#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_Mutation_Status	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
RERE	473	broad.mit.edu	37	1	8421855	8421855	+	Missense_Mutation	SNP	C	C	T	rs368517564		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:8421855C>T	ENST00000337907.3	-	18	2618	c.1984G>A	c.(1984-1986)Gac>Aac	p.D662N	RERE_ENST00000400907.2_Intron|RERE_ENST00000400908.2_Missense_Mutation_p.D662N|RERE_ENST00000476556.1_Missense_Mutation_p.D108N|RERE_ENST00000377464.1_Missense_Mutation_p.D394N	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	662					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CTGGTCCTGTCAGCCTCCTCC	0.552																																						uc001ape.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1984-1986)GAC>AAC		atrophin-1 like protein isoform a							98.0	95.0	96.0					1																	8421855		2203	4300	6503	SO:0001583	missense	473				multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:8421855C>T	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.1984G>A	1.37:g.8421855C>T	ENSP00000338629:p.Asp662Asn		Somatic				RERE_uc001apf.2_Missense_Mutation_p.D662N|RERE_uc010nzx.1_Missense_Mutation_p.D394N|RERE_uc001apd.2_Missense_Mutation_p.D108N	p.D662N	NM_012102	NP_036234	WXS	Illumina HiSeq	Unspecified	Q9P2R6	RERE_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)	18	2794	-	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)	662					O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	ENST00000337907.3	37	c.1984G>A	CCDS95.1	.	.	.	.	.	.	.	.	.	.	C	36	5.830832	0.97003	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908;ENST00000505225	T;T;T;T	0.63096	-0.02;3.49;1.99;-0.02	5.44	5.44	0.79542	.	.	.	.	.	T	0.57755	0.2075	L	0.36672	1.1	0.53005	D	0.999965	P;B	0.35493	0.505;0.099	B;B	0.39738	0.308;0.112	T	0.53535	-0.8425	9	0.25751	T	0.34	-20.0712	18.2489	0.89996	0.0:1.0:0.0:0.0	.	394;662	B1AKN3;Q9P2R6	.;RERE_HUMAN	N	662;394;108;662;82	ENSP00000338629:D662N;ENSP00000366684:D394N;ENSP00000422246:D108N;ENSP00000383700:D662N	ENSP00000338629:D662N	D	-	1	0	RERE	8344442	1.000000	0.71417	0.923000	0.36655	0.988000	0.76386	6.021000	0.70832	2.576000	0.86940	0.561000	0.74099	GAC		0.552	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1			47	107	0	0	0	0	47	107				
SLC2A5	6518	broad.mit.edu	37	1	9101976	9101976	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:9101976G>C	ENST00000377424.4	-	5	618	c.439C>G	c.(439-441)Ccc>Gcc	p.P147A	SLC2A5_ENST00000536305.1_Missense_Mutation_p.P88A|SLC2A5_ENST00000535586.1_Missense_Mutation_p.P32A|SLC2A5_ENST00000377414.3_Missense_Mutation_p.P147A	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	147					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)			endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		AAGTACATGGGGACCACGTTG	0.512																																						uc001apo.2		NA																	0				pancreas(2)|ovary(1)	3						c.(439-441)CCC>GCC		solute carrier family 2 (facilitated							24.0	23.0	23.0					1																	9101976		2203	4300	6503	SO:0001583	missense	6518				carbohydrate metabolic process	integral to membrane|plasma membrane	fructose transmembrane transporter activity|glucose transmembrane transporter activity	g.chr1:9101976G>C	BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.439C>G	1.37:g.9101976G>C	ENSP00000366641:p.Pro147Ala		Somatic				SLC2A5_uc010nzy.1_Missense_Mutation_p.P88A|SLC2A5_uc010nzz.1_Missense_Mutation_p.P32A|SLC2A5_uc010oaa.1_Missense_Mutation_p.P103A|SLC2A5_uc010oab.1_Missense_Mutation_p.P147A|SLC2A5_uc010oac.1_Missense_Mutation_p.P105R|SLC2A5_uc001app.3_Missense_Mutation_p.P147A	p.P147A	NM_003039	NP_003030	WXS	Illumina HiSeq	Unspecified	P22732	GTR5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)	5	731	-	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)	147			Cytoplasmic (Potential).		Q14770|Q5T977|Q8IVB3	Missense_Mutation	SNP	ENST00000377424.4	37	c.439C>G	CCDS99.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971638	0.92919	.	.	ENSG00000142583	ENST00000377424;ENST00000456780;ENST00000536305;ENST00000535586;ENST00000377414	D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72	5.49	5.49	0.81192	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Sugar transporter, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.93556	0.7943	M	0.93808	3.46	0.80722	D	1	P;P;D;P	0.76494	0.955;0.955;0.999;0.955	P;P;D;P	0.76575	0.887;0.887;0.988;0.887	D	0.94746	0.7923	10	0.87932	D	0	.	18.3241	0.90247	0.0:0.0:1.0:0.0	.	103;88;147;147	B4DG19;B4DU31;P22732-2;P22732	.;.;.;GTR5_HUMAN	A	147;130;88;32;147	ENSP00000366641:P147A;ENSP00000440688:P88A;ENSP00000442744:P32A;ENSP00000366631:P147A	ENSP00000366631:P147A	P	-	1	0	SLC2A5	9024563	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	9.133000	0.94460	2.731000	0.93534	0.650000	0.86243	CCC		0.512	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004932.1	NM_003039		12	39	0	0	0	0	12	39				
NBPF3	84224	broad.mit.edu	37	1	21808093	21808093	+	Silent	SNP	C	C	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:21808093C>A	ENST00000318249.5	+	13	1787	c.1437C>A	c.(1435-1437)ctC>ctA	p.L479L	NBPF3_ENST00000342104.5_Silent_p.L467L|NBPF3_ENST00000454000.2_Silent_p.L409L|NBPF3_ENST00000318220.6_Silent_p.L423L	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	479	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TTTCCAGGCTCAGCAGAGAGC	0.458																																						uc001ber.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1435-1437)CTC>CTA		neuroblastoma breakpoint family, member 3							53.0	65.0	61.0					1																	21808093		2200	4298	6498	SO:0001819	synonymous_variant	84224					cytoplasm		g.chr1:21808093C>A	BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1437C>A	1.37:g.21808093C>A			Somatic				NBPF3_uc001bes.2_Silent_p.L423L|NBPF3_uc009vqb.2_Silent_p.L467L|NBPF3_uc010odm.1_Silent_p.L409L	p.L479L	NM_032264	NP_115640	WXS	Illumina HiSeq	Unspecified	Q9H094	NBPF3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	13	1787	+		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)	479			NBPF 4.		A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Silent	SNP	ENST00000318249.5	37	c.1437C>A	CCDS216.1																																																																																				0.458	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032264		44	106	1	0	1.03e-13	1.14e-13	44	106				
CELA3B	23436	broad.mit.edu	37	1	22313044	22313044	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:22313044C>T	ENST00000337107.6	+	7	682	c.663C>T	c.(661-663)ctC>ctT	p.L221L	RN7SL386P_ENST00000485776.2_RNA|CELA3B_ENST00000473526.1_3'UTR|RNU6-1022P_ENST00000365049.1_RNA	NM_007352.2	NP_031378.1	P08861	CEL3B_HUMAN	chymotrypsin-like elastase family, member 3B	221	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			breast(2)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						GAGGACCCCTCAACTGCCCCA	0.572																																						uc001bfk.2		NA																	0				ovary(1)	1						c.(661-663)CTC>CTT		elastase 3B, pancreatic preproprotein							72.0	65.0	67.0					1																	22313044		2203	4300	6503	SO:0001819	synonymous_variant	23436				cholesterol metabolic process|proteolysis	extracellular region	serine-type endopeptidase activity	g.chr1:22313044C>T	M18692	CCDS219.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000219073	ENSG00000219073	3.4.21.70		15945	protein-coding gene	gene with protein product	"""proteinase E"", ""elastase 1"", ""cholesterol-binding pancreatic protease"", ""pancreatic endopeptidase E"""		"""elastase 3B, pancreatic"""	ELA3B		2826474, 2460440	Standard	NM_007352		Approved	CBPP	uc001bfk.3	P08861	OTTHUMG00000002758	ENST00000337107.6:c.663C>T	1.37:g.22313044C>T			Somatic				CELA3B_uc009vqf.2_Intron	p.L221L	NM_007352	NP_031378	WXS	Illumina HiSeq	Unspecified	P08861	CEL3B_HUMAN			7	778	+			221			Peptidase S1.		B2RE44|P11423|Q5VU28|Q5VU29|Q5VU30	Silent	SNP	ENST00000337107.6	37	c.663C>T	CCDS219.1																																																																																				0.572	CELA3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007797.1	NM_007352		7	96	0	0	0	0	7	96				
ZNF436	80818	broad.mit.edu	37	1	23688794	23688795	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:23688794_23688795GC>AA	ENST00000314011.4	-	4	1216_1217	c.1080_1081GC>TT	c.(1078-1083)aaGCca>aaTTca	p.360_361KP>NS	ZNF436_ENST00000374608.3_Missense_Mutation_p.360_361KP>NS	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	360					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		CATTCATATGGCTTCTCTCCAG	0.48																																						uc001bgt.2		NA																	0				breast(1)	1						c.(1078-1083)AAGCCA>AATTCA		zinc finger protein 436																																				SO:0001583	missense	80818				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:23688794_23688795GC>AA	AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232	ENST00000314011.4:c.1080_1081delinsAA	1.37:g.23688794_23688795delinsAA	ENSP00000313582:p.K360_P361delinsNS		Somatic				ZNF436_uc001bgu.2_Missense_Mutation_p.360_361KP>NS	p.360_361KP>NS	NM_030634	NP_085137	WXS	Illumina HiSeq	Unspecified	Q9C0F3	ZN436_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)	3	1461_1462	-		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)	360_361					Q658I9	Missense_Mutation	DNP	ENST00000314011.4	37	c.1080_1081GC>TT	CCDS233.1																																																																																				0.480	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634		121	154	0	0	0	0	121	154				
NIPAL3	57185	broad.mit.edu	37	1	24766687	24766687	+	Missense_Mutation	SNP	C	C	T	rs143586098		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:24766687C>T	ENST00000374399.4	+	3	487	c.119C>T	c.(118-120)gCg>gTg	p.A40V	NIPAL3_ENST00000339255.2_Missense_Mutation_p.A40V|NIPAL3_ENST00000358028.4_Missense_Mutation_p.A40V|NIPAL3_ENST00000428131.1_Missense_Mutation_p.A40V|NIPAL3_ENST00000003912.3_5'UTR	NM_020448.4	NP_065181.1	Q6P499	NPAL3_HUMAN	NIPA-like domain containing 3	40						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(1)	14						GCCCTCTTGGCGATCTTCGGG	0.537																																						uc001bjh.2		NA																	0					0						c.(118-120)GCG>GTG		NIPA-like domain containing 3		C	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	102.0	91.0	95.0		119	5.0	0.9	1	dbSNP_134	95	0,8600		0,0,4300	no	missense	NIPAL3	NM_020448.4	64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	40/407	24766687	1,13005	2203	4300	6503	SO:0001583	missense	57185					integral to membrane		g.chr1:24766687C>T	BX640883	CCDS30631.1	1p36.12-p35.1	2009-03-24		2009-03-24	ENSG00000001461	ENSG00000001461			25233	protein-coding gene	gene with protein product				NPAL3		8619474, 9110174	Standard	NM_020448		Approved	DJ462O23.2	uc001bjh.3	Q6P499	OTTHUMG00000003299	ENST00000374399.4:c.119C>T	1.37:g.24766687C>T	ENSP00000363520:p.Ala40Val		Somatic				NIPAL3_uc010oek.1_Missense_Mutation_p.A40V|NIPAL3_uc001bjg.2_Missense_Mutation_p.A40V|NIPAL3_uc009vrc.2_5'UTR	p.A40V	NM_020448	NP_065181	WXS	Illumina HiSeq	Unspecified	Q6P499	NPAL3_HUMAN			3	526	+			40			Helical; (Potential).		A2A298|Q6MZT9|Q9BVE6	Missense_Mutation	SNP	ENST00000374399.4	37	c.119C>T	CCDS30631.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.411890	0.83340	2.27E-4	0.0	ENSG00000001461	ENST00000374399;ENST00000358028;ENST00000339255;ENST00000428131	D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5	4.99	4.99	0.66335	.	0.052766	0.85682	D	0.000000	D	0.97632	0.9224	M	0.88377	2.95	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72982	0.946;0.968;0.979	D	0.98600	1.0658	10	0.87932	D	0	-20.0202	18.2644	0.90048	0.0:1.0:0.0:0.0	.	40;40;40	Q6P499-3;Q6P499;A6NN97	.;NPAL3_HUMAN;.	V	40	ENSP00000363520:A40V;ENSP00000350722:A40V;ENSP00000343549:A40V;ENSP00000406509:A40V	ENSP00000343549:A40V	A	+	2	0	NIPAL3	24639274	1.000000	0.71417	0.942000	0.38095	0.423000	0.31445	6.387000	0.73191	2.317000	0.78254	0.585000	0.79938	GCG		0.537	NIPAL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276996.1	NM_020448		41	108	0	0	0	0	41	108				
PPIE	10450	broad.mit.edu	37	1	40214724	40214724	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:40214724G>A	ENST00000324379.5	+	8	677	c.658G>A	c.(658-660)Gat>Aat	p.D220N	PPIE_ENST00000356511.2_Missense_Mutation_p.D220N|PPIE_ENST00000372830.1_Missense_Mutation_p.D220N|PPIE_ENST00000470213.1_Silent_p.S178S	NM_006112.3	NP_006103.1	Q9UNP9	PPIE_HUMAN	peptidylprolyl isomerase E (cyclophilin E)	220	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of viral genome replication (GO:0045070)|protein folding (GO:0006457)|regulation of transcription, DNA-templated (GO:0006355)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|nucleotide binding (GO:0000166)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(3)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	9	all_cancers(7;1.63e-13)|all_lung(5;2.27e-16)|all_epithelial(6;1.35e-15)|Lung NSC(20;1.49e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;2.7e-17)|all cancers(16;5.5e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GAAGAAGTTCGATGATGAAAA	0.552																																						uc001cds.1		NA																	0					0						c.(658-660)GAT>AAT		peptidylprolyl isomerase E isoform 1							88.0	84.0	85.0					1																	40214724		2203	4300	6503	SO:0001583	missense	10450				protein folding|regulation of transcription, DNA-dependent	catalytic step 2 spliceosome	cyclosporin A binding|nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|protein binding|RNA binding	g.chr1:40214724G>A	AF042385	CCDS442.1, CCDS443.1, CCDS53299.1	1p32	2013-02-12			ENSG00000084072	ENSG00000084072		"""RNA binding motif (RRM) containing"""	9258	protein-coding gene	gene with protein product	"""peptidyl-prolyl cis-trans isomerase E"", ""cyclophilin 33"", ""cyclophilin E"", ""PPIase E"", ""rotamase E"", ""peptidylprolyl isomerase E, isoform 1"""	602435				9747881	Standard	NM_203456		Approved	CyP-33, MGC3736, MGC111222	uc001cdw.3	Q9UNP9	OTTHUMG00000009248	ENST00000324379.5:c.658G>A	1.37:g.40214724G>A	ENSP00000312769:p.Asp220Asn		Somatic				PPIE_uc001cdt.1_Missense_Mutation_p.D154N|PPIE_uc010oiy.1_Missense_Mutation_p.D141N|PPIE_uc001cdu.1_RNA|PPIE_uc001cdv.2_Missense_Mutation_p.D220N|PPIE_uc001cdw.2_Missense_Mutation_p.D220N|PPIE_uc001cdx.1_Missense_Mutation_p.D136N	p.D220N	NM_006112	NP_006103	WXS	Illumina HiSeq	Unspecified	Q9UNP9	PPIE_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;2.7e-17)|all cancers(16;5.5e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)		8	701	+	all_cancers(7;1.63e-13)|all_lung(5;2.27e-16)|all_epithelial(6;1.35e-15)|Lung NSC(20;1.49e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	220			PPIase cyclophilin-type.		B2R971|O43634|O43635|Q32Q72|Q3S611|Q5TGA0|Q5TGA2|Q5TGA3|Q9UIZ5	Missense_Mutation	SNP	ENST00000324379.5	37	c.658G>A	CCDS443.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.669414	0.67814	.	.	ENSG00000084072	ENST00000324379;ENST00000356511;ENST00000497370;ENST00000372835;ENST00000372830	T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97	4.87	4.87	0.63330	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (3);Cyclophilin-like (1);	0.052701	0.85682	D	0.000000	T	0.23572	0.0570	L	0.39245	1.2	0.80722	D	1	P;P;P;P	0.51449	0.641;0.942;0.851;0.945	B;P;B;B	0.44860	0.221;0.462;0.193;0.261	T	0.01252	-1.1405	10	0.40728	T	0.16	-30.9549	17.7843	0.88533	0.0:0.0:1.0:0.0	.	141;220;220;220	B4E3F2;Q5TGA3;Q9UNP9-2;Q9UNP9	.;.;.;PPIE_HUMAN	N	220;220;154;169;220	ENSP00000312769:D220N;ENSP00000348904:D220N;ENSP00000433475:D154N;ENSP00000361925:D169N;ENSP00000361918:D220N	ENSP00000312769:D220N	D	+	1	0	PPIE	39987311	1.000000	0.71417	0.997000	0.53966	0.815000	0.46073	9.233000	0.95337	2.550000	0.86006	0.462000	0.41574	GAT		0.552	PPIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025642.2	NM_006112		51	94	0	0	0	0	51	94				
PTPRF	5792	broad.mit.edu	37	1	44069435	44069435	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:44069435G>A	ENST00000359947.4	+	16	2952	c.2612G>A	c.(2611-2613)gGc>gAc	p.G871D	PTPRF_ENST00000422171.2_Missense_Mutation_p.G219D|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000438120.1_Missense_Mutation_p.G862D|PTPRF_ENST00000372413.3_Missense_Mutation_p.G862D|PTPRF_ENST00000372414.3_Missense_Mutation_p.G871D	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	871	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ATAGATTTCGGCAAGGATGAC	0.637																																						uc001cjr.2		NA																	0				ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10						c.(2611-2613)GGC>GAC		protein tyrosine phosphatase, receptor type, F							61.0	65.0	64.0					1																	44069435		2203	4300	6503	SO:0001583	missense	5792				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity	g.chr1:44069435G>A	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.2612G>A	1.37:g.44069435G>A	ENSP00000353030:p.Gly871Asp		Somatic				PTPRF_uc001cjs.2_Missense_Mutation_p.G862D|PTPRF_uc001cju.2_Intron|PTPRF_uc009vwt.2_Missense_Mutation_p.G431D|PTPRF_uc001cjv.2_Missense_Mutation_p.G331D|PTPRF_uc001cjw.2_Missense_Mutation_p.G97D	p.G871D	NM_002840	NP_002831	WXS	Illumina HiSeq	Unspecified	P10586	PTPRF_HUMAN			16	2952	+	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)	871			Extracellular (Potential).|Fibronectin type-III 6.		D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	c.2612G>A	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.38|13.38	2.219662|2.219662	0.39201|0.39201	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000429895|ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171	.|T;T;T;T;T	.|0.55413	.|0.52;0.52;0.52;0.52;0.52	5.03|5.03	5.03|5.03	0.67393|0.67393	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.000000	.|0.34986	.|N	.|0.003535	T|T	0.50274|0.50274	0.1606|0.1606	L|L	0.28115|0.28115	0.83|0.83	0.58432|0.58432	D|D	0.999999|0.999999	.|B;B;B;P	.|0.50272	.|0.004;0.094;0.106;0.933	.|B;B;B;P	.|0.53146	.|0.033;0.16;0.045;0.719	T|T	0.35425|0.35425	-0.9789|-0.9789	5|10	.|0.06891	.|T	.|0.86	.|.	18.746|18.746	0.91792|0.91792	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|516;219;862;871	.|Q59FI2;F2Z3B8;P10586-2;P10586	.|.;.;.;PTPRF_HUMAN	T|D	517|871;862;871;862;219	.|ENSP00000353030:G871D;ENSP00000398822:G862D;ENSP00000361491:G871D;ENSP00000361490:G862D;ENSP00000387885:G219D	.|ENSP00000353030:G871D	A|G	+|+	1|2	0|0	PTPRF|PTPRF	43842022|43842022	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.869000|0.869000	0.49853|0.49853	2.810000|2.810000	0.47979|0.47979	2.504000|2.504000	0.84457|0.84457	0.655000|0.655000	0.94253|0.94253	GCA|GGC		0.637	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1			35	85	0	0	0	0	35	85				
MAST2	23139	broad.mit.edu	37	1	46500768	46500768	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:46500768G>T	ENST00000361297.2	+	29	4710	c.4427G>T	c.(4426-4428)cGg>cTg	p.R1476L	MAST2_ENST00000372009.2_Missense_Mutation_p.R1286L	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					GCTCCCTCACGGGCCCTAGGC	0.662																																						uc001cov.2		NA																	0				ovary(5)|lung(3)|stomach(2)|breast(1)	11						c.(4426-4428)CGG>CTG		microtubule associated serine/threonine kinase							23.0	27.0	25.0					1																	46500768		2031	4180	6211	SO:0001583	missense	23139				regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity	g.chr1:46500768G>T	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.4427G>T	1.37:g.46500768G>T	ENSP00000354671:p.Arg1476Leu		Somatic				MAST2_uc001cow.2_Missense_Mutation_p.R1475L|MAST2_uc001cpa.2_RNA	p.R1476L	NM_015112	NP_055927	WXS	Illumina HiSeq	Unspecified	Q6P0Q8	MAST2_HUMAN			29	4710	+	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)		1476						Missense_Mutation	SNP	ENST00000361297.2	37	c.4427G>T	CCDS41326.1	.	.	.	.	.	.	.	.	.	.	g	11.66	1.705170	0.30232	.	.	ENSG00000086015	ENST00000361297;ENST00000372009;ENST00000456625	T;T	0.68181	-0.2;-0.31	4.58	4.58	0.56647	.	0.466412	0.20894	N	0.083780	T	0.58366	0.2117	L	0.32530	0.975	0.26558	N	0.97379	B;B	0.29341	0.22;0.242	B;B	0.25987	0.065;0.029	T	0.59364	-0.7468	10	0.66056	D	0.02	-2.1073	17.9515	0.89055	0.0:0.0:1.0:0.0	.	1286;1476	E7ERL6;Q6P0Q8	.;MAST2_HUMAN	L	1476;1286;163	ENSP00000354671:R1476L;ENSP00000361079:R1286L	ENSP00000354671:R1476L	R	+	2	0	MAST2	46273355	1.000000	0.71417	0.128000	0.21923	0.436000	0.31835	6.140000	0.71738	2.538000	0.85594	0.461000	0.40582	CGG		0.662	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112		21	40	1	0	5.26e-13	5.81e-13	21	40				
MYSM1	114803	broad.mit.edu	37	1	59147716	59147716	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:59147716C>T	ENST00000472487.1	-	8	1039	c.1000G>A	c.(1000-1002)Gat>Aat	p.D334N	MYSM1_ENST00000493821.1_5'UTR	NM_001085487.2	NP_001078956.1	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	334					chromatin remodeling (GO:0006338)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(7;9.36e-06)					TGCCTGGCATCAACTATTATT	0.348																																						uc009wab.1		NA																	0				skin(1)	1						c.(1000-1002)GAT>AAT		Myb-like, SWIRM and MPN domains 1							119.0	108.0	111.0					1																	59147716		1834	4094	5928	SO:0001583	missense	114803				histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin remodeling complex	DNA binding|histone binding|metal ion binding|metallopeptidase activity|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr1:59147716C>T	AB067502	CCDS41343.1	1p32.1	2009-02-11	2009-02-11		ENSG00000162601	ENSG00000162601			29401	protein-coding gene	gene with protein product		612176				11572484, 17428495, 17707232	Standard	NM_001085487		Approved	KIAA1915	uc009wab.2	Q5VVJ2	OTTHUMG00000009533	ENST00000472487.1:c.1000G>A	1.37:g.59147716C>T	ENSP00000418734:p.Asp334Asn		Somatic				MYSM1_uc001czc.2_RNA	p.D334N	NM_001085487	NP_001078956	WXS	Illumina HiSeq	Unspecified	Q5VVJ2	MYSM1_HUMAN			8	1023	-	all_cancers(7;9.36e-06)		334					A8KA54|B3KX65|Q68DD3|Q6AI53|Q7Z3G8|Q96PX3	Missense_Mutation	SNP	ENST00000472487.1	37	c.1000G>A	CCDS41343.1	.	.	.	.	.	.	.	.	.	.	C	6.763	0.509707	0.12883	.	.	ENSG00000162601	ENST00000472487	T	0.22743	1.94	4.63	2.62	0.31277	.	0.996046	0.08149	N	0.990355	T	0.15089	0.0364	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19289	-1.0310	10	0.38643	T	0.18	-0.4563	8.9933	0.36037	0.1472:0.7701:0.0:0.0826	.	334	Q5VVJ2	MYSM1_HUMAN	N	334	ENSP00000418734:D334N	ENSP00000418734:D334N	D	-	1	0	MYSM1	58920304	0.000000	0.05858	0.006000	0.13384	0.038000	0.13279	0.323000	0.19593	1.312000	0.45043	0.585000	0.79938	GAT		0.348	MYSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026343.2	XM_055481		79	174	0	0	0	0	79	174				
CACHD1	57685	broad.mit.edu	37	1	65117854	65117854	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:65117854G>A	ENST00000371073.2	+	10	1401	c.1401G>A	c.(1399-1401)atG>atA	p.M467I	CACHD1_ENST00000290039.5_Missense_Mutation_p.M416I|CACHD1_ENST00000495994.1_3'UTR			Q5VU97	CAHD1_HUMAN	cache domain containing 1	467	Cache 1.				calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						GTTTGATAATGACTGTGAGTA	0.403																																						uc001dbo.1		NA																	0				ovary(2)	2						c.(1246-1248)ATG>ATA		cache domain containing 1							174.0	161.0	165.0					1																	65117854		2203	4300	6503	SO:0001583	missense	57685				calcium ion transport	integral to membrane		g.chr1:65117854G>A	AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.1401G>A	1.37:g.65117854G>A	ENSP00000360113:p.Met467Ile		Somatic				CACHD1_uc001dbp.1_Missense_Mutation_p.M171I|CACHD1_uc001dbq.1_Missense_Mutation_p.M171I	p.M416I	NM_020925	NP_065976	WXS	Illumina HiSeq	Unspecified	Q5VU97	CAHD1_HUMAN			10	1353	+			467			Extracellular (Potential).|Cache 1.		Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Missense_Mutation	SNP	ENST00000371073.2	37	c.1248G>A		.	.	.	.	.	.	.	.	.	.	G	11.13	1.549014	0.27652	.	.	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.20881	2.04;2.04	6.17	6.17	0.99709	Cache (1);	0.000000	0.85682	D	0.000000	T	0.06462	0.0166	N	0.00436	-1.5	0.80722	D	1	P	0.40180	0.705	P	0.55824	0.785	T	0.33214	-0.9877	10	0.05436	T	0.98	-36.9794	20.8794	0.99867	0.0:0.0:1.0:0.0	.	467	Q5VU97	CAHD1_HUMAN	I	467;416	ENSP00000360113:M467I;ENSP00000290039:M416I	ENSP00000290039:M416I	M	+	3	0	CACHD1	64890442	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	ATG		0.403	CACHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_020925		49	113	0	0	0	0	49	113				
GADD45A	1647	broad.mit.edu	37	1	68153400	68153400	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:68153400C>T	ENST00000370986.4	+	4	875	c.441C>T	c.(439-441)tgC>tgT	p.C147C	GADD45A_ENST00000370985.3_Silent_p.C113C	NM_001924.3	NP_001915.1	P24522	GA45A_HUMAN	growth arrest and DNA-damage-inducible, alpha	147					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|signal transduction in response to DNA damage (GO:0042770)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter binding (GO:0001047)			lung(2)|ovary(2)	4						TTTGTTTTTGCCGGGAAAGTC	0.358																																						uc001ddz.1		NA																	0				ovary(1)	1						c.(439-441)TGC>TGT		growth arrest and DNA-damage-inducible, alpha							108.0	101.0	103.0					1																	68153400		2203	4300	6503	SO:0001819	synonymous_variant	1647				apoptosis|cell cycle arrest|cellular response to ionizing radiation|cellular response to mechanical stimulus|DNA repair|positive regulation of reactive oxygen species metabolic process|regulation of cyclin-dependent protein kinase activity|signal transduction in response to DNA damage	nucleus	protein binding	g.chr1:68153400C>T	M60974	CCDS640.1, CCDS55605.1, CCDS72806.1	1p31.2	2010-08-27			ENSG00000116717	ENSG00000116717			4095	protein-coding gene	gene with protein product		126335		DDIT1		1990262, 8226988	Standard	NM_001924		Approved	GADD45	uc001ddz.2	P24522	OTTHUMG00000009374	ENST00000370986.4:c.441C>T	1.37:g.68153400C>T			Somatic				GADD45A_uc009wbb.1_Silent_p.C113C|GADD45A_uc009wbc.1_RNA|GADD45A_uc009wbd.1_RNA	p.C147C	NM_001924	NP_001915	WXS	Illumina HiSeq	Unspecified	P24522	GA45A_HUMAN			4	736	+			147					Q5TCA7|Q5TCA8	Silent	SNP	ENST00000370986.4	37	c.441C>T	CCDS640.1																																																																																				0.358	GADD45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025988.2	NM_001924		4	239	0	0	0	0	4	239				
