-0.67	4.98	4.98	0.66077	Cytoskeleton-associated protein, Gly-rich domain (1);	0.000000	0.85682	D	0.000000	T	0.74313	0.3700	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.66960	-0.5791	10	0.05351	T	0.99	-20.3597	16.9936	0.86360	0.0:0.0:1.0:0.0	.	307;307	Q9UDT6-2;Q9UDT6	.;CLIP2_HUMAN	S	307	ENSP00000223398:G307S;ENSP00000355151:G307S;ENSP00000378500:G307S	ENSP00000223398:G307S	G	+	1	0	CLIP2	73408791	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.245000	0.95431	2.584000	0.87258	0.561000	0.74099	GGT		0.617	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388		26	74	26	74
SLC52A2	79581	hgsc.bcm.edu;broad.mit.edu	37	8	145584537	145584537	+	Silent	SNP	G	G	C			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr8:145584537G>C	ENST00000532887.1	+	5	1783	c.1200G>C	c.(1198-1200)ggG>ggC	p.G400G	SLC52A2_ENST00000540505.1_Silent_p.G312G|SLC52A2_ENST00000530047.1_Silent_p.G400G|FBXL6_ENST00000331890.5_5'Flank|SLC52A2_ENST00000329994.2_Silent_p.G400G|SLC52A2_ENST00000526752.1_Missense_Mutation_p.G69R|SLC52A2_ENST00000527078.1_Silent_p.G400G|SLC52A2_ENST00000402965.1_Silent_p.G400G|FBXL6_ENST00000455319.2_5'Flank			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	400					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	TGCATGGCGGGGGCCGGCCGG	0.657																																																0													74.0	66.0	69.0					8																	145584537		2203	4300	6503	SO:0001819	synonymous_variant	79581			AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.1200G>C	8.37:g.145584537G>C		Somatic		WXS	Illumina GAIIx	Phase_I	A8K6B6|D3DWL8|G1UCY1|Q86UT1	Missense_Mutation	SNP	ENST00000532887.1	37	CCDS6423.1	.	.	.	.	.	.	.	.	.	.	G	4.712	0.132306	0.08981	.	.	ENSG00000185803	ENST00000526752	D	0.89485	-2.52	5.25	-7.06	0.01568	.	0.125040	0.51477	D	0.000082	D	0.84660	0.5521	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	T	0.75654	-0.3243	7	0.87932	D	0	.	1.0941	0.01669	0.3624:0.3:0.1319:0.2057	.	.	.	.	R	69	ENSP00000433796:G69R	ENSP00000433796:G69R	G	+	1	0	GPR172A	145555345	0.000000	0.05858	0.033000	0.17914	0.487000	0.33371	-2.107000	0.01337	-0.896000	0.03915	0.456000	0.33151	GGG		0.657	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382405.1	NM_024531		9	116	9	116
ARHGAP6	395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	11174686	11174686	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chrX:11174686C>T	ENST00000337414.4	-	10	2742	c.1870G>A	c.(1870-1872)Gtg>Atg	p.V624M	ARHGAP6_ENST00000413512.3_Missense_Mutation_p.V433M|ARHGAP6_ENST00000380732.3_Missense_Mutation_p.V656M|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.V624M|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.V421M|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.V449M|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.V421M	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	624					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						AAATAGTCCACGACATCAGGA	0.443																																																0													106.0	82.0	90.0					X																	11174686		2203	4300	6503	SO:0001583	missense	395			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1870G>A	X.37:g.11174686C>T	ENSP00000338967:p.Val624Met	Somatic		WXS	Illumina GAIIx	Phase_I	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	ENST00000337414.4	37	CCDS14140.