#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
CNR2	1269	broad.mit.edu	37	1	24202069	24202069	+	Silent	SNP	G	G	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr1:24202069G>C	ENST00000374472.4	-	2	200	c.39C>G	c.(37-39)tcC>tcG	p.S13S	CNR2_ENST00000536471.1_Silent_p.S13S	NM_001841.2	NP_001832.1	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	13					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of action potential (GO:0045759)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|response to amphetamine (GO:0001975)|response to lipopolysaccharide (GO:0032496)|sensory perception of pain (GO:0019233)	dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(9)|pancreas(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(2)	26		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Dronabinol(DB00470)|Nabilone(DB00486)	AGCCATCCTTGGAGCCATTGG	0.512																																						uc001bif.2		NA																	0				skin(2)|central_nervous_system(1)	3						c.(37-39)TCC>TCG		cannabinoid receptor 2 (macrophage)	Nabilone(DB00486)						98.0	105.0	102.0					1																	24202069		2202	4299	6501	SO:0001819	synonymous_variant	1269				behavior|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	dendrite|integral to plasma membrane|perikaryon	cannabinoid receptor activity	g.chr1:24202069G>C	X74328	CCDS245.1	1p	2012-08-08			ENSG00000188822	ENSG00000188822		"""GPCR / Class A : Cannabinoid receptors"""	2160	protein-coding gene	gene with protein product		605051					Standard	NM_001841		Approved	CB2	uc001bif.3	P34972	OTTHUMG00000013892	ENST00000374472.4:c.39C>G	1.37:g.24202069G>C			Somatic					p.S13S	NM_001841	NP_001832	WXS	Illumina HiSeq	Unspecified	P34972	CNR2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	2	166	-		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)	13			Extracellular (Potential).		C6ES44|Q4VBK8|Q5JRH7|Q6B0G7|Q6NSY0	Silent	SNP	ENST00000374472.4	37	c.39C>G	CCDS245.1																																																																																				0.512	CNR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038949.1	NM_001841		24	188	0	0	0	0	24	188				
THRAP3	9967	broad.mit.edu	37	1	36755247	36755247	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr1:36755247G>T	ENST00000354618.5	+	5	1851	c.1627G>T	c.(1627-1629)Gag>Tag	p.E543*	THRAP3_ENST00000469141.2_Nonsense_Mutation_p.E543*	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	543	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AAAGACCTCTGAGAGCCGAGA	0.507			T	USP6	aneurysmal bone cysts																																Pancreas(129;785 1795 20938 23278 32581)	uc001cae.3		NA		Dom	yes		1	1p34.3	9967	T	thyroid hormone receptor associated protein 3 (TRAP150)			M	USP6		aneurysmal bone cysts		0				ovary(5)|lung(3)|breast(1)	9						c.(1627-1629)GAG>TAG		thyroid hormone receptor associated protein 3							84.0	91.0	89.0					1																	36755247		2203	4300	6503	SO:0001587	stop_gained	9967				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ATP binding|ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr1:36755247G>T	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.1627G>T	1.37:g.36755247G>T	ENSP00000346634:p.Glu543*		Somatic				THRAP3_uc001caf.3_Nonsense_Mutation_p.E543*|THRAP3_uc001cag.1_Nonsense_Mutation_p.E543*	p.E543*	NM_005119	NP_005110	WXS	Illumina HiSeq	Unspecified	Q9Y2W1	TR150_HUMAN			5	1851	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	543					D3DPS5|Q5VTK6	Nonsense_Mutation	SNP	ENST00000354618.5	37	c.1627G>T	CCDS405.1	.	.	.	.	.	.	.	.	.	.	G	41	8.826061	0.98968	.	.	ENSG00000054118	ENST00000354618;ENST00000469141	.	.	.	6.06	6.06	0.98353	.	0.065007	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-20.9817	19.609	0.95594	0.0:0.0:1.0:0.0	.	.	.	.	X	543	.	ENSP00000346634:E543X	E	+	1	0	THRAP3	36527834	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.827000	0.86722	2.882000	0.98803	0.655000	0.94253	GAG		0.507	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119		24	198	1	0	6.13e-19	7.2e-19	24	198				
PODN	127435	broad.mit.edu	37	1	53543413	53543413	+	Silent	SNP	C	C	T	rs138179023		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr1:53543413C>T	ENST00000312553.5	+	7	946	c.939C>T	c.(937-939)cgC>cgT	p.R313R	PODN_ENST00000371500.3_Silent_p.R294R|PODN_ENST00000395871.2_Silent_p.R171R|RP11-334A14.5_ENST00000447867.1_RNA	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	265					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GCAGCCTGCGCGAGCTATACC	0.612																																						uc001cuv.2		NA																	0				ovary(1)|pancreas(1)	2						c.(937-939)CGC>CGT		podocan		C	,,,	3,4403	6.2+/-15.9	0,3,2200	114.0	125.0	121.0		882,882,513,939	-9.6	0.1	1	dbSNP_134	121	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PODN	NM_001199080.1,NM_001199081.1,NM_001199082.1,NM_153703.4	,,,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	,,,	294/643,294/643,171/520,313/662	53543413	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	127435				negative regulation of cell migration|negative regulation of cell proliferation	cytoplasm|extracellular space|proteinaceous extracellular matrix	collagen binding	g.chr1:53543413C>T	AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.939C>T	1.37:g.53543413C>T			Somatic				PODN_uc001cuw.2_Silent_p.R294R|PODN_uc010onr.1_Silent_p.R294R|PODN_uc010ons.1_Silent_p.R171R	p.R313R	NM_153703	NP_714914	WXS	Illumina HiSeq	Unspecified	Q7Z5L7	PODN_HUMAN			7	946	+			265			LRR 8.		B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Silent	SNP	ENST00000312553.5	37	c.939C>T	CCDS573.1																																																																																				0.612	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024735.1	NM_153703		40	183	0	0	0	0	40	183				
RTCA	8634	broad.mit.edu	37	1	100736125	100736125	+	Silent	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr1:100736125C>T	ENST00000370128.4	+	4	472	c.303C>T	c.(301-303)ctC>ctT	p.L101L	RTCA_ENST00000498617.1_3'UTR|RTCA_ENST00000260563.4_Silent_p.L114L	NM_003729.3	NP_003720.1	O00442	RTCA_HUMAN	RNA 3'-terminal phosphate cyclase	101					RNA processing (GO:0006396)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA-3'-phosphate cyclase activity (GO:0003963)										GTGTGTGCCTCTTGATGCAGG	0.398																																						uc001dtc.2		NA																	0					0						c.(301-303)CTC>CTT		RNA terminal phosphate cyclase domain 1 isoform							260.0	227.0	238.0					1																	100736125		2203	4300	6503	SO:0001819	synonymous_variant	8634				RNA processing	mitochondrion|nucleoplasm	ATP binding|protein binding|RNA binding|RNA-3'-phosphate cyclase activity	g.chr1:100736125C>T	Y11651	CCDS768.1, CCDS44178.1	1p13.3	2012-03-30	2012-03-30	2012-03-30	ENSG00000137996	ENSG00000137996	6.5.1.4		17981	protein-coding gene	gene with protein product		611286	"""RTC domain containing 1"", ""RNA terminal phosphate cyclase domain 1"""	RTCD1		9184239	Standard	NM_003729		Approved	RPC, RTC1	uc001dtd.3	O00442	OTTHUMG00000010920	ENST00000370128.4:c.303C>T	1.37:g.100736125C>T			Somatic				RTCD1_uc010ouh.1_Silent_p.L101L|RTCD1_uc001dtd.2_Silent_p.L114L	p.L101L	NM_003729	NP_003720	WXS	Illumina HiSeq	Unspecified	O00442	RTC1_HUMAN		Epithelial(280;0.0513)|all cancers(265;0.0902)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	4	521	+		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)	101					Q5VVL5|Q5VVL6|Q96E99	Silent	SNP	ENST00000370128.4	37	c.303C>T	CCDS768.1																																																																																				0.398	RTCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030098.2			43	289	0	0	0	0	43	289				
STXBP3	6814	broad.mit.edu	37	1	109342874	109342874	+	Silent	SNP	A	A	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr1:109342874A>G	ENST00000370008.3	+	17	1532	c.1482A>G	c.(1480-1482)gaA>gaG	p.E494E		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	494					blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		ATTCAAAAGAATGGCCATATT	0.343																																						uc001dvy.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1480-1482)GAA>GAG		syntaxin binding protein 3							90.0	91.0	91.0					1																	109342874		2203	4299	6502	SO:0001819	synonymous_variant	6814				negative regulation of calcium ion-dependent exocytosis|neutrophil degranulation|platelet aggregation|protein transport|vesicle docking involved in exocytosis	cytosol|nucleus|platelet alpha granule|specific granule|tertiary granule	syntaxin-2 binding	g.chr1:109342874A>G	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.1482A>G	1.37:g.109342874A>G			Somatic				STXBP3_uc001dvz.2_RNA	p.E494E	NM_007269	NP_009200	WXS	Illumina HiSeq	Unspecified	O00186	STXB3_HUMAN		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)	17	1557	+		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)	494					A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Silent	SNP	ENST00000370008.3	37	c.1482A>G	CCDS790.1																																																																																				0.343	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269		15	96	0	0	0	0	15	96				
APH1A	51107	broad.mit.edu	37	1	150240393	150240393	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr1:150240393T>C	ENST00000369109.3	-	2	436	c.248A>G	c.(247-249)cAg>cGg	p.Q83R	APH1A_ENST00000414276.2_Splice_Site|C1orf54_ENST00000369102.1_5'Flank|APH1A_ENST00000461320.1_Splice_Site|APH1A_ENST00000360244.4_Missense_Mutation_p.Q83R	NM_001077628.2	NP_001071096.1	Q96BI3	APH1A_HUMAN	APH1A gamma secretase subunit	83					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|metanephros development (GO:0001656)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	9	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAACACCTCCTGTAGAAGGAC	0.552																																						uc001ety.1		NA																	0				ovary(1)|lung(1)	2						c.(247-249)CAG>CGG		anterior pharynx defective 1 homolog A isoform							96.0	102.0	100.0					1																	150240393		1960	4148	6108	SO:0001583	missense	51107				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to plasma membrane	protein binding	g.chr1:150240393T>C	AF151835	CCDS41390.1, CCDS41391.1, CCDS58025.1	1q21.2	2013-05-01	2013-05-01		ENSG00000117362	ENSG00000117362			29509	protein-coding gene	gene with protein product		607629	"""anterior pharynx defective 1 homolog A (C. elegans)"""			10810093, 12110170	Standard	NM_001077628		Approved	APH-1A, CGI-78	uc001ety.2	Q96BI3	OTTHUMG00000012545	ENST00000369109.3:c.248A>G	1.37:g.150240393T>C	ENSP00000358105:p.Gln83Arg		Somatic				APH1A_uc010pbx.1_Splice_Site_p.G38_splice|APH1A_uc001etz.1_Missense_Mutation_p.Q83R|APH1A_uc001eua.1_Missense_Mutation_p.Q83R|APH1A_uc010pby.1_Intron|APH1A_uc001eub.1_Splice_Site|APH1A_uc010pbz.1_Splice_Site	p.Q83R	NM_001077628	NP_001071096	WXS	Illumina HiSeq	Unspecified	Q96BI3	APH1A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		2	570	-	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		83			Helical; Name=3; (Potential).		B4DQK0|Q5TB22|Q5TB23|Q969R6|Q9BVG0|Q9Y386	Missense_Mutation	SNP	ENST00000369109.3	37	c.248A>G	CCDS41390.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.11|19.11	3.763562|3.763562	0.69878|0.69878	.|.	.|.	ENSG00000117362|ENSG00000117362	ENST00000414276|ENST00000369109;ENST00000360244	.|T;T	.|0.62941	.|-0.01;-0.01	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.72137	.|0.3423	M|M	0.92555|0.92555	3.32|3.32	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.49307	.|0.716;0.759;0.922	.|P;P;P	.|0.51701	.|0.515;0.647;0.677	.|T	.|0.80153	.|-0.1501	.|10	.|0.72032	.|D	.|0.01	.|-7.1358	12.7075|12.7075	0.57070|0.57070	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|83;83;83	.|Q96BI3-2;Q5TB22;Q96BI3	.|.;.;APH1A_HUMAN	.|R	-1|83	.|ENSP00000358105:Q83R;ENSP00000353380:Q83R	.|ENSP00000353380:Q83R	.|Q	-|-	.|2	.|0	APH1A|APH1A	148507017|148507017	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.777000|7.777000	0.85628|0.85628	2.091000|2.091000	0.63221|0.63221	0.482000|0.482000	0.46254|0.46254	.|CAG		0.552	APH1A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000035048.1	NM_016022		22	134	0	0	0	0	22	134				
USH2A	7399	broad.mit.edu	37	1	215972260	215972260	+	Missense_Mutation	SNP	T	T	A	rs377732592		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr1:215972260T>A	ENST00000307340.3	-	50	10333	c.9947A>T	c.(9946-9948)aAt>aTt	p.N3316I	USH2A_ENST00000366943.2_Missense_Mutation_p.N3316I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3316					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGGAAGGCGATTGTACACCAC	0.483										HNSCC(13;0.011)																												uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(9946-9948)AAT>ATT		usherin isoform B							156.0	133.0	141.0					1																	215972260		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:215972260T>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9947A>T	1.37:g.215972260T>A	ENSP00000305941:p.Asn3316Ile	HNSCC(13;0.011)	Somatic					p.N3316I	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	50	10334	-			3316			Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.9947A>T	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	3.580	-0.085765	0.07097	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.12879	2.65;2.64	5.8	-1.41	0.08941	Fibronectin, type III (2);	1.091850	0.07078	N	0.836577	T	0.04497	0.0123	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38585	-0.9654	10	0.36615	T	0.2	.	1.9873	0.03439	0.1329:0.3651:0.2678:0.2341	.	3316	O75445	USH2A_HUMAN	I	3316	ENSP00000305941:N3316I;ENSP00000355910:N3316I	ENSP00000305941:N3316I	N	-	2	0	USH2A	214038883	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.492000	0.06467	-0.150000	0.11195	-0.248000	0.11899	AAT		0.483	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		36	128	0	0	0	0	36	128				
USH2A	7399	broad.mit.edu	37	1	216390860	216390860	+	Missense_Mutation	SNP	G	G	A	rs150729680	byFrequency	TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr1:216390860G>A	ENST00000307340.3	-	15	3412	c.3026C>T	c.(3025-3027)gCc>gTc	p.A1009V	USH2A_ENST00000366943.2_Missense_Mutation_p.A1009V|USH2A_ENST00000366942.3_Missense_Mutation_p.A1009V	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1009	Laminin EGF-like 10. {ECO:0000255|PROSITE-ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTCATTCAAGGCTCCTGAGAG	0.393										HNSCC(13;0.011)			G|||	4	0.000798722	0.003	0.0	5008	,	,		18079	0.0		0.0	False		,,,				2504	0.0					uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(3025-3027)GCC>GTC		usherin isoform B		G	VAL/ALA,VAL/ALA	4,4402	8.1+/-20.4	0,4,2199	76.0	71.0	72.0		3026,3026	5.2	1.0	1	dbSNP_134	72	0,8600		0,0,4300	yes	missense,missense	USH2A	NM_007123.5,NM_206933.2	64,64	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	probably-damaging,probably-damaging	1009/1547,1009/5203	216390860	4,13002	2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216390860G>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3026C>T	1.37:g.216390860G>A	ENSP00000305941:p.Ala1009Val	HNSCC(13;0.011)	Somatic				USH2A_uc001hkv.2_Missense_Mutation_p.A1009V	p.A1009V	NM_206933	NP_996816	WXS	Illumina HiSeq	Unspecified	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	15	3413	-			1009			Laminin EGF-like 10.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.3026C>T	CCDS31025.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	27.2	4.807378	0.90623	9.08E-4	0.0	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.62788	0.0;0.0;0.0	5.22	5.22	0.72569	EGF-like, laminin (3);	0.000000	0.40554	U	0.001071	T	0.65873	0.2733	L	0.45352	1.415	0.37285	D	0.907999	P;P	0.52463	0.481;0.953	B;P	0.50590	0.193;0.645	T	0.69658	-0.5086	10	0.41790	T	0.15	.	18.78	0.91928	0.0:0.0:1.0:0.0	.	1009;1009	O75445-2;O75445	.;USH2A_HUMAN	V	1009	ENSP00000305941:A1009V;ENSP00000355910:A1009V;ENSP00000355909:A1009V	ENSP00000305941:A1009V	A	-	2	0	USH2A	214457483	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.891000	0.56227	2.443000	0.82685	0.591000	0.81541	GCC		0.393	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		9	52	0	0	0	0	9	52				
MARK1	4139	broad.mit.edu	37	1	220826574	220826574	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr1:220826574G>C	ENST00000366917.4	+	16	2134	c.1868G>C	c.(1867-1869)cGc>cCc	p.R623P	MARK1_ENST00000366918.4_Missense_Mutation_p.R601P|MARK1_ENST00000402574.1_Missense_Mutation_p.R488P					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		CGGGAGCGACGCAGCGTTGCT	0.532																																						uc001hmn.3		NA																	0				ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10						c.(1867-1869)CGC>CCC		MAP/microtubule affinity-regulating kinase 1							94.0	85.0	88.0					1																	220826574		2203	4300	6503	SO:0001583	missense	4139				intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr1:220826574G>C	AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1868G>C	1.37:g.220826574G>C	ENSP00000355884:p.Arg623Pro		Somatic				MARK1_uc009xdw.2_Missense_Mutation_p.R624P|MARK1_uc010pun.1_Missense_Mutation_p.R623P|MARK1_uc001hmm.3_Missense_Mutation_p.R601P	p.R623P	NM_018650	NP_061120	WXS	Illumina HiSeq	Unspecified	Q9P0L2	MARK1_HUMAN		GBM - Glioblastoma multiforme(131;0.0407)	16	2465	+			623						Missense_Mutation	SNP	ENST00000366917.4	37	c.1868G>C	CCDS31029.2	.	.	.	.	.	.	.	.	.	.	G	20.3	3.961236	0.74016	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.52295	0.67;0.67;0.67	4.94	3.98	0.46160	.	0.000000	0.85682	D	0.000000	T	0.62159	0.2405	M	0.73319	2.225	0.46499	D	0.999075	B;B;D;P	0.76494	0.324;0.182;0.999;0.841	B;B;D;B	0.72982	0.124;0.221;0.979;0.432	T	0.62553	-0.6830	10	0.48119	T	0.1	.	8.2834	0.31913	0.0793:0.0:0.765:0.1558	.	623;488;623;601	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	P	488;601;623	ENSP00000386017:R488P;ENSP00000355885:R601P;ENSP00000355884:R623P	ENSP00000355884:R623P	R	+	2	0	MARK1	218893197	1.000000	0.71417	0.968000	0.41197	0.941000	0.58515	7.660000	0.83776	2.267000	0.75376	0.462000	0.41574	CGC		0.532	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090899.1			19	127	0	0	0	0	19	127				
AGT	183	broad.mit.edu	37	1	230845931	230845931	+	Silent	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr1:230845931C>T	ENST00000366667.4	-	2	880	c.666G>A	c.(664-666)ccG>ccA	p.P222P	RP11-99J16__A.2_ENST00000412344.1_RNA	NM_000029.3	NP_000020.1	P01019	ANGT_HUMAN	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	222					activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|angiotensin maturation (GO:0002003)|angiotensin mediated vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001998)|angiotensin-mediated drinking behavior (GO:0003051)|artery smooth muscle contraction (GO:0014824)|astrocyte activation (GO:0048143)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|branching involved in ureteric bud morphogenesis (GO:0001658)|catenin import into nucleus (GO:0035411)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|cellular sodium ion homeostasis (GO:0006883)|cytokine secretion (GO:0050663)|ERK1 and ERK2 cascade (GO:0070371)|establishment of blood-nerve barrier (GO:0008065)|excretion (GO:0007588)|extracellular matrix organization (GO:0030198)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of tissue remodeling (GO:0034104)|nitric oxide mediated signal transduction (GO:0007263)|ovarian follicle rupture (GO:0001543)|peristalsis (GO:0030432)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytokine production (GO:0001819)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of organ growth (GO:0046622)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of calcium ion transport (GO:0051924)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of norepinephrine secretion (GO:0014061)|regulation of proteolysis (GO:0030162)|regulation of renal output by angiotensin (GO:0002019)|regulation of renal sodium excretion (GO:0035813)|regulation of vasoconstriction (GO:0019229)|renal response to blood flow involved in circulatory renin-angiotensin regulation of systemic arterial blood pressure (GO:0001999)|renal system process (GO:0003014)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cold (GO:0009409)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|response to salt stress (GO:0009651)|small molecule metabolic process (GO:0044281)|smooth muscle cell differentiation (GO:0051145)|smooth muscle cell proliferation (GO:0048659)|stress-activated MAPK cascade (GO:0051403)|uterine smooth muscle contraction (GO:0070471)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|hormone activity (GO:0005179)|serine-type endopeptidase inhibitor activity (GO:0004867)|superoxide-generating NADPH oxidase activator activity (GO:0016176)|type 1 angiotensin receptor binding (GO:0031702)|type 2 angiotensin receptor binding (GO:0031703)			endometrium(5)|kidney(1)|large_intestine(6)|lung(7)|pancreas(1)|prostate(5)	25	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CCTGCACAAACGGCTGCTTCA	0.617																																						uc001hty.3		NA																	0					0						c.(664-666)CCG>CCA		angiotensinogen preproprotein	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)						53.0	55.0	54.0					1																	230845931		2203	4300	6503	SO:0001819	synonymous_variant	183				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding	g.chr1:230845931C>T	K02215	CCDS1585.1	1q42.2	2014-02-18	2005-08-18	2001-06-29	ENSG00000135744	ENSG00000135744		"""Serine (or cysteine) peptidase inhibitors"", ""Endogenous ligands"""	333	protein-coding gene	gene with protein product	"""alpha-1 antiproteinase, antitrypsin"""	106150		SERPINA8		6089875, 24172014	Standard	NM_000029		Approved		uc001hty.4	P01019	OTTHUMG00000037757	ENST00000366667.4:c.666G>A	1.37:g.230845931C>T			Somatic				AGT_uc009xfe.2_Silent_p.P222P|AGT_uc009xff.2_Silent_p.P194P	p.P222P	NM_000029	NP_000020	WXS	Illumina HiSeq	Unspecified	P01019	ANGT_HUMAN		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	2	1174	-	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)	222					Q16358|Q16359|Q96F91	Silent	SNP	ENST00000366667.4	37	c.666G>A	CCDS1585.1																																																																																				0.617	AGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092102.1	NM_000029		5	91	0	0	0	0	5	91				
GREM2	64388	broad.mit.edu	37	1	240656540	240656540	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr1:240656540C>T	ENST00000318160.4	-	2	502	c.236G>A	c.(235-237)cGg>cAg	p.R79Q		NM_022469.3	NP_071914.3	Q9H772	GREM2_HUMAN	gremlin 2, DAN family BMP antagonist	79	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				BMP signaling pathway (GO:0030509)|cytokine-mediated signaling pathway (GO:0019221)|determination of dorsal identity (GO:0048263)|embryonic body morphogenesis (GO:0010172)|regulation of cytokine activity (GO:0060300)|sequestering of BMP from receptor via BMP binding (GO:0038098)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	heparin binding (GO:0008201)	p.R79P(1)		endometrium(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	10		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)			CACCGTCTGCCGCAGCGGCTG	0.642																																						uc001hys.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(235-237)CGG>CAG		gremlin 2 precursor							48.0	49.0	49.0					1																	240656540		2203	4300	6503	SO:0001583	missense	64388				BMP signaling pathway	extracellular space	cytokine activity	g.chr1:240656540C>T	AK024848	CCDS31070.1	1q43	2013-02-26	2013-02-26		ENSG00000180875	ENSG00000180875			17655	protein-coding gene	gene with protein product	"""protein related to DAN and cerberus"""	608832	"""gremlin 2, cysteine knot superfamily, homolog (Xenopus laevis)"", ""gremlin 2"""			15039429	Standard	XM_005273226		Approved	Prdc, FLJ21195, CKTSF1B2, DAND3	uc001hys.3	Q9H772	OTTHUMG00000039909	ENST00000318160.4:c.236G>A	1.37:g.240656540C>T	ENSP00000318650:p.Arg79Gln		Somatic					p.R79Q	NM_022469	NP_071914	WXS	Illumina HiSeq	Unspecified	Q9H772	GREM2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0123)		2	516	-		all_cancers(173;0.0196)	79			CTCK.		Q86UD9	Missense_Mutation	SNP	ENST00000318160.4	37	c.236G>A	CCDS31070.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.035207	0.93575	.	.	ENSG00000180875	ENST00000318160	T	0.29655	1.56	5.15	5.15	0.70609	DAN (1);Cystine knot, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.31544	0.0800	L	0.52266	1.64	0.58432	D	0.999998	P	0.47762	0.9	P	0.45610	0.487	T	0.02581	-1.1138	10	0.22706	T	0.39	-30.0496	12.0472	0.53487	0.0:0.9206:0.0:0.0794	.	79	Q9H772	GREM2_HUMAN	Q	79	ENSP00000318650:R79Q	ENSP00000318650:R79Q	R	-	2	0	GREM2	238723163	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.982000	0.56909	2.393000	0.81446	0.557000	0.71058	CGG		0.642	GREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096286.1	NM_022469		4	29	0	0	0	0	4	29				
GATA3	2625	broad.mit.edu	37	10	8100579	8100579	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr10:8100579A>G	ENST00000346208.3	+	3	1008	c.553A>G	c.(553-555)Aag>Gag	p.K185E	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Missense_Mutation_p.K185E			P23771	GATA3_HUMAN	GATA binding protein 3	185					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						AGAGTGCCTCAAGTACCAGGT	0.701			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															uc001ika.2		NA		Rec	yes		10	10p15	2625	F|N|S	GATA binding protein 3	yes	HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)	E			breast		0				breast(17)|ovary(3)|central_nervous_system(2)	22						c.(553-555)AAG>GAG		GATA binding protein 3 isoform 2							73.0	67.0	69.0					10																	8100579		2203	4300	6503	SO:0001583	missense	2625				aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding	g.chr10:8100579A>G	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.553A>G	10.37:g.8100579A>G	ENSP00000341619:p.Lys185Glu		Somatic				GATA3_uc001ijz.2_Missense_Mutation_p.K185E	p.K185E	NM_002051	NP_002042	WXS	Illumina HiSeq	Unspecified	P23771	GATA3_HUMAN			3	1110	+			185					Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	ENST00000346208.3	37	c.553A>G	CCDS7083.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.441747	0.83993	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.96716	-4.1;-4.08	5.55	5.55	0.83447	.	0.336129	0.21599	U	0.071973	D	0.96510	0.8861	M	0.77820	2.39	0.58432	D	0.999999	D;P	0.58620	0.983;0.498	P;B	0.47744	0.556;0.166	D	0.96158	0.9113	10	0.45353	T	0.12	-26.7673	15.6961	0.77499	1.0:0.0:0.0:0.0	.	185;185	P23771;P23771-2	GATA3_HUMAN;.	E	185	ENSP00000368632:K185E;ENSP00000341619:K185E	ENSP00000341619:K185E	K	+	1	0	GATA3	8140585	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.911000	0.92721	2.107000	0.64212	0.459000	0.35465	AAG		0.701	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295		11	97	0	0	0	0	11	97				
ANKRD30A	91074	broad.mit.edu	37	10	37430782	37430782	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr10:37430782C>A	ENST00000602533.1	+	7	888	c.789C>A	c.(787-789)agC>agA	p.S263R	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.S263R|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.S263R			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	319					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CGGCTGAAAGCTTGGTGGAAA	0.483																																						uc001iza.1		NA																	0				ovary(7)|breast(1)|skin(1)	9						c.(787-789)AGC>AGA		ankyrin repeat domain 30A							58.0	59.0	58.0					10																	37430782		1874	4114	5988	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37430782C>A	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.789C>A	10.37:g.37430782C>A	ENSP00000473551:p.Ser263Arg		Somatic					p.S263R	NM_052997	NP_443723	WXS	Illumina HiSeq	Unspecified	Q9BXX3	AN30A_HUMAN			7	888	+			319					Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.789C>A		.	.	.	.	.	.	.	.	.	.	.	0.038	-1.298703	0.01364	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.05139	3.49;3.49	0.609	-1.05	0.10036	.	.	.	.	.	T	0.03915	0.0110	N	0.24115	0.695	0.09310	N	1	P	0.39520	0.676	B	0.39706	0.307	T	0.42464	-0.9450	8	0.17832	T	0.49	.	.	.	.	.	319	Q9BXX3	AN30A_HUMAN	R	263	ENSP00000354432:S263R;ENSP00000363792:S263R	ENSP00000354432:S263R	S	+	3	2	ANKRD30A	37470788	0.053000	0.20554	0.002000	0.10522	0.011000	0.07611	1.267000	0.33050	-0.400000	0.07656	-0.738000	0.03535	AGC		0.483	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		8	64	1	0	0.000274275	0.000291741	8	64				
EXOSC1	51013	broad.mit.edu	37	10	99196219	99196219	+	Missense_Mutation	SNP	C	C	T	rs368248968		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr10:99196219C>T	ENST00000370902.3	-	8	602	c.571G>A	c.(571-573)Gaa>Aaa	p.E191K	EXOSC1_ENST00000485122.2_3'UTR|EXOSC1_ENST00000370885.4_Missense_Mutation_p.E166K|EXOSC1_ENST00000471049.1_5'Flank|EXOSC1_ENST00000370886.5_Missense_Mutation_p.E174K	NM_016046.3	NP_057130.1	Q9Y3B2	EXOS1_HUMAN	exosome component 1	191					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|endometrium(1)|lung(5)	7		Renal(717;0.000147)|Colorectal(252;0.00205)|Ovarian(717;0.00965)		all cancers(201;8.29e-42)|Epithelial(162;5.7e-33)|BRCA - Breast invasive adenocarcinoma(275;0.000315)|Kidney(138;0.000832)|KIRC - Kidney renal clear cell carcinoma(50;0.00269)|STAD - Stomach adenocarcinoma(243;0.202)		TGCAAGAATTCGGGTTGTACT	0.478																																						uc001kni.2		NA																	0					0						c.(571-573)GAA>AAA		exosomal core protein CSL4		C	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	132.0	132.0	132.0		571	5.9	1.0	10		132	1,8599	1.2+/-3.3	0,1,4299	no	missense	EXOSC1	NM_016046.3	56	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	191/196	99196219	2,13004	2203	4300	6503	SO:0001583	missense	51013				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA processing	cytosol|exosome (RNase complex)|nucleolus	protein binding|RNA binding	g.chr10:99196219C>T	AF151866	CCDS7459.1	10q24	2004-03-26			ENSG00000171311	ENSG00000171311			17286	protein-coding gene	gene with protein product	"""CSL4 exosomal core protein homolog (yeast)"""	606493				11812149, 11719186	Standard	XR_246092		Approved	hCsl4p, Csl4p, CSL4, Ski4p, SKI4, CGI-108, p13	uc001kni.3	Q9Y3B2	OTTHUMG00000018854	ENST00000370902.3:c.571G>A	10.37:g.99196219C>T	ENSP00000359939:p.Glu191Lys		Somatic				EXOSC1_uc009xvp.1_RNA	p.E191K	NM_016046	NP_057130	WXS	Illumina HiSeq	Unspecified	Q9Y3B2	EXOS1_HUMAN		all cancers(201;8.29e-42)|Epithelial(162;5.7e-33)|BRCA - Breast invasive adenocarcinoma(275;0.000315)|Kidney(138;0.000832)|KIRC - Kidney renal clear cell carcinoma(50;0.00269)|STAD - Stomach adenocarcinoma(243;0.202)	8	597	-		Renal(717;0.000147)|Colorectal(252;0.00205)|Ovarian(717;0.00965)	191					B2R9B3|Q5JTH3	Missense_Mutation	SNP	ENST00000370902.3	37	c.571G>A	CCDS7459.1	.	.	.	.	.	.	.	.	.	.	C	18.96	3.734638	0.69189	2.27E-4	1.16E-4	ENSG00000171311	ENST00000370902;ENST00000370886;ENST00000370885;ENST00000370884	.	.	.	5.95	5.95	0.96441	.	0.088368	0.85682	D	0.000000	T	0.52805	0.1757	L	0.29908	0.895	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.46707	-0.9172	9	0.54805	T	0.06	-0.1745	16.0929	0.81102	0.0:0.8301:0.1699:0.0	.	191	Q9Y3B2	EXOS1_HUMAN	K	191;174;166;150	.	ENSP00000359921:E150K	E	-	1	0	EXOSC1	99186209	0.996000	0.38824	0.997000	0.53966	0.966000	0.64601	3.176000	0.50863	2.821000	0.97095	0.561000	0.74099	GAA		0.478	EXOSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049680.1			17	174	0	0	0	0	17	174				
HRAS	3265	broad.mit.edu	37	11	534286	534286	+	Missense_Mutation	SNP	C	C	G	rs104894228		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:534286C>G	ENST00000451590.1	-	2	224	c.37G>C	c.(37-39)Ggt>Cgt	p.G13R	HRAS_ENST00000417302.1_Missense_Mutation_p.G13R|HRAS_ENST00000468682.2_5'UTR|HRAS_ENST00000397594.1_Missense_Mutation_p.G13R|HRAS_ENST00000311189.7_Missense_Mutation_p.G13R|HRAS_ENST00000397596.2_Missense_Mutation_p.G13R	NM_001130442.1|NM_005343.2	NP_001123914.1|NP_005334.1	P01112	RASH_HUMAN	Harvey rat sarcoma viral oncogene homolog	13			G -> C (in CSTLO). {ECO:0000269|PubMed:16329078}.|G -> D (in CSTLO). {ECO:0000269|PubMed:16170316}.|G -> R (in SFM; somatic mutation; shows constitutive activation of the MAPK and PI3K-AKT signaling pathways). {ECO:0000269|PubMed:22683711}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway (GO:0097193)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Rho GTPase activity (GO:0034259)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of wound healing (GO:0090303)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein C-terminus binding (GO:0008022)	p.G13R(70)|p.G13S(9)|p.G13C(8)|p.G12_G13insAG(1)		adrenal_gland(1)|bone(3)|breast(7)|cervix(23)|endometrium(4)|haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|oesophagus(2)|penis(2)|pituitary(10)|prostate(31)|salivary_gland(24)|skin(184)|soft_tissue(38)|stomach(14)|testis(5)|thymus(1)|thyroid(173)|upper_aerodigestive_tract(122)|urinary_tract(225)	901		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTGCCCACACCGCCGGCGCCC	0.642		6	Mis		"""infrequent sarcomas, rare other types"""	"""rhadomyosarcoma, ganglioneuroblastoma, bladder"""			Costello syndrome	HNSCC(11;0.0054)																												uc001lpv.2		6	yes	Dom	yes	Costello syndrome	11	11p15.5	3265	Mis	v-Ha-ras Harvey rat sarcoma viral oncogene homolog			"""E, L, M"""		rhadomyosarcoma|ganglioneuroblastoma|bladder	infrequent sarcomas|rare other types		88	Substitution - Missense(87)|Insertion - In frame(1)	p.G13R(34)|p.G13V(10)|p.G13D(9)|p.G13S(9)|p.G13C(6)|p.G13G(1)|p.G12_G13insAG(1)	skin(26)|thyroid(17)|urinary_tract(13)|upper_aerodigestive_tract(11)|soft_tissue(8)|lung(5)|salivary_gland(3)|prostate(3)|adrenal_gland(1)|bone(1)	urinary_tract(174)|thyroid(155)|skin(126)|upper_aerodigestive_tract(112)|soft_tissue(37)|prostate(29)|salivary_gland(24)|cervix(23)|stomach(14)|pituitary(10)|lung(9)|haematopoietic_and_lymphoid_tissue(9)|breast(6)|testis(5)|endometrium(4)|bone(3)|large_intestine(2)|oesophagus(2)|penis(2)|kidney(1)|adrenal_gland(1)|thymus(1)	749	GRCh37	CM060018	HRAS	M	rs104894228	c.(37-39)GGT>CGT		v-Ha-ras Harvey rat sarcoma viral oncogene	Sulindac(DB00605)						85.0	80.0	82.0					11																	534286		2202	4300	6502	SO:0001583	missense	3265	Costello_syndrome	Familial Cancer Database	incl.: Facio-Cutaneous-Skeletal syndrome	activation of MAPKK activity|axon guidance|blood coagulation|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|Ras protein signal transduction|synaptic transmission	cytosol|Golgi membrane|plasma membrane	GTP binding|GTPase activity|protein C-terminus binding	g.chr11:534286C>G	AJ437024	CCDS7698.1, CCDS7699.1	11p15.5	2014-09-17	2013-07-08		ENSG00000174775	ENSG00000174775			5173	protein-coding gene	gene with protein product		190020	"""v-Ha-ras Harvey rat sarcoma viral oncogene homolog"""	HRAS1			Standard	NM_176795		Approved		uc010qvx.2	P01112	OTTHUMG00000131919	ENST00000451590.1:c.37G>C	11.37:g.534286C>G	ENSP00000407586:p.Gly13Arg	HNSCC(11;0.0054)	Somatic				HRAS_uc010qvw.1_Missense_Mutation_p.G13R|HRAS_uc010qvx.1_Missense_Mutation_p.G13R|HRAS_uc010qvy.1_RNA	p.G13R	NM_005343	NP_005334	WXS	Illumina HiSeq	Unspecified	P01112	RASH_HUMAN		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)	2	225	-		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)	13		G -> D (in FCSS).|G -> C (in FCSS).	GTP.		B5BUA0|Q14080|Q6FHV9|Q9BR65|Q9UCE2	Missense_Mutation	SNP	ENST00000451590.1	37	c.37G>C	CCDS7698.1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589995	0.66105	.	.	ENSG00000174775	ENST00000397594;ENST00000397596;ENST00000451590;ENST00000417302;ENST00000311189	T;T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76;-0.76	3.0	3.0	0.34707	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84257	0.5432	M	0.74647	2.275	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.73708	0.967;0.981	D	0.86952	0.2086	10	0.87932	D	0	.	14.1517	0.65389	0.0:1.0:0.0:0.0	.	13;13	P01112-2;P01112	.;RASH_HUMAN	R	13	ENSP00000380722:G13R;ENSP00000380723:G13R;ENSP00000407586:G13R;ENSP00000388246:G13R;ENSP00000309845:G13R	ENSP00000309845:G13R	G	-	1	0	HRAS	524286	1.000000	0.71417	0.446000	0.26920	0.236000	0.25371	7.472000	0.80996	1.986000	0.57962	0.561000	0.74099	GGT		0.642	HRAS-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259403.2	NM_176795		8	28	0	0	0	0	8	28				
MUC2	4583	broad.mit.edu	37	11	1087951	1087951	+	Silent	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:1087951C>T	ENST00000441003.2	+	25	3453	c.3426C>T	c.(3424-3426)ttC>ttT	p.F1142F	MUC2_ENST00000359061.5_Silent_p.F1142F	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1142					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACCGGAGCTTCGAGACCTGCA	0.612																																						uc001lsx.1		NA																	0				lung(1)|breast(1)	2						c.(3424-3426)TTC>TTT		mucin 2 precursor	Pranlukast(DB01411)						69.0	74.0	72.0					11																	1087951		2150	4251	6401	SO:0001819	synonymous_variant	4583					inner mucus layer|outer mucus layer	protein binding	g.chr11:1087951C>T	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.3426C>T	11.37:g.1087951C>T			Somatic					p.F1142F	NM_002457	NP_002448	WXS	Illumina HiSeq	Unspecified	Q02817	MUC2_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	25	3453	+		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)	1142					Q14878	Silent	SNP	ENST00000441003.2	37	c.3426C>T																																																																																					0.612	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457		3	18	0	0	0	0	3	18				
PGAP2	27315	broad.mit.edu	37	11	3845337	3845337	+	Silent	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:3845337C>T	ENST00000463452.2	+	3	473	c.390C>T	c.(388-390)ctC>ctT	p.L130L	PGAP2_ENST00000493547.2_Silent_p.L130L|PGAP2_ENST00000396991.2_Silent_p.L191L|PGAP2_ENST00000396993.4_Missense_Mutation_p.H84Y|PGAP2_ENST00000278243.4_Silent_p.L191L|PGAP2_ENST00000496834.2_5'UTR|PGAP2_ENST00000396986.2_Silent_p.L187L|PGAP2_ENST00000479072.1_5'UTR|AC090587.2_ENST00000507938.1_RNA|PGAP2_ENST00000300730.6_Silent_p.L187L|PGAP2_ENST00000465307.2_Missense_Mutation_p.H134Y|PGAP2_ENST00000532017.1_3'UTR	NM_001256240.1	NP_001243169.1	Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2	130					GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						TGCTAGTGCTCACTTATGTCT	0.612																																						uc001lys.2		NA																	0					0						c.(571-573)CTC>CTT		FGF receptor activating protein 1 isoform 1							83.0	71.0	75.0					11																	3845337		2201	4298	6499	SO:0001819	synonymous_variant	27315				GPI anchor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	protein transporter activity	g.chr11:3845337C>T	AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000463452.2:c.390C>T	11.37:g.3845337C>T			Somatic				PGAP2_uc001lyl.2_Silent_p.L148L|PGAP2_uc010qxw.1_Silent_p.L248L|PGAP2_uc010qxx.1_Missense_Mutation_p.H172Y|PGAP2_uc001lyp.3_Intron|PGAP2_uc010qxy.1_Silent_p.L187L|PGAP2_uc010qxz.1_Silent_p.L187L|PGAP2_uc001lyn.3_Missense_Mutation_p.H84Y|PGAP2_uc010qya.1_RNA|PGAP2_uc001lyr.2_Silent_p.L130L|PGAP2_uc010qyb.1_Missense_Mutation_p.H134Y|PGAP2_uc001lyt.2_5'UTR	p.L191L	NM_014489	NP_055304	WXS	Illumina HiSeq	Unspecified	Q9UHJ9	PGAP2_HUMAN			4	699	+			191			Helical; (Potential).		E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	Silent	SNP	ENST00000463452.2	37	c.573C>T	CCDS58112.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.82|12.82	2.052476|2.052476	0.36181|0.36181	.|.	.|.	ENSG00000148985|ENSG00000148985	ENST00000396993;ENST00000532523;ENST00000465307|ENST00000459679;ENST00000464906	.|.	.|.	.|.	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	.|.	.|.	.|.	.|.	T|T	0.71685|0.71685	0.3369|0.3369	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.71656|.	0.955;0.974|.	T|T	0.69636|0.69636	-0.5092|-0.5092	7|4	0.87932|.	D|.	0|.	-24.2032|-24.2032	15.3348|15.3348	0.74244|0.74244	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	134;84|.	B7Z2X5;A8MZF5|.	.;.|.	Y|L	84;149;134|161;221	.|.	ENSP00000380190:H84Y|.	H|S	+|+	1|2	0|0	PGAP2|PGAP2	3801913|3801913	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.607000|0.607000	0.37147|0.37147	1.484000|1.484000	0.35508|0.35508	2.682000|2.682000	0.91365|0.91365	0.650000|0.650000	0.86243|0.86243	CAC|TCA		0.612	PGAP2-049	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000383260.1			6	38	0	0	0	0	6	38				
ANO5	203859	broad.mit.edu	37	11	22249037	22249037	+	Nonsense_Mutation	SNP	G	G	T	rs140381407		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:22249037G>T	ENST00000324559.8	+	7	870	c.553G>T	c.(553-555)Gaa>Taa	p.E185*		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	185					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TCCCCATCCTGAATATTTTAC	0.463																																						uc001mqi.2		NA																	0				central_nervous_system(3)|ovary(1)	4						c.(553-555)GAA>TAA		anoctamin 5 isoform a							127.0	123.0	125.0					11																	22249037		2203	4300	6503	SO:0001587	stop_gained	203859					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity	g.chr11:22249037G>T	AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.553G>T	11.37:g.22249037G>T	ENSP00000315371:p.Glu185*		Somatic				ANO5_uc001mqj.2_Nonsense_Mutation_p.E184*	p.E185*	NM_213599	NP_998764	WXS	Illumina HiSeq	Unspecified	Q75V66	ANO5_HUMAN			7	870	+			185			Cytoplasmic (Potential).			Nonsense_Mutation	SNP	ENST00000324559.8	37	c.553G>T	CCDS31444.1	.	.	.	.	.	.	.	.	.	.	G	40	8.184149	0.98693	.	.	ENSG00000171714	ENST00000324559	.	.	.	5.75	5.75	0.90469	.	0.085998	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	19.9375	0.97146	0.0:0.0:1.0:0.0	.	.	.	.	X	185	.	ENSP00000315371:E185X	E	+	1	0	ANO5	22205613	1.000000	0.71417	0.998000	0.56505	0.722000	0.41435	9.444000	0.97578	2.717000	0.92951	0.650000	0.86243	GAA		0.463	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599		18	164	1	0	8.01e-06	8.79e-06	18	164				