CLCA2	9635	broad.mit.edu	37	1	86919091	86919091	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:86919091G>A	ENST00000370565.4	+	13	2357	c.2195G>A	c.(2194-2196)aGa>aAa	p.R732K	CLCA2_ENST00000498802.1_3'UTR	NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	732					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		TCAGTAGGCAGAAATGAGGAG	0.453																																					Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	uc001dlr.3		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(2194-2196)AGA>AAA		chloride channel accessory 2 precursor							64.0	68.0	66.0					1																	86919091		2203	4300	6503	SO:0001583	missense	9635				cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity	g.chr1:86919091G>A		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.2195G>A	1.37:g.86919091G>A	ENSP00000359596:p.Arg732Lys		Somatic					p.R732K	NM_006536	NP_006527	WXS	Illumina HiSeq	Unspecified	Q9UQC9	CLCA2_HUMAN		all cancers(265;0.0233)|Epithelial(280;0.0452)	13	2357	+		Lung NSC(277;0.238)	732			Extracellular (Potential).		A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	37	c.2195G>A	CCDS708.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.242142	0.22796	.	.	ENSG00000137975	ENST00000370565	T	0.02656	4.21	5.72	2.01	0.26516	.	1.323620	0.04678	N	0.411824	T	0.00724	0.0024	L	0.32530	0.975	0.09310	N	1	B	0.12013	0.005	B	0.11329	0.006	T	0.47114	-0.9142	10	0.15499	T	0.54	0.5308	2.8564	0.05573	0.2695:0.0:0.2747:0.4558	.	732	Q9UQC9	CLCA2_HUMAN	K	732	ENSP00000359596:R732K	ENSP00000359596:R732K	R	+	2	0	CLCA2	86691679	0.000000	0.05858	0.001000	0.08648	0.935000	0.57460	0.554000	0.23407	0.688000	0.31529	0.650000	0.86243	AGA		0.453	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536		4	108	0	0	0	0	4	108				
LRRC8B	23507	broad.mit.edu	37	1	90049934	90049934	+	Silent	SNP	G	G	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:90049934G>T	ENST00000330947.2	+	5	2085	c.1725G>T	c.(1723-1725)ctG>ctT	p.L575L	LRRC8B_ENST00000358200.4_Silent_p.L575L|RP5-1007M22.2_ENST00000443562.1_RNA|LRRC8B_ENST00000439853.1_Silent_p.L575L	NM_001134476.1	NP_001127948.1	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member B	575					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	26		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		GAAGCAAACTGGTTGTGTTGA	0.463																																						uc001dni.2		NA																	0				ovary(2)	2						c.(1723-1725)CTG>CTT		leucine rich repeat containing 8 family, member							51.0	51.0	51.0					1																	90049934		2203	4300	6503	SO:0001819	synonymous_variant	23507					integral to membrane		g.chr1:90049934G>T	AF385436	CCDS724.1	1p22.2	2008-02-05			ENSG00000197147	ENSG00000197147			30692	protein-coding gene	gene with protein product	"""T cell activation leucine repeat rich protein"""	612888				9039502	Standard	NM_015350		Approved	TA-LRRP, KIAA0231	uc001dni.3	Q6P9F7	OTTHUMG00000010129	ENST00000330947.2:c.1725G>T	1.37:g.90049934G>T			Somatic				LRRC8B_uc001dnh.2_Silent_p.L575L|LRRC8B_uc001dnj.2_Silent_p.L575L	p.L575L	NM_001134476	NP_001127948	WXS	Illumina HiSeq	Unspecified	Q6P9F7	LRC8B_HUMAN		all cancers(265;0.00515)|Epithelial(280;0.0241)	7	2232	+		all_lung(203;0.17)	575			LRR 5.		D3DT28|Q6UY21|Q8N106|Q92627	Silent	SNP	ENST00000330947.2	37	c.1725G>T	CCDS724.1																																																																																				0.463	LRRC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028008.1	NM_015350		4	94	1	0	0.00909568	0.00942467	4	94				
SARS	6301	broad.mit.edu	37	1	109778722	109778722	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:109778722G>T	ENST00000234677.2	+	8	1168	c.1093G>T	c.(1093-1095)Gtc>Ttc	p.V365F	SARS_ENST00000369923.4_Missense_Mutation_p.V365F	NM_006513.3	NP_006504.2	P49591	SYSC_HUMAN	seryl-tRNA synthetase	365					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|RNA binding (GO:0003723)|serine-tRNA ligase activity (GO:0004828)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	17		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	TGTGAATATTGTCTCAGGTAT	0.507																																						uc001dwu.1		NA																	0				central_nervous_system(1)	1						c.(1093-1095)GTC>TTC		seryl-tRNA synthetase	L-Serine(DB00133)						85.0	79.0	81.0					1																	109778722		2203	4300	6503	SO:0001583	missense	6301				seryl-tRNA aminoacylation|tRNA processing	cytosol	ATP binding|protein binding|RNA binding|serine-tRNA ligase activity	g.chr1:109778722G>T	BC009390	CCDS795.1	1p13.3	2011-07-01			ENSG00000031698	ENSG00000031698	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	10537	protein-coding gene	gene with protein product	"""serine tRNA ligase 1, cytoplasmic"""	607529				9431993	Standard	NM_006513		Approved	SERS	uc001dwu.2	P49591	OTTHUMG00000011726	ENST00000234677.2:c.1093G>T	1.37:g.109778722G>T	ENSP00000234677:p.Val365Phe		Somatic				SARS_uc001dwt.1_Missense_Mutation_p.V365F|SARS_uc001dwv.1_Missense_Mutation_p.V365F|SARS_uc001dww.1_Missense_Mutation_p.V298F|SARS_uc001dwx.1_Missense_Mutation_p.V317F|SARS_uc009wfa.1_Missense_Mutation_p.V365F|SARS_uc001dwy.1_Missense_Mutation_p.V190F|SARS_uc001dwz.1_Missense_Mutation_p.V190F	p.V365F	NM_006513	NP_006504	WXS	Illumina HiSeq	Unspecified	P49591	SYSC_HUMAN		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	8	1168	+		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)	365					B2R6Y9|Q5T5C8|Q9NSE3	Missense_Mutation	SNP	ENST00000234677.2	37	c.1093G>T	CCDS795.1	.	.	.	.	.	.	.	.	.	.	g	28.9	4.960942	0.92791	.	.	ENSG00000031698	ENST00000234677;ENST00000369923	T;T	0.77098	-1.07;-1.07	5.88	5.88	0.94601	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.91965	0.7455	H	0.96398	3.815	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.997;0.999;0.998	D	0.93572	0.6905	10	0.87932	D	0	-27.9372	19.8332	0.96644	0.0:0.0:1.0:0.0	.	365;365;365;365	Q0VGA5;Q53HA4;Q5T5C7;P49591	.;.;.;SYSC_HUMAN	F	365	ENSP00000234677:V365F;ENSP00000358939:V365F	ENSP00000234677:V365F	V	+	1	0	SARS	109580245	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	9.795000	0.99099	2.789000	0.95967	0.655000	0.94253	GTC		0.507	SARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032394.2	NM_006513		63	84	1	0	1.43e-28	1.65e-28	63	84				
ADORA3	140	broad.mit.edu	37	1	112031598	112031598	+	Missense_Mutation	SNP	G	G	A	rs376471415		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:112031598G>A	ENST00000369716.4	-	3	639	c.506C>T	c.(505-507)aCg>aTg	p.T169M	ADORA3_ENST00000369717.4_Missense_Mutation_p.T88M|RNU6-792P_ENST00000363490.1_RNA	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor	0					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	GGCAGAAGCCGTGTCCAGCAC	0.498																																						uc001ebf.2		NA																	0				ovary(2)|large_intestine(1)|skin(1)	4						c.(505-507)ACG>ATG		adenosine A3 receptor isoform 1	Adenosine(DB00640)|Aminophylline(DB01223)	G	MET/THR,MET/THR	3,4403	6.2+/-15.9	0,3,2200	195.0	179.0	185.0		263,506	3.9	0.8	1		185	0,8600		0,0,4300	no	missense,missense	ADORA3	NM_001081976.1,NM_020683.6	81,81	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	,	88/267,169/348	112031598	3,13003	2203	4300	6503	SO:0001583	missense	140				activation of adenylate cyclase activity|inflammatory response|regulation of heart contraction	integral to plasma membrane	adenosine receptor activity, G-protein coupled	g.chr1:112031598G>A	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.506C>T	1.37:g.112031598G>A	ENSP00000358730:p.Thr169Met		Somatic				ADORA3_uc001ebg.3_Missense_Mutation_p.T88M	p.T169M	NM_020683	NP_065734	WXS	Illumina HiSeq	Unspecified	P33765	AA3R_HUMAN		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	3	1273	-		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)	Error:Variant_position_missing_in_P33765_after_alignment					A2A3P4|Q6UWU0|Q9BYZ1	Missense_Mutation	SNP	ENST00000369716.4	37	c.506C>T	CCDS838.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.31|16.31	3.087920|3.087920	0.55968|0.55968	6.81E-4|6.81E-4	0.0|0.0	ENSG00000121933|ENSG00000121933	ENST00000414219|ENST00000369717;ENST00000369716	.|T;T	.|0.56611	.|2.33;0.45	4.85|4.85	3.93|3.93	0.45458|0.45458	.|.	.|0.000000	.|0.52532	.|D	.|0.000072	T|T	0.63070|0.63070	0.2480|0.2480	M|M	0.84326|0.84326	2.69|2.69	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;P	.|0.70487	.|0.969;0.832	T|T	0.66312|0.66312	-0.5955|-0.5955	5|10	.|0.54805	.|T	.|0.06	-0.0896|-0.0896	8.3952|8.3952	0.32553|0.32553	0.1059:0.0:0.8941:0.0|0.1059:0.0:0.8941:0.0	.|.	.|88;169	.|Q5QNY7;P33765-2	.|.;.	W|M	29|88;169	.|ENSP00000358731:T88M;ENSP00000358730:T169M	.|ENSP00000358730:T169M	R|T	-|-	1|2	2|0	ADORA3|ADORA3	111833121|111833121	0.904000|0.904000	0.30761|0.30761	0.813000|0.813000	0.32504|0.32504	0.704000|0.704000	0.40688|0.40688	0.981000|0.981000	0.29526|0.29526	2.386000|2.386000	0.81285|0.81285	0.462000|0.462000	0.41574|0.41574	CGG|ACG		0.498	ADORA3-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157679.1	NM_000677, NM_020683		33	80	0	0	0	0	33	80				
SYCP1	6847	broad.mit.edu	37	1	115489931	115489931	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:115489931G>A	ENST00000369522.3	+	27	2552	c.2312G>A	c.(2311-2313)aGa>aAa	p.R771K	SYCP1_ENST00000369518.1_Missense_Mutation_p.R771K	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	771					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)	p.R771I(1)	RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAAATAGAAAGAGAAGAGAAG	0.299																																						uc001efr.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	skin(1)	1						c.(2311-2313)AGA>AAA		synaptonemal complex protein 1							60.0	65.0	63.0					1																	115489931		2203	4293	6496	SO:0001583	missense	6847				cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding	g.chr1:115489931G>A	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2312G>A	1.37:g.115489931G>A	ENSP00000358535:p.Arg771Lys		Somatic				SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Missense_Mutation_p.R771K|SYCP1_uc009wgw.2_Intron	p.R771K	NM_003176	NP_003167	WXS	Illumina HiSeq	Unspecified	Q15431	SYCP1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	27	2521	+	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)	771			Potential.		O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	37	c.2312G>A	CCDS879.1	.	.	.	.	.	.	.	.	.	.	G	5.404	0.259744	0.10239	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.39787	1.06;1.06;1.06	5.12	0.656	0.17844	.	0.631633	0.16096	N	0.229806	T	0.06872	0.0175	L	0.27053	0.805	0.19945	N	0.999946	B	0.12013	0.005	B	0.12156	0.007	T	0.34153	-0.9840	10	0.09843	T	0.71	-4.6803	2.1566	0.03814	0.144:0.116:0.4017:0.3383	.	771	Q15431	SYCP1_HUMAN	K	771	ENSP00000358535:R771K;ENSP00000410011:R771K;ENSP00000358531:R771K	ENSP00000358531:R771K	R	+	2	0	SYCP1	115291454	0.989000	0.36119	1.000000	0.80357	0.862000	0.49288	0.009000	0.13219	0.226000	0.20979	0.650000	0.86243	AGA		0.299	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176		43	116	0	0	0	0	43	116				
SPAG17	200162	broad.mit.edu	37	1	118567969	118567969	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:118567969C>A	ENST00000336338.5	-	27	3866	c.3801G>T	c.(3799-3801)aaG>aaT	p.K1267N		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1267						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ACTCATAGTGCTTCACCCTCT	0.458																																						uc001ehk.2		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6						c.(3799-3801)AAG>AAT		sperm associated antigen 17							99.0	97.0	98.0					1																	118567969		2203	4300	6503	SO:0001583	missense	200162					cilium|flagellar axoneme|microtubule		g.chr1:118567969C>A		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.3801G>T	1.37:g.118567969C>A	ENSP00000337804:p.Lys1267Asn		Somatic					p.K1267N	NM_206996	NP_996879	WXS	Illumina HiSeq	Unspecified	Q6Q759	SPG17_HUMAN		Lung(183;0.0858)	27	3869	-	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)	1267					Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	c.3801G>T	CCDS899.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.220396	0.79464	.	.	ENSG00000155761	ENST00000336338	T	0.19394	2.15	5.85	5.85	0.93711	.	0.289069	0.37261	N	0.002180	T	0.26955	0.0660	L	0.60455	1.87	0.30306	N	0.789024	D	0.71674	0.998	D	0.64237	0.923	T	0.05869	-1.0859	10	0.44086	T	0.13	.	12.2816	0.54767	0.0:0.9217:0.0:0.0783	.	1267	Q6Q759	SPG17_HUMAN	N	1267	ENSP00000337804:K1267N	ENSP00000337804:K1267N	K	-	3	2	SPAG17	118369492	0.999000	0.42202	1.000000	0.80357	0.927000	0.56198	0.331000	0.19733	2.773000	0.95371	0.655000	0.94253	AAG		0.458	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996		71	151	1	0	2.73e-36	3.21e-36	71	151				
NBPF7	343505	broad.mit.edu	37	1	120384093	120384093	+	IGR	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:120384093C>G								REG4 (29810 upstream) : ADAM30 (52062 downstream)																							TGGGAGTTGTCATGCTTATCC	0.577																																						uc010oxk.1		NA																	0				ovary(1)|skin(1)	2						c.(469-471)GAC>CAC		hypothetical protein LOC343505							108.0	122.0	117.0					1																	120384093		2203	4300	6503	SO:0001628	intergenic_variant	343505					cytoplasm		g.chr1:120384093C>G																													1.37:g.120384093C>G			Somatic					p.D157H	NM_001047980	NP_001041445	WXS	Illumina HiSeq	Unspecified	P0C2Y1	NBPF7_HUMAN		Lung(183;0.0103)|LUSC - Lung squamous cell carcinoma(189;0.0544)	3	1090	-	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;3.66e-05)|Lung NSC(69;0.000192)|all_epithelial(167;0.0347)	157						Missense_Mutation	SNP		37	c.469G>C																																																																																				0	0.577									5	304	0	0	0	0	5	304				
Unknown	0	broad.mit.edu	37	1	144621623	144621623	+	IGR	SNP	G	G	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:144621623G>T								RP11-640M9.2 (15732 upstream) : NBPF9 (190120 downstream)																							AACTCAACTGGCCGGCTTCCT	0.428																																						uc009wig.1		NA																	0					0						c.(955-957)GCC>TCC		hypothetical protein LOC400818																																				SO:0001628	intergenic_variant	400818					cytoplasm		g.chr1:144621623G>T																													1.37:g.144621623G>T			Somatic				NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Missense_Mutation_p.A319S|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Missense_Mutation_p.A250S|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Missense_Mutation_p.A250S|NBPF9_uc010oyg.1_Missense_Mutation_p.A284S|NBPF9_uc009wii.1_Missense_Mutation_p.A48S	p.A319S	NM_001037675	NP_001032764	WXS	Illumina HiSeq	Unspecified	Q3BBV1	NBPFK_HUMAN			9	1031	+			319						Missense_Mutation	SNP		37	c.955G>T																																																																																				0	0.428									5	397	1	0	3.6e-05	3.82e-05	5	397				
NBPF10	100132406	broad.mit.edu	37	1	145367739	145367739	+	Silent	SNP	A	A	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:145367739A>G	ENST00000342960.5	+	83	10370	c.10335A>G	c.(10333-10335)aaA>aaG	p.K3445K	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	750						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K3445K(4)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ggaaggggaaaaaaagaaggg	0.413																																						uc001end.3		NA																	4	Substitution - coding silent(4)		prostate(3)|kidney(1)		0						c.(10558-10560)AAA>AAG		hypothetical protein LOC100132406																																				SO:0001819	synonymous_variant	100132406							g.chr1:145367739A>G	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10335A>G	1.37:g.145367739A>G			Somatic				NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	p.K3520K	NM_001039703	NP_001034792	WXS	Illumina HiSeq	Unspecified	A6NDV3	A6NDV3_HUMAN		Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	85	10595	+	all_hematologic(923;0.032)		3445					Q5RHC0|Q9NWN6	Silent	SNP	ENST00000342960.5	37	c.10560A>G	CCDS53355.1																																																																																				0.413	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703		4	213	0	0	0	0	4	213				
SV2A	9900	broad.mit.edu	37	1	149879361	149879361	+	Silent	SNP	T	T	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:149879361T>C	ENST00000369146.3	-	10	2059	c.1569A>G	c.(1567-1569)tcA>tcG	p.S523S	SV2A_ENST00000369145.1_Silent_p.S523S	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	523					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	CAAAGGACACTGACTTGAGCC	0.488																																						uc001etg.2		NA																	0				ovary(6)|pancreas(1)	7						c.(1567-1569)TCA>TCG		synaptic vesicle glycoprotein 2	Levetiracetam(DB01202)						108.0	90.0	96.0					1																	149879361		2203	4300	6503	SO:0001819	synonymous_variant	9900				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr1:149879361T>C	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1569A>G	1.37:g.149879361T>C			Somatic				SV2A_uc009wlk.2_5'Flank|SV2A_uc001eth.2_Silent_p.S523S	p.S523S	NM_014849	NP_055664	WXS	Illumina HiSeq	Unspecified	Q7L0J3	SV2A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		10	2060	-	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		523			Extracellular (Potential).		D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	ENST00000369146.3	37	c.1569A>G	CCDS940.1																																																																																				0.488	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1			29	113	0	0	0	0	29	113				
ECM1	1893	broad.mit.edu	37	1	150484939	150484939	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:150484939C>T	ENST00000369047.4	+	8	1320	c.1195C>T	c.(1195-1197)Cgg>Tgg	p.R399W	ECM1_ENST00000470432.1_3'UTR|ECM1_ENST00000369049.4_Missense_Mutation_p.R426W|ECM1_ENST00000346569.6_Missense_Mutation_p.R274W	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1	399	2 X approximate repeats.				angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CTTTGCCCGTCGGGCTCCTTA	0.567																																					Melanoma(156;1696 2560 11093 19685)	uc001eus.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1195-1197)CGG>TGG		extracellular matrix protein 1 isoform 1							113.0	100.0	104.0					1																	150484939		2203	4300	6503	SO:0001583	missense	1893				angiogenesis|biomineral tissue development|negative regulation of bone mineralization|negative regulation of peptidase activity|ossification|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of I-kappaB kinase/NF-kappaB cascade	proteinaceous extracellular matrix	laminin binding|protease binding|protein C-terminus binding|signal transducer activity	g.chr1:150484939C>T	U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.1195C>T	1.37:g.150484939C>T	ENSP00000358043:p.Arg399Trp		Somatic				ECM1_uc001eut.2_Missense_Mutation_p.R274W|ECM1_uc001euu.2_Missense_Mutation_p.R428W|ECM1_uc001euv.2_Missense_Mutation_p.R426W|ECM1_uc009wlu.2_Missense_Mutation_p.R159W	p.R399W	NM_004425	NP_004416	WXS	Illumina HiSeq	Unspecified	Q16610	ECM1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		8	1394	+	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		399			2 X approximate repeats.|2.		A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	Missense_Mutation	SNP	ENST00000369047.4	37	c.1195C>T	CCDS953.1	.	.	.	.	.	.	.	.	.	.	C	4.301	0.055202	0.08291	.	.	ENSG00000143369	ENST00000369049;ENST00000369047;ENST00000346569	D;D;D	0.85861	-2.04;-2.04;-2.04	4.17	1.15	0.20763	.	1.724110	0.03262	N	0.183391	T	0.64994	0.2649	L	0.47716	1.5	0.09310	N	1	B;B;B;B	0.28324	0.084;0.059;0.207;0.169	B;B;B;B	0.24269	0.016;0.052;0.046;0.04	T	0.55717	-0.8097	10	0.66056	D	0.02	0.2134	3.9209	0.09244	0.1844:0.6112:0.0:0.2044	.	426;399;274;399	Q16610-4;C8CHS3;Q16610-2;Q16610	.;.;.;ECM1_HUMAN	W	426;399;274	ENSP00000358045:R426W;ENSP00000358043:R399W;ENSP00000271630:R274W	ENSP00000271630:R274W	R	+	1	2	ECM1	148751563	0.000000	0.05858	0.001000	0.08648	0.224000	0.24922	0.715000	0.25822	0.122000	0.18314	0.462000	0.41574	CGG		0.567	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035832.2	NM_004425		59	173	0	0	0	0	59	173				
CERS2	29956	broad.mit.edu	37	1	150940906	150940906	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:150940906G>A	ENST00000271688.6	-	3	642	c.256C>T	c.(256-258)Cat>Tat	p.H86Y	RP11-316M1.12_ENST00000561111.1_RNA|RP11-316M1.12_ENST00000560481.1_RNA|CERS2_ENST00000345896.4_5'UTR|CERS2_ENST00000368954.5_Missense_Mutation_p.H86Y|CERS2_ENST00000561294.1_Missense_Mutation_p.H86Y	NM_181746.3	NP_859530.1	Q96G23	CERS2_HUMAN	ceramide synthase 2	86					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										AGGTAGAAATGTTCCAAGGTG	0.572																																						uc001evy.2		NA																	0					0						c.(256-258)CAT>TAT		LAG1 longevity assurance 2							81.0	74.0	76.0					1																	150940906		2203	4300	6503	SO:0001583	missense	29956					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity	g.chr1:150940906G>A	AF189062	CCDS973.1	1q21.3	2012-09-20	2011-07-08	2011-07-08	ENSG00000143418	ENSG00000143418		"""Homeoboxes / CERS class"""	14076	protein-coding gene	gene with protein product		606920	"""longevity assurance (LAG1, S. cerevisiae) homolog 2"", ""LAG1 longevity assurance homolog 2 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 2"""	LASS2		11543633	Standard	NM_181746		Approved	SP260, FLJ10243	uc001evz.3	Q96G23	OTTHUMG00000035064	ENST00000271688.6:c.256C>T	1.37:g.150940906G>A	ENSP00000271688:p.His86Tyr		Somatic				LASS2_uc001evz.2_Missense_Mutation_p.H86Y|LASS2_uc009wmh.2_5'UTR	p.H86Y	NM_181746	NP_859530	WXS	Illumina HiSeq	Unspecified	Q96G23	CERS2_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)		3	643	-	all_lung(15;8.07e-35)|Lung NSC(24;7.93e-31)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		86			Cytoplasmic (Potential).|Homeobox.		D3DV06|Q5SZE5|Q9HD96|Q9NW79	Missense_Mutation	SNP	ENST00000271688.6	37	c.256C>T	CCDS973.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.074921	0.36566	.	.	ENSG00000143418	ENST00000368954;ENST00000271688;ENST00000368949;ENST00000361419;ENST00000421609;ENST00000457392	D;D;D;D;D;D	0.96104	-3.91;-3.91;-3.91;-3.91;-3.91;-3.91	5.08	4.11	0.48088	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.411149	0.26804	N	0.022417	D	0.83257	0.5215	N	0.08118	0	0.37489	D	0.916308	B	0.06786	0.001	B	0.04013	0.001	T	0.81037	-0.1114	10	0.56958	D	0.05	-18.1225	10.7372	0.46133	0.0:0.0:0.6443:0.3557	.	86	Q96G23	CERS2_HUMAN	Y	86;86;106;86;86;86	ENSP00000357950:H86Y;ENSP00000271688:H86Y;ENSP00000357945:H106Y;ENSP00000355020:H86Y;ENSP00000393239:H86Y;ENSP00000394012:H86Y	ENSP00000271688:H86Y	H	-	1	0	CERS2	149207530	0.981000	0.34729	0.991000	0.47740	0.744000	0.42396	2.234000	0.43035	2.646000	0.89796	0.655000	0.94253	CAT		0.572	CERS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084897.2	NM_022075		42	89	0	0	0	0	42	89				
OR10K1	391109	broad.mit.edu	37	1	158436255	158436255	+	Missense_Mutation	SNP	C	C	G	rs573938963		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:158436255C>G	ENST00000289451.2	+	1	984	c.904C>G	c.(904-906)Cga>Gga	p.R302G		NM_001004473.1	NP_001004473.1	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K, member 1	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	27	all_hematologic(112;0.0378)					ATCAGCCCTACGAAGAACAAT	0.373																																						uc010pij.1		NA																	0				ovary(1)	1						c.(904-906)CGA>GGA		olfactory receptor, family 10, subfamily K,							100.0	97.0	98.0					1																	158436255		2203	4300	6503	SO:0001583	missense	391109				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158436255C>G	AP002532	CCDS30897.1	1q23.1	2012-08-09			ENSG00000173285	ENSG00000173285		"""GPCR / Class A : Olfactory receptors"""	14693	protein-coding gene	gene with protein product							Standard	NM_001004473		Approved		uc010pij.2	Q8NGX5	OTTHUMG00000017517	ENST00000289451.2:c.904C>G	1.37:g.158436255C>G	ENSP00000289451:p.Arg302Gly		Somatic					p.R302G	NM_001004473	NP_001004473	WXS	Illumina HiSeq	Unspecified	Q8NGX5	O10K1_HUMAN			1	904	+	all_hematologic(112;0.0378)		302			Cytoplasmic (Potential).		Q6IFS2	Missense_Mutation	SNP	ENST00000289451.2	37	c.904C>G	CCDS30897.1	.	.	.	.	.	.	.	.	.	.	c	7.949	0.744411	0.15710	.	.	ENSG00000173285	ENST00000289451	T	0.40225	1.04	4.24	0.958	0.19619	.	1.305430	0.05653	N	0.585547	T	0.10895	0.0266	N	0.25825	0.765	0.09310	N	1	B	0.29612	0.251	B	0.20184	0.028	T	0.27365	-1.0076	10	0.52906	T	0.07	.	4.1367	0.10174	0.3174:0.4795:0.0:0.2031	.	302	Q8NGX5	O10K1_HUMAN	G	302	ENSP00000289451:R302G	ENSP00000289451:R302G	R	+	1	2	OR10K1	156702879	0.000000	0.05858	0.010000	0.14722	0.060000	0.15804	-0.843000	0.04350	0.385000	0.24970	-0.259000	0.10710	CGA		0.373	OR10K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046367.1			46	135	0	0	0	0	46	135				