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.712486	0.89112	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718;ENST00000413512;ENST00000380732	T;T;T;T;T;T;T;T	0.25912	1.8;1.78;1.78;1.77;1.8;1.79;1.89;1.88	5.51	5.51	0.81932	.	0.000000	0.48286	D	0.000183	T	0.37892	0.1020	N	0.19112	0.55	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;1.0	P;D;D;D;D	0.76071	0.862;0.957;0.967;0.966;0.987	T	0.34354	-0.9832	10	0.72032	D	0.01	.	17.1584	0.86797	0.0:1.0:0.0:0.0	.	433;421;624;624;624	B7Z8H7;O43182-5;O43182-2;O43182;A8KAL3	.;.;.;RHG06_HUMAN;.	M	449;421;421;624;460;624;433;656	ENSP00000438135:V449M;ENSP00000370112:V421M;ENSP00000302312:V421M;ENSP00000338967:V624M;ENSP00000370093:V460M;ENSP00000370094:V624M;ENSP00000389394:V433M;ENSP00000370108:V656M	ENSP00000302312:V421M	V	-	1	0	ARHGAP6	11084607	1.000000	0.71417	0.934000	0.37439	0.976000	0.68499	6.611000	0.74183	2.317000	0.78254	0.600000	0.82982	GTG		0.443	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427		14	27	14	27
GRPR	2925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	16142351	16142351	+	Missense_Mutation	SNP	C	C	T			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chrX:16142351C>T	ENST00000380289.2	+	1	673	c.275C>T	c.(274-276)aCg>aTg	p.T92M		NM_005314.2	NP_005305.1	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	92					cell proliferation (GO:0008283)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)|G-protein coupled peptide receptor activity (GO:0008528)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(3)|stomach(1)|upper_aerodigestive_tract(3)	25	Hepatocellular(33;0.183)					CTCCTAATAACGTGTGCTCCA	0.488											OREG0019682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0													188.0	148.0	162.0					X																	16142351		2203	4300	6503	SO:0001583	missense	2925				CCDS14174.1	Xp22.2	2014-02-21			ENSG00000126010	ENSG00000126010		"""GPCR / Class A : Bombesin receptors"""	4609	protein-coding gene	gene with protein product	"""bombesin receptor 2"""	305670					Standard	NM_005314		Approved	BB2	uc004cxj.3	P30550	OTTHUMG00000021189	ENST00000380289.2:c.275C>T	X.37:g.16142351C>T	ENSP00000369643:p.Thr92Met	Somatic	708	WXS	Illumina GAIIx	Phase_I	B2R910	Missense_Mutation	SNP	ENST00000380289.2	37	CCDS14174.1	.	.	.	.	.	.	.	.	.	.	C	18.42	3.621095	0.66787	.	.	ENSG00000126010	ENST00000380289	T	0.73469	-0.75	6.02	6.02	0.97574	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.85969	0.5821	M	0.80028	2.48	0.80722	D	1	D	0.76494	0.999	D	0.65323	0.934	D	0.84430	0.0576	10	0.33141	T	0.24	-22.2126	18.3084	0.90190	0.0:1.0:0.0:0.0	.	92	P30550	GRPR_HUMAN	M	92	ENSP00000369643:T92M	ENSP00000369643:T92M	T	+	2	0	GRPR	16052272	1.000000	0.71417	0.828000	0.32881	0.224000	0.24922	7.818000	0.86416	2.549000	0.85964	0.600000	0.82982	ACG		0.488	GRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055901.1	NM_005314		54	104	54	104