PAMR1	25891	broad.mit.edu	37	11	35463155	35463155	+	Missense_Mutation	SNP	G	G	A	rs149018193	byFrequency	TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:35463155G>A	ENST00000378880.2	-	7	1352	c.907C>T	c.(907-909)Cgc>Tgc	p.R303C	PAMR1_ENST00000532848.1_Missense_Mutation_p.R263C|PAMR1_ENST00000378878.3_Missense_Mutation_p.R192C|PAMR1_ENST00000278360.3_Missense_Mutation_p.R320C	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	303	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						TTAGCATGGCGTCCGTTGATA	0.468													G|||	2	0.000399361	0.0015	0.0	5008	,	,		15270	0.0		0.0	False		,,,				2504	0.0					uc001mwg.2		NA																	0				ovary(2)	2						c.(907-909)CGC>TGC		regeneration associated muscle protease isoform		G	CYS/ARG,CYS/ARG	5,4399	9.9+/-24.2	0,5,2197	110.0	110.0	110.0		907,958	4.8	0.1	11	dbSNP_134	110	1,8595	1.2+/-3.3	0,1,4297	yes	missense,missense	PAMR1	NM_001001991.1,NM_015430.2	180,180	0,6,6494	AA,AG,GG		0.0116,0.1135,0.0462	possibly-damaging,possibly-damaging	303/721,320/738	35463155	6,12994	2202	4298	6500	SO:0001583	missense	25891				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr11:35463155G>A		CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.907C>T	11.37:g.35463155G>A	ENSP00000368158:p.Arg303Cys		Somatic				PAMR1_uc001mwf.2_Missense_Mutation_p.R320C|PAMR1_uc010rew.1_Missense_Mutation_p.R192C|PAMR1_uc010rex.1_Missense_Mutation_p.R263C	p.R303C	NM_001001991	NP_001001991	WXS	Illumina HiSeq	Unspecified	Q6UXH9	PAMR1_HUMAN			7	950	-			303			Sushi 1.		A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	ENST00000378880.2	37	c.907C>T	CCDS31460.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	11.74	1.730128	0.30684	0.001135	1.16E-4	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000532848;ENST00000527605	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	5.74	4.82	0.62117	Complement control module (2);Sushi/SCR/CCP (3);	0.485871	0.25935	N	0.027357	T	0.72558	0.3475	L	0.58354	1.805	0.23673	N	0.997141	D;D;D	0.76494	0.999;0.984;0.98	P;P;P	0.60609	0.877;0.636;0.502	T	0.67027	-0.5774	10	0.87932	D	0	.	13.7491	0.62897	0.0:0.0:0.7198:0.2802	.	192;303;320	A8MQ58;Q6UXH9;Q6UXH9-2	.;PAMR1_HUMAN;.	C	320;303;192;263;280	ENSP00000278360:R320C;ENSP00000368158:R303C;ENSP00000368156:R192C;ENSP00000433868:R263C;ENSP00000432591:R280C	ENSP00000278360:R320C	R	-	1	0	PAMR1	35419731	0.331000	0.24713	0.100000	0.21137	0.000000	0.00434	2.645000	0.46621	1.406000	0.46857	-0.293000	0.09583	CGC		0.468	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389177.1	NM_015430		50	178	0	0	0	0	50	178				
MADD	8567	broad.mit.edu	37	11	47330541	47330541	+	Silent	SNP	A	A	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:47330541A>G	ENST00000311027.5	+	26	4044	c.3879A>G	c.(3877-3879)aaA>aaG	p.K1293K	MADD_ENST00000395336.3_Silent_p.K1293K|MADD_ENST00000395344.3_Intron|MADD_ENST00000402799.1_Intron|MADD_ENST00000406482.1_Intron|MADD_ENST00000342922.4_Intron|MADD_ENST00000405573.2_Silent_p.K103K|MADD_ENST00000402192.2_Intron|MADD_ENST00000407859.3_Intron|MADD_ENST00000349238.3_Intron	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		GAAGGGACAAAGGATCCATGT	0.458																																						uc001ner.1		NA																	0				ovary(5)|skin(4)|central_nervous_system(2)	11						c.(3877-3879)AAA>AAG		MAP-kinase activating death domain-containing							139.0	118.0	125.0					11																	47330541		2201	4298	6499	SO:0001819	synonymous_variant	8567				activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity	g.chr11:47330541A>G	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.3879A>G	11.37:g.47330541A>G			Somatic				MADD_uc001neq.2_Intron|MADD_uc001nev.1_Intron|MADD_uc001nes.1_Intron|MADD_uc001net.1_Intron|MADD_uc009yln.1_Intron|MADD_uc001neu.1_Intron|MADD_uc001nex.2_Silent_p.K1293K|MADD_uc001nez.2_Intron|MADD_uc001new.2_Intron|MADD_uc009ylo.2_Silent_p.K207K	p.K1293K	NM_003682	NP_003673	WXS	Illumina HiSeq	Unspecified	Q8WXG6	MADD_HUMAN		Lung(87;0.182)	26	4070	+			1293						Silent	SNP	ENST00000311027.5	37	c.3879A>G	CCDS7930.1																																																																																				0.458	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1			36	172	0	0	0	0	36	172				
OR8J3	81168	broad.mit.edu	37	11	55904306	55904306	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:55904306C>A	ENST00000301529.1	-	1	888	c.889G>T	c.(889-891)Gta>Tta	p.V297L		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	297						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					GCAACATTTACATCATTATTC	0.338																																						uc010riz.1		NA																	0				skin(2)	2						c.(889-891)GTA>TTA		olfactory receptor, family 8, subfamily J,							95.0	95.0	95.0					11																	55904306		2201	4296	6497	SO:0001583	missense	81168				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55904306C>A		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.889G>T	11.37:g.55904306C>A	ENSP00000301529:p.Val297Leu		Somatic					p.V297L	NM_001004064	NP_001004064	WXS	Illumina HiSeq	Unspecified	Q8NGG0	OR8J3_HUMAN			1	889	-	Esophageal squamous(21;0.00693)		297			Cytoplasmic (Potential).		Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	37	c.889G>T	CCDS31520.1	.	.	.	.	.	.	.	.	.	.	C	6.677	0.493556	0.12702	.	.	ENSG00000167822	ENST00000301529	T	0.37584	1.19	3.27	2.32	0.28847	.	0.000000	0.56097	D	0.000031	T	0.26882	0.0658	L	0.49455	1.56	0.09310	N	1	P	0.41232	0.743	B	0.37833	0.259	T	0.25710	-1.0124	10	0.87932	D	0	.	4.4162	0.11457	0.0:0.5849:0.1969:0.2182	.	297	Q8NGG0	OR8J3_HUMAN	L	297	ENSP00000301529:V297L	ENSP00000301529:V297L	V	-	1	0	OR8J3	55660882	0.043000	0.20138	0.422000	0.26621	0.129000	0.20672	0.337000	0.19841	1.553000	0.49476	0.297000	0.19635	GTA		0.338	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064		20	141	1	0	3.99e-14	4.6e-14	20	141				
OR9Q1	219956	broad.mit.edu	37	11	57947391	57947391	+	Missense_Mutation	SNP	C	C	T	rs2513718		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:57947391C>T	ENST00000335397.3	+	3	791	c.475C>T	c.(475-477)Cgg>Tgg	p.R159W		NM_001005212.3	NP_001005212.1	Q8NGQ5	OR9Q1_HUMAN	olfactory receptor, family 9, subfamily Q, member 1	159			R -> L (in dbSNP:rs12420738).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R159W(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Breast(21;0.222)				TGCCTTGGTGCGGACAGTCTC	0.537																																						uc001nmj.2		NA																	1	Substitution - Missense(1)		endometrium(1)	ovary(1)	1						c.(475-477)CGG>TGG		olfactory receptor, family 9, subfamily Q,		A	TRP/ARG	0,4402		0,0,2201	110.0	88.0	95.0		475	-9.6	0.0	11	dbSNP_100	95	1,8591	1.2+/-3.3	0,1,4295	no	missense	OR9Q1	NM_001005212.3	101	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	159/311	57947391	1,12993	2201	4296	6497	SO:0001583	missense	219956				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57947391C>T	AB065734	CCDS31543.1	11q12.1	2012-08-09				ENSG00000186509		"""GPCR / Class A : Olfactory receptors"""	14724	protein-coding gene	gene with protein product							Standard	NM_001005212		Approved		uc001nmj.3	Q8NGQ5		ENST00000335397.3:c.475C>T	11.37:g.57947391C>T	ENSP00000334934:p.Arg159Trp		Somatic					p.R159W	NM_001005212	NP_001005212	WXS	Illumina HiSeq	Unspecified	Q8NGQ5	OR9Q1_HUMAN			3	791	+		Breast(21;0.222)	159			Helical; Name=4; (Potential).		Q2TAN3|Q96RA7	Missense_Mutation	SNP	ENST00000335397.3	37	c.475C>T	CCDS31543.1	.	.	.	.	.	.	.	.	.	.	c	13.66	2.303548	0.40795	0.0	1.16E-4	ENSG00000186509	ENST00000335397	T	0.00123	8.7	4.83	-9.65	0.00537	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000195	T	0.00328	0.0010	L	0.53249	1.67	0.20638	N	0.999874	D	0.89917	1.0	D	0.91635	0.999	T	0.48175	-0.9058	10	0.87932	D	0	-15.456	23.5226	0.99983	0.8258:0.1742:0.0:0.0	rs2513718;rs2513718	159	Q8NGQ5	OR9Q1_HUMAN	W	159	ENSP00000334934:R159W	ENSP00000334934:R159W	R	+	1	2	OR9Q1	57703967	0.000000	0.05858	0.032000	0.17829	0.277000	0.26821	-5.714000	0.00103	-1.955000	0.01023	-0.335000	0.08231	CGG		0.537	OR9Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394538.2	NM_001005212		24	62	0	0	0	0	24	62				
OR1S1	219959	broad.mit.edu	37	11	57982965	57982965	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:57982965C>T	ENST00000309433.6	+	1	749	c.749C>T	c.(748-750)gCc>gTc	p.A250V		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				AAGTGGAAAGCCTTCTCCACT	0.468																																						uc010rkc.1		NA																	0				breast(1)	1						c.(748-750)GCC>GTC		olfactory receptor, family 1, subfamily S,							157.0	125.0	136.0					11																	57982965		2201	4295	6496	SO:0001583	missense	219959				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57982965C>T	BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.749C>T	11.37:g.57982965C>T	ENSP00000311688:p.Ala250Val		Somatic					p.A250V	NM_001004458	NP_001004458	WXS	Illumina HiSeq	Unspecified	Q8NH92	OR1S1_HUMAN			1	749	+		Breast(21;0.0589)	250			Helical; Name=6; (Potential).		Q6IFG3	Missense_Mutation	SNP	ENST00000309433.6	37	c.749C>T	CCDS31546.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839501	0.51057	.	.	ENSG00000172774	ENST00000309433	T	0.00342	8.03	3.23	3.23	0.37069	GPCR, rhodopsin-like superfamily (1);	0.139884	0.32819	N	0.005604	T	0.00580	0.0019	M	0.67517	2.055	0.28774	N	0.900196	D	0.55385	0.971	P	0.60415	0.874	T	0.43940	-0.9360	10	0.66056	D	0.02	.	13.6137	0.62094	0.0:1.0:0.0:0.0	.	250	Q8NH92	OR1S1_HUMAN	V	250	ENSP00000311688:A250V	ENSP00000311688:A250V	A	+	2	0	OR1S1	57739541	0.288000	0.24324	1.000000	0.80357	0.717000	0.41224	2.164000	0.42387	1.647000	0.50633	0.479000	0.44913	GCC		0.468	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394705.1	NM_001004458		25	110	0	0	0	0	25	110				
OR4D10	390197	broad.mit.edu	37	11	59244959	59244959	+	Silent	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:59244959G>A	ENST00000530162.1	+	1	114	c.57G>A	c.(55-57)caG>caA	p.Q19Q		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	19						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCCTGACCCAGAATCGGGAAG	0.403																																						uc001nnz.1		NA																	0				ovary(2)|skin(1)	3						c.(55-57)CAG>CAA		olfactory receptor, family 4, subfamily D,							87.0	90.0	89.0					11																	59244959		1993	4159	6152	SO:0001819	synonymous_variant	390197				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59244959G>A	AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.57G>A	11.37:g.59244959G>A			Somatic					p.Q19Q	NM_001004705	NP_001004705	WXS	Illumina HiSeq	Unspecified	Q8NGI6	OR4DA_HUMAN			1	57	+			19			Extracellular (Potential).		B2RNH6	Silent	SNP	ENST00000530162.1	37	c.57G>A	CCDS53636.1																																																																																				0.403	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394235.1	NM_001004705		5	162	0	0	0	0	5	162				
NRXN2	9379	broad.mit.edu	37	11	64397889	64397889	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:64397889C>T	ENST00000377551.1	-	18	3953	c.3742G>A	c.(3742-3744)Gag>Aag	p.E1248K	NRXN2_ENST00000409571.1_Missense_Mutation_p.E1241K|NRXN2_ENST00000265459.6_Missense_Mutation_p.E1248K|NRXN2_ENST00000301894.2_Missense_Mutation_p.E202K|NRXN2_ENST00000377559.3_Missense_Mutation_p.E1208K			Q9P2S2	NRX2A_HUMAN	neurexin 2	1248	Laminin G-like 6. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						GGGTACCGCTCGTTGACCGGC	0.731																																						uc001oap.2		NA																	0				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						c.(604-606)GAG>AAG		neurexin 2 isoform beta precursor							60.0	53.0	55.0					11																	64397889		2201	4297	6498	SO:0001583	missense	9379				cell adhesion	integral to membrane		g.chr11:64397889C>T		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.3742G>A	11.37:g.64397889C>T	ENSP00000366774:p.Glu1248Lys		Somatic				NRXN2_uc001oar.2_Missense_Mutation_p.E1248K|NRXN2_uc001oas.2_Missense_Mutation_p.E1208K|NRXN2_uc001oaq.2_Missense_Mutation_p.E915K	p.E202K	NM_138734	NP_620063	WXS	Illumina HiSeq	Unspecified	P58401	NRX2B_HUMAN			4	1115	-			202			Extracellular (Potential).|Laminin G-like.		A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	c.604G>A	CCDS8077.1	.	.	.	.	.	.	.	.	.	.	C	35	5.506185	0.96386	.	.	ENSG00000110076	ENST00000301894;ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571;ENST00000423049	T;T;T;T;T;T	0.78003	0.93;-1.14;-1.14;-1.14;-1.14;0.93	4.8	4.8	0.61643	Concanavalin A-like lectin/glucanase (2);Concanavalin A-like lectin/glucanase, subgroup (2);Laminin G domain (4);Laminin G, subdomain 2 (2);	0.000000	0.42964	U	0.000623	D	0.86969	0.6061	M	0.73217	2.22	0.80722	D	1	P;D;D;D	0.89917	0.929;0.988;1.0;0.999	B;P;D;D	0.80764	0.34;0.812;0.994;0.982	D	0.88172	0.2865	10	0.72032	D	0.01	.	16.1594	0.81686	0.0:1.0:0.0:0.0	.	1208;1248;994;202	Q9P2S2-2;Q9P2S2;E7EV67;P58401	.;NRX2A_HUMAN;.;NRX2B_HUMAN	K	202;1248;1208;1248;1208;1241;163	ENSP00000301894:E202K;ENSP00000366774:E1248K;ENSP00000366782:E1208K;ENSP00000265459:E1248K;ENSP00000386416:E1241K;ENSP00000407374:E163K	ENSP00000265459:E1248K	E	-	1	0	NRXN2	64154465	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.618000	0.83043	2.599000	0.87857	0.561000	0.74099	GAG		0.731	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080		10	60	0	0	0	0	10	60				
SF1	7536	broad.mit.edu	37	11	64536792	64536792	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:64536792G>A	ENST00000377390.3	-	7	1019	c.682C>T	c.(682-684)Cag>Tag	p.Q228*	SF1_ENST00000334944.5_Nonsense_Mutation_p.Q228*|SF1_ENST00000489544.1_5'UTR|SF1_ENST00000377387.1_Nonsense_Mutation_p.Q353*|SF1_ENST00000422298.2_Nonsense_Mutation_p.Q113*|SF1_ENST00000227503.9_Nonsense_Mutation_p.Q228*|SF1_ENST00000377394.3_Nonsense_Mutation_p.Q228*|SF1_ENST00000433274.2_Nonsense_Mutation_p.Q202*	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	228					Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						TCGATACCCTGCTTCAGGATG	0.502																																						uc001obb.1		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(682-684)CAG>TAG		splicing factor 1 isoform 1							99.0	95.0	97.0					11																	64536792		2201	4297	6498	SO:0001587	stop_gained	7536				nuclear mRNA 3'-splice site recognition|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ribosome|spliceosomal complex	protein binding|RNA binding|transcription corepressor activity|zinc ion binding	g.chr11:64536792G>A	D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.682C>T	11.37:g.64536792G>A	ENSP00000366607:p.Gln228*		Somatic				SF1_uc010rnm.1_5'Flank|SF1_uc010rnn.1_Nonsense_Mutation_p.Q202*|SF1_uc001oaz.1_Nonsense_Mutation_p.Q353*|SF1_uc001oba.1_Nonsense_Mutation_p.Q228*|SF1_uc001obc.1_Nonsense_Mutation_p.Q228*|SF1_uc001obd.1_Nonsense_Mutation_p.Q228*|SF1_uc001obe.1_Nonsense_Mutation_p.Q113*|SF1_uc010rno.1_Nonsense_Mutation_p.Q113*	p.Q228*	NM_004630	NP_004621	WXS	Illumina HiSeq	Unspecified	Q15637	SF01_HUMAN			7	1059	-			228					B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Nonsense_Mutation	SNP	ENST00000377390.3	37	c.682C>T	CCDS31599.1	.	.	.	.	.	.	.	.	.	.	G	39	7.700893	0.98441	.	.	ENSG00000168066	ENST00000377387;ENST00000377390;ENST00000227503;ENST00000377394;ENST00000334944;ENST00000422298;ENST00000433274	.	.	.	6.03	6.03	0.97812	.	0.054550	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	18.0691	0.89400	0.0:0.0:1.0:0.0	.	.	.	.	X	353;228;228;228;228;113;202	.	ENSP00000227503:Q228X	Q	-	1	0	SF1	64293368	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	9.508000	0.98000	2.868000	0.98415	0.557000	0.71058	CAG		0.502	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143242.1	NM_004630		6	121	0	0	0	0	6	121				
C11orf30	56946	broad.mit.edu	37	11	76171120	76171120	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:76171120T>C	ENST00000529032.1	+	5	562	c.562T>C	c.(562-564)Tat>Cat	p.Y188H	C11orf30_ENST00000525038.1_Missense_Mutation_p.Y203H|C11orf30_ENST00000525919.1_Missense_Mutation_p.Y189H|C11orf30_ENST00000334736.3_Missense_Mutation_p.Y188H|C11orf30_ENST00000343878.3_Missense_Mutation_p.Y188H|C11orf30_ENST00000524767.1_Missense_Mutation_p.Y203H|C11orf30_ENST00000533248.1_Missense_Mutation_p.Y202H|C11orf30_ENST00000524490.1_Missense_Mutation_p.Y189H			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	188	Interaction with BRCA2.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						AAGTACTGTTTATGTCAAAAG	0.458																																						uc001oxl.2		NA																	0				ovary(5)|skin(1)	6						c.(562-564)TAT>CAT		EMSY protein							270.0	245.0	253.0					11																	76171120		2200	4292	6492	SO:0001583	missense	56946				chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus		g.chr11:76171120T>C	AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.562T>C	11.37:g.76171120T>C	ENSP00000432327:p.Tyr188His		Somatic				C11orf30_uc001oxk.2_3'UTR|C11orf30_uc009yuj.1_Missense_Mutation_p.Y203H|C11orf30_uc010rsa.1_Intron|C11orf30_uc001oxm.2_Missense_Mutation_p.Y189H|C11orf30_uc010rsb.1_Missense_Mutation_p.Y203H|C11orf30_uc010rsc.1_Missense_Mutation_p.Y203H|C11orf30_uc001oxn.2_Missense_Mutation_p.Y189H|C11orf30_uc010rsd.1_Missense_Mutation_p.Y202H	p.Y188H	NM_020193	NP_064578	WXS	Illumina HiSeq	Unspecified	Q7Z589	EMSY_HUMAN			6	705	+			188			Interaction with BRCA2.		B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	ENST00000529032.1	37	c.562T>C	CCDS8244.1	.	.	.	.	.	.	.	.	.	.	T	16.06	3.016521	0.54468	.	.	ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000343878;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032	T;T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.37073	0.0990	N	0.24115	0.695	0.46478	D	0.999063	P;P;P;P;P;P	0.51791	0.948;0.91;0.948;0.91;0.91;0.91	P;P;P;P;P;P	0.49226	0.603;0.603;0.603;0.603;0.603;0.603	T	0.08249	-1.0731	10	0.22706	T	0.39	-2.5442	14.9939	0.71415	0.0:0.0:0.0:1.0	.	202;203;203;189;189;188	B7ZKT8;B7ZKU2;B7ZKU0;Q17RM7;E9PMC9;Q7Z589	.;.;.;.;.;EMSY_HUMAN	H	189;188;188;203;202;189;203;188	ENSP00000431166:Y189H;ENSP00000334130:Y188H;ENSP00000344688:Y188H;ENSP00000433205:Y203H;ENSP00000433634:Y202H;ENSP00000432010:Y189H;ENSP00000436968:Y203H;ENSP00000432327:Y188H	ENSP00000334130:Y188H	Y	+	1	0	C11orf30	75848768	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.261000	0.72509	2.000000	0.58554	0.482000	0.46254	TAT		0.458	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193		45	309	0	0	0	0	45	309				
CNTN5	53942	broad.mit.edu	37	11	100179177	100179177	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:100179177C>G	ENST00000524871.1	+	21	2997	c.2707C>G	c.(2707-2709)Cta>Gta	p.L903V	CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000418526.2_Missense_Mutation_p.L829V|CNTN5_ENST00000528682.1_Missense_Mutation_p.L903V|CNTN5_ENST00000279463.3_Missense_Mutation_p.L903V|CNTN5_ENST00000527185.1_Missense_Mutation_p.L903V	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	903	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TAAAGAGAGTCTAGGAAGACC	0.418																																						uc001pga.2		NA																	0				skin(3)|ovary(2)|pancreas(2)|breast(1)	8						c.(2707-2709)CTA>GTA		contactin 5 isoform long							68.0	67.0	67.0					11																	100179177		1874	4103	5977	SO:0001583	missense	53942				cell adhesion	anchored to membrane|plasma membrane	protein binding	g.chr11:100179177C>G	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.2707C>G	11.37:g.100179177C>G	ENSP00000435637:p.Leu903Val		Somatic				CNTN5_uc001pfz.2_Missense_Mutation_p.L903V|CNTN5_uc001pgb.2_Missense_Mutation_p.L829V|CNTN5_uc010ruk.1_Missense_Mutation_p.L174V	p.L903V	NM_014361	NP_055176	WXS	Illumina HiSeq	Unspecified	O94779	CNTN5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)	21	3046	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	903			Fibronectin type-III 3.		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	c.2707C>G	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.515673	0.27123	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.53423	2.31;0.62;0.62;0.62;0.62	5.69	4.75	0.60458	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.070349	0.64402	D	0.000018	T	0.35098	0.0920	L	0.36672	1.1	0.49213	D	0.999763	B;B	0.13145	0.003;0.007	B;B	0.14578	0.006;0.011	T	0.13737	-1.0498	10	0.28530	T	0.3	.	8.7007	0.34323	0.0:0.8183:0.0:0.1817	.	829;903	O94779-2;O94779	.;CNTN5_HUMAN	V	903;903;903;829;903	ENSP00000433575:L903V;ENSP00000436185:L903V;ENSP00000435637:L903V;ENSP00000393229:L829V;ENSP00000279463:L903V	ENSP00000279463:L903V	L	+	1	2	CNTN5	99684387	0.996000	0.38824	0.879000	0.34478	0.835000	0.47333	1.694000	0.37752	1.452000	0.47756	0.591000	0.81541	CTA		0.418	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361		8	49	0	0	0	0	8	49				
HTR3B	9177	broad.mit.edu	37	11	113803138	113803138	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:113803138G>A	ENST00000260191.2	+	5	753	c.496G>A	c.(496-498)Gtc>Atc	p.V166I	HTR3B_ENST00000537778.1_Missense_Mutation_p.V155I	NM_006028.4	NP_006019.1	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B, ionotropic	166					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ion channel activity (GO:0005216)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(11)	20		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	Ergoloid mesylate(DB01049)	TCCATTTGATGTCCAGAATTG	0.428																																						uc001pok.2		NA																	0					0						c.(496-498)GTC>ATC		5-hydroxytryptamine (serotonin) receptor 3B							157.0	133.0	141.0					11																	113803138		2201	4296	6497	SO:0001583	missense	9177				synaptic transmission	integral to plasma membrane|postsynaptic membrane	serotonin receptor activity|serotonin-activated cation-selective channel activity	g.chr11:113803138G>A	AF080582	CCDS8364.1	11q23.1	2012-05-22	2012-02-03		ENSG00000149305	ENSG00000149305		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5298	protein-coding gene	gene with protein product		604654	"""5-hydroxytryptamine (serotonin) receptor 3B"""			9950429, 10521471	Standard	NM_006028		Approved	5-HT3B	uc001pok.3	O95264	OTTHUMG00000168210	ENST00000260191.2:c.496G>A	11.37:g.113803138G>A	ENSP00000260191:p.Val166Ile		Somatic				HTR3B_uc001pol.2_Missense_Mutation_p.V155I	p.V166I	NM_006028	NP_006019	WXS	Illumina HiSeq	Unspecified	O95264	5HT3B_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	5	563	+		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	166			Extracellular (Potential).		B0YJ23|Q0VJC3	Missense_Mutation	SNP	ENST00000260191.2	37	c.496G>A	CCDS8364.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.08|11.08	1.533905|1.533905	0.27387|0.27387	.|.	.|.	ENSG00000149305|ENSG00000149305	ENST00000543092|ENST00000260191;ENST00000537778	.|T;T	.|0.79352	.|-1.26;-1.26	5.82|5.82	-0.921|-0.921	0.10472|0.10472	.|Neurotransmitter-gated ion-channel ligand-binding (3);	.|0.553666	.|0.19874	.|N	.|0.104125	T|T	0.63450|0.63450	0.2512|0.2512	L|L	0.28458|0.28458	0.855|0.855	0.21782|0.21782	N|N	0.999544|0.999544	.|B;B	.|0.16603	.|0.018;0.002	.|B;B	.|0.19148	.|0.024;0.003	T|T	0.46205|0.46205	-0.9208|-0.9208	5|10	.|0.22706	.|T	.|0.39	-6.0334|-6.0334	13.3443|13.3443	0.60564|0.60564	0.3627:0.0:0.6373:0.0|0.3627:0.0:0.6373:0.0	.|.	.|155;166	.|O95264-2;O95264	.|.;5HT3B_HUMAN	I|I	94|166;155	.|ENSP00000260191:V166I;ENSP00000443118:V155I	.|ENSP00000260191:V166I	M|V	+|+	3|1	0|0	HTR3B|HTR3B	113308348|113308348	0.996000|0.996000	0.38824|0.38824	0.956000|0.956000	0.39512|0.39512	0.991000|0.991000	0.79684|0.79684	1.060000|1.060000	0.30530|0.30530	-0.411000|-0.411000	0.07530|0.07530	-0.253000|-0.253000	0.11424|0.11424	ATG|GTC		0.428	HTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398842.1	NM_006028		4	144	0	0	0	0	4	144				
BSX	390259	broad.mit.edu	37	11	122849989	122849989	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:122849989G>A	ENST00000343035.2	-	2	487	c.439C>T	c.(439-441)Ctc>Ttc	p.L147F		NM_001098169.1	NP_001091639.1	Q3C1V8	BSH_HUMAN	brain-specific homeobox	147					eating behavior (GO:0042755)|locomotory behavior (GO:0007626)|mammary gland involution (GO:0060056)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	10		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)		GACAGGCTGAGGGCCGTGGCC	0.612																																						uc010rzs.1		NA																	0					0						c.(439-441)CTC>TTC		brain specific homeobox							63.0	75.0	71.0					11																	122849989		2059	4206	6265	SO:0001583	missense	390259							g.chr11:122849989G>A		CCDS41728.1	11q24.1	2011-07-19			ENSG00000188909	ENSG00000188909		"""Homeoboxes / ANTP class : NKL subclass"""	20450	protein-coding gene	gene with protein product		611074					Standard	NM_001098169		Approved	BSX1	uc010rzs.2	Q3C1V8	OTTHUMG00000150247	ENST00000343035.2:c.439C>T	11.37:g.122849989G>A	ENSP00000344285:p.Leu147Phe		Somatic					p.L147F	NM_001098169	NP_001091639	WXS	Illumina HiSeq	Unspecified	Q3C1V8	BSH_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)	2	439	-		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	147			Homeobox.			Missense_Mutation	SNP	ENST00000343035.2	37	c.439C>T	CCDS41728.1	.	.	.	.	.	.	.	.	.	.	G	33	5.227647	0.95173	.	.	ENSG00000188909	ENST00000343035	D	0.98264	-4.83	5.22	5.22	0.72569	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.059885	0.64402	D	0.000002	D	0.99542	0.9836	H	0.99609	4.655	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97562	1.0099	10	0.87932	D	0	.	18.7806	0.91930	0.0:0.0:1.0:0.0	.	147	Q3C1V8	BSH_HUMAN	F	147	ENSP00000344285:L147F	ENSP00000344285:L147F	L	-	1	0	BSX	122355199	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	7.767000	0.85331	2.454000	0.82982	0.655000	0.94253	CTC		0.612	BSX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317076.1	NM_001098169		43	119	0	0	0	0	43	119				
OR6T1	219874	broad.mit.edu	37	11	123813728	123813728	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr11:123813728C>A	ENST00000321252.2	-	1	852	c.818G>T	c.(817-819)gGt>gTt	p.G273V		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GACGGAGGCACCTTTGTTGAG	0.512																																						uc010sab.1		NA																	0				ovary(1)	1						c.(817-819)GGT>GTT		olfactory receptor, family 6, subfamily T,							273.0	229.0	244.0					11																	123813728		2202	4299	6501	SO:0001583	missense	219874				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123813728C>A	AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.818G>T	11.37:g.123813728C>A	ENSP00000325203:p.Gly273Val		Somatic					p.G273V	NM_001005187	NP_001005187	WXS	Illumina HiSeq	Unspecified	Q8NGN1	OR6T1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)	1	818	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	273			Helical; Name=7; (Potential).		Q6IFE7	Missense_Mutation	SNP	ENST00000321252.2	37	c.818G>T	CCDS31700.1	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.434761	0.01108	.	.	ENSG00000181499	ENST00000321252	T	0.00014	9.2	3.7	2.72	0.32119	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.00525	-1.395	0.28009	N	0.934987	B	0.12013	0.005	B	0.17098	0.017	T	0.01748	-1.1282	9	0.40728	T	0.16	-9.2584	10.8498	0.46763	0.0:0.8076:0.1923:0.0	.	273	Q8NGN1	OR6T1_HUMAN	V	273	ENSP00000325203:G273V	ENSP00000325203:G273V	G	-	2	0	OR6T1	123318938	0.000000	0.05858	0.218000	0.23776	0.026000	0.11368	1.135000	0.31454	1.872000	0.54250	0.563000	0.77884	GGT		0.512	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387264.1	NM_001005187		70	226	1	0	5.02e-34	5.93e-34	70	226				
DYRK4	8798	broad.mit.edu	37	12	4721794	4721794	+	Missense_Mutation	SNP	A	A	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr12:4721794A>T	ENST00000540757.2	+	12	1391	c.1231A>T	c.(1231-1233)Agg>Tgg	p.R411W	DYRK4_ENST00000543431.1_Missense_Mutation_p.R411W|DYRK4_ENST00000010132.5_Missense_Mutation_p.R411W|DYRK4_ENST00000545342.1_Missense_Mutation_p.R48W|RP11-500M8.7_ENST00000536588.1_Intron	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4	411						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			GCCACAGCCCAGGCCCCAGAC	0.542																																						uc001qmx.2		NA																	0				lung(2)|skin(1)	3						c.(1231-1233)AGG>TGG		dual-specificity tyrosine-(Y)-phosphorylation							111.0	103.0	106.0					12																	4721794		2203	4300	6503	SO:0001583	missense	8798					Golgi apparatus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr12:4721794A>T	Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.1231A>T	12.37:g.4721794A>T	ENSP00000441755:p.Arg411Trp		Somatic				DYRK4_uc009zeh.1_Missense_Mutation_p.R526W|DYRK4_uc001qmy.1_Missense_Mutation_p.R411W|DYRK4_uc001qmz.1_Missense_Mutation_p.R125W|DYRK4_uc001qna.1_Missense_Mutation_p.R48W|DYRK4_uc010ser.1_Missense_Mutation_p.R48W	p.R411W	NM_003845	NP_003836	WXS	Illumina HiSeq	Unspecified	Q9NR20	DYRK4_HUMAN	Colorectal(7;0.103)		12	1391	+			411					A8K8F7|Q8NEF2|Q92631	Missense_Mutation	SNP	ENST00000540757.2	37	c.1231A>T	CCDS8530.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.30|14.30	2.495131|2.495131	0.44352|0.44352	.|.	.|.	ENSG00000010219|ENSG00000010219	ENST00000544671|ENST00000542744;ENST00000540757;ENST00000010132;ENST00000543431;ENST00000545342	.|T;T;T;T;T	.|0.74315	.|2.06;2.06;2.06;2.06;-0.83	5.81|5.81	4.64|4.64	0.57946|0.57946	.|Protein kinase-like domain (1);	.|0.273612	.|0.39759	.|N	.|0.001269	T|T	0.77025|0.77025	0.4070|0.4070	L|L	0.42245|0.42245	1.32|1.32	0.47862|0.47862	D|D	0.999536|0.999536	.|D;B;P;P	.|0.54964	.|0.969;0.025;0.927;0.926	.|P;B;P;P	.|0.55508	.|0.777;0.01;0.755;0.685	T|T	0.78288|0.78288	-0.2262|-0.2262	5|10	.|0.72032	.|D	.|0.01	.|.	12.6831|12.6831	0.56932|0.56932	0.862:0.138:0.0:0.0|0.862:0.138:0.0:0.0	.|.	.|526;125;411;411	.|F5H6L9;B4E1A4;Q9NR20-2;Q9NR20	.|.;.;.;DYRK4_HUMAN	L|W	72|526;411;411;411;48	.|ENSP00000437534:R526W;ENSP00000441755:R411W;ENSP00000010132:R411W;ENSP00000439697:R411W;ENSP00000446005:R48W	.|ENSP00000010132:R411W	Q|R	+|+	2|1	0|2	DYRK4|DYRK4	4592055|4592055	0.869000|0.869000	0.29996|0.29996	0.377000|0.377000	0.26055|0.26055	0.004000|0.004000	0.04260|0.04260	3.756000|3.756000	0.55205|0.55205	0.996000|0.996000	0.38943|0.38943	0.533000|0.533000	0.62120|0.62120	CAG|AGG		0.542	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398780.2			23	149	0	0	0	0	23	149				
RERG	85004	broad.mit.edu	37	12	15262344	15262344	+	Silent	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr12:15262344G>A	ENST00000256953.2	-	5	636	c.300C>T	c.(298-300)aaC>aaT	p.N100N	RERG_ENST00000536465.1_Silent_p.N100N|RERG_ENST00000546331.1_Silent_p.N81N|RERG_ENST00000538313.1_Silent_p.N100N|RERG-IT1_ENST00000539734.1_RNA	NM_032918.2	NP_116307.1	Q96A58	RERG_HUMAN	RAS-like, estrogen-regulated, growth inhibitor	100					negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|response to hormone (GO:0009725)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	estrogen receptor binding (GO:0030331)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16						CATCTAGGATGTTCTTAAGTG	0.498																																						uc001rcs.2		NA																	0				lung(1)	1						c.(298-300)AAC>AAT		RAS-like, estrogen-regulated, growth inhibitor							308.0	304.0	305.0					12																	15262344		2203	4300	6503	SO:0001819	synonymous_variant	85004				negative regulation of cell growth|negative regulation of cell proliferation|response to hormone stimulus|small GTPase mediated signal transduction	cytosol|membrane|nucleus	estrogen receptor binding|GDP binding|GTP binding|GTPase activity	g.chr12:15262344G>A	AF339750	CCDS8673.1, CCDS53753.1	12p13.1	2014-05-09			ENSG00000134533	ENSG00000134533			15980	protein-coding gene	gene with protein product		612664				11533059	Standard	NM_032918		Approved	MGC15754	uc001rct.3	Q96A58	OTTHUMG00000168745	ENST00000256953.2:c.300C>T	12.37:g.15262344G>A			Somatic				RERG_uc001rct.2_Silent_p.N100N|RERG_uc010shu.1_Silent_p.N81N	p.N100N	NM_032918	NP_116307	WXS	Illumina HiSeq	Unspecified	Q96A58	RERG_HUMAN			4	440	-			100					B2R9R0|B4DI02	Silent	SNP	ENST00000256953.2	37	c.300C>T	CCDS8673.1																																																																																				0.498	RERG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400882.1	NM_032918		91	414	0	0	0	0	91	414				
SCAF11	9169	broad.mit.edu	37	12	46316327	46316327	+	Silent	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr12:46316327T>C	ENST00000369367.3	-	14	4397	c.4164A>G	c.(4162-4164)aaA>aaG	p.K1388K	SCAF11_ENST00000419565.2_Silent_p.K1388K|SCAF11_ENST00000465950.1_Silent_p.K1073K|SCAF11_ENST00000549162.1_Silent_p.K1196K|SCAF11_ENST00000550629.1_5'UTR	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	1388					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						TGATGGCCAATTTTACCTCTT	0.323																																						uc001rox.2		NA																	0					0						c.(4162-4164)AAA>AAG		splicing factor, arginine/serine-rich 2,							106.0	95.0	99.0					12																	46316327		2203	4299	6502	SO:0001819	synonymous_variant	9169				spliceosome assembly	nucleus	protein binding|zinc ion binding	g.chr12:46316327T>C	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.4164A>G	12.37:g.46316327T>C			Somatic				SFRS2IP_uc001row.2_Silent_p.K1073K	p.K1388K	NM_004719	NP_004710	WXS	Illumina HiSeq	Unspecified	Q99590	SCAFB_HUMAN	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)	14	4451	-	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	1388					A6NEU9|A6NLW5|Q8IW59	Silent	SNP	ENST00000369367.3	37	c.4164A>G	CCDS8748.2																																																																																				0.323	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719		20	96	0	0	0	0	20	96				
DIP2B	57609	broad.mit.edu	37	12	51080428	51080428	+	Missense_Mutation	SNP	A	A	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr12:51080428A>T	ENST00000301180.5	+	12	1548	c.1514A>T	c.(1513-1515)cAc>cTc	p.H505L		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	505						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						TGGCAGCCACACATCTCACCT	0.458																																						uc001rwv.2		NA																	0				ovary(4)|breast(1)|pancreas(1)	6						c.(1513-1515)CAC>CTC		DIP2 disco-interacting protein 2 homolog B							73.0	66.0	68.0					12																	51080428		2203	4300	6503	SO:0001583	missense	57609					nucleus	catalytic activity|transcription factor binding	g.chr12:51080428A>T	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.1514A>T	12.37:g.51080428A>T	ENSP00000301180:p.His505Leu		Somatic				DIP2B_uc009zlt.2_5'UTR	p.H505L	NM_173602	NP_775873	WXS	Illumina HiSeq	Unspecified	Q9P265	DIP2B_HUMAN			12	1670	+			505					Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	37	c.1514A>T	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	A	12.50	1.955780	0.34471	.	.	ENSG00000066084	ENST00000301180	T	0.41065	1.01	4.56	3.39	0.38822	AMP-dependent synthetase/ligase (1);	0.139543	0.64402	N	0.000004	T	0.25975	0.0633	N	0.20685	0.6	0.47584	D	0.999464	B	0.02656	0.0	B	0.06405	0.002	T	0.04481	-1.0948	10	0.23891	T	0.37	-4.1363	10.7623	0.46272	0.8576:0.0:0.0:0.1424	.	505	Q9P265	DIP2B_HUMAN	L	505	ENSP00000301180:H505L	ENSP00000301180:H505L	H	+	2	0	DIP2B	49366695	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	4.699000	0.61796	0.860000	0.35481	0.477000	0.44152	CAC		0.458	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602		4	24	0	0	0	0	4	24				
NAV3	89795	broad.mit.edu	37	12	78452823	78452823	+	Missense_Mutation	SNP	G	G	A	rs374085687		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr12:78452823G>A	ENST00000397909.2	+	12	2737	c.2564G>A	c.(2563-2565)cGa>cAa	p.R855Q	NAV3_ENST00000266692.7_Missense_Mutation_p.R855Q|NAV3_ENST00000536525.2_Missense_Mutation_p.R855Q|NAV3_ENST00000228327.6_Missense_Mutation_p.R855Q|RP11-136F16.1_ENST00000549103.1_RNA			Q8IVL0	NAV3_HUMAN	neuron navigator 3	855						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						AGTCTGAACCGAATACCAGAC	0.413										HNSCC(70;0.22)																												uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(2563-2565)CGA>CAA		neuron navigator 3		G	GLN/ARG	1,3821		0,1,1910	99.0	95.0	96.0		2564	5.8	1.0	12		96	0,8258		0,0,4129	no	missense	NAV3	NM_014903.4	43	0,1,6039	AA,AG,GG		0.0,0.0262,0.0083	probably-damaging	855/2364	78452823	1,12079	1911	4129	6040	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78452823G>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2564G>A	12.37:g.78452823G>A	ENSP00000381007:p.Arg855Gln	HNSCC(70;0.22)	Somatic				NAV3_uc001syo.2_Missense_Mutation_p.R855Q|NAV3_uc010sub.1_Missense_Mutation_p.R355Q	p.R855Q	NM_014903	NP_055718	WXS	Illumina HiSeq	Unspecified	Q8IVL0	NAV3_HUMAN			12	2737	+			855					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.2564G>A		.	.	.	.	.	.	.	.	.	.	G	25.4	4.632671	0.87660	2.62E-4	0.0	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.42131	1.16;1.17;1.17;0.98	5.82	5.82	0.92795	.	0.000000	0.32868	U	0.005552	T	0.60958	0.2309	L	0.46157	1.445	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.998	D;P;D	0.75484	0.97;0.644;0.986	T	0.58713	-0.7588	10	0.56958	D	0.05	-9.1264	20.1142	0.97922	0.0:0.0:1.0:0.0	.	855;855;855	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	Q	855	ENSP00000446132:R855Q;ENSP00000381007:R855Q;ENSP00000228327:R855Q;ENSP00000266692:R855Q	ENSP00000228327:R855Q	R	+	2	0	NAV3	76976954	1.000000	0.71417	0.983000	0.44433	0.923000	0.55619	8.902000	0.92568	2.765000	0.95021	0.650000	0.86243	CGA		0.413	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		20	89	0	0	0	0	20	89				
HNF1A	6927	broad.mit.edu	37	12	121431330	121431330	+	Silent	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr12:121431330C>T	ENST00000257555.6	+	3	760	c.534C>T	c.(532-534)acC>acT	p.T178T	HNF1A_ENST00000402929.1_Silent_p.T178T|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000541395.1_Silent_p.T178T|HNF1A_ENST00000544413.1_Silent_p.T178T|HNF1A_ENST00000400024.2_Silent_p.T178T|HNF1A_ENST00000543427.1_Silent_p.T61T			P20823	HNF1A_HUMAN	HNF1 homeobox A	178					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.H179fs*9(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CAGAGTTCACCCATGCAGGGC	0.587									Hepatic Adenoma, Familial Clustering of																													uc001tzg.2		NA																	1	Insertion - Frameshift(1)		liver(1)	liver(92)|large_intestine(15)|endometrium(6)|breast(2)|lung(1)	116						c.(532-534)ACC>ACT		hepatic nuclear factor-1-alpha							50.0	53.0	52.0					12																	121431330		2203	4300	6503	SO:0001819	synonymous_variant	6927	Hepatic_Adenoma_Familial_Clustering_of	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	glucose homeostasis|glucose import|insulin secretion|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|renal glucose absorption	cytoplasm|nucleus|protein complex	DNA binding|protein dimerization activity|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr12:121431330C>T	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.534C>T	12.37:g.121431330C>T			Somatic				HNF1A_uc001tze.1_Silent_p.T178T|HNF1A_uc001tzf.2_Silent_p.T178T|HNF1A_uc010szn.1_Silent_p.T178T	p.T178T	NM_000545	NP_000536	WXS	Illumina HiSeq	Unspecified	P20823	HNF1A_HUMAN			3	557	+	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		178					A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Silent	SNP	ENST00000257555.6	37	c.534C>T	CCDS9209.1																																																																																				0.587	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545		6	38	0	0	0	0	6	38				
OASL	8638	broad.mit.edu	37	12	121461833	121461833	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr12:121461833T>C	ENST00000257570.5	-	5	1277	c.1007A>G	c.(1006-1008)tAt>tGt	p.Y336C	OASL_ENST00000339275.5_Silent_p.L255L	NM_003733.3	NP_003724.1	Q15646	OASL_HUMAN	2'-5'-oligoadenylate synthetase-like	336					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|transferase activity (GO:0016740)			NS(1)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCTGTTGTCATAGCAACAGTC	0.557																																					Colon(192;517 2041 31392 31913 39966)	uc001tzj.1		NA																	0				skin(1)	1						c.(1006-1008)TAT>TGT		2'-5'-oligoadenylate synthetase-like isoform a							157.0	122.0	134.0					12																	121461833		2203	4300	6503	SO:0001583	missense	8638				interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoplasm|nucleolus	ATP binding|DNA binding|double-stranded RNA binding|thyroid hormone receptor binding|transferase activity	g.chr12:121461833T>C	AF063611	CCDS9211.1, CCDS9212.1, CCDS73536.1	12q24.2	2008-08-05			ENSG00000135114	ENSG00000135114			8090	protein-coding gene	gene with protein product		603281				10087211	Standard	NM_003733		Approved	TRIP14, p59OASL	uc001tzj.2	Q15646	OTTHUMG00000154981	ENST00000257570.5:c.1007A>G	12.37:g.121461833T>C	ENSP00000257570:p.Tyr336Cys		Somatic				OASL_uc001tzk.1_Silent_p.L255L	p.Y336C	NM_003733	NP_003724	WXS	Illumina HiSeq	Unspecified	Q15646	OASL_HUMAN			5	1013	-	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		336					B2RAZ2|I1YDD2|O75686|Q17R95|Q9Y6K6|Q9Y6K7	Missense_Mutation	SNP	ENST00000257570.5	37	c.1007A>G	CCDS9211.1	.	.	.	.	.	.	.	.	.	.	T	12.65	2.002735	0.35320	.	.	ENSG00000135114	ENST00000257570;ENST00000543677	T	0.42131	0.98	5.42	1.56	0.23342	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	0.934868	0.08941	N	0.871524	T	0.55016	0.1894	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	T	0.56768	-0.7924	9	0.44086	T	0.13	-13.8005	2.9624	0.05896	0.1948:0.1982:0.0:0.6071	.	336	Q15646	OASL_HUMAN	C	336;153	ENSP00000257570:Y336C	ENSP00000257570:Y336C	Y	-	2	0	OASL	119946216	0.054000	0.20591	1.000000	0.80357	0.226000	0.24999	0.381000	0.20619	0.904000	0.36572	0.533000	0.62120	TAT		0.557	OASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337875.2	NM_003733		5	102	0	0	0	0	5	102				
MIPEP	4285	broad.mit.edu	37	13	24460635	24460635	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr13:24460635C>T	ENST00000382172.3	-	2	298	c.200G>A	c.(199-201)gGa>gAa	p.G67E	C1QTNF9B-AS1_ENST00000382133.4_RNA|MIPEP_ENST00000469167.1_5'UTR|C1QTNF9B-AS1_ENST00000435039.2_RNA	NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	67					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		CTCAGGAACTCCAAAAAGACC	0.373																																						uc001uox.3		NA																	0				central_nervous_system(1)	1						c.(199-201)GGA>GAA		mitochondrial intermediate peptidase precursor							71.0	72.0	71.0					13																	24460635		2203	4300	6503	SO:0001583	missense	4285				protein processing involved in protein targeting to mitochondrion|proteolysis	mitochondrial matrix	metal ion binding|metalloendopeptidase activity	g.chr13:24460635C>T		CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.200G>A	13.37:g.24460635C>T	ENSP00000371607:p.Gly67Glu		Somatic				PCOTH_uc001uoy.2_5'Flank|PCOTH_uc009zzx.2_5'Flank	p.G67E	NM_005932	NP_005923	WXS	Illumina HiSeq	Unspecified	Q99797	MIPEP_HUMAN		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)	2	300	-		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)	67					Q5JV15|Q5T9Q9|Q96G65	Missense_Mutation	SNP	ENST00000382172.3	37	c.200G>A	CCDS9303.1	.	.	.	.	.	.	.	.	.	.	c	17.39	3.377073	0.61735	.	.	ENSG00000027001	ENST00000382172	T	0.42513	0.97	4.39	4.39	0.52855	.	0.000000	0.85682	D	0.000000	T	0.48822	0.1521	M	0.79693	2.465	0.80722	D	1	B	0.30937	0.301	B	0.34242	0.178	T	0.50725	-0.8794	10	0.22109	T	0.4	.	17.308	0.87200	0.0:1.0:0.0:0.0	.	67	Q99797	MIPEP_HUMAN	E	67	ENSP00000371607:G67E	ENSP00000371607:G67E	G	-	2	0	MIPEP	23358635	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.828000	0.62730	2.162000	0.67917	0.484000	0.47621	GGA		0.373	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044169.1			25	120	0	0	0	0	25	120				