CFH	3075	broad.mit.edu	37	1	196712640	196712640	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:196712640G>A	ENST00000367429.4	+	20	3432	c.3192G>A	c.(3190-3192)atG>atA	p.M1064I		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	1064	Sushi 18. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						CGAGACAGATGAGTAAATATC	0.403																																						uc001gtj.3		NA																	0				skin(4)|ovary(1)|breast(1)	6						c.(3190-3192)ATG>ATA		complement factor H isoform a precursor							220.0	207.0	212.0					1																	196712640		2203	4300	6503	SO:0001583	missense	3075				complement activation, alternative pathway	extracellular space		g.chr1:196712640G>A	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.3192G>A	1.37:g.196712640G>A	ENSP00000356399:p.Met1064Ile		Somatic					p.M1064I	NM_000186	NP_000177	WXS	Illumina HiSeq	Unspecified	P08603	CFAH_HUMAN			20	3432	+			1064			Sushi 18.		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	37	c.3192G>A	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	.	7.104	0.574659	0.13623	.	.	ENSG00000000971	ENST00000367429	T	0.73047	-0.71	5.13	4.21	0.49690	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.56381	0.1981	L	0.31578	0.945	0.32569	N	0.53002	B	0.19583	0.037	B	0.19666	0.026	T	0.57545	-0.7793	9	0.17832	T	0.49	.	10.7272	0.46074	0.0903:0.0:0.9097:0.0	.	1064	P08603	CFAH_HUMAN	I	1064	ENSP00000356399:M1064I	ENSP00000356399:M1064I	M	+	3	0	CFH	194979263	0.101000	0.21875	0.001000	0.08648	0.010000	0.07245	3.391000	0.52530	1.285000	0.44548	0.455000	0.32223	ATG		0.403	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186		68	189	0	0	0	0	68	189				
ASPM	259266	broad.mit.edu	37	1	197112028	197112028	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:197112028C>G	ENST00000367409.4	-	3	1610	c.1354G>C	c.(1354-1356)Gaa>Caa	p.E452Q	ASPM_ENST00000294732.7_Missense_Mutation_p.E452Q	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	452					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ACTAGTTCTTCAAAAATAGCT	0.338																																						uc001gtu.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(1354-1356)GAA>CAA		asp (abnormal spindle)-like, microcephaly							64.0	69.0	67.0					1																	197112028		2188	4286	6474	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197112028C>G	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.1354G>C	1.37:g.197112028C>G	ENSP00000356379:p.Glu452Gln		Somatic				ASPM_uc001gtv.2_Missense_Mutation_p.E452Q|ASPM_uc001gtw.3_Intron	p.E452Q	NM_018136	NP_060606	WXS	Illumina HiSeq	Unspecified	Q8IZT6	ASPM_HUMAN			3	1611	-			452					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.1354G>C	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	6.117	0.389769	0.11581	.	.	ENSG00000066279	ENST00000367409;ENST00000294732	T;T	0.59083	0.29;1.53	5.54	2.6	0.31112	.	0.395025	0.25890	N	0.027622	T	0.46229	0.1382	L	0.58428	1.81	0.09310	N	1	B;P	0.35363	0.123;0.497	B;B	0.28553	0.03;0.091	T	0.39187	-0.9626	10	0.45353	T	0.12	.	7.9552	0.30038	0.0:0.7057:0.1371:0.1572	.	452;452	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	Q	452	ENSP00000356379:E452Q;ENSP00000294732:E452Q	ENSP00000294732:E452Q	E	-	1	0	ASPM	195378651	0.049000	0.20398	0.039000	0.18376	0.047000	0.14425	0.072000	0.14617	0.811000	0.34303	0.643000	0.83706	GAA		0.338	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		6	289	0	0	0	0	6	289				
PTPRC	5788	broad.mit.edu	37	1	198721488	198721488	+	Silent	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr1:198721488G>A	ENST00000367376.2	+	30	3483	c.3312G>A	c.(3310-3312)ctG>ctA	p.L1104L	PTPRC_ENST00000594404.1_Silent_p.L943L|PTPRC_ENST00000348564.6_Silent_p.L945L|PTPRC_ENST00000352140.3_Silent_p.L1056L|PTPRC_ENST00000442510.2_Silent_p.L1106L	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	1104	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						TCTTTGAACTGAGACATTCCA	0.378																																						uc001gur.1		NA																	0				breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						c.(3310-3312)CTG>CTA		protein tyrosine phosphatase, receptor type, C							98.0	93.0	95.0					1																	198721488		2203	4300	6503	SO:0001819	synonymous_variant	5788				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr1:198721488G>A	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.3312G>A	1.37:g.198721488G>A			Somatic				PTPRC_uc001gus.1_Silent_p.L1056L|PTPRC_uc001gut.1_Silent_p.L943L	p.L1104L	NM_002838	NP_002829	WXS	Illumina HiSeq	Unspecified	P08575	PTPRC_HUMAN			30	3492	+			1104			Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).		A8K7W6|Q16614|Q9H0Y6	Silent	SNP	ENST00000367376.2	37	c.3312G>A																																																																																					0.378	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				19	148	0	0	0	0	19	148				
AGAP4	119016	broad.mit.edu	37	10	46322371	46322371	+	Silent	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr10:46322371G>A	ENST00000448048.2	-	7	1109	c.984C>T	c.(982-984)gcC>gcT	p.A328A	AGAP4_ENST00000430779.2_5'Flank	NM_133446.2	NP_597703.2	Q96P64	AGAP4_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 4	328	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			central_nervous_system(1)|lung(1)|ovary(1)	3						TGGGTGTGCAGGCCGATGTGG	0.488																																						uc001jcx.3		NA																	0				ovary(1)	1						c.(982-984)GCC>GCT		ArfGAP with GTPase domain, ankyrin repeat and PH							65.0	82.0	77.0					10																	46322371		1511	3341	4852	SO:0001819	synonymous_variant	119016				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding	g.chr10:46322371G>A	AF411132	CCDS7215.1	10q11.21	2014-06-19	2008-09-22	2008-09-22	ENSG00000188234	ENSG00000188234		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23459	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 1"", ""ArfGAP with GTPase domain, ankyrin repeat and PH domain 8"", ""centaurin, gamma-like family, member 5"""	CTGLF1, AGAP8, CTGLF5		12477932	Standard	XM_005271797		Approved	Em:AC012044.1, MRIP2	uc001jcx.4	Q96P64	OTTHUMG00000018088	ENST00000448048.2:c.984C>T	10.37:g.46322371G>A			Somatic				AGAP4_uc010qfl.1_Silent_p.A351A|AGAP4_uc001jcy.3_Silent_p.A243A	p.A328A	NM_133446	NP_597703	WXS	Illumina HiSeq	Unspecified	Q96P64	AGAP4_HUMAN			7	1110	-			328			PH.			Silent	SNP	ENST00000448048.2	37	c.984C>T	CCDS7215.1																																																																																				0.488	AGAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047799.1	NM_133446		72	216	0	0	0	0	72	216				
ARID5B	84159	broad.mit.edu	37	10	63851964	63851964	+	Silent	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr10:63851964G>A	ENST00000279873.7	+	10	3152	c.2742G>A	c.(2740-2742)ccG>ccA	p.P914P	ARID5B_ENST00000309334.5_Silent_p.P671P	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	914					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					CCAAGAACCCGCACAAACCTA	0.572																																						uc001jlt.1		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4						c.(2740-2742)CCG>CCA		AT rich interactive domain 5B (MRF1-like)							78.0	80.0	79.0					10																	63851964		2203	4300	6503	SO:0001819	synonymous_variant	84159				liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding	g.chr10:63851964G>A	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.2742G>A	10.37:g.63851964G>A			Somatic					p.P914P	NM_032199	NP_115575	WXS	Illumina HiSeq	Unspecified	Q14865	ARI5B_HUMAN			10	2768	+	Prostate(12;0.016)|all_hematologic(501;0.215)		914					B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Silent	SNP	ENST00000279873.7	37	c.2742G>A	CCDS31208.1																																																																																				0.572	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482		5	255	0	0	0	0	5	255				
PALD1	27143	broad.mit.edu	37	10	72324152	72324152	+	Silent	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr10:72324152G>A	ENST00000263563.6	+	19	2563	c.2295G>A	c.(2293-2295)cgG>cgA	p.R765R		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	765						cytosol (GO:0005829)											AAGAAATGCGGAGGCTGCAGC	0.617																																						uc001jrd.3		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2293-2295)CGG>CGA		KIAA1274							88.0	86.0	87.0					10																	72324152		2203	4300	6503	SO:0001819	synonymous_variant	27143							g.chr10:72324152G>A	AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.2295G>A	10.37:g.72324152G>A			Somatic				KIAA1274_uc001jre.3_Silent_p.R56R	p.R765R	NM_014431	NP_055246	WXS	Illumina HiSeq	Unspecified	Q9ULE6	PALD_HUMAN			19	2576	+			765					B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Silent	SNP	ENST00000263563.6	37	c.2295G>A	CCDS31215.1	.	.	.	.	.	.	.	.	.	.	g	9.060	0.994139	0.19043	.	.	ENSG00000107719	ENST00000426268	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	T	0.62925	0.2468	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61734	-0.7002	4	.	.	.	-6.1481	11.2395	0.48962	0.0857:0.0:0.9143:0.0	.	.	.	.	K	146	.	.	E	+	1	0	KIAA1274	71994158	0.897000	0.30589	0.848000	0.33437	0.779000	0.44077	4.614000	0.61183	2.260000	0.74910	0.555000	0.69702	GAG		0.617	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048515.2	NM_014431		31	131	0	0	0	0	31	131				
UNC5B	219699	broad.mit.edu	37	10	73050857	73050857	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr10:73050857G>A	ENST00000335350.6	+	9	1701	c.1285G>A	c.(1285-1287)Gca>Aca	p.A429T	UNC5B_ENST00000373192.4_Missense_Mutation_p.A418T	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	429					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)		p.A429T(2)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						CTTTAAGACGGCAAGGCCCAG	0.597																																						uc001jro.2		NA																	2	Substitution - Missense(2)		prostate(2)	ovary(2)|lung(1)	3						c.(1285-1287)GCA>ACA		unc-5 homolog B precursor							165.0	158.0	160.0					10																	73050857		2203	4300	6503	SO:0001583	missense	219699				apoptosis|axon guidance|regulation of apoptosis	integral to membrane		g.chr10:73050857G>A	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.1285G>A	10.37:g.73050857G>A	ENSP00000334329:p.Ala429Thr		Somatic				UNC5B_uc001jrp.2_Missense_Mutation_p.A418T	p.A429T	NM_170744	NP_734465	WXS	Illumina HiSeq	Unspecified	Q8IZJ1	UNC5B_HUMAN			9	1730	+			429			Cytoplasmic (Potential).		Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	c.1285G>A	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	G	4.088	0.014355	0.07959	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.51574	0.78;0.7	5.39	2.49	0.30216	.	0.365957	0.31495	N	0.007559	T	0.37758	0.1015	L	0.53249	1.67	0.09310	N	1	B;B	0.10296	0.003;0.002	B;B	0.10450	0.005;0.002	T	0.25152	-1.0140	10	0.31617	T	0.26	-3.4221	6.4845	0.22081	0.1408:0.0:0.4509:0.4083	.	418;429	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	T	429;418	ENSP00000334329:A429T;ENSP00000362288:A418T	ENSP00000334329:A429T	A	+	1	0	UNC5B	72720863	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	1.081000	0.30791	0.253000	0.21552	-0.136000	0.14681	GCA		0.597	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744		6	451	0	0	0	0	6	451				
SCD	6319	broad.mit.edu	37	10	102114253	102114253	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr10:102114253C>A	ENST00000370355.2	+	4	892	c.511C>A	c.(511-513)Cat>Aat	p.H171N		NM_005063.4	NP_005054.3	O00767	ACOD_HUMAN	stearoyl-CoA desaturase (delta-9-desaturase)	171					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			endometrium(1)|large_intestine(3)|lung(5)	9		Colorectal(252;0.0323)		Epithelial(162;1.97e-10)|all cancers(201;1.73e-08)		TGCTGATCCTCATAATTCCCG	0.502																																					Colon(67;260 1459 9574 11663)	uc001kqy.2		NA																	0					0						c.(511-513)CAT>AAT		stearoyl-CoA desaturase 1							117.0	111.0	113.0					10																	102114253		2203	4300	6503	SO:0001583	missense	6319				fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity	g.chr10:102114253C>A	AF097514	CCDS7493.1	10q23-q24	2013-01-25			ENSG00000099194	ENSG00000099194	1.14.19.1	"""Fatty acid desaturases"""	10571	protein-coding gene	gene with protein product	"""acyl-CoA desaturase"", ""fatty acid desaturase"", ""delta-9-desaturase"""	604031	"""stearoyl-CoA desaturase opposite strand"""	SCDOS		7909540, 10229681	Standard	NM_005063		Approved	FADS5	uc001kqy.3	O00767	OTTHUMG00000018906	ENST00000370355.2:c.511C>A	10.37:g.102114253C>A	ENSP00000359380:p.His171Asn		Somatic					p.H171N	NM_005063	NP_005054	WXS	Illumina HiSeq	Unspecified	O00767	ACOD_HUMAN		Epithelial(162;1.97e-10)|all cancers(201;1.73e-08)	4	1001	+		Colorectal(252;0.0323)	171			Cytoplasmic (Potential).		B2R5U0|D3DR68|Q16150|Q53GR9|Q5W037|Q5W038|Q6GSS4|Q96KF6|Q9BS07|Q9Y695	Missense_Mutation	SNP	ENST00000370355.2	37	c.511C>A	CCDS7493.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419328	0.83559	.	.	ENSG00000099194	ENST00000423840;ENST00000370355	T	0.16897	2.31	5.39	5.39	0.77823	Fatty acid desaturase, type 1 (1);	0.000000	0.64402	D	0.000002	T	0.65964	0.2742	H	0.99642	4.675	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83291	-0.0033	10	0.87932	D	0	-35.0051	19.1601	0.93527	0.0:1.0:0.0:0.0	.	171	O00767	ACOD_HUMAN	N	171	ENSP00000359380:H171N	ENSP00000359380:H171N	H	+	1	0	SCD	102104243	1.000000	0.71417	0.998000	0.56505	0.493000	0.33554	7.818000	0.86416	2.533000	0.85409	0.563000	0.77884	CAT		0.502	SCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049857.2	NM_005063		69	163	1	0	3.31e-33	3.87e-33	69	163				
FBXW4	6468	broad.mit.edu	37	10	103432746	103432746	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr10:103432746G>A	ENST00000331272.7	-	4	1219	c.601C>T	c.(601-603)Cat>Tat	p.H201Y		NM_022039.3	NP_071322.1	P57775	FBXW4_HUMAN	F-box and WD repeat domain containing 4	201					cartilage development (GO:0051216)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|positive regulation of mesenchymal cell proliferation (GO:0002053)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	ubiquitin ligase complex (GO:0000151)				breast(3)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	15		Colorectal(252;0.123)		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)		TCCTGTTCATGAGCCGAGTAC	0.507																																						uc001kto.2		NA																	0				skin(1)	1						c.(601-603)CAT>TAT		F-box and WD repeat domain containing 4							188.0	144.0	159.0					10																	103432746		2203	4300	6503	SO:0001583	missense	6468				ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	ubiquitin ligase complex		g.chr10:103432746G>A	AF281859	CCDS31271.1	10q24	2013-01-09	2007-02-08	2005-03-12	ENSG00000107829	ENSG00000107829		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	10847	protein-coding gene	gene with protein product		608071	"""split hand/foot malformation (ectrodactyly) type 3"", ""F-box and WD-40 domain protein 4"""	SHFM3		8723077, 7912888	Standard	XM_005270053		Approved	Fbw4, dactylin	uc001kto.3	P57775	OTTHUMG00000018938	ENST00000331272.7:c.601C>T	10.37:g.103432746G>A	ENSP00000359149:p.His201Tyr		Somatic					p.H201Y	NM_022039	NP_071322	WXS	Illumina HiSeq	Unspecified	P57775	FBXW4_HUMAN		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)	4	947	-		Colorectal(252;0.123)	201			WD 2.		Q5SVS1|Q96IM6	Missense_Mutation	SNP	ENST00000331272.7	37	c.601C>T	CCDS31271.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185445	0.78677	.	.	ENSG00000107829	ENST00000331272;ENST00000389046;ENST00000457105;ENST00000431477	T	0.81415	-1.49	5.85	5.85	0.93711	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.93835	0.8028	H	0.96861	3.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95163	0.8283	10	0.87932	D	0	-9.0019	20.1624	0.98139	0.0:0.0:1.0:0.0	.	201	P57775	FBXW4_HUMAN	Y	201;201;114;157	ENSP00000359149:H201Y	ENSP00000359149:H201Y	H	-	1	0	FBXW4	103422736	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.992000	0.88273	2.764000	0.94973	0.591000	0.81541	CAT		0.507	FBXW4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049979.2	NM_022039		42	74	0	0	0	0	42	74				
ATRNL1	26033	broad.mit.edu	37	10	117704253	117704253	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr10:117704253G>T	ENST00000355044.3	+	29	4229	c.4103G>T	c.(4102-4104)cGa>cTa	p.R1368L	ATRNL1_ENST00000423111.2_Missense_Mutation_p.R419L|ATRNL1_ENST00000303745.7_Missense_Mutation_p.R161L	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1368					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		GTCCGGAATCGAAAACACCTT	0.418																																						uc001lcg.2		NA																	0				ovary(5)|lung(1)|central_nervous_system(1)	7						c.(4102-4104)CGA>CTA		attractin-like 1 precursor							94.0	98.0	97.0					10																	117704253		2203	4300	6503	SO:0001583	missense	26033					integral to membrane	sugar binding	g.chr10:117704253G>T	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.4103G>T	10.37:g.117704253G>T	ENSP00000347152:p.Arg1368Leu		Somatic				ATRNL1_uc010qsm.1_Missense_Mutation_p.R497L|ATRNL1_uc010qsn.1_RNA	p.R1368L	NM_207303	NP_997186	WXS	Illumina HiSeq	Unspecified	Q5VV63	ATRN1_HUMAN		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)	29	4489	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	1368			Cytoplasmic (Potential).		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	c.4103G>T	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.212510	0.79240	.	.	ENSG00000107518	ENST00000355044;ENST00000423111;ENST00000303745	T;T	0.27720	2.23;1.65	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.56031	0.1958	M	0.62723	1.935	0.46678	D	0.999155	D;D	0.76494	0.999;0.987	D;D	0.77004	0.989;0.953	T	0.50659	-0.8802	10	0.52906	T	0.07	-10.4655	20.3754	0.98918	0.0:0.0:1.0:0.0	.	419;1368	B4DH41;Q5VV63	.;ATRN1_HUMAN	L	1368;419;161	ENSP00000347152:R1368L;ENSP00000409624:R419L	ENSP00000307660:R161L	R	+	2	0	ATRNL1	117694243	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.535000	0.82014	2.894000	0.99253	0.591000	0.81541	CGA		0.418	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349		69	142	1	0	1.78e-30	2.06e-30	69	142				
SYT8	90019	broad.mit.edu	37	11	1858221	1858221	+	Silent	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr11:1858221G>A	ENST00000381968.3	+	8	995	c.867G>A	c.(865-867)caG>caA	p.Q289Q	SYT8_ENST00000341958.3_Silent_p.Q275Q|TNNI2_ENST00000252898.7_5'Flank|TNNI2_ENST00000381906.1_5'Flank|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381911.1_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	289	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGCTGAACCAGAGGAAGTGGA	0.627																																						uc001lue.1		NA																	0				ovary(1)	1						c.(865-867)CAG>CAA		synaptotagmin VIII							87.0	100.0	95.0					11																	1858221		2202	4299	6501	SO:0001819	synonymous_variant	90019					acrosomal vesicle|integral to membrane|plasma membrane|synaptic vesicle	transporter activity	g.chr11:1858221G>A	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.867G>A	11.37:g.1858221G>A			Somatic				SYT8_uc001lud.2_Silent_p.Q289Q|SYT8_uc001luf.1_Silent_p.Q275Q|TNNI2_uc010qxc.1_5'Flank|TNNI2_uc010qxd.1_5'Flank	p.Q289Q	NM_138567	NP_612634	WXS	Illumina HiSeq	Unspecified	Q8NBV8	SYT8_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)	8	995	+		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	289			C2 2.|Cytoplasmic (Potential).		A6NFJ4|Q9NSV9	Silent	SNP	ENST00000381968.3	37	c.867G>A	CCDS7726.2	.	.	.	.	.	.	.	.	.	.	g	7.039	0.562096	0.13498	.	.	ENSG00000149043	ENST00000381978	.	.	.	3.23	3.23	0.37069	.	.	.	.	.	T	0.55433	0.1920	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52283	-0.8596	4	.	.	.	.	6.6718	0.23072	0.223:0.0:0.777:0.0	.	.	.	.	K	288	.	.	E	+	1	0	SYT8	1814797	0.622000	0.27085	1.000000	0.80357	0.763000	0.43281	0.575000	0.23729	1.823000	0.53134	0.491000	0.48974	GAG		0.627	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4			8	89	0	0	0	0	8	89				
TSPAN32	10077	broad.mit.edu	37	11	2335794	2335794	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr11:2335794C>T	ENST00000182290.4	+	6	673	c.536C>T	c.(535-537)gCg>gTg	p.A179V	TSPAN32_ENST00000381121.3_Missense_Mutation_p.A179V|TSPAN32_ENST00000483227.1_3'UTR|TSPAN32_ENST00000451520.2_Missense_Mutation_p.A168V	NM_139022.2	NP_620591.3	Q96QS1	TSN32_HUMAN	tetraspanin 32	179					cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|defense response to protozoan (GO:0042832)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid dendritic cell activation (GO:0030886)|platelet aggregation (GO:0070527)|regulation of defense response to virus (GO:0050688)	cell surface (GO:0009986)|integrin alphaIIb-beta3 complex (GO:0070442)|intracellular (GO:0005622)				breast(1)|central_nervous_system(1)|lung(4)|ovary(1)|skin(1)	8		all_epithelial(84;4.89e-05)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.00791)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000533)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		GAGGAGGCGGCGAGAGAGGTG	0.652																																						uc001lvy.1		NA																	0				central_nervous_system(1)	1						c.(535-537)GCG>GTG		tumor-suppressing subtransferable candidate 6							56.0	44.0	48.0					11																	2335794		2199	4298	6497	SO:0001583	missense	10077				cell-cell signaling	integral to membrane		g.chr11:2335794C>T	AF176070	CCDS7733.1	11p15	2013-02-14	2005-08-16	2005-08-16	ENSG00000064201	ENSG00000064201		"""Tetraspanins"""	13410	protein-coding gene	gene with protein product		603853	"""pan-hematopoietic expression"""	TSSC6, PHEMX		10072438, 10950922	Standard	NM_139022		Approved		uc001lvy.1	Q96QS1	OTTHUMG00000009762	ENST00000182290.4:c.536C>T	11.37:g.2335794C>T	ENSP00000182290:p.Ala179Val		Somatic				TSPAN32_uc001lvx.1_3'UTR|TSPAN32_uc009ydk.1_Missense_Mutation_p.A189V|TSPAN32_uc010qxk.1_Missense_Mutation_p.A214V|TSPAN32_uc009ydl.1_RNA|TSPAN32_uc001lvz.1_Missense_Mutation_p.A149V|TSPAN32_uc001lwb.1_Missense_Mutation_p.A149V|TSPAN32_uc001lwc.1_Missense_Mutation_p.A124V|TSPAN32_uc001lwd.1_5'Flank	p.A179V	NM_139022	NP_620591	WXS	Illumina HiSeq	Unspecified	Q96QS1	TSN32_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000533)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)	6	673	+		all_epithelial(84;4.89e-05)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.00791)|Lung NSC(207;0.209)	179					Q96KX4|Q9HC50|Q9HC51|Q9Y5U1	Missense_Mutation	SNP	ENST00000182290.4	37	c.536C>T	CCDS7733.1	.	.	.	.	.	.	.	.	.	.	C	17.28	3.350494	0.61183	.	.	ENSG00000064201	ENST00000182290;ENST00000381121;ENST00000451520;ENST00000444307;ENST00000381117	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	3.57	-1.72	0.08107	Tetraspanin, EC2 domain (1);CD81 extracellular domain (1);	2.105500	0.03406	N	0.204090	T	0.76716	0.4026	L	0.53249	1.67	0.09310	N	1	D;D;P;D;P	0.63046	0.992;0.988;0.91;0.963;0.927	P;P;B;B;B	0.48270	0.557;0.572;0.149;0.204;0.233	T	0.63363	-0.6654	10	0.33141	T	0.24	-0.3412	1.8138	0.03096	0.3321:0.3849:0.1642:0.1188	.	166;179;124;179;179	B4DQ90;Q96QS1-5;G3XAG6;Q96QS1-3;Q96QS1	.;.;.;.;TSN32_HUMAN	V	179;179;168;115;124	ENSP00000182290:A179V;ENSP00000370513:A179V;ENSP00000405205:A168V;ENSP00000370509:A124V	ENSP00000182290:A179V	A	+	2	0	TSPAN32	2292370	0.000000	0.05858	0.002000	0.10522	0.275000	0.26752	-0.515000	0.06290	-0.153000	0.11137	0.491000	0.48974	GCG		0.652	TSPAN32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026912.2	NM_139024		9	7	0	0	0	0	9	7				
KCNA4	3739	broad.mit.edu	37	11	30032952	30032952	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr11:30032952T>A	ENST00000328224.6	-	2	2507	c.1274A>T	c.(1273-1275)cAg>cTg	p.Q425L	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	425					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	CCCCTGTTGCTGGGCCAGGTC	0.507																																						uc001msk.2		NA																	0				ovary(2)|central_nervous_system(1)|pancreas(1)	4						c.(1273-1275)CAG>CTG		potassium voltage-gated channel, shaker-related							69.0	66.0	67.0					11																	30032952		2077	4238	6315	SO:0001583	missense	3739					voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity	g.chr11:30032952T>A	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.1274A>T	11.37:g.30032952T>A	ENSP00000328511:p.Gln425Leu		Somatic					p.Q425L	NM_002233	NP_002224	WXS	Illumina HiSeq	Unspecified	P22459	KCNA4_HUMAN			2	2426	-			425						Missense_Mutation	SNP	ENST00000328224.6	37	c.1274A>T	CCDS41629.1	.	.	.	.	.	.	.	.	.	.	T	18.03	3.533467	0.64972	.	.	ENSG00000182255	ENST00000328224	D	0.98493	-4.96	5.42	5.42	0.78866	Ion transport (1);	0.066308	0.64402	D	0.000006	D	0.96537	0.8870	N	0.25957	0.775	0.80722	D	1	P	0.48834	0.916	P	0.47915	0.561	D	0.97314	0.9939	10	0.72032	D	0.01	.	15.4798	0.75517	0.0:0.0:0.0:1.0	.	425	P22459	KCNA4_HUMAN	L	425	ENSP00000328511:Q425L	ENSP00000328511:Q425L	Q	-	2	0	KCNA4	29989528	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.040000	0.89188	2.062000	0.61559	0.528000	0.53228	CAG		0.507	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233		57	44	0	0	0	0	57	44				
OR4C16	219428	broad.mit.edu	37	11	55340373	55340373	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr11:55340373C>A	ENST00000314634.3	+	1	770	c.770C>A	c.(769-771)aCa>aAa	p.T257K		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	257						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				TTTATGTACACATGCCTTGCA	0.398																																						uc010rih.1		NA																	0				ovary(1)|skin(1)	2						c.(769-771)ACA>AAA		olfactory receptor, family 4, subfamily C,							166.0	141.0	149.0					11																	55340373		2201	4296	6497	SO:0001583	missense	219428				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55340373C>A	AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.770C>A	11.37:g.55340373C>A	ENSP00000324913:p.Thr257Lys		Somatic					p.T257K	NM_001004701	NP_001004701	WXS	Illumina HiSeq	Unspecified	Q8NGL9	OR4CG_HUMAN			1	770	+		all_epithelial(135;0.0748)	257			Extracellular (Potential).		Q6IEV8	Missense_Mutation	SNP	ENST00000314634.3	37	c.770C>A	CCDS31502.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673590	0.47781	.	.	ENSG00000181935	ENST00000314634	T	0.37584	1.19	4.68	2.77	0.32553	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000005	T	0.51160	0.1658	M	0.75615	2.305	0.09310	N	1	D	0.56521	0.976	D	0.67548	0.952	T	0.36383	-0.9750	10	0.72032	D	0.01	.	4.4934	0.11824	0.176:0.634:0.0:0.19	.	257	Q8NGL9	OR4CG_HUMAN	K	257	ENSP00000324913:T257K	ENSP00000324913:T257K	T	+	2	0	OR4C16	55096949	0.000000	0.05858	0.936000	0.37596	0.742000	0.42306	0.083000	0.14871	1.206000	0.43276	0.549000	0.68633	ACA		0.398	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382627.1	NM_001004701		53	109	1	0	3.77e-23	4.29e-23	53	109				