ZNF645	158506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	22291550	22291550	+	Missense_Mutation	SNP	G	G	A	rs200886998		TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chrX:22291550G>A	ENST00000323684.1	+	1	486	c.442G>A	c.(442-444)Gct>Act	p.A148T		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	148	HYB domain.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						AGTTACCAGCGCTTCGCTTGA	0.438																																																0													67.0	65.0	66.0					X																	22291550		2203	4300	6503	SO:0001583	missense	158506			AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.442G>A	X.37:g.22291550G>A	ENSP00000323348:p.Ala148Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	ENST00000323684.1	37	CCDS14205.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.445703	0.25987	.	.	ENSG00000175809	ENST00000323684	T	0.32272	1.46	3.3	2.43	0.29744	.	0.283763	0.34291	U	0.004092	T	0.13500	0.0327	L	0.29908	0.895	0.09310	N	1	P	0.35714	0.517	B	0.22386	0.039	T	0.13656	-1.0501	10	0.16896	T	0.51	.	4.264	0.10754	0.1365:0.2325:0.631:0.0	.	148	Q8N7E2	ZN645_HUMAN	T	148	ENSP00000323348:A148T	ENSP00000323348:A148T	A	+	1	0	ZNF645	22201471	0.059000	0.20769	0.001000	0.08648	0.001000	0.01503	0.911000	0.28584	0.778000	0.33520	-0.190000	0.12839	GCT		0.438	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056037.1	NM_152577		39	55	39	55
GRIPAP1	56850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	48830666	48830666	+	Missense_Mutation	SNP	C	C	T	rs371634362		TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chrX:48830666C>T	ENST00000376441.1	-	26	2499	c.2465G>A	c.(2464-2466)cGg>cAg	p.R822Q	GRIPAP1_ENST00000376425.3_Missense_Mutation_p.R791Q|GRIPAP1_ENST00000473581.1_5'Flank|KCND1_ENST00000218176.3_5'Flank|GRIPAP1_ENST00000376444.3_Missense_Mutation_p.R777Q	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	822						blood microparticle (GO:0072562)|endosome (GO:0005768)		p.R465Q(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						CTTGCTGAGCCGCACAATTTC	0.567																																																1	Substitution - Missense(1)	large_intestine(1)							GLN/ARG	0,3835		0,0,1632,571	62.0	48.0	53.0		2465	3.9	1.0	X		53	1,6727		0,1,2427,1872	no	missense	GRIPAP1	NM_020137.3	43	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging	822/842	48830666	1,10562	2203	4300	6503	SO:0001583	missense	56850			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.2465G>A	X.37:g.48830666C>T	ENSP00000365624:p.Arg822Gln	Somatic		WXS	Illumina GAIIx	Phase_I	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	ENST00000376441.1	37	CCDS35248.1	.	.	.	.	.	.	.	.	.	.	c	25.7	4.666511	0.88251	0.0	1.49E-4	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291	.	.	.	3.93	3.93	0.45458	.	0.000000	0.53938	U	0.000053	T	0.70351	0.3214	M	0.65498	2.005	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	T	0.70730	-0.4792	9	0.45353	T	0.12	-15.5009	10.3749	0.44077	0.0:1.0:0.0:0.0	.	822	Q4V328	GRAP1_HUMAN	Q	791;777;822;791	.	ENSP00000365608:R791Q	R	-	2	0	GRIPAP1	48715610	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.008000	0.57103	1.805000	0.52779	0.548000	0.68491	CGG		0.567	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672		10	29	10	29
ZC4H2	55906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	64139085	64139085	+	Splice_Site	SNP	C	C	A			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chrX:64139085C>A	ENST00000374839.3	-	4	505		c.e4-1		ZC4H2_ENST00000488608.1_5'UTR|ZC4H2_ENST00000337990.2_Splice_Site|ZC4H2_ENST00000545618.1_Splice_Site|ZC4H2_ENST00000447788.2_Intron	NM_018684.3	NP_061154.1	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing						nervous system development (GO:0007399)|neuromuscular junction development (GO:0007528)|spinal cord motor neuron differentiation (GO:0021522)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	