ATP12A	479	broad.mit.edu	37	13	25276139	25276139	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr13:25276139T>C	ENST00000381946.3	+	14	2115	c.1948T>C	c.(1948-1950)Tca>Cca	p.S650P	RNY1P7_ENST00000384743.1_RNA|ATP12A_ENST00000218548.6_Missense_Mutation_p.S656P			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	650					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		GGGGATCATTTCAGCCAACAG	0.458																																					Pancreas(156;1582 1935 18898 22665 26498)	uc001upp.2		NA																	0				ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6						c.(1948-1950)TCA>CCA		hydrogen/potassium-exchanging ATPase 12A	Esomeprazole(DB00736)|Pantoprazole(DB00213)						245.0	200.0	215.0					13																	25276139		2203	4300	6503	SO:0001583	missense	479				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding	g.chr13:25276139T>C	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1948T>C	13.37:g.25276139T>C	ENSP00000371372:p.Ser650Pro		Somatic				ATP12A_uc010aaa.2_Missense_Mutation_p.S656P	p.S650P	NM_001676	NP_001667	WXS	Illumina HiSeq	Unspecified	P54707	AT12A_HUMAN		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	14	2135	+		Lung SC(185;0.0225)|Breast(139;0.077)	650			Cytoplasmic (Potential).		Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	37	c.1948T>C	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.219820	0.79464	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.99080	-5.4;-5.4	5.25	5.25	0.73442	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.000000	0.56097	D	0.000029	D	0.98623	0.9539	L	0.38649	1.16	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.978;0.998	D	0.99843	1.1063	10	0.87932	D	0	.	13.3971	0.60861	0.0:0.0:0.0:1.0	.	656;650	P54707-2;P54707	.;AT12A_HUMAN	P	656;650	ENSP00000218548:S656P;ENSP00000371372:S650P	ENSP00000218548:S656P	S	+	1	0	ATP12A	24174139	1.000000	0.71417	0.998000	0.56505	0.666000	0.39218	7.903000	0.87398	2.111000	0.64477	0.383000	0.25322	TCA		0.458	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676		22	131	0	0	0	0	22	131				
FRY	10129	broad.mit.edu	37	13	32841345	32841345	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr13:32841345C>T	ENST00000380250.3	+	55	8481	c.7985C>T	c.(7984-7986)tCg>tTg	p.S2662L	FRY_ENST00000542859.1_Missense_Mutation_p.S32L	NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2662						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CCCCCTCCCTCGCCCTTCTTC	0.537																																						uc001utx.2		NA																	0				ovary(5)|large_intestine(1)|skin(1)	7						c.(7984-7986)TCG>TTG		furry homolog							111.0	114.0	113.0					13																	32841345		2008	4174	6182	SO:0001583	missense	10129				regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane		g.chr13:32841345C>T	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.7985C>T	13.37:g.32841345C>T	ENSP00000369600:p.Ser2662Leu		Somatic				FRY_uc010tdw.1_RNA|FRY_uc001uty.2_Missense_Mutation_p.S217L|FRY_uc001utz.2_Missense_Mutation_p.S187L|FRY_uc010tdx.1_Missense_Mutation_p.S32L	p.S2662L	NM_023037	NP_075463	WXS	Illumina HiSeq	Unspecified	Q5TBA9	FRY_HUMAN		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)	55	8481	+		Lung SC(185;0.0271)	2662					Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	c.7985C>T	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987141	0.74589	.	.	ENSG00000073910	ENST00000380250;ENST00000380235;ENST00000542859	T	0.30981	1.51	5.29	4.45	0.53987	.	0.000000	0.85682	D	0.000000	T	0.35364	0.0929	M	0.80422	2.495	0.80722	D	1	B;B	0.31153	0.31;0.134	B;B	0.18561	0.015;0.022	T	0.34650	-0.9820	10	0.87932	D	0	.	13.7731	0.63038	0.0:0.9259:0.0:0.0741	.	443;2662	Q8NB82;Q5TBA9	.;FRY_HUMAN	L	2662;306;32	ENSP00000369600:S2662L	ENSP00000369567:S306L	S	+	2	0	FRY	31739345	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.358000	0.79466	1.238000	0.43771	0.650000	0.86243	TCG		0.537	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037		47	230	0	0	0	0	47	230				
LRCH1	23143	broad.mit.edu	37	13	47260079	47260079	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr13:47260079G>C	ENST00000389798.3	+	5	922	c.725G>C	c.(724-726)tGc>tCc	p.C242S	LRCH1_ENST00000311191.6_Missense_Mutation_p.C242S|LRCH1_ENST00000389797.3_Missense_Mutation_p.C242S	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	242										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		GACTTTTCCTGCAACAAAGTG	0.343																																						uc001vbj.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(724-726)TGC>TCC		leucine-rich repeats and calponin homology (CH)							57.0	53.0	54.0					13																	47260079		2203	4300	6503	SO:0001583	missense	23143							g.chr13:47260079G>C	AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.725G>C	13.37:g.47260079G>C	ENSP00000374448:p.Cys242Ser		Somatic				LRCH1_uc010acp.2_Missense_Mutation_p.C242S|LRCH1_uc001vbk.2_Missense_Mutation_p.C242S|LRCH1_uc001vbl.3_Missense_Mutation_p.C242S	p.C242S	NM_015116	NP_055931	WXS	Illumina HiSeq	Unspecified	Q9Y2L9	LRCH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)	5	961	+		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	242			LRR 7.		B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	ENST00000389798.3	37	c.725G>C	CCDS31972.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.795217	0.90453	.	.	ENSG00000136141	ENST00000311191;ENST00000389798;ENST00000389797	T;T;T	0.16196	2.36;2.36;2.36	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.34978	0.0916	L	0.47716	1.5	0.80722	D	1	D;D;D;B	0.89917	1.0;1.0;1.0;0.022	D;D;D;B	0.91635	0.996;0.999;0.998;0.124	T	0.01488	-1.1342	10	0.12430	T	0.62	-23.0439	19.3421	0.94347	0.0:0.0:1.0:0.0	.	242;242;242;242	Q17R43;Q9Y2L9-2;F8W6F0;Q9Y2L9	.;.;.;LRCH1_HUMAN	S	242	ENSP00000308493:C242S;ENSP00000374448:C242S;ENSP00000374447:C242S	ENSP00000308493:C242S	C	+	2	0	LRCH1	46158080	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.204000	0.95041	2.826000	0.97356	0.655000	0.94253	TGC		0.343	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044824.2	NM_015116		7	55	0	0	0	0	7	55				
WDFY2	115825	broad.mit.edu	37	13	52313218	52313218	+	Missense_Mutation	SNP	A	A	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr13:52313218A>T	ENST00000298125.5	+	7	812	c.632A>T	c.(631-633)cAg>cTg	p.Q211L		NM_052950.3	NP_443182.1	Q96P53	WDFY2_HUMAN	WD repeat and FYVE domain containing 2	211							metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)		GACCCAGTCCAGCGGGTGTTG	0.512																																						uc001vfp.2		NA																	0					0						c.(631-633)CAG>CTG		WD repeat and FYVE domain containing 2							163.0	150.0	154.0					13																	52313218		2203	4300	6503	SO:0001583	missense	115825						metal ion binding	g.chr13:52313218A>T	AF411978	CCDS9429.1	13q14.12	2013-01-09	2003-03-13		ENSG00000139668	ENSG00000139668		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20482	protein-coding gene	gene with protein product		610418	"""WD40 and FYVE domain containing 2"""				Standard	NM_052950		Approved	ZFYVE22	uc001vfp.3	Q96P53	OTTHUMG00000017407	ENST00000298125.5:c.632A>T	13.37:g.52313218A>T	ENSP00000298125:p.Gln211Leu		Somatic				WDFY2_uc010ads.1_Missense_Mutation_p.Q211L|WDFY2_uc010adt.1_RNA	p.Q211L	NM_052950	NP_443182	WXS	Illumina HiSeq	Unspecified	Q96P53	WDFY2_HUMAN		GBM - Glioblastoma multiforme(99;9e-08)	7	972	+		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)	211			WD 5.		B1AL86|Q96CS1	Missense_Mutation	SNP	ENST00000298125.5	37	c.632A>T	CCDS9429.1	.	.	.	.	.	.	.	.	.	.	A	19.80	3.894069	0.72639	.	.	ENSG00000139668	ENST00000298125	T	0.65732	-0.17	6.16	6.16	0.99307	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.096818	0.64402	D	0.000001	T	0.53433	0.1796	N	0.11756	0.17	0.80722	D	1	P;B	0.36354	0.549;0.022	B;B	0.43413	0.419;0.053	T	0.60120	-0.7325	10	0.62326	D	0.03	-11.238	15.6301	0.76899	1.0:0.0:0.0:0.0	.	108;211	Q96LK4;Q96P53	.;WDFY2_HUMAN	L	211	ENSP00000298125:Q211L	ENSP00000298125:Q211L	Q	+	2	0	WDFY2	51211219	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.734000	0.68580	2.367000	0.80283	0.528000	0.53228	CAG		0.512	WDFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045985.3	NM_052950		43	215	0	0	0	0	43	215				
SLITRK5	26050	broad.mit.edu	37	13	88329623	88329623	+	Silent	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr13:88329623G>A	ENST00000325089.6	+	2	2199	c.1980G>A	c.(1978-1980)tcG>tcA	p.S660S	SLITRK5_ENST00000400028.3_Silent_p.S419S	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	660					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GGGCGTCGTCGGTGCCCTTGT	0.642																																						uc001vln.2		NA																	0				ovary(2)|pancreas(2)|central_nervous_system(1)	5						c.(1978-1980)TCG>TCA		SLIT and NTRK-like family, member 5 precursor							111.0	112.0	111.0					13																	88329623		2203	4300	6503	SO:0001819	synonymous_variant	26050					integral to membrane		g.chr13:88329623G>A	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1980G>A	13.37:g.88329623G>A			Somatic				SLITRK5_uc010tic.1_Silent_p.S419S	p.S660S	NM_015567	NP_056382	WXS	Illumina HiSeq	Unspecified	O94991	SLIK5_HUMAN			2	2199	+	all_neural(89;0.101)|Medulloblastoma(90;0.163)		660			Extracellular (Potential).		B3KNB8|B4DSH5|Q5VT81	Silent	SNP	ENST00000325089.6	37	c.1980G>A	CCDS9465.1																																																																																				0.642	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3			7	51	0	0	0	0	7	51				
GPC6	10082	broad.mit.edu	37	13	94482798	94482798	+	Splice_Site	SNP	G	G	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr13:94482798G>T	ENST00000377047.4	+	3	1326	c.711G>T	c.(709-711)aaG>aaT	p.K237N	GPC6-AS2_ENST00000445540.1_RNA	NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	237					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				GAGTTTCCAAGGTAATTGAAA	0.398																																						uc001vlt.2		NA																	0					0						c.(709-711)AAG>AAT		glypican 6 precursor							30.0	31.0	31.0					13																	94482798		2203	4300	6503	SO:0001630	splice_region_variant	10082					anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding	g.chr13:94482798G>T	AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.711+1G>T	13.37:g.94482798G>T			Somatic				GPC6_uc010tig.1_Missense_Mutation_p.K237N|GPC6_uc001vlu.1_Missense_Mutation_p.K167N	p.K237N	NM_005708	NP_005699	WXS	Illumina HiSeq	Unspecified	Q9Y625	GPC6_HUMAN			3	1343	+	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)	237					A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	ENST00000377047.4	37	c.711G>T	CCDS9469.1	.	.	.	.	.	.	.	.	.	.	G	19.49	3.838182	0.71373	.	.	ENSG00000183098	ENST00000377047	T	0.52295	0.67	5.77	5.77	0.91146	.	0.059154	0.64402	D	0.000003	T	0.48714	0.1515	L	0.39326	1.205	0.58432	D	0.999992	B;B	0.34290	0.242;0.447	B;B	0.43194	0.243;0.411	T	0.21211	-1.0252	10	0.11485	T	0.65	.	20.3472	0.98799	0.0:0.0:1.0:0.0	.	237;237	B4E2M1;Q9Y625	.;GPC6_HUMAN	N	237	ENSP00000366246:K237N	ENSP00000366246:K237N	K	+	3	2	GPC6	93280799	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	9.420000	0.97426	2.890000	0.99128	0.650000	0.86243	AAG		0.398	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045460.4	NM_005708	Missense_Mutation	9	61	1	0	1.13e-05	1.23e-05	9	61				
SLC10A2	6555	broad.mit.edu	37	13	103710731	103710731	+	Splice_Site	SNP	C	C	T	rs150843319		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr13:103710731C>T	ENST00000245312.3	-	2	975	c.379G>A	c.(379-381)Gtc>Atc	p.V127I		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	127					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)			breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	GTCATGCTGACGCTGAAAGGC	0.423													C|||	1	0.000199681	0.0	0.0014	5008	,	,		2527	0.0		0.0	False		,,,				2504	0.0					uc001vpy.3		NA																	0				ovary(3)|skin(1)	4						c.(379-381)GTC>ATC		solute carrier family 10 (sodium/bile acid		C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	100.0	84.0	89.0		379	-5.0	0.2	13	dbSNP_134	89	0,8600		0,0,4300	yes	missense-near-splice	SLC10A2	NM_000452.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	127/349	103710731	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	6555				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity	g.chr13:103710731C>T	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.378-1G>A	13.37:g.103710731C>T			Somatic					p.V127I	NM_000452	NP_000443	WXS	Illumina HiSeq	Unspecified	Q12908	NTCP2_HUMAN			2	976	-	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)		127			Helical; (Potential).		A1L4F4|Q13839	Missense_Mutation	SNP	ENST00000245312.3	37	c.379G>A	CCDS9506.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	3.409	-0.120586	0.06838	2.27E-4	0.0	ENSG00000125255	ENST00000245312	T	0.12039	2.72	5.74	-4.97	0.03029	.	0.211749	0.47852	N	0.000207	T	0.03053	0.0090	N	0.01019	-1.045	0.80722	D	1	B	0.09022	0.002	B	0.15052	0.012	T	0.46303	-0.9201	10	0.02654	T	1	-20.5607	14.834	0.70169	0.0:0.2235:0.0:0.7765	.	127	Q12908	NTCP2_HUMAN	I	127	ENSP00000245312:V127I	ENSP00000245312:V127I	V	-	1	0	SLC10A2	102508732	0.293000	0.24371	0.218000	0.23776	0.795000	0.44927	0.334000	0.19787	-0.943000	0.03691	-0.244000	0.11960	GTC		0.423	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1		Missense_Mutation	14	84	0	0	0	0	14	84				
REM2	161253	broad.mit.edu	37	14	23355326	23355326	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr14:23355326A>G	ENST00000267396.4	+	4	736	c.613A>G	c.(613-615)Aaa>Gaa	p.K205E	REM2_ENST00000536884.1_Missense_Mutation_p.Q180R	NM_173527.2	NP_775798.2	Q8IYK8	REM2_HUMAN	RAS (RAD and GEM)-like GTP binding 2	205					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|large_intestine(2)|ovary(1)	5	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.012)		GAGTTTCTCCAAAGTTCCAGA	0.627																																						uc001whf.1		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(613-615)AAA>GAA		rad and gem related GTP binding protein 2							49.0	54.0	52.0					14																	23355326		1945	4138	6083	SO:0001583	missense	161253				regulation of transcription, DNA-dependent|small GTPase mediated signal transduction	intracellular|plasma membrane	ATP binding|GTP binding|transcription factor binding	g.chr14:23355326A>G		CCDS45082.1	14q11.2	2014-05-09	2006-12-14		ENSG00000139890	ENSG00000139890			20248	protein-coding gene	gene with protein product			"""RAS (RAD and GEM) like GTP binding 2"""			10727423	Standard	NM_173527		Approved	FLJ38964	uc001whf.1	Q8IYK8	OTTHUMG00000170277	ENST00000267396.4:c.613A>G	14.37:g.23355326A>G	ENSP00000267396:p.Lys205Glu		Somatic				REM2_uc010tnd.1_Missense_Mutation_p.Q172R	p.K205E	NM_173527	NP_775798	WXS	Illumina HiSeq	Unspecified	Q8IYK8	REM2_HUMAN		GBM - Glioblastoma multiforme(265;0.012)	4	678	+	all_cancers(95;4.69e-05)		205					B7Z5P1|Q8N8R8	Missense_Mutation	SNP	ENST00000267396.4	37	c.613A>G	CCDS45082.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.24|16.24	3.066735|3.066735	0.55539|0.55539	.|.	.|.	ENSG00000139890|ENSG00000139890	ENST00000267396|ENST00000536884	T|T	0.76578|0.34472	-1.03|1.36	5.48|5.48	4.34|4.34	0.51931|0.51931	.|.	0.057229|.	0.64402|.	D|.	0.000004|.	T|T	0.20251|0.20251	0.0487|0.0487	N|N	0.10874|0.10874	0.06|0.06	0.20074|0.20074	N|N	0.999935|0.999935	B|B	0.28998|0.12013	0.23|0.005	B|B	0.28991|0.12156	0.097|0.007	T|T	0.16217|0.16217	-1.0410|-1.0410	10|9	0.11794|0.87932	T|D	0.64|0	.|.	6.4815|6.4815	0.22065|0.22065	0.658:0.2614:0.0806:0.0|0.658:0.2614:0.0806:0.0	.|.	205|180	Q8IYK8|B7Z5P1	REM2_HUMAN|.	E|R	205|180	ENSP00000267396:K205E|ENSP00000442774:Q180R	ENSP00000267396:K205E|ENSP00000442774:Q180R	K|Q	+|+	1|2	0|0	REM2|REM2	22425166|22425166	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	3.115000|3.115000	0.50391|0.50391	1.030000|1.030000	0.39839|0.39839	0.460000|0.460000	0.39030|0.39030	AAA|CAA		0.627	REM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408290.1	NM_173527		13	73	0	0	0	0	13	73				
AJUBA	84962	broad.mit.edu	37	14	23444270	23444270	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr14:23444270C>T	ENST00000262713.2	-	5	1658	c.1283G>A	c.(1282-1284)cGa>cAa	p.R428Q	AJUBA_ENST00000397388.3_Missense_Mutation_p.R11Q|RP11-298I3.5_ENST00000555074.1_Intron|AJUBA_ENST00000361265.4_Missense_Mutation_p.R428Q	NM_032876.4	NP_116265.1	Q96IF1	AJUBA_HUMAN	ajuba LIM protein	428	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				calcium-dependent cell-cell adhesion (GO:0016339)|cellular protein localization (GO:0034613)|focal adhesion assembly (GO:0048041)|G2/M transition of mitotic cell cycle (GO:0000086)|gene silencing by miRNA (GO:0035195)|glycerophospholipid biosynthetic process (GO:0046474)|lamellipodium assembly (GO:0030032)|mitotic cell cycle (GO:0000278)|negative regulation of hippo signaling (GO:0035331)|negative regulation of kinase activity (GO:0033673)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular biosynthetic process (GO:0031328)|positive regulation of gene silencing by miRNA (GO:2000637)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein complex assembly (GO:0031334)|regulation of cell migration (GO:0030334)|regulation of cellular response to hypoxia (GO:1900037)|regulation of GTPase activity (GO:0043087)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|wound healing, spreading of epidermal cells (GO:0035313)	cell-cell junction (GO:0005911)|cytoplasmic mRNA processing body (GO:0000932)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcription factor complex (GO:0005667)	alpha-catenin binding (GO:0045294)|chromatin binding (GO:0003682)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)										AACAATGCATCGGAAACAGCC	0.532																																						uc001whz.2		NA																	0					0						c.(1282-1284)CGA>CAA		ajuba isoform 1							133.0	123.0	127.0					14																	23444270		2203	4300	6503	SO:0001583	missense	84962				cell cycle|gene silencing by miRNA|positive regulation of protein complex assembly	cell-cell junction|cytoplasmic mRNA processing body|microtubule organizing center	alpha-catenin binding|zinc ion binding	g.chr14:23444270C>T	AK025567	CCDS9581.1, CCDS9582.1	14q11.2	2011-11-10	2011-11-10	2011-11-10	ENSG00000129474	ENSG00000129474			20250	protein-coding gene	gene with protein product		609066	"""jub, ajuba homolog (Xenopus laevis)"""	JUB		10330178	Standard	NM_032876		Approved	MGC15563	uc001whz.3	Q96IF1	OTTHUMG00000028711	ENST00000262713.2:c.1283G>A	14.37:g.23444270C>T	ENSP00000262713:p.Arg428Gln		Somatic				JUB_uc001why.2_Missense_Mutation_p.R11Q	p.R428Q	NM_032876	NP_116265	WXS	Illumina HiSeq	Unspecified	Q96IF1	JUB_HUMAN		GBM - Glioblastoma multiforme(265;0.0122)	5	1659	-	all_cancers(95;4.6e-05)		428			LIM zinc-binding 2.		A8MX18|D3DS37	Missense_Mutation	SNP	ENST00000262713.2	37	c.1283G>A	CCDS9581.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.009231	0.93346	.	.	ENSG00000129474	ENST00000262713;ENST00000397388;ENST00000361265;ENST00000553592;ENST00000556731;ENST00000553911	D;D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41;-2.25	6.17	5.28	0.74379	Zinc finger, LIM-type (4);	0.000000	0.64402	D	0.000001	D	0.93367	0.7885	M	0.72894	2.215	0.58432	D	0.999999	D	0.76494	0.999	D	0.75020	0.985	D	0.92458	0.5975	10	0.33141	T	0.24	.	15.5083	0.75760	0.0:0.8614:0.1386:0.0	.	428	Q96IF1	JUB_HUMAN	Q	428;11;428;11;11;11	ENSP00000262713:R428Q;ENSP00000380543:R11Q;ENSP00000354491:R428Q;ENSP00000452369:R11Q;ENSP00000451649:R11Q;ENSP00000452325:R11Q	ENSP00000262713:R428Q	R	-	2	0	JUB	22514110	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	7.442000	0.80503	1.616000	0.50265	0.655000	0.94253	CGA		0.532	AJUBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071685.2			5	106	0	0	0	0	5	106				
CDKL1	8814	broad.mit.edu	37	14	50863888	50863888	+	5'UTR	SNP	A	A	T	rs201257127		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr14:50863888A>T	ENST00000356146.1	-	0	401				CDKL1_ENST00000216378.2_Intron|CDKL1_ENST00000395834.1_5'Flank|RP11-247L20.3_ENST00000556713.1_lincRNA			Q00532	CDKL1_HUMAN	cyclin-dependent kinase-like 1 (CDC2-related kinase)						heart development (GO:0007507)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|stomach(1)	12	all_epithelial(31;0.000746)|Breast(41;0.0102)					CTGCGCTAGGAGCCCCTCCTG	0.602													A|||	1	0.000199681	0.0	0.0	5008	,	,		16136	0.0		0.001	False		,,,				2504	0.0					uc010anu.1		NA																	0				ovary(1)|stomach(1)	2						c.(400-402)GCT>GCA		cyclin-dependent kinase-like 1		A		0,1752		0,0,876	37.0	36.0	37.0			1.2	0.0	14		37	2,3980		0,2,1989	no	near-gene-5				0,2,2865	TT,TA,AA		0.0502,0.0,0.0349			50863888	2,5732	876	1991	2867	SO:0001623	5_prime_UTR_variant	8814					cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity	g.chr14:50863888A>T	AF390028	CCDS9699.1, CCDS73637.1	14q21.3	2011-11-04			ENSG00000100490	ENSG00000100490		"""Cyclin-dependent kinases"""	1781	protein-coding gene	gene with protein product		603441				1639063, 7595554	Standard	XM_005268157		Approved	KKIALRE	uc010anu.2	Q00532	OTTHUMG00000140290	ENST00000356146.1:c.-2581T>A	14.37:g.50863888A>T			Somatic				CDKL1_uc001wxz.2_5'Flank	p.A134A	NM_004196	NP_004187	WXS	Illumina HiSeq	Unspecified	Q00532	CDKL1_HUMAN			4	402	-	all_epithelial(31;0.000746)|Breast(41;0.0102)		Error:Variant_position_missing_in_Q00532_after_alignment					Q2M3A4|Q6QUA0|Q8WXQ5	Silent	SNP	ENST00000356146.1	37	c.402T>A																																																																																					0.602	CDKL1-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000276873.2			5	45	0	0	0	0	5	45				
RDH12	145226	broad.mit.edu	37	14	68191267	68191267	+	Missense_Mutation	SNP	C	C	T	rs28940314		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr14:68191267C>T	ENST00000551171.1	+	4	470	c.146C>T	c.(145-147)aCg>aTg	p.T49M	RDH12_ENST00000267502.3_Missense_Mutation_p.T49M|RDH12_ENST00000539142.1_Missense_Mutation_p.T49M	NM_152443.2	NP_689656.2	Q96NR8	RDH12_HUMAN	retinol dehydrogenase 12 (all-trans/9-cis/11-cis)	49			T -> M (in LCA13; aberrant activity in interconverting isomers of retinol and retinal; there is differing activity profiles associated with each of the alleles of the R-161-Q polymorphism; genetic background may act as a modifier of mutation effect; dbSNP:rs28940314). {ECO:0000269|PubMed:15258582}.		photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	intracellular (GO:0005622)|photoreceptor inner segment membrane (GO:0060342)	retinol dehydrogenase activity (GO:0004745)			large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(4)	12				all cancers(60;0.000704)|OV - Ovarian serous cystadenocarcinoma(108;0.00161)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	Vitamin A(DB00162)	GGCGCCAACACGGGCATTGGC	0.557																																						uc001xjz.3		NA																	0				ovary(1)	1	GRCh37	CM042103	RDH12	M	rs28940314	c.(145-147)ACG>ATG		retinol dehydrogenase 12	Vitamin A(DB00162)						234.0	192.0	206.0					14																	68191267		2203	4300	6503	SO:0001583	missense	145226				photoreceptor cell maintenance|response to stimulus|retinol metabolic process	intracellular	binding|retinol dehydrogenase activity	g.chr14:68191267C>T	AK054835	CCDS9787.1	14q24.1	2013-02-14	2006-05-09		ENSG00000139988	ENSG00000139988	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19977	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 2"""	608830	"""retinol dehydrogenase 12 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_152443		Approved	FLJ30273, SDR7C2, LCA13, RP53	uc001xjz.4	Q96NR8		ENST00000551171.1:c.146C>T	14.37:g.68191267C>T	ENSP00000449079:p.Thr49Met		Somatic					p.T49M	NM_152443	NP_689656	WXS	Illumina HiSeq	Unspecified	Q96NR8	RDH12_HUMAN		all cancers(60;0.000704)|OV - Ovarian serous cystadenocarcinoma(108;0.00161)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	4	470	+			49			NADP (By similarity).		B2RDA2|Q8TAW6	Missense_Mutation	SNP	ENST00000551171.1	37	c.146C>T	CCDS9787.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030129	0.93575	.	.	ENSG00000139988	ENST00000551171;ENST00000267502;ENST00000539142	D;D;D	0.89810	-2.57;-2.57;-2.57	5.32	5.32	0.75619	NAD(P)-binding domain (1);	0.051722	0.85682	D	0.000000	D	0.94518	0.8235	M	0.76838	2.35	0.80722	A	1	D	0.76494	0.999	D	0.72075	0.976	D	0.94713	0.7894	9	0.87932	D	0	.	19.1982	0.93698	0.0:1.0:0.0:0.0	rs28940314	49	Q96NR8	RDH12_HUMAN	M	49	ENSP00000449079:T49M;ENSP00000267502:T49M;ENSP00000438715:T49M	ENSP00000267502:T49M	T	+	2	0	RDH12	67261020	1.000000	0.71417	0.984000	0.44739	0.959000	0.62525	5.470000	0.66756	2.773000	0.95371	0.655000	0.94253	ACG		0.557	RDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406918.1			19	72	0	0	0	0	19	72				
GPATCH2L	55668	broad.mit.edu	37	14	76642983	76642983	+	Silent	SNP	T	T	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr14:76642983T>G	ENST00000261530.7	+	6	1068	c.1002T>G	c.(1000-1002)acT>acG	p.T334T	GPATCH2L_ENST00000312858.5_Silent_p.T334T	NM_017926.2	NP_060396.2	Q9NWQ4	GPT2L_HUMAN	G patch domain containing 2-like	334																	GCATAAACACTTTGGGGACTG	0.413																																						uc001xsh.2		NA																	0				ovary(2)|skin(1)	3						c.(1000-1002)ACT>ACG		hypothetical protein LOC55668 isoform 1							157.0	141.0	146.0					14																	76642983		2203	4300	6503	SO:0001819	synonymous_variant	55668							g.chr14:76642983T>G	AK000696	CCDS9848.1, CCDS9849.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000089916	ENSG00000089916			20210	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 118"""	C14orf118		10574461	Standard	NM_017926		Approved	FLJ20689, FLJ10033	uc001xsh.3	Q9NWQ4	OTTHUMG00000171490	ENST00000261530.7:c.1002T>G	14.37:g.76642983T>G			Somatic				C14orf118_uc001xsi.2_Silent_p.T334T|C14orf118_uc001xsj.1_3'UTR|C14orf118_uc001xsk.1_3'UTR|C14orf118_uc001xsl.2_RNA	p.T334T	NM_017926	NP_060396	WXS	Illumina HiSeq	Unspecified	Q9NWQ4	CN118_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0172)	6	1088	+			334					B3KN42|Q6PEJ7|Q9H3M3|Q9NWH0|Q9ULR8	Silent	SNP	ENST00000261530.7	37	c.1002T>G	CCDS9848.1																																																																																				0.413	GPATCH2L-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000413698.2	NM_017926		27	152	0	0	0	0	27	152				
PPP4R4	57718	broad.mit.edu	37	14	94711996	94711996	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr14:94711996C>T	ENST00000304338.3	+	13	1571	c.1417C>T	c.(1417-1419)Caa>Taa	p.Q473*		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	473					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						AAGCAGTGTTCAAGAAAATAA	0.338																																						uc001ycs.1		NA																	0				skin(3)|upper_aerodigestive_tract(1)	4						c.(1417-1419)CAA>TAA		HEAT-like repeat-containing protein isoform 1							91.0	93.0	92.0					14																	94711996		2203	4298	6501	SO:0001587	stop_gained	57718					cytoplasm|protein serine/threonine phosphatase complex	protein binding	g.chr14:94711996C>T	AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.1417C>T	14.37:g.94711996C>T	ENSP00000305924:p.Gln473*		Somatic					p.Q473*	NM_058237	NP_478144	WXS	Illumina HiSeq	Unspecified	Q6NUP7	PP4R4_HUMAN			13	1571	+			473					Q9BUF8|Q9HCF0	Nonsense_Mutation	SNP	ENST00000304338.3	37	c.1417C>T	CCDS9921.1	.	.	.	.	.	.	.	.	.	.	C	39	7.392435	0.98255	.	.	ENSG00000119698	ENST00000304338	.	.	.	6.07	6.07	0.98685	.	0.314175	0.33980	N	0.004368	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-16.8767	7.9992	0.30286	0.0:0.8157:0.0:0.1843	.	.	.	.	X	473	.	ENSP00000305924:Q473X	Q	+	1	0	PPP4R4	93781749	0.997000	0.39634	0.998000	0.56505	0.996000	0.88848	1.966000	0.40481	2.885000	0.99019	0.650000	0.86243	CAA		0.338	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413056.1	NM_058237		25	148	0	0	0	0	25	148				
NPAP1	23742	broad.mit.edu	37	15	24923846	24923846	+	Silent	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr15:24923846T>C	ENST00000329468.2	+	1	3306	c.2832T>C	c.(2830-2832)ggT>ggC	p.G944G		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	944					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											TTCCACCAGGTTTTGCAGAGT	0.483																																						uc001ywo.2		NA																	0				ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8						c.(2830-2832)GGT>GGC		hypothetical protein LOC23742							78.0	81.0	80.0					15																	24923846		2203	4300	6503	SO:0001819	synonymous_variant	23742				cell differentiation|multicellular organismal development|spermatogenesis			g.chr15:24923846T>C	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2832T>C	15.37:g.24923846T>C			Somatic					p.G944G	NM_018958	NP_061831	WXS	Illumina HiSeq	Unspecified	Q9NZP6	CO002_HUMAN		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)	1	3306	+		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)	944						Silent	SNP	ENST00000329468.2	37	c.2832T>C	CCDS10015.1																																																																																				0.483	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958		24	108	0	0	0	0	24	108				
FAN1	22909	broad.mit.edu	37	15	31229329	31229329	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr15:31229329A>G	ENST00000362065.4	+	14	3215	c.2924A>G	c.(2923-2925)gAa>gGa	p.E975G		NM_014967.4	NP_055782.3	Q9Y2M0	FAN1_HUMAN	FANCD2/FANCI-associated nuclease 1	975	VRR-NUC.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA incision (GO:0033683)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-flap endonuclease activity (GO:0017108)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphodiesterase I activity (GO:0004528)|ubiquitin binding (GO:0043130)			autonomic_ganglia(2)|breast(2)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(6)|lung(8)|skin(1)	29						CAGCTGGTGGAAGTTAAAGGC	0.398								Direct reversal of damage																														uc001zff.2		NA																	0					0						c.(2923-2925)GAA>GGA	Direct_reversal_of_damage|Editing_and_processing_nucleases	myotubularin related protein 15 isoform a							77.0	79.0	78.0					15																	31229329		2202	4300	6502	SO:0001583	missense	22909				double-strand break repair via homologous recombination|nucleotide-excision repair, DNA incision	nucleus	5'-3' exonuclease activity|5'-flap endonuclease activity|DNA binding|magnesium ion binding|phosphodiesterase I activity|ubiquitin binding	g.chr15:31229329A>G		CCDS32186.1, CCDS58344.1	15q13.2-q13.3	2010-08-04	2010-08-04	2010-08-04		ENSG00000198690			29170	protein-coding gene	gene with protein product		613534	"""KIAA1018"", ""myotubularin related protein 15"""	KIAA1018, MTMR15		20603015, 20603016, 20603073	Standard	NM_014967		Approved		uc001zff.3	Q9Y2M0		ENST00000362065.4:c.2924A>G	15.37:g.31229329A>G	ENSP00000354497:p.Glu975Gly		Somatic				MTMR15_uc001zfe.2_Missense_Mutation_p.E580G	p.E975G	NM_014967	NP_055782	WXS	Illumina HiSeq	Unspecified	Q9Y2M0	FAN1_HUMAN		all cancers(64;4.72e-15)|Epithelial(43;5.4e-11)|GBM - Glioblastoma multiforme(186;0.000136)|BRCA - Breast invasive adenocarcinoma(123;0.00402)|Lung(196;0.168)	14	3215	+		all_lung(180;2.23e-09)	975	E->A: Loss of nuclease activity; when associated with A-864; A-960 and A-977.		VRR-NUC.		A8K4M2|Q86WU8	Missense_Mutation	SNP	ENST00000362065.4	37	c.2924A>G	CCDS32186.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.646420	0.87958	.	.	ENSG00000198690	ENST00000362065	D	0.99801	-6.81	5.21	5.21	0.72293	VRR-NUC (1);	0.000000	0.85682	D	0.000000	D	0.99771	0.9906	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97017	0.9740	10	0.87932	D	0	-24.7243	15.3796	0.74645	1.0:0.0:0.0:0.0	.	975;975	Q9Y2M0;D9MXF4	FAN1_HUMAN;.	G	975	ENSP00000354497:E975G	ENSP00000354497:E975G	E	+	2	0	FAN1	29016621	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	8.954000	0.93051	2.090000	0.63153	0.459000	0.35465	GAA		0.398	FAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430740.1	NM_014967		14	134	0	0	0	0	14	134				
RYR3	6263	broad.mit.edu	37	15	34040349	34040349	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr15:34040349C>G	ENST00000389232.4	+	54	8094	c.8024C>G	c.(8023-8025)tCc>tGc	p.S2675C	RYR3_ENST00000415757.3_Missense_Mutation_p.S2675C	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2675	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.S2675F(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GCGCGAGAGTCCCTGAAAACC	0.527																																						uc001zhi.2		NA																	1	Substitution - Missense(1)		skin(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(8023-8025)TCC>TGC		ryanodine receptor 3							87.0	93.0	91.0					15																	34040349		1986	4167	6153	SO:0001583	missense	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:34040349C>G		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8024C>G	15.37:g.34040349C>G	ENSP00000373884:p.Ser2675Cys		Somatic				RYR3_uc010bar.2_Missense_Mutation_p.S2675C	p.S2675C	NM_001036	NP_001027	WXS	Illumina HiSeq	Unspecified	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	54	8094	+		all_lung(180;7.18e-09)	2675			3.|Cytoplasmic (By similarity).|4 X approximate repeats.		O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	c.8024C>G	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.623532	0.66901	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.91631	-2.88;-2.88	5.18	5.18	0.71444	Ryanodine receptor Ryr (1);	0.137507	0.50627	D	0.000105	D	0.94006	0.8080	L	0.42744	1.35	0.58432	D	0.999993	P;D	0.89917	0.839;1.0	B;D	0.87578	0.405;0.998	D	0.91396	0.5139	10	0.19590	T	0.45	.	18.8778	0.92345	0.0:1.0:0.0:0.0	.	2675;2675	Q15413-2;Q15413	.;RYR3_HUMAN	C	2675	ENSP00000373884:S2675C;ENSP00000399610:S2675C	ENSP00000354735:S2675C	S	+	2	0	RYR3	31827641	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.609000	0.82925	2.679000	0.91253	0.655000	0.94253	TCC		0.527	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			16	99	0	0	0	0	16	99				
TYRO3	7301	broad.mit.edu	37	15	41870164	41870164	+	Missense_Mutation	SNP	A	A	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr15:41870164A>T	ENST00000263798.3	+	19	2587	c.2363A>T	c.(2362-2364)aAc>aTc	p.N788I	TYRO3_ENST00000559066.1_Missense_Mutation_p.N743I	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	788	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GAACTGGAGAACATCTTGGGC	0.572																																						uc001zof.1		NA																	0				ovary(3)|lung(2)|central_nervous_system(1)	6						c.(2362-2364)AAC>ATC		TYRO3 protein tyrosine kinase precursor							48.0	55.0	53.0					15																	41870164		2203	4300	6503	SO:0001583	missense	7301					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr15:41870164A>T	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.2363A>T	15.37:g.41870164A>T	ENSP00000263798:p.Asn788Ile		Somatic					p.N788I	NM_006293	NP_006284	WXS	Illumina HiSeq	Unspecified	Q06418	TYRO3_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)	19	2587	+		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)	788			Protein kinase.|Cytoplasmic (Potential).		O14953|Q86VR3	Missense_Mutation	SNP	ENST00000263798.3	37	c.2363A>T	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	A	7.915	0.737275	0.15574	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.60920	0.15	5.95	-9.94	0.00449	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	1.224380	0.05996	N	0.646872	T	0.41604	0.1166	L	0.42529	1.33	0.09310	N	0.999997	B	0.06786	0.001	B	0.06405	0.002	T	0.28586	-1.0039	10	0.42905	T	0.14	0.1854	7.6966	0.28598	0.1451:0.5659:0.1863:0.1027	.	788	Q06418	TYRO3_HUMAN	I	720;788	ENSP00000263798:N788I	ENSP00000263798:N788I	N	+	2	0	TYRO3	39657456	0.018000	0.18449	0.203000	0.23512	0.340000	0.28889	-0.321000	0.08018	-2.233000	0.00716	-1.170000	0.01741	AAC		0.572	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2			9	102	0	0	0	0	9	102				
DMXL2	23312	broad.mit.edu	37	15	51806663	51806663	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr15:51806663C>G	ENST00000251076.5	-	15	2907	c.2620G>C	c.(2620-2622)Gaa>Caa	p.E874Q	DMXL2_ENST00000543779.2_Missense_Mutation_p.E874Q|DMXL2_ENST00000449909.3_Missense_Mutation_p.E874Q	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	874						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.E874*(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		AAAAATATTTCTGTTTCCTTT	0.318																																						uc002abf.2		NA																	1	Substitution - Nonsense(1)		large_intestine(1)	ovary(6)|skin(3)	9						c.(2620-2622)GAA>CAA		Dmx-like 2							204.0	195.0	198.0					15																	51806663		2195	4292	6487	SO:0001583	missense	23312					cell junction|synaptic vesicle membrane	Rab GTPase binding	g.chr15:51806663C>G	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.2620G>C	15.37:g.51806663C>G	ENSP00000251076:p.Glu874Gln		Somatic				DMXL2_uc010ufy.1_Missense_Mutation_p.E874Q|DMXL2_uc010bfa.2_Missense_Mutation_p.E874Q	p.E874Q	NM_015263	NP_056078	WXS	Illumina HiSeq	Unspecified	Q8TDJ6	DMXL2_HUMAN		all cancers(107;0.00494)	15	2845	-			874					B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	c.2620G>C	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.487117	0.44249	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.25579	1.95;1.95;1.79	4.97	4.97	0.65823	.	0.368200	0.32970	N	0.005427	T	0.37865	0.1019	L	0.47716	1.5	0.22017	N	0.999411	D;P;D	0.63880	0.993;0.954;0.961	P;P;P	0.56563	0.801;0.781;0.516	T	0.25152	-1.0140	10	0.19147	T	0.46	.	18.5956	0.91228	0.0:1.0:0.0:0.0	.	874;874;874	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	Q	874	ENSP00000251076:E874Q;ENSP00000441858:E874Q;ENSP00000400855:E874Q	ENSP00000251076:E874Q	E	-	1	0	DMXL2	49593955	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.980000	0.70516	2.472000	0.83506	0.591000	0.81541	GAA		0.318	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263		32	213	0	0	0	0	32	213				
ANPEP	290	broad.mit.edu	37	15	90328694	90328694	+	Silent	SNP	G	G	A	rs145116014		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr15:90328694G>A	ENST00000300060.6	-	21	3103	c.2790C>T	c.(2788-2790)ttC>ttT	p.F930F		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	930	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	TGCCTGAGCCGAAGCCTGTTT	0.562																																					NSCLC(30;827 977 2459 19669 26125)	uc002bop.3		NA																	0				ovary(3)|skin(1)	4						c.(2788-2790)TTC>TTT		membrane alanine aminopeptidase precursor	Ezetimibe(DB00973)	G		0,4400		0,0,2200	171.0	162.0	165.0		2790	-3.4	1.0	15	dbSNP_134	165	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	ANPEP	NM_001150.2		0,1,6498	AA,AG,GG		0.0116,0.0,0.0077		930/968	90328694	1,12997	2200	4299	6499	SO:0001819	synonymous_variant	290				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding	g.chr15:90328694G>A	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.2790C>T	15.37:g.90328694G>A			Somatic					p.F930F	NM_001150	NP_001141	WXS	Illumina HiSeq	Unspecified	P15144	AMPN_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		21	3082	-	Lung NSC(78;0.0221)|all_lung(78;0.0448)		930			Extracellular.|Metalloprotease.		Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Silent	SNP	ENST00000300060.6	37	c.2790C>T	CCDS10356.1																																																																																				0.562	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1			14	212	0	0	0	0	14	212				
ZSCAN10	84891	broad.mit.edu	37	16	3140386	3140386	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr16:3140386G>A	ENST00000252463.2	-	5	971	c.884C>T	c.(883-885)gCg>gTg	p.A295V	ZSCAN10_ENST00000538082.2_Missense_Mutation_p.A213V|ZSCAN10_ENST00000575108.1_5'UTR	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	295					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						CCCGCAGTCCGCGCAGATGAA	0.637																																						uc002ctv.1		NA																	0				ovary(1)	1						c.(883-885)GCG>GTG		zinc finger and SCAN domain containing 10							51.0	54.0	53.0					16																	3140386		2168	4241	6409	SO:0001583	missense	84891				negative regulation of transcription, DNA-dependent|viral reproduction	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:3140386G>A	AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.884C>T	16.37:g.3140386G>A	ENSP00000252463:p.Ala295Val		Somatic				ZSCAN10_uc002cty.1_5'UTR|ZSCAN10_uc002ctw.1_Missense_Mutation_p.A213V|ZSCAN10_uc002ctx.1_Missense_Mutation_p.A223V	p.A295V	NM_032805	NP_116194	WXS	Illumina HiSeq	Unspecified	Q96SZ4	ZSC10_HUMAN			5	972	-			295			C2H2-type 1.		B3KQD3|H0YFS6|Q1WWM2	Missense_Mutation	SNP	ENST00000252463.2	37	c.884C>T	CCDS10493.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.729796	0.48833	.	.	ENSG00000130182	ENST00000538082;ENST00000252463	T	0.51325	0.71	5.27	5.27	0.74061	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.420157	0.20299	N	0.095064	T	0.30386	0.0763	N	0.12443	0.215	0.30078	N	0.809462	P;B	0.35944	0.529;0.396	B;B	0.29440	0.102;0.065	T	0.32981	-0.9886	10	0.51188	T	0.08	-8.1563	16.399	0.83632	0.0:0.0:1.0:0.0	.	228;295	Q1WWM2;Q96SZ4	.;ZSC10_HUMAN	V	228;295	ENSP00000252463:A295V	ENSP00000252463:A295V	A	-	2	0	ZSCAN10	3080387	0.000000	0.05858	0.874000	0.34290	0.043000	0.13939	0.702000	0.25631	2.479000	0.83701	0.563000	0.77884	GCG		0.637	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437124.2	NM_032805		7	129	0	0	0	0	7	129				