OR5M10	390167	broad.mit.edu	37	11	56344940	56344940	+	Silent	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr11:56344940G>A	ENST00000526812.2	-	1	323	c.258C>T	c.(256-258)ctC>ctT	p.L86L		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						TCTGTTCTGAGAGGAAATTGT	0.438																																						uc001niz.1		NA																	0					0						c.(256-258)CTC>CTT		olfactory receptor, family 5, subfamily M,							133.0	126.0	128.0					11																	56344940		1928	4128	6056	SO:0001819	synonymous_variant	390167				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56344940G>A	BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.258C>T	11.37:g.56344940G>A			Somatic					p.L86L	NM_001004741	NP_001004741	WXS	Illumina HiSeq	Unspecified	Q6IEU7	OR5MA_HUMAN			1	258	-			86			Extracellular (Potential).		B9EIL9	Silent	SNP	ENST00000526812.2	37	c.258C>T	CCDS53630.1																																																																																				0.438	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391609.1	NM_001004741		44	86	0	0	0	0	44	86				
PCNXL3	399909	broad.mit.edu	37	11	65383829	65383829	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr11:65383829C>T	ENST00000355703.3	+	1	586	c.47C>T	c.(46-48)tCg>tTg	p.S16L	MAP3K11_ENST00000309100.3_5'Flank	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	16						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						GTGTGGGCCTCGCTCACCGGC	0.667																																						uc001oey.2		NA																	0					0						c.(46-48)TCG>TTG		pecanex-like 3							19.0	27.0	24.0					11																	65383829		2071	4169	6240	SO:0001583	missense	399909					integral to membrane		g.chr11:65383829C>T	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.47C>T	11.37:g.65383829C>T	ENSP00000347931:p.Ser16Leu		Somatic				MAP3K11_uc001oew.2_5'Flank	p.S16L	NM_032223	NP_115599	WXS	Illumina HiSeq	Unspecified	Q9H6A9	PCX3_HUMAN			1	47	+			16					Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	37	c.47C>T	CCDS44650.1	.	.	.	.	.	.	.	.	.	.	C	33	5.276656	0.95459	.	.	ENSG00000197136	ENST00000355703	T	0.61742	0.08	4.11	4.11	0.48088	.	0.000000	0.27323	U	0.019900	T	0.61009	0.2313	M	0.78916	2.43	0.39983	D	0.97494	D	0.57899	0.981	B	0.43508	0.422	T	0.72833	-0.4173	10	0.87932	D	0	.	14.6545	0.68823	0.0:1.0:0.0:0.0	.	16	Q9H6A9	PCX3_HUMAN	L	16	ENSP00000347931:S16L	ENSP00000347931:S16L	S	+	2	0	PCNXL3	65140405	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.151000	0.77411	2.575000	0.86900	0.561000	0.74099	TCG		0.667	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223		9	9	0	0	0	0	9	9				
NUDT8	254552	broad.mit.edu	37	11	67395614	67395615	+	Missense_Mutation	DNP	GG	GG	TA			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr11:67395614_67395615GG>TA	ENST00000376693.2	-	4	522_523	c.513_514CC>TA	c.(511-516)ttCCtg>ttTAtg	p.L172M	NUDT8_ENST00000301490.4_3'UTR|RP11-655M14.13_ENST00000533311.1_lincRNA	NM_001243750.1	NP_001230679.1	Q8WV74	NUDT8_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 8	172	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(1)|prostate(1)|skin(1)	4						GGTCCATGCAGGAAGACGGGTA	0.639																																						uc001omo.1		NA																	0					0						c.(511-516)TTCCTG>TTTATG		nudix-type motif 8																																				SO:0001583	missense	254552					mitochondrion	hydrolase activity|metal ion binding	g.chr11:67395614_67395615GG>TA	AI743601	CCDS8174.1, CCDS58151.1	11q13.2	2008-07-21			ENSG00000167799	ENSG00000167799		"""Nudix motif containing"""	8055	protein-coding gene	gene with protein product						11415433	Standard	NM_181843		Approved	FLJ41567	uc001omo.2	Q8WV74	OTTHUMG00000167292	ENST00000376693.2:c.513_514delinsTA	11.37:g.67395614_67395615delinsTA	ENSP00000365883:p.Leu172Met		Somatic				NUDT8_uc001omn.2_3'UTR	p.L172M	NM_181843	NP_862826	WXS	Illumina HiSeq	Unspecified	Q8WV74	NUDT8_HUMAN			4	532_533	-			172			Nudix hydrolase.		Q6ZW59	Missense_Mutation	DNP	ENST00000376693.2	37	c.513_514CC>TA	CCDS58151.1																																																																																				0.639	NUDT8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394036.1	NM_181843		28	132	0	0	0	0	28	132				
FOLR1	2348	broad.mit.edu	37	11	71906662	71906662	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr11:71906662C>T	ENST00000393679.1	+	4	800	c.364C>T	c.(364-366)Cag>Tag	p.Q122*	FOLR1_ENST00000393676.3_Nonsense_Mutation_p.Q122*|FOLR1_ENST00000312293.4_Nonsense_Mutation_p.Q122*|FOLR1_ENST00000393681.2_Nonsense_Mutation_p.Q122*|RP11-807H22.7_ENST00000378140.3_RNA			P15328	FOLR1_HUMAN	folate receptor 1 (adult)	122					cell death (GO:0008219)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|receptor-mediated endocytosis (GO:0006898)	anchored component of external side of plasma membrane (GO:0031362)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|receptor activity (GO:0004872)			cervix(2)|endometrium(1)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	14					Methotrexate(DB00563)	CCAGGTGGATCAGAGCTGGCG	0.542																																						uc001orz.1		NA																	0				ovary(1)	1						c.(364-366)CAG>TAG		folate receptor 1 precursor							64.0	60.0	61.0					11																	71906662		2200	4293	6493	SO:0001587	stop_gained	2348				cell death|folic acid transport|receptor-mediated endocytosis	anchored to membrane|extracellular region|integral to plasma membrane|membrane fraction	folic acid binding|receptor activity	g.chr11:71906662C>T	J05013	CCDS8211.1	11q13.3-q14.1	2010-04-09			ENSG00000110195	ENSG00000110195			3791	protein-coding gene	gene with protein product		136430		FOLR		1717147	Standard	NM_000802		Approved		uc001osa.2	P15328		ENST00000393679.1:c.364C>T	11.37:g.71906662C>T	ENSP00000377284:p.Gln122*		Somatic				FOLR1_uc001osa.1_Nonsense_Mutation_p.Q122*|FOLR1_uc001osb.1_Nonsense_Mutation_p.Q122*|FOLR1_uc001osc.1_Nonsense_Mutation_p.Q122*|FOLR1_uc001osd.1_Nonsense_Mutation_p.Q122*	p.Q122*	NM_016724	NP_057936	WXS	Illumina HiSeq	Unspecified	P15328	FOLR1_HUMAN			5	502	+			122					Q53EW2|Q6FGT8|Q6LC90|Q9UCT2	Nonsense_Mutation	SNP	ENST00000393679.1	37	c.364C>T	CCDS8211.1	.	.	.	.	.	.	.	.	.	.	c	32	5.181299	0.94846	.	.	ENSG00000110195	ENST00000312293;ENST00000393681;ENST00000393679;ENST00000393676	.	.	.	5.45	3.46	0.39613	.	0.433935	0.25572	N	0.029743	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-19.4543	3.2284	0.06740	0.2694:0.4977:0.145:0.0879	.	.	.	.	X	122	.	ENSP00000308137:Q122X	Q	+	1	0	FOLR1	71584310	0.988000	0.35896	0.959000	0.39883	0.271000	0.26615	0.800000	0.27042	2.700000	0.92200	0.563000	0.77884	CAG		0.542	FOLR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396773.1	NM_016725		28	199	0	0	0	0	28	199				
ARHGEF17	9828	broad.mit.edu	37	11	73021005	73021005	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr11:73021005G>A	ENST00000263674.3	+	1	1672	c.1322G>A	c.(1321-1323)gGc>gAc	p.G441D	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	441					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						GGACCTGGAGGCACCTCTAGG	0.607																																						uc001otu.2		NA																	0					0						c.(1321-1323)GGC>GAC		Rho guanine nucleotide exchange factor (GEF) 17							55.0	59.0	57.0					11																	73021005		2200	4293	6493	SO:0001583	missense	9828				actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity	g.chr11:73021005G>A	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.1322G>A	11.37:g.73021005G>A	ENSP00000263674:p.Gly441Asp		Somatic					p.G441D	NM_014786	NP_055601	WXS	Illumina HiSeq	Unspecified	Q96PE2	ARHGH_HUMAN			1	1343	+			441					B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	c.1322G>A	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	G	8.090	0.774411	0.16051	.	.	ENSG00000110237	ENST00000263674	T	0.61274	0.12	5.13	4.21	0.49690	.	0.154096	0.30820	N	0.008820	T	0.42040	0.1185	L	0.29908	0.895	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.24584	-1.0156	10	0.45353	T	0.12	-14.6297	8.3197	0.32121	0.1763:0.0:0.8237:0.0	.	441	Q96PE2	ARHGH_HUMAN	D	441	ENSP00000263674:G441D	ENSP00000263674:G441D	G	+	2	0	ARHGEF17	72698653	0.996000	0.38824	0.961000	0.40146	0.051000	0.14879	2.348000	0.44045	2.387000	0.81309	0.462000	0.41574	GGC		0.607	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786		37	29	0	0	0	0	37	29				
TYR	7299	broad.mit.edu	37	11	88911535	88911535	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr11:88911535C>T	ENST00000263321.5	+	1	916	c.414C>T	c.(412-414)ctC>ctT	p.L138L	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	138					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	TTGCCTACCTCACTTTAGCAA	0.438																																						uc001pcs.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(412-414)CTC>CTT		tyrosinase precursor	Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)						149.0	141.0	144.0					11																	88911535		2201	4299	6500	SO:0001819	synonymous_variant	7299	Oculocutaneous_Albinism			eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity	g.chr11:88911535C>T	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.414C>T	11.37:g.88911535C>T			Somatic					p.L138L	NM_000372	NP_000363	WXS	Illumina HiSeq	Unspecified	P14679	TYRO_HUMAN			1	496	+		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)	138			Lumenal, melanosome (Potential).		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Silent	SNP	ENST00000263321.5	37	c.414C>T	CCDS8284.1																																																																																				0.438	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372		13	136	0	0	0	0	13	136				
HEPN1	641654	broad.mit.edu	37	11	124789685	124789685	+	Missense_Mutation	SNP	T	T	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr11:124789685T>A	ENST00000408930.5	+	1	540	c.39T>A	c.(37-39)gaT>gaA	p.D13E	HEPACAM_ENST00000298251.4_3'UTR	NM_001037558.2	NP_001032647.2	Q6WQI6	HEPN1_HUMAN	hepatocellular carcinoma, down-regulated 1	13						cytoplasm (GO:0005737)				large_intestine(1)|lung(1)|stomach(1)	3	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0287)		CATGGGTTGATGGCGAATCAG	0.517																																						uc001qbj.1		NA																	0					0						c.(37-39)GAT>GAA		HEPACAM opposite strand 1							137.0	143.0	141.0					11																	124789685		2020	4184	6204	SO:0001583	missense	641654					cytoplasm		g.chr11:124789685T>A	BC148521	CCDS41729.1	11q24	2013-07-02	2011-02-11		ENSG00000221932	ENSG00000221932			34400	protein-coding gene	gene with protein product	"""cancer susceptibility gene HEPN1"""	611641	"""HEPACAM opposite strand 1"""			12971969, 23548416	Standard	NM_001037558		Approved		uc001qbj.1	Q6WQI6	OTTHUMG00000165939	ENST00000408930.5:c.39T>A	11.37:g.124789685T>A	ENSP00000386143:p.Asp13Glu		Somatic				HEPACAM_uc009zbj.2_3'UTR|HEPACAM_uc001qbk.2_3'UTR	p.D13E	NM_001037558	NP_001032647	WXS	Illumina HiSeq	Unspecified	Q6WQI6	HEPN1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0287)	1	540	+	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)	13						Missense_Mutation	SNP	ENST00000408930.5	37	c.39T>A	CCDS41729.1	.	.	.	.	.	.	.	.	.	.	T	7.676	0.687923	0.14973	.	.	ENSG00000221932	ENST00000408930	T	0.55413	0.52	3.59	0.829	0.18847	.	.	.	.	.	T	0.39759	0.1090	.	.	.	0.09310	N	1	B	0.24721	0.11	B	0.22152	0.038	T	0.38351	-0.9665	8	0.87932	D	0	.	7.1785	0.25760	0.0:0.0:0.4638:0.5362	.	13	Q6WQI6	HEPN1_HUMAN	E	13	ENSP00000386143:D13E	ENSP00000386143:D13E	D	+	3	2	HEPN1	124294895	0.593000	0.26840	0.015000	0.15790	0.003000	0.03518	0.628000	0.24522	0.501000	0.28013	0.383000	0.25322	GAT		0.517	HEPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387129.1	NM_001037558		39	37	0	0	0	0	39	37				
CACNA1C	775	broad.mit.edu	37	12	2595407	2595407	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr12:2595407T>C	ENST00000347598.4	+	6	895	c.895T>C	c.(895-897)Tac>Cac	p.Y299H	CACNA1C_ENST00000399629.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399606.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000327702.7_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399591.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399603.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399617.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399601.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000406454.3_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399621.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000344100.3_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399634.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399641.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399649.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399597.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000335762.5_Missense_Mutation_p.Y299H|CACNA1C_ENST00000480911.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000402845.3_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399644.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399638.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399655.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399637.1_Missense_Mutation_p.Y299H|CACNA1C_ENST00000399595.1_Missense_Mutation_p.Y299H	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	299					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CAAGACCTGCTACAACCAGGA	0.602																																						uc009zdu.1		NA																	0				ovary(10)|central_nervous_system(1)	11						c.(895-897)TAC>CAC		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						75.0	77.0	77.0					12																	2595407		2192	4298	6490	SO:0001583	missense	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2595407T>C	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.895T>C	12.37:g.2595407T>C	ENSP00000266376:p.Tyr299His		Somatic				CACNA1C_uc009zdv.1_Missense_Mutation_p.Y299H|CACNA1C_uc001qkb.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qkc.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qke.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qkf.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qjz.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qkd.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qkg.2_Missense_Mutation_p.Y299H|CACNA1C_uc009zdw.1_Missense_Mutation_p.Y299H|CACNA1C_uc001qkh.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qkl.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qkn.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qko.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qkp.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qkr.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qku.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qkq.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qks.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qkt.2_Missense_Mutation_p.Y299H|CACNA1C_uc001qka.1_5'UTR|CACNA1C_uc001qki.1_Missense_Mutation_p.Y35H|CACNA1C_uc001qkj.1_Missense_Mutation_p.Y35H|CACNA1C_uc001qkk.1_Missense_Mutation_p.Y35H|CACNA1C_uc001qkm.1_Missense_Mutation_p.Y35H	p.Y299H	NM_199460	NP_955630	WXS	Illumina HiSeq	Unspecified	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	6	1208	+			299			I.|Extracellular (Potential).		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	c.895T>C	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.072221	0.76415	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98474	-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95;-4.95	5.0	5.0	0.66597	Ion transport (1);	0.275476	0.35970	N	0.002873	D	0.99096	0.9689	M	0.91818	3.245	0.45930	D	0.998766	D;D;D;D;D;D;D;P;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.969;0.993;0.999;0.98;0.969;0.98;0.902;0.996;0.98;0.969;0.96;0.964;0.975;0.984;0.969;0.997;0.98;0.997;0.969;0.991;0.98;0.969;0.969	D;P;D;D;P;P;P;D;D;P;P;P;P;P;D;P;D;P;D;P;P;P;P;P	0.85130	0.997;0.742;0.976;0.997;0.861;0.742;0.861;0.944;0.945;0.861;0.66;0.891;0.861;0.771;0.914;0.742;0.917;0.807;0.917;0.742;0.861;0.807;0.66;0.742	D	0.99461	1.0943	10	0.72032	D	0.01	.	14.8709	0.70456	0.0:0.0:0.0:1.0	.	299;299;299;299;299;299;299;299;299;299;299;270;299;299;299;299;299;299;299;299;299;299;299;299	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	H	299;299;299;299;299;299;299;299;299;299;299;299;299;299;299;299;299;299;299;299;299;299;299;140	ENSP00000336982:Y299H;ENSP00000382563:Y299H;ENSP00000437936:Y299H;ENSP00000382552:Y299H;ENSP00000382547:Y299H;ENSP00000382506:Y299H;ENSP00000382530:Y299H;ENSP00000382546:Y299H;ENSP00000382500:Y299H;ENSP00000382549:Y299H;ENSP00000266376:Y299H;ENSP00000382515:Y299H;ENSP00000382510:Y299H;ENSP00000341092:Y299H;ENSP00000382537:Y299H;ENSP00000329877:Y299H;ENSP00000382557:Y299H;ENSP00000385724:Y299H;ENSP00000382512:Y299H;ENSP00000382542:Y299H;ENSP00000382526:Y299H;ENSP00000385896:Y299H;ENSP00000382504:Y299H	ENSP00000323129:Y140H	Y	+	1	0	CACNA1C	2465668	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.562000	0.67346	2.098000	0.63641	0.533000	0.62120	TAC		0.602	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		16	61	0	0	0	0	16	61				
CLEC4E	26253	broad.mit.edu	37	12	8689784	8689784	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr12:8689784G>A	ENST00000299663.3	-	4	464	c.299C>T	c.(298-300)tCc>tTc	p.S100F	CLEC4E_ENST00000545274.1_Intron|CLEC4E_ENST00000446457.2_Intron	NM_014358.2	NP_055173.1	Q9ULY5	CLC4E_HUMAN	C-type lectin domain family 4, member E	100	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				immune response (GO:0006955)|positive regulation of cytokine secretion (GO:0050715)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12	Lung SC(5;0.184)					TAACGCCCAGGAAATGGTGTC	0.463																																						uc001quo.1		NA																	0				central_nervous_system(1)	1						c.(298-300)TCC>TTC		C-type lectin domain family 4, member E							95.0	92.0	93.0					12																	8689784		2203	4300	6503	SO:0001583	missense	26253					integral to membrane	sugar binding	g.chr12:8689784G>A	AB024718	CCDS8594.1	12p13.31	2005-02-09		2005-02-09	ENSG00000166523	ENSG00000166523		"""C-type lectin domain containing"""	14555	protein-coding gene	gene with protein product		609962	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 9"""	CLECSF9		10528209	Standard	NM_014358		Approved	mincle	uc001quo.1	Q9ULY5	OTTHUMG00000168675	ENST00000299663.3:c.299C>T	12.37:g.8689784G>A	ENSP00000299663:p.Ser100Phe		Somatic					p.S100F	NM_014358	NP_055173	WXS	Illumina HiSeq	Unspecified	Q9ULY5	CLC4E_HUMAN			4	464	-	Lung SC(5;0.184)		100			C-type lectin.|Extracellular (Potential).		B2R6Q6	Missense_Mutation	SNP	ENST00000299663.3	37	c.299C>T	CCDS8594.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.213|8.213	0.800693|0.800693	0.16397|0.16397	.|.	.|.	ENSG00000166523|ENSG00000166523	ENST00000537698|ENST00000299663	.|T	.|0.20738	.|2.05	5.23|5.23	1.08|1.08	0.20341|0.20341	.|C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.|1.593470	.|0.03826	.|N	.|0.268392	T|T	0.39682|0.39682	0.1087|0.1087	M|M	0.77103|0.77103	2.36|2.36	0.36982|0.36982	D|D	0.894362|0.894362	.|P	.|0.37612	.|0.602	.|P	.|0.48524	.|0.58	T|T	0.17289|0.17289	-1.0374|-1.0374	5|10	.|0.45353	.|T	.|0.12	.|.	8.3327|8.3327	0.32195|0.32195	0.0:0.1457:0.4077:0.4466|0.0:0.1457:0.4077:0.4466	.|.	.|100	.|Q9ULY5	.|CLC4E_HUMAN	S|F	40|100	.|ENSP00000299663:S100F	.|ENSP00000299663:S100F	P|S	-|-	1|2	0|0	CLEC4E|CLEC4E	8581051|8581051	0.963000|0.963000	0.33076|0.33076	0.163000|0.163000	0.22734|0.22734	0.007000|0.007000	0.05969|0.05969	1.576000|1.576000	0.36504|0.36504	0.097000|0.097000	0.17492|0.17492	0.591000|0.591000	0.81541|0.81541	CCT|TCC		0.463	CLEC4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400566.1	NM_014358		47	77	0	0	0	0	47	77				
ATF7IP	55729	broad.mit.edu	37	12	14577111	14577111	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr12:14577111T>C	ENST00000540793.1	+	1	417	c.262T>C	c.(262-264)Tgg>Cgg	p.W88R	ATF7IP_ENST00000536444.1_Missense_Mutation_p.W88R|ATF7IP_ENST00000261168.4_Missense_Mutation_p.W88R|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000543189.1_Missense_Mutation_p.W88R|ATF7IP_ENST00000544627.1_Missense_Mutation_p.W96R			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	88					DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						TAAAGCAGAATGGAAGGAAAC	0.378																																						uc001rbw.2		NA																	0				lung(3)|ovary(1)|skin(1)	5						c.(262-264)TGG>CGG		activating transcription factor 7 interacting							109.0	104.0	105.0					12																	14577111		2203	4300	6503	SO:0001583	missense	55729				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding	g.chr12:14577111T>C	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.262T>C	12.37:g.14577111T>C	ENSP00000444589:p.Trp88Arg		Somatic				ATF7IP_uc010shs.1_Missense_Mutation_p.W88R|ATF7IP_uc001rbu.2_Missense_Mutation_p.W88R|ATF7IP_uc001rbv.1_Missense_Mutation_p.W88R|ATF7IP_uc001rbx.2_Missense_Mutation_p.W88R|ATF7IP_uc010sht.1_Missense_Mutation_p.W88R|ATF7IP_uc001rby.3_Missense_Mutation_p.W88R|ATF7IP_uc001rbz.1_Missense_Mutation_p.W88R|ATF7IP_uc001rca.2_Missense_Mutation_p.W88R|ATF7IP_uc001rcb.2_5'Flank	p.W88R	NM_018179	NP_060649	WXS	Illumina HiSeq	Unspecified	Q6VMQ6	MCAF1_HUMAN			2	420	+			88					F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	ENST00000540793.1	37	c.262T>C	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	T	17.57	3.422344	0.62622	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000542967;ENST00000534828;ENST00000535132;ENST00000544627;ENST00000541056;ENST00000539057;ENST00000545769;ENST00000428217;ENST00000396279;ENST00000542514;ENST00000536279;ENST00000540793	T;T;T;T;T;T	0.23348	2.21;2.22;2.21;2.21;1.91;2.21	5.6	4.42	0.53409	.	0.499176	0.18746	N	0.132318	T	0.24928	0.0605	L	0.51422	1.61	0.27735	N	0.944683	P;P;P;P;P	0.45078	0.85;0.85;0.575;0.575;0.575	B;B;B;B;B	0.40285	0.325;0.325;0.178;0.178;0.178	T	0.12293	-1.0553	10	0.87932	D	0	0.0369	10.1481	0.42776	0.2665:0.0:0.0:0.7335	.	96;88;88;88;88	B4E2A2;B4DRL6;G3V1U0;Q6VMQ6;Q6VMQ6-2	.;.;.;MCAF1_HUMAN;.	R	88;88;88;88;88;88;96;88;88;88;88;88;88;88;88	ENSP00000261168:W88R;ENSP00000443179:W88R;ENSP00000445955:W88R;ENSP00000440440:W96R;ENSP00000379575:W88R;ENSP00000444589:W88R	ENSP00000261168:W88R	W	+	1	0	ATF7IP	14468378	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	2.603000	0.46266	1.008000	0.39264	0.460000	0.39030	TGG		0.378	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179		34	67	0	0	0	0	34	67				
KMT2D	8085	broad.mit.edu	37	12	49445126	49445126	+	Nonsense_Mutation	SNP	G	G	T	rs530563702		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr12:49445126G>T	ENST00000301067.7	-	10	2339	c.2340C>A	c.(2338-2340)tgC>tgA	p.C780*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	780	Pro-rich.			Missing (in Ref. 1; AAC51734). {ECO:0000305}.	chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CAGGCACAGCGCATAGGCATG	0.667																																						uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		0				kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(2338-2340)TGC>TGA		myeloid/lymphoid or mixed-lineage leukemia 2							23.0	24.0	24.0					12																	49445126		1876	3956	5832	SO:0001587	stop_gained	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49445126G>T	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.2340C>A	12.37:g.49445126G>T	ENSP00000301067:p.Cys780*	HNSCC(34;0.089)	Somatic					p.C780*	NM_003482	NP_003473	WXS	Illumina HiSeq	Unspecified	O14686	MLL2_HUMAN			10	2340	-			780	Missing (in Ref. 1; AAC51734).		Pro-rich.		O14687	Nonsense_Mutation	SNP	ENST00000301067.7	37	c.2340C>A	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297344	0.81025	.	.	ENSG00000167548	ENST00000301067	.	.	.	3.57	-1.86	0.07760	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.0842	0.14673	0.3889:0.148:0.4631:0.0	.	.	.	.	X	780	.	ENSP00000301067:C780X	C	-	3	2	MLL2	47731393	0.306000	0.24490	0.001000	0.08648	0.002000	0.02628	0.335000	0.19806	-0.402000	0.07633	-0.251000	0.11542	TGC		0.667	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			27	39	1	0	1.3e-26	1.5e-26	27	39				
HOXC9	3225	broad.mit.edu	37	12	54396297	54396297	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr12:54396297G>A	ENST00000303450.4	+	2	692	c.622G>A	c.(622-624)Gag>Aag	p.E208K	HOXC-AS1_ENST00000505700.1_RNA|HOXC9_ENST00000504557.1_3'UTR|HOXC9_ENST00000508190.1_Missense_Mutation_p.E208K|RP11-834C11.12_ENST00000513209.1_Intron|HOXC-AS1_ENST00000512427.1_RNA	NM_006897.1	NP_008828.1	P31274	HXC9_HUMAN	homeobox C9	208					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(3)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14						GCTGGAACTGGAGAAGGAGTT	0.557																																						uc001sep.2		NA																	0				large_intestine(1)|pancreas(1)|skin(1)	3						c.(622-624)GAG>AAG		homeobox C9							78.0	82.0	81.0					12																	54396297		2203	4300	6503	SO:0001583	missense	3225				multicellular organismal development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:54396297G>A		CCDS8869.1	12q13.13	2011-06-20	2005-12-22			ENSG00000180806		"""Homeoboxes / ANTP class : HOXL subclass"""	5130	protein-coding gene	gene with protein product		142971	"""homeo box C9"""	HOX3, HOX3B		1973146	Standard	NM_006897		Approved		uc001seq.3	P31274		ENST00000303450.4:c.622G>A	12.37:g.54396297G>A	ENSP00000302836:p.Glu208Lys		Somatic				HOXC9_uc001seq.2_Missense_Mutation_p.E208K	p.E208K	NM_006897	NP_008828	WXS	Illumina HiSeq	Unspecified	P31274	HXC9_HUMAN			3	720	+			208			Homeobox.		B2RCN7|Q9H1I0	Missense_Mutation	SNP	ENST00000303450.4	37	c.622G>A	CCDS8869.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.389571	0.82902	.	.	ENSG00000180806	ENST00000508190;ENST00000303450	D;D	0.97575	-4.44;-4.44	3.99	3.99	0.46301	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000002	D	0.98523	0.9507	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99406	1.0929	10	0.87932	D	0	.	15.3675	0.74535	0.0:0.0:1.0:0.0	.	208	P31274	HXC9_HUMAN	K	208	ENSP00000423861:E208K;ENSP00000302836:E208K	ENSP00000302836:E208K	E	+	1	0	HOXC9	52682564	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.490000	0.97952	2.244000	0.73946	0.561000	0.74099	GAG		0.557	HOXC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358958.1			62	119	0	0	0	0	62	119				