metal ion binding (GO:0046872)			endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						CTCAAAGTAACTTTGGAGATG	0.532																																																0													53.0	44.0	47.0					X																	64139085		2203	4300	6503	SO:0001630	splice_region_variant	55906			AF270491	CCDS14380.1, CCDS55431.1, CCDS55432.1	Xq11.1	2013-07-23	2008-10-01	2008-10-01	ENSG00000126970	ENSG00000126970		"""Zinc fingers"""	24931	protein-coding gene	gene with protein product		300897	"""KIAA1166"", ""Wieacker-Wolff syndrome"""	KIAA1166, WWS		10574461, 12097419, 23623388	Standard	NM_018684		Approved	HCA127	uc004dvu.3	Q9NQZ6	OTTHUMG00000021712	ENST00000374839.3:c.399-1G>T	X.37:g.64139085C>A		Somatic		WXS	Illumina GAIIx	Phase_I	B2RDC2|B3KVZ5|B4DED0|E7EM74|G3V1L3|Q53H73|Q5JTF9|Q9H9C3|Q9H9H7|Q9ULQ4	Splice_Site	SNP	ENST00000374839.3	37	CCDS14380.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051870	0.75960	.	.	ENSG00000126970	ENST00000545618;ENST00000374839;ENST00000337990	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7218	0.77718	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZC4H2	64055810	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.552000	0.82192	2.397000	0.81536	0.597000	0.82753	.		0.532	ZC4H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056958.1	NM_018684	Intron	23	53	23	53
DLG3	1741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	69669655	69669655	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chrX:69669655C>T	ENST00000374360.3	+	4	882	c.649C>T	c.(649-651)Cga>Tga	p.R217*	DLG3_ENST00000194900.4_Nonsense_Mutation_p.R235*|DLG3_ENST00000374355.3_5'Flank|RNU4-81P_ENST00000363561.1_RNA	NM_021120.3	NP_066943.2	Q92796	DLG3_HUMAN	discs, large homolog 3 (Drosophila)	217	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axon guidance (GO:0007411)|establishment of planar polarity (GO:0001736)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphatase activity (GO:0010923)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)|tight junction (GO:0005923)	phosphatase binding (GO:0019902)			endometrium(4)|kidney(1)|large_intestine(10)|lung(5)|pancreas(1)|urinary_tract(1)	22	Renal(35;0.156)					GGTGCGGAGGCGACAGCCTCC	0.662																																																0													52.0	38.0	43.0					X																	69669655		2202	4293	6495	SO:0001587	stop_gained	1741			U49089	CCDS14403.1, CCDS43967.1, CCDS55439.1	Xq13.1	2014-06-12	2008-12-15		ENSG00000082458	ENSG00000082458			2902	protein-coding gene	gene with protein product	"""neuroendocrine-dlg"", ""protein phosphatase 1, regulatory subunit 82"""	300189	"""discs, large homolog 3 (neuroendocrine-dlg, Drosophila)"""			9598320	Standard	NM_021120		Approved	NE-Dlg, SAP102, SAP-102, NEDLG, KIAA1232, MRX90, PPP1R82	uc004dyi.2	Q92796	OTTHUMG00000021778	ENST00000374360.3:c.649C>T	X.37:g.69669655C>T	ENSP00000363480:p.Arg217*	Somatic		WXS	Illumina GAIIx	Phase_I	B4E0H1|D3DVU5|Q5JUW6|Q5JUW7|Q9ULI8	Nonsense_Mutation	SNP	ENST00000374360.3	37	CCDS14403.1	.	.	.	.	.	.	.	.	.	.	C	39	7.387823	0.98252	.	.	ENSG00000082458	ENST00000194900;ENST00000374360	.	.	.	4.48	2.47	0.30058	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1769	0.48606	0.4343:0.5657:0.0:0.0	.	.	.	.	X	235;217	.	.	R	+	1	2	DLG3	69586380	1.000000	0.71417	1.000000	0.80357	0.659000	0.38960	2.699000	0.47077	0.872000	0.35775	0.436000	0.28706	CGA		0.662	DLG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057074.2	NM_021120		8	16	8	16