MON1B	22879	broad.mit.edu	37	16	77229463	77229463	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr16:77229463G>C	ENST00000248248.3	+	5	1677	c.1327G>C	c.(1327-1329)Gag>Cag	p.E443Q	MON1B_ENST00000545553.1_Missense_Mutation_p.E297Q|MON1B_ENST00000439557.2_Missense_Mutation_p.E334Q|MON1B_ENST00000320859.6_Intron	NM_014940.2	NP_055755.1	Q7L1V2	MON1B_HUMAN	MON1 secretory trafficking family member B	443										breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	17						CAGCAGAGAGGAGGAGCGGCA	0.632																																						uc002fez.2		NA																	0					0						c.(1327-1329)GAG>CAG		MON1 homolog B							53.0	43.0	46.0					16																	77229463		2198	4300	6498	SO:0001583	missense	22879						protein binding	g.chr16:77229463G>C	BC024277	CCDS10925.1, CCDS67082.1, CCDS67083.1	16q23.1	2013-08-21	2013-08-21		ENSG00000103111	ENSG00000103111			25020	protein-coding gene	gene with protein product		608954	"""MON1 homolog B (yeast)"""			10048485	Standard	NM_014940		Approved	SAND2, HSRG1, KIAA0872	uc002fez.3	Q7L1V2	OTTHUMG00000137618	ENST00000248248.3:c.1327G>C	16.37:g.77229463G>C	ENSP00000248248:p.Glu443Gln		Somatic				MON1B_uc010vnf.1_Missense_Mutation_p.E334Q|MON1B_uc010vng.1_Missense_Mutation_p.E297Q|MON1B_uc002ffa.2_Missense_Mutation_p.E323Q	p.E443Q	NM_014940	NP_055755	WXS	Illumina HiSeq	Unspecified	Q7L1V2	MON1B_HUMAN			5	1657	+			443					B4DDZ0|O94949	Missense_Mutation	SNP	ENST00000248248.3	37	c.1327G>C	CCDS10925.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.976868	0.92982	.	.	ENSG00000103111	ENST00000248248;ENST00000439557;ENST00000545553	.	.	.	5.02	4.06	0.47325	.	0.119671	0.64402	D	0.000010	T	0.68265	0.2982	M	0.66297	2.02	0.80722	D	1	D;D;D;D	0.69078	0.997;0.992;0.992;0.994	D;D;D;P	0.66497	0.944;0.928;0.928;0.892	T	0.63879	-0.6537	9	0.28530	T	0.3	.	10.8149	0.46569	0.0928:0.0:0.9072:0.0	.	297;334;323;443	B4DDZ0;E7EW32;Q6ZR87;Q7L1V2	.;.;.;MON1B_HUMAN	Q	443;334;297	.	ENSP00000248248:E443Q	E	+	1	0	MON1B	75786964	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.971000	0.56831	2.711000	0.92665	0.655000	0.94253	GAG		0.632	MON1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269036.2	NM_014940		5	24	0	0	0	0	5	24				
SLC38A8	146167	broad.mit.edu	37	16	84050761	84050761	+	Missense_Mutation	SNP	C	C	T	rs373901370		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr16:84050761C>T	ENST00000299709.3	-	7	936	c.937G>A	c.(937-939)Gtg>Atg	p.V313M		NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	313					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						AGGAAGAGCACGATGGGGTAG	0.552																																						uc002fhg.1		NA																	0					0						c.(937-939)GTG>ATG		solute carrier family 38, member 8		C	MET/VAL	0,4400		0,0,2200	94.0	76.0	82.0		937	3.8	1.0	16		82	1,8599		0,1,4299	no	missense	SLC38A8	NM_001080442.1	21	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	313/436	84050761	1,12999	2200	4300	6500	SO:0001583	missense	146167				amino acid transport|sodium ion transport	integral to membrane		g.chr16:84050761C>T		CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.937G>A	16.37:g.84050761C>T	ENSP00000299709:p.Val313Met		Somatic					p.V313M	NM_001080442	NP_001073911	WXS	Illumina HiSeq	Unspecified	A6NNN8	S38A8_HUMAN			7	937	-			313			Helical; (Potential).			Missense_Mutation	SNP	ENST00000299709.3	37	c.937G>A	CCDS32495.1	.	.	.	.	.	.	.	.	.	.	.	12.86	2.064221	0.36373	0.0	1.16E-4	ENSG00000166558	ENST00000299709	T	0.02421	4.3	4.75	3.78	0.43462	.	0.551479	0.18422	N	0.141708	T	0.07188	0.0182	L	0.45581	1.43	0.33043	D	0.531674	D	0.63880	0.993	P	0.61397	0.888	T	0.19976	-1.0289	10	0.25751	T	0.34	-17.7635	8.86	0.35251	0.0:0.8213:0.0:0.1787	.	313	A6NNN8	S38A8_HUMAN	M	313	ENSP00000299709:V313M	ENSP00000299709:V313M	V	-	1	0	SLC38A8	82608262	0.924000	0.31332	0.986000	0.45419	0.991000	0.79684	1.898000	0.39809	2.184000	0.69523	0.478000	0.44815	GTG		0.552	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432623.1	NM_001080442		10	56	0	0	0	0	10	56				
PRDM7	11105	broad.mit.edu	37	16	90133294	90133294	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr16:90133294C>T	ENST00000449207.2	-	4	345	c.326G>A	c.(325-327)aGa>aAa	p.R109K	PRDM7_ENST00000407825.1_5'UTR	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	109					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)			lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		CTGTTCTCCTCTGAAGGCCAT	0.383																																						uc010cje.2		NA																	0				ovary(1)	1						c.(325-327)AGA>AAA		PR domain containing 7 isoform 1							236.0	242.0	240.0					16																	90133294		1854	4094	5948	SO:0001583	missense	11105					chromosome|nucleus	nucleic acid binding	g.chr16:90133294C>T	AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.326G>A	16.37:g.90133294C>T	ENSP00000396732:p.Arg109Lys		Somatic				PRDM7_uc010cjf.2_Intron|PRDM7_uc010cjh.1_RNA	p.R109K	NM_001098173	NP_001091643	WXS	Illumina HiSeq	Unspecified	Q9NQW5	PRDM7_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0278)	4	346	-		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)	109					A4Q9G8|Q08EM4|Q9NQW4	Missense_Mutation	SNP	ENST00000449207.2	37	c.326G>A	CCDS45557.1	.	.	.	.	.	.	.	.	.	.	.	12.01	1.809335	0.31961	.	.	ENSG00000126856	ENST00000449207;ENST00000414728	T	0.10573	2.86	1.5	1.5	0.22942	.	.	.	.	.	T	0.08358	0.0208	L	0.44542	1.39	0.80722	D	1	P	0.43431	0.807	B	0.39217	0.294	T	0.30504	-0.9976	8	.	.	.	-6.1597	6.5009	0.22168	0.0:1.0:0.0:0.0	.	109	Q9NQW5	PRDM7_HUMAN	K	109	ENSP00000396732:R109K	.	R	-	2	0	PRDM7	88660795	0.056000	0.20664	0.769000	0.31535	0.088000	0.18126	0.793000	0.26944	1.157000	0.42530	0.549000	0.68633	AGA		0.383	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420560.1			46	281	0	0	0	0	46	281				
RPH3AL	9501	broad.mit.edu	37	17	169309	169309	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr17:169309G>A	ENST00000331302.7	-	5	560	c.253C>T	c.(253-255)Cgg>Tgg	p.R85W	RP11-1260E13.1_ENST00000570501.1_RNA|RPH3AL_ENST00000323434.8_Missense_Mutation_p.R85W|RP11-1260E13.1_ENST00000572998.1_RNA|RPH3AL_ENST00000576001.1_5'Flank|RPH3AL_ENST00000536489.2_Missense_Mutation_p.R85W	NM_001190411.1|NM_006987.3	NP_001177340.1|NP_008918.1	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)	85	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.			R -> Q (in Ref. 4; AAH05153). {ECO:0000305}.	exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|intracellular protein transport (GO:0006886)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|positive regulation of protein secretion (GO:0050714)|regulation of calcium ion-dependent exocytosis (GO:0017158)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|secretory granule membrane (GO:0030667)	cytoskeletal protein binding (GO:0008092)|metal ion binding (GO:0046872)	p.R85W(1)		NS(2)|breast(1)|kidney(1)|large_intestine(1)|skin(1)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		ATCACATTCCGCCTCATGGTC	0.632																																						uc002frd.1		NA																	1	Substitution - Missense(1)		NS(1)	skin(1)	1						c.(253-255)CGG>TGG		rabphilin 3A-like (without C2 domains)							105.0	84.0	91.0					17																	169309		2199	4296	6495	SO:0001583	missense	9501				exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding	g.chr17:169309G>A		CCDS10994.1, CCDS54059.1	17p13.3	2014-07-02			ENSG00000181031	ENSG00000181031		"""Synaptotagmins"""	10296	protein-coding gene	gene with protein product		604881				10395805	Standard	NM_006987		Approved	Noc2	uc021tmx.1	Q9UNE2	OTTHUMG00000090273	ENST00000331302.7:c.253C>T	17.37:g.169309G>A	ENSP00000328977:p.Arg85Trp		Somatic				RPH3AL_uc010vpy.1_Missense_Mutation_p.R85W|RPH3AL_uc002fre.1_Missense_Mutation_p.R85W|RPH3AL_uc002frf.1_Missense_Mutation_p.R85W|RPH3AL_uc010cjl.1_Missense_Mutation_p.R85W	p.R85W	NM_006987	NP_008918	WXS	Illumina HiSeq	Unspecified	Q9UNE2	RPH3L_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)	3	297	-			85	R -> Q (in Ref. 4; AAH05153).		RabBD.		D3DTG7|Q9BSB3	Missense_Mutation	SNP	ENST00000331302.7	37	c.253C>T	CCDS10994.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.291111	0.80914	.	.	ENSG00000181031	ENST00000323434;ENST00000331302;ENST00000536489	T;T;T	0.79352	-1.26;-1.26;-1.26	5.74	0.995	0.19838	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Rabphilin-3A effector, zinc-binding (1);Zinc finger, FYVE/PHD-type (1);	0.430095	0.21665	N	0.070949	T	0.75910	0.3914	L	0.29908	0.895	0.34059	D	0.65705	D;D;D	0.76494	0.998;0.999;0.999	P;P;P	0.62382	0.809;0.854;0.901	T	0.77319	-0.2632	10	0.36615	T	0.2	-13.2383	9.6735	0.40026	0.0:0.1029:0.2659:0.6312	.	85;85;85	A8K7D5;Q9UNE2-2;Q9UNE2	.;.;RPH3L_HUMAN	W	85	ENSP00000319210:R85W;ENSP00000328977:R85W;ENSP00000438224:R85W	ENSP00000319210:R85W	R	-	1	2	RPH3AL	169309	1.000000	0.71417	0.533000	0.28001	0.912000	0.54170	3.692000	0.54727	0.307000	0.22880	-0.175000	0.13238	CGG		0.632	RPH3AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206597.2	NM_006987		5	40	0	0	0	0	5	40				
TOM1L2	146691	broad.mit.edu	37	17	17788024	17788024	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr17:17788024T>A	ENST00000379504.3	-	5	508	c.425A>T	c.(424-426)gAg>gTg	p.E142V	TOM1L2_ENST00000395739.4_Intron|TOM1L2_ENST00000535933.1_Missense_Mutation_p.E142V|TOM1L2_ENST00000581396.1_Missense_Mutation_p.E92V|TOM1L2_ENST00000540946.1_Intron|TOM1L2_ENST00000542206.1_Intron|TOM1L2_ENST00000318094.10_Intron	NM_001082968.1	NP_001076437.1	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 (chicken)	142	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	clathrin binding (GO:0030276)|protein kinase binding (GO:0019901)			endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(2)	10	all_neural(463;0.228)					CTTCAGCTCCTCATATATGTG	0.517																																					Melanoma(192;2505 2909 14455 25269)	uc002grz.3		NA																	0					0						c.(424-426)GAG>GTG		target of myb1-like 2 isoform 3							185.0	153.0	164.0					17																	17788024		2203	4300	6503	SO:0001583	missense	146691				intracellular protein transport	intracellular		g.chr17:17788024T>A	AJ230803	CCDS32584.1, CCDS42270.1, CCDS74000.1, CCDS74001.1, CCDS74002.1, CCDS74003.1	17p11.2	2008-07-03	2001-11-28		ENSG00000175662	ENSG00000175662			11984	protein-coding gene	gene with protein product		615519	"""target of myb1 (chicken) homolog-like 1"""			10036180	Standard	NM_001082968		Approved		uc002grz.4	Q6ZVM7	OTTHUMG00000059353	ENST00000379504.3:c.425A>T	17.37:g.17788024T>A	ENSP00000368818:p.Glu142Val		Somatic				TOM1L2_uc002gry.3_Missense_Mutation_p.E92V|TOM1L2_uc010vwy.1_Missense_Mutation_p.E142V|TOM1L2_uc010cpr.2_Intron|TOM1L2_uc010vwz.1_Intron|TOM1L2_uc010vxa.1_Intron|TOM1L2_uc010vxb.1_Missense_Mutation_p.E92V	p.E142V	NM_001082968	NP_001076437	WXS	Illumina HiSeq	Unspecified	Q6ZVM7	TM1L2_HUMAN			5	582	-	all_neural(463;0.228)		142			VHS.		B7Z2L7|B7Z7F4|Q86V61|Q8TDE7|Q96M88	Missense_Mutation	SNP	ENST00000379504.3	37	c.425A>T	CCDS42270.1	.	.	.	.	.	.	.	.	.	.	T	29.9	5.043943	0.93685	.	.	ENSG00000175662	ENST00000379504;ENST00000318094;ENST00000535933;ENST00000537091	T;T	0.24350	1.86;1.86	5.97	5.97	0.96955	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.000000	0.85682	D	0.000000	T	0.51822	0.1697	M	0.78049	2.395	0.80722	D	1	D;B;D;D	0.89917	1.0;0.338;0.993;0.999	D;B;P;D	0.76071	0.987;0.318;0.895;0.951	T	0.47394	-0.9121	10	0.25751	T	0.34	-25.2155	16.4504	0.83984	0.0:0.0:0.0:1.0	.	92;142;142;92	B7Z8F0;B7Z2L7;Q6ZVM7;Q6ZVM7-2	.;.;TM1L2_HUMAN;.	V	142;92;142;92	ENSP00000368818:E142V;ENSP00000438621:E142V	ENSP00000312860:E92V	E	-	2	0	TOM1L2	17728749	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	7.991000	0.88244	2.288000	0.76882	0.533000	0.62120	GAG		0.517	TOM1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131928.1			23	207	0	0	0	0	23	207				
ABHD15	116236	broad.mit.edu	37	17	27893561	27893561	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr17:27893561C>G	ENST00000307201.4	-	1	594	c.424G>C	c.(424-426)Gga>Cga	p.G142R	TP53I13_ENST00000584522.1_3'UTR|RP11-68I3.2_ENST00000581474.1_RNA|TP53I13_ENST00000301057.7_5'Flank	NM_198147.2	NP_937790.2	Q6UXT9	ABH15_HUMAN	abhydrolase domain containing 15	142						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	10						ACACAAGGTCCTACCACCCAG	0.687																																						uc002hed.1		NA																	0					0						c.(424-426)GGA>CGA		abhydrolase domain containing 15 precursor							29.0	25.0	27.0					17																	27893561		2199	4295	6494	SO:0001583	missense	116236					extracellular region	carboxylesterase activity	g.chr17:27893561C>G	AK056717	CCDS32602.1	17q11.2	2009-11-20			ENSG00000168792	ENSG00000168792		"""Abhydrolase domain containing"""	26971	protein-coding gene	gene with protein product						12975309	Standard	NM_198147		Approved		uc002hed.2	Q6UXT9		ENST00000307201.4:c.424G>C	17.37:g.27893561C>G	ENSP00000302657:p.Gly142Arg		Somatic				TP53I13_uc002hee.2_5'Flank	p.G142R	NM_198147	NP_937790	WXS	Illumina HiSeq	Unspecified	Q6UXT9	ABH15_HUMAN			1	488	-			142					Q96EC5	Missense_Mutation	SNP	ENST00000307201.4	37	c.424G>C	CCDS32602.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.670754	0.29693	.	.	ENSG00000168792	ENST00000307201	T	0.70516	-0.49	4.34	3.37	0.38596	.	0.292074	0.27792	N	0.017823	T	0.57272	0.2042	L	0.34521	1.04	0.80722	D	1	B	0.30973	0.302	B	0.26770	0.073	T	0.59289	-0.7482	10	0.66056	D	0.02	-23.6933	10.9399	0.47268	0.0:0.907:0.0:0.093	.	142	Q6UXT9	ABH15_HUMAN	R	142	ENSP00000302657:G142R	ENSP00000302657:G142R	G	-	1	0	ABHD15	24917687	1.000000	0.71417	0.995000	0.50966	0.597000	0.36814	2.292000	0.43549	1.041000	0.40125	0.563000	0.77884	GGA		0.687	ABHD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447796.2	NM_198147		3	28	0	0	0	0	3	28				
WIPF2	147179	broad.mit.edu	37	17	38421105	38421105	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr17:38421105C>T	ENST00000323571.4	+	5	917	c.677C>T	c.(676-678)gCt>gTt	p.A226V	WIPF2_ENST00000536600.1_Intron|WIPF2_ENST00000394103.3_Intron|WIPF2_ENST00000583130.1_Missense_Mutation_p.A226V|WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000585043.1_Missense_Mutation_p.A226V	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	226					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						GGACCTCCTGCTCCACCCCCA	0.607										HNSCC(43;0.11)																												uc002hug.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						c.(676-678)GCT>GTT		WIRE protein							151.0	133.0	139.0					17																	38421105		2203	4300	6503	SO:0001583	missense	147179					cytoplasm|cytoskeleton	actin binding	g.chr17:38421105C>T	BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.677C>T	17.37:g.38421105C>T	ENSP00000320924:p.Ala226Val	HNSCC(43;0.11)	Somatic				WIPF2_uc002huh.1_Missense_Mutation_p.A76V|WIPF2_uc010cww.1_Missense_Mutation_p.A76V|WIPF2_uc002hui.1_Missense_Mutation_p.A226V|WIPF2_uc010cwx.1_Intron|WIPF2_uc010cwy.1_Missense_Mutation_p.A226V	p.A226V	NM_133264	NP_573571	WXS	Illumina HiSeq	Unspecified	Q8TF74	WIPF2_HUMAN			5	917	+			226					A8K0L3|Q658J8|Q71RE1|Q8TE44	Missense_Mutation	SNP	ENST00000323571.4	37	c.677C>T	CCDS11364.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.152509	0.78001	.	.	ENSG00000171475	ENST00000323571	T	0.30714	1.52	5.16	5.16	0.70880	.	0.111270	0.64402	D	0.000008	T	0.34513	0.0900	L	0.35414	1.06	0.80722	D	1	D	0.55172	0.97	P	0.48704	0.587	T	0.06232	-1.0838	10	0.52906	T	0.07	-9.6384	18.5007	0.90879	0.0:1.0:0.0:0.0	.	226	Q8TF74	WIPF2_HUMAN	V	226	ENSP00000320924:A226V	ENSP00000320924:A226V	A	+	2	0	WIPF2	35674631	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.519000	0.73768	2.698000	0.92095	0.456000	0.33151	GCT		0.607	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2	NM_133264		29	213	0	0	0	0	29	213				
KANSL1	284058	broad.mit.edu	37	17	44109631	44109631	+	Nonsense_Mutation	SNP	G	G	A	rs147378906		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr17:44109631G>A	ENST00000262419.6	-	14	3342	c.2872C>T	c.(2872-2874)Cag>Tag	p.Q958*	KANSL1_ENST00000432791.1_Nonsense_Mutation_p.Q958*|KANSL1_ENST00000572904.1_Nonsense_Mutation_p.Q958*|KANSL1_ENST00000393476.3_Nonsense_Mutation_p.Q252*|KANSL1_ENST00000574590.1_Nonsense_Mutation_p.Q958*|KANSL1_ENST00000575318.1_Nonsense_Mutation_p.Q894*	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	958	Sufficient for interaction with KAT8.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CTGCCCAGCTGGGGGGTTGTC	0.577																																						uc002ikb.2		NA																	0				skin(2)	2						c.(2872-2874)CAG>TAG		hypothetical protein LOC284058		G	stop/GLN,stop/GLN,stop/GLN	1,4403		0,1,2201	39.0	45.0	43.0		2869,2872,2872	5.2	1.0	17	dbSNP_134	43	0,8596		0,0,4298	no	stop-gained,stop-gained,stop-gained	KIAA1267	NM_001193465.1,NM_001193466.1,NM_015443.3	,,	0,1,6499	AA,AG,GG		0.0,0.0227,0.0077	,,	957/1105,958/1106,958/1106	44109631	1,12999	2202	4298	6500	SO:0001587	stop_gained	284058					MLL1 complex	protein binding	g.chr17:44109631G>A	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.2872C>T	17.37:g.44109631G>A	ENSP00000262419:p.Gln958*		Somatic				KIAA1267_uc002ikc.2_Nonsense_Mutation_p.Q958*|KIAA1267_uc002ikd.2_Nonsense_Mutation_p.Q958*|KIAA1267_uc010dav.2_Nonsense_Mutation_p.Q957*|KIAA1267_uc010wkb.1_Nonsense_Mutation_p.Q289*|KIAA1267_uc010wkc.1_Nonsense_Mutation_p.Q226*	p.Q958*	NM_015443	NP_056258	WXS	Illumina HiSeq	Unspecified	Q7Z3B3	K1267_HUMAN			13	2957	-		Melanoma(429;0.211)	958					A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Nonsense_Mutation	SNP	ENST00000262419.6	37	c.2872C>T	CCDS11503.1	.	.	.	.	.	.	.	.	.	.	G	54	22.065549	0.99945	2.27E-4	0.0	ENSG00000120071	ENST00000262419;ENST00000432791;ENST00000393476	.	.	.	5.2	5.2	0.72013	.	0.197991	0.42682	D	0.000672	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-10.2323	17.4764	0.87660	0.0:0.0:1.0:0.0	.	.	.	.	X	958;958;252	.	ENSP00000262419:Q958X	Q	-	1	0	KIAA1267	41465478	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	6.717000	0.74707	2.706000	0.92434	0.561000	0.74099	CAG		0.577	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443		11	76	0	0	0	0	11	76				
ANKFN1	162282	broad.mit.edu	37	17	54230890	54230890	+	Splice_Site	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr17:54230890G>A	ENST00000318698.2	+	1	55	c.20G>A	c.(19-21)aGg>aAg	p.R7K	ANKFN1_ENST00000566473.2_Splice_Site_p.R7K|ANKFN1_ENST00000574292.1_3'UTR	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	7										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						TCTCTAACCAGGGTAGGAAAA	0.488																																						uc002iun.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(19-21)AGG>AAG		ankyrin-repeat and fibronectin type III domain							143.0	131.0	135.0					17																	54230890		2203	4300	6503	SO:0001630	splice_region_variant	162282							g.chr17:54230890G>A	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.21+1G>A	17.37:g.54230890G>A			Somatic					p.R7K	NM_153228	NP_694960	WXS	Illumina HiSeq	Unspecified	Q8N957	ANKF1_HUMAN			1	55	+			7						Missense_Mutation	SNP	ENST00000318698.2	37	c.20G>A	CCDS32686.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.047579	0.36085	.	.	ENSG00000153930	ENST00000318698	T	0.21734	1.99	5.33	4.34	0.51931	.	1.324610	0.04633	N	0.404036	T	0.13841	0.0335	N	0.08118	0	0.21499	N	0.999663	B	0.26635	0.155	B	0.23574	0.047	T	0.24548	-1.0157	10	0.28530	T	0.3	.	11.1178	0.48270	0.0:0.0:0.8161:0.1839	.	7	Q8N957	ANKF1_HUMAN	K	7	ENSP00000321627:R7K	ENSP00000321627:R7K	R	+	2	0	ANKFN1	51585889	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.118000	0.50414	1.434000	0.47414	0.655000	0.94253	AGG		0.488	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228	Missense_Mutation	11	112	0	0	0	0	11	112				
TRIM37	4591	broad.mit.edu	37	17	57181722	57181722	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr17:57181722T>C	ENST00000262294.7	-	2	314	c.55A>G	c.(55-57)Atg>Gtg	p.M19V	TRIM37_ENST00000393066.3_Missense_Mutation_p.M19V|TRIM37_ENST00000393065.2_Intron|TRIM37_ENST00000376149.3_5'UTR|AC099850.1_ENST00000451775.1_RNA|TRIM37_ENST00000584889.1_Missense_Mutation_p.M19V	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	19					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					AATTTCTCCATACAAATGAAA	0.408									Mulibrey Nanism																													uc002iwy.3		NA																	0				lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7						c.(55-57)ATG>GTG		tripartite motif-containing 37 protein							91.0	81.0	84.0					17																	57181722		2203	4300	6503	SO:0001583	missense	4591	Mulibrey_Nanism	Familial Cancer Database	Perheentupa syndrome		perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding	g.chr17:57181722T>C	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.55A>G	17.37:g.57181722T>C	ENSP00000262294:p.Met19Val		Somatic				TRIM37_uc002iwz.3_Missense_Mutation_p.M19V|TRIM37_uc002ixa.3_5'UTR|TRIM37_uc010woc.1_Intron|uc002ixb.2_5'Flank	p.M19V	NM_001005207	NP_001005207	WXS	Illumina HiSeq	Unspecified	O94972	TRI37_HUMAN			2	499	-	Medulloblastoma(34;0.0922)|all_neural(34;0.101)		19			RING-type; degenerate.		Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	ENST00000262294.7	37	c.55A>G	CCDS32694.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.505239	0.85282	.	.	ENSG00000108395	ENST00000393066;ENST00000262294	T;T	0.17054	2.3;2.3	5.26	5.26	0.73747	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.000000	0.85682	D	0.000000	T	0.43255	0.1239	M	0.88450	2.955	0.80722	D	1	P	0.47106	0.89	P	0.55713	0.782	T	0.51411	-0.8709	10	0.72032	D	0.01	-18.9731	14.4948	0.67680	0.0:0.0:0.0:1.0	.	19	O94972	TRI37_HUMAN	V	19	ENSP00000376785:M19V;ENSP00000262294:M19V	ENSP00000262294:M19V	M	-	1	0	TRIM37	54536504	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.634000	0.83273	2.113000	0.64589	0.524000	0.50904	ATG		0.408	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445930.1	NM_015294		15	92	0	0	0	0	15	92				
MED13	9969	broad.mit.edu	37	17	60050211	60050211	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr17:60050211G>A	ENST00000397786.2	-	17	3920	c.3844C>T	c.(3844-3846)Ctc>Ttc	p.L1282F		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1282					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AGAGAGAGGAGCATTCGAAGT	0.373																																						uc002izo.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(3844-3846)CTC>TTC		mediator complex subunit 13							205.0	198.0	200.0					17																	60050211		1870	4109	5979	SO:0001583	missense	9969				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:60050211G>A	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.3844C>T	17.37:g.60050211G>A	ENSP00000380888:p.Leu1282Phe		Somatic					p.L1282F	NM_005121	NP_005112	WXS	Illumina HiSeq	Unspecified	Q9UHV7	MED13_HUMAN			17	3921	-			1282			LXXLL motif 2.		B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	37	c.3844C>T	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	G	33	5.219228	0.95139	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.60548	0.18	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.77772	0.4180	M	0.74881	2.28	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.78868	-0.2034	10	0.87932	D	0	-1.324	20.099	0.97865	0.0:0.0:1.0:0.0	.	1282	Q9UHV7	MED13_HUMAN	F	1282;1281	ENSP00000380888:L1282F	ENSP00000262436:L1281F	L	-	1	0	MED13	57404993	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.752000	0.94435	0.655000	0.94253	CTC		0.373	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121		60	249	0	0	0	0	60	249				
TLK2	11011	broad.mit.edu	37	17	60678092	60678092	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr17:60678092A>G	ENST00000326270.9	+	19	1965	c.1697A>G	c.(1696-1698)gAg>gGg	p.E566G	TLK2_ENST00000346027.5_Missense_Mutation_p.E544G|TLK2_ENST00000343388.7_Missense_Mutation_p.E512G|TLK2_ENST00000542523.1_Missense_Mutation_p.E512G|TLK2_ENST00000582809.1_Missense_Mutation_p.E395G	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	566	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						TCGGAGAAAGAGGCCCGGTCC	0.368																																						uc010ddp.2		NA																	0				stomach(1)|kidney(1)	2						c.(1696-1698)GAG>GGG		tousled-like kinase 2 isoform A							86.0	79.0	81.0					17																	60678092		2203	4300	6503	SO:0001583	missense	11011				cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr17:60678092A>G	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.1697A>G	17.37:g.60678092A>G	ENSP00000316512:p.Glu566Gly		Somatic				TLK2_uc002izx.3_Missense_Mutation_p.E392G|TLK2_uc002izz.3_Missense_Mutation_p.E544G|TLK2_uc002jaa.3_Missense_Mutation_p.E512G|TLK2_uc010wpd.1_Missense_Mutation_p.E512G	p.E566G	NM_006852	NP_006843	WXS	Illumina HiSeq	Unspecified	Q86UE8	TLK2_HUMAN			19	1965	+			566			Protein kinase.		D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	37	c.1697A>G		.	.	.	.	.	.	.	.	.	.	A	15.24	2.773703	0.49786	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.6	5.6	0.85130	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80732	0.4679	M	0.72479	2.2	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.81914	0.995;0.994;0.986;0.995	T	0.83035	-0.0160	10	0.87932	D	0	.	14.9604	0.71153	1.0:0.0:0.0:0.0	.	566;512;544;544	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	G	544;512;566;512	ENSP00000275780:E544G;ENSP00000340800:E512G;ENSP00000316512:E566G;ENSP00000442311:E512G	ENSP00000316512:E566G	E	+	2	0	TLK2	58031824	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.287000	0.95975	2.129000	0.65627	0.383000	0.25322	GAG		0.368	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852		19	97	0	0	0	0	19	97				
ABCA10	10349	broad.mit.edu	37	17	67197795	67197795	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr17:67197795C>T	ENST00000269081.4	-	11	1930	c.1021G>A	c.(1021-1023)Ggg>Agg	p.G341R	ABCA10_ENST00000416101.2_Missense_Mutation_p.G341R|ABCA10_ENST00000432313.2_Missense_Mutation_p.G341R	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	341					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					GGAGAATCCCCATGGCCATCT	0.313																																						uc010dfa.1		NA																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(1021-1023)GGG>AGG		ATP-binding cassette, sub-family A, member 10							44.0	47.0	46.0					17																	67197795		2201	4296	6497	SO:0001583	missense	10349				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:67197795C>T	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.1021G>A	17.37:g.67197795C>T	ENSP00000269081:p.Gly341Arg		Somatic				ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_5'UTR|ABCA10_uc010dfc.1_Intron	p.G341R	NM_080282	NP_525021	WXS	Illumina HiSeq	Unspecified	Q8WWZ4	ABCAA_HUMAN			11	1900	-	Breast(10;6.95e-12)		341					C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	37	c.1021G>A	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.880204	0.00537	.	.	ENSG00000154263	ENST00000269081;ENST00000416101;ENST00000432313	D;D;T	0.85702	-2.02;-1.71;-1.37	2.78	-2.88	0.05682	.	0.645821	0.11148	N	0.594513	T	0.45756	0.1358	N	0.00504	-1.425	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.54153	-0.8336	10	0.02654	T	1	.	0.9327	0.01338	0.1877:0.1507:0.3657:0.2958	.	341	Q8WWZ4	ABCAA_HUMAN	R	341	ENSP00000269081:G341R;ENSP00000407772:G341R;ENSP00000387674:G341R	ENSP00000269081:G341R	G	-	1	0	ABCA10	64709390	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.303000	0.19210	-0.358000	0.08162	-0.447000	0.05616	GGG		0.313	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282		6	75	0	0	0	0	6	75				
RFNG	5986	broad.mit.edu	37	17	80006664	80006664	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr17:80006664G>A	ENST00000310496.4	-	8	941	c.934C>T	c.(934-936)Ctt>Ttt	p.L312F	RFNG_ENST00000429557.3_Missense_Mutation_p.L186F|RFNG_ENST00000584838.1_5'UTR	NM_002917.1	NP_002908.1	Q9Y644	RFNG_HUMAN	RFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	312					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|pattern specification process (GO:0007389)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			GGGTACAGAAGACAATGGATA	0.652																																						uc002kdj.2		NA																	0				central_nervous_system(1)	1						c.(934-936)CTT>TTT		radical fringe							72.0	68.0	69.0					17																	80006664		2202	4300	6502	SO:0001583	missense	5986				cell differentiation|nervous system development|organ morphogenesis|pattern specification process	extracellular region|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity	g.chr17:80006664G>A	BC069034	CCDS32773.1	17q25.3	2013-02-19	2006-11-13		ENSG00000169733	ENSG00000169733	2.4.1.222	"""Beta 3-glycosyltransferases"""	9974	protein-coding gene	gene with protein product		602578	"""radical fringe (Drosophila) homolog"", ""radical fringe homolog (Drosophila)"""			9187150	Standard	NM_002917		Approved		uc002kdj.3	Q9Y644	OTTHUMG00000178512	ENST00000310496.4:c.934C>T	17.37:g.80006664G>A	ENSP00000307971:p.Leu312Phe		Somatic				RFNG_uc002kdh.2_Missense_Mutation_p.L97F	p.L312F	NM_002917	NP_002908	WXS	Illumina HiSeq	Unspecified	Q9Y644	RFNG_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)		8	942	-	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		312			Lumenal (Potential).		O00588	Missense_Mutation	SNP	ENST00000310496.4	37	c.934C>T	CCDS32773.1	.	.	.	.	.	.	.	.	.	.	g	15.18	2.757566	0.49468	.	.	ENSG00000169733	ENST00000310496;ENST00000429557	T	0.61158	0.13	3.1	3.1	0.35709	.	0.212379	0.31884	U	0.006907	T	0.64034	0.2562	L	0.45698	1.435	0.36918	D	0.891252	D	0.76494	0.999	D	0.65233	0.933	T	0.64546	-0.6382	10	0.18276	T	0.48	-11.56	13.6558	0.62338	0.0:0.0:1.0:0.0	.	312	Q9Y644	RFNG_HUMAN	F	312;271	ENSP00000307971:L312F	ENSP00000307971:L312F	L	-	1	0	RFNG	77599953	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	4.698000	0.61789	1.728000	0.51552	0.461000	0.40582	CTT		0.652	RFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442263.1	NM_002917		7	81	0	0	0	0	7	81				
CDH19	28513	broad.mit.edu	37	18	64239419	64239419	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr18:64239419C>T	ENST00000540086.1	-	2	269	c.23G>A	c.(22-24)cGt>cAt	p.R8H	CDH19_ENST00000262150.2_Missense_Mutation_p.R8H	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	0					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				CAACATAAAACGCAGCAGTAA	0.398																																						uc002lkc.1		NA																	0				ovary(1)|skin(1)	2						c.(22-24)CGT>CAT		cadherin 19, type 2 preproprotein							88.0	82.0	84.0					18																	64239419		2203	4300	6503	SO:0001583	missense	28513				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:64239419C>T	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.23G>A	18.37:g.64239419C>T	ENSP00000439593:p.Arg8His		Somatic				CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_Missense_Mutation_p.R8H|CDH19_uc002lkd.2_Missense_Mutation_p.R8H	p.R8H	NM_021153	NP_066976	WXS	Illumina HiSeq	Unspecified	Q9H159	CAD19_HUMAN			2	161	-		Esophageal squamous(42;0.0132)	8					O15098	Missense_Mutation	SNP	ENST00000540086.1	37	c.23G>A	CCDS59325.1	.	.	.	.	.	.	.	.	.	.	C	9.472	1.095986	0.20552	.	.	ENSG00000071991	ENST00000262150;ENST00000540086	T;T	0.56103	0.48;0.5	5.85	-2.94	0.05581	.	2.735250	0.00958	N	0.003060	T	0.18676	0.0448	N	0.00926	-1.1	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.10042	-1.0647	10	0.15066	T	0.55	.	1.5831	0.02638	0.2574:0.1683:0.3914:0.1829	.	8;8	F5H1K0;Q9H159	.;CAD19_HUMAN	H	8	ENSP00000262150:R8H;ENSP00000439593:R8H	ENSP00000262150:R8H	R	-	2	0	CDH19	62390399	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-1.365000	0.02587	-0.389000	0.07786	-1.018000	0.02450	CGT		0.398	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000442285.1	NM_021153		4	99	0	0	0	0	4	99				
ZNF791	163049	broad.mit.edu	37	19	12734621	12734621	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr19:12734621C>G	ENST00000343325.4	+	2	273	c.111C>G	c.(109-111)ttC>ttG	p.F37L	ZNF791_ENST00000540038.1_Intron|ZNF490_ENST00000465656.1_Intron|ZNF791_ENST00000458122.3_Missense_Mutation_p.F5L|ZNF791_ENST00000446165.1_Missense_Mutation_p.F37L	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	37	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						AGGAAACATTCAAGAACCTGG	0.443																																						uc002mua.2		NA																	0				ovary(2)	2						c.(109-111)TTC>TTG		zinc finger protein 791							67.0	68.0	68.0					19																	12734621		2203	4300	6503	SO:0001583	missense	163049				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12734621C>G	AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.111C>G	19.37:g.12734621C>G	ENSP00000342974:p.Phe37Leu		Somatic				ZNF791_uc010xml.1_Missense_Mutation_p.F5L|ZNF791_uc010dyu.1_5'UTR|ZNF791_uc010xmm.1_Intron	p.F37L	NM_153358	NP_699189	WXS	Illumina HiSeq	Unspecified	Q3KP31	ZN791_HUMAN			2	273	+			37			KRAB.		B7Z586|Q8NC99	Missense_Mutation	SNP	ENST00000343325.4	37	c.111C>G	CCDS12273.1	.	.	.	.	.	.	.	.	.	.	C	8.542	0.873552	0.17322	.	.	ENSG00000173875	ENST00000446165;ENST00000343325;ENST00000393303;ENST00000458122	T;T;T	0.05855	4.57;4.57;3.38	1.06	-2.13	0.07144	Krueppel-associated box (4);	.	.	.	.	T	0.04003	0.0112	L	0.31420	0.93	0.28512	N	0.9135	B	0.11235	0.004	B	0.12156	0.007	T	0.42531	-0.9446	9	0.29301	T	0.29	.	3.0833	0.06270	0.26:0.3656:0.3744:0.0	.	37	Q3KP31	ZN791_HUMAN	L	37;37;37;5	ENSP00000412981:F37L;ENSP00000342974:F37L;ENSP00000441761:F5L	ENSP00000342974:F37L	F	+	3	2	ZNF791	12595621	0.000000	0.05858	0.368000	0.25939	0.900000	0.52787	-0.922000	0.04004	-0.709000	0.05008	0.313000	0.20887	TTC		0.443	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344140.1	NM_153358		16	108	0	0	0	0	16	108				
CPAMD8	27151	broad.mit.edu	37	19	17038893	17038893	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr19:17038893T>C	ENST00000443236.1	-	25	3468	c.3437A>G	c.(3436-3438)tAc>tGc	p.Y1146C		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1099						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GGCCTCGCTGTAGCTCTCGTC	0.637																																						uc002nfb.2		NA																	0				ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						c.(3436-3438)TAC>TGC		C3 and PZP-like, alpha-2-macroglobulin domain							52.0	62.0	59.0					19																	17038893		1986	4162	6148	SO:0001583	missense	27151					extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity	g.chr19:17038893T>C	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3437A>G	19.37:g.17038893T>C	ENSP00000402505:p.Tyr1146Cys		Somatic					p.Y1146C	NM_015692	NP_056507	WXS	Illumina HiSeq	Unspecified	Q8IZJ3	CPMD8_HUMAN			25	3469	-			1099					Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	c.3437A>G	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.25|16.25	3.069896|3.069896	0.55539|0.55539	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	.|.	.|.	.|.	3.02|3.02	3.02|3.02	0.34903|0.34903	.|.	.|0.087674	.|0.44483	.|U	.|0.000448	T|T	0.48187|0.48187	0.1486|0.1486	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|D	.|0.63880	.|0.993	.|P	.|0.49999	.|0.628	T|T	0.50136|0.50136	-0.8863|-0.8863	5|9	.|0.59425	.|D	.|0.04	.|.	11.1866|11.1866	0.48660|0.48660	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1099	.|Q8IZJ3	.|CPMD8_HUMAN	A|C	1157|1146	.|.	.|ENSP00000291440:Y1146C	T|Y	-|-	1|2	0|0	CPAMD8|CPAMD8	16899893|16899893	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.466000|0.466000	0.32739|0.32739	6.648000|6.648000	0.74359|0.74359	1.021000|1.021000	0.39600|0.39600	0.533000|0.533000	0.62120|0.62120	ACA|TAC		0.637	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692		4	91	0	0	0	0	4	91				
ZNF208	7757	broad.mit.edu	37	19	22155688	22155688	+	Silent	SNP	A	A	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr19:22155688A>T	ENST00000397126.4	-	4	2296	c.2148T>A	c.(2146-2148)acT>acA	p.T716T	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	716					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GTTTCTCTCCAGTATGAATTC	0.373																																						uc002nqp.2		NA																	0				ovary(5)|skin(2)	7						c.(1846-1848)ACT>ACA		zinc finger protein 208							37.0	39.0	38.0					19																	22155688		2009	4178	6187	SO:0001819	synonymous_variant	7757							g.chr19:22155688A>T	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2148T>A	19.37:g.22155688A>T			Somatic				ZNF208_uc002nqo.1_Intron	p.T616T	NM_007153	NP_009084	WXS	Illumina HiSeq	Unspecified					5	1997	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Silent	SNP	ENST00000397126.4	37	c.1848T>A	CCDS54240.1																																																																																				0.373	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		12	111	0	0	0	0	12	111				
ZNF181	339318	broad.mit.edu	37	19	35231761	35231761	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr19:35231761A>G	ENST00000492450.1	+	4	564	c.475A>G	c.(475-477)Ata>Gta	p.I159V	ZNF181_ENST00000459757.2_Missense_Mutation_p.I158V|ZNF181_ENST00000392232.3_Missense_Mutation_p.I203V			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			CAAATACAATATATTTAGAAG	0.373																																						uc002nvu.3		NA																	0				ovary(1)	1						c.(475-477)ATA>GTA		zinc finger protein 181 isoform 1							45.0	49.0	48.0					19																	35231761		2203	4294	6497	SO:0001583	missense	339318				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:35231761A>G	BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.475A>G	19.37:g.35231761A>G	ENSP00000420727:p.Ile159Val		Somatic				ZNF181_uc010xsa.1_Missense_Mutation_p.I158V|ZNF181_uc010xsb.1_Missense_Mutation_p.I158V|ZNF181_uc010xsc.1_Missense_Mutation_p.I94V	p.I159V	NM_001029997	NP_001025168	WXS	Illumina HiSeq	Unspecified	Q2M3W8	ZN181_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.138)		4	938	+	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		159					B7ZKX3|Q49A75	Missense_Mutation	SNP	ENST00000492450.1	37	c.475A>G	CCDS32990.2	.	.	.	.	.	.	.	.	.	.	A	0.016	-1.523444	0.00959	.	.	ENSG00000197841	ENST00000392232;ENST00000425140;ENST00000492450;ENST00000459757	T;T;T	0.05855	3.38;3.47;3.44	2.73	1.7	0.24286	.	.	.	.	.	T	0.05135	0.0137	L	0.29908	0.895	0.09310	N	1	B;B	0.15141	0.002;0.012	B;B	0.06405	0.002;0.002	T	0.36432	-0.9748	9	0.52906	T	0.07	.	6.3274	0.21251	0.8682:0.0:0.1318:0.0	.	158;159	B7ZKX3;Q2M3W8	.;ZN181_HUMAN	V	203;158;159;158	ENSP00000376065:I203V;ENSP00000420727:I159V;ENSP00000419435:I158V	ENSP00000376065:I203V	I	+	1	0	ZNF181	39923601	0.009000	0.17119	0.002000	0.10522	0.014000	0.08584	1.753000	0.38359	0.488000	0.27723	0.391000	0.25812	ATA		0.373	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349005.3	NM_001029997		23	104	0	0	0	0	23	104				
SERTAD1	29950	broad.mit.edu	37	19	40928872	40928872	+	Silent	SNP	G	G	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr19:40928872G>C	ENST00000357949.4	-	2	740	c.582C>G	c.(580-582)ctC>ctG	p.L194L		NM_013376.3	NP_037508.2	Q9UHV2	SRTD1_HUMAN	SERTA domain containing 1	194					positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription, DNA-templated (GO:0006351)					endometrium(2)|lung(1)|prostate(1)|skin(1)	5			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGCCTGGTTTGAGGCCCTCAG	0.582																																						uc002ont.3		NA																	0					0						c.(580-582)CTC>CTG		SERTA domain containing 1							24.0	21.0	22.0					19																	40928872		2203	4300	6503	SO:0001819	synonymous_variant	29950				positive regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent			g.chr19:40928872G>C	AF117959	CCDS12557.1	19q13.1-q13.2	2008-02-05				ENSG00000197019			17932	protein-coding gene	gene with protein product	"""CDK4-binding protein p34SEI"", ""transcriptional regulator interacting with the PHD-bromodomain 1"""					6434876, 10580009	Standard	NM_013376		Approved	SEI1, TRIP-Br1	uc002ont.4	Q9UHV2		ENST00000357949.4:c.582C>G	19.37:g.40928872G>C			Somatic					p.L194L	NM_013376	NP_037508	WXS	Illumina HiSeq	Unspecified	Q9UHV2	SRTD1_HUMAN	Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		2	741	-			194					Q9BUE7	Silent	SNP	ENST00000357949.4	37	c.582C>G	CCDS12557.1																																																																																				0.582	SERTAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462571.1	NM_013376		6	26	0	0	0	0	6	26				
CLASRP	11129	broad.mit.edu	37	19	45561107	45561107	+	Silent	SNP	G	G	A	rs143800882	byFrequency	TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr19:45561107G>A	ENST00000221455.3	+	7	662	c.564G>A	c.(562-564)gcG>gcA	p.A188A	CLASRP_ENST00000544944.2_Silent_p.A188A|CLASRP_ENST00000391953.4_Silent_p.A126A	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	188					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						AGGAGTCAGCGGCCGAGGAGG	0.612													g|||	6	0.00119808	0.0045	0.0	5008	,	,		18248	0.0		0.0	False		,,,				2504	0.0					uc002pak.2		NA																	0					0						c.(562-564)GCG>GCA		splicing factor, arginine/serine-rich 16		A		19,4387	26.2+/-53.5	0,19,2184	177.0	123.0	142.0		564	-9.9	0.1	19	dbSNP_134	142	0,8600		0,0,4300	no	coding-synonymous	CLASRP	NM_007056.2		0,19,6484	AA,AG,GG		0.0,0.4312,0.1461		188/675	45561107	19,12987	2203	4300	6503	SO:0001819	synonymous_variant	11129				mRNA processing|RNA splicing	nucleus		g.chr19:45561107G>A	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.564G>A	19.37:g.45561107G>A			Somatic				SFRS16_uc002pal.2_RNA|SFRS16_uc010xxh.1_Silent_p.A126A|SFRS16_uc002pam.2_Silent_p.A188A|SFRS16_uc002pan.1_RNA	p.A188A	NM_007056	NP_008987	WXS	Illumina HiSeq	Unspecified	Q8N2M8	CLASR_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0102)	7	662	+		Ovarian(192;0.0728)|all_neural(266;0.112)	188					B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Silent	SNP	ENST00000221455.3	37	c.564G>A	CCDS12652.2																																																																																				0.612	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056		12	95	0	0	0	0	12	95				
VASP	7408	broad.mit.edu	37	19	46032622	46032622	+	IGR	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr19:46032622G>A	ENST00000245932.6	+	0	2305				OPA3_ENST00000323060.3_Silent_p.L79L	NM_003370.3	NP_003361.1	P50552	VASP_HUMAN	vasodilator-stimulated phosphoprotein						actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|neural tube closure (GO:0001843)|positive regulation of actin filament polymerization (GO:0030838)|protein homotetramerization (GO:0051289)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	profilin binding (GO:0005522)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)	18		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)		TCCGCGCCCAGCTCGGCGGCT	0.627																																						uc002pcj.3		NA																	0					0						c.(235-237)CTG>TTG		OPA3 protein isoform a							76.0	81.0	79.0					19																	46032622		2201	4299	6500	SO:0001628	intergenic_variant	80207				response to stimulus|visual perception	mitochondrion		g.chr19:46032622G>A		CCDS33051.1	19q13.32	2012-02-22			ENSG00000125753	ENSG00000125753			12652	protein-coding gene	gene with protein product		601703				8812448	Standard	XM_005259199		Approved		uc002pcg.3	P50552			19.37:g.46032622G>A			Somatic					p.L79L	NM_001017989	NP_001017989	WXS	Illumina HiSeq	Unspecified	Q9H6K4	OPA3_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00778)|GBM - Glioblastoma multiforme(486;0.0976)|Epithelial(262;0.242)	2	335	-		Ovarian(192;0.051)|all_neural(266;0.112)	79					B2RBT9|Q6PIZ1|Q93035	Silent	SNP	ENST00000245932.6	37	c.235C>T	CCDS33051.1																																																																																				0.627	VASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459589.1			10	82	0	0	0	0	10	82				