R3HDM2	22864	broad.mit.edu	37	12	57648863	57648863	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr12:57648863G>A	ENST00000347140.3	-	24	3014	c.2624C>T	c.(2623-2625)cCt>cTt	p.P875L	RP11-123K3.4_ENST00000548184.1_Intron|R3HDM2_ENST00000413953.2_Intron|R3HDM2_ENST00000403821.2_Missense_Mutation_p.P909L|R3HDM2_ENST00000358907.2_Missense_Mutation_p.P875L|R3HDM2_ENST00000441731.2_Missense_Mutation_p.P570L|R3HDM2_ENST00000546843.1_5'Flank|R3HDM2_ENST00000402412.1_Missense_Mutation_p.P889L			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	875						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						GATGCCCTCAGGGAGATCTGT	0.602																																						uc009zpm.1		NA																	0				ovary(2)	2						c.(2623-2625)CCT>CTT		R3H domain containing 2							61.0	59.0	60.0					12																	57648863		2203	4300	6503	SO:0001583	missense	22864					nucleus	nucleic acid binding	g.chr12:57648863G>A	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.2624C>T	12.37:g.57648863G>A	ENSP00000317903:p.Pro875Leu		Somatic				R3HDM2_uc010srn.1_Intron|R3HDM2_uc001snu.2_Missense_Mutation_p.P570L|R3HDM2_uc001snr.2_Missense_Mutation_p.P602L|R3HDM2_uc001sns.2_Missense_Mutation_p.P875L|R3HDM2_uc001snt.2_Missense_Mutation_p.P889L|R3HDM2_uc009zpn.1_Intron	p.P875L	NM_014925	NP_055740	WXS	Illumina HiSeq	Unspecified	Q9Y2K5	R3HD2_HUMAN			22	2659	-			875					Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	ENST00000347140.3	37	c.2624C>T	CCDS8937.2	.	.	.	.	.	.	.	.	.	.	G	32	5.173033	0.94807	.	.	ENSG00000179912	ENST00000393811;ENST00000347140;ENST00000402412;ENST00000358907;ENST00000441731;ENST00000429355;ENST00000403821	T;T;T;T;T;T;T	0.63096	-0.02;0.89;0.92;0.89;0.02;0.63;0.89	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.75635	0.3876	L	0.52573	1.65	0.80722	D	1	P;P;D;P	0.89917	0.745;0.745;1.0;0.948	B;B;D;P	0.83275	0.31;0.31;0.996;0.628	T	0.76764	-0.2839	10	0.87932	D	0	-8.9274	18.0941	0.89483	0.0:0.0:1.0:0.0	.	909;889;875;602	B5MCG9;B5MCU0;Q9Y2K5;E9PAL1	.;.;R3HD2_HUMAN;.	L	602;875;889;875;570;640;909	ENSP00000377400:P602L;ENSP00000317903:P875L;ENSP00000385839:P889L;ENSP00000351784:P875L;ENSP00000408536:P570L;ENSP00000394676:P640L;ENSP00000385169:P909L	ENSP00000317903:P875L	P	-	2	0	R3HDM2	55935130	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.209000	0.95087	2.885000	0.99019	0.655000	0.94253	CCT		0.602	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925		48	91	0	0	0	0	48	91				
SLC26A10	65012	broad.mit.edu	37	12	58018675	58018675	+	Silent	SNP	C	C	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr12:58018675C>A	ENST00000320442.4	+	10	1565	c.1254C>A	c.(1252-1254)atC>atA	p.I418I	SLC26A10_ENST00000490243.1_3'UTR|SLC26A10_ENST00000379218.2_Missense_Mutation_p.S454Y	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	418	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.					integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)	p.S454C(1)|p.I418M(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					GGCTCTGCATCCTGAGCTATC	0.577																																						uc001spe.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|central_nervous_system(1)	2						c.(1252-1254)ATC>ATA		solute carrier family 26, member 10							103.0	101.0	101.0					12																	58018675		2203	4300	6503	SO:0001819	synonymous_variant	65012					integral to membrane	antiporter activity	g.chr12:58018675C>A		CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.1254C>A	12.37:g.58018675C>A			Somatic				SLC26A10_uc001spf.2_RNA|SLC26A10_uc009zpz.1_RNA	p.I418I	NM_133489	NP_597996	WXS	Illumina HiSeq	Unspecified	Q8NG04	S2610_HUMAN			10	1565	+	Melanoma(17;0.122)		418			STAS.		A6NMJ2|B6ZDQ3|Q6ZWI7	Silent	SNP	ENST00000320442.4	37	c.1254C>A	CCDS8949.2	.	.	.	.	.	.	.	.	.	.	.	14.38	2.519564	0.44866	.	.	ENSG00000135502	ENST00000379218	D	0.94417	-3.42	4.71	4.71	0.59529	.	.	.	.	.	D	0.95987	0.8693	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.96203	0.9147	6	0.87932	D	0	.	13.0322	0.58848	0.0:1.0:0.0:0.0	.	.	.	.	Y	454	ENSP00000368520:S454Y	ENSP00000368520:S454Y	S	+	2	0	SLC26A10	56304942	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.968000	0.40500	2.448000	0.82819	0.561000	0.74099	TCC		0.577	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250311.2			78	165	1	0	7.68e-34	9e-34	78	165				
TMEM132D	121256	broad.mit.edu	37	12	130184678	130184678	+	Silent	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr12:130184678G>A	ENST00000422113.2	-	2	971	c.645C>T	c.(643-645)tcC>tcT	p.S215S	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	215					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GCTGGTCCACGGACTTCCTCC	0.692																																						uc009zyl.1		NA																	0				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14						c.(643-645)TCC>TCT		transmembrane protein 132D precursor							32.0	35.0	34.0					12																	130184678		2203	4299	6502	SO:0001819	synonymous_variant	121256					integral to membrane		g.chr12:130184678G>A	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.645C>T	12.37:g.130184678G>A			Somatic					p.S215S	NM_133448	NP_597705	WXS	Illumina HiSeq	Unspecified	Q14C87	T132D_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	2	973	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	215			Extracellular (Potential).		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	37	c.645C>T	CCDS9266.1																																																																																				0.692	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		40	79	0	0	0	0	40	79				
ZNF10	7556	broad.mit.edu	37	12	133732286	133732286	+	Missense_Mutation	SNP	T	T	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr12:133732286T>G	ENST00000248211.6	+	5	676	c.454T>G	c.(454-456)Ttc>Gtc	p.F152V	ZNF10_ENST00000426665.2_Missense_Mutation_p.F152V|ZNF10_ENST00000402932.2_Intron|ZNF268_ENST00000416488.1_Intron|CTD-2140B24.4_ENST00000540096.2_Intron	NM_015394.4	NP_056209.2	P21506	ZNF10_HUMAN	zinc finger protein 10	152				Missing (in Ref. 1). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(1)|skin(5)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		GCAAGTGGCATTCACCCAAAA	0.413																																						uc009zzb.2		NA																	0				breast(1)|central_nervous_system(1)|skin(1)	3						c.(454-456)TTC>GTC		zinc finger protein 10							108.0	105.0	106.0					12																	133732286		2203	4300	6503	SO:0001583	missense	7556				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr12:133732286T>G	X52332, BC024182	CCDS9283.1	12q24.33	2013-01-08	2005-05-22		ENSG00000256223	ENSG00000256223		"""Zinc fingers, C2H2-type"", ""-"""	12879	protein-coding gene	gene with protein product		194538	"""zinc finger protein 10 (KOX 1)"""			7865130, 8262519	Standard	NM_015394		Approved	KOX1	uc001ulq.3	P21506	OTTHUMG00000167944	ENST00000248211.6:c.454T>G	12.37:g.133732286T>G	ENSP00000248211:p.Phe152Val		Somatic				ZNF268_uc010tbv.1_Intron|ZNF10_uc001ulq.2_Missense_Mutation_p.F152V	p.F152V	NM_015394	NP_056209	WXS	Illumina HiSeq	Unspecified	P21506	ZNF10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)	5	901	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)	152	Missing (in Ref. 1).				B2RBS1|Q8TC91	Missense_Mutation	SNP	ENST00000248211.6	37	c.454T>G	CCDS9283.1	.	.	.	.	.	.	.	.	.	.	T	0.504	-0.869614	0.02570	.	.	ENSG00000256223	ENST00000248211;ENST00000426665;ENST00000537119	T;T;T	0.04454	3.62;3.62;4.84	4.44	3.2	0.36748	.	0.962863	0.08511	N	0.934985	T	0.04452	0.0122	L	0.38733	1.17	0.09310	N	0.999997	B	0.19331	0.035	B	0.12156	0.007	T	0.38351	-0.9665	9	.	.	.	.	4.8102	0.13340	0.1672:0.0941:0.0:0.7387	.	152	P21506	ZNF10_HUMAN	V	152;152;110	ENSP00000248211:F152V;ENSP00000393814:F152V;ENSP00000437397:F110V	.	F	+	1	0	ZNF10	132242359	0.987000	0.35691	0.989000	0.46669	0.991000	0.79684	3.046000	0.49846	1.992000	0.58205	0.533000	0.62120	TTC		0.413	ZNF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397182.1	NM_015394		43	64	0	0	0	0	43	64				
RIPK3	11035	broad.mit.edu	37	14	24808260	24808260	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr14:24808260C>T	ENST00000216274.5	-	3	650	c.432G>A	c.(430-432)aaG>aaA	p.K144K	RIPK3_ENST00000554338.1_5'Flank|RP11-934B9.3_ENST00000555591.1_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	144	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		CGTTGGATGGCTTGAGGTCCC	0.627																																					Pancreas(58;918 1191 4668 13304 15331)	uc001wpb.2		NA																	0				central_nervous_system(2)|ovary(1)|lung(1)	4						c.(430-432)AAG>AAA		receptor-interacting serine-threonine kinase 3							37.0	44.0	42.0					14																	24808260		2193	4293	6486	SO:0001819	synonymous_variant	11035				apoptosis|induction of apoptosis by extracellular signals	cytoplasm	ATP binding|protein binding|transcription coactivator activity	g.chr14:24808260C>T	AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.432G>A	14.37:g.24808260C>T			Somatic				RIPK3_uc001wpa.2_5'UTR|RIPK3_uc010alq.2_RNA|RIPK3_uc010toi.1_5'UTR|RIPK3_uc010toj.1_Silent_p.K144K	p.K144K	NM_006871	NP_006862	WXS	Illumina HiSeq	Unspecified	Q9Y572	RIPK3_HUMAN		GBM - Glioblastoma multiforme(265;0.0181)	3	642	-			144			Protein kinase.		B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Silent	SNP	ENST00000216274.5	37	c.432G>A	CCDS9628.1																																																																																				0.627	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073203.4	NM_006871		30	34	0	0	0	0	30	34				
MIA2	117153	broad.mit.edu	37	14	39716525	39716525	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr14:39716525C>T	ENST00000280082.3	+	4	946	c.747C>T	c.(745-747)agC>agT	p.S249S	RP11-407N17.3_ENST00000553728.1_Silent_p.S249S|MIA2_ENST00000556784.1_Silent_p.S248S	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	249					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)				NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		TACAAGAAAGCTCATTTCGGA	0.403																																						uc001wux.2		NA																	0				ovary(1)|breast(1)	2						c.(745-747)AGC>AGT		melanoma inhibitory activity 2							76.0	77.0	76.0					14																	39716525		2203	4300	6503	SO:0001819	synonymous_variant	117153					extracellular region		g.chr14:39716525C>T	BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.747C>T	14.37:g.39716525C>T			Somatic				MIA2_uc010amy.1_Silent_p.S180S	p.S249S	NM_054024	NP_473365	WXS	Illumina HiSeq	Unspecified	Q96PC5	MIA2_HUMAN	LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)	4	941	+	Hepatocellular(127;0.213)		249					A1L4H0|Q9H6C1	Silent	SNP	ENST00000280082.3	37	c.747C>T	CCDS9672.1																																																																																				0.403	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276768.3	NM_054024		46	25	0	0	0	0	46	25				
PTGER2	5732	broad.mit.edu	37	14	52781581	52781581	+	Silent	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr14:52781581G>A	ENST00000245457.5	+	1	469	c.315G>A	c.(313-315)gaG>gaA	p.E105E	PTGER2_ENST00000557436.1_Intron	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	105					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to prostaglandin E stimulus (GO:0071380)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)	TGGCGCCCGAGAGCCGCGCGT	0.647																																						uc001wzr.2		NA																	0				lung(1)|breast(1)	2						c.(313-315)GAG>GAA		prostaglandin E receptor 2 (subtype EP2), 53kDa	Alprostadil(DB00770)|Iloprost(DB01088)						41.0	38.0	39.0					14																	52781581		2190	4278	6468	SO:0001819	synonymous_variant	5732					integral to plasma membrane	prostaglandin E receptor activity	g.chr14:52781581G>A		CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384		"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""			8250933, 7759114	Standard	NM_000956		Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.315G>A	14.37:g.52781581G>A			Somatic					p.E105E	NM_000956	NP_000947	WXS	Illumina HiSeq	Unspecified	P43116	PE2R2_HUMAN			1	566	+	Breast(41;0.0639)|all_epithelial(31;0.0729)		105			Extracellular (Potential).		D3DSC0|Q52LG8	Silent	SNP	ENST00000245457.5	37	c.315G>A	CCDS9708.1																																																																																				0.647	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276890.1			26	63	0	0	0	0	26	63				
HEATR4	399671	broad.mit.edu	37	14	73959252	73959252	+	Intron	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr14:73959252C>T	ENST00000553558.1	-	17	3166				C14orf169_ENST00000531973.1_RNA|HEATR4_ENST00000560393.1_Intron|HEATR4_ENST00000334988.2_Intron	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4											breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		CGATTCTCTGCCCCCTGTTTT	0.562																																						uc001xok.1		NA																	0					0						c.(1531-1533)CCC>TCC		chromosome 14 open reading frame 169							29.0	30.0	30.0					14																	73959252		1926	4124	6050	SO:0001627	intron_variant	79697				negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm	histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K4 specific)|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr14:73959252C>T	BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2844+517G>A	14.37:g.73959252C>T			Somatic				HEATR4_uc010tua.1_Intron	p.P511S	NM_024644	NP_078920	WXS	Illumina HiSeq	Unspecified	Q9H6W3	NO66_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.215)	3	1610	+			511					B7Z7V9|E9KL41	Missense_Mutation	SNP	ENST00000553558.1	37	c.1531C>T	CCDS9815.2																																																																																				0.562	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414422.2	NM_203309		39	16	0	0	0	0	39	16				
FBLN5	10516	broad.mit.edu	37	14	92357640	92357640	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr14:92357640C>T	ENST00000342058.4	-	6	1137	c.544G>A	c.(544-546)Gcg>Acg	p.A182T	FBLN5_ENST00000556154.1_Missense_Mutation_p.A187T|FBLN5_ENST00000267620.10_Missense_Mutation_p.A223T	NM_006329.3	NP_006320.2	Q9UBX5	FBLN5_HUMAN	fibulin 5	182	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|protein localization to cell surface (GO:0034394)|regulation of cell growth (GO:0001558)|regulation of removal of superoxide radicals (GO:2000121)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	28		all_cancers(154;0.0722)				GGAACATTCGCACAGAGCTGC	0.473																																						uc001xzx.3		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6						c.(544-546)GCG>ACG		fibulin 5 precursor							168.0	130.0	143.0					14																	92357640		2203	4300	6503	SO:0001583	missense	10516				cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding	g.chr14:92357640C>T	AJ133490	CCDS9898.1	14q31	2014-09-17				ENSG00000140092		"""Fibulins"""	3602	protein-coding gene	gene with protein product		604580				10640802	Standard	NM_006329		Approved	EVEC, UP50, DANCE, ARMD3	uc001xzx.4	Q9UBX5		ENST00000342058.4:c.544G>A	14.37:g.92357640C>T	ENSP00000345008:p.Ala182Thr		Somatic				FBLN5_uc010aud.2_Missense_Mutation_p.A187T|FBLN5_uc010aue.2_Missense_Mutation_p.A223T	p.A182T	NM_006329	NP_006320	WXS	Illumina HiSeq	Unspecified	Q9UBX5	FBLN5_HUMAN			6	1017	-		all_cancers(154;0.0722)	182			EGF-like 3; calcium-binding (Potential).		O75966|Q6IAL4|Q6UWA3	Missense_Mutation	SNP	ENST00000342058.4	37	c.544G>A	CCDS9898.1	.	.	.	.	.	.	.	.	.	.	C	32	5.127506	0.94473	.	.	ENSG00000140092	ENST00000267620;ENST00000342058;ENST00000556154	T;T;T	0.77620	-1.11;-1.11;-1.11	5.0	5.0	0.66597	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.69967	0.3170	N	0.00885	-1.115	0.80722	D	1	D;D;D	0.71674	0.998;0.996;0.993	D;D;D	0.77557	0.971;0.99;0.977	T	0.82049	-0.0650	10	0.42905	T	0.14	.	17.9214	0.88967	0.0:1.0:0.0:0.0	.	223;187;182	G3XA98;G3V4U0;Q9UBX5	.;.;FBLN5_HUMAN	T	223;182;187	ENSP00000267620:A223T;ENSP00000345008:A182T;ENSP00000451982:A187T	ENSP00000267620:A279T	A	-	1	0	FBLN5	91427393	1.000000	0.71417	0.985000	0.45067	0.965000	0.64279	7.426000	0.80270	2.342000	0.79632	0.561000	0.74099	GCG		0.473	FBLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411787.1			79	29	0	0	0	0	79	29				
FMN1	342184	broad.mit.edu	37	15	33359987	33359987	+	Intron	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr15:33359987G>A	ENST00000559047.1	-	3	2043				FMN1_ENST00000561249.1_Intron|FMN1_ENST00000559150.1_Intron|FMN1_ENST00000334528.9_Silent_p.F33F|FMN1_ENST00000558197.1_Silent_p.F33F			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		ATTTCATAGAGAACTTACTCA	0.428																																						uc001zhf.3		NA																	0				ovary(1)	1						c.(97-99)TTC>TTT		formin 1							75.0	72.0	73.0					15																	33359987		1909	4129	6038	SO:0001627	intron_variant	342184				actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding	g.chr15:33359987G>A	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-2712C>T	15.37:g.33359987G>A			Somatic				FMN1_uc001zhg.2_Silent_p.F33F	p.F33F	NM_001103184	NP_001096654	WXS	Illumina HiSeq	Unspecified	Q68DA7	FMN1_HUMAN		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	1	99	-		all_lung(180;1.14e-07)	Error:Variant_position_missing_in_Q68DA7_after_alignment					Q3B7I6|Q3ZAR4|Q6ZSY1	Silent	SNP	ENST00000559047.1	37	c.99C>T																																																																																					0.428	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184		42	68	0	0	0	0	42	68				
THBS1	7057	broad.mit.edu	37	15	39876366	39876366	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr15:39876366T>C	ENST00000260356.5	+	5	1046	c.881T>C	c.(880-882)cTg>cCg	p.L294P		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	294					activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		GTGACCACGCTGCAGGACAGC	0.557																																						uc001zkh.2		NA																	0				ovary(3)|central_nervous_system(3)	6						c.(880-882)CTG>CCG		thrombospondin 1 precursor	Becaplermin(DB00102)						45.0	42.0	43.0					15																	39876366		2200	4297	6497	SO:0001583	missense	7057				activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding	g.chr15:39876366T>C		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.881T>C	15.37:g.39876366T>C	ENSP00000260356:p.Leu294Pro		Somatic					p.L294P	NM_003246	NP_003237	WXS	Illumina HiSeq	Unspecified	P07996	TSP1_HUMAN		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	5	1060	+		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)	294					A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	37	c.881T>C	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.359744	0.82353	.	.	ENSG00000137801	ENST00000260356	T	0.79940	-1.32	5.88	5.88	0.94601	.	0.000000	0.30464	N	0.009564	D	0.89952	0.6864	M	0.79693	2.465	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.91201	0.4991	10	0.87932	D	0	-14.5809	15.4523	0.75282	0.0:0.0:0.0:1.0	.	294	P07996	TSP1_HUMAN	P	294	ENSP00000260356:L294P	ENSP00000260356:L294P	L	+	2	0	THBS1	37663658	1.000000	0.71417	0.515000	0.27774	0.987000	0.75469	6.258000	0.72487	2.247000	0.74100	0.533000	0.62120	CTG		0.557	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246		19	42	0	0	0	0	19	42				
MAPK6	5597	broad.mit.edu	37	15	52339091	52339091	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr15:52339091C>G	ENST00000261845.5	+	2	1241	c.434C>G	c.(433-435)tCt>tGt	p.S145C		NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	145	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		TATATTCACTCTGCAAATGTA	0.468																																						uc002abp.2		NA																	0				lung(3)|ovary(1)	4						c.(433-435)TCT>TGT		mitogen-activated protein kinase 6							61.0	60.0	60.0					15																	52339091		2194	4293	6487	SO:0001583	missense	5597				cell cycle		ATP binding|MAP kinase activity	g.chr15:52339091C>G	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.434C>G	15.37:g.52339091C>G	ENSP00000261845:p.Ser145Cys		Somatic					p.S145C	NM_002748	NP_002739	WXS	Illumina HiSeq	Unspecified	Q16659	MK06_HUMAN		all cancers(107;0.0028)	2	1228	+			145			Protein kinase.		B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	ENST00000261845.5	37	c.434C>G	CCDS10147.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.201713	0.79015	.	.	ENSG00000069956	ENST00000261845	T	0.52057	0.68	5.53	5.53	0.82687	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75295	0.3830	M	0.88241	2.94	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.79943	-0.1590	10	0.87932	D	0	-15.9053	19.531	0.95230	0.0:1.0:0.0:0.0	.	145	Q16659	MK06_HUMAN	C	145	ENSP00000261845:S145C	ENSP00000261845:S145C	S	+	2	0	MAPK6	50126383	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.815000	0.86186	2.636000	0.89361	0.650000	0.86243	TCT		0.468	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254841.2	NM_002748		71	96	0	0	0	0	71	96				
ABCA3	21	broad.mit.edu	37	16	2376444	2376444	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr16:2376444C>T	ENST00000301732.5	-	4	724	c.24G>A	c.(22-24)gcG>gcA	p.A8A	ABCA3_ENST00000382381.3_Silent_p.A8A|ABCA3_ENST00000567910.1_Silent_p.A8A	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	8					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	AGAGGAGGAGCGCCAGCTGCC	0.602																																						uc002cpy.1		NA																	0				breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16						c.(22-24)GCG>GCA		ATP-binding cassette, sub-family A member 3							50.0	44.0	46.0					16																	2376444		2198	4300	6498	SO:0001819	synonymous_variant	21				response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:2376444C>T	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.24G>A	16.37:g.2376444C>T			Somatic				ABCA3_uc010bsk.1_Silent_p.A8A|ABCA3_uc010bsl.1_Silent_p.A8A|ABCA3_uc002cpz.1_Silent_p.A8A	p.A8A	NM_001089	NP_001080	WXS	Illumina HiSeq	Unspecified	Q99758	ABCA3_HUMAN			4	736	-		Ovarian(90;0.17)	8					B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	ENST00000301732.5	37	c.24G>A	CCDS10466.1																																																																																				0.602	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089		15	37	0	0	0	0	15	37				
TOX3	27324	broad.mit.edu	37	16	52497888	52497888	+	Silent	SNP	G	G	A	rs147213203	byFrequency	TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr16:52497888G>A	ENST00000219746.9	-	3	650	c.366C>T	c.(364-366)ctC>ctT	p.L122L	TOX3_ENST00000407228.3_Silent_p.L117L	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	122					apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						CTTGTTCCACGAGATTTCTTG	0.433													G|||	8	0.00159744	0.0061	0.0	5008	,	,		19812	0.0		0.0	False		,,,				2504	0.0					uc002egw.2		NA																	0					0						c.(364-366)CTC>CTT		TOX high mobility group box family member 3		G	,	17,3813		0,17,1898	83.0	89.0	87.0		366,351	-3.2	1.0	16	dbSNP_134	87	0,8258		0,0,4129	no	coding-synonymous,coding-synonymous	TOX3	NM_001080430.2,NM_001146188.1	,	0,17,6027	AA,AG,GG		0.0,0.4439,0.1406	,	122/577,117/572	52497888	17,12071	1915	4129	6044	SO:0001819	synonymous_variant	27324				apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity	g.chr16:52497888G>A	U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.366C>T	16.37:g.52497888G>A			Somatic				TOX3_uc010vgt.1_Silent_p.L117L|TOX3_uc010vgu.1_Silent_p.L122L	p.L122L	NM_001080430	NP_001073899	WXS	Illumina HiSeq	Unspecified	O15405	TOX3_HUMAN			3	537	-			122					B4DRD0|B5MCW4	Silent	SNP	ENST00000219746.9	37	c.366C>T	CCDS54009.1																																																																																				0.433	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000422534.1	XM_049037		58	118	0	0	0	0	58	118				
HYDIN	54768	broad.mit.edu	37	16	70913521	70913521	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr16:70913521C>G	ENST00000393567.2	-	61	10504	c.10354G>C	c.(10354-10356)Gat>Cat	p.D3452H		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3452					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGCAAGCCATCCAAGGTAGCC	0.577																																						uc002ezr.2		NA																	0				ovary(1)|skin(1)	2						c.(10351-10353)GAT>CAT		hydrocephalus inducing isoform a							51.0	56.0	54.0					16																	70913521		1967	4174	6141	SO:0001583	missense	54768							g.chr16:70913521C>G	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.10354G>C	16.37:g.70913521C>G	ENSP00000377197:p.Asp3452His		Somatic					p.D3451H	NM_032821	NP_116210	WXS	Illumina HiSeq	Unspecified	Q4G0P3	HYDIN_HUMAN			61	10479	-		Ovarian(137;0.0654)	3452					A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	c.10351G>C	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.026817	0.75390	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00976	5.48	5.19	5.19	0.71726	.	0.226115	0.21308	U	0.076691	T	0.02888	0.0086	L	0.60455	1.87	0.80722	D	1	P	0.42337	0.776	P	0.49451	0.611	T	0.64283	-0.6444	10	0.36615	T	0.2	.	18.3269	0.90258	0.0:1.0:0.0:0.0	.	3451	F8WD23	.	H	3452;3451	ENSP00000377197:D3452H	ENSP00000313052:D3451H	D	-	1	0	HYDIN	69471022	1.000000	0.71417	0.995000	0.50966	0.962000	0.63368	5.332000	0.65911	2.413000	0.81919	0.511000	0.50034	GAT		0.577	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			18	83	0	0	0	0	18	83				