TMEM164	84187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	109416566	109416566	+	Missense_Mutation	SNP	A	A	C			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chrX:109416566A>C	ENST00000372073.1	+	7	1117	c.781A>C	c.(781-783)Act>Cct	p.T261P	TMEM164_ENST00000464177.1_3'UTR|TMEM164_ENST00000372068.2_Missense_Mutation_p.T261P|TMEM164_ENST00000288381.4_Missense_Mutation_p.T222P|TMEM164_ENST00000372072.3_Missense_Mutation_p.T112P			Q5U3C3	TM164_HUMAN	transmembrane protein 164	261						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|skin(1)	14						GGGACACCAGACTCTCATGAC	0.552																																																0													109.0	93.0	98.0					X																	109416566		2203	4300	6503	SO:0001583	missense	84187			AK094127	CCDS14550.2, CCDS55475.1	Xq22.3	2008-02-05			ENSG00000157600	ENSG00000157600			26217	protein-coding gene	gene with protein product						12477932	Standard	NM_032227		Approved	FLJ22679, RP13-360B22.2	uc004eom.3	Q5U3C3	OTTHUMG00000022192	ENST00000372073.1:c.781A>C	X.37:g.109416566A>C	ENSP00000361143:p.Thr261Pro	Somatic		WXS	Illumina GAIIx	Phase_I	B3KSQ8|F5H2P2	Missense_Mutation	SNP	ENST00000372073.1	37	CCDS14550.2	.	.	.	.	.	.	.	.	.	.	a	13.70	2.315964	0.40996	.	.	ENSG00000157600	ENST00000372072;ENST00000372073;ENST00000372068;ENST00000288381;ENST00000501872	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.30135	0.0755	N	0.20401	0.57	0.80722	D	1	B;B	0.14805	0.011;0.011	B;B	0.17979	0.02;0.013	T	0.05716	-1.0868	10	0.32370	T	0.25	-3.7868	14.3201	0.66479	1.0:0.0:0.0:0.0	.	222;261	Q9H617;Q5U3C3	.;TM164_HUMAN	P	112;261;261;222;222	ENSP00000384075:T112P;ENSP00000361143:T261P;ENSP00000361138:T261P;ENSP00000288381:T222P	ENSP00000288381:T222P	T	+	1	0	TMEM164	109303222	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.959000	0.93110	1.760000	0.52011	0.378000	0.23410	ACT		0.552	TMEM164-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057898.1	NM_032227		30	77	30	77
CUL4B	8450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	119669687	119669687	+	Missense_Mutation	SNP	C	C	G			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chrX:119669687C>G	ENST00000404115.3	-	18	2613	c.2212G>C	c.(2212-2214)Gag>Cag	p.E738Q	CUL4B_ENST00000336592.6_Missense_Mutation_p.E725Q|CUL4B_ENST00000371322.5_Missense_Mutation_p.E720Q	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	738					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E720Q(1)|p.E738Q(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CCACTTACCTCTTTAAATTCT	0.353																																																2	Substitution - Missense(2)	cervix(2)											149.0	147.0	147.0					X																	119669687		2203	4300	6503	SO:0001583	missense	8450			U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.2212G>C	X.37:g.119669687C>G	ENSP00000384109:p.Glu738Gln	Somatic		WXS	Illumina GAIIx	Phase_I	B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Missense_Mutation	SNP	ENST00000404115.3	37	CCDS35379.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.025170	0.54683	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115	T;T;T	0.73897	-0.79;-0.79;-0.79	5.69	5.69	0.88448	Cullin, N-terminal (1);Cullin homology (2);	0.000000	0.85682	D	0.000000	T	0.69260	0.3091	L	0.46670	1.46	0.80722	D	1	B;B;B	0.19445	0.0;0.036;0.016	B;B;B	0.16722	0.001;0.016;0.006	T	0.63677	-0.6583	9	.	