IGFL2	147920	broad.mit.edu	37	19	46664118	46664118	+	Silent	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr19:46664118C>T	ENST00000377693.4	+	3	357	c.321C>T	c.(319-321)ccC>ccT	p.P107P	IGFL2_ENST00000434646.2_Silent_p.P118P|IGFL2_ENST00000600243.1_3'UTR|AC007193.6_ENST00000597989.1_lincRNA	NM_001135113.1	NP_001128585.1	Q6UWQ7	IGFL2_HUMAN	IGF-like family member 2	107						extracellular region (GO:0005576)				cervix(1)|lung(5)	6		Ovarian(192;0.0908)|all_neural(266;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(486;0.031)|Epithelial(262;0.247)		ACTCATCTCCCATCTCCAGTA	0.532																																						uc010xxv.1		NA																	0					0						c.(319-321)CCC>CCT		IGF-like family member 2 isoform b							70.0	72.0	71.0					19																	46664118		2100	4240	6340	SO:0001819	synonymous_variant	147920					extracellular region	protein binding	g.chr19:46664118C>T	AY672112	CCDS46121.1, CCDS46122.1	19q13.32	2006-07-14							32929	protein-coding gene	gene with protein product		610545				14702039	Standard	NM_001002915		Approved	UNQ645	uc010xxv.2	Q6UWQ7		ENST00000377693.4:c.321C>T	19.37:g.46664118C>T			Somatic				IGFL2_uc002peb.2_Silent_p.P118P	p.P107P	NM_001135113	NP_001128585	WXS	Illumina HiSeq	Unspecified	Q6UWQ7	IGFL2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(486;0.031)|Epithelial(262;0.247)	3	357	+		Ovarian(192;0.0908)|all_neural(266;0.113)	107					E9PAV1|Q6B9Z3	Silent	SNP	ENST00000377693.4	37	c.321C>T	CCDS46121.1																																																																																				0.532	IGFL2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000461705.1	NM_001002915		5	129	0	0	0	0	5	129				
DHX34	9704	broad.mit.edu	37	19	47865870	47865870	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr19:47865870G>A	ENST00000328771.4	+	6	1862	c.1513G>A	c.(1513-1515)Gcc>Acc	p.A505T	DHX34_ENST00000471451.1_Intron	NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	505	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CCGCCTCTATGCCGAATCGGA	0.657																																						uc010xyn.1		NA																	0				ovary(4)|upper_aerodigestive_tract(1)	5						c.(1513-1515)GCC>ACC		DEAH (Asp-Glu-Ala-His) box polypeptide 34							26.0	27.0	27.0					19																	47865870		2203	4300	6503	SO:0001583	missense	9704					intracellular	ATP binding|ATP-dependent helicase activity|RNA binding|zinc ion binding	g.chr19:47865870G>A	D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.1513G>A	19.37:g.47865870G>A	ENSP00000331907:p.Ala505Thr		Somatic				DHX34_uc010elc.1_Missense_Mutation_p.A420T	p.A505T	NM_014681	NP_055496	WXS	Illumina HiSeq	Unspecified	Q14147	DHX34_HUMAN		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)	6	1854	+		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)	505			Helicase C-terminal.		B4DMY8	Missense_Mutation	SNP	ENST00000328771.4	37	c.1513G>A	CCDS12700.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.704766	0.30232	.	.	ENSG00000134815	ENST00000328771;ENST00000257252	T	0.02197	4.4	5.6	5.6	0.85130	Helicase, C-terminal (1);	0.000000	0.64402	D	0.000007	T	0.00845	0.0028	N	0.00471	-1.455	0.54753	D	0.999982	B	0.32350	0.366	B	0.23574	0.047	T	0.56535	-0.7963	10	0.02654	T	1	-19.8985	18.362	0.90377	0.0:0.0:1.0:0.0	.	505	Q14147	DHX34_HUMAN	T	505;420	ENSP00000331907:A505T	ENSP00000257252:A420T	A	+	1	0	DHX34	52557714	1.000000	0.71417	0.627000	0.29227	0.531000	0.34715	4.195000	0.58400	2.637000	0.89404	0.561000	0.74099	GCC		0.657	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681		9	51	0	0	0	0	9	51				
SLC4A1AP	22950	broad.mit.edu	37	2	27890212	27890212	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr2:27890212A>G	ENST00000326019.6	+	3	1381	c.1099A>G	c.(1099-1101)Ata>Gta	p.I367V		NM_018158.2	NP_060628.2	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger), member 1, adaptor protein	367						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.155)					GGCCTTTTATATAAAGGATCC	0.418																																						uc002rlk.3		NA																	0					0						c.(1099-1101)ATA>GTA		solute carrier family 4 (anion exchanger),							76.0	78.0	77.0					2																	27890212		2203	4300	6503	SO:0001583	missense	22950					cytoplasm|nucleus	double-stranded RNA binding|protein binding	g.chr2:27890212A>G		CCDS33166.1	2p23.3	2010-03-11	2001-11-28		ENSG00000163798	ENSG00000163798			13813	protein-coding gene	gene with protein product	"""lung cancer oncogene 3"""	602655	"""solute carrier family 4 (anion exchanger), member 1, adapter protein"""			9422766	Standard	NM_018158		Approved	kanadaptin, HLC3	uc002rlk.4	Q9BWU0	OTTHUMG00000151944	ENST00000326019.6:c.1099A>G	2.37:g.27890212A>G	ENSP00000323837:p.Ile367Val		Somatic					p.I367V	NM_018158	NP_060628	WXS	Illumina HiSeq	Unspecified	Q9BWU0	NADAP_HUMAN			3	1381	+	Acute lymphoblastic leukemia(172;0.155)		367					A6NJ39|Q4KMT1|Q4KMX0|Q7Z5Q9|Q9NVN2	Missense_Mutation	SNP	ENST00000326019.6	37	c.1099A>G	CCDS33166.1	.	.	.	.	.	.	.	.	.	.	A	11.34	1.608785	0.28623	.	.	ENSG00000163798	ENST00000326019	T	0.29917	1.55	5.27	5.27	0.74061	.	0.105498	0.64402	D	0.000003	T	0.22820	0.0551	L	0.43152	1.355	0.30834	N	0.73635	B	0.24823	0.112	B	0.24394	0.053	T	0.18871	-1.0323	10	0.10636	T	0.68	-17.3704	9.323	0.37975	0.7229:0.0:0.0:0.2771	.	367	Q9BWU0	NADAP_HUMAN	V	367	ENSP00000323837:I367V	ENSP00000323837:I367V	I	+	1	0	SLC4A1AP	27743716	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.818000	0.48041	1.979000	0.57680	0.533000	0.62120	ATA		0.418	SLC4A1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324550.1	NM_018158		26	123	0	0	0	0	26	123				
SLC8A1	6546	broad.mit.edu	37	2	40656013	40656013	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr2:40656013C>T	ENST00000403092.1	-	2	1441	c.1408G>A	c.(1408-1410)Gat>Aat	p.D470N	SLC8A1_ENST00000402441.1_Missense_Mutation_p.D470N|SLC8A1_ENST00000542024.1_Missense_Mutation_p.D470N|SLC8A1_ENST00000405269.1_Missense_Mutation_p.D470N|SLC8A1_ENST00000406785.2_Missense_Mutation_p.D470N|SLC8A1_ENST00000408028.2_Missense_Mutation_p.D470N|SLC8A1_ENST00000332839.4_Missense_Mutation_p.D470N|SLC8A1_ENST00000406391.2_Missense_Mutation_p.D470N|SLC8A1_ENST00000542756.1_Missense_Mutation_p.D470N|SLC8A1_ENST00000405901.3_Missense_Mutation_p.D470N			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	470	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TTCTGGGTATCACCAGGCTTA	0.408																																						uc002rrx.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(1408-1410)GAT>AAT		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						79.0	71.0	74.0					2																	40656013		2203	4300	6503	SO:0001583	missense	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40656013C>T		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1408G>A	2.37:g.40656013C>T	ENSP00000384763:p.Asp470Asn		Somatic				SLC8A1_uc002rry.2_Missense_Mutation_p.D470N|SLC8A1_uc002rrz.2_Missense_Mutation_p.D470N|SLC8A1_uc002rsa.2_Missense_Mutation_p.D470N|SLC8A1_uc002rsd.3_Missense_Mutation_p.D470N|SLC8A1_uc002rsb.1_Missense_Mutation_p.D470N|SLC8A1_uc010fan.1_Missense_Mutation_p.D470N|SLC8A1_uc002rsc.1_Missense_Mutation_p.D470N	p.D470N	NM_021097	NP_066920	WXS	Illumina HiSeq	Unspecified	P32418	NAC1_HUMAN			1	1432	-			470			Calx-beta 1.|Cytoplasmic (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	c.1408G>A	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.094563	0.56075	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.26	6.17	6.17	0.99709	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.39436	0.1078	L	0.46947	1.48	0.33521	D	0.592408	B;B;B;B;B	0.27166	0.029;0.001;0.029;0.17;0.096	B;B;B;B;B	0.31442	0.06;0.003;0.06;0.13;0.099	T	0.50457	-0.8826	10	0.87932	D	0	.	18.3732	0.90420	0.0:1.0:0.0:0.0	.	470;470;470;470;470	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	N	470	ENSP00000383886:D470N;ENSP00000440727:D470N;ENSP00000384763:D470N;ENSP00000385678:D470N;ENSP00000385188:D470N;ENSP00000385535:D470N;ENSP00000332931:D470N;ENSP00000384908:D470N;ENSP00000385811:D470N;ENSP00000443515:D470N	ENSP00000332931:D470N	D	-	1	0	SLC8A1	40509517	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	7.663000	0.83820	2.941000	0.99782	0.655000	0.94253	GAT		0.408	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		12	106	0	0	0	0	12	106				
TUBA3D	113457	broad.mit.edu	37	2	132240222	132240222	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr2:132240222C>T	ENST00000321253.6	+	5	1261	c.1154C>T	c.(1153-1155)gCg>gTg	p.A385V	MZT2A_ENST00000410036.2_5'Flank	NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	385					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		ACGGCCATTGCGGAGGCCTGG	0.632																																					Ovarian(137;2059 2432 35543 39401)	uc002tsu.3		NA																	0					0						c.(1153-1155)GCG>GTG		tubulin, alpha 3d							71.0	70.0	71.0					2																	132240222		2203	4300	6503	SO:0001583	missense	113457				'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity	g.chr2:132240222C>T	K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.1154C>T	2.37:g.132240222C>T	ENSP00000326042:p.Ala385Val		Somatic					p.A385V	NM_080386	NP_525125	WXS	Illumina HiSeq	Unspecified	Q13748	TBA3C_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.13)	5	1261	+			385					A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	ENST00000321253.6	37	c.1154C>T	CCDS33290.1	.	.	.	.	.	.	.	.	.	.	c	10.04	1.240921	0.22711	.	.	ENSG00000075886	ENST00000321253;ENST00000341158	D	0.82081	-1.57	2.41	2.41	0.29592	Tubulin/FtsZ, 2-layer sandwich domain (2);Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.45606	U	0.000346	T	0.79221	0.4409	M	0.64630	1.985	0.45822	D	0.998691	B	0.26845	0.161	B	0.27500	0.08	T	0.79541	-0.1761	10	0.72032	D	0.01	.	10.5186	0.44905	0.0:1.0:0.0:0.0	.	385	Q13748	TBA3C_HUMAN	V	385	ENSP00000326042:A385V	ENSP00000326042:A385V	A	+	2	0	TUBA3D	131956692	1.000000	0.71417	0.312000	0.25196	0.496000	0.33645	7.008000	0.76341	1.334000	0.45468	0.194000	0.17425	GCG		0.632	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331800.2	NM_080386		18	116	0	0	0	0	18	116				
LRP1B	53353	broad.mit.edu	37	2	141027862	141027862	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr2:141027862T>C	ENST00000389484.3	-	86	14167	c.13196A>G	c.(13195-13197)tAc>tGc	p.Y4399C		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4399	EGF-like 22. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.Y4399F(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCCACCATTGTAACAGTAGCC	0.403										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	1	Substitution - Missense(1)		haematopoietic_and_lymphoid_tissue(1)	lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(13195-13197)TAC>TGC		low density lipoprotein-related protein 1B							121.0	106.0	111.0					2																	141027862		2203	4300	6503	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141027862T>C	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13196A>G	2.37:g.141027862T>C	ENSP00000374135:p.Tyr4399Cys	TSP Lung(27;0.18)	Somatic					p.Y4399C	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	86	14168	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4399			Extracellular (Potential).|EGF-like 14.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.13196A>G	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.2|20.2	3.943033|3.943033	0.73672|0.73672	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000437977;ENST00000442974|ENST00000389484;ENST00000544579	.|T	.|0.43294	.|0.95	5.73|5.73	5.73|5.73	0.89815|0.89815	.|Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.|0.000000	.|0.64402	.|U	.|0.000003	T|T	0.42471|0.42471	0.1204|0.1204	L|L	0.56769|0.56769	1.78|1.78	0.46279|0.46279	D|D	0.998961|0.998961	.|B	.|0.18461	.|0.028	.|B	.|0.15052	.|0.012	T|T	0.21655|0.21655	-1.0239|-1.0239	5|10	.|0.37606	.|T	.|0.19	.|.	16.3197|16.3197	0.82945|0.82945	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|4399	.|Q9NZR2	.|LRP1B_HUMAN	A|C	631;131|4399;4337	.|ENSP00000374135:Y4399C	.|ENSP00000374135:Y4399C	T|Y	-|-	1|2	0|0	LRP1B|LRP1B	140744332|140744332	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.498000|7.498000	0.81546|0.81546	2.302000|2.302000	0.77476|0.77476	0.533000|0.533000	0.62120|0.62120	ACA|TAC		0.403	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		12	132	0	0	0	0	12	132				
LRP1B	53353	broad.mit.edu	37	2	141571360	141571360	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr2:141571360T>A	ENST00000389484.3	-	32	6196	c.5225A>T	c.(5224-5226)tAt>tTt	p.Y1742F		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1742					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTTTTCCACATAGTCTATCGA	0.348										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(5224-5226)TAT>TTT		low density lipoprotein-related protein 1B							122.0	109.0	113.0					2																	141571360		2201	4300	6501	SO:0001583	missense	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141571360T>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5225A>T	2.37:g.141571360T>A	ENSP00000374135:p.Tyr1742Phe	TSP Lung(27;0.18)	Somatic					p.Y1742F	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	32	6197	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	1742			Extracellular (Potential).|LDL-receptor class B 16.		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	c.5225A>T	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	5.515	0.279946	0.10458	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91124	-2.79	5.71	5.71	0.89125	Six-bladed beta-propeller, TolB-like (1);	0.164731	0.41938	D	0.000793	T	0.82042	0.4951	N	0.12961	0.28	0.35510	D	0.800525	B	0.15141	0.012	B	0.15052	0.012	T	0.79482	-0.1785	10	0.11182	T	0.66	.	15.9781	0.80086	0.0:0.0:0.0:1.0	.	1742	Q9NZR2	LRP1B_HUMAN	F	1742;1680	ENSP00000374135:Y1742F	ENSP00000374135:Y1742F	Y	-	2	0	LRP1B	141287830	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.982000	0.56909	2.171000	0.68590	0.533000	0.62120	TAT		0.348	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		13	109	0	0	0	0	13	109				
ZC3H15	55854	broad.mit.edu	37	2	187364950	187364950	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr2:187364950C>G	ENST00000337859.6	+	3	446	c.219C>G	c.(217-219)gaC>gaG	p.D73E	ZC3H15_ENST00000468120.1_3'UTR|AC018867.1_ENST00000396985.1_Intron|ZC3H15_ENST00000544130.1_5'UTR	NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	73					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			AGAAGGATGACAAGAAGAAAG	0.308																																						uc002upo.2		NA																	0				skin(1)	1						c.(217-219)GAC>GAG		erythropoietin 4 immediate early response							95.0	94.0	94.0					2																	187364950		1814	4082	5896	SO:0001583	missense	55854					cytoplasm|nucleolus|plasma membrane	nucleic acid binding|zinc ion binding	g.chr2:187364950C>G		CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.219C>G	2.37:g.187364950C>G	ENSP00000338788:p.Asp73Glu		Somatic					p.D73E	NM_018471	NP_060941	WXS	Illumina HiSeq	Unspecified	Q8WU90	ZC3HF_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)		3	444	+			73			Potential.		B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Missense_Mutation	SNP	ENST00000337859.6	37	c.219C>G	CCDS42791.1	.	.	.	.	.	.	.	.	.	.	C	9.884	1.202394	0.22121	.	.	ENSG00000065548	ENST00000337859;ENST00000536434	T	0.63580	-0.05	6.06	-0.388	0.12459	.	0.000000	0.85682	D	0.000000	T	0.40522	0.1120	L	0.33710	1.025	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.14924	-1.0455	10	0.09338	T	0.73	-14.0568	7.0252	0.24936	0.0:0.3569:0.1221:0.5209	.	73	Q8WU90	ZC3HF_HUMAN	E	73	ENSP00000338788:D73E	ENSP00000338788:D73E	D	+	3	2	ZC3H15	187073195	0.971000	0.33674	0.995000	0.50966	0.994000	0.84299	0.170000	0.16663	-0.137000	0.11455	-0.142000	0.14014	GAC		0.308	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334547.2	NM_018471		6	51	0	0	0	0	6	51				
CASP8	841	broad.mit.edu	37	2	202149860	202149860	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr2:202149860C>G	ENST00000432109.2	+	9	1313	c.1124C>G	c.(1123-1125)tCa>tGa	p.S375*	CASP8_ENST00000323492.7_Nonsense_Mutation_p.S360*|CASP8_ENST00000264274.9_Nonsense_Mutation_p.S291*|CASP8_ENST00000392266.3_3'UTR|CASP8_ENST00000392259.2_3'UTR|CASP8_ENST00000264275.5_Nonsense_Mutation_p.S392*|CASP8_ENST00000358485.4_Nonsense_Mutation_p.S434*	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	375					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)	p.S392*(3)|p.S434*(1)		breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						GAGACTGATTCAGAGGAGCAA	0.448										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)	uc002uxr.1		NA																	4	Substitution - Nonsense(4)		lung(3)|upper_aerodigestive_tract(1)	upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						c.(1123-1125)TCA>TGA		caspase 8 isoform B precursor							84.0	83.0	83.0					2																	202149860		2203	4300	6503	SO:0001587	stop_gained	841				activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding	g.chr2:202149860C>G	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.1124C>G	2.37:g.202149860C>G	ENSP00000412523:p.Ser375*	HNSCC(4;0.00038)	Somatic				CASP8_uc002uxp.1_Nonsense_Mutation_p.S392*|CASP8_uc002uxq.1_Nonsense_Mutation_p.S360*|CASP8_uc002uxt.1_Nonsense_Mutation_p.S434*|CASP8_uc002uxu.1_RNA|CASP8_uc002uxw.1_Nonsense_Mutation_p.S360*|CASP8_uc002uxy.1_Intron|CASP8_uc002uxx.1_Intron|CASP8_uc010ftf.2_Nonsense_Mutation_p.S291*	p.S375*	NM_033355	NP_203519	WXS	Illumina HiSeq	Unspecified	Q14790	CASP8_HUMAN			9	1333	+			375					O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Nonsense_Mutation	SNP	ENST00000432109.2	37	c.1124C>G	CCDS2342.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165091	0.78339	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000432109;ENST00000264275;ENST00000358485;ENST00000323492;ENST00000444430	.	.	.	5.82	3.91	0.45181	.	2.877110	0.00986	N	0.003446	.	.	.	.	.	.	0.26681	N	0.971539	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	5.0776	0.14640	0.1501:0.6251:0.1454:0.0794	.	.	.	.	X	360;291;375;392;434;360;154	.	ENSP00000264274:S291X	S	+	2	0	CASP8	201858105	0.853000	0.29707	0.904000	0.35570	0.533000	0.34776	1.540000	0.36115	1.440000	0.47531	0.561000	0.74099	TCA		0.448	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228		25	112	0	0	0	0	25	112				
CNPPD1	27013	broad.mit.edu	37	2	220037648	220037648	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr2:220037648C>A	ENST00000409789.1	-	9	1320	c.893G>T	c.(892-894)tGc>tTc	p.C298F	SLC23A3_ENST00000396775.3_5'Flank|SLC23A3_ENST00000295738.7_5'Flank|SLC23A3_ENST00000455516.2_5'Flank|CNPPD1_ENST00000360507.5_Missense_Mutation_p.C298F|SLC23A3_ENST00000409878.3_5'Flank			Q9BV87	CNPD1_HUMAN	cyclin Pas1/PHO80 domain containing 1	298					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	integral component of membrane (GO:0016021)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	12						GCCTTCCAGGCAGCTGGAGAC	0.647																																						uc002vju.3		NA																	0					0						c.(892-894)TGC>TTC		hypothetical protein LOC27013							76.0	70.0	72.0					2																	220037648		2202	4300	6502	SO:0001583	missense	27013				regulation of cyclin-dependent protein kinase activity	integral to membrane	protein kinase binding	g.chr2:220037648C>A	AF070638	CCDS2433.1	2q36	2011-03-23	2011-03-23	2011-03-23	ENSG00000115649	ENSG00000115649			25220	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 24"""	C2orf24		8619474, 9110174	Standard	NM_015680		Approved	CGI-57	uc002vju.4	Q9BV87	OTTHUMG00000133132	ENST00000409789.1:c.893G>T	2.37:g.220037648C>A	ENSP00000386277:p.Cys298Phe		Somatic				NHEJ1_uc002vjq.3_5'Flank|SLC23A3_uc010zkr.1_5'Flank|SLC23A3_uc010zks.1_5'Flank|SLC23A3_uc010fwb.2_5'Flank|C2orf24_uc002vjv.2_Missense_Mutation_p.C298F	p.C298F	NM_015680	NP_056495	WXS	Illumina HiSeq	Unspecified	Q9BV87	CNPD1_HUMAN		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	8	1045	-		Renal(207;0.0915)	298					B2RC77|O75548|Q9H4N0|Q9UQN0	Missense_Mutation	SNP	ENST00000409789.1	37	c.893G>T	CCDS2433.1	.	.	.	.	.	.	.	.	.	.	C	6.158	0.397415	0.11638	.	.	ENSG00000115649	ENST00000360507;ENST00000409789;ENST00000453038	T;T;T	0.31247	2.41;2.41;1.5	5.03	3.05	0.35203	.	0.635090	0.17124	N	0.186086	T	0.20577	0.0495	L	0.27053	0.805	0.30791	N	0.740876	B	0.02656	0.0	B	0.01281	0.0	T	0.12319	-1.0552	10	0.62326	D	0.03	-23.6629	8.3669	0.32391	0.1587:0.7504:0.0:0.0909	.	298	Q9BV87	CNPD1_HUMAN	F	298	ENSP00000353698:C298F;ENSP00000386277:C298F;ENSP00000410109:C298F	ENSP00000353698:C298F	C	-	2	0	CNPPD1	219745892	0.103000	0.21917	0.995000	0.50966	0.391000	0.30476	0.771000	0.26633	1.315000	0.45114	0.655000	0.94253	TGC		0.647	CNPPD1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336220.1	NM_015680		17	127	1	0	2.39e-15	2.78e-15	17	127				
RBL1	5933	broad.mit.edu	37	20	35684633	35684633	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr20:35684633T>A	ENST00000373664.3	-	10	1345	c.1279A>T	c.(1279-1281)Att>Ttt	p.I427F	RBL1_ENST00000344359.3_Missense_Mutation_p.I427F	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	427	Domain A.|Pocket; binds T and E1A.				chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				ATTTTCATAATGTTTTCCACA	0.348																																						uc002xgi.2		NA																	0				lung(5)|skin(3)|ovary(2)	10						c.(1279-1281)ATT>TTT		retinoblastoma-like protein 1 isoform a							134.0	112.0	119.0					20																	35684633		2202	4300	6502	SO:0001583	missense	5933				cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding	g.chr20:35684633T>A	L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.1279A>T	20.37:g.35684633T>A	ENSP00000362768:p.Ile427Phe		Somatic				RBL1_uc010zvt.1_RNA|RBL1_uc002xgj.1_Missense_Mutation_p.I427F|RBL1_uc010gfv.1_RNA	p.I427F	NM_002895	NP_002886	WXS	Illumina HiSeq	Unspecified	P28749	RBL1_HUMAN			10	1358	-		Myeloproliferative disorder(115;0.00878)	427			Domain A.|Pocket; binds T and E1A.		A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Missense_Mutation	SNP	ENST00000373664.3	37	c.1279A>T	CCDS13289.1	.	.	.	.	.	.	.	.	.	.	T	14.72	2.620335	0.46736	.	.	ENSG00000080839	ENST00000373664;ENST00000344359	D;D	0.90788	-2.73;-2.73	4.64	4.64	0.57946	Retinoblastoma-associated protein, A-box (1);Cyclin-like (2);	0.106321	0.64402	D	0.000009	D	0.95490	0.8535	M	0.88640	2.97	0.58432	D	0.999999	D;D	0.76494	0.999;0.998	D;D	0.74674	0.951;0.984	D	0.96093	0.9063	10	0.87932	D	0	-14.6067	12.7944	0.57551	0.0:0.0:0.0:1.0	.	427;427	P28749-2;P28749	.;RBL1_HUMAN	F	427	ENSP00000362768:I427F;ENSP00000343646:I427F	ENSP00000343646:I427F	I	-	1	0	RBL1	35118047	1.000000	0.71417	0.996000	0.52242	0.091000	0.18340	3.601000	0.54059	1.962000	0.57031	0.528000	0.53228	ATT		0.348	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079067.2	NM_002895		13	51	0	0	0	0	13	51				
SLC12A5	57468	broad.mit.edu	37	20	44676687	44676687	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr20:44676687C>T	ENST00000454036.2	+	16	2093	c.2044C>T	c.(2044-2046)Cgc>Tgc	p.R682C	SLC12A5_ENST00000243964.3_Missense_Mutation_p.R659C	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	682					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	TGCCCTCTTACGCCTGGAGGA	0.597																																						uc010zxl.1		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						c.(2044-2046)CGC>TGC		solute carrier family 12 (potassium-chloride	Bumetanide(DB00887)|Potassium Chloride(DB00761)						73.0	55.0	61.0					20																	44676687		2203	4300	6503	SO:0001583	missense	57468				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity	g.chr20:44676687C>T	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.2044C>T	20.37:g.44676687C>T	ENSP00000387694:p.Arg682Cys		Somatic				SLC12A5_uc010zxm.1_RNA|SLC12A5_uc002xrb.2_Missense_Mutation_p.R659C	p.R682C	NM_001134771	NP_001128243	WXS	Illumina HiSeq	Unspecified	Q9H2X9	S12A5_HUMAN			16	2120	+		Myeloproliferative disorder(115;0.0122)	682					A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	ENST00000454036.2	37	c.2044C>T	CCDS46610.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.120875	0.77436	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	D;D	0.98762	-5.12;-5.12	3.92	3.92	0.45320	Amino acid permease domain (1);	0.128081	0.52532	D	0.000067	D	0.99275	0.9747	M	0.93720	3.45	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72338	0.977;0.947	D	0.98755	1.0722	10	0.87932	D	0	.	14.669	0.68929	0.0:1.0:0.0:0.0	.	682;659	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	C	682;659	ENSP00000387694:R682C;ENSP00000243964:R659C	ENSP00000243964:R659C	R	+	1	0	SLC12A5	44110094	0.999000	0.42202	0.996000	0.52242	0.921000	0.55340	1.366000	0.34193	1.992000	0.58205	0.455000	0.32223	CGC		0.597	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1			3	24	0	0	0	0	3	24				
ZNF334	55713	broad.mit.edu	37	20	45131097	45131097	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr20:45131097T>A	ENST00000347606.4	-	5	1063	c.881A>T	c.(880-882)gAa>gTa	p.E294V	ZNF334_ENST00000593880.1_Missense_Mutation_p.E317V|ZNF334_ENST00000457685.2_Missense_Mutation_p.E256V	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	294					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				TTCACTGCATTCATAGGGTCT	0.423																																						uc002xsc.2		NA																	0				ovary(1)|pancreas(1)	2						c.(880-882)GAA>GTA		zinc finger protein 334 isoform a							106.0	106.0	106.0					20																	45131097		2203	4300	6503	SO:0001583	missense	55713				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr20:45131097T>A	AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.881A>T	20.37:g.45131097T>A	ENSP00000255129:p.Glu294Val		Somatic				ZNF334_uc002xsa.2_Missense_Mutation_p.E317V|ZNF334_uc002xsb.2_Missense_Mutation_p.E256V|ZNF334_uc002xsd.2_Missense_Mutation_p.E256V|ZNF334_uc010ghl.2_Missense_Mutation_p.E293V	p.E294V	NM_018102	NP_060572	WXS	Illumina HiSeq	Unspecified	Q9HCZ1	ZN334_HUMAN			5	1065	-		Myeloproliferative disorder(115;0.0122)	294			C2H2-type 3.		Q5T6U2|Q9NVW4	Missense_Mutation	SNP	ENST00000347606.4	37	c.881A>T	CCDS33480.1	.	.	.	.	.	.	.	.	.	.	T	10.85	1.467112	0.26335	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	T;T	0.33216	1.42;1.42	3.3	3.3	0.37823	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14399	0.0348	N	0.05259	-0.085	0.09310	N	1	B;B;B	0.34181	0.44;0.44;0.44	B;B;B	0.32090	0.14;0.14;0.14	T	0.09751	-1.0660	9	0.56958	D	0.05	.	6.6925	0.23181	0.0:0.0:0.2433:0.7566	.	256;294;317	B3KQ93;Q9HCZ1;Q8N3P8	.;ZN334_HUMAN;.	V	256;294	ENSP00000402582:E256V;ENSP00000255129:E294V	ENSP00000255129:E294V	E	-	2	0	ZNF334	44564504	0.000000	0.05858	0.039000	0.18376	0.956000	0.61745	-0.611000	0.05622	1.491000	0.48482	0.482000	0.46254	GAA		0.423	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079575.1			52	241	0	0	0	0	52	241				
TPTE	7179	broad.mit.edu	37	21	10934054	10934054	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr21:10934054T>A	ENST00000361285.4	-	16	1252	c.923A>T	c.(922-924)aAt>aTt	p.N308I	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.N290I|TPTE_ENST00000342420.5_Missense_Mutation_p.N270I	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	308	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGTGGGGACATTATGATCATC	0.299																																						uc002yip.1		NA																	0				ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(922-924)AAT>ATT		transmembrane phosphatase with tensin homology							159.0	168.0	165.0					21																	10934054		2203	4300	6503	SO:0001583	missense	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10934054T>A	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.923A>T	21.37:g.10934054T>A	ENSP00000355208:p.Asn308Ile		Somatic				TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.N290I|TPTE_uc002yir.1_Missense_Mutation_p.N270I|TPTE_uc010gkv.1_Missense_Mutation_p.N170I	p.N308I	NM_199261	NP_954870	WXS	Illumina HiSeq	Unspecified	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	16	1291	-			308			Phosphatase tensin-type.		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	c.923A>T	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	13.33	2.203929	0.38905	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	T;T;T	0.31510	1.49;1.49;1.49	2.07	2.07	0.26955	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.000000	0.85682	U	0.000000	T	0.61800	0.2376	H	0.95224	3.64	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.994;0.997;0.993	T	0.67894	-0.5552	10	0.87932	D	0	-31.1914	8.0889	0.30788	0.0:0.0:0.0:1.0	.	270;290;308	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	I	290;308;270	ENSP00000298232:N290I;ENSP00000355208:N308I;ENSP00000344441:N270I	ENSP00000298232:N290I	N	-	2	0	TPTE	9955925	1.000000	0.71417	0.873000	0.34254	0.424000	0.31475	6.068000	0.71201	1.204000	0.43247	0.163000	0.16589	AAT		0.299	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			20	438	0	0	0	0	20	438				
APP	351	broad.mit.edu	37	21	27269978	27269978	+	Silent	SNP	C	C	T	rs141559720		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr21:27269978C>T	ENST00000346798.3	-	16	2004	c.1971G>A	c.(1969-1971)ggG>ggA	p.G657G	APP_ENST00000448388.2_Silent_p.G547G|APP_ENST00000357903.3_Silent_p.G638G|APP_ENST00000348990.5_Silent_p.G582G|APP_ENST00000358918.3_Silent_p.G639G|APP_ENST00000354192.3_Silent_p.G526G|APP_ENST00000359726.3_Silent_p.G601G|APP_ENST00000440126.3_Silent_p.G633G|APP_ENST00000439274.2_Silent_p.G601G	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	657					adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				TATTTGTCAACCCAGAACCTG	0.358													C|||	1	0.000199681	0.0008	0.0	5008	,	,		23445	0.0		0.0	False		,,,				2504	0.0					uc002ylz.2		NA																	0				ovary(1)	1						c.(1969-1971)GGG>GGA		amyloid beta A4 protein isoform a precursor		C	,,,,,,,,,	2,4404	4.2+/-10.8	0,2,2201	146.0	141.0	142.0		1971,1899,1578,1803,1641,1917,1860,1692,1914,1746	-2.6	0.3	21	dbSNP_134	142	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	APP	NM_000484.3,NM_001136016.3,NM_001136129.2,NM_001136130.2,NM_001136131.2,NM_001204301.1,NM_001204302.1,NM_001204303.1,NM_201413.2,NM_201414.2	,,,,,,,,,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,,,,,,,,,	657/771,633/747,526/640,601/715,547/661,639/753,620/734,564/678,638/752,582/696	27269978	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	351				adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity	g.chr21:27269978C>T	M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.1971G>A	21.37:g.27269978C>T			Somatic				APP_uc011acg.1_Silent_p.G165G|APP_uc010glk.2_Silent_p.G633G|APP_uc002yma.2_Silent_p.G638G|APP_uc011ach.1_Silent_p.G601G|APP_uc002ymb.2_Silent_p.G582G|APP_uc010glj.2_Silent_p.G526G|APP_uc011aci.1_Silent_p.G547G	p.G657G	NM_000484	NP_000475	WXS	Illumina HiSeq	Unspecified	P05067	A4_HUMAN			16	2171	-		Breast(209;0.00295)	657			Extracellular (Potential).		B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Silent	SNP	ENST00000346798.3	37	c.1971G>A	CCDS13576.1																																																																																				0.358	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171340.1	NM_000484		31	237	0	0	0	0	31	237				
GRIK1	2897	broad.mit.edu	37	21	30959875	30959875	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr21:30959875G>T	ENST00000399907.1	-	12	2015	c.1604C>A	c.(1603-1605)aCc>aAc	p.T535N	GRIK1_ENST00000309434.7_Missense_Mutation_p.T537N|GRIK1_ENST00000389125.3_Missense_Mutation_p.T520N|GRIK1_ENST00000399913.1_Missense_Mutation_p.T535N|GRIK1_ENST00000389124.2_Missense_Mutation_p.T535N|GRIK1_ENST00000399914.1_Missense_Mutation_p.T520N|GRIK1_ENST00000399909.1_Missense_Mutation_p.T520N|GRIK1_ENST00000535441.1_Missense_Mutation_p.T537N|GRIK1_ENST00000327783.4_Missense_Mutation_p.T535N	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	535					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	CCGCACGTAGGTGATGGTAAG	0.483																																						uc002yno.1		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(1603-1605)ACC>AAC		glutamate receptor, ionotropic, kainate 1	L-Glutamic Acid(DB00142)|Topiramate(DB00273)						72.0	72.0	72.0					21																	30959875		2203	4300	6503	SO:0001583	missense	2897				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity	g.chr21:30959875G>T		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.1604C>A	21.37:g.30959875G>T	ENSP00000382791:p.Thr535Asn		Somatic				GRIK1_uc002ynn.2_Missense_Mutation_p.T520N|GRIK1_uc011acs.1_Missense_Mutation_p.T535N|GRIK1_uc011act.1_Missense_Mutation_p.T396N|GRIK1_uc010glq.1_Missense_Mutation_p.T378N	p.T535N	NM_000830	NP_000821	WXS	Illumina HiSeq	Unspecified	P39086	GRIK1_HUMAN			12	2068	-			535			Extracellular (Potential).		Q13001|Q86SU9	Missense_Mutation	SNP	ENST00000399907.1	37	c.1604C>A	CCDS42913.1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.530637	0.64860	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	T;T;T;T;T;T;T;T;T	0.19806	2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12	4.7	4.7	0.59300	Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.45458	0.1343	M	0.66506	2.035	0.80722	D	1	D;D;D;D;D	0.76494	0.998;0.998;0.992;0.998;0.999	D;D;D;D;D	0.78314	0.98;0.98;0.97;0.98;0.991	T	0.29458	-1.0011	10	0.42905	T	0.14	.	17.7849	0.88534	0.0:0.0:1.0:0.0	.	520;535;520;535;520	E7EPY9;E9PD61;E7EPZ0;P39086;P39086-2	.;.;.;GRIK1_HUMAN;.	N	535;520;535;520;537;396;535;535;520;537	ENSP00000327687:T535N;ENSP00000373777:T520N;ENSP00000382797:T535N;ENSP00000382798:T520N;ENSP00000446326:T537N;ENSP00000373776:T535N;ENSP00000382791:T535N;ENSP00000382793:T520N;ENSP00000311646:T537N	ENSP00000311646:T537N	T	-	2	0	GRIK1	29881746	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	7.599000	0.82757	2.610000	0.88304	0.655000	0.94253	ACC		0.483	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1			3	48	1	0	0.004672	0.00490017	3	48				
DSCR3	10311	broad.mit.edu	37	21	38610786	38610786	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr21:38610786T>C	ENST00000309117.6	-	3	563	c.326A>G	c.(325-327)tAt>tGt	p.Y109C	DSCR3_ENST00000476950.1_Missense_Mutation_p.Y109C|DSCR3_ENST00000399001.1_Intron|DSCR3_ENST00000539844.1_Intron|DSCR3_ENST00000399000.3_5'UTR|DSCR3_ENST00000398998.1_Missense_Mutation_p.Y61C|AP001432.14_ENST00000440629.1_lincRNA|DSCR3_ENST00000288304.5_Missense_Mutation_p.Y67C	NM_006052.1	NP_006043.1	O14972	DSCR3_HUMAN	Down syndrome critical region gene 3	109						nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9						CACGCCATGATACGTCTCATA	0.448																																						uc002ywf.1		NA																	0					0						c.(325-327)TAT>TGT		Down syndrome critical region protein 3							168.0	153.0	158.0					21																	38610786		2203	4300	6503	SO:0001583	missense	10311				vacuolar transport	nucleus|retromer complex		g.chr21:38610786T>C	D87343	CCDS33553.1	21q22.2	2008-05-22			ENSG00000157538	ENSG00000157538			3044	protein-coding gene	gene with protein product		605298				9399594	Standard	NM_006052		Approved	DCRA	uc002ywf.1	O14972	OTTHUMG00000086659	ENST00000309117.6:c.326A>G	21.37:g.38610786T>C	ENSP00000311399:p.Tyr109Cys		Somatic				DSCR3_uc010gnm.1_RNA|DSCR3_uc010gnn.1_Missense_Mutation_p.Y67C|DSCR3_uc010gnl.2_Missense_Mutation_p.Y109C|DSCR3_uc011aeg.1_Intron|DSCR3_uc011aeh.1_Intron	p.Y109C	NM_006052	NP_006043	WXS	Illumina HiSeq	Unspecified	O14972	DSCR3_HUMAN			4	565	-			109					B2R6T8|B7Z6B1|D3DSH4|Q2TAY6	Missense_Mutation	SNP	ENST00000309117.6	37	c.326A>G	CCDS33553.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.342724	0.82022	.	.	ENSG00000157538	ENST00000309117;ENST00000288304;ENST00000476950;ENST00000398998	T	0.06449	3.3	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.33498	0.0865	M	0.91406	3.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.39014	-0.9634	10	0.87932	D	0	-10.8321	15.7411	0.77899	0.0:0.0:0.0:1.0	.	109;109	B7Z6B1;O14972	.;DSCR3_HUMAN	C	109;67;109;61	ENSP00000311399:Y109C	ENSP00000288304:Y67C	Y	-	2	0	DSCR3	37532656	1.000000	0.71417	0.925000	0.36789	0.758000	0.43043	7.668000	0.83897	2.171000	0.68590	0.533000	0.62120	TAT		0.448	DSCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194807.1			7	162	0	0	0	0	7	162				
B3GALT5	10317	broad.mit.edu	37	21	41032541	41032541	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr21:41032541C>A	ENST00000380620.4	+	5	647	c.55C>A	c.(55-57)Ctt>Att	p.L19I	AF064860.5_ENST00000416555.1_RNA|B3GALT5_ENST00000398714.2_Missense_Mutation_p.L19I|B3GALT5_ENST00000343118.4_Missense_Mutation_p.L19I|B3GALT5_ENST00000380618.1_Missense_Mutation_p.L19I			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5	19					protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				TCTGGGGGCTCTTTGTTTGTA	0.398																																						uc002yyb.1		NA																	0				skin(1)	1						c.(55-57)CTT>ATT		UDP-Gal:betaGlcNAc beta							164.0	161.0	162.0					21																	41032541		2203	4300	6503	SO:0001583	missense	10317				protein glycosylation	endoplasmic reticulum|Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity	g.chr21:41032541C>A	AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.55C>A	21.37:g.41032541C>A	ENSP00000369994:p.Leu19Ile		Somatic				B3GALT5_uc002yye.2_Missense_Mutation_p.L19I|B3GALT5_uc002yyi.1_Missense_Mutation_p.L19I|B3GALT5_uc002yyj.1_Missense_Mutation_p.L19I|B3GALT5_uc002yyk.1_Missense_Mutation_p.L19I|B3GALT5_uc002yyl.1_Missense_Mutation_p.L19I|B3GALT5_uc002yym.1_Missense_Mutation_p.L19I	p.L19I	NM_033173	NP_149363	WXS	Illumina HiSeq	Unspecified	Q9Y2C3	B3GT5_HUMAN			5	647	+		Prostate(19;2.55e-06)	19			Helical; Signal-anchor for type II membrane protein; (Potential).		A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	Missense_Mutation	SNP	ENST00000380620.4	37	c.55C>A	CCDS13667.1	.	.	.	.	.	.	.	.	.	.	C	12.68	2.011866	0.35511	.	.	ENSG00000183778	ENST00000380620;ENST00000380618;ENST00000343118;ENST00000398714	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.75	2.5	0.30297	.	0.816177	0.10661	N	0.648665	T	0.43809	0.1264	M	0.65975	2.015	0.09310	N	1	B	0.21381	0.055	B	0.17433	0.018	T	0.38887	-0.9640	10	0.29301	T	0.29	.	1.1204	0.01723	0.1509:0.2624:0.3339:0.2528	.	19	Q9Y2C3	B3GT5_HUMAN	I	19	ENSP00000369994:L19I;ENSP00000369992:L19I;ENSP00000343318:L19I;ENSP00000381699:L19I	ENSP00000343318:L19I	L	+	1	0	B3GALT5	39954411	0.005000	0.15991	0.007000	0.13788	0.023000	0.10783	0.229000	0.17833	0.733000	0.32492	0.655000	0.94253	CTT		0.398	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195008.2	NM_033170		28	220	1	0	1.08e-15	1.27e-15	28	220				
S100B	6285	broad.mit.edu	37	21	48022218	48022218	+	Missense_Mutation	SNP	G	G	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr21:48022218G>C	ENST00000291700.4	-	2	307	c.111C>G	c.(109-111)atC>atG	p.I37M	S100B_ENST00000397648.1_Missense_Mutation_p.I37M|S100B_ENST00000367071.4_Missense_Mutation_p.I37M	NM_006272.2	NP_006263.1	P04271	S100B_HUMAN	S100 calcium binding protein B	37	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				astrocyte differentiation (GO:0048708)|axonogenesis (GO:0007409)|cell proliferation (GO:0008283)|cellular response to hypoxia (GO:0071456)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of cell shape (GO:0008360)|regulation of neuronal synaptic plasticity (GO:0048168)|response to glucocorticoid (GO:0051384)|response to methylmercury (GO:0051597)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RAGE receptor binding (GO:0050786)|S100 protein binding (GO:0044548)|tau protein binding (GO:0048156)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(1)|skin(1)	5	Breast(49;0.247)	Lung NSC(3;0.245)		OV - Ovarian serous cystadenocarcinoma(3;1.84e-06)|Epithelial(3;4.45e-06)|all cancers(3;2.07e-05)|Colorectal(79;0.241)	Olopatadine(DB00768)	GCTCATTGTTGATGAGCTCCT	0.443																																						uc002zju.1		NA																	0					0						c.(109-111)ATC>ATG		S100 calcium-binding protein, beta							139.0	115.0	123.0					21																	48022218		2203	4300	6503	SO:0001583	missense	6285				axonogenesis|cell proliferation|central nervous system development|innate immune response|positive regulation of I-kappaB kinase/NF-kappaB cascade	extracellular region|nucleus|perinuclear region of cytoplasm|ruffle	calcium ion binding|calcium-dependent protein binding|protein homodimerization activity|RAGE receptor binding|S100 beta binding|tau protein binding|zinc ion binding	g.chr21:48022218G>C	M59488	CCDS13736.1	21q22.3	2013-01-10	2006-09-11		ENSG00000160307	ENSG00000160307		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10500	protein-coding gene	gene with protein product		176990	"""S100 calcium binding protein, beta (neural)"""			2394738, 1998503	Standard	NM_006272		Approved	S100beta	uc002zju.1	P04271	OTTHUMG00000090715	ENST00000291700.4:c.111C>G	21.37:g.48022218G>C	ENSP00000291700:p.Ile37Met		Somatic				S100B_uc002zjv.1_Missense_Mutation_p.I37M	p.I37M	NM_006272	NP_006263	WXS	Illumina HiSeq	Unspecified	P04271	S100B_HUMAN		OV - Ovarian serous cystadenocarcinoma(3;1.84e-06)|Epithelial(3;4.45e-06)|all cancers(3;2.07e-05)|Colorectal(79;0.241)	2	222	-	Breast(49;0.247)	Lung NSC(3;0.245)	37			EF-hand 1.		D3DSN6	Missense_Mutation	SNP	ENST00000291700.4	37	c.111C>G	CCDS13736.1	.	.	.	.	.	.	.	.	.	.	G	5.201	0.222662	0.09863	.	.	ENSG00000160307	ENST00000291700;ENST00000367071;ENST00000397648	T;T;T	0.08282	3.11;3.11;3.11	5.48	2.56	0.30785	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	0.108851	0.64402	D	0.000008	T	0.06325	0.0163	.	.	.	0.38493	D	0.948032	P;B	0.44429	0.835;0.228	P;B	0.45071	0.468;0.129	T	0.42327	-0.9458	9	0.21540	T	0.41	-12.7009	2.4969	0.04623	0.2146:0.1356:0.5104:0.1394	.	37;37	A8MRB1;P04271	.;S100B_HUMAN	M	37	ENSP00000291700:I37M;ENSP00000356038:I37M;ENSP00000380769:I37M	ENSP00000291700:I37M	I	-	3	3	S100B	46846646	0.997000	0.39634	0.987000	0.45799	0.083000	0.17756	0.314000	0.19432	1.464000	0.47987	0.655000	0.94253	ATC		0.443	S100B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207427.1	NM_006272		11	76	0	0	0	0	11	76				