CBFA2T3	863	broad.mit.edu	37	16	88968004	88968004	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr16:88968004G>A	ENST00000268679.4	-	2	608	c.212C>T	c.(211-213)aCg>aTg	p.T71M	CBFA2T3_ENST00000327483.5_Missense_Mutation_p.T10M|CBFA2T3_ENST00000360302.2_Missense_Mutation_p.T10M|CBFA2T3_ENST00000448839.1_Intron|CBFA2T3_ENST00000436887.2_Missense_Mutation_p.T71M	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	71	Mediates interaction with PDE7A (in isoform 2).|Mediates localization to the nucleus. {ECO:0000250}.|Pro-rich.|Required for nucleolar targeting (in isoform 1).				cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CCGGGGCTGCGTCTTCACCTC	0.667			T	RUNX1	AML																																	uc002fmm.1		NA		Dom	yes		16	16q24	863	T	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""			L	RUNX1		AML		0				large_intestine(3)|ovary(1)	4						c.(211-213)ACG>ATG		myeloid translocation gene on chromosome 16																																				SO:0001583	missense	863				cell proliferation|granulocyte differentiation	Golgi membrane|nucleolus|nucleoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:88968004G>A	AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.212C>T	16.37:g.88968004G>A	ENSP00000268679:p.Thr71Met		Somatic				CBFA2T3_uc002fml.1_Missense_Mutation_p.T10M|CBFA2T3_uc010cif.1_Missense_Mutation_p.T10M|CBFA2T3_uc002fmn.1_Missense_Mutation_p.T71M	p.T71M	NM_005187	NP_005178	WXS	Illumina HiSeq	Unspecified	O75081	MTG16_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0275)	2	398	-			71			Mediates localization to the nucleus (By similarity).|Pro-rich.|Mediates interaction with PDE7A (in isoform 2).|Required for nucleolar targeting (in isoform 1).		D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Missense_Mutation	SNP	ENST00000268679.4	37	c.212C>T	CCDS10972.1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.645761	0.29246	.	.	ENSG00000129993	ENST00000327483;ENST00000268679;ENST00000436887;ENST00000360302	T;T;T;T	0.53423	1.33;0.62;0.64;1.33	3.95	2.98	0.34508	.	0.116319	0.56097	D	0.000023	T	0.57169	0.2035	L	0.47190	1.495	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;0.999;0.996	P;D;P;D	0.66497	0.828;0.944;0.902;0.919	T	0.58160	-0.7685	10	0.66056	D	0.02	1.7004	11.2436	0.48982	0.0931:0.0:0.9069:0.0	.	71;71;71;10	E7EU24;B2RBQ7;O75081;O75081-2	.;.;MTG16_HUMAN;.	M	10;71;71;10	ENSP00000332122:T10M;ENSP00000268679:T71M;ENSP00000395739:T71M;ENSP00000353449:T10M	ENSP00000268679:T71M	T	-	2	0	CBFA2T3	87495505	0.996000	0.38824	0.998000	0.56505	0.180000	0.23129	2.238000	0.43070	0.774000	0.33427	0.491000	0.48974	ACG		0.667	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269545.2	NM_005187		23	46	0	0	0	0	23	46				
TP53	7157	broad.mit.edu	37	17	7577570	7577570	+	Missense_Mutation	SNP	C	C	T	rs587782664		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr17:7577570C>T	ENST00000269305.4	-	7	900	c.711G>A	c.(709-711)atG>atA	p.M237I	TP53_ENST00000413465.2_Missense_Mutation_p.M237I|TP53_ENST00000455263.2_Missense_Mutation_p.M237I|TP53_ENST00000359597.4_Missense_Mutation_p.M237I|TP53_ENST00000445888.2_Missense_Mutation_p.M237I|TP53_ENST00000420246.2_Missense_Mutation_p.M237I|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	237	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		M -> I (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.M237I(109)|p.0?(8)|p.?(5)|p.M144I(4)|p.M237_N239delMCN(4)|p.Y236_M237delYM(1)|p.H233fs*6(1)|p.M144_N146delMCN(1)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.H233_C242del10(1)|p.M237fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACTGTTACACATGTAGTTGT	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		139	Substitution - Missense(113)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)|Insertion - In frame(1)	p.M237I(99)|p.M237K(8)|p.0?(7)|p.M237V(6)|p.M237fs*10(4)|p.M237R(3)|p.M237T(2)|p.M237L(2)|p.Y236_M237delYM(1)|p.Y236_M237insXX(1)|p.M237_N239delMCN(1)|p.H233fs*6(1)|p.M144I(1)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.Y236_M237>*L(1)|p.H233_C242del10(1)|p.M237fs*1(1)	upper_aerodigestive_tract(23)|ovary(22)|lung(18)|breast(18)|central_nervous_system(11)|haematopoietic_and_lymphoid_tissue(9)|large_intestine(9)|stomach(6)|biliary_tract(5)|bone(5)|oesophagus(4)|urinary_tract(3)|pancreas(2)|thyroid(1)|testis(1)|soft_tissue(1)|liver(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM011014	TP53	M		c.(709-711)ATG>ATA	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							130.0	102.0	112.0					17																	7577570		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577570C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.711G>A	17.37:g.7577570C>T	ENSP00000269305:p.Met237Ile	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)	Somatic				TP53_uc002gig.1_Missense_Mutation_p.M237I|TP53_uc002gih.2_Missense_Mutation_p.M237I|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.M105I|TP53_uc010cng.1_Missense_Mutation_p.M105I|TP53_uc002gii.1_Missense_Mutation_p.M105I|TP53_uc010cnh.1_Missense_Mutation_p.M237I|TP53_uc010cni.1_Missense_Mutation_p.M237I|TP53_uc002gij.2_Missense_Mutation_p.M237I|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.M144I|TP53_uc002gio.2_Missense_Mutation_p.M105I	p.M237I	NM_001126112	NP_001119584	WXS	Illumina HiSeq	Unspecified	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	7	905	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	237		M -> L (in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> I (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.711G>A	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.343240	0.82022	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99793	-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77	4.09	3.12	0.35913	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	M	0.86953	2.85	0.54753	D	0.999983	D;D;D;D;D;D	0.89917	1.0;0.975;0.999;1.0;0.998;1.0	D;P;D;D;D;D	0.91635	0.999;0.864;0.999;0.999;0.999;0.998	D	0.97922	1.0315	10	0.72032	D	0.01	-32.6033	10.0519	0.42221	0.0:0.8993:0.0:0.1007	.	237;237;144;237;237;237	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	I	237;237;237;237;237;237;226;144;105;144	ENSP00000410739:M237I;ENSP00000352610:M237I;ENSP00000269305:M237I;ENSP00000398846:M237I;ENSP00000391127:M237I;ENSP00000391478:M237I;ENSP00000425104:M105I;ENSP00000423862:M144I	ENSP00000269305:M237I	M	-	3	0	TP53	7518295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	1.305000	0.44909	0.462000	0.41574	ATG		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		18	21	0	0	0	0	18	21				
MYO18A	399687	broad.mit.edu	37	17	27493807	27493807	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr17:27493807G>A	ENST00000527372.1	-	2	332	c.152C>T	c.(151-153)tCc>tTc	p.S51F	MYO18A_ENST00000533112.1_Missense_Mutation_p.S51F|MYO18A_ENST00000354329.4_Missense_Mutation_p.S51F|MYO18A_ENST00000531253.1_Missense_Mutation_p.S51F	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	51	Mediates nucleotide-independent binding to F-actin and interaction with GOLPH3.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			ACGCTTGGAGGAGCGGTTCAG	0.567																																					Esophageal Squamous(182;472 2015 7001 15270 22562)	uc002hdt.1		NA																	0					0						c.(151-153)TCC>TTC		myosin 18A isoform a							45.0	54.0	51.0					17																	27493807		2167	4276	6443	SO:0001583	missense	399687				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity	g.chr17:27493807G>A	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.152C>T	17.37:g.27493807G>A	ENSP00000437073:p.Ser51Phe		Somatic				MYO18A_uc010csa.1_Missense_Mutation_p.S51F|MYO18A_uc002hdu.1_Missense_Mutation_p.S51F	p.S51F	NM_078471	NP_510880	WXS	Illumina HiSeq	Unspecified	Q92614	MY18A_HUMAN	Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)		2	310	-			51					Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	c.152C>T	CCDS45642.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098675	0.56183	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372	D;D;D;D	0.88896	-2.32;-2.44;-2.32;-2.32	4.94	3.98	0.46160	.	0.587506	0.18393	N	0.142603	D	0.87454	0.6181	N	0.24115	0.695	0.34956	D	0.751681	D;D;P	0.53151	0.958;0.958;0.93	P;P;P	0.54312	0.748;0.748;0.564	D	0.91134	0.4940	10	0.87932	D	0	.	13.3405	0.60542	0.076:0.0:0.924:0.0	.	51;51;51	Q92614-3;Q92614-4;Q92614	.;.;MY18A_HUMAN	F	51	ENSP00000346291:S51F;ENSP00000435932:S51F;ENSP00000434228:S51F;ENSP00000437073:S51F	ENSP00000346291:S51F	S	-	2	0	MYO18A	24517933	1.000000	0.71417	0.998000	0.56505	0.942000	0.58702	2.877000	0.48506	1.325000	0.45301	0.467000	0.42956	TCC		0.567	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471		11	16	0	0	0	0	11	16				
HNF1B	6928	broad.mit.edu	37	17	36064935	36064935	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr17:36064935G>C	ENST00000225893.4	-	6	1689	c.1328C>G	c.(1327-1329)gCa>gGa	p.A443G	HNF1B_ENST00000560016.1_Missense_Mutation_p.A443G|HNF1B_ENST00000561193.1_Missense_Mutation_p.A417G|HNF1B_ENST00000427275.2_Missense_Mutation_p.A417G	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	443					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			TTGTGCAATTGCCATGACTCC	0.463																																					Colon(71;102 1179 9001 27917 43397)	uc002hok.3		NA																	0				ovary(3)	3						c.(1327-1329)GCA>GGA		hepatocyte nuclear factor 1-beta isoform 1							180.0	174.0	176.0					17																	36064935		2203	4300	6503	SO:0001583	missense	6928	Hereditary_Prostate_Cancer			endocrine pancreas development|genitalia development|kidney development|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric nephron tubule development|regulation of pronephros size	nucleus	DNA binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr17:36064935G>C	BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.1328C>G	17.37:g.36064935G>C	ENSP00000225893:p.Ala443Gly		Somatic				HNF1B_uc010wdi.1_Missense_Mutation_p.A417G	p.A443G	NM_000458	NP_000449	WXS	Illumina HiSeq	Unspecified	P35680	HNF1B_HUMAN	STAD - Stomach adenocarcinoma(1;0.0142)		6	1549	-		Breast(25;0.00765)|Ovarian(249;0.15)	443					B4DKM3|E0YMJ9	Missense_Mutation	SNP	ENST00000225893.4	37	c.1328C>G	CCDS11324.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.472964	0.84640	.	.	ENSG00000108753	ENST00000225893;ENST00000427275;ENST00000539087	D;D	0.97850	-4.57;-4.57	5.85	4.87	0.63330	Hepatocyte nuclear factor 1, beta isoform, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98403	0.9469	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	0.995;1.0	D;D	0.87578	0.969;0.998	D	0.98465	1.0598	10	0.28530	T	0.3	-23.9525	16.1951	0.82021	0.0:0.133:0.8669:0.0	.	417;443	E0YMJ6;P35680	.;HNF1B_HUMAN	G	443;417;331	ENSP00000225893:A443G;ENSP00000412212:A417G	ENSP00000225893:A443G	A	-	2	0	HNF1B	33139048	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.869000	0.99810	1.466000	0.48025	0.655000	0.94253	GCA		0.463	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256807.3	NM_000458		56	141	0	0	0	0	56	141				
KRT33B	3884	broad.mit.edu	37	17	39522833	39522833	+	Silent	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr17:39522833G>A	ENST00000251646.3	-	3	526	c.477C>T	c.(475-477)atC>atT	p.I159I		NM_002279.4	NP_002270.1	Q14525	KT33B_HUMAN	keratin 33B	159	Coil 1B.|Rod.				aging (GO:0007568)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(6)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000496)				GCAGGCTGTTGATGTCGGACT	0.562																																						uc002hwl.2		NA																	0					0						c.(475-477)ATC>ATT		type I hair keratin 3B							58.0	59.0	59.0					17																	39522833		2192	4300	6492	SO:0001819	synonymous_variant	3884					intermediate filament	protein binding|structural molecule activity	g.chr17:39522833G>A	X82634	CCDS11389.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131738	ENSG00000131738		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6451	protein-coding gene	gene with protein product	"""hard keratin type I 3II"""	602762	"""keratin, hair, acidic, 3B"""	KRTHA3B		7565656, 16831889	Standard	NM_002279		Approved	Ha-3II	uc002hwl.4	Q14525	OTTHUMG00000133429	ENST00000251646.3:c.477C>T	17.37:g.39522833G>A			Somatic					p.I159I	NM_002279	NP_002270	WXS	Illumina HiSeq	Unspecified	Q14525	KT33B_HUMAN			3	522	-		Breast(137;0.000496)	159			Rod.|Coil 1B.		O76010	Silent	SNP	ENST00000251646.3	37	c.477C>T	CCDS11389.1																																																																																				0.562	KRT33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257292.1	NM_002279		40	82	0	0	0	0	40	82				
PPY	5539	broad.mit.edu	37	17	42018893	42018893	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr17:42018893C>T	ENST00000591228.1	-	2	217	c.130G>A	c.(130-132)Gag>Aag	p.E44K	PPY_ENST00000587006.1_Missense_Mutation_p.E44K|PPY_ENST00000225992.3_Missense_Mutation_p.E44K			P01298	PAHO_HUMAN	pancreatic polypeptide	44					digestion (GO:0007586)|protein secretion (GO:0009306)	extracellular region (GO:0005576)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			large_intestine(2)|lung(1)|skin(1)	4		Breast(137;0.00314)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GCCATCTGCTCTGGTGTGGCA	0.607																																						uc002iep.2		NA																	0					0						c.(130-132)GAG>AAG		pancreatic polypeptide preproprotein							157.0	143.0	148.0					17																	42018893		2203	4300	6503	SO:0001583	missense	5539				digestion|protein secretion	extracellular region	hormone activity	g.chr17:42018893C>T		CCDS11472.1	17q21.31	2013-02-28			ENSG00000108849	ENSG00000108849		"""Endogenous ligands"""	9327	protein-coding gene	gene with protein product	"""pancreatic polypeptide Y"", ""prepro-PP (prepropancreatic polypeptide)"""	167780				3753985	Standard	NM_002722		Approved	PNP	uc002iep.3	P01298		ENST00000591228.1:c.130G>A	17.37:g.42018893C>T	ENSP00000466009:p.Glu44Lys		Somatic					p.E44K	NM_002722	NP_002713	WXS	Illumina HiSeq	Unspecified	P01298	PAHO_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.113)	2	175	-		Breast(137;0.00314)|Prostate(33;0.0724)	44						Missense_Mutation	SNP	ENST00000591228.1	37	c.130G>A	CCDS11472.1	.	.	.	.	.	.	.	.	.	.	C	16.87	3.242220	0.58995	.	.	ENSG00000108849	ENST00000225992	T	0.61627	0.09	4.63	3.63	0.41609	.	0.000000	0.85682	D	0.000000	T	0.61515	0.2353	.	.	.	0.35910	D	0.831045	D	0.53312	0.959	P	0.50590	0.645	T	0.72010	-0.4419	9	0.59425	D	0.04	-8.5003	10.6581	0.45686	0.0:0.8057:0.1943:0.0	.	44	P01298	PAHO_HUMAN	K	44	ENSP00000225992:E44K	ENSP00000225992:E44K	E	-	1	0	PPY	39374419	0.905000	0.30787	0.875000	0.34327	0.972000	0.66771	1.455000	0.35190	1.267000	0.44247	0.561000	0.74099	GAG		0.607	PPY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457656.1	NM_002722		44	107	0	0	0	0	44	107				
SCN4A	6329	broad.mit.edu	37	17	62034533	62034533	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr17:62034533C>T	ENST00000435607.1	-	13	2441	c.2365G>A	c.(2365-2367)Ggc>Agc	p.G789S	SCN4A_ENST00000578147.1_Missense_Mutation_p.G789S	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	789					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACAAGATTGCCGATGACCATG	0.582																																						uc002jds.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(2365-2367)GGC>AGC		voltage-gated sodium channel type 4 alpha	Lamotrigine(DB00555)						41.0	41.0	41.0					17																	62034533		2201	4300	6501	SO:0001583	missense	6329				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr17:62034533C>T	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.2365G>A	17.37:g.62034533C>T	ENSP00000396320:p.Gly789Ser		Somatic					p.G789S	NM_000334	NP_000325	WXS	Illumina HiSeq	Unspecified	P35499	SCN4A_HUMAN			13	2442	-			789			II.|Helical; Name=S6 of repeat II; (Potential).		Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	c.2365G>A	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.839909	0.91117	.	.	ENSG00000007314	ENST00000435607	D	0.98792	-5.14	3.91	3.91	0.45181	Ion transport (1);	0.107035	0.64402	D	0.000006	D	0.98927	0.9636	M	0.78223	2.4	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	D	0.99327	1.0908	10	0.87932	D	0	.	15.018	0.71600	0.0:1.0:0.0:0.0	.	789	P35499	SCN4A_HUMAN	S	789	ENSP00000396320:G789S	ENSP00000396320:G789S	G	-	1	0	SCN4A	59388265	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.609000	0.82925	2.180000	0.69256	0.561000	0.74099	GGC		0.582	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334		17	43	0	0	0	0	17	43				
FBF1	85302	broad.mit.edu	37	17	73915956	73915956	+	Splice_Site	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr17:73915956C>T	ENST00000586717.1	-	19	2163		c.e19-1		FBF1_ENST00000319129.5_Splice_Site|FBF1_ENST00000389570.4_Splice_Site			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1						apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						GATGCGGCTTCTGCCAACAGA	0.602																																						uc002jqc.2		NA																	0					0						c.e19-1		Fas (TNFRSF6) binding factor 1							74.0	74.0	74.0					17																	73915956		2013	4181	6194	SO:0001630	splice_region_variant	85302							g.chr17:73915956C>T	AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.1890-1G>A	17.37:g.73915956C>T			Somatic				FBF1_uc002jqa.1_Splice_Site|FBF1_uc010wsp.1_Splice_Site_p.R620_splice|FBF1_uc002jqd.1_Splice_Site_p.R630_splice|FBF1_uc002jqb.2_Splice_Site|FBF1_uc010dgr.1_Splice_Site	p.R629_splice	NM_001080542	NP_001074011	WXS	Illumina HiSeq	Unspecified	Q8TES7	FBF1_HUMAN			19	2161	-								B5MEM5|Q96IF6|Q96JG4|Q96MA8	Splice_Site	SNP	ENST00000586717.1	37	c.1887_splice		.	.	.	.	.	.	.	.	.	.	C	15.20	2.762497	0.49574	.	.	ENSG00000188878	ENST00000337792;ENST00000389570;ENST00000319129;ENST00000427433	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2267	0.89920	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FBF1	71427551	1.000000	0.71417	0.999000	0.59377	0.230000	0.25150	4.962000	0.63687	2.409000	0.81822	0.655000	0.94253	.		0.602	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000448945.2	NM_001080542	Intron	37	57	0	0	0	0	37	57				
AANAT	15	broad.mit.edu	37	17	74465350	74465350	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr17:74465350G>A	ENST00000392492.3	+	3	493	c.259G>A	c.(259-261)Gag>Aag	p.E87K	AANAT_ENST00000250615.3_Missense_Mutation_p.E132K	NM_001088.2	NP_001079.1	Q16613	SNAT_HUMAN	aralkylamine N-acetyltransferase	87	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|N-terminal protein amino acid acetylation (GO:0006474)|response to calcium ion (GO:0051592)|response to copper ion (GO:0046688)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to insulin (GO:0032868)|response to light stimulus (GO:0009416)|response to prostaglandin E (GO:0034695)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	aralkylamine N-acetyltransferase activity (GO:0004059)|arylamine N-acetyltransferase activity (GO:0004060)			lung(1)	1						CTGGTTCGAGGAGGGCTGCCT	0.627																																						uc002jro.2		NA																	0					0						c.(259-261)GAG>AAG		arylalkylamine N-acetyltransferase							139.0	140.0	139.0					17																	74465350		2203	4300	6503	SO:0001583	missense	15				circadian rhythm|melatonin biosynthetic process	cytosol	aralkylamine N-acetyltransferase activity	g.chr17:74465350G>A	U40347	CCDS11745.1, CCDS54169.1	17q25.1	2013-10-15	2010-05-07		ENSG00000129673	ENSG00000129673	2.3.1.87		19	protein-coding gene	gene with protein product	"""serotonin N-acetyltransferase"""	600950	"""arylalkylamine N-acetyltransferase"""			8661026	Standard	NM_001088		Approved	SNAT	uc002jro.3	Q16613	OTTHUMG00000180179	ENST00000392492.3:c.259G>A	17.37:g.74465350G>A	ENSP00000376282:p.Glu87Lys		Somatic				AANAT_uc010wte.1_RNA	p.E87K	NM_001088	NP_001079	WXS	Illumina HiSeq	Unspecified	Q16613	SNAT_HUMAN			3	493	+			87			N-acetyltransferase.		A0AVF2|J3KMZ5|Q562F4	Missense_Mutation	SNP	ENST00000392492.3	37	c.259G>A	CCDS11745.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707001	0.89018	.	.	ENSG00000129673	ENST00000250615;ENST00000392492	T;T	0.23147	1.92;1.92	4.98	3.94	0.45596	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.100156	0.64402	D	0.000002	T	0.45875	0.1364	M	0.65498	2.005	0.80722	D	1	D	0.67145	0.996	D	0.66847	0.947	T	0.35301	-0.9794	10	0.34782	T	0.22	-4.4293	14.7516	0.69530	0.0:0.1452:0.8548:0.0	.	87	Q16613	SNAT_HUMAN	K	132;87	ENSP00000250615:E132K;ENSP00000376282:E87K	ENSP00000250615:E132K	E	+	1	0	AANAT	71976945	1.000000	0.71417	0.994000	0.49952	0.768000	0.43524	6.082000	0.71318	2.302000	0.77476	0.462000	0.41574	GAG		0.627	AANAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450130.1	NM_001088		113	232	0	0	0	0	113	232				
SYNGR2	9144	broad.mit.edu	37	17	76167595	76167595	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr17:76167595C>T	ENST00000225777.3	+	3	401	c.342C>T	c.(340-342)ctC>ctT	p.L114L	SYNGR2_ENST00000590201.1_Silent_p.L58L|SYNGR2_ENST00000588282.1_Silent_p.L114L|SYNGR2_ENST00000592456.1_3'UTR|SYNGR2_ENST00000585591.1_Silent_p.L114L|SYNGR2_ENST00000589711.1_Missense_Mutation_p.S35F			O43760	SNG2_HUMAN	synaptogyrin 2	114	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				protein targeting (GO:0006605)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)				endometrium(2)|large_intestine(1)|liver(1)|lung(1)|skin(1)|urinary_tract(1)	7			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.0994)			CCCCAGCTCTCTGGACCTTCC	0.637																																						uc002juu.1		NA																	0					0						c.(340-342)CTC>CTT		synaptogyrin 2							80.0	62.0	68.0					17																	76167595		2203	4300	6503	SO:0001819	synonymous_variant	9144					integral to plasma membrane		g.chr17:76167595C>T	AJ002308	CCDS11753.1	17q25.3	2014-09-11			ENSG00000108639	ENSG00000108639			11499	protein-coding gene	gene with protein product	"""cellugyrin"""	603926				9760194	Standard	NM_004710		Approved		uc002juu.1	O43760	OTTHUMG00000177457	ENST00000225777.3:c.342C>T	17.37:g.76167595C>T			Somatic				SYNGR2_uc002jut.2_Silent_p.L114L|SYNGR2_uc002juv.1_Intron|SYNGR2_uc010dhi.1_RNA	p.L114L	NM_004710	NP_004701	WXS	Illumina HiSeq	Unspecified	O43760	SNG2_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.0994)		3	369	+			114			MARVEL.|Helical; (Potential).		O43762|Q3KQZ2|Q658S7	Silent	SNP	ENST00000225777.3	37	c.342C>T	CCDS11753.1																																																																																				0.637	SYNGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437009.2			34	71	0	0	0	0	34	71				
SPIRE1	56907	broad.mit.edu	37	18	12453101	12453101	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr18:12453101A>G	ENST00000409402.4	-	14	2080	c.1813T>C	c.(1813-1815)Ttc>Ctc	p.F605L	SPIRE1_ENST00000410092.3_Missense_Mutation_p.F591L|SPIRE1_ENST00000453447.2_Missense_Mutation_p.F471L|SPIRE1_ENST00000464481.1_5'UTR|SPIRE1_ENST00000309836.5_Missense_Mutation_p.F394L|SPIRE1_ENST00000383356.2_Missense_Mutation_p.F432L	NM_001128626.1	NP_001122098.1			spire-type actin nucleation factor 1											breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)	28						GACCAAGTGAAGAAGGAAAAC	0.328																																						uc002kre.2		NA																	0					0						c.(1813-1815)TTC>CTC		spire homolog 1 isoform a							61.0	63.0	62.0					18																	12453101		2203	4300	6503	SO:0001583	missense	56907					cytoskeleton|perinuclear region of cytoplasm	actin binding	g.chr18:12453101A>G	AL833817	CCDS32790.2, CCDS45829.1, CCDS45830.1	18p11.21	2013-08-27	2013-08-27		ENSG00000134278	ENSG00000134278			30622	protein-coding gene	gene with protein product		609216	"""spire homolog 1 (Drosophila)"", ""spire family actin nucleation factor 1"""			10574461, 11747823	Standard	NM_001128626		Approved	spir-1, KIAA1135	uc002kre.3	Q08AE8	OTTHUMG00000153940	ENST00000409402.4:c.1813T>C	18.37:g.12453101A>G	ENSP00000387266:p.Phe605Leu		Somatic				SPIRE1_uc002krc.2_RNA|SPIRE1_uc010wzw.1_Missense_Mutation_p.F471L|SPIRE1_uc010wzx.1_Missense_Mutation_p.F394L|SPIRE1_uc010wzy.1_Missense_Mutation_p.F591L	p.F605L	NM_001128626	NP_001122098	WXS	Illumina HiSeq	Unspecified	Q08AE8	SPIR1_HUMAN			14	1860	-			605						Missense_Mutation	SNP	ENST00000409402.4	37	c.1813T>C	CCDS45829.1	.	.	.	.	.	.	.	.	.	.	A	35	5.413643	0.96072	.	.	ENSG00000134278	ENST00000453447;ENST00000409402;ENST00000410092;ENST00000309836;ENST00000383356	T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92	5.95	5.95	0.96441	Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.85665	0.5749	M	0.75777	2.31	0.80722	D	1	P;D;P	0.89917	0.676;1.0;0.907	P;D;P	0.76071	0.45;0.987;0.797	D	0.85458	0.1165	10	0.42905	T	0.14	-15.5914	16.4177	0.83748	1.0:0.0:0.0:0.0	.	591;394;605	Q08AE8-2;B4DWX0;Q08AE8	.;.;SPIR1_HUMAN	L	471;605;591;394;432	ENSP00000407050:F471L;ENSP00000387266:F605L;ENSP00000387226:F591L;ENSP00000309661:F394L;ENSP00000372847:F432L	ENSP00000309661:F394L	F	-	1	0	SPIRE1	12443101	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.654000	0.91092	2.267000	0.75376	0.528000	0.53228	TTC		0.328	SPIRE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333109.2	XM_290818		4	79	0	0	0	0	4	79				
NETO1	81832	broad.mit.edu	37	18	70461640	70461640	+	Splice_Site	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr18:70461640C>G	ENST00000327305.6	-	5	1127		c.e5-1		NETO1_ENST00000299430.2_Splice_Site|NETO1_ENST00000583169.1_Splice_Site	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1						memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		AAGTCAGGATCTTAAAAATTG	0.294																																						uc002lkw.2		NA																	0				ovary(2)|skin(2)	4						c.e5-1		neuropilin- and tolloid-like protein 1 isoform 3							71.0	78.0	76.0					18																	70461640		2203	4299	6502	SO:0001630	splice_region_variant	81832				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity	g.chr18:70461640C>G	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.470-1G>C	18.37:g.70461640C>G			Somatic				NETO1_uc002lkx.1_Splice_Site_p.D156_splice|NETO1_uc002lky.1_Splice_Site_p.D157_splice	p.D157_splice	NM_138966	NP_620416	WXS	Illumina HiSeq	Unspecified	Q8TDF5	NETO1_HUMAN		READ - Rectum adenocarcinoma(1;0.0487)	5	754	-		Esophageal squamous(42;0.129)						Q86W85|Q8ND78|Q8TDF4	Splice_Site	SNP	ENST00000327305.6	37	c.470_splice	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.321849	0.81580	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6103	0.95602	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NETO1	68612620	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.998000	0.76277	2.629000	0.89072	0.655000	0.94253	.		0.294	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999	Intron	82	61	0	0	0	0	82	61				