.	.	-15.3508	17.7098	0.88318	0.0:1.0:0.0:0.0	.	542;738;720	Q13620-3;Q13620;Q13620-1	.;CUL4B_HUMAN;.	Q	720;725;738	ENSP00000360373:E720Q;ENSP00000338919:E725Q;ENSP00000384109:E738Q	.	E	-	1	0	CUL4B	119553715	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.679000	0.84048	2.400000	0.81607	0.583000	0.79449	GAG		0.353	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058103.1	NM_003588		46	129	46	129
CSAG1	158511	hgsc.bcm.edu;broad.mit.edu	37	X	151908875	151908875	+	Missense_Mutation	SNP	G	G	C			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chrX:151908875G>C	ENST00000370287.3	+	4	442	c.114G>C	c.(112-114)agG>agC	p.R38S	CSAG1_ENST00000452779.2_Missense_Mutation_p.R38S|CSAG1_ENST00000370291.2_Missense_Mutation_p.R38S	NM_153478.1	NP_705611.1	Q6PB30	CSAG1_HUMAN	chondrosarcoma associated gene 1	38										central_nervous_system(1)|kidney(1)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					AGATGTCCAGGAAACCACGAG	0.572																																																0													245.0	220.0	228.0					X																	151908875		2203	4300	6503	SO:0001583	missense	158511			AF268419	CCDS76047.1	Xq28	2009-08-07			ENSG00000198930	ENSG00000198930			24294	protein-coding gene	gene with protein product	"""cancer/testis antigen family 24, member 1"""					12039054	Standard	XM_006724810		Approved	CSAGE, CT24.1	uc004fgf.3	Q6PB30	OTTHUMG00000022648	ENST00000370287.3:c.114G>C	X.37:g.151908875G>C	ENSP00000359310:p.Arg38Ser	Somatic		WXS	Illumina GAIIx	Phase_I	A6NE22	Missense_Mutation	SNP	ENST00000370287.3	37	CCDS14711.1	.	.	.	.	.	.	.	.	.	.	G	4.115	0.019585	0.08006	.	.	ENSG00000198930	ENST00000370287;ENST00000452779;ENST00000370291	T;T;T	0.59224	0.96;0.96;0.28	0.903	-0.0179	0.13966	.	.	.	.	.	T	0.45074	0.1324	.	.	.	0.09310	N	1	D	0.55172	0.97	B	0.43680	0.427	T	0.36480	-0.9746	8	0.56958	D	0.05	.	3.3133	0.07024	0.3226:0.0:0.6774:0.0	.	38	Q6PB30	CSAG1_HUMAN	S	38	ENSP00000359310:R38S;ENSP00000396520:R38S;ENSP00000359314:R38S	ENSP00000359310:R38S	R	+	3	2	CSAG1	151659531	0.019000	0.18553	0.056000	0.19401	0.034000	0.12701	-0.033000	0.12246	-0.084000	0.12595	-0.739000	0.03532	AGG		0.572	CSAG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058760.2	NM_153479		24	383	24	383
BLK	640	broad.mit.edu;ucsc.edu	37	8	11400849	11400849	+	Missense_Mutation	SNP	C	C	T	rs142352008	byFrequency	TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr8:11400849C>T	ENST00000259089.4	+	2	708	c.116C>T	c.(115-117)cCg>cTg	p.P39L	BLK_ENST00000529894.1_Intron	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	39					B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		CCGCCACTGCCGCCCCTGGTG	0.532													C|||	4	0.000798722	0.0	0.0014	5008	,	,		16043	0.0		0.003	False		,,,				2504	0.0															0								C	LEU/PRO	5,4401	9.9+/-24.2	0,5,2198	38.0	44.0	42.0		116	5.5	0.9	8	dbSNP_134	42	30,8570	20.4+/-63.3	0,30,4270	yes	missense	BLK	NM_001715.2	98	0,35,6468	TT,TC,CC		0.3488,0.1135,0.2691	probably-damaging	39/506	11400849	35,12971	2203	4300	6503	SO:0001583	missense	640			BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.116C>T	8.37:g.11400849C>T	ENSP00000259089:p.Pro39Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q16291|Q96IN1	Missense_Mutation	SNP	ENST00000259089.4	37	CCDS5982.1	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	C	11.99	1.802484	0.31869	0.001135	0.003488	ENSG00000136573	ENST00000259089;ENST00000427279	T	0.76578	-1.03	5.54	5.54	0.83059	Src homology-3 domain (1);	0.000000	0.43416	D	0.000571	T	0.57533	0.2060	N	0.08118	0	0.80722	D	1	P	0.36412	0.552	B	0.24701	0.055	T	0.66148	-0.5996	10	0.66056	D	0.02	.	