DNAJB7	150353	broad.mit.edu	37	22	41257198	41257198	+	Silent	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr22:41257198C>T	ENST00000307221.4	-	1	932	c.801G>A	c.(799-801)gaG>gaA	p.E267E	XPNPEP3_ENST00000482652.1_Intron|XPNPEP3_ENST00000357137.4_Intron|XPNPEP3_ENST00000541156.1_Intron|XPNPEP3_ENST00000544094.1_5'Flank|XPNPEP3_ENST00000414396.1_Intron	NM_145174.1	NP_660157.1	Q7Z6W7	DNJB7_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 7	267							chaperone binding (GO:0051087)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10						ATATACCTCCCTCATCATTGT	0.423																																						uc003azj.2		NA																	0				ovary(1)	1						c.(799-801)GAG>GAA		DnaJ (Hsp40) homolog, subfamily B, member 7							129.0	121.0	123.0					22																	41257198		2203	4300	6503	SO:0001819	synonymous_variant	150353				protein folding		heat shock protein binding|unfolded protein binding	g.chr22:41257198C>T	AF085232	CCDS14008.1	22q13.2	2011-09-02			ENSG00000172404	ENSG00000172404		"""Heat shock proteins / DNAJ (HSP40)"""	24986	protein-coding gene	gene with protein product		611336				12477932	Standard	NM_145174		Approved	HSC3	uc003azj.3	Q7Z6W7	OTTHUMG00000151202	ENST00000307221.4:c.801G>A	22.37:g.41257198C>T			Somatic				XPNPEP3_uc011aox.1_Intron|XPNPEP3_uc003azh.2_Intron|XPNPEP3_uc003azi.2_Intron|XPNPEP3_uc011aoy.1_5'Flank|XPNPEP3_uc003azg.1_Intron|XPNPEP3_uc003azf.1_Intron|XPNPEP3_uc010gyh.1_5'Flank	p.E267E	NM_145174	NP_660157	WXS	Illumina HiSeq	Unspecified	Q7Z6W7	DNJB7_HUMAN			1	933	-			267					Q2M220|Q5H904|Q8WYJ7	Silent	SNP	ENST00000307221.4	37	c.801G>A	CCDS14008.1																																																																																				0.423	DNAJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321765.1	NM_145174		23	136	0	0	0	0	23	136				
CYB5R3	1727	broad.mit.edu	37	22	43032788	43032788	+	Missense_Mutation	SNP	C	C	T	rs140159332		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr22:43032788C>T	ENST00000352397.5	-	2	338	c.86G>A	c.(85-87)cGc>cAc	p.R29H	CYB5R3_ENST00000402438.1_Missense_Mutation_p.R6H|CYB5R3_ENST00000361740.4_Missense_Mutation_p.R62H|CYB5R3_ENST00000407332.1_Missense_Mutation_p.R6H|CYB5R3_ENST00000396303.3_Missense_Mutation_p.R6H|CYB5R3_ENST00000407623.3_Missense_Mutation_p.R6H	NM_000398.6	NP_000389.1	P00387	NB5R3_HUMAN	cytochrome b5 reductase 3	29				QRSTP -> RWPRA (in Ref. 11; AAA52307). {ECO:0000305}.|R -> G (in Ref. 1; AAA59900). {ECO:0000305}.	blood circulation (GO:0008015)|cholesterol biosynthetic process (GO:0006695)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|hemoglobin complex (GO:0005833)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|FAD binding (GO:0071949)|flavin adenine dinucleotide binding (GO:0050660)|NAD binding (GO:0051287)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6					Flavin adenine dinucleotide(DB03147)	TGGCGTGGAGCGCTGGAACAG	0.647																																						uc003bcz.2		NA																	0				skin(1)	1						c.(85-87)CGC>CAC		cytochrome b5 reductase 3 isoform m	NADH(DB00157)	C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	71.0	62.0	65.0		86,17,185,17,17	1.3	1.0	22	dbSNP_134	65	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	CYB5R3	NM_000398.6,NM_001129819.2,NM_001171660.1,NM_001171661.1,NM_007326.4	29,29,29,29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	29/302,6/279,62/335,6/279,6/279	43032788	1,13005	2203	4300	6503	SO:0001583	missense	1727				blood circulation|cholesterol biosynthetic process|water-soluble vitamin metabolic process	endoplasmic reticulum membrane|hemoglobin complex|mitochondrial outer membrane	cytochrome-b5 reductase activity	g.chr22:43032788C>T	M16461	CCDS14040.1, CCDS33658.1, CCDS54535.1	22q13.2	2012-10-02		2005-07-13	ENSG00000100243	ENSG00000100243	1.6.2.2		2873	protein-coding gene	gene with protein product		613213	"""diaphorase (NADH) (cytochrome b-5 reductase)"""	DIA1		2479590, 3268037	Standard	NM_001129819		Approved		uc011aps.2	P00387	OTTHUMG00000150745	ENST00000352397.5:c.86G>A	22.37:g.43032788C>T	ENSP00000338461:p.Arg29His		Somatic				CYB5R3_uc010gzc.1_5'UTR|CYB5R3_uc003bcw.2_Missense_Mutation_p.R19H|CYB5R3_uc011aps.1_Missense_Mutation_p.R62H|CYB5R3_uc003bcy.2_Missense_Mutation_p.R6H|CYB5R3_uc003bcx.2_Missense_Mutation_p.R6H	p.R29H	NM_000398	NP_000389	WXS	Illumina HiSeq	Unspecified	P00387	NB5R3_HUMAN			2	170	-			29	QRSTP -> RWPRA (in Ref. 10; AAA52307).|R -> G (in Ref. 1; AAA59900).				B1AHF2|B7Z7L3|O75675|Q8TDL8|Q8WTS8|Q9UEN4|Q9UEN5|Q9UL55|Q9UL56	Missense_Mutation	SNP	ENST00000352397.5	37	c.86G>A	CCDS33658.1	.	.	.	.	.	.	.	.	.	.	C	14.55	2.570333	0.45798	2.27E-4	0.0	ENSG00000100243	ENST00000361740;ENST00000396303;ENST00000352397;ENST00000407623;ENST00000407332;ENST00000402438;ENST00000438270	D;D;D;D;D;D;D	0.87809	-2.3;-2.27;-2.25;-2.27;-2.27;-2.27;-1.56	4.82	1.32	0.21799	.	1.038390	0.07564	N	0.917459	T	0.74884	0.3775	L	0.29908	0.895	0.27052	N	0.963756	P;B	0.51147	0.942;0.063	B;B	0.38056	0.264;0.025	T	0.70167	-0.4946	10	0.56958	D	0.05	-33.8871	1.3543	0.02179	0.1972:0.4398:0.1911:0.172	.	62;29	B7Z7L3;P00387	.;NB5R3_HUMAN	H	62;6;29;6;6;6;6	ENSP00000354468:R62H;ENSP00000379597:R6H;ENSP00000338461:R29H;ENSP00000384834:R6H;ENSP00000384457:R6H;ENSP00000385679:R6H;ENSP00000403439:R6H	ENSP00000338461:R29H	R	-	2	0	CYB5R3	41362732	0.994000	0.37717	1.000000	0.80357	0.693000	0.40251	1.014000	0.29950	1.144000	0.42321	0.313000	0.20887	CGC		0.647	CYB5R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320439.1			7	23	0	0	0	0	7	23				
GRM7	2917	broad.mit.edu	37	3	7348199	7348199	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr3:7348199C>A	ENST00000357716.4	+	4	1167	c.893C>A	c.(892-894)gCa>gAa	p.A298E	GRM7_ENST00000403881.1_Missense_Mutation_p.A298E|GRM7_ENST00000486284.1_Missense_Mutation_p.A298E|GRM7_ENST00000389336.4_Missense_Mutation_p.A298E|GRM7_ENST00000402647.2_Missense_Mutation_p.A298E	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	298					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						ATCCTTGCAGCAGCCAAAAGA	0.438																																						uc003bqm.2		NA																	0				ovary(4)|lung(3)	7						c.(892-894)GCA>GAA		glutamate receptor, metabotropic 7 isoform a	L-Glutamic Acid(DB00142)						84.0	90.0	88.0					3																	7348199		2203	4300	6503	SO:0001583	missense	2917				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding	g.chr3:7348199C>A	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.893C>A	3.37:g.7348199C>A	ENSP00000350348:p.Ala298Glu		Somatic				GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.A298E|GRM7_uc003bql.2_Missense_Mutation_p.A298E|GRM7_uc003bqn.1_5'UTR	p.A298E	NM_000844	NP_000835	WXS	Illumina HiSeq	Unspecified	Q14831	GRM7_HUMAN			4	1167	+			298			Extracellular (Potential).		Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	c.893C>A	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.322308	0.81580	.	.	ENSG00000196277	ENST00000448328;ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	D;D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76;-1.76	5.65	5.65	0.86999	Extracellular ligand-binding receptor (1);	0.649129	0.16186	N	0.225624	D	0.88702	0.6508	L	0.57536	1.79	0.80722	D	1	P;P;P	0.50943	0.782;0.818;0.94	B;B;P	0.61592	0.14;0.157;0.891	D	0.84565	0.0652	10	0.25106	T	0.35	.	18.7028	0.91627	0.0:1.0:0.0:0.0	.	298;298;298	Q14831-5;Q14831;Q14831-2	.;GRM7_HUMAN;.	E	90;298;298;298;298;298;298;298	ENSP00000393799:A90E;ENSP00000350348:A298E;ENSP00000417536:A298E;ENSP00000373987:A298E;ENSP00000385664:A298E;ENSP00000384585:A298E	ENSP00000350348:A298E	A	+	2	0	GRM7	7323199	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.843000	0.97960	0.585000	0.79938	GCA		0.438	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		6	198	1	0	0.00198382	0.00209043	6	198				
ITGA9	3680	broad.mit.edu	37	3	37555268	37555268	+	Silent	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr3:37555268C>T	ENST00000264741.5	+	9	1168	c.912C>T	c.(910-912)ttC>ttT	p.F304F	ITGA9_ENST00000422441.1_Silent_p.F304F	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	304					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		GCTCTTACTTCGGCTCCTCCT	0.552																																						uc003chd.2		NA																	0				breast(3)|pancreas(1)|lung(1)|skin(1)	6						c.(910-912)TTC>TTT		integrin, alpha 9 precursor							96.0	93.0	94.0					3																	37555268		2203	4300	6503	SO:0001819	synonymous_variant	3680				axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr3:37555268C>T	L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.912C>T	3.37:g.37555268C>T			Somatic				ITGA9_uc003chc.2_Silent_p.F304F	p.F304F	NM_002207	NP_002198	WXS	Illumina HiSeq	Unspecified	Q13797	ITA9_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)	9	965	+			304			Extracellular (Potential).|FG-GAP 5.		Q14638	Silent	SNP	ENST00000264741.5	37	c.912C>T	CCDS2669.1																																																																																				0.552	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207		15	82	0	0	0	0	15	82				
RBM6	10180	broad.mit.edu	37	3	50095359	50095359	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr3:50095359G>A	ENST00000266022.4	+	9	2151	c.1892G>A	c.(1891-1893)aGg>aAg	p.R631K	RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000539992.1_5'UTR|RBM6_ENST00000442092.1_Missense_Mutation_p.R109K|RBM6_ENST00000443081.1_Missense_Mutation_p.R499K|RBM6_ENST00000422955.1_Missense_Mutation_p.R109K	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	631					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		CCTTCTCGAAGGGAAGGGCCA	0.512																																						uc003cyc.2		NA																	0				ovary(2)	2						c.(1891-1893)AGG>AAG		RNA binding motif protein 6							81.0	78.0	79.0					3																	50095359		2203	4300	6503	SO:0001583	missense	10180				RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding	g.chr3:50095359G>A	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.1892G>A	3.37:g.50095359G>A	ENSP00000266022:p.Arg631Lys		Somatic				RBM6_uc011bdh.1_RNA|RBM6_uc010hlc.1_Missense_Mutation_p.R150K|RBM6_uc003cyd.2_Missense_Mutation_p.R109K|RBM6_uc003cye.2_Missense_Mutation_p.R109K|RBM6_uc011bdi.1_5'UTR|RBM6_uc010hld.1_RNA|RBM6_uc010hle.1_RNA|RBM6_uc010hlf.1_RNA	p.R631K	NM_005777	NP_005768	WXS	Illumina HiSeq	Unspecified	P78332	RBM6_HUMAN		BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)	9	2025	+			631					O60549|O75524|Q86SS3	Missense_Mutation	SNP	ENST00000266022.4	37	c.1892G>A	CCDS2809.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750785	0.69533	.	.	ENSG00000004534	ENST00000442092;ENST00000266022;ENST00000443081;ENST00000422955;ENST00000446471	T;T;T;T	0.42131	0.98;1.53;1.55;0.98	5.71	5.71	0.89125	.	0.748208	0.13109	N	0.413105	T	0.36690	0.0976	L	0.32530	0.975	0.80722	D	1	B;B	0.14438	0.005;0.01	B;B	0.12156	0.003;0.007	T	0.10200	-1.0640	9	.	.	.	-2.0163	18.0966	0.89492	0.0:0.0:1.0:0.0	.	499;631	E9PGM9;P78332	.;RBM6_HUMAN	K	109;631;499;109;109	ENSP00000393530:R109K;ENSP00000266022:R631K;ENSP00000396466:R499K;ENSP00000392939:R109K	.	R	+	2	0	RBM6	50070363	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	2.980000	0.49321	2.711000	0.92665	0.650000	0.86243	AGG		0.512	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777		10	61	0	0	0	0	10	61				
BAP1	8314	broad.mit.edu	37	3	52441440	52441440	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr3:52441440C>T	ENST00000460680.1	-	6	883	c.412G>A	c.(412-414)Gcc>Acc	p.A138T	BAP1_ENST00000296288.5_Missense_Mutation_p.A138T	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0	Interaction with HIP2.				anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(2)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TGGGCCTTGGCCAACTCCGGG	0.517			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)	uc003ddx.2		NA		Rec	yes		3	3p21.31-p21.2	8314	N|Mis|F|S|O	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)			E			uveal melanoma|breast|NSCLC		2	Unknown(2)	p.?(2)	eye(2)	pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65						c.(412-414)GCC>ACC		BRCA1 associated protein-1							95.0	99.0	97.0					3																	52441440		2203	4300	6503	SO:0001583	missense	8314				monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr3:52441440C>T	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.412G>A	3.37:g.52441440C>T	ENSP00000417132:p.Ala138Thr		Somatic				BAP1_uc010hmh.2_5'Flank	p.A138T	NM_004656	NP_004647	WXS	Illumina HiSeq	Unspecified	Q92560	BAP1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)	6	527	-			138					B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	37	c.412G>A	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	C	34	5.382263	0.95967	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000470173	T;T;T	0.55234	0.53;0.53;0.53	5.73	5.73	0.89815	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.000000	0.85682	D	0.000000	T	0.71056	0.3295	L	0.58583	1.82	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.70212	-0.4934	10	0.54805	T	0.06	-7.9627	19.9064	0.97008	0.0:1.0:0.0:0.0	.	138	Q92560	BAP1_HUMAN	T	138;138;59	ENSP00000417132:A138T;ENSP00000296288:A138T;ENSP00000417776:A59T	ENSP00000296288:A138T	A	-	1	0	BAP1	52416480	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.453000	0.80700	2.716000	0.92895	0.655000	0.94253	GCC		0.517	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			5	162	0	0	0	0	5	162				
FAM208A	23272	broad.mit.edu	37	3	56681252	56681252	+	Splice_Site	SNP	C	C	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr3:56681252C>A	ENST00000493960.2	-	14	1524		c.e14-1		FAM208A_ENST00000355628.5_Splice_Site|FAM208A_ENST00000431842.2_Splice_Site	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A								poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						CCTTTTTGTGCTGTAAATAAA	0.318																																						uc003did.3		NA																	0				ovary(3)|kidney(1)|central_nervous_system(1)	5						c.e14-1		retinoblastoma-associated protein 140 isoform b							37.0	38.0	37.0					3																	56681252		2200	4288	6488	SO:0001630	splice_region_variant	23272							g.chr3:56681252C>A	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.1514-1G>T	3.37:g.56681252C>A			Somatic				C3orf63_uc003dic.3_Splice_Site_p.S109_splice|C3orf63_uc003die.3_Splice_Site_p.S505_splice	p.S505_splice	NM_015224	NP_056039	WXS	Illumina HiSeq	Unspecified	Q9UK61	CC063_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)	14	1615	-								A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Splice_Site	SNP	ENST00000493960.2	37	c.1514_splice	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	C	18.27	3.585898	0.66105	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5023	0.87735	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C3orf63	56656292	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.870000	0.28010	2.793000	0.96121	0.655000	0.94253	.		0.318	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	Intron	17	88	1	0	2.94e-08	3.32e-08	17	88				
PLS1	5357	broad.mit.edu	37	3	142388320	142388320	+	Silent	SNP	C	C	T	rs371894541		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr3:142388320C>T	ENST00000337777.3	+	3	372	c.159C>T	c.(157-159)cgC>cgT	p.R53R	PLS1_ENST00000497002.1_Silent_p.R53R|PLS1_ENST00000457734.2_Silent_p.R53R	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	53	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						ACAAGGTGCGCGAGATTGTGG	0.408																																						uc010huv.2		NA																	0				ovary(1)	1						c.(157-159)CGC>CGT		plastin 1		C	,,	0,4406		0,0,2203	171.0	173.0	173.0		159,159,159	-8.2	0.8	3		173	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	PLS1	NM_001145319.1,NM_001172312.1,NM_002670.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	53/630,53/630,53/630	142388320	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5357					cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr3:142388320C>T	L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.159C>T	3.37:g.142388320C>T			Somatic				PLS1_uc003euz.2_Silent_p.R53R|PLS1_uc003eva.2_Silent_p.R53R	p.R53R	NM_001145319	NP_001138791	WXS	Illumina HiSeq	Unspecified	Q14651	PLSI_HUMAN			3	318	+			53			EF-hand 2.		A8K2Q1|D3DNG3|Q8NEG6	Silent	SNP	ENST00000337777.3	37	c.159C>T	CCDS3125.1																																																																																				0.408	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354435.1	NM_002670		26	184	0	0	0	0	26	184				
ZIC4	84107	broad.mit.edu	37	3	147114229	147114229	+	Missense_Mutation	SNP	T	T	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr3:147114229T>G	ENST00000383075.3	-	3	610	c.98A>C	c.(97-99)cAg>cCg	p.Q33P	ZIC4_ENST00000491672.1_Intron|ZIC4_ENST00000484399.1_Missense_Mutation_p.Q33P|ZIC4_ENST00000525172.2_Missense_Mutation_p.Q83P|ZIC4_ENST00000425731.3_Missense_Mutation_p.Q71P|ZIC4_ENST00000473123.1_Missense_Mutation_p.Q33P	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	33						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						GGCGGTGAGCTGGGGGCCATG	0.692																																						uc003ewd.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(97-99)CAG>CCG		zinc finger protein of the cerebellum 4							22.0	29.0	27.0					3																	147114229		2012	4161	6173	SO:0001583	missense	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147114229T>G	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.98A>C	3.37:g.147114229T>G	ENSP00000372553:p.Gln33Pro		Somatic				ZIC4_uc003ewc.1_5'UTR|ZIC4_uc011bno.1_Missense_Mutation_p.Q83P	p.Q33P	NM_032153	NP_115529	WXS	Illumina HiSeq	Unspecified	Q8N9L1	ZIC4_HUMAN			3	371	-			33					A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	ENST00000383075.3	37	c.98A>C	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	T	17.18	3.324850	0.60634	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000462748;ENST00000484586;ENST00000463250	T;T;T;T;T;T	0.11821	2.87;2.8;2.81;2.87;2.87;2.74	5.16	3.96	0.45880	.	0.336610	0.21359	N	0.075828	T	0.10380	0.0254	N	0.24115	0.695	0.80722	D	1	B;B	0.11235	0.004;0.0	B;B	0.06405	0.002;0.001	T	0.07849	-1.0751	10	0.49607	T	0.09	.	11.8867	0.52606	0.0:0.0:0.1463:0.8537	.	83;33	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	P	33;71;83;33;33;33;33;33	ENSP00000372553:Q33P;ENSP00000397695:Q71P;ENSP00000435509:Q83P;ENSP00000417855:Q33P;ENSP00000420775:Q33P;ENSP00000420627:Q33P	ENSP00000372553:Q33P	Q	-	2	0	ZIC4	148596919	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.743000	0.62110	0.766000	0.33244	0.459000	0.35465	CAG		0.692	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			9	37	0	0	0	0	9	37				
PTX3	5806	broad.mit.edu	37	3	157160520	157160520	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr3:157160520C>T	ENST00000295927.3	+	3	1043	c.898C>T	c.(898-900)Cac>Tac	p.H300Y	VEPH1_ENST00000392832.2_Intron|VEPH1_ENST00000543418.1_Intron|VEPH1_ENST00000362010.2_Intron|VEPH1_ENST00000392833.2_Intron	NM_002852.3	NP_002843.2	P26022	PTX3_HUMAN	pentraxin 3, long	300	Pentaxin.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of viral entry into host cell (GO:0046597)|opsonization (GO:0008228)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phagocytosis (GO:0050766)|response to yeast (GO:0001878)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	(1->3)-beta-D-glucan binding (GO:0001872)|complement component C1q binding (GO:0001849)|virion binding (GO:0046790)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)	10			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			GGCCACAGGTCACATTGTTCC	0.532																																						uc003fbl.3		NA																	0				central_nervous_system(1)	1						c.(898-900)CAC>TAC		pentraxin 3 precursor							120.0	115.0	117.0					3																	157160520		2203	4300	6503	SO:0001583	missense	5806				inflammatory response	extracellular region		g.chr3:157160520C>T	X63613	CCDS3180.1	3q25	2010-03-11	2010-03-11		ENSG00000163661	ENSG00000163661			9692	protein-coding gene	gene with protein product		602492	"""pentaxin-related gene, rapidly induced by IL-1 beta"", ""tumor necrosis factor, alpha-induced protein 5"", ""pentraxin-related gene, rapidly induced by IL-1 beta"""	TNFAIP5		1429570	Standard	NM_002852		Approved	TSG-14	uc003fbl.4	P26022	OTTHUMG00000158750	ENST00000295927.3:c.898C>T	3.37:g.157160520C>T	ENSP00000295927:p.His300Tyr		Somatic				VEPH1_uc003fbj.1_Intron|VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	p.H300Y	NM_002852	NP_002843	WXS	Illumina HiSeq	Unspecified	P26022	PTX3_HUMAN	Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)		3	1041	+			300			Pentaxin.		B2R6T6|Q38M82	Missense_Mutation	SNP	ENST00000295927.3	37	c.898C>T	CCDS3180.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.062576	0.36373	.	.	ENSG00000163661	ENST00000295927	T	0.05081	3.5	5.86	5.86	0.93980	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.054338	0.64402	D	0.000001	T	0.11580	0.0282	L	0.41079	1.255	0.58432	D	0.999998	D	0.62365	0.991	P	0.55455	0.776	T	0.03394	-1.1041	10	0.33940	T	0.23	-22.6271	10.5406	0.45031	0.0:0.8571:0.0:0.1429	.	300	P26022	PTX3_HUMAN	Y	300	ENSP00000295927:H300Y	ENSP00000295927:H300Y	H	+	1	0	PTX3	158643214	0.996000	0.38824	0.096000	0.21009	0.289000	0.27227	3.015000	0.49599	2.777000	0.95525	0.655000	0.94253	CAC		0.532	PTX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352028.1	NM_002852		9	83	0	0	0	0	9	83				
SLITRK3	22865	broad.mit.edu	37	3	164908254	164908254	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr3:164908254T>C	ENST00000475390.1	-	2	808	c.365A>G	c.(364-366)aAt>aGt	p.N122S	SLITRK3_ENST00000241274.3_Missense_Mutation_p.N122S			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	122					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						CTTAAGACCATTGAAAGCTCC	0.348										HNSCC(40;0.11)																												uc003fej.3		NA																	0				ovary(6)|skin(3)|pancreas(1)	10						c.(364-366)AAT>AGT		slit and trk like 3 protein precursor							45.0	45.0	45.0					3																	164908254		2202	4299	6501	SO:0001583	missense	22865					integral to membrane		g.chr3:164908254T>C	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.365A>G	3.37:g.164908254T>C	ENSP00000420091:p.Asn122Ser	HNSCC(40;0.11)	Somatic				SLITRK3_uc003fek.2_Missense_Mutation_p.N122S	p.N122S	NM_014926	NP_055741	WXS	Illumina HiSeq	Unspecified	O94933	SLIK3_HUMAN			2	809	-			122			LRR 2.|Extracellular (Potential).		Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	c.365A>G	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	T	6.451	0.451431	0.12223	.	.	ENSG00000121871	ENST00000475390;ENST00000241274;ENST00000497724	T;T;T	0.55930	0.49;0.49;0.49	5.99	4.83	0.62350	.	0.000000	0.40469	N	0.001097	T	0.36413	0.0966	L	0.29908	0.895	0.35085	D	0.763778	B	0.02656	0.0	B	0.04013	0.001	T	0.36261	-0.9755	10	0.07990	T	0.79	-18.9997	12.2903	0.54815	0.0:0.0669:0.0:0.9331	.	122	O94933	SLIK3_HUMAN	S	122	ENSP00000420091:N122S;ENSP00000241274:N122S;ENSP00000419611:N122S	ENSP00000241274:N122S	N	-	2	0	SLITRK3	166390948	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.406000	0.52637	2.296000	0.77279	0.533000	0.62120	AAT		0.348	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		22	106	0	0	0	0	22	106				
PPAT	5471	broad.mit.edu	37	4	57267496	57267496	+	Splice_Site	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr4:57267496C>T	ENST00000264220.2	-	7	1023	c.886G>A	c.(886-888)Gac>Aac	p.D296N	PPAT_ENST00000507648.1_5'Flank	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	296					'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	ATCTACTTACCTTCGAACATA	0.353																																						uc003hbr.2		NA																	0					0						c.(886-888)GAC>AAC		phosphoribosyl pyrophosphate amidotransferase	L-Glutamine(DB00130)|Thioguanine(DB00352)						97.0	98.0	98.0					4																	57267496		2203	4300	6503	SO:0001630	splice_region_variant	5471				glutamine metabolic process|nucleoside metabolic process|purine base biosynthetic process|purine ribonucleoside monophosphate biosynthetic process	cytosol	4 iron, 4 sulfur cluster binding|amidophosphoribosyltransferase activity|metal ion binding	g.chr4:57267496C>T		CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.886+1G>A	4.37:g.57267496C>T			Somatic					p.D296N	NM_002703	NP_002694	WXS	Illumina HiSeq	Unspecified	Q06203	PUR1_HUMAN			7	1088	-	Glioma(25;0.08)|all_neural(26;0.101)		296						Missense_Mutation	SNP	ENST00000264220.2	37	c.886G>A	CCDS3505.1	.	.	.	.	.	.	.	.	.	.	C	12.52	1.963120	0.34659	.	.	ENSG00000128059	ENST00000264220	.	.	.	5.21	0.298	0.15766	.	0.382825	0.33916	N	0.004435	T	0.28134	0.0694	N	0.11724	0.165	0.36224	D	0.852182	B	0.02656	0.0	B	0.06405	0.002	T	0.14727	-1.0462	8	.	.	.	-3.5547	9.5024	0.39026	0.0:0.6331:0.0:0.3669	.	296	Q06203	PUR1_HUMAN	N	296	.	.	D	-	1	0	PPAT	56962253	1.000000	0.71417	0.990000	0.47175	0.403000	0.30841	2.106000	0.41835	-0.197000	0.10350	0.555000	0.69702	GAC		0.353	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250781.2	NM_002703	Missense_Mutation	19	271	0	0	0	0	19	271				
YTHDC1	91746	broad.mit.edu	37	4	69184292	69184292	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr4:69184292T>C	ENST00000344157.4	-	15	2104	c.1769A>G	c.(1768-1770)aAt>aGt	p.N590S	YTHDC1_ENST00000355665.3_Missense_Mutation_p.N572S|YTHDC1_ENST00000579690.1_Missense_Mutation_p.N598S	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	590					mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						CACATAATCATTGTAGGACTA	0.289																																						uc003hdx.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1768-1770)AAT>AGT		splicing factor YT521-B isoform 1							58.0	64.0	62.0					4																	69184292		2200	4300	6500	SO:0001583	missense	91746							g.chr4:69184292T>C	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.1769A>G	4.37:g.69184292T>C	ENSP00000339245:p.Asn590Ser		Somatic				YTHDC1_uc003hdy.2_Missense_Mutation_p.N572S	p.N590S	NM_001031732	NP_001026902	WXS	Illumina HiSeq	Unspecified	Q96MU7	YTDC1_HUMAN			15	2122	-			590					Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	ENST00000344157.4	37	c.1769A>G	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	T	15.37	2.812408	0.50527	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.23754	1.91;1.89	5.25	5.25	0.73442	.	0.084806	0.85682	D	0.000000	T	0.34483	0.0899	N	0.24115	0.695	0.58432	D	0.999999	D;B	0.67145	0.996;0.259	D;B	0.70935	0.971;0.064	T	0.06991	-1.0796	10	0.20519	T	0.43	.	15.4548	0.75305	0.0:0.0:0.0:1.0	.	572;590	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	S	590;572	ENSP00000339245:N590S;ENSP00000347888:N572S	ENSP00000339245:N590S	N	-	2	0	YTHDC1	68866887	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.917000	0.75782	2.113000	0.64589	0.482000	0.46254	AAT		0.289	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370		7	64	0	0	0	0	7	64				
FRAS1	80144	broad.mit.edu	37	4	79285132	79285132	+	Silent	SNP	C	C	T	rs535942655	byFrequency	TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr4:79285132C>T	ENST00000325942.6	+	22	3086	c.2646C>T	c.(2644-2646)ctC>ctT	p.L882L	FRAS1_ENST00000264895.6_Silent_p.L882L	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	882					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.L882L(2)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						ACACCAACCTCGTGCTGTCCC	0.527													C|||	2	0.000399361	0.0	0.0	5008	,	,		20028	0.0		0.0	False		,,,				2504	0.002					uc003hlb.2		NA																	2	Substitution - coding silent(2)		large_intestine(2)	large_intestine(5)	5						c.(2644-2646)CTC>CTT		Fraser syndrome 1							72.0	76.0	75.0					4																	79285132		2096	4230	6326	SO:0001819	synonymous_variant	80144				cell communication	integral to membrane|plasma membrane	metal ion binding	g.chr4:79285132C>T	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.2646C>T	4.37:g.79285132C>T			Somatic				FRAS1_uc003hkw.2_Silent_p.L882L	p.L882L	NM_025074	NP_079350	WXS	Illumina HiSeq	Unspecified	Q86XX4	FRAS1_HUMAN			22	3086	+			882			FU 10.|Extracellular (Potential).		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000325942.6	37	c.2646C>T	CCDS54772.1																																																																																				0.527	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2			3	24	0	0	0	0	3	24				
HERC3	8916	broad.mit.edu	37	4	89591032	89591032	+	Missense_Mutation	SNP	G	G	A	rs372500127		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr4:89591032G>A	ENST00000402738.1	+	15	1894	c.1655G>A	c.(1654-1656)tGc>tAc	p.C552Y	HERC3_ENST00000264345.3_Missense_Mutation_p.C552Y|HERC3_ENST00000543130.1_5'UTR	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	552					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		TCTCAGGTATGCCCGAAATAT	0.363																																						uc003hrw.1		NA																	0				lung(2)|prostate(1)|skin(1)	4						c.(1654-1656)TGC>TAC		hect domain and RLD 3		G	TYR/CYS	0,4406		0,0,2203	95.0	96.0	96.0		1655	5.1	1.0	4		96	1,8599	1.2+/-3.3	0,1,4299	no	missense	HERC3	NM_014606.1	194	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	552/1051	89591032	1,13005	2203	4300	6503	SO:0001583	missense	8916				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity	g.chr4:89591032G>A	D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.1655G>A	4.37:g.89591032G>A	ENSP00000385684:p.Cys552Tyr		Somatic				HERC3_uc011cdn.1_Missense_Mutation_p.C434Y|HERC3_uc011cdo.1_5'UTR	p.C552Y	NM_014606	NP_055421	WXS	Illumina HiSeq	Unspecified	Q15034	HERC3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000319)	15	1821	+			552					A8K1S5|Q8IXX3	Missense_Mutation	SNP	ENST00000402738.1	37	c.1655G>A	CCDS34028.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678145	0.47886	0.0	1.16E-4	ENSG00000138641	ENST00000402738;ENST00000264345	T;T	0.39229	1.09;1.09	5.08	5.08	0.68730	.	0.099573	0.64402	D	0.000001	T	0.34716	0.0907	N	0.22421	0.69	0.80722	D	1	P	0.50156	0.932	B	0.41917	0.37	T	0.29397	-1.0013	10	0.62326	D	0.03	.	19.0331	0.92965	0.0:0.0:1.0:0.0	.	552	Q15034	HERC3_HUMAN	Y	552	ENSP00000385684:C552Y;ENSP00000264345:C552Y	ENSP00000264345:C552Y	C	+	2	0	HERC3	89810055	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.776000	0.62354	2.802000	0.96397	0.655000	0.94253	TGC		0.363	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318081.2	NM_014606		20	137	0	0	0	0	20	137				
PAPSS1	9061	broad.mit.edu	37	4	108608212	108608212	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr4:108608212C>T	ENST00000265174.4	-	4	805	c.533G>A	c.(532-534)cGg>cAg	p.R178Q	PAPSS1_ENST00000511304.1_5'UTR	NM_005443.4	NP_005434.4	O43252	PAPS1_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 1	178					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			NS(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|ovary(1)	16		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)		TTCTCCTGCCCGGGCTTTTTT	0.363																																						uc003hyk.2		NA																	0				ovary(1)	1						c.(532-534)CGG>CAG		3'-phosphoadenosine 5'-phosphosulfate synthase							108.0	117.0	114.0					4																	108608212		2203	4300	6503	SO:0001583	missense	9061				3'-phosphoadenosine 5'-phosphosulfate biosynthetic process|skeletal system development|sulfate assimilation|xenobiotic metabolic process	cytosol	adenylylsulfate kinase activity|ATP binding|sulfate adenylyltransferase (ATP) activity	g.chr4:108608212C>T	Y10387	CCDS3676.1	4q24	2012-07-13			ENSG00000138801	ENSG00000138801	2.7.7.4, 2.7.1.25		8603	protein-coding gene	gene with protein product		603262				9576487, 9771708	Standard	NM_005443		Approved	ATPSK1, PAPSS	uc003hyk.3	O43252	OTTHUMG00000131210	ENST00000265174.4:c.533G>A	4.37:g.108608212C>T	ENSP00000265174:p.Arg178Gln		Somatic				PAPSS1_uc011cfh.1_Intron	p.R178Q	NM_005443	NP_005434	WXS	Illumina HiSeq	Unspecified	O43252	PAPS1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)	4	617	-		Hepatocellular(203;0.217)	178			Adenylyl-sulfate kinase.		O43841|O75332|Q96FB1|Q96TF4|Q9P1P9|Q9UE98	Missense_Mutation	SNP	ENST00000265174.4	37	c.533G>A	CCDS3676.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.511044	0.85389	.	.	ENSG00000138801	ENST00000265174	T	0.79033	-1.23	5.22	3.5	0.40072	Adenylylsulphate kinase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.83261	0.5216	H	0.95884	3.735	0.80722	D	1	B	0.20164	0.042	B	0.06405	0.002	T	0.80975	-0.1142	10	0.66056	D	0.02	-6.6337	11.4637	0.50225	0.0:0.8534:0.0:0.1466	.	178	O43252	PAPS1_HUMAN	Q	178	ENSP00000265174:R178Q	ENSP00000265174:R178Q	R	-	2	0	PAPSS1	108827661	0.998000	0.40836	1.000000	0.80357	0.990000	0.78478	5.567000	0.67378	0.602000	0.29896	0.555000	0.69702	CGG		0.363	PAPSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253946.2			11	238	0	0	0	0	11	238				
MORF4	10934	broad.mit.edu	37	4	174537544	174537545	+	IGR	DNP	CA	CA	GC			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr4:174537544_174537545CA>GC								RP11-475B2.1 (21837 upstream) : RP11-161D15.2 (279999 downstream)																							AATTAAGTCCCAGTCATCAACA	0.391																																						uc011cke.1		NA																	0					0						c.(250-252)TGG>GCG		mortality factor 4																																				SO:0001628	intergenic_variant	10934							g.chr4:174537544_174537545CA>GC																													4.37:g.174537544_174537545delinsGC			Somatic					p.W84A	NM_006792	NP_006783	WXS	Illumina HiSeq	Unspecified				all cancers(43;1.88e-18)|Epithelial(43;1.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)	1	250_251	-		Prostate(90;0.00201)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0765)|all_hematologic(60;0.107)							Missense_Mutation	DNP		37	c.250_251TG>GC																																																																																				0	0.391									31	253	0	0	0	0	31	253				
MROH2B	133558	broad.mit.edu	37	5	41018010	41018010	+	Silent	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr5:41018010G>A	ENST00000399564.4	-	28	3276	c.2826C>T	c.(2824-2826)acC>acT	p.T942T	MROH2B_ENST00000506092.2_Silent_p.T497T	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	942																	TGGTGGGCAGGGTATCACAGG	0.483																																						uc003jmj.3		NA																	0				ovary(6)|central_nervous_system(2)	8						c.(2824-2826)ACC>ACT		HEAT repeat family member 7B2							47.0	46.0	46.0					5																	41018010		1932	4137	6069	SO:0001819	synonymous_variant	133558						binding	g.chr5:41018010G>A		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2826C>T	5.37:g.41018010G>A			Somatic				HEATR7B2_uc003jmi.3_Silent_p.T497T	p.T942T	NM_173489	NP_775760	WXS	Illumina HiSeq	Unspecified	Q7Z745	HTRB2_HUMAN			28	3316	-			942					Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	ENST00000399564.4	37	c.2826C>T	CCDS47202.1																																																																																				0.483	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		7	12	0	0	0	0	7	12				
PPIP5K2	23262	broad.mit.edu	37	5	102487035	102487035	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr5:102487035A>T	ENST00000358359.3	+	9	1494	c.985A>T	c.(985-987)Aaa>Taa	p.K329*	PPIP5K2_ENST00000414217.1_Nonsense_Mutation_p.K329*|PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000321521.9_Nonsense_Mutation_p.K329*	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	329	Substrate binding.				inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						CAGTTTTGTGAAAAATTCCAT	0.308																																						uc003kod.3		NA																	0				ovary(1)|skin(1)	2						c.(985-987)AAA>TAA		Histidine acid phosphatase domain containing 1							84.0	91.0	89.0					5																	102487035		2203	4300	6503	SO:0001587	stop_gained	23262				inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity	g.chr5:102487035A>T	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.985A>T	5.37:g.102487035A>T	ENSP00000351126:p.Lys329*		Somatic				PPIP5K2_uc011cva.1_RNA|PPIP5K2_uc003koe.2_Nonsense_Mutation_p.K329*|PPIP5K2_uc010jbo.1_Nonsense_Mutation_p.K251*	p.K329*	NM_015216	NP_056031	WXS	Illumina HiSeq	Unspecified	O43314	VIP2_HUMAN			9	1504	+			329					A1NI53|A6NGS8|Q8TB50	Nonsense_Mutation	SNP	ENST00000358359.3	37	c.985A>T		.	.	.	.	.	.	.	.	.	.	A	36	5.973383	0.97162	.	.	ENSG00000145725	ENST00000321521;ENST00000507921;ENST00000358359;ENST00000451606;ENST00000414217	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1971	0.73100	1.0:0.0:0.0:0.0	.	.	.	.	X	329;251;329;329;329	.	ENSP00000313070:K329X	K	+	1	0	PPIP5K2	102514934	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.283000	0.95860	2.033000	0.60031	0.455000	0.32223	AAA		0.308	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216		31	131	0	0	0	0	31	131				
C5orf15	56951	broad.mit.edu	37	5	133295208	133295208	+	Missense_Mutation	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr5:133295208T>C	ENST00000231512.3	-	2	845	c.643A>G	c.(643-645)Att>Gtt	p.I215V	C5orf15_ENST00000507191.1_5'Flank	NM_020199.2	NP_064584.1	Q8NC54	KCT2_HUMAN	chromosome 5 open reading frame 15	215						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)			TGATATGTAATGTAAACAACA	0.294																																						uc003kyo.2		NA																	0					0						c.(643-645)ATT>GTT		keratinocytes associated transmembrane protein 2							38.0	41.0	40.0					5																	133295208		2203	4300	6503	SO:0001583	missense	56951					integral to membrane		g.chr5:133295208T>C	AF226055	CCDS4167.1	5q31.1	2012-02-22			ENSG00000113583	ENSG00000113583			20656	protein-coding gene	gene with protein product	"""keratinocytes associated transmembrane protein 2"""						Standard	NM_020199		Approved	KCT2, HTGN29	uc003kyo.3	Q8NC54	OTTHUMG00000129125	ENST00000231512.3:c.643A>G	5.37:g.133295208T>C	ENSP00000231512:p.Ile215Val		Somatic					p.I215V	NM_020199	NP_064584	WXS	Illumina HiSeq	Unspecified	Q8NC54	KCT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		2	774	-			215			Helical; (Potential).		B2RD10|D3DQ92|Q9NRG2	Missense_Mutation	SNP	ENST00000231512.3	37	c.643A>G	CCDS4167.1	.	.	.	.	.	.	.	.	.	.	T	8.073	0.770672	0.15983	.	.	ENSG00000113583	ENST00000231512;ENST00000451255	.	.	.	5.75	1.07	0.20283	.	0.372064	0.25786	N	0.028308	T	0.21427	0.0516	N	0.17723	0.515	0.29015	N	0.886623	B	0.10296	0.003	B	0.11329	0.006	T	0.28427	-1.0044	9	0.06891	T	0.86	-12.2516	9.324	0.37982	0.0:0.4497:0.0:0.5503	.	215	Q8NC54	KCT2_HUMAN	V	215;115	.	ENSP00000231512:I215V	I	-	1	0	C5orf15	133323107	1.000000	0.71417	0.535000	0.28026	0.929000	0.56500	1.081000	0.30791	0.236000	0.21180	-0.242000	0.12053	ATT		0.294	C5orf15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251175.1	NM_020199		12	68	0	0	0	0	12	68				
HARS2	23438	broad.mit.edu	37	5	140073602	140073602	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr5:140073602G>A	ENST00000230771.3	+	3	489	c.266G>A	c.(265-267)gGa>gAa	p.G89E	HARS2_ENST00000502303.1_3'UTR|HARS2_ENST00000448069.2_Intron|HARS_ENST00000457527.2_5'Flank|HARS2_ENST00000435019.2_Intron|HARS2_ENST00000437649.2_Missense_Mutation_p.G89E|HARS_ENST00000307633.3_5'Flank|HARS_ENST00000431330.2_5'Flank|HARS_ENST00000504156.1_5'Flank|HARS2_ENST00000508522.1_Missense_Mutation_p.G64E|HARS_ENST00000438307.2_5'Flank|HARS2_ENST00000432671.2_Intron|HARS_ENST00000415192.2_5'Flank|HARS_ENST00000448240.1_5'Flank	NM_012208.2	NP_036340.1	P49590	SYHM_HUMAN	histidyl-tRNA synthetase 2, mitochondrial	89					gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|large_intestine(5)|lung(10)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAACGTCATGGAGCAAAGGGG	0.478																																						uc003lgx.2		NA																	0					0						c.(265-267)GGA>GAA		histidyl-tRNA synthetase 2 precursor							144.0	144.0	144.0					5																	140073602		2203	4300	6503	SO:0001583	missense	23438				histidyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|histidine-tRNA ligase activity	g.chr5:140073602G>A	U18937	CCDS4238.1, CCDS64267.1	5q31.3	2012-07-20	2012-07-20	2007-02-23	ENSG00000112855	ENSG00000112855	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4817	protein-coding gene	gene with protein product	"""histidine tRNA ligase 2, mitochondrial (putative)"""	600783	"""histidyl-tRNA synthetase-like"""	HARSL		7755634, 21464306	Standard	NM_012208		Approved	HO3, HARSR	uc003lgx.3	P49590	OTTHUMG00000129500	ENST00000230771.3:c.266G>A	5.37:g.140073602G>A	ENSP00000230771:p.Gly89Glu		Somatic				HARS_uc003lgv.2_5'Flank|HARS_uc011czm.1_5'Flank|HARS_uc003lgw.2_5'Flank|HARS_uc011czn.1_5'Flank|HARS_uc010jfu.2_5'Flank|HARS_uc011czo.1_5'Flank|HARS_uc011czp.1_5'Flank|HARS_uc011czq.1_5'Flank|HARS2_uc010jfv.1_Missense_Mutation_p.G19E|HARS2_uc011czr.1_Missense_Mutation_p.G64E|HARS2_uc011czs.1_Missense_Mutation_p.G19E|HARS2_uc011czt.1_Intron|HARS2_uc011czu.1_5'Flank	p.G89E	NM_012208	NP_036340	WXS	Illumina HiSeq	Unspecified	P49590	SYHM_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		3	482	+			89					B4DDY8	Missense_Mutation	SNP	ENST00000230771.3	37	c.266G>A	CCDS4238.1	.	.	.	.	.	.	.	.	.	.	g	34	5.360490	0.95877	.	.	ENSG00000112855	ENST00000230771;ENST00000509299;ENST00000503873;ENST00000437649;ENST00000508522	T;T;T;T;T	0.78126	-0.4;0.61;0.61;-1.15;-0.4	6.17	6.17	0.99709	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.94503	0.8230	H	0.99705	4.715	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.96125	0.9088	10	0.87932	D	0	-12.3669	20.8794	0.99867	0.0:0.0:1.0:0.0	.	89;64;89;89	E9PG66;B4DDY8;B2R7G6;P49590	.;.;.;SYHM_HUMAN	E	89;95;95;89;64	ENSP00000230771:G89E;ENSP00000425695:G95E;ENSP00000424516:G95E;ENSP00000411708:G89E;ENSP00000423616:G64E	ENSP00000230771:G89E	G	+	2	0	HARS2	140053786	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.357000	0.97099	2.941000	0.99782	0.655000	0.94253	GGA		0.478	HARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251670.2	NM_012208		59	245	0	0	0	0	59	245				
PCDHGB7	56099	broad.mit.edu	37	5	140798230	140798230	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr5:140798230C>A	ENST00000398594.2	+	1	804	c.804C>A	c.(802-804)gaC>gaA	p.D268E	PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA6_ENST00000517434.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	268	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGCCACTGACCAGGACGAGG	0.532																																						uc003lkn.1		NA																	0				ovary(2)	2						c.(802-804)GAC>GAA		protocadherin gamma subfamily B, 7 isoform 1							57.0	59.0	59.0					5																	140798230		2056	4192	6248	SO:0001583	missense	56099				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140798230C>A	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.804C>A	5.37:g.140798230C>A	ENSP00000381594:p.Asp268Glu		Somatic				PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Missense_Mutation_p.D268E|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	p.D268E	NM_018927	NP_061750	WXS	Illumina HiSeq	Unspecified	Q9Y5F8	PCDGJ_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	949	+			268			Extracellular (Potential).|Cadherin 3.		Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	c.804C>A	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	c	16.72	3.202193	0.58234	.	.	ENSG00000254122	ENST00000398594	T	0.73897	-0.79	5.7	-0.843	0.10744	Cadherin (5);Cadherin-like (1);	0.000000	0.33834	U	0.004513	D	0.88540	0.6464	H	0.97158	3.95	0.09310	N	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80703	-0.1264	10	0.87932	D	0	.	10.7559	0.46237	0.0:0.3012:0.0:0.6988	.	268;268	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	E	268	ENSP00000381594:D268E	ENSP00000381594:D268E	D	+	3	2	PCDHGB7	140778414	0.000000	0.05858	0.402000	0.26371	0.980000	0.70556	-1.167000	0.03126	0.003000	0.14656	0.561000	0.74099	GAC		0.532	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927		13	68	1	0	0.000151284	0.000161681	13	68				