FBXO15	201456	broad.mit.edu	37	18	71797839	71797839	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr18:71797839C>T	ENST00000419743.2	-	4	466	c.387G>A	c.(385-387)tgG>tgA	p.W129*	FBXO15_ENST00000269500.5_Nonsense_Mutation_p.W53*	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	129						SCF ubiquitin ligase complex (GO:0019005)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		AATTAAATTTCCAATTTGATC	0.348																																						uc002lle.2		NA																	0				ovary(2)|pancreas(1)	3						c.(157-159)TGG>TGA		F-box protein 15 isoform 1							84.0	83.0	83.0					18																	71797839		2203	4300	6503	SO:0001587	stop_gained	201456							g.chr18:71797839C>T	AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.387G>A	18.37:g.71797839C>T	ENSP00000393154:p.Trp129*		Somatic				FBXO15_uc002llf.2_Nonsense_Mutation_p.W129*	p.W53*	NM_152676	NP_689889	WXS	Illumina HiSeq	Unspecified	Q8NCQ5	FBX15_HUMAN		BRCA - Breast invasive adenocarcinoma(31;0.143)	4	495	-		Esophageal squamous(42;0.103)|Prostate(75;0.173)	53					B3KST3	Nonsense_Mutation	SNP	ENST00000419743.2	37	c.159G>A	CCDS45884.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.576535	0.28092	.	.	ENSG00000141665	ENST00000269500;ENST00000419743	.	.	.	5.37	5.37	0.77165	.	0.167388	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.2775	17.875	0.88822	0.0:1.0:0.0:0.0	.	.	.	.	X	53;129	.	ENSP00000269500:W53X	W	-	3	0	FBXO15	69948819	0.997000	0.39634	0.399000	0.26333	0.016000	0.09150	3.691000	0.54720	2.535000	0.85469	0.655000	0.94253	TGG		0.348	FBXO15-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000444223.1	NM_152676		4	40	0	0	0	0	4	40				
TICAM1	148022	broad.mit.edu	37	19	4817884	4817884	+	Nonsense_Mutation	SNP	G	G	T	rs373468408		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:4817884G>T	ENST00000248244.5	-	2	735	c.506C>A	c.(505-507)tCg>tAg	p.S169*		NM_182919.3	NP_891549.1	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	169					apoptotic signaling pathway (GO:0097190)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of protein homodimerization activity (GO:0043496)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|ripoptosome (GO:0097342)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		GGGCAAAGCCGAGGATGGTGG	0.652																																						uc002mbi.2		NA																	0				breast(1)	1						c.(505-507)TCG>TAG		toll-like receptor adaptor molecule 1							91.0	91.0	91.0					19																	4817884		2203	4300	6503	SO:0001587	stop_gained	148022				apoptosis|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein kinase binding|signal transducer activity	g.chr19:4817884G>T	AB086380	CCDS12136.1	19p13.3	2014-09-17				ENSG00000127666			18348	protein-coding gene	gene with protein product		607601				12539043, 12471095	Standard	NM_182919		Approved	TRIF, TICAM-1, MGC35334, PRVTIRB	uc002mbi.4	Q8IUC6		ENST00000248244.5:c.506C>A	19.37:g.4817884G>T	ENSP00000248244:p.Ser169*		Somatic					p.S169*	NM_182919	NP_891549	WXS	Illumina HiSeq	Unspecified	Q8IUC6	TCAM1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)	2	757	-			169					B3Y691|O75532|Q86XP8|Q96GA0	Nonsense_Mutation	SNP	ENST00000248244.5	37	c.506C>A	CCDS12136.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873788	0.91664	.	.	ENSG00000127666	ENST00000248244	.	.	.	4.66	1.05	0.20165	.	0.300009	0.18228	U	0.147646	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.581	3.5491	0.07839	0.2139:0.0:0.588:0.1981	.	.	.	.	X	169	.	ENSP00000248244:S169X	S	-	2	0	TICAM1	4768884	0.595000	0.26857	0.008000	0.14137	0.021000	0.10359	2.781000	0.47750	0.493000	0.27837	0.305000	0.20034	TCG		0.652	TICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450435.1	NM_014261		7	176	1	0	0.00198382	0.00207322	7	176				
KANK2	25959	broad.mit.edu	37	19	11283762	11283762	+	Silent	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:11283762G>A	ENST00000586659.1	-	10	2420	c.2106C>T	c.(2104-2106)taC>taT	p.Y702Y	KANK2_ENST00000432929.2_Silent_p.Y710Y|KANK2_ENST00000355150.5_Silent_p.Y702Y|KANK2_ENST00000589359.1_Silent_p.Y710Y|KANK2_ENST00000589894.1_Silent_p.Y702Y|KANK2_ENST00000587317.1_5'Flank			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	702	Interaction with NCOA1.				apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TAATAGGGCTGTAGCCAGCAC	0.567																																						uc010dxv.2		NA																	0					0						c.(2104-2106)TAC>TAT		ankyrin repeat domain 25 isoform 1							154.0	123.0	133.0					19																	11283762		2203	4300	6503	SO:0001819	synonymous_variant	25959							g.chr19:11283762G>A	AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.2106C>T	19.37:g.11283762G>A			Somatic				KANK2_uc002mqm.2_Silent_p.Y710Y|KANK2_uc002mqo.3_Silent_p.Y702Y|KANK2_uc002mqp.1_Silent_p.Y511Y	p.Y702Y	NM_015493	NP_056308	WXS	Illumina HiSeq	Unspecified	Q63ZY3	KANK2_HUMAN			12	2664	-			702			ANK 2.		B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Silent	SNP	ENST00000586659.1	37	c.2106C>T	CCDS12255.1																																																																																				0.567	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453066.2	NM_015493		77	110	0	0	0	0	77	110				
MAST1	22983	broad.mit.edu	37	19	12976159	12976159	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:12976159C>T	ENST00000251472.4	+	15	1707	c.1668C>T	c.(1666-1668)ccC>ccT	p.P556P		NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						ACATCGCGCCCGAGGTCATCC	0.657																																						uc002mvm.2		NA																	0				ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						c.(1666-1668)CCC>CCT		microtubule associated serine/threonine kinase							70.0	67.0	68.0					19																	12976159		2203	4300	6503	SO:0001819	synonymous_variant	22983				cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:12976159C>T	AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.1668C>T	19.37:g.12976159C>T			Somatic					p.P556P	NM_014975	NP_055790	WXS	Illumina HiSeq	Unspecified	Q9Y2H9	MAST1_HUMAN			15	1796	+			556			Protein kinase.			Silent	SNP	ENST00000251472.4	37	c.1668C>T	CCDS32921.1																																																																																				0.657	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2	NM_014975		64	76	0	0	0	0	64	76				
ZNF253	56242	broad.mit.edu	37	19	20003119	20003119	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:20003119C>T	ENST00000589717.1	+	4	1155	c.1063C>T	c.(1063-1065)Ctt>Ttt	p.L355F	CTC-559E9.8_ENST00000585571.1_RNA|ZNF253_ENST00000355650.4_Missense_Mutation_p.L279F|AC011477.1_ENST00000578823.1_RNA	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	355				Missing (in Ref. 1; AAC26844). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATCCTCACACCTTACTACACA	0.388																																						uc002noj.2		NA																	0					0						c.(1063-1065)CTT>TTT		zinc finger protein 253							45.0	48.0	47.0					19																	20003119		2179	4278	6457	SO:0001583	missense	56242				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:20003119C>T	AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.1063C>T	19.37:g.20003119C>T	ENSP00000468720:p.Leu355Phe		Somatic				ZNF253_uc002nok.2_Missense_Mutation_p.L279F|ZNF253_uc002nol.2_RNA	p.L355F	NM_021047	NP_066385	WXS	Illumina HiSeq	Unspecified	O75346	ZN253_HUMAN			4	1155	+			355	Missing (in Ref. 1; AAC26844).		C2H2-type 7.		A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Missense_Mutation	SNP	ENST00000589717.1	37	c.1063C>T	CCDS42532.1	.	.	.	.	.	.	.	.	.	.	c	10.78	1.446628	0.25987	.	.	ENSG00000256771	ENST00000355650	.	.	.	0.876	0.876	0.19138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.53318	0.1789	L	0.53249	1.67	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.35919	-0.9769	7	.	.	.	.	7.1488	0.25597	0.0:1.0:0.0:0.0	.	355	O75346	ZN253_HUMAN	F	355	.	.	L	+	1	0	ZNF253	19864119	0.000000	0.05858	0.009000	0.14445	0.009000	0.06853	0.318000	0.19504	0.293000	0.22520	0.298000	0.19748	CTT		0.388	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460802.1	NM_021047		41	45	0	0	0	0	41	45				
ZNF714	148206	broad.mit.edu	37	19	21300358	21300358	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:21300358C>T	ENST00000596143.1	+	5	1213	c.888C>T	c.(886-888)ttC>ttT	p.F296F	ZNF714_ENST00000291770.7_3'UTR|ZNF714_ENST00000596053.1_Intron|ZNF714_ENST00000601416.1_3'UTR	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	296					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						TTAACCGATTCTCATACCTTA	0.348																																						uc002npo.3		NA																	0					0						c.(889-891)TTC>TTT		zinc finger protein 714							23.0	25.0	24.0					19																	21300358		2181	4292	6473	SO:0001819	synonymous_variant	148206				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:21300358C>T	AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.888C>T	19.37:g.21300358C>T			Somatic				ZNF714_uc002npl.2_Silent_p.F142F|ZNF714_uc010ecp.1_Silent_p.F248F|ZNF714_uc002npn.2_RNA	p.F297F	NM_182515	NP_872321	WXS	Illumina HiSeq	Unspecified	Q96N38	ZN714_HUMAN			6	1251	+			297			C2H2-type 7.		Q49AI1|Q86W65|Q8ND40	Silent	SNP	ENST00000596143.1	37	c.891C>T	CCDS54239.1																																																																																				0.348	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463930.1	NM_182515		3	17	0	0	0	0	3	17				
ZNF208	7757	broad.mit.edu	37	19	22170088	22170088	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:22170088C>T	ENST00000397126.4	-	3	304	c.156G>A	c.(154-156)ctG>ctA	p.L52L	ZNF208_ENST00000597040.1_Silent_p.L20L|ZNF208_ENST00000601773.1_Silent_p.L52L|ZNF208_ENST00000599916.1_Silent_p.L52L	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	52	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GAAAAATGATCAGGTCTGGCT	0.398																																						uc002nqp.2		NA																	0				ovary(5)|skin(2)	7						c.(154-156)CTG>CTA		zinc finger protein 208							71.0	73.0	72.0					19																	22170088		2194	4297	6491	SO:0001819	synonymous_variant	7757							g.chr19:22170088C>T	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.156G>A	19.37:g.22170088C>T			Somatic				ZNF208_uc002nqo.1_Silent_p.L52L|ZNF208_uc002nqq.2_RNA	p.L52L	NM_007153	NP_009084	WXS	Illumina HiSeq	Unspecified					3	305	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Silent	SNP	ENST00000397126.4	37	c.156G>A	CCDS54240.1																																																																																				0.398	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153		29	69	0	0	0	0	29	69				
ZNF780A	284323	broad.mit.edu	37	19	40580552	40580552	+	Missense_Mutation	SNP	T	T	G	rs200594600		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:40580552T>G	ENST00000595687.2	-	6	2006	c.1797A>C	c.(1795-1797)caA>caC	p.Q599H	ZNF780A_ENST00000455521.1_Missense_Mutation_p.Q600H|AC005614.5_ENST00000595508.1_RNA|ZNF780A_ENST00000414720.2_Intron|ZNF780A_ENST00000340963.5_Missense_Mutation_p.Q599H|ZNF780A_ENST00000450241.2_Missense_Mutation_p.Q565H|ZNF780A_ENST00000594395.1_Missense_Mutation_p.Q600H	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	599					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GTCGAATAAGTTGCATATGAA	0.403																																						uc002omy.2		NA																	0					0						c.(1795-1797)CAA>CAC		zinc finger protein 780A isoform b							144.0	142.0	143.0					19																	40580552		2203	4300	6503	SO:0001583	missense	284323				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:40580552T>G	AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.1797A>C	19.37:g.40580552T>G	ENSP00000472189:p.Gln599His		Somatic				ZNF780A_uc002omw.3_Intron|ZNF780A_uc002omz.2_Missense_Mutation_p.Q599H|ZNF780A_uc010xvh.1_Missense_Mutation_p.Q600H	p.Q599H	NM_001010880	NP_001010880	WXS	Illumina HiSeq	Unspecified	O75290	Z780A_HUMAN			6	2022	-	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)		599			C2H2-type 16.		E9PB48|Q6ZN87	Missense_Mutation	SNP	ENST00000595687.2	37	c.1797A>C	CCDS33026.2	.	.	.	.	.	.	.	.	.	.	t	9.527	1.109847	0.20714	.	.	ENSG00000197782	ENST00000450241;ENST00000455521;ENST00000340963	T;T	0.27402	1.67;1.67	1.93	-1.27	0.09347	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19208	0.0461	N	0.02674	-0.535	0.09310	N	1	B;D	0.69078	0.387;0.997	B;D	0.65684	0.312;0.937	T	0.17715	-1.0360	9	0.08599	T	0.76	.	6.7369	0.23415	0.0:0.0:0.4738:0.5262	.	600;599	E9PB48;O75290	.;Z780A_HUMAN	H	599;600;599	ENSP00000400997:Q600H;ENSP00000341507:Q599H	ENSP00000341507:Q599H	Q	-	3	2	ZNF780A	45272392	0.000000	0.05858	0.004000	0.12327	0.653000	0.38743	-2.502000	0.00965	-0.004000	0.14419	0.260000	0.18958	CAA		0.403	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000470066.1	NM_001010880		4	325	0	0	0	0	4	325				
RELB	5971	broad.mit.edu	37	19	45528913	45528913	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:45528913C>T	ENST00000221452.8	+	7	954	c.804C>T	c.(802-804)atC>atT	p.I268I	RELB_ENST00000505236.1_Silent_p.I265I|RELB_ENST00000540120.1_Silent_p.I268I	NM_006509.3	NP_006500.2	Q01201	RELB_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog B	268	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				antigen processing and presentation (GO:0019882)|circadian regulation of gene expression (GO:0032922)|myeloid dendritic cell differentiation (GO:0043011)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of gene expression (GO:0010628)|T-helper 1 cell differentiation (GO:0045063)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(3)|skin(1)	12		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		TGGTGAGGATCTGCTTCCAGG	0.567																																						uc002paj.1		NA																	0				ovary(1)	1						c.(802-804)ATC>ATT		reticuloendotheliosis viral oncogene homolog B							149.0	147.0	147.0					19																	45528913		2000	4171	6171	SO:0001819	synonymous_variant	5971					nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr19:45528913C>T	M83221	CCDS46110.1	19q13.32	2013-07-09	2013-07-09		ENSG00000104856	ENSG00000104856			9956	protein-coding gene	gene with protein product		604758	"""v-rel avian reticuloendotheliosis viral oncogene homolog B (nuclear factor of kappa light polypeptide gene enhancer in B-cells 3)"""			1531086	Standard	NM_006509		Approved	REL-B	uc021uvp.1	Q01201	OTTHUMG00000162116	ENST00000221452.8:c.804C>T	19.37:g.45528913C>T			Somatic					p.I268I	NM_006509	NP_006500	WXS	Illumina HiSeq	Unspecified	Q01201	RELB_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00986)	8	930	+		Ovarian(192;0.0728)|all_neural(266;0.112)	268			RHD.		Q6GTX7|Q9UEI7	Silent	SNP	ENST00000221452.8	37	c.804C>T	CCDS46110.1																																																																																				0.567	RELB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000367361.2			93	141	0	0	0	0	93	141				
TULP2	7288	broad.mit.edu	37	19	49398650	49398650	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:49398650C>T	ENST00000221399.3	-	5	466	c.322G>A	c.(322-324)Ggc>Agc	p.G108S		NM_003323.2	NP_003314.2	O00295	TULP2_HUMAN	tubby like protein 2	108					visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	protein complex binding (GO:0032403)			NS(1)|breast(2)|central_nervous_system(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	22		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		GTCGGGAGGCCGCGCTCGCCC	0.632																																						uc002pkz.2		NA																	0				ovary(1)|kidney(1)|skin(1)	3						c.(322-324)GGC>AGC		tubby like protein 2							69.0	79.0	75.0					19																	49398650		2203	4300	6503	SO:0001583	missense	7288				visual perception	cytoplasm|extracellular region		g.chr19:49398650C>T	U82469	CCDS12739.1	19q13.1	2009-08-06			ENSG00000104804	ENSG00000104804			12424	protein-coding gene	gene with protein product	"""cancer/testis antigen 65"""	602309				9096357	Standard	NM_003323		Approved	TUBL2, CT65	uc002pkz.2	O00295	OTTHUMG00000164406	ENST00000221399.3:c.322G>A	19.37:g.49398650C>T	ENSP00000221399:p.Gly108Ser		Somatic					p.G108S	NM_003323	NP_003314	WXS	Illumina HiSeq	Unspecified	O00295	TULP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)	5	473	-		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	108					Q8TC50	Missense_Mutation	SNP	ENST00000221399.3	37	c.322G>A	CCDS12739.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.047536	0.36085	.	.	ENSG00000104804	ENST00000221399;ENST00000522945;ENST00000520977;ENST00000522229	D;T;T	0.82081	-1.57;1.48;0.9	4.81	0.0632	0.14347	.	3.479370	0.01209	U	0.007784	T	0.67683	0.2919	N	0.24115	0.695	0.09310	N	1	B	0.31837	0.342	B	0.14578	0.011	T	0.55679	-0.8103	10	0.20046	T	0.44	-0.765	4.295	0.10897	0.1624:0.5534:0.0:0.2841	.	108	O00295	TULP2_HUMAN	S	108;105;89;64	ENSP00000221399:G108S;ENSP00000430040:G105S;ENSP00000428535:G89S	ENSP00000221399:G108S	G	-	1	0	TULP2	54090462	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.744000	0.01832	0.166000	0.19597	0.549000	0.68633	GGC		0.632	TULP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378633.1	NM_003323		80	126	0	0	0	0	80	126				
CD33	945	broad.mit.edu	37	19	51742808	51742808	+	Silent	SNP	T	T	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:51742808T>A	ENST00000262262.4	+	7	981	c.960T>A	c.(958-960)acT>acA	p.T320T	CD33_ENST00000600557.1_3'UTR|CD33_ENST00000421133.2_Silent_p.T193T	NM_001772.3	NP_001763.3	P20138	CD33_HUMAN	CD33 molecule	320					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(15)|skin(1)|stomach(1)	24		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	ATGGCCCCACTGAAACCTCAA	0.522																																						uc002pwa.2		NA																	0					0						c.(958-960)ACT>ACA		CD33 antigen isoform 1 precursor	Gemtuzumab ozogamicin(DB00056)						109.0	97.0	101.0					19																	51742808		2203	4300	6503	SO:0001819	synonymous_variant	945				cell adhesion|cell-cell signaling|negative regulation of cell proliferation	external side of plasma membrane|integral to plasma membrane	receptor activity|sugar binding	g.chr19:51742808T>A	M23197	CCDS33084.1, CCDS46157.1, CCDS54299.1	19q13.3	2013-01-29	2006-03-28		ENSG00000105383	ENSG00000105383		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1659	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 3"""	159590	"""CD33 antigen (gp67)"""			3139766, 9465907	Standard	NM_001772		Approved	SIGLEC3, SIGLEC-3, p67, FLJ00391	uc002pwa.2	P20138		ENST00000262262.4:c.960T>A	19.37:g.51742808T>A			Somatic				CD33_uc010eos.1_3'UTR|CD33_uc010eot.1_Silent_p.T193T|CD33_uc010eou.1_RNA	p.T320T	NM_001772	NP_001763	WXS	Illumina HiSeq	Unspecified	P20138	CD33_HUMAN		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	7	1000	+		all_neural(266;0.0199)	320			Cytoplasmic (Potential).		B4E3P8|C9JEN7|F8WAL2|Q8TD24	Silent	SNP	ENST00000262262.4	37	c.960T>A	CCDS33084.1																																																																																				0.522	CD33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464199.2	NM_001772		31	50	0	0	0	0	31	50				
ZNF610	162963	broad.mit.edu	37	19	52856995	52856995	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:52856995G>C	ENST00000403906.3	+	4	580	c.124G>C	c.(124-126)Gac>Cac	p.D42H	ZNF610_ENST00000327920.8_Missense_Mutation_p.D42H|ZNF610_ENST00000601151.1_Missense_Mutation_p.D42H|ZNF610_ENST00000321287.8_Missense_Mutation_p.D42H	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	42	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D42Y(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		GAAATCCCTGGACCCTGGACA	0.493																																						uc002pyx.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|upper_aerodigestive_tract(1)	3						c.(124-126)GAC>CAC		zinc finger protein 610 isoform a							104.0	102.0	102.0					19																	52856995		2203	4300	6503	SO:0001583	missense	162963				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52856995G>C	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.124G>C	19.37:g.52856995G>C	ENSP00000383922:p.Asp42His		Somatic				ZNF610_uc002pyy.3_Missense_Mutation_p.D42H|ZNF610_uc002pyz.3_Missense_Mutation_p.D42H|ZNF610_uc002pza.2_Missense_Mutation_p.D42H	p.D42H	NM_001161426	NP_001154898	WXS	Illumina HiSeq	Unspecified	Q8N9Z0	ZN610_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)	4	530	+			42			KRAB.		A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	ENST00000403906.3	37	c.124G>C	CCDS12851.1	.	.	.	.	.	.	.	.	.	.	G	9.267	1.044597	0.19748	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T;T	0.02763	4.17;4.17;4.17	1.47	0.397	0.16314	Krueppel-associated box (4);	.	.	.	.	T	0.15003	0.0362	M	0.89534	3.04	0.25064	N	0.99104	D;D	0.89917	1.0;1.0	D;D	0.81914	0.991;0.995	T	0.03103	-1.1072	9	0.46703	T	0.11	.	7.5967	0.28052	0.0:0.2687:0.7313:0.0	.	42;42	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	H	42	ENSP00000383922:D42H;ENSP00000324441:D42H;ENSP00000327597:D42H	ENSP00000324441:D42H	D	+	1	0	ZNF610	57548807	0.934000	0.31675	0.771000	0.31576	0.187000	0.23431	1.357000	0.34090	0.193000	0.20303	-0.216000	0.12614	GAC		0.493	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1	NM_173530		70	117	0	0	0	0	70	117				
ZNF880	400713	broad.mit.edu	37	19	52887510	52887510	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:52887510A>T	ENST00000422689.2	+	4	692	c.677A>T	c.(676-678)aAc>aTc	p.N226I		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	226					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						AACAGTTCAAACCTTGTACAA	0.388																																						uc002pzc.2		NA																	0					0						c.(676-678)AAC>ATC		zinc finger protein LOC400713							39.0	37.0	38.0					19																	52887510		1568	3582	5150	SO:0001583	missense	400713				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr19:52887510A>T	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.677A>T	19.37:g.52887510A>T	ENSP00000406318:p.Asn226Ile		Somatic					p.N226I	NM_001145434	NP_001138906	WXS	Illumina HiSeq	Unspecified	Q6PDB4	ZN880_HUMAN			4	726	+			226			C2H2-type 2.		B4DNA6	Missense_Mutation	SNP	ENST00000422689.2	37	c.677A>T	CCDS46164.1	.	.	.	.	.	.	.	.	.	.	A	8.871	0.949261	0.18356	.	.	ENSG00000221923	ENST00000422689	T	0.22539	1.95	2.03	-4.06	0.03986	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17365	0.0417	L	0.52905	1.665	0.09310	N	1	P	0.36125	0.538	B	0.41691	0.364	T	0.20273	-1.0280	8	.	.	.	.	0.8856	0.01243	0.3382:0.1676:0.3275:0.1666	.	226	Q6PDB4	ZN880_HUMAN	I	226	ENSP00000406318:N226I	.	N	+	2	0	ZNF880	57579322	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.131000	0.03238	-1.101000	0.03027	-0.486000	0.04755	AAC		0.388	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397374.1	NM_001145434		7	22	0	0	0	0	7	22				
MBOAT7	79143	broad.mit.edu	37	19	54692109	54692109	+	Silent	SNP	G	G	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:54692109G>C	ENST00000245615.1	-	3	648	c.168C>G	c.(166-168)acC>acG	p.T56T	MBOAT7_ENST00000338624.6_Missense_Mutation_p.H26D|TSEN34_ENST00000396388.2_5'Flank|TSEN34_ENST00000429671.2_5'Flank|TSEN34_ENST00000302937.4_5'Flank|TSEN34_ENST00000396383.1_5'Flank|MBOAT7_ENST00000431666.2_Missense_Mutation_p.H26D|MBOAT7_ENST00000474910.1_5'UTR|MBOAT7_ENST00000391754.1_Silent_p.T56T	NM_024298.3	NP_077274.3	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain containing 7	56					glycerophospholipid biosynthetic process (GO:0046474)|layer formation in cerebral cortex (GO:0021819)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|ventricular system development (GO:0021591)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipid acyltransferase activity (GO:0071617)			endometrium(4)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	10	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TCCCGAGGATGGTGACCAGAG	0.637																																					NSCLC(97;826 2151 10470 22540)	uc002qdq.2		NA																	0					0						c.(166-168)ACC>ACG		membrane bound O-acyltransferase domain							56.0	63.0	61.0					19																	54692109		2203	4300	6503	SO:0001819	synonymous_variant	79143				phospholipid biosynthetic process	integral to membrane	acyltransferase activity	g.chr19:54692109G>C	AF211969	CCDS12883.1, CCDS54315.1, CCDS54316.1	19q13.4	2008-12-15	2008-01-17	2008-01-17	ENSG00000125505	ENSG00000125505			15505	protein-coding gene	gene with protein product	"""lysophosphatidylinositol acyltransferase"""	606048	"""leukocyte receptor cluster (LRC) member 4"""	LENG4		10941842, 8702217, 18094042	Standard	NM_024298		Approved	BB1, hMBOA-7, LPIAT	uc002qdr.3	Q96N66	OTTHUMG00000066516	ENST00000245615.1:c.168C>G	19.37:g.54692109G>C			Somatic				MBOAT7_uc010erg.2_5'Flank|MBOAT7_uc010yem.1_Silent_p.T38T|MBOAT7_uc002qdr.2_Silent_p.T56T|MBOAT7_uc002qds.2_Missense_Mutation_p.H26D|MBOAT7_uc010yen.1_Missense_Mutation_p.H26D|MBOAT7_uc002qdt.3_Silent_p.T56T|TSEN34_uc010yeo.1_5'Flank|TSEN34_uc002qdu.2_5'Flank|TSEN34_uc002qdv.2_5'Flank|TSEN34_uc002qdw.2_5'Flank	p.T56T	NM_024298	NP_077274	WXS	Illumina HiSeq	Unspecified	Q96N66	MBOA7_HUMAN			4	434	-	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		56			Helical; (Potential).		A9C4B6|B0V3I5|B4DQ87|Q05DF0|Q7L5N2|Q99908|Q9BPV2|Q9BRE9	Silent	SNP	ENST00000245615.1	37	c.168C>G	CCDS12883.1	.	.	.	.	.	.	.	.	.	.	G	8.966	0.971809	0.18736	.	.	ENSG00000125505	ENST00000431666;ENST00000338624	T;T	0.15256	2.44;2.44	4.06	1.81	0.25067	.	.	.	.	.	T	0.09113	0.0225	.	.	.	0.23962	N	0.996333	B	0.02656	0.0	B	0.01281	0.0	T	0.36212	-0.9757	8	0.27082	T	0.32	-31.7589	3.8294	0.08868	0.092:0.1652:0.5719:0.1708	.	26	Q96N66-2	.	D	26	ENSP00000410503:H26D;ENSP00000344377:H26D	ENSP00000344377:H26D	H	-	1	0	MBOAT7	59383921	0.937000	0.31787	0.999000	0.59377	0.830000	0.47004	0.029000	0.13666	0.293000	0.22520	-0.304000	0.09214	CAT		0.637	MBOAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142203.1	NM_024298		70	108	0	0	0	0	70	108				