14.9922	0.71396	0.0:1.0:0.0:0.0	.	39	P51451	BLK_HUMAN	L	39	ENSP00000259089:P39L	ENSP00000259089:P39L	P	+	2	0	BLK	11438258	0.984000	0.35163	0.878000	0.34440	0.012000	0.07955	3.424000	0.52764	2.591000	0.87537	0.555000	0.69702	CCG		0.532	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207460.1			23	28	23	28
SSH1	54434	broad.mit.edu;ucsc.edu	37	12	109183011	109183011	+	Missense_Mutation	SNP	T	T	C			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr12:109183011T>C	ENST00000326495.5	-	15	1996	c.1903A>G	c.(1903-1905)Ata>Gta	p.I635V	SSH1_ENST00000360239.3_Missense_Mutation_p.I323V	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	635					actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ATCCCAAATATAGCATCATCC	0.547																																																0													18.0	18.0	18.0					12																	109183011		2203	4299	6502	SO:0001583	missense	54434			BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.1903A>G	12.37:g.109183011T>C	ENSP00000315713:p.Ile635Val	Somatic		WXS	Illumina GAIIx	Phase_I	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	ENST00000326495.5	37	CCDS9121.1	.	.	.	.	.	.	.	.	.	.	T	2.784	-0.252832	0.05829	.	.	ENSG00000084112	ENST00000360239;ENST00000326495	T;T	0.81330	-1.48;-1.48	4.8	0.682	0.17992	.	2.309250	0.01167	N	0.006793	T	0.73102	0.3544	L	0.47716	1.5	0.09310	N	1	B;B	0.11235	0.0;0.004	B;B	0.10450	0.001;0.005	T	0.44817	-0.9303	10	0.15066	T	0.55	-4.001	4.976	0.14140	0.0:0.1977:0.285:0.5173	.	635;323	Q8WYL5;Q8WYL5-4	SSH1_HUMAN;.	V	323;635	ENSP00000353374:I323V;ENSP00000315713:I635V	ENSP00000315713:I635V	I	-	1	0	SSH1	107707140	0.164000	0.22935	0.015000	0.15790	0.898000	0.52572	0.982000	0.29539	-0.066000	0.12998	0.454000	0.30748	ATA		0.547	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403724.1	NM_018984		4	12	4	12
FUBP1	8880	broad.mit.edu;hgsc.bcm.edu	37	1	78444597	78444597	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HT-A615-01A-11D-A29Q-08	TCGA-HT-A615-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb574e00-e564-4dda-972c-dc25f4b07540	c83749e7-fee4-46ed-8263-ae642aee2429	g.chr1:78444597delA	ENST00000370768.2	-	1	173	c.92delT	c.(91-93)ttcfs	p.F31fs	FUBP1_ENST00000370767.1_Frame_Shift_Del_p.F31fs|FUBP1_ENST00000436586.2_Frame_Shift_Del_p.F31fs	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	31					positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						TGCATCTTTGAAAGCGTCGTT	0.612			"""F, N"""		oligodendroglioma																																		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	0													77.0	86.0	83.0					1																	78444597		2203	4300	6503	SO:0001589	frameshift_variant	8880			U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.92delT	1.37:g.78444597delA	ENSP00000359804:p.Phe31fs	Somatic		WXS	Illumina GAIIx	Phase_I	Q12828	Frame_Shift_Del	DEL	ENST00000370768.2	37	CCDS683.1																																																																																				0.612	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902		77	72	77	72