CRISP2	7180	broad.mit.edu	37	6	49667570	49667570	+	Missense_Mutation	SNP	C	C	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr6:49667570C>G	ENST00000339139.4	-	6	454	c.218G>C	c.(217-219)aGg>aCg	p.R73T		NM_001142407.2|NM_001142408.2|NM_001142417.2|NM_001142435.2|NM_001261822.1|NM_003296.3	NP_001135879.1|NP_001135880.1|NP_001135889.1|NP_001135907.1|NP_001248751.1|NP_003287.1	P16562	CRIS2_HUMAN	cysteine-rich secretory protein 2	73	SCP.				single organismal cell-cell adhesion (GO:0016337)	extracellular space (GO:0005615)				kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	19	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			GTTTGCCCACCTTTGGGCATT	0.333																																						uc003ozq.2		NA																	0				skin(1)	1						c.(217-219)AGG>ACG		cysteine-rich secretory protein 2 precursor							149.0	122.0	131.0					6																	49667570		2203	4300	6503	SO:0001583	missense	7180					extracellular space		g.chr6:49667570C>G	X95239	CCDS4928.1	6p12.3	2009-03-12	2003-09-03	2003-09-05	ENSG00000124490	ENSG00000124490			12024	protein-coding gene	gene with protein product	"""cancer/testis antigen 36"""	187430	"""testis specific protein 1 (probe H4-1 p3-1)"""	GAPDL5, TPX1		2613236, 8665901	Standard	NM_003296		Approved	CRISP-2, CT36	uc003ozo.3	P16562	OTTHUMG00000014822	ENST00000339139.4:c.218G>C	6.37:g.49667570C>G	ENSP00000339155:p.Arg73Thr		Somatic				CRISP2_uc003ozl.2_Missense_Mutation_p.R73T|CRISP2_uc003ozn.2_Missense_Mutation_p.R73T|CRISP2_uc003ozr.2_Missense_Mutation_p.R73T|CRISP2_uc003ozo.2_Missense_Mutation_p.R73T|CRISP2_uc003ozm.2_Missense_Mutation_p.R73T|CRISP2_uc003ozp.2_Missense_Mutation_p.R73T	p.R73T	NM_001142408	NP_001135880	WXS	Illumina HiSeq	Unspecified	P16562	CRIS2_HUMAN	KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)		6	474	-	Lung NSC(77;0.0161)		73					A8K8M0|Q53FF2|Q5U8Z9|Q7Z7B2	Missense_Mutation	SNP	ENST00000339139.4	37	c.218G>C	CCDS4928.1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.772709	0.31411	.	.	ENSG00000124490	ENST00000339139;ENST00000211238	T	0.07327	3.2	5.02	2.5	0.30297	CAP domain (3);	0.522563	0.21197	N	0.078528	T	0.02267	0.0070	L	0.41710	1.295	0.28369	N	0.920083	B;B	0.26672	0.139;0.156	B;B	0.32864	0.154;0.114	T	0.42682	-0.9437	10	0.29301	T	0.29	.	4.3501	0.11151	0.0:0.1057:0.2027:0.6916	.	73;73	Q7Z7B2;P16562	.;CRIS2_HUMAN	T	73	ENSP00000339155:R73T	ENSP00000211238:R73T	R	-	2	0	CRISP2	49775529	0.945000	0.32115	1.000000	0.80357	0.496000	0.33645	0.837000	0.27558	1.046000	0.40249	-0.312000	0.09012	AGG		0.333	CRISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040870.2	NM_003296		12	78	0	0	0	0	12	78				
MICAL1	64780	broad.mit.edu	37	6	109766112	109766112	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr6:109766112C>T	ENST00000358807.3	-	23	3279	c.2968G>A	c.(2968-2970)Gag>Aag	p.E990K	MICAL1_ENST00000368952.4_Missense_Mutation_p.E1009K|MICAL1_ENST00000358577.3_Missense_Mutation_p.E904K	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	990					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		ATCATGAGCTCGGCCTCCTCA	0.552																																						uc003ptj.2		NA																	0				breast(2)|ovary(1)	3						c.(2968-2970)GAG>AAG		microtubule associated monoxygenase, calponin							156.0	152.0	154.0					6																	109766112		2203	4300	6503	SO:0001583	missense	64780				cytoskeleton organization|signal transduction	cytoplasm|intermediate filament	SH3 domain binding|zinc ion binding	g.chr6:109766112C>T	AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.2968G>A	6.37:g.109766112C>T	ENSP00000351664:p.Glu990Lys		Somatic				MICAL1_uc003ptk.2_Missense_Mutation_p.E990K|MICAL1_uc010kdr.2_Missense_Mutation_p.E904K|MICAL1_uc011eaq.1_Missense_Mutation_p.E1009K	p.E990K	NM_022765	NP_073602	WXS	Illumina HiSeq	Unspecified	Q8TDZ2	MICA1_HUMAN		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)	22	3222	-		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)	990					B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Missense_Mutation	SNP	ENST00000358807.3	37	c.2968G>A	CCDS5076.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.211261	0.79240	.	.	ENSG00000135596	ENST00000358807;ENST00000368952;ENST00000358577;ENST00000368957;ENST00000335266	T;T;T	0.57107	0.42;0.42;0.42	5.85	5.85	0.93711	Domain of unknown function DUF3585 (1);	0.067272	0.64402	D	0.000017	T	0.60869	0.2302	M	0.88241	2.94	0.40232	D	0.977864	D;P;D	0.57571	0.98;0.954;0.98	P;B;P	0.48795	0.59;0.266;0.59	T	0.71248	-0.4649	10	0.87932	D	0	.	15.6578	0.77155	0.0:1.0:0.0:0.0	.	1009;904;990	B7Z3R5;Q8TDZ2-2;Q8TDZ2	.;.;MICA1_HUMAN	K	990;1009;904;514;246	ENSP00000351664:E990K;ENSP00000357948:E1009K;ENSP00000351385:E904K	ENSP00000335372:E246K	E	-	1	0	MICAL1	109872805	1.000000	0.71417	0.997000	0.53966	0.948000	0.59901	5.598000	0.67585	2.767000	0.95098	0.655000	0.94253	GAG		0.552	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2	NM_022765		5	242	0	0	0	0	5	242				
SOD2	6648	broad.mit.edu	37	6	160106063	160106063	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr6:160106063C>T	ENST00000546087.1	-	6	2035	c.208G>A	c.(208-210)Gag>Aag	p.E70K	SOD2_ENST00000337404.4_Missense_Mutation_p.E77K|SOD2_ENST00000444946.2_Intron|SOD2_ENST00000367055.4_Missense_Mutation_p.E116K|SOD2_ENST00000538183.2_Missense_Mutation_p.E116K|SOD2_ENST00000367054.2_Missense_Mutation_p.E77K			P04179	SODM_HUMAN	superoxide dismutase 2, mitochondrial	116					age-dependent response to reactive oxygen species (GO:0001315)|cellular response to ethanol (GO:0071361)|detection of oxygen (GO:0003032)|erythrophore differentiation (GO:0048773)|glutathione metabolic process (GO:0006749)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|hydrogen peroxide biosynthetic process (GO:0050665)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|iron ion homeostasis (GO:0055072)|liver development (GO:0001889)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|oxygen homeostasis (GO:0032364)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to gamma radiation (GO:0010332)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to lipopolysaccharide (GO:0032496)|response to manganese ion (GO:0010042)|response to selenium ion (GO:0010269)|response to silicon dioxide (GO:0034021)|response to superoxide (GO:0000303)|response to zinc ion (GO:0010043)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)|vasodilation by acetylcholine involved in regulation of systemic arterial blood pressure (GO:0003069)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|manganese ion binding (GO:0030145)|oxygen binding (GO:0019825)|superoxide dismutase activity (GO:0004784)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(3)|skin(1)	14		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.103)		OV - Ovarian serous cystadenocarcinoma(65;1.4e-18)|BRCA - Breast invasive adenocarcinoma(81;5.77e-06)		TCCAGCAACTCCCCTATTAAA	0.373																																						uc003qsg.2		NA																	0					0						c.(346-348)GAG>AAG		manganese superoxide dismutase isoform A							54.0	52.0	53.0					6																	160106063		2203	4300	6503	SO:0001583	missense	6648				age-dependent response to reactive oxygen species|negative regulation of neuron apoptosis|oxygen homeostasis|protein homotetramerization|regulation of transcription from RNA polymerase II promoter|release of cytochrome c from mitochondria|removal of superoxide radicals|vasodilation by acetylcholine involved in regulation of systemic arterial blood pressure		manganese ion binding|superoxide dismutase activity	g.chr6:160106063C>T	M36693	CCDS5265.1, CCDS34564.1	6q25	2008-02-05			ENSG00000112096	ENSG00000112096	1.15.1.1		11180	protein-coding gene	gene with protein product		147460					Standard	NM_000636		Approved		uc003qsg.3	P04179	OTTHUMG00000015940	ENST00000546087.1:c.208G>A	6.37:g.160106063C>T	ENSP00000442920:p.Glu70Lys		Somatic				SOD2_uc003qsh.2_Missense_Mutation_p.E77K|SOD2_uc003qsi.1_Missense_Mutation_p.E116K|SOD2_uc011efu.1_Intron|SOD2_uc011efv.1_Missense_Mutation_p.E77K	p.E116K	NM_001024465	NP_001019636	WXS	Illumina HiSeq	Unspecified	P04179	SODM_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.4e-18)|BRCA - Breast invasive adenocarcinoma(81;5.77e-06)	4	500	-		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.103)	116					B2R7R1|B3KUK2|B4DL20|B4E3K9|E1P5A9|P78434|Q16792|Q5TCM1|Q96EE6|Q9P2Z3	Missense_Mutation	SNP	ENST00000546087.1	37	c.346G>A		.	.	.	.	.	.	.	.	.	.	C	17.36	3.369601	0.61624	.	.	ENSG00000112096	ENST00000367055;ENST00000538183;ENST00000367054;ENST00000546087;ENST00000337404;ENST00000545162;ENST00000535561;ENST00000537657;ENST00000401980	T;T;T;T;T;T;T;T;T	0.44083	0.93;0.93;1.66;0.93;1.66;0.93;0.93;0.93;1.66	5.5	4.61	0.57282	Manganese/iron superoxide dismutase, C-terminal (2);	0.093741	0.64402	D	0.000001	T	0.26991	0.0661	L	0.52266	1.64	0.80722	D	1	B;B;B	0.10296	0.0;0.003;0.001	B;B;B	0.20577	0.001;0.03;0.003	T	0.14090	-1.0485	10	0.54805	T	0.06	3.5875	16.4608	0.84044	0.0:0.8684:0.1316:0.0	.	112;77;116	Q7Z7M4;B4DL20;P04179	.;.;SODM_HUMAN	K	116;116;77;70;77;139;139;70;31	ENSP00000356022:E116K;ENSP00000446252:E116K;ENSP00000356021:E77K;ENSP00000442920:E70K;ENSP00000337127:E77K;ENSP00000441362:E139K;ENSP00000445015:E139K;ENSP00000439191:E70K;ENSP00000384196:E31K	ENSP00000337127:E77K	E	-	1	0	SOD2	160026053	1.000000	0.71417	0.997000	0.53966	0.779000	0.44077	5.523000	0.67099	1.425000	0.47237	0.650000	0.86243	GAG		0.373	SOD2-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000399943.1	NM_000636		7	49	0	0	0	0	7	49				
EIF3B	8662	broad.mit.edu	37	7	2409152	2409153	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr7:2409152_2409153GC>TT	ENST00000360876.4	+	10	1505_1506	c.1449_1450GC>TT	c.(1447-1452)gtGCct>gtTTct	p.P484S	EIF3B_ENST00000397011.2_Missense_Mutation_p.P484S	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		CCTTCTGGGTGCCTGAAGACAA	0.47																																						uc003slx.2		NA																	0					0						c.(1447-1452)GTGCCT>GTTTCT		eukaryotic translation initiation factor 3,																																				SO:0001583	missense	8662				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity	g.chr7:2409152_2409153GC>TT	U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	Exception_encountered	7.37:g.2409152_2409153delinsTT	ENSP00000354125:p.Pro484Ser		Somatic				EIF3B_uc003sly.2_Missense_Mutation_p.P484S|EIF3B_uc003sma.2_Missense_Mutation_p.P212S	p.P484S	NM_003751	NP_003742	WXS	Illumina HiSeq	Unspecified	P55884	EIF3B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)	10	1532_1533	+		Ovarian(82;0.0253)	484						Missense_Mutation	DNP	ENST00000360876.4	37	c.1449_1450GC>TT	CCDS5332.1																																																																																				0.470	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207006.1			48	338	0	0	0	0	48	338				
SEMA3A	10371	broad.mit.edu	37	7	83606507	83606507	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr7:83606507G>A	ENST00000265362.4	-	15	1972	c.1658C>T	c.(1657-1659)aCa>aTa	p.T553I	SEMA3A_ENST00000436949.1_Missense_Mutation_p.T553I	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	553					apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						TTGTCGTCTTGTGCGTCTGAA	0.343																																						uc003uhz.2		NA																	0				ovary(2)|breast(1)|kidney(1)	4						c.(1657-1659)ACA>ATA		semaphorin 3A precursor							235.0	207.0	217.0					7																	83606507		2203	4300	6503	SO:0001583	missense	10371				axon guidance	extracellular region|membrane	receptor activity	g.chr7:83606507G>A	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1658C>T	7.37:g.83606507G>A	ENSP00000265362:p.Thr553Ile		Somatic					p.T553I	NM_006080	NP_006071	WXS	Illumina HiSeq	Unspecified	Q14563	SEM3A_HUMAN			15	1973	-			553						Missense_Mutation	SNP	ENST00000265362.4	37	c.1658C>T	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.063292	0.76187	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.22539	1.95;1.95	5.01	5.01	0.66863	.	0.047406	0.85682	D	0.000000	T	0.31420	0.0796	M	0.65975	2.015	0.80722	D	1	P	0.42827	0.791	P	0.45232	0.474	T	0.04178	-1.0971	10	0.28530	T	0.3	.	17.9458	0.89038	0.0:0.0:1.0:0.0	.	553	Q14563	SEM3A_HUMAN	I	553	ENSP00000265362:T553I;ENSP00000415260:T553I	ENSP00000265362:T553I	T	-	2	0	SEMA3A	83444443	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.748000	0.85085	2.324000	0.78689	0.585000	0.79938	ACA		0.343	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080		18	120	0	0	0	0	18	120				
MUC17	140453	broad.mit.edu	37	7	100679879	100679879	+	Missense_Mutation	SNP	C	C	T	rs71273404		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr7:100679879C>T	ENST00000306151.4	+	3	5246	c.5182C>T	c.(5182-5184)Cgt>Tgt	p.R1728C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1728	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TACTGAAGCCCGTTCATCTCC	0.498																																						uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(5182-5184)CGT>TGT		mucin 17 precursor		A	CYS/ARG	0,4406		0,0,2203	238.0	244.0	242.0		5182	1.1	0.0	7	dbSNP_130	242	1,8599	1.2+/-3.3	0,1,4299	no	missense	MUC17	NM_001040105.1	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1728/4494	100679879	1,13005	2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100679879C>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5182C>T	7.37:g.100679879C>T	ENSP00000302716:p.Arg1728Cys		Somatic				MUC17_uc010lho.1_RNA	p.R1728C	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	5235	+	Lung NSC(181;0.136)|all_lung(186;0.182)		1728			Extracellular (Potential).|59 X approximate tandem repeats.|27.|Ser-rich.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.5182C>T	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	2.003	-0.428999	0.04701	0.0	1.16E-4	ENSG00000169876	ENST00000306151	T	0.02236	4.38	1.08	1.08	0.20341	.	.	.	.	.	T	0.01254	0.0041	N	0.08118	0	0.09310	N	1	B	0.26744	0.158	B	0.04013	0.001	T	0.48293	-0.9048	9	0.56958	D	0.05	.	4.0074	0.09607	0.6171:0.3829:0.0:0.0	.	1728	Q685J3	MUC17_HUMAN	C	1728	ENSP00000302716:R1728C	ENSP00000302716:R1728C	R	+	1	0	MUC17	100466599	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	0.565000	0.23578	-0.046000	0.13446	-1.596000	0.00833	CGT		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		58	353	0	0	0	0	58	353				
MUC17	140453	broad.mit.edu	37	7	100683048	100683048	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr7:100683048C>A	ENST00000306151.4	+	3	8415	c.8351C>A	c.(8350-8352)aCt>aAt	p.T2784N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2784	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCTGTCACCACTTCTACTGAA	0.478																																						uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(8350-8352)ACT>AAT		mucin 17 precursor							253.0	246.0	248.0					7																	100683048		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100683048C>A	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8351C>A	7.37:g.100683048C>A	ENSP00000302716:p.Thr2784Asn		Somatic				MUC17_uc010lho.1_RNA	p.T2784N	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	8404	+	Lung NSC(181;0.136)|all_lung(186;0.182)		2784			Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|45.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.8351C>A	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	7.416	0.635702	0.14322	.	.	ENSG00000169876	ENST00000306151	T	0.02974	4.09	1.06	0.122	0.14702	.	.	.	.	.	T	0.04092	0.0114	L	0.29908	0.895	0.09310	N	1	P	0.51653	0.947	P	0.55965	0.788	T	0.44406	-0.9330	9	0.26408	T	0.33	.	3.8136	0.08806	0.0:0.5217:0.0:0.4783	.	2784	Q685J3	MUC17_HUMAN	N	2784	ENSP00000302716:T2784N	ENSP00000302716:T2784N	T	+	2	0	MUC17	100469768	0.001000	0.12720	0.000000	0.03702	0.008000	0.06430	0.316000	0.19469	0.034000	0.15491	0.134000	0.15878	ACT		0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		9	340	1	0	2.18e-05	2.36e-05	9	340				
MUC17	140453	broad.mit.edu	37	7	100686329	100686329	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr7:100686329A>G	ENST00000306151.4	+	3	11696	c.11632A>G	c.(11632-11634)Act>Gct	p.T3878A		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3878					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCCATTAACAACTCTCCTTGT	0.468																																						uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(11632-11634)ACT>GCT		mucin 17 precursor							157.0	146.0	150.0					7																	100686329		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100686329A>G	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11632A>G	7.37:g.100686329A>G	ENSP00000302716:p.Thr3878Ala		Somatic				MUC17_uc010lho.1_RNA	p.T3878A	NM_001040105	NP_001035194	WXS	Illumina HiSeq	Unspecified	Q685J3	MUC17_HUMAN			3	11685	+	Lung NSC(181;0.136)|all_lung(186;0.182)		3878			Extracellular (Potential).		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.11632A>G	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	a	8.321	0.824414	0.16678	.	.	ENSG00000169876	ENST00000306151	T	0.02682	4.2	1.14	-0.904	0.10530	.	.	.	.	.	T	0.01765	0.0056	N	0.14661	0.345	0.09310	N	0.999999	P	0.50819	0.939	B	0.43386	0.418	T	0.44498	-0.9324	9	0.24483	T	0.36	.	3.0361	0.06122	0.6109:0.0:0.0:0.3891	.	3878	Q685J3	MUC17_HUMAN	A	3878	ENSP00000302716:T3878A	ENSP00000302716:T3878A	T	+	1	0	MUC17	100473049	0.000000	0.05858	0.035000	0.18076	0.203000	0.24098	0.114000	0.15520	-0.513000	0.06496	0.158000	0.16466	ACT		0.468	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		38	185	0	0	0	0	38	185				
MOGAT3	346606	broad.mit.edu	37	7	100843751	100843751	+	Missense_Mutation	SNP	A	A	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr7:100843751A>T	ENST00000223114.4	-	2	321	c.155T>A	c.(154-156)cTc>cAc	p.L52H	MOGAT3_ENST00000379423.3_Missense_Mutation_p.L52H|MOGAT3_ENST00000440203.2_Missense_Mutation_p.L52H	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	52					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					GAAGGGCCAGAGTGACGTGAA	0.527																																						uc003uyc.2		NA																	0				ovary(2)	2						c.(154-156)CTC>CAC		monoacylglycerol O-acyltransferase 3							75.0	77.0	76.0					7																	100843751		2203	4300	6503	SO:0001583	missense	346606				glycerol metabolic process|lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity|diacylglycerol O-acyltransferase activity	g.chr7:100843751A>T	AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.155T>A	7.37:g.100843751A>T	ENSP00000223114:p.Leu52His		Somatic				MOGAT3_uc010lhr.2_Missense_Mutation_p.L52H	p.L52H	NM_178176	NP_835470	WXS	Illumina HiSeq	Unspecified	Q86VF5	MOGT3_HUMAN			2	322	-	Lung NSC(181;0.168)|all_lung(186;0.215)		52			Helical; (Potential).		Q496A6|Q496A7|Q496A8|Q9UDW7	Missense_Mutation	SNP	ENST00000223114.4	37	c.155T>A	CCDS5714.1	.	.	.	.	.	.	.	.	.	.	.	16.85	3.237753	0.58886	.	.	ENSG00000106384	ENST00000223114;ENST00000440203;ENST00000379423	D;T;T	0.94184	-3.37;2.46;2.46	4.25	2.87	0.33458	.	0.307372	0.27092	N	0.020975	D	0.94434	0.8209	L	0.58969	1.84	0.42835	D	0.994031	D;D	0.71674	0.997;0.998	D;D	0.66847	0.912;0.947	D	0.92517	0.6021	10	0.48119	T	0.1	-29.9026	8.95	0.35783	0.6944:0.3056:0.0:0.0	.	52;52	Q86VF5-2;Q86VF5	.;MOGT3_HUMAN	H	52	ENSP00000223114:L52H;ENSP00000403756:L52H;ENSP00000368734:L52H	ENSP00000223114:L52H	L	-	2	0	MOGAT3	100630471	0.997000	0.39634	0.010000	0.14722	0.042000	0.13812	5.142000	0.64820	0.465000	0.27167	0.523000	0.50628	CTC		0.527	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059649.3	NM_178176		7	27	0	0	0	0	7	27				
LRRN3	54674	broad.mit.edu	37	7	110762919	110762919	+	Silent	SNP	C	C	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr7:110762919C>A	ENST00000422987.3	+	2	922	c.91C>A	c.(91-93)Cgg>Agg	p.R31R	IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000331762.3_Intron|LRRN3_ENST00000451085.1_Silent_p.R31R|LRRN3_ENST00000308478.5_Silent_p.R31R|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000447215.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	31	LRRNT.				positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		GGATTGTCCACGGTTATGTAC	0.408																																						uc003vft.3		NA																	0				skin(3)|ovary(2)|pancreas(2)|central_nervous_system(1)	8						c.(91-93)CGG>AGG		leucine rich repeat neuronal 3 precursor							145.0	129.0	135.0					7																	110762919		2203	4300	6503	SO:0001819	synonymous_variant	54674					integral to membrane		g.chr7:110762919C>A	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.91C>A	7.37:g.110762919C>A			Somatic				IMMP2L_uc003vfq.1_Intron|IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron|LRRN3_uc003vfu.3_Silent_p.R31R|LRRN3_uc003vfs.3_Silent_p.R31R	p.R31R	NM_001099660	NP_001093130	WXS	Illumina HiSeq	Unspecified	Q9H3W5	LRRN3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)	4	1137	+			31			Extracellular (Potential).|LRRNT.		O43377|Q6I9V8|Q8IYQ6	Silent	SNP	ENST00000422987.3	37	c.91C>A	CCDS5754.1																																																																																				0.408	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334		21	148	1	0	2.38e-13	2.73e-13	21	148				
NRF1	4899	broad.mit.edu	37	7	129297354	129297354	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr7:129297354G>T	ENST00000393232.1	+	2	280	c.163G>T	c.(163-165)Gac>Tac	p.D55Y	NRF1_ENST00000393230.2_Missense_Mutation_p.D55Y|NRF1_ENST00000539636.1_5'UTR|NRF1_ENST00000311967.2_Missense_Mutation_p.D55Y|NRF1_ENST00000393231.3_Missense_Mutation_p.D55Y|NRF1_ENST00000353868.4_Missense_Mutation_p.D55Y|NRF1_ENST00000223190.4_Missense_Mutation_p.D55Y	NM_005011.3	NP_005002.3	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	55	Asp/Glu-rich (acidic).|Dimerization.				cellular lipid metabolic process (GO:0044255)|generation of precursor metabolites and energy (GO:0006091)|mitochondrion organization (GO:0007005)|organ regeneration (GO:0031100)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	24						CTCTTACGATGACTCAGATAT	0.478																																						uc003voz.2		NA																	0				ovary(1)	1						c.(163-165)GAC>TAC		nuclear respiratory factor 1							103.0	89.0	93.0					7																	129297354		2203	4300	6503	SO:0001583	missense	4899				generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding	g.chr7:129297354G>T	L22454	CCDS5813.2	7q32	2008-07-18			ENSG00000106459	ENSG00000106459			7996	protein-coding gene	gene with protein product	"""alpha palindromic-binding protein"""	600879				2584221	Standard	NM_005011		Approved	EWG, ALPHA-PAL	uc003voz.3	Q16656	OTTHUMG00000143736	ENST00000393232.1:c.163G>T	7.37:g.129297354G>T	ENSP00000376924:p.Asp55Tyr		Somatic				NRF1_uc003vpa.2_Missense_Mutation_p.D55Y|NRF1_uc011kpa.1_5'UTR|NRF1_uc003vpb.2_Missense_Mutation_p.D55Y	p.D55Y	NM_005011	NP_005002	WXS	Illumina HiSeq	Unspecified	Q16656	NRF1_HUMAN			2	280	+			55			Dimerization.|Asp/Glu-rich (acidic).		A8K4C6|B4DDV6|Q15305|Q96AN2	Missense_Mutation	SNP	ENST00000393232.1	37	c.163G>T	CCDS5813.2	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989487	0.74589	.	.	ENSG00000106459	ENST00000393232;ENST00000353868;ENST00000454688;ENST00000223190;ENST00000311967;ENST00000393230;ENST00000393231	.	.	.	5.53	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.50871	0.1641	N	0.19112	0.55	0.80722	D	1	D;D	0.55385	0.971;0.971	P;P	0.54401	0.751;0.671	T	0.57248	-0.7844	9	0.87932	D	0	-13.7393	13.6529	0.62320	0.0746:0.0:0.9254:0.0	.	55;55	Q96AN2;Q16656	.;NRF1_HUMAN	Y	55	.	ENSP00000223190:D55Y	D	+	1	0	NRF1	129084590	1.000000	0.71417	0.985000	0.45067	0.863000	0.49368	9.361000	0.97122	1.350000	0.45770	0.585000	0.79938	GAC		0.478	NRF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289813.1	NM_001040110		9	124	1	0	4.69e-08	5.26e-08	9	124				
ST18	9705	broad.mit.edu	37	8	53055550	53055550	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr8:53055550G>A	ENST00000276480.7	-	17	2791	c.2108C>T	c.(2107-2109)gCc>gTc	p.A703V		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	703					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGGTATAGAGGCCTCTCCAGG	0.418																																						uc003xqz.2		NA																	0				ovary(4)|skin(1)	5						c.(2107-2109)GCC>GTC		suppression of tumorigenicity 18							143.0	136.0	138.0					8																	53055550		2203	4300	6503	SO:0001583	missense	9705					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:53055550G>A	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2108C>T	8.37:g.53055550G>A	ENSP00000276480:p.Ala703Val		Somatic				ST18_uc011ldq.1_Missense_Mutation_p.A350V|ST18_uc011ldr.1_Missense_Mutation_p.A668V|ST18_uc011lds.1_Missense_Mutation_p.A608V|ST18_uc003xra.2_Missense_Mutation_p.A703V	p.A703V	NM_014682	NP_055497	WXS	Illumina HiSeq	Unspecified	O60284	ST18_HUMAN			12	2264	-		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)	703					Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	c.2108C>T	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	G	3.564	-0.089122	0.07097	.	.	ENSG00000147488	ENST00000276480	T	0.39997	1.05	5.33	4.34	0.51931	Myelin transcription factor 1 (1);	0.383878	0.30003	N	0.010657	T	0.12561	0.0305	N	0.01649	-0.78	0.27267	N	0.958476	B	0.11235	0.004	B	0.14578	0.011	T	0.34750	-0.9816	10	0.02654	T	1	-11.212	6.3545	0.21395	0.2192:0.0:0.7808:0.0	.	703	O60284	ST18_HUMAN	V	703	ENSP00000276480:A703V	ENSP00000276480:A703V	A	-	2	0	ST18	53218103	0.985000	0.35326	0.997000	0.53966	0.643000	0.38383	1.869000	0.39519	2.507000	0.84556	0.650000	0.86243	GCC		0.418	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1			25	193	0	0	0	0	25	193				
ATP6V1H	51606	broad.mit.edu	37	8	54730074	54730074	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr8:54730074A>G	ENST00000359530.2	-	5	586	c.323T>C	c.(322-324)gTt>gCt	p.V108A	ATP6V1H_ENST00000520188.1_Missense_Mutation_p.V68A|ATP6V1H_ENST00000355221.3_Missense_Mutation_p.V108A|ATP6V1H_ENST00000396774.2_Missense_Mutation_p.V108A	NM_015941.3	NP_057025.2	Q9UI12	VATH_HUMAN	ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H	108					ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|endocytosis (GO:0006897)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|regulation of catalytic activity (GO:0050790)|regulation of defense response to virus by virus (GO:0050690)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V1 domain (GO:0000221)	enzyme regulator activity (GO:0030234)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	18		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)			GAAAATGCTAACACGCTGATG	0.413																																						uc003xrl.2		NA																	0					0						c.(322-324)GTT>GCT		ATPase, H+ transporting, lysosomal 50/57kDa, V1							82.0	74.0	77.0					8																	54730074		2203	4300	6503	SO:0001583	missense	51606				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|endocytosis|insulin receptor signaling pathway|interspecies interaction between organisms|regulation of defense response to virus by virus|transferrin transport|vacuolar acidification|viral reproduction	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase, V1 domain	enzyme regulator activity|protein binding|proton-transporting ATPase activity, rotational mechanism	g.chr8:54730074A>G	AF132945	CCDS6153.1, CCDS6154.1	8q11.2	2011-05-24	2002-08-29		ENSG00000047249	ENSG00000047249		"""ATPases / V-type"""	18303	protein-coding gene	gene with protein product	"""vacuolar ATP synthase subunit H"""	608861	"""ATPase, H+ transporting, lysosomal 50/57kD, V1 subunit H"""			9620685, 10810093	Standard	NM_015941		Approved	CGI-11, SFD, VMA13, SFDalpha, SFDbeta	uc003xrm.4	Q9UI12	OTTHUMG00000164231	ENST00000359530.2:c.323T>C	8.37:g.54730074A>G	ENSP00000352522:p.Val108Ala		Somatic				ATP6V1H_uc003xrk.2_Missense_Mutation_p.V68A|ATP6V1H_uc003xrm.2_Missense_Mutation_p.V108A|ATP6V1H_uc003xrn.2_Missense_Mutation_p.V108A|ATP6V1H_uc011ldv.1_Missense_Mutation_p.V28A|ATP6V1H_uc010lyd.2_Missense_Mutation_p.V44A	p.V108A	NM_213620	NP_998785	WXS	Illumina HiSeq	Unspecified	Q9UI12	VATH_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)		5	475	-		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	108					B3KMR0|Q6PK44|Q9H3E3|Q9Y300	Missense_Mutation	SNP	ENST00000359530.2	37	c.323T>C	CCDS6153.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.861833	0.91433	.	.	ENSG00000047249	ENST00000355221;ENST00000520188;ENST00000359530;ENST00000396774;ENST00000520070	.	.	.	5.63	5.63	0.86233	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64360	0.2591	L	0.53561	1.675	0.80722	D	1	P;P	0.46064	0.73;0.872	P;P	0.54706	0.495;0.759	T	0.59123	-0.7513	9	0.10902	T	0.67	-23.0296	15.8419	0.78852	1.0:0.0:0.0:0.0	.	108;108	Q9UI12-2;Q9UI12	.;VATH_HUMAN	A	108;68;108;108;88	.	ENSP00000347359:V108A	V	-	2	0	ATP6V1H	54892627	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.337000	0.96545	2.137000	0.66172	0.533000	0.62120	GTT		0.413	ATP6V1H-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377865.1	NM_015941		13	51	0	0	0	0	13	51				
RALYL	138046	broad.mit.edu	37	8	85774590	85774590	+	Missense_Mutation	SNP	G	G	A	rs371267637		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr8:85774590G>A	ENST00000521268.1	+	6	1578	c.473G>A	c.(472-474)cGt>cAt	p.R158H	RALYL_ENST00000521376.1_Missense_Mutation_p.R69H|RALYL_ENST00000521695.1_Missense_Mutation_p.R158H|RALYL_ENST00000517638.1_Missense_Mutation_p.R171H|RALYL_ENST00000518566.1_Missense_Mutation_p.R147H|RALYL_ENST00000522455.1_Missense_Mutation_p.R158H|RALYL_ENST00000523850.1_Missense_Mutation_p.R85H	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	158							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						CCGCTGAAGCGTCCCAGAGTG	0.507													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15673	0.0		0.0	False		,,,				2504	0.0					uc003ycq.3		NA																	0				ovary(1)	1						c.(472-474)CGT>CAT		RALY RNA binding protein-like isoform 2		G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	2,3846		0,2,1922	59.0	61.0	60.0		512,473,473,473	5.2	1.0	8		60	1,8273		0,1,4136	no	missense,missense,missense,missense	RALYL	NM_001100391.1,NM_001100392.1,NM_001100393.1,NM_173848.5	29,29,29,29	0,3,6058	AA,AG,GG		0.0121,0.052,0.0247	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	171/305,158/292,158/292,158/292	85774590	3,12119	1924	4137	6061	SO:0001583	missense	138046						identical protein binding|nucleotide binding|RNA binding	g.chr8:85774590G>A		CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.473G>A	8.37:g.85774590G>A	ENSP00000430367:p.Arg158His		Somatic				RALYL_uc003ycr.3_Missense_Mutation_p.R158H|RALYL_uc003ycs.3_Missense_Mutation_p.R158H|RALYL_uc010lzy.2_Missense_Mutation_p.R147H|RALYL_uc003yct.3_Missense_Mutation_p.R171H|RALYL_uc003ycu.3_Missense_Mutation_p.R85H|RALYL_uc003ycv.3_Missense_Mutation_p.R70H	p.R158H	NM_001100392	NP_001093862	WXS	Illumina HiSeq	Unspecified	Q86SE5	RALYL_HUMAN			7	889	+			158					B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	ENST00000521268.1	37	c.473G>A	CCDS55253.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409671	0.83340	5.2E-4	1.21E-4	ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850;ENST00000521376	T;T;T;T;T;T;T	0.25749	2.31;2.31;2.31;2.39;2.29;1.94;1.78	5.25	5.25	0.73442	.	0.048014	0.85682	D	0.000000	T	0.49762	0.1576	L	0.58810	1.83	0.43275	D	0.995234	P;D;P;P;D	0.89917	0.755;1.0;0.953;0.939;1.0	B;D;B;P;D	0.79784	0.312;0.993;0.267;0.565;0.993	T	0.47433	-0.9118	10	0.62326	D	0.03	-4.6088	19.1979	0.93696	0.0:0.0:1.0:0.0	.	147;158;85;171;158	B3KT61;B3KSX3;Q86SE5-2;G3V129;Q86SE5	.;.;.;.;RALYL_HUMAN	H	158;158;158;147;171;85;69	ENSP00000430394:R158H;ENSP00000428667:R158H;ENSP00000430367:R158H;ENSP00000430065:R147H;ENSP00000430128:R171H;ENSP00000428807:R85H;ENSP00000428310:R69H	ENSP00000430128:R171H	R	+	2	0	RALYL	85937145	1.000000	0.71417	0.995000	0.50966	0.777000	0.43975	7.074000	0.76791	2.599000	0.87857	0.551000	0.68910	CGT		0.507	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379448.1			7	38	0	0	0	0	7	38				
VPS13B	157680	broad.mit.edu	37	8	100523369	100523369	+	Missense_Mutation	SNP	A	A	T	rs371961155		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr8:100523369A>T	ENST00000358544.2	+	29	4448	c.4337A>T	c.(4336-4338)cAt>cTt	p.H1446L	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.H1421L	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1446					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CATCAGCAGCATGGATTCCTC	0.333																																					Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	0				ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(4336-4338)CAT>CTT		vacuolar protein sorting 13B isoform 5							90.0	92.0	91.0					8																	100523369		2203	4300	6503	SO:0001583	missense	157680				protein transport			g.chr8:100523369A>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4337A>T	8.37:g.100523369A>T	ENSP00000351346:p.His1446Leu		Somatic				VPS13B_uc003yiw.2_Missense_Mutation_p.H1421L|VPS13B_uc003yix.1_Missense_Mutation_p.H916L	p.H1446L	NM_017890	NP_060360	WXS	Illumina HiSeq	Unspecified	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		29	4448	+	Breast(36;3.73e-07)		1446					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	c.4337A>T	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.412952	0.83449	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.48201	0.82;0.82	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.61590	0.2359	L	0.44542	1.39	0.80722	D	1	D;D;D	0.76494	0.993;0.999;0.999	P;D;D	0.80764	0.889;0.994;0.991	T	0.63161	-0.6699	10	0.56958	D	0.05	.	15.7487	0.77967	1.0:0.0:0.0:0.0	.	1445;1421;1446	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8	.;.;VP13B_HUMAN	L	1421;1446	ENSP00000349685:H1421L;ENSP00000351346:H1446L	ENSP00000349685:H1421L	H	+	2	0	VPS13B	100592545	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.027000	0.93706	2.184000	0.69523	0.397000	0.26171	CAT		0.333	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		37	161	0	0	0	0	37	161				
DCAF13	25879	broad.mit.edu	37	8	104432504	104432504	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr8:104432504A>G	ENST00000297579.5	+	2	816	c.539A>G	c.(538-540)tAt>tGt	p.Y180C	DCAF13_ENST00000519682.1_Missense_Mutation_p.Y24C|DCAF13_ENST00000521971.1_Missense_Mutation_p.Y24C|DCAF13_ENST00000521716.1_Missense_Mutation_p.Y24C|DCAF13_ENST00000521999.1_Intron	NM_015420.6	NP_056235.4	Q9NV06	DCA13_HUMAN	DDB1 and CUL4 associated factor 13	28					protein ubiquitination (GO:0016567)|rRNA processing (GO:0006364)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						CCAAGAAACTATGATCCTGCT	0.358																																						uc003yln.2		NA																	0				breast(1)	1						c.(538-540)TAT>TGT		WD repeats and SOF1 domain containing							92.0	88.0	90.0					8																	104432504		2203	4300	6503	SO:0001583	missense	25879				rRNA processing	CUL4 RING ubiquitin ligase complex|nucleolus|ribonucleoprotein complex		g.chr8:104432504A>G	AK074725	CCDS34934.1	8q22.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000164934	ENSG00000164934		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24535	protein-coding gene	gene with protein product			"""WD repeats and SOF1 domain containing"""	WDSOF1		11042152	Standard	NM_015420		Approved	DKFZP564O0463, Gm83, HSPC064	uc003yln.3	Q9NV06	OTTHUMG00000164888	ENST00000297579.5:c.539A>G	8.37:g.104432504A>G	ENSP00000297579:p.Tyr180Cys		Somatic				DCAF13_uc003ylm.1_Intron|DCAF13_uc003ylo.2_5'UTR	p.Y180C	NM_015420	NP_056235	WXS	Illumina HiSeq	Unspecified	Q9NV06	DCA13_HUMAN			2	816	+			28					Q3MII9|Q8NCH8|Q8TC51|Q96JY7|Q9NZX3	Missense_Mutation	SNP	ENST00000297579.5	37	c.539A>G	CCDS34934.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.110968	0.77210	.	.	ENSG00000164934	ENST00000297579;ENST00000521716;ENST00000521971;ENST00000388778;ENST00000519682	T;T;T;T	0.01335	5.0;5.0;5.0;5.0	5.26	5.26	0.73747	.	0.118956	0.64402	D	0.000015	T	0.09730	0.0239	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.66196	0.942	T	0.00585	-1.1658	10	0.72032	D	0.01	-25.0351	15.1803	0.72952	1.0:0.0:0.0:0.0	.	28	B3KME9	.	C	180;24;24;28;24	ENSP00000297579:Y180C;ENSP00000430645:Y24C;ENSP00000430883:Y24C;ENSP00000430411:Y24C	ENSP00000297579:Y180C	Y	+	2	0	DCAF13	104501680	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.715000	0.91416	1.988000	0.58038	0.533000	0.62120	TAT		0.358	DCAF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380797.2	NM_015420		17	107	0	0	0	0	17	107				
FAM91A1	157769	broad.mit.edu	37	8	124796733	124796733	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr8:124796733A>G	ENST00000334705.7	+	9	973	c.727A>G	c.(727-729)Atg>Gtg	p.M243V	FAM91A1_ENST00000521166.1_Missense_Mutation_p.M243V	NM_144963.2	NP_659400	Q658Y4	F91A1_HUMAN	family with sequence similarity 91, member A1	243										breast(4)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			AGGTTTTGTAATGAATCGAGT	0.308																																						uc003yqv.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(727-729)ATG>GTG		hypothetical protein LOC157769							85.0	78.0	80.0					8																	124796733		1803	4064	5867	SO:0001583	missense	157769							g.chr8:124796733A>G	AK074370	CCDS6346.2	8q24.13	2005-10-04			ENSG00000176853	ENSG00000176853			26306	protein-coding gene	gene with protein product						12477932	Standard	XM_005250806		Approved	FLJ23790	uc003yqv.3	Q658Y4	OTTHUMG00000133021	ENST00000334705.7:c.727A>G	8.37:g.124796733A>G	ENSP00000335082:p.Met243Val		Somatic				FAM91A1_uc011lik.1_Missense_Mutation_p.M243V|FAM91A1_uc011lil.1_Missense_Mutation_p.M1V	p.M243V	NM_144963	NP_659400	WXS	Illumina HiSeq	Unspecified	Q658Y4	F91A1_HUMAN	STAD - Stomach adenocarcinoma(47;0.00192)		9	788	+	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		243					B6YY23|Q658T5|Q8TE89	Missense_Mutation	SNP	ENST00000334705.7	37	c.727A>G	CCDS6346.2	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527395	0.85706	.	.	ENSG00000176853	ENST00000521166;ENST00000334705	T;T	0.57752	0.38;0.93	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.75649	0.3878	M	0.86651	2.83	0.80722	D	1	P;P	0.43578	0.811;0.811	P;P	0.60789	0.879;0.879	T	0.79308	-0.1857	10	0.72032	D	0.01	.	16.28	0.82672	1.0:0.0:0.0:0.0	.	243;243	E7ER68;Q658Y4	.;F91A1_HUMAN	V	243	ENSP00000429491:M243V;ENSP00000335082:M243V	ENSP00000335082:M243V	M	+	1	0	FAM91A1	124865914	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.182000	0.94881	2.301000	0.77427	0.524000	0.50904	ATG		0.308	FAM91A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256607.1	NM_144963		5	115	0	0	0	0	5	115				
PHF20L1	51105	broad.mit.edu	37	8	133851650	133851650	+	Missense_Mutation	SNP	A	A	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr8:133851650A>T	ENST00000395386.2	+	18	2509	c.2210A>T	c.(2209-2211)aAa>aTa	p.K737I	AF230666.2_ENST00000608375.1_RNA|AF230666.2_ENST00000429151.1_RNA|PHF20L1_ENST00000395390.2_Missense_Mutation_p.K712I|PHF20L1_ENST00000220847.7_Missense_Mutation_p.K124I	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	737							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TGGAGTGCAAAATATCGTTAT	0.373																																						uc003ytt.2		NA																	0				ovary(2)	2						c.(2209-2211)AAA>ATA		PHD finger protein 20-like 1 isoform 1							129.0	124.0	126.0					8																	133851650		1886	4124	6010	SO:0001583	missense	51105						nucleic acid binding|zinc ion binding	g.chr8:133851650A>T	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2210A>T	8.37:g.133851650A>T	ENSP00000378784:p.Lys737Ile		Somatic				PHF20L1_uc011lja.1_Missense_Mutation_p.K711I	p.K737I	NM_016018	NP_057102	WXS	Illumina HiSeq	Unspecified	A8MW92	P20L1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;4.46e-05)		18	2535	+	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		737					A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	ENST00000395386.2	37	c.2210A>T	CCDS6367.2	.	.	.	.	.	.	.	.	.	.	A	17.37	3.372635	0.61624	.	.	ENSG00000129292	ENST00000395386;ENST00000220847;ENST00000395390	T;T;T	0.63255	-0.03;-0.03;-0.03	5.41	4.27	0.50696	Zinc finger, FYVE/PHD-type (1);	0.300147	0.28488	U	0.015166	T	0.70988	0.3287	M	0.66939	2.045	0.39114	D	0.961529	D;D	0.57257	0.979;0.964	P;P	0.58454	0.839;0.694	T	0.75720	-0.3219	10	0.72032	D	0.01	-27.5557	9.9636	0.41710	0.9209:0.0:0.0791:0.0	.	712;737	F8W9L8;A8MW92	.;P20L1_HUMAN	I	737;124;712	ENSP00000378784:K737I;ENSP00000220847:K124I;ENSP00000378788:K712I	ENSP00000220847:K124I	K	+	2	0	PHF20L1	133920832	1.000000	0.71417	0.954000	0.39281	0.984000	0.73092	4.812000	0.62613	2.064000	0.61679	0.533000	0.62120	AAA		0.373	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308949.3	NM_016018		7	154	0	0	0	0	7	154				
COL22A1	169044	broad.mit.edu	37	8	139601676	139601676	+	Silent	SNP	G	G	A	rs564075290		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr8:139601676G>A	ENST00000303045.6	-	65	5147	c.4701C>T	c.(4699-4701)ccC>ccT	p.P1567P	COL22A1_ENST00000435777.1_Silent_p.P1547P|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1567	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CAGGTTCCCCGGGTTGACCTG	0.577										HNSCC(7;0.00092)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		18272	0.0		0.0	False		,,,				2504	0.0					uc003yvd.2		NA																	0				ovary(11)|pancreas(1)|skin(1)	13						c.(4699-4701)CCC>CCT		collagen, type XXII, alpha 1							35.0	31.0	32.0					8																	139601676		2203	4300	6503	SO:0001819	synonymous_variant	169044				cell adhesion	collagen|cytoplasm	structural molecule activity	g.chr8:139601676G>A	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4701C>T	8.37:g.139601676G>A		HNSCC(7;0.00092)	Somatic				COL22A1_uc011ljo.1_Silent_p.P847P	p.P1567P	NM_152888	NP_690848	WXS	Illumina HiSeq	Unspecified	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)		65	5148	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		1567			Pro-rich.|Gly-rich.		B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	c.4701C>T	CCDS6376.1																																																																																				0.577	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		3	26	0	0	0	0	3	26				
FREM1	158326	broad.mit.edu	37	9	14801743	14801743	+	Missense_Mutation	SNP	A	A	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr9:14801743A>G	ENST00000380880.3	-	20	4384	c.3601T>C	c.(3601-3603)Ttt>Ctt	p.F1201L	FREM1_ENST00000422223.2_Missense_Mutation_p.F1201L|FREM1_ENST00000380881.4_Missense_Mutation_p.F1202L			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1201					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TCTTTGCTAAACCCCCTATCG	0.522																																						uc003zlm.2		NA																	0				ovary(2)|breast(2)|pancreas(1)	5						c.(3601-3603)TTT>CTT		FRAS1 related extracellular matrix 1 precursor							148.0	145.0	146.0					9																	14801743		2002	4186	6188	SO:0001583	missense	158326				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding	g.chr9:14801743A>G	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.3601T>C	9.37:g.14801743A>G	ENSP00000370262:p.Phe1201Leu		Somatic				FREM1_uc010mic.2_RNA	p.F1201L	NM_144966	NP_659403	WXS	Illumina HiSeq	Unspecified	Q5H8C1	FREM1_HUMAN		GBM - Glioblastoma multiforme(50;3.53e-06)	20	4191	-			1201			CSPG 8.		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	c.3601T>C	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	A	12.44	1.937784	0.34189	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.09817	2.94;2.96;2.96	5.51	-4.53	0.03462	.	1.625140	0.02842	N	0.128104	T	0.05914	0.0154	N	0.16478	0.41	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36212	-0.9757	10	0.11485	T	0.65	2.316	7.0175	0.24897	0.3991:0.0:0.4473:0.1536	.	1201	Q5H8C1	FREM1_HUMAN	L	1202;1201;1201	ENSP00000370263:F1202L;ENSP00000412940:F1201L;ENSP00000370262:F1201L	ENSP00000370257:F1204L	F	-	1	0	FREM1	14791743	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.045000	0.12003	-0.673000	0.05259	0.482000	0.46254	TTT		0.522	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966		12	129	0	0	0	0	12	129				
KIF24	347240	broad.mit.edu	37	9	34255735	34255735	+	Silent	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr9:34255735C>T	ENST00000402558.2	-	10	3894	c.3870G>A	c.(3868-3870)gcG>gcA	p.A1290A	KIF24_ENST00000379174.3_Silent_p.A1156A|KIF24_ENST00000345050.2_Silent_p.A1156A|KIF24_ENST00000379166.2_Silent_p.A1290A			Q5T7B8	KIF24_HUMAN	kinesin family member 24	1290					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			CAACTTACTGCGCTTGCTCCA	0.567											OREG0019148	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc003zua.3		NA																	0				central_nervous_system(1)	1						c.(3868-3870)GCG>GCA		kinesin family member 24							56.0	51.0	53.0					9																	34255735		2203	4300	6503	SO:0001819	synonymous_variant	347240				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr9:34255735C>T	AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.3870G>A	9.37:g.34255735C>T			Somatic	OREG0019148	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	846	KIF24_uc010mkb.2_Intron	p.A1290A	NM_194313	NP_919289	WXS	Illumina HiSeq	Unspecified	Q5T7B8	KIF24_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0107)		11	3990	-			1290					Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Silent	SNP	ENST00000402558.2	37	c.3870G>A	CCDS6551.2	.	.	.	.	.	.	.	.	.	.	C	12.63	1.995957	0.35226	.	.	ENSG00000186638	ENST00000443226	.	.	.	5.27	4.14	0.48551	.	0.000000	0.44688	D	0.000426	T	0.65133	0.2662	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66760	-0.5842	6	0.87932	D	0	.	9.0185	0.36184	0.0:0.0841:0.0:0.9159	.	.	.	.	T	242	.	ENSP00000414628:A242T	A	-	1	0	KIF24	34245735	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	0.657000	0.24963	1.013000	0.39391	-0.295000	0.09555	GCA		0.567	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5			5	38	0	0	0	0	5	38				
WNK2	65268	broad.mit.edu	37	9	95993222	95993222	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr9:95993222C>T	ENST00000297954.4	+	3	907	c.907C>T	c.(907-909)Cgg>Tgg	p.R303W	WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000349097.3_5'UTR|WNK2_ENST00000395477.2_Missense_Mutation_p.R303W|WNK2_ENST00000395475.2_Missense_Mutation_p.R289W|WNK2_ENST00000427277.2_5'UTR	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	303	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						CAGCTGGTGCCGGCAGATCCT	0.587																																						uc004ati.1		NA																	0				lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						c.(907-909)CGG>TGG		WNK lysine deficient protein kinase 2							90.0	79.0	83.0					9																	95993222		2203	4300	6503	SO:0001583	missense	65268				intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity	g.chr9:95993222C>T	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.907C>T	9.37:g.95993222C>T	ENSP00000297954:p.Arg303Trp		Somatic				WNK2_uc011lud.1_Missense_Mutation_p.R303W|WNK2_uc004atj.2_Missense_Mutation_p.R303W|WNK2_uc010mrc.1_Missense_Mutation_p.R303W|WNK2_uc010mrd.1_5'UTR	p.R303W	NM_006648	NP_006639	WXS	Illumina HiSeq	Unspecified	Q9Y3S1	WNK2_HUMAN			3	907	+			303			Protein kinase.		Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	ENST00000297954.4	37	c.907C>T		.	.	.	.	.	.	.	.	.	.	C	17.12	3.307723	0.60305	.	.	ENSG00000165238	ENST00000448039;ENST00000297954;ENST00000395477;ENST00000395475	T;T;T;T	0.26660	1.72;1.72;1.72;1.72	5.52	4.62	0.57501	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.46268	0.1384	L	0.48986	1.54	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.47586	-0.9106	10	0.87932	D	0	.	15.7959	0.78409	0.1372:0.8628:0.0:0.0	.	303;303;303;303	Q9Y3S1-2;Q9Y3S1-4;F8W9F9;Q9Y3S1	.;.;.;WNK2_HUMAN	W	303;303;303;289	ENSP00000412465:R303W;ENSP00000297954:R303W;ENSP00000378860:R303W;ENSP00000378858:R289W	ENSP00000297954:R303W	R	+	1	2	WNK2	95033043	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.049000	0.49869	1.317000	0.45149	0.655000	0.94253	CGG		0.587	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648		25	77	0	0	0	0	25	77				
GPR107	57720	broad.mit.edu	37	9	132854651	132854651	+	Missense_Mutation	SNP	G	G	A	rs200754726		TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr9:132854651G>A	ENST00000372406.1	+	9	1361	c.854G>A	c.(853-855)cGa>cAa	p.R285Q	GPR107_ENST00000347136.6_Missense_Mutation_p.R285Q|GPR107_ENST00000372410.3_Missense_Mutation_p.R285Q	NM_001136557.1	NP_001130029.1	Q5VW38	GP107_HUMAN	G protein-coupled receptor 107	285						integral component of membrane (GO:0016021)				endometrium(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	11		Ovarian(14;0.000531)				CATATCCTTCGAAAACGACGG	0.423																																						uc004bze.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(853-855)CGA>CAA		G protein-coupled receptor 107 isoform 1							136.0	133.0	134.0					9																	132854651		2203	4300	6503	SO:0001583	missense	57720					integral to membrane		g.chr9:132854651G>A	AF376725	CCDS35162.1, CCDS48041.1, CCDS48042.1	9q34.2	2014-01-30			ENSG00000148358	ENSG00000148358		"""GPCR / Unclassified : 7TM orphan receptors"""	17830	protein-coding gene	gene with protein product							Standard	NM_020960		Approved	KIAA1624, RP11-88G17, FLJ20998, LUSTR1	uc004bzd.2	Q5VW38	OTTHUMG00000020804	ENST00000372406.1:c.854G>A	9.37:g.132854651G>A	ENSP00000361483:p.Arg285Gln		Somatic				GPR107_uc004bzb.2_Missense_Mutation_p.R96Q|GPR107_uc004bzc.3_RNA|GPR107_uc011mbx.1_Missense_Mutation_p.R285Q|GPR107_uc004bzd.2_Missense_Mutation_p.R285Q	p.R285Q	NM_001136557	NP_001130029	WXS	Illumina HiSeq	Unspecified	Q5VW38	GP107_HUMAN			9	1081	+		Ovarian(14;0.000531)	285					A6NJ53|Q2TB81|Q5JPA3|Q5VW39|Q96T26|Q9H658|Q9HCE8	Missense_Mutation	SNP	ENST00000372406.1	37	c.854G>A	CCDS48041.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822716	0.90873	.	.	ENSG00000148358	ENST00000372406;ENST00000347136;ENST00000372410;ENST00000455412	T;T;T	0.25749	1.78;1.83;1.8	5.56	5.56	0.83823	.	0.101618	0.41097	D	0.000949	T	0.42131	0.1189	M	0.68317	2.08	0.48901	D	0.999722	D;D;D	0.59767	0.963;0.986;0.963	P;P;P	0.53689	0.505;0.732;0.505	T	0.09378	-1.0677	10	0.29301	T	0.29	-5.1077	18.183	0.89785	0.0:0.0:1.0:0.0	.	285;285;285	G5E994;Q5VW38;Q5VW38-2	.;GP107_HUMAN;.	Q	285	ENSP00000361483:R285Q;ENSP00000336988:R285Q;ENSP00000361487:R285Q	ENSP00000336988:R285Q	R	+	2	0	GPR107	131894472	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.326000	0.72905	2.638000	0.89438	0.603000	0.83216	CGA		0.423	GPR107-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054643.2			62	170	0	0	0	0	62	170				
TPRN	286262	broad.mit.edu	37	9	140087090	140087090	+	Silent	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr9:140087090G>A	ENST00000409012.4	-	2	1865	c.1779C>T	c.(1777-1779)tcC>tcT	p.S593S	TPRN_ENST00000321773.2_Silent_p.S532S|TPRN_ENST00000541945.1_5'Flank	NM_001128228.2	NP_001121700.2	Q4KMQ1	TPRN_HUMAN	taperin	593	Glu-rich.				sensory perception of sound (GO:0007605)	stereocilium (GO:0032420)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	8						GGGAGCTCTCGGAAGGGTACT	0.582																																						uc004clt.2		NA																	0					0						c.(1594-1596)TCC>TCT		hypothetical protein LOC286262 isoform 2							73.0	67.0	69.0					9																	140087090		2203	4299	6502	SO:0001819	synonymous_variant	286262				sensory perception of sound	stereocilium		g.chr9:140087090G>A	AK074735	CCDS56594.1	9q34.3	2011-01-06	2010-03-24	2010-03-24	ENSG00000176058	ENSG00000176058			26894	protein-coding gene	gene with protein product		613354	"""chromosome 9 open reading frame 75"", ""deafness, autosomal recessive 79"""	C9orf75, DFNB79		20170898, 20170899	Standard	NM_001128228		Approved	FLJ90254	uc004clu.3	Q4KMQ1	OTTHUMG00000020984	ENST00000409012.4:c.1779C>T	9.37:g.140087090G>A			Somatic				TPRN_uc004clu.2_Silent_p.S532S	p.S532S	NM_173691	NP_775962	WXS	Illumina HiSeq	Unspecified	Q4KMQ1	TPRN_HUMAN			2	1596	-			593			Glu-rich.		B7ZKU5|Q5VSG5|Q5VSG6|Q6IPP2|Q8NCH2	Silent	SNP	ENST00000409012.4	37	c.1596C>T	CCDS56594.1																																																																																				0.582	TPRN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055323.3	NM_173691		5	91	0	0	0	0	5	91				
FRMPD4	9758	broad.mit.edu	37	X	12701661	12701661	+	Silent	SNP	C	C	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chrX:12701661C>A	ENST00000380682.1	+	6	1034	c.528C>A	c.(526-528)gtC>gtA	p.V176V		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	176					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						CCAATCCTGTCAAAGTACGCT	0.418																																						uc004cuz.1		NA																	0				central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						c.(526-528)GTC>GTA		FERM and PDZ domain containing 4							126.0	96.0	106.0					X																	12701661		2203	4300	6503	SO:0001819	synonymous_variant	9758				positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding	g.chrX:12701661C>A	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.528C>A	X.37:g.12701661C>A			Somatic				FRMPD4_uc011mij.1_Silent_p.V168V	p.V176V	NM_014728	NP_055543	WXS	Illumina HiSeq	Unspecified	Q14CM0	FRPD4_HUMAN			6	1034	+			176					A8K0X9|O15032	Silent	SNP	ENST00000380682.1	37	c.528C>A	CCDS35201.1																																																																																				0.418	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712		14	90	1	0	2.32e-05	2.51e-05	14	90				
PHKA2	5256	broad.mit.edu	37	X	18972501	18972501	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chrX:18972501G>T	ENST00000379942.4	-	2	773	c.108C>A	c.(106-108)agC>agA	p.S36R		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	36					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TCTGCTCATGGCTGGCTGACA	0.562																																						uc004cyv.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(106-108)AGC>AGA		phosphorylase kinase, alpha 2 (liver)							85.0	63.0	71.0					X																	18972501		2203	4300	6503	SO:0001583	missense	5256				glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity	g.chrX:18972501G>T		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.108C>A	X.37:g.18972501G>T	ENSP00000369274:p.Ser36Arg		Somatic				PHKA2_uc010nfh.1_RNA|PHKA2_uc010nfi.1_5'UTR	p.S36R	NM_000292	NP_000283	WXS	Illumina HiSeq	Unspecified	P46019	KPB2_HUMAN			2	538	-	Hepatocellular(33;0.183)		36					A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	37	c.108C>A	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.662779	0.67700	.	.	ENSG00000044446	ENST00000379942	D	0.96136	-3.92	5.65	2.74	0.32292	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.036019	0.85682	D	0.000000	D	0.96892	0.8985	M	0.92604	3.325	0.49051	D	0.999744	P	0.49559	0.925	P	0.55260	0.772	D	0.94704	0.7886	10	0.72032	D	0.01	-16.5169	5.4654	0.16639	0.3511:0.1312:0.5177:0.0	.	36	P46019	KPB2_HUMAN	R	36	ENSP00000369274:S36R	ENSP00000369274:S36R	S	-	3	2	PHKA2	18882422	0.996000	0.38824	0.999000	0.59377	0.993000	0.82548	2.287000	0.43505	0.109000	0.17891	0.600000	0.82982	AGC		0.562	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292		25	107	1	0	4.27e-12	4.89e-12	25	107				
RPS6KA3	6197	broad.mit.edu	37	X	20211697	20211697	+	Missense_Mutation	SNP	T	T	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chrX:20211697T>A	ENST00000379565.3	-	7	708	c.501A>T	c.(499-501)gaA>gaT	p.E167D	RPS6KA3_ENST00000544447.1_Missense_Mutation_p.E139D|RPS6KA3_ENST00000540702.1_Missense_Mutation_p.E139D|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.E138D	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	167	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	TGACATCTTCTTCTGTGAACA	0.294																																						uc004czu.2		NA																	0				central_nervous_system(4)|stomach(1)|ovary(1)|lung(1)|breast(1)	8						c.(499-501)GAA>GAT		ribosomal protein S6 kinase, 90kDa, polypeptide							73.0	63.0	66.0					X																	20211697		2203	4299	6502	SO:0001583	missense	6197				axon guidance|central nervous system development|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|skeletal system development|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein serine/threonine kinase activity	g.chrX:20211697T>A	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.501A>T	X.37:g.20211697T>A	ENSP00000368884:p.Glu167Asp		Somatic				RPS6KA3_uc011mjk.1_Missense_Mutation_p.E138D|RPS6KA3_uc004czv.2_Missense_Mutation_p.E155D|RPS6KA3_uc011mjl.1_Missense_Mutation_p.E139D|RPS6KA3_uc011mjm.1_Missense_Mutation_p.E139D	p.E167D	NM_004586	NP_004577	WXS	Illumina HiSeq	Unspecified	P51812	KS6A3_HUMAN			7	501	-			167			Protein kinase 1.		B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	37	c.501A>T	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	t	19.88	3.909141	0.72868	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702;ENST00000457145	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	4.78	2.37	0.29283	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.056064	0.64402	D	0.000001	T	0.49915	0.1585	M	0.76574	2.34	0.80722	D	1	D;D;D;D	0.76494	0.996;0.99;0.993;0.999	D;D;D;D	0.87578	0.966;0.981;0.995;0.998	T	0.43228	-0.9404	10	0.87932	D	0	.	7.1411	0.25556	0.0:0.2685:0.0:0.7315	.	139;138;139;167	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	D	167;139;138;139;138	ENSP00000368884:E167D;ENSP00000440220:E139D;ENSP00000368865:E138D;ENSP00000444837:E139D;ENSP00000407655:E138D	ENSP00000368865:E138D	E	-	3	2	RPS6KA3	20121618	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.962000	0.29280	0.157000	0.19338	-0.318000	0.08688	GAA		0.294	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586		6	78	0	0	0	0	6	78				
MED12	9968	broad.mit.edu	37	X	70349995	70349995	+	Silent	SNP	T	T	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chrX:70349995T>C	ENST00000374080.3	+	28	4010	c.3978T>C	c.(3976-3978)taT>taC	p.Y1326Y	MED12_ENST00000374102.1_Silent_p.Y1326Y|MED12_ENST00000333646.6_Silent_p.Y1326Y			Q93074	MED12_HUMAN	mediator complex subunit 12	1326					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					TCATTTGCTATCCACATCGAC	0.572			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															uc004dyy.2		NA		Dom	yes		X	Xq13	9968		mediator complex subunit 12	Yes		M					0				ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4						c.(3976-3978)TAT>TAC		mediator complex subunit 12							48.0	45.0	46.0					X																	70349995		2033	4179	6212	SO:0001819	synonymous_variant	9968				androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chrX:70349995T>C	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.3978T>C	X.37:g.70349995T>C			Somatic				MED12_uc011mpq.1_Silent_p.Y1326Y|MED12_uc004dyz.2_Silent_p.Y1326Y|MED12_uc004dza.2_Silent_p.Y1173Y|MED12_uc010nla.2_5'UTR	p.Y1326Y	NM_005120	NP_005111	WXS	Illumina HiSeq	Unspecified	Q93074	MED12_HUMAN			28	4177	+	Renal(35;0.156)		1326					O15410|O75557|Q9UHV6|Q9UND7	Silent	SNP	ENST00000374080.3	37	c.3978T>C	CCDS43970.1																																																																																				0.572	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120		4	29	0	0	0	0	4	29				
ATRX	546	broad.mit.edu	37	X	76814235	76814235	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chrX:76814235C>T	ENST00000373344.5	-	29	6623	c.6409G>A	c.(6409-6411)Gct>Act	p.A2137T	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.A2099T	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2137	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with MECP2.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.A2137T(2)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TTCCAAGAAGCGTCGAATATA	0.353			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																															uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		3	Substitution - Missense(2)|Unknown(1)		large_intestine(2)|bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(6409-6411)GCT>ACT		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						78.0	76.0	77.0					X																	76814235		2203	4295	6498	SO:0001583	missense	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76814235C>T	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6409G>A	X.37:g.76814235C>T	ENSP00000362441:p.Ala2137Thr		Somatic				ATRX_uc004ecq.3_Missense_Mutation_p.A2099T|ATRX_uc004eco.3_Missense_Mutation_p.A1922T	p.A2137T	NM_000489	NP_000480	WXS	Illumina HiSeq	Unspecified	P46100	ATRX_HUMAN			29	6641	-			2137			Helicase C-terminal.		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	c.6409G>A	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932515	0.73442	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	T;T	0.75821	-0.97;-0.97	5.21	5.21	0.72293	Helicase, C-terminal (3);	0.000000	0.64402	U	0.000001	D	0.83557	0.5280	L	0.49513	1.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.85501	0.1191	10	0.87932	D	0	-9.3111	17.8291	0.88676	0.0:1.0:0.0:0.0	.	2099;2137	P46100-4;P46100	.;ATRX_HUMAN	T	2137;2099	ENSP00000362441:A2137T;ENSP00000378967:A2099T	ENSP00000362441:A2137T	A	-	1	0	ATRX	76700891	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.487000	0.81328	2.141000	0.66446	0.600000	0.82982	GCT		0.353	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		28	170	0	0	0	0	28	170				
ATRX	546	broad.mit.edu	37	X	76939409	76939409	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chrX:76939409C>T	ENST00000373344.5	-	9	1553	c.1339G>A	c.(1339-1341)Gaa>Aaa	p.E447K	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.E409K	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	447					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						CAAGGTTTTTCTCCTTTTCGT	0.363			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																															uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		1	Unknown(1)		bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(1339-1341)GAA>AAA		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						150.0	141.0	144.0					X																	76939409		2203	4295	6498	SO:0001583	missense	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76939409C>T	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.1339G>A	X.37:g.76939409C>T	ENSP00000362441:p.Glu447Lys		Somatic				ATRX_uc004ecq.3_Missense_Mutation_p.E409K|ATRX_uc004eco.3_Missense_Mutation_p.E232K|ATRX_uc004ecr.2_Missense_Mutation_p.E408K|ATRX_uc010nlx.1_Missense_Mutation_p.E447K|ATRX_uc010nly.1_Missense_Mutation_p.E392K	p.E447K	NM_000489	NP_000480	WXS	Illumina HiSeq	Unspecified	P46100	ATRX_HUMAN			9	1571	-			447					D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	c.1339G>A	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	c	11.28	1.592491	0.28357	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	D;D	0.92911	-3.13;-3.12	4.89	4.89	0.63831	.	0.301431	0.30639	N	0.009195	D	0.92593	0.7647	L	0.40543	1.245	0.80722	D	1	D;D;D;D	0.89917	0.997;1.0;0.998;0.997	D;D;D;D	0.87578	0.98;0.998;0.991;0.98	D	0.90739	0.4648	10	0.33141	T	0.24	-8.7218	8.5543	0.33471	0.0:0.8399:0.0:0.1601	.	447;408;409;447	A4LAA3;P46100-6;P46100-4;P46100	.;.;.;ATRX_HUMAN	K	447;409;403	ENSP00000362441:E447K;ENSP00000378967:E409K	ENSP00000362441:E447K	E	-	1	0	ATRX	76826065	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	3.653000	0.54446	2.012000	0.59069	0.509000	0.49947	GAA		0.363	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		60	379	0	0	0	0	60	379				
PGAM4	441531	broad.mit.edu	37	X	77224509	77224509	+	Silent	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chrX:77224509G>A	ENST00000458128.1	-	1	626	c.627C>T	c.(625-627)aaC>aaT	p.N209N	ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000341514.6_Intron|ATP7A_ENST00000343533.5_Intron	NM_001029891.2	NP_001025062.1	Q8N0Y7	PGAM4_HUMAN	phosphoglycerate mutase family member 4	209					glycolytic process (GO:0006096)|positive regulation of sperm motility (GO:1902093)	extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|phosphoglycerate mutase activity (GO:0004619)			endometrium(2)|lung(4)	6						CAGTCGGCAGGTTCAGCTCCA	0.527																																						uc004ecy.1		NA																	0					0						c.(625-627)AAC>AAT		bisphosphoglycerate mutase 4							104.0	98.0	100.0					X																	77224509		2203	4294	6497	SO:0001819	synonymous_variant	441531				glycolysis		2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity|phosphoglycerate mutase activity	g.chrX:77224509G>A	AF465731	CCDS35338.1	Xq21.1	2011-02-09	2006-02-09		ENSG00000226784	ENSG00000226784			21731	protein-coding gene	gene with protein product		300567	"""phosphoglycerate mutase family 4"""			11961099, 9370262	Standard	NM_001029891		Approved	dJ1000K24.1, PGAM3, PGAM-B, PGAM1	uc004ecy.1	Q8N0Y7	OTTHUMG00000057865	ENST00000458128.1:c.627C>T	X.37:g.77224509G>A			Somatic				ATP7A_uc004ecw.2_Intron|ATP7A_uc004ecx.3_Intron	p.N209N	NM_001029891	NP_001025062	WXS	Illumina HiSeq	Unspecified	Q8N0Y7	PGAM4_HUMAN			1	627	-			209					Q5JPN2|Q8NI24|Q8NI25|Q8NI26	Silent	SNP	ENST00000458128.1	37	c.627C>T	CCDS35338.1																																																																																				0.527	PGAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128371.2	NM_001029891		11	232	0	0	0	0	11	232				
GPRASP1	9737	broad.mit.edu	37	X	101909693	101909693	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chrX:101909693G>T	ENST00000361600.5	+	5	1653	c.852G>T	c.(850-852)agG>agT	p.R284S	GPRASP1_ENST00000537097.1_Missense_Mutation_p.R284S|GPRASP1_ENST00000444152.1_Missense_Mutation_p.R284S|GPRASP1_ENST00000415986.1_Missense_Mutation_p.R284S|RP4-769N13.7_ENST00000602441.1_RNA	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	284					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GCAGGTCCAGGTTTAGGTCTA	0.483																																						uc004ejj.3		NA																	0				ovary(1)|lung(1)	2						c.(850-852)AGG>AGT		G protein-coupled receptor associated sorting							110.0	110.0	110.0					X																	101909693		2203	4300	6503	SO:0001583	missense	9737					cytoplasm	protein binding	g.chrX:101909693G>T	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.852G>T	X.37:g.101909693G>T	ENSP00000355146:p.Arg284Ser		Somatic				GPRASP1_uc004eji.3_Missense_Mutation_p.R284S|GPRASP1_uc010nod.2_Missense_Mutation_p.R284S	p.R284S	NM_014710	NP_055525	WXS	Illumina HiSeq	Unspecified	Q5JY77	GASP1_HUMAN			5	1653	+			284					O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	37	c.852G>T	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	G	8.937	0.964783	0.18583	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.08807	3.05;3.05;3.05;3.05	1.95	1.05	0.20165	.	.	.	.	.	T	0.06188	0.0160	L	0.42245	1.32	0.09310	N	1	B	0.33266	0.404	B	0.32090	0.14	T	0.40001	-0.9586	9	0.10111	T	0.7	1.7826	6.1073	0.20081	0.1852:0.0:0.8148:0.0	.	284	Q5JY77	GASP1_HUMAN	S	284	ENSP00000393691:R284S;ENSP00000409420:R284S;ENSP00000355146:R284S;ENSP00000445683:R284S	ENSP00000355146:R284S	R	+	3	2	GPRASP1	101796349	0.005000	0.15991	0.011000	0.14972	0.452000	0.32318	0.136000	0.15974	0.270000	0.21984	0.279000	0.19357	AGG		0.483	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710		19	241	1	0	1.56e-12	1.8e-12	19	241				
RAB40A	142684	broad.mit.edu	37	X	102755663	102755663	+	Missense_Mutation	SNP	C	C	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chrX:102755663C>A	ENST00000372633.1	-	1	2140	c.22G>T	c.(22-24)Gac>Tac	p.D8Y	RAB40A_ENST00000304236.1_Missense_Mutation_p.D8Y|LL0XNC01-250H12.3_ENST00000445990.1_RNA			Q8WXH6	RB40A_HUMAN	RAB40A, member RAS oncogene family	8					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	12						TAGGCCTGGTCGGGGCTGCCC	0.667																																						uc004ekk.2		NA																	0					0						c.(22-24)GAC>TAC		RAB40A, member RAS oncogene family							43.0	42.0	43.0					X																	102755663		2203	4300	6503	SO:0001583	missense	142684				protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding	g.chrX:102755663C>A	AF132748	CCDS35357.1	Xq22.1	2009-08-25			ENSG00000172476	ENSG00000172476		"""RAB, member RAS oncogene"""	18283	protein-coding gene	gene with protein product						11697911	Standard	NM_080879		Approved	RAR2A, Rar-2	uc004ekk.3	Q8WXH6	OTTHUMG00000022100	ENST00000372633.1:c.22G>T	X.37:g.102755663C>A	ENSP00000361716:p.Asp8Tyr		Somatic					p.D8Y	NM_080879	NP_543155	WXS	Illumina HiSeq	Unspecified	Q8WXH6	RB40A_HUMAN			3	364	-			8					O00407|Q17RQ5|Q6DK06|Q8TF06	Missense_Mutation	SNP	ENST00000372633.1	37	c.22G>T	CCDS35357.1	.	.	.	.	.	.	.	.	.	.	.	13.83	2.354788	0.41700	.	.	ENSG00000172476	ENST00000372633;ENST00000304236	T;T	0.71817	-0.6;-0.6	1.53	0.356	0.16074	.	1.086520	0.07669	U	0.935090	T	0.64983	0.2648	L	0.60904	1.88	0.28104	N	0.931298	B	0.28971	0.229	B	0.28991	0.097	T	0.56559	-0.7959	10	0.66056	D	0.02	.	6.4962	0.22144	0.2882:0.7117:0.0:0.0	.	8	Q8WXH6	RB40A_HUMAN	Y	8	ENSP00000361716:D8Y;ENSP00000305648:D8Y	ENSP00000305648:D8Y	D	-	1	0	RAB40A	102642319	0.014000	0.17966	0.002000	0.10522	0.517000	0.34286	2.320000	0.43797	-0.221000	0.09973	0.284000	0.19432	GAC		0.667	RAB40A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057714.1			12	81	1	0	5.17e-11	5.88e-11	12	81				
WDR44	54521	broad.mit.edu	37	X	117582909	117582909	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chrX:117582909G>A	ENST00000254029.3	+	20	3096	c.2701G>A	c.(2701-2703)Gca>Aca	p.A901T	WDR44_ENST00000371825.3_Missense_Mutation_p.A893T|WDR44_ENST00000371822.5_Missense_Mutation_p.A812T	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	901						endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						CTTCACTGGAGCAATCAAAGT	0.254																																						uc004eqn.2		NA																	0				lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						c.(2701-2703)GCA>ACA		WD repeat domain 44 protein							33.0	35.0	34.0					X																	117582909		2195	4286	6481	SO:0001583	missense	54521					cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm		g.chrX:117582909G>A	AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.2701G>A	X.37:g.117582909G>A	ENSP00000254029:p.Ala901Thr		Somatic				WDR44_uc004eqo.2_Missense_Mutation_p.A893T|WDR44_uc011mtr.1_Missense_Mutation_p.A812T|WDR44_uc010nqi.2_3'UTR	p.A901T	NM_019045	NP_061918	WXS	Illumina HiSeq	Unspecified	Q5JSH3	WDR44_HUMAN			20	3126	+			901			WD 7.		B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	ENST00000254029.3	37	c.2701G>A	CCDS14572.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.144860	0.57044	.	.	ENSG00000131725	ENST00000371822;ENST00000254029;ENST00000371825	T;T;T	0.72835	-0.69;-0.26;-0.13	5.23	5.23	0.72850	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.74635	0.3742	L	0.61036	1.89	0.80722	D	1	B;P;B	0.52577	0.026;0.954;0.075	B;P;B	0.51297	0.025;0.665;0.041	T	0.71321	-0.4628	10	0.10902	T	0.67	-5.0445	17.933	0.89004	0.0:0.0:1.0:0.0	.	812;893;901	F8W913;Q5JSH3-2;Q5JSH3	.;.;WDR44_HUMAN	T	812;901;893	ENSP00000360887:A812T;ENSP00000254029:A901T;ENSP00000360890:A893T	ENSP00000254029:A901T	A	+	1	0	WDR44	117466937	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.414000	0.97362	2.168000	0.68352	0.502000	0.49764	GCA		0.254	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045		16	91	0	0	0	0	16	91				
CT47B1	643311	broad.mit.edu	37	X	120008795	120008795	+	Missense_Mutation	SNP	G	G	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chrX:120008795G>A	ENST00000371311.3	-	1	984	c.730C>T	c.(730-732)Ccg>Tcg	p.P244S		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	244										breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						TCTGCGGCCGGTtcctctgtg	0.692																																						uc011muc.1		NA																	0					0						c.(730-732)CCG>TCG		cancer/testis antigen family 147, member B1							53.0	47.0	49.0					X																	120008795		692	1589	2281	SO:0001583	missense	643311							g.chrX:120008795G>A		CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.730C>T	X.37:g.120008795G>A	ENSP00000360360:p.Pro244Ser		Somatic					p.P244S	NM_001145718	NP_001139190	WXS	Illumina HiSeq	Unspecified	P0C2W7	CT47B_HUMAN			1	985	-			244					A6NM97	Missense_Mutation	SNP	ENST00000371311.3	37	c.730C>T	CCDS48161.1	.	.	.	.	.	.	.	.	.	.	G	4.290	0.053093	0.08291	.	.	ENSG00000236446	ENST00000371311	.	.	.	1.68	-1.33	0.09172	.	.	.	.	.	T	0.11879	0.0289	N	0.24115	0.695	0.09310	N	1	P	0.35139	0.486	B	0.26202	0.067	T	0.23833	-1.0177	8	0.10111	T	0.7	.	2.4149	0.04433	0.3379:0.2895:0.3726:0.0	.	244	P0C2W7	CT47B_HUMAN	S	244	.	ENSP00000360360:P244S	P	-	1	0	CT47B1	119892823	0.002000	0.14202	0.000000	0.03702	0.094000	0.18550	-0.371000	0.07513	-0.430000	0.07318	0.110000	0.15639	CCG		0.692	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058121.1	NM_001145718		34	197	0	0	0	0	34	197				
PNMA5	114824	broad.mit.edu	37	X	152159412	152159412	+	Missense_Mutation	SNP	G	G	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chrX:152159412G>T	ENST00000439251.1	-	2	1169	c.731C>A	c.(730-732)tCt>tAt	p.S244Y	PNMA5_ENST00000535214.1_Missense_Mutation_p.S244Y|PNMA5_ENST00000361887.5_Missense_Mutation_p.S244Y|PNMA5_ENST00000452693.1_Missense_Mutation_p.S244Y	NM_001103150.1	NP_001096620.1	Q96PV4	PNMA5_HUMAN	paraneoplastic Ma antigen family member 5	244					positive regulation of apoptotic process (GO:0043065)					breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					CCTAAACTGAGAGGCTCTAAA	0.522																																						uc010ntw.2		NA																	0				ovary(1)|skin(1)	2						c.(730-732)TCT>TAT		paraneoplastic antigen like 5							69.0	67.0	68.0					X																	152159412		2203	4300	6503	SO:0001583	missense	114824				apoptosis			g.chrX:152159412G>T	AB067521	CCDS14718.1	Xq28	2012-02-09	2012-02-09		ENSG00000198883	ENSG00000198883		"""Paraneoplastic Ma antigens"""	18743	protein-coding gene	gene with protein product	"""paraneoplastic antigen family 5"""	300916	"""paraneoplastic antigen like 5"""			16214224	Standard	NM_052926		Approved	KIAA1934	uc004fgy.4	Q96PV4	OTTHUMG00000024184	ENST00000439251.1:c.731C>A	X.37:g.152159412G>T	ENSP00000388850:p.Ser244Tyr		Somatic				PNMA5_uc004fha.3_Missense_Mutation_p.S244Y|PNMA5_uc010ntx.2_Missense_Mutation_p.S244Y|PNMA5_uc004fgy.3_Missense_Mutation_p.S244Y	p.S244Y	NM_001103151	NP_001096621	WXS	Illumina HiSeq	Unspecified	Q96PV4	PNMA5_HUMAN			3	1070	-	Acute lymphoblastic leukemia(192;6.56e-05)		244					B4DI72|B7Z9Y9|Q495L5|Q8NET3	Missense_Mutation	SNP	ENST00000439251.1	37	c.731C>A	CCDS14718.1	.	.	.	.	.	.	.	.	.	.	G	7.824	0.718452	0.15372	.	.	ENSG00000198883	ENST00000361887;ENST00000535214;ENST00000439251;ENST00000452693	T;T;T;T	0.10099	2.91;2.91;2.91;2.91	2.57	-1.83	0.07833	.	.	.	.	.	T	0.07728	0.0194	L	0.48642	1.525	0.09310	N	1	P	0.37688	0.605	B	0.34590	0.186	T	0.22312	-1.0220	9	0.41790	T	0.15	.	2.7351	0.05238	0.4753:0.0:0.306:0.2187	.	244	Q96PV4	PNMA5_HUMAN	Y	244	ENSP00000354834:S244Y;ENSP00000445775:S244Y;ENSP00000388850:S244Y;ENSP00000392342:S244Y	ENSP00000354834:S244Y	S	-	2	0	PNMA5	151910068	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.272000	0.18644	-0.643000	0.05473	0.292000	0.19580	TCT		0.522	PNMA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060925.1	NM_052926		30	184	1	0	3e-07	3.34e-07	30	184				
PNMA3	29944	broad.mit.edu	37	X	152226640	152226640	+	Missense_Mutation	SNP	C	C	T			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chrX:152226640C>T	ENST00000370264.4	+	1	1254	c.1228C>T	c.(1228-1230)Cgc>Tgc	p.R410C	PNMA3_ENST00000447306.1_Missense_Mutation_p.R410C|PNMA3_ENST00000370265.4_Missense_Mutation_p.R410C			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	410	Arg-rich.				positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					AAAACGGAAACGCCACACATT	0.597																																						uc004fhc.2		NA																	0				skin(2)|large_intestine(1)	3						c.(1228-1230)CGC>TGC		paraneoplastic cancer-testis-brain antigen							76.0	79.0	78.0					X																	152226640		2203	4300	6503	SO:0001583	missense	29944				apoptosis	nucleolus	nucleic acid binding|zinc ion binding	g.chrX:152226640C>T	AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.1228C>T	X.37:g.152226640C>T	ENSP00000359286:p.Arg410Cys		Somatic				PNMA5_uc004fha.3_5'Flank|PNMA3_uc004fhd.2_5'Flank	p.R410C	NM_013364	NP_037496	WXS	Illumina HiSeq	Unspecified	Q9UL41	PNMA3_HUMAN			2	1564	+	Acute lymphoblastic leukemia(192;6.56e-05)		410			Arg-rich.		D3DWT7|Q9H0A4	Missense_Mutation	SNP	ENST00000370264.4	37	c.1228C>T	CCDS35435.2	.	.	.	.	.	.	.	.	.	.	c	9.448	1.089742	0.20390	.	.	ENSG00000183837	ENST00000370265;ENST00000447306;ENST00000370264	T;T;T	0.16457	2.34;2.35;2.35	1.9	0.977	0.19733	Zinc finger, CCHC retroviral-type (1);	.	.	.	.	T	0.08358	0.0208	L	0.29908	0.895	0.09310	N	1	D	0.53885	0.963	B	0.35182	0.197	T	0.25882	-1.0119	9	0.35671	T	0.21	.	3.559	0.07875	0.0:0.7328:0.0:0.2672	.	410	Q9UL41	PNMA3_HUMAN	C	410	ENSP00000359288:R410C;ENSP00000407642:R410C;ENSP00000359286:R410C	ENSP00000359286:R410C	R	+	1	0	PNMA3	151977296	0.000000	0.05858	0.000000	0.03702	0.235000	0.25334	-0.126000	0.10563	0.252000	0.21531	0.287000	0.19450	CGC		0.597	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060946.2	NM_013364		16	137	0	0	0	0	16	137				
MYCBP2	23077	broad.mit.edu	37	13	77625189	77625190	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr13:77625189_77625190insA	ENST00000544440.2	-	82	13766_13767	c.13749_13750insT	c.(13747-13752)catgatfs	p.D4584fs	MYCBP2_ENST00000407578.2_Frame_Shift_Ins_p.D4622fs|MYCBP2_ENST00000357337.6_Frame_Shift_Ins_p.D4584fs					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TGAAAATCATCATGACAAGCAT	0.347																																						uc001vkf.2		NA																	0				ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14						c.(13747-13752)CATGATfs		MYC binding protein 2																																				SO:0001589	frameshift_variant	23077				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding	g.chr13:77625189_77625190insA	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.13750dupT	13.37:g.77625190_77625190dupA	ENSP00000444596:p.Asp4584fs		Somatic				MYCBP2_uc010aev.2_Frame_Shift_Ins_p.H3987fs|MYCBP2_uc001vke.2_Frame_Shift_Ins_p.H1200fs	p.H4583fs	NM_015057	NP_055872	WXS	Illumina HiSeq	Unspecified	O75592	MYCB2_HUMAN		GBM - Glioblastoma multiforme(99;0.109)	83	13840_13841	-		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)	4583_4584			B box-type.			Frame_Shift_Ins	INS	ENST00000544440.2	37	c.13749_13750insT																																																																																					0.347	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		23	138	NA	NA	NA	NA	23	138	---	---	---	---
AJUBA	84962	broad.mit.edu	37	14	23450566	23450567	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr14:23450566_23450567insC	ENST00000262713.2	-	1	1284_1285	c.909_910insG	c.(907-912)gggattfs	p.I304fs	RP11-298I3.4_ENST00000555294.1_RNA|RP11-298I3.4_ENST00000556503.1_RNA|RP11-298I3.5_ENST00000555074.1_Intron|RP11-298I3.4_ENST00000557615.1_RNA|AJUBA_ENST00000361265.4_Frame_Shift_Ins_p.I304fs	NM_032876.4	NP_116265.1	Q96IF1	AJUBA_HUMAN	ajuba LIM protein	304	PreLIM.				calcium-dependent cell-cell adhesion (GO:0016339)|cellular protein localization (GO:0034613)|focal adhesion assembly (GO:0048041)|G2/M transition of mitotic cell cycle (GO:0000086)|gene silencing by miRNA (GO:0035195)|glycerophospholipid biosynthetic process (GO:0046474)|lamellipodium assembly (GO:0030032)|mitotic cell cycle (GO:0000278)|negative regulation of hippo signaling (GO:0035331)|negative regulation of kinase activity (GO:0033673)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular biosynthetic process (GO:0031328)|positive regulation of gene silencing by miRNA (GO:2000637)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein complex assembly (GO:0031334)|regulation of cell migration (GO:0030334)|regulation of cellular response to hypoxia (GO:1900037)|regulation of GTPase activity (GO:0043087)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|wound healing, spreading of epidermal cells (GO:0035313)	cell-cell junction (GO:0005911)|cytoplasmic mRNA processing body (GO:0000932)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcription factor complex (GO:0005667)	alpha-catenin binding (GO:0045294)|chromatin binding (GO:0003682)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)										GACGGCTCAATCCCCGAGGGTT	0.703																																						uc001whz.2		NA																	0					0						c.(907-912)GGGATTfs		ajuba isoform 1																																				SO:0001589	frameshift_variant	84962				cell cycle|gene silencing by miRNA|positive regulation of protein complex assembly	cell-cell junction|cytoplasmic mRNA processing body|microtubule organizing center	alpha-catenin binding|zinc ion binding	g.chr14:23450566_23450567insC	AK025567	CCDS9581.1, CCDS9582.1	14q11.2	2011-11-10	2011-11-10	2011-11-10	ENSG00000129474	ENSG00000129474			20250	protein-coding gene	gene with protein product		609066	"""jub, ajuba homolog (Xenopus laevis)"""	JUB		10330178	Standard	NM_032876		Approved	MGC15563	uc001whz.3	Q96IF1	OTTHUMG00000028711	ENST00000262713.2:c.910dupG	14.37:g.23450570_23450570dupC	ENSP00000262713:p.Ile304fs		Somatic					p.G303fs	NM_032876	NP_116265	WXS	Illumina HiSeq	Unspecified	Q96IF1	JUB_HUMAN		GBM - Glioblastoma multiforme(265;0.0122)	1	1285_1286	-	all_cancers(95;4.6e-05)		303_304			PreLIM.		A8MX18|D3DS37	Frame_Shift_Ins	INS	ENST00000262713.2	37	c.909_910insG	CCDS9581.1																																																																																				0.703	AJUBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071685.2			9	49	NA	NA	NA	NA	9	49	---	---	---	---
TP53BP1	7158	broad.mit.edu	37	15	43701208	43701209	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr15:43701208_43701209insG	ENST00000263801.3	-	26	5723_5724	c.5471_5472insC	c.(5470-5472)cctfs	p.P1824fs	TP53BP1_ENST00000450115.2_Frame_Shift_Ins_p.P1827fs|TP53BP1_ENST00000382039.3_Frame_Shift_Ins_p.P1779fs|TP53BP1_ENST00000382044.4_Frame_Shift_Ins_p.P1829fs	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1824	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		GAGACACACAAGGAATCCCACT	0.49								Other conserved DNA damage response genes																														uc001zrs.2		NA																	0				ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7						c.(5470-5472)CCTfs	Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	tumor protein p53 binding protein 1 isoform 3																																				SO:0001589	frameshift_variant	7158				double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity	g.chr15:43701208_43701209insG	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.5472dupC	15.37:g.43701210_43701210dupG	ENSP00000263801:p.Pro1824fs		Somatic				TP53BP1_uc010udp.1_Frame_Shift_Ins_p.P1822fs|TP53BP1_uc001zrq.3_Frame_Shift_Ins_p.P1827fs|TP53BP1_uc001zrr.3_Frame_Shift_Ins_p.P1829fs|TP53BP1_uc001zrp.2_Frame_Shift_Ins_p.P241fs	p.P1824fs	NM_005657	NP_005648	WXS	Illumina HiSeq	Unspecified	Q12888	TP53B_HUMAN		GBM - Glioblastoma multiforme(94;1.59e-06)	26	5619_5620	-		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)	1824			BRCT 1.		F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Frame_Shift_Ins	INS	ENST00000263801.3	37	c.5471_5472insC	CCDS10096.1																																																																																				0.490	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3			16	123	NA	NA	NA	NA	16	123	---	---	---	---
WWP1	11059	broad.mit.edu	37	8	87470164	87470165	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BA-5556-01A-01D-1512-08	TCGA-BA-5556-10A-01D-1512-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	d31fda32-363b-44e4-8f2c-834a66f46b87	39b1a5f5-ffcd-4af3-8a6f-3c71f1496df7	g.chr8:87470164_87470165insA	ENST00000517970.1	+	22	2716_2717	c.2409_2410insA	c.(2410-2412)atgfs	p.M804fs	WWP1_ENST00000265428.4_Frame_Shift_Ins_p.M804fs|WWP1_ENST00000341922.2_Frame_Shift_Ins_p.M674fs|WWP1_ENST00000349423.2_Frame_Shift_Ins_p.M586fs	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	804	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						TGTTGTGTGGCATGCAGGAGGT	0.376																																						uc003ydt.2		NA																	0				lung(1)|liver(1)	2						c.(2407-2412)GGCATGfs		WW domain containing E3 ubiquitin protein ligase																																				SO:0001589	frameshift_variant	11059				central nervous system development|entry of virus into host cell|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|signal transduction	cytoplasm|nucleus|plasma membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	g.chr8:87470164_87470165insA	AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.2410dupA	8.37:g.87470165_87470165dupA	ENSP00000427793:p.Met804fs		Somatic					p.G803fs	NM_007013	NP_008944	WXS	Illumina HiSeq	Unspecified	Q9H0M0	WWP1_HUMAN			22	2689_2690	+			803_804	M->P: Strongly reduces ubiquitin transfer; when associated with P-806.		HECT.		O00307|Q5YLC1|Q96BP4	Frame_Shift_Ins	INS	ENST00000517970.1	37	c.2409_2410insA	CCDS6242.1																																																																																				0.376	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374755.1	NM_007013		32	194	NA	NA	NA	NA	32	194	---	---	---	---