BRSK1	84446	broad.mit.edu	37	19	55805389	55805389	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:55805389A>G	ENST00000309383.1	+	5	740	c.463A>G	c.(463-465)Aga>Gga	p.R155G	BRSK1_ENST00000585418.1_Missense_Mutation_p.R155G|BRSK1_ENST00000590333.1_Missense_Mutation_p.R171G	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	155	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		TCTCAGCCACAGAGACCTAAA	0.577																																						uc002qkg.2		NA																	0				ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6						c.(463-465)AGA>GGA		BR serine/threonine kinase 1							127.0	131.0	130.0					19																	55805389		2203	4300	6503	SO:0001583	missense	84446				establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity	g.chr19:55805389A>G	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.463A>G	19.37:g.55805389A>G	ENSP00000310649:p.Arg155Gly		Somatic				BRSK1_uc002qkf.2_Missense_Mutation_p.R171G	p.R155G	NM_032430	NP_115806	WXS	Illumina HiSeq	Unspecified	Q8TDC3	BRSK1_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)	5	740	+		Renal(1328;0.245)	155			Protein kinase.		F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Missense_Mutation	SNP	ENST00000309383.1	37	c.463A>G	CCDS12921.1	.	.	.	.	.	.	.	.	.	.	.	19.17	3.776018	0.70107	.	.	ENSG00000160469	ENST00000309383	T	0.48522	0.81	4.79	4.79	0.61399	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70090	0.3184	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75207	-0.3399	10	0.87932	D	0	.	10.302	0.43659	0.8346:0.1654:0.0:0.0	.	155;171	Q8TDC3;Q8TDC3-2	BRSK1_HUMAN;.	G	155	ENSP00000310649:R155G	ENSP00000310649:R155G	R	+	1	2	BRSK1	60497201	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.937000	0.48979	1.920000	0.55613	0.459000	0.35465	AGA		0.577	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430		110	229	0	0	0	0	110	229				
DNAJC27	51277	broad.mit.edu	37	2	25186283	25186283	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:25186283G>T	ENST00000264711.2	-	3	420	c.231C>A	c.(229-231)ttC>ttA	p.F77L	DNAJC27_ENST00000468467.1_5'UTR|DNAJC27_ENST00000534855.1_Missense_Mutation_p.F6L	NM_001198559.1|NM_016544.2	NP_001185488.1|NP_057628.1	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27	77					small GTPase mediated signal transduction (GO:0007264)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						CCTCATAGAAGAAGGGATGTC	0.368																																						uc002rft.1		NA																	0				skin(1)	1						c.(229-231)TTC>TTA		DnaJ (Hsp40) homolog, subfamily C, member 27							133.0	114.0	121.0					2																	25186283		2203	4300	6503	SO:0001583	missense	51277				protein folding|small GTPase mediated signal transduction		GTP binding|heat shock protein binding|unfolded protein binding	g.chr2:25186283G>T		CCDS1716.1, CCDS74493.1	2p23.3	2011-09-02	2008-08-20	2008-08-20	ENSG00000115137	ENSG00000115137		"""Heat shock proteins / DNAJ (HSP40)"""	30290	protein-coding gene	gene with protein product		613527	"""rab and DnaJ domain containing"""	RBJ		14980719	Standard	NM_016544		Approved	RabJS	uc002rft.2	Q9NZQ0	OTTHUMG00000125524	ENST00000264711.2:c.231C>A	2.37:g.25186283G>T	ENSP00000264711:p.Phe77Leu		Somatic				DNAJC27_uc010ykn.1_Missense_Mutation_p.F6L|DNAJC27_uc002rfu.1_RNA|DNAJC27_uc010eyg.1_Missense_Mutation_p.F77L	p.F77L	NM_016544	NP_057628	WXS	Illumina HiSeq	Unspecified	Q9NZQ0	DJC27_HUMAN			3	282	-			77					Q5JV88|Q86Y24	Missense_Mutation	SNP	ENST00000264711.2	37	c.231C>A	CCDS1716.1	.	.	.	.	.	.	.	.	.	.	G	11.73	1.726269	0.30593	.	.	ENSG00000115137	ENST00000264711;ENST00000534855	T;T	0.76186	-1.0;-1.0	5.55	5.55	0.83447	Small GTP-binding protein domain (1);	0.151310	0.64402	D	0.000009	T	0.57213	0.2038	N	0.14661	0.345	0.58432	D	0.999999	B;B	0.02656	0.0;0.0	B;B	0.10450	0.005;0.002	T	0.54159	-0.8335	10	0.08599	T	0.76	-4.1642	16.2337	0.82360	0.0:0.0:1.0:0.0	.	77;77	Q9NZQ0-3;Q9NZQ0	.;DJC27_HUMAN	L	77;6	ENSP00000264711:F77L;ENSP00000440086:F6L	ENSP00000264711:F77L	F	-	3	2	DNAJC27	25039787	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.689000	0.68234	2.618000	0.88619	0.655000	0.94253	TTC		0.368	DNAJC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246855.3	NM_016544		22	50	1	0	1.56e-14	1.74e-14	22	50				
SLC4A1AP	22950	broad.mit.edu	37	2	27887203	27887203	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:27887203C>G	ENST00000326019.6	+	1	866	c.584C>G	c.(583-585)tCt>tGt	p.S195C	SUPT7L_ENST00000406540.1_5'Flank|SUPT7L_ENST00000405491.1_5'Flank|SUPT7L_ENST00000404798.2_5'Flank|SUPT7L_ENST00000337768.5_5'Flank|SUPT7L_ENST00000464789.2_5'Flank	NM_018158.2	NP_060628.2	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger), member 1, adaptor protein	195	FHA. {ECO:0000255|PROSITE- ProRule:PRU00086}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.155)					GGGAGGCTGTCTGGCTGCGAC	0.632																																						uc002rlk.3		NA																	0					0						c.(583-585)TCT>TGT		solute carrier family 4 (anion exchanger),							70.0	67.0	68.0					2																	27887203		2203	4300	6503	SO:0001583	missense	22950					cytoplasm|nucleus	double-stranded RNA binding|protein binding	g.chr2:27887203C>G		CCDS33166.1	2p23.3	2010-03-11	2001-11-28		ENSG00000163798	ENSG00000163798			13813	protein-coding gene	gene with protein product	"""lung cancer oncogene 3"""	602655	"""solute carrier family 4 (anion exchanger), member 1, adapter protein"""			9422766	Standard	NM_018158		Approved	kanadaptin, HLC3	uc002rlk.4	Q9BWU0	OTTHUMG00000151944	ENST00000326019.6:c.584C>G	2.37:g.27887203C>G	ENSP00000323837:p.Ser195Cys		Somatic				SUPT7L_uc002rlh.1_5'Flank|SUPT7L_uc002rli.1_5'Flank|SUPT7L_uc010ymf.1_5'Flank|SUPT7L_uc002rlj.1_5'Flank|SUPT7L_uc010ezh.1_5'Flank	p.S195C	NM_018158	NP_060628	WXS	Illumina HiSeq	Unspecified	Q9BWU0	NADAP_HUMAN			1	866	+	Acute lymphoblastic leukemia(172;0.155)		195			FHA.		A6NJ39|Q4KMT1|Q4KMX0|Q7Z5Q9|Q9NVN2	Missense_Mutation	SNP	ENST00000326019.6	37	c.584C>G	CCDS33166.1	.	.	.	.	.	.	.	.	.	.	C	17.82	3.482675	0.63962	.	.	ENSG00000163798	ENST00000326019	D	0.88201	-2.35	4.67	4.67	0.58626	Forkhead-associated (FHA) domain (4);SMAD/FHA domain (1);	0.335476	0.31438	N	0.007648	D	0.92603	0.7650	M	0.73319	2.225	0.09310	N	1	B	0.26635	0.155	P	0.45660	0.489	D	0.87443	0.2396	10	0.66056	D	0.02	1.5181	17.7606	0.88463	0.0:1.0:0.0:0.0	.	195	Q9BWU0	NADAP_HUMAN	C	195	ENSP00000323837:S195C	ENSP00000323837:S195C	S	+	2	0	SLC4A1AP	27740707	0.666000	0.27475	0.012000	0.15200	0.707000	0.40811	6.952000	0.75989	2.402000	0.81655	0.555000	0.69702	TCT		0.632	SLC4A1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324550.1	NM_018158		32	56	0	0	0	0	32	56				
GPR75	10936	broad.mit.edu	37	2	54080671	54080671	+	Missense_Mutation	SNP	C	C	T	rs372784242		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:54080671C>T	ENST00000394705.2	-	2	1493	c.1223G>A	c.(1222-1224)cGa>cAa	p.R408Q	ASB3_ENST00000406625.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron|ASB3_ENST00000498475.2_Intron	NM_006794.3	NP_006785.1	O95800	GPR75_HUMAN	G protein-coupled receptor 75	408					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of neuron death (GO:1901214)	integral component of plasma membrane (GO:0005887)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TCCCATGGCTCGAAGTCGAGT	0.448																																						uc002rxo.3		NA																	0				ovary(1)|skin(1)	2						c.(1222-1224)CGA>CAA		G protein-coupled receptor 75		C	,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	104.0	114.0	111.0		,1223	4.7	1.0	2		111	0,8600		0,0,4300	no	intron,missense	GPR75,GPR75-ASB3	NM_001164165.1,NM_006794.3	,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,benign	,408/541	54080671	1,13005	2203	4300	6503	SO:0001583	missense	10936					integral to plasma membrane	G-protein coupled receptor activity	g.chr2:54080671C>T	AF101472	CCDS1849.1	2p16	2012-08-21			ENSG00000119737	ENSG00000119737		"""GPCR / Class A : Orphans"""	4526	protein-coding gene	gene with protein product		606704				10381362	Standard	NM_006794		Approved	WI-31133	uc002rxo.3	O95800	OTTHUMG00000129280	ENST00000394705.2:c.1223G>A	2.37:g.54080671C>T	ENSP00000378195:p.Arg408Gln		Somatic				ASB3_uc002rxi.3_Intron	p.R408Q	NM_006794	NP_006785	WXS	Illumina HiSeq	Unspecified	O95800	GPR75_HUMAN	Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)		2	1494	-			408			Cytoplasmic (Potential).		B2RC02|Q6NWR2	Missense_Mutation	SNP	ENST00000394705.2	37	c.1223G>A	CCDS1849.1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.376359	0.42105	2.27E-4	0.0	ENSG00000119737	ENST00000394705	T	0.23348	1.91	5.55	4.68	0.58851	.	0.135152	0.50627	D	0.000106	T	0.19485	0.0468	.	.	.	0.37631	D	0.92168	B	0.33379	0.41	B	0.17098	0.017	T	0.11372	-1.0590	9	0.72032	D	0.01	-2.247	12.3646	0.55222	0.0:0.8598:0.0:0.1402	.	408	O95800	GPR75_HUMAN	Q	408	ENSP00000378195:R408Q	ENSP00000378195:R408Q	R	-	2	0	GPR75	53934175	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	3.576000	0.53878	1.349000	0.45751	0.561000	0.74099	CGA		0.448	GPR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251403.2			94	183	0	0	0	0	94	183				
CCDC85A	114800	broad.mit.edu	37	2	56419779	56419779	+	Silent	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:56419779G>A	ENST00000407595.2	+	2	946	c.444G>A	c.(442-444)ctG>ctA	p.L148L	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	148										breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TGCAGAAGCTGAAAGACCTGG	0.572																																						uc002rzn.2		NA																	0				breast(3)|ovary(2)	5						c.(442-444)CTG>CTA		coiled-coil domain containing 85A							54.0	63.0	60.0					2																	56419779		2074	4231	6305	SO:0001819	synonymous_variant	114800							g.chr2:56419779G>A	AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.444G>A	2.37:g.56419779G>A			Somatic					p.L148L	NM_001080433	NP_001073902	WXS	Illumina HiSeq	Unspecified	Q96PX6	CC85A_HUMAN	LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)		2	946	+			148			Potential.			Silent	SNP	ENST00000407595.2	37	c.444G>A	CCDS46290.1																																																																																				0.572	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324993.1			39	56	0	0	0	0	39	56				
ACTR2	10097	broad.mit.edu	37	2	65473816	65473816	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:65473816A>T	ENST00000260641.5	+	3	475	c.318A>T	c.(316-318)aaA>aaT	p.K106N	ACTR2_ENST00000542850.1_Missense_Mutation_p.K51N|ACTR2_ENST00000476840.1_3'UTR|ACTR2_ENST00000377982.4_Missense_Mutation_p.K111N	NM_005722.3	NP_005713.1	P61160	ARP2_HUMAN	ARP2 actin-related protein 2 homolog (yeast)	106					Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium assembly (GO:0042384)|cytoplasmic transport (GO:0016482)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|spindle localization (GO:0051653)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)	12						GAAATTGTAAAATCTTACTCA	0.368																																						uc002sdq.2		NA																	0					0						c.(316-318)AAA>AAT		actin-related protein 2 isoform b							110.0	121.0	117.0					2																	65473816		2203	4300	6503	SO:0001583	missense	10097				cellular component movement	Arp2/3 protein complex|cell projection|cytoplasm	actin binding|ATP binding	g.chr2:65473816A>T	AF006082	CCDS1881.1, CCDS46307.1	2p14	2008-05-20	2001-11-28		ENSG00000138071	ENSG00000138071			169	protein-coding gene	gene with protein product		604221	"""ARP2 (actin-related protein 2, yeast) homolog"""			9230079	Standard	NM_001005386		Approved	ARP2	uc002sdp.3	P61160	OTTHUMG00000129540	ENST00000260641.5:c.318A>T	2.37:g.65473816A>T	ENSP00000260641:p.Lys106Asn		Somatic				ACTR2_uc010yqf.1_Missense_Mutation_p.K51N|ACTR2_uc002sdp.2_Missense_Mutation_p.K111N|ACTR2_uc010yqg.1_Missense_Mutation_p.K54N	p.K106N	NM_005722	NP_005713	WXS	Illumina HiSeq	Unspecified	P61160	ARP2_HUMAN			3	533	+			106					B2RCP5|D6W5F4|E9PF41|O15142|Q96C82	Missense_Mutation	SNP	ENST00000260641.5	37	c.318A>T	CCDS1881.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.973178	0.74246	.	.	ENSG00000138071	ENST00000260641;ENST00000542850;ENST00000377982;ENST00000535303	D;D;D	0.97114	-4.25;-4.25;-4.25	5.34	4.2	0.49525	.	0.000000	0.85682	D	0.000000	D	0.97807	0.9280	M	0.72894	2.215	0.58432	D	0.999998	D;D;D	0.89917	1.0;0.992;0.992	D;D;D	0.91635	0.999;0.968;0.99	D	0.97614	1.0131	10	0.72032	D	0.01	-20.3478	10.2597	0.43419	0.9211:0.0:0.0789:0.0	.	51;106;111	F5H6T1;P61160;E9PF41	.;ARP2_HUMAN;.	N	106;51;111;51	ENSP00000260641:K106N;ENSP00000437383:K51N;ENSP00000367220:K111N	ENSP00000260641:K106N	K	+	3	2	ACTR2	65327320	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.517000	0.53443	0.894000	0.36317	0.459000	0.35465	AAA		0.368	ACTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251730.1	NM_001005386		72	154	0	0	0	0	72	154				
APLF	200558	broad.mit.edu	37	2	68765290	68765290	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:68765290C>T	ENST00000303795.4	+	7	1262	c.1091C>T	c.(1090-1092)tCa>tTa	p.S364L	APLF_ENST00000471727.1_3'UTR	NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	364					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						GCAACTGATTCAGTTCTACAA	0.443																																						uc002sep.2		NA																	0				ovary(2)	2						c.(1090-1092)TCA>TTA		aprataxin and PNKP like factor							76.0	73.0	74.0					2																	68765290		2203	4300	6503	SO:0001583	missense	200558				double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding	g.chr2:68765290C>T	BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.1091C>T	2.37:g.68765290C>T	ENSP00000307004:p.Ser364Leu		Somatic				APLF_uc002seq.1_RNA|APLF_uc010fdf.2_Missense_Mutation_p.S340L|APLF_uc002ser.1_Missense_Mutation_p.S95L	p.S364L	NM_173545	NP_775816	WXS	Illumina HiSeq	Unspecified	Q8IW19	APLF_HUMAN			7	1264	+			364					A8K476|Q53P47|Q53PB9|Q53QU0	Missense_Mutation	SNP	ENST00000303795.4	37	c.1091C>T	CCDS1888.1	.	.	.	.	.	.	.	.	.	.	.	12.50	1.957062	0.34565	.	.	ENSG00000169621	ENST00000303795	T	0.24151	1.87	5.39	5.39	0.77823	.	0.928117	0.09092	N	0.849735	T	0.31231	0.0790	M	0.65975	2.015	0.25590	N	0.986706	B	0.33694	0.421	B	0.30495	0.116	T	0.20042	-1.0287	10	0.44086	T	0.13	.	13.5768	0.61879	0.1561:0.8439:0.0:0.0	.	364	Q8IW19	APLF_HUMAN	L	364	ENSP00000307004:S364L	ENSP00000307004:S364L	S	+	2	0	APLF	68618794	0.000000	0.05858	0.539000	0.28077	0.371000	0.29859	0.544000	0.23253	2.522000	0.85027	0.557000	0.71058	TCA		0.443	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1	NM_173545		64	88	0	0	0	0	64	88				
EXOC6B	23233	broad.mit.edu	37	2	72945308	72945308	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:72945308G>A	ENST00000272427.6	-	6	723	c.593C>T	c.(592-594)tCt>tTt	p.S198F	EXOC6B_ENST00000410104.1_Missense_Mutation_p.S198F	NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	198					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)				breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						ATCGGACATAGAAACATCTTT	0.438																																						uc010fep.2		NA																	0				central_nervous_system(2)	2						c.(592-594)TCT>TTT		SEC15-like 2							148.0	142.0	144.0					2																	72945308		1892	4124	6016	SO:0001583	missense	23233				protein transport|vesicle docking involved in exocytosis	exocyst		g.chr2:72945308G>A	AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.593C>T	2.37:g.72945308G>A	ENSP00000272427:p.Ser198Phe		Somatic				EXOC6B_uc002sij.2_Missense_Mutation_p.S198F	p.S198F	NM_015189	NP_056004	WXS	Illumina HiSeq	Unspecified	Q9Y2D4	EXC6B_HUMAN			6	731	-			198					B8ZZY3	Missense_Mutation	SNP	ENST00000272427.6	37	c.593C>T	CCDS46333.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822892	0.90873	.	.	ENSG00000144036	ENST00000272427;ENST00000410104;ENST00000290144	T;T	0.32023	1.47;1.47	5.61	5.61	0.85477	.	0.055747	0.64402	D	0.000001	T	0.61060	0.2317	M	0.84433	2.695	0.80722	D	1	D;D	0.71674	0.978;0.998	P;D	0.70016	0.758;0.967	T	0.64757	-0.6332	10	0.54805	T	0.06	.	18.2035	0.89847	0.0:0.0:1.0:0.0	.	198;198	Q9Y2D4;Q9Y2D4-2	EXC6B_HUMAN;.	F	198	ENSP00000272427:S198F;ENSP00000386698:S198F	ENSP00000272427:S198F	S	-	2	0	EXOC6B	72798816	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.632000	0.89209	0.655000	0.94253	TCT		0.438	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327558.1	XM_039570		56	104	0	0	0	0	56	104				
MAP3K19	80122	broad.mit.edu	37	2	135745305	135745305	+	Silent	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:135745305G>A	ENST00000375845.3	-	7	1167	c.1137C>T	c.(1135-1137)aaC>aaT	p.N379N	MAP3K19_ENST00000392915.1_Silent_p.N396N|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000358371.4_Silent_p.N266N|MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000375844.3_Intron	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	379							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										CTTGTTCATAGTTTTTGGCTA	0.378																																						uc002tue.1		NA																	0				stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5						c.(1135-1137)AAC>AAT		Yeast Sps1/Ste20-related kinase 4 isoform 1							77.0	75.0	76.0					2																	135745305		2203	4300	6503	SO:0001819	synonymous_variant	80122						ATP binding|protein serine/threonine kinase activity	g.chr2:135745305G>A	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.1137C>T	2.37:g.135745305G>A			Somatic				YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Silent_p.N266N|YSK4_uc010zbg.1_Intron|YSK4_uc002tuh.3_Silent_p.N107N|YSK4_uc002tui.3_Silent_p.N396N	p.N379N	NM_025052	NP_079328	WXS	Illumina HiSeq	Unspecified	Q56UN5	YSK4_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.112)	7	1168	-			379					B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Silent	SNP	ENST00000375845.3	37	c.1137C>T	CCDS2176.2																																																																																				0.378	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052		56	99	0	0	0	0	56	99				
LRP1B	53353	broad.mit.edu	37	2	141072662	141072662	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:141072662G>T	ENST00000389484.3	-	83	13618	c.12647C>A	c.(12646-12648)tCa>tAa	p.S4216*		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4216	EGF-like 17. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TAACTTACATGAATCATCTGT	0.303										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	uc002tvj.1		NA																	0				lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50						c.(12646-12648)TCA>TAA		low density lipoprotein-related protein 1B							96.0	88.0	91.0					2																	141072662		2203	4300	6503	SO:0001587	stop_gained	53353				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding	g.chr2:141072662G>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12647C>A	2.37:g.141072662G>T	ENSP00000374135:p.Ser4216*	TSP Lung(27;0.18)	Somatic					p.S4216*	NM_018557	NP_061027	WXS	Illumina HiSeq	Unspecified	Q9NZR2	LRP1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	83	13619	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	4216			Extracellular (Potential).|EGF-like 10.		Q8WY29|Q8WY30|Q8WY31	Nonsense_Mutation	SNP	ENST00000389484.3	37	c.12647C>A	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	57|57	27.464857|27.464857	0.99971|0.99971	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000437977|ENST00000389484;ENST00000544579	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|0.238578	.|0.30437	.|U	.|0.009625	T|.	0.30823|.	0.0777|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.31668|.	-0.9935|.	3|.	.|0.06625	.|T	.|0.88	.|.	10.8311|10.8311	0.46661|0.46661	0.0683:0.1313:0.8004:0.0|0.0683:0.1313:0.8004:0.0	.|.	.|.	.|.	.|.	N|X	448|4216;4154	.|.	.|ENSP00000374135:S4216X	H|S	-|-	1|2	0|0	LRP1B|LRP1B	140789132|140789132	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.197000|0.197000	0.23852|0.23852	4.442000|4.442000	0.59988|0.59988	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	CAT|TCA		0.303	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		27	62	1	0	3.29e-13	3.64e-13	27	62				
CERKL	375298	broad.mit.edu	37	2	182468677	182468677	+	Missense_Mutation	SNP	A	A	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:182468677A>T	ENST00000339098.5	-	2	367	c.368T>A	c.(367-369)tTc>tAc	p.F123Y	CERKL_ENST00000374969.2_Missense_Mutation_p.F123Y|CERKL_ENST00000409440.3_Missense_Mutation_p.F123Y|CERKL_ENST00000479558.1_5'UTR|CERKL_ENST00000410087.3_Missense_Mutation_p.F123Y|CERKL_ENST00000374970.2_Missense_Mutation_p.F123Y			Q49MI3	CERKL_HUMAN	ceramide kinase-like	123					negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CAAGCAGATGAAGAGTGTGAT	0.333																																						uc002unx.2		NA																	0				ovary(2)|kidney(1)|skin(1)	4						c.(367-369)TTC>TAC		ceramide kinase-like isoform b							78.0	75.0	76.0					2																	182468677		2203	4300	6503	SO:0001583	missense	375298				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity	g.chr2:182468677A>T	BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.368T>A	2.37:g.182468677A>T	ENSP00000341159:p.Phe123Tyr		Somatic				CERKL_uc002uny.2_Missense_Mutation_p.F123Y|CERKL_uc010zfm.1_Missense_Mutation_p.F123Y|CERKL_uc002unz.2_5'UTR|CERKL_uc002uoa.2_Missense_Mutation_p.F123Y|CERKL_uc002uob.2_5'UTR|CERKL_uc002uoc.2_Missense_Mutation_p.F123Y|CERKL_uc010frk.2_RNA|CERKL_uc002uod.1_5'UTR|CERKL_uc002uoe.2_Missense_Mutation_p.F123Y	p.F123Y	NM_001030311	NP_001025482	WXS	Illumina HiSeq	Unspecified	Q49MI3	CERKL_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.088)		2	469	-			123					B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Missense_Mutation	SNP	ENST00000339098.5	37	c.368T>A	CCDS42789.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.244600	0.79912	.	.	ENSG00000188452	ENST00000410087;ENST00000409440;ENST00000374969;ENST00000339098;ENST00000374970	T;T;T;T;T	0.57907	2.07;1.34;0.37;2.28;1.15	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.59362	0.2188	L	0.32530	0.975	0.34012	D	0.65163	D;D;D;D;D	0.89917	1.0;0.999;0.996;1.0;1.0	D;D;P;D;D	0.87578	0.981;0.96;0.851;0.998;0.996	T	0.60915	-0.7168	10	0.12103	T	0.63	.	15.0538	0.71897	1.0:0.0:0.0:0.0	.	123;123;123;123;123	B4DEY1;Q49MI3-4;Q49MI3-3;Q49MI3-2;Q49MI3	.;.;.;.;CERKL_HUMAN	Y	123	ENSP00000386725:F123Y;ENSP00000387080:F123Y;ENSP00000364108:F123Y;ENSP00000341159:F123Y;ENSP00000364109:F123Y	ENSP00000341159:F123Y	F	-	2	0	CERKL	182176922	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	6.741000	0.74837	2.105000	0.64084	0.533000	0.62120	TTC		0.333	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334811.1			11	60	0	0	0	0	11	60				
FAM171B	165215	broad.mit.edu	37	2	187626381	187626381	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:187626381C>T	ENST00000304698.5	+	8	1515	c.1312C>T	c.(1312-1314)Cag>Tag	p.Q438*		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	438						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						ATATAGTCCTCAGAAAAAGGA	0.348																																						uc002ups.2		NA																	0				ovary(6)|breast(3)|central_nervous_system(1)	10						c.(1312-1314)CAG>TAG		KIAA1946							66.0	69.0	68.0					2																	187626381		2203	4299	6502	SO:0001587	stop_gained	165215					integral to membrane	DNA binding	g.chr2:187626381C>T	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.1312C>T	2.37:g.187626381C>T	ENSP00000304108:p.Gln438*		Somatic				FAM171B_uc002upr.1_Intron|FAM171B_uc002upt.2_5'Flank	p.Q438*	NM_177454	NP_803237	WXS	Illumina HiSeq	Unspecified	Q6P995	F171B_HUMAN			8	1424	+			438			Cytoplasmic (Potential).		Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Nonsense_Mutation	SNP	ENST00000304698.5	37	c.1312C>T	CCDS33347.1	.	.	.	.	.	.	.	.	.	.	C	37	6.019789	0.97205	.	.	ENSG00000144369	ENST00000304698	.	.	.	5.93	5.05	0.67936	.	0.631279	0.16539	N	0.210046	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-3.8624	12.836	0.57773	0.0:0.9254:0.0:0.0746	.	.	.	.	X	438	.	ENSP00000304108:Q438X	Q	+	1	0	FAM171B	187334626	1.000000	0.71417	0.948000	0.38648	0.990000	0.78478	4.075000	0.57584	2.805000	0.96524	0.655000	0.94253	CAG		0.348	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454		41	91	0	0	0	0	41	91				
MARS2	92935	broad.mit.edu	37	2	198570720	198570720	+	Silent	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:198570720C>G	ENST00000282276.6	+	1	634	c.591C>G	c.(589-591)ctC>ctG	p.L197L	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	197					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)	p.L197L(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	CTGTATCTCTCGAGAGCGGGC	0.587																																						uc002uuq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|central_nervous_system(1)|skin(1)	3						c.(589-591)CTC>CTG		methionine-tRNA synthetase 2 precursor	L-Methionine(DB00134)						44.0	51.0	49.0					2																	198570720		2203	4300	6503	SO:0001819	synonymous_variant	92935				methionyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|methionine-tRNA ligase activity	g.chr2:198570720C>G	BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.591C>G	2.37:g.198570720C>G			Somatic				uc002uup.2_Intron	p.L197L	NM_138395	NP_612404	WXS	Illumina HiSeq	Unspecified	Q96GW9	SYMM_HUMAN			1	634	+			197					A0AVC3|Q76E79|Q8IW62|Q8N7N4	Silent	SNP	ENST00000282276.6	37	c.591C>G	CCDS33358.1																																																																																				0.587	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1	NM_138395		57	119	0	0	0	0	57	119				
CHPF	79586	broad.mit.edu	37	2	220404983	220404983	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:220404983G>A	ENST00000243776.6	-	4	1698	c.1450C>T	c.(1450-1452)Cga>Tga	p.R484*	CHPF_ENST00000535926.1_Nonsense_Mutation_p.R322*	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	484					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		AGCTGCACTCGGCGAGTGAGG	0.667																																						uc002vmc.3		NA																	0					0						c.(1450-1452)CGA>TGA		chondroitin polymerizing factor							21.0	23.0	22.0					2																	220404983		2198	4297	6495	SO:0001587	stop_gained	79586					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity|protein binding	g.chr2:220404983G>A	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.1450C>T	2.37:g.220404983G>A	ENSP00000243776:p.Arg484*		Somatic				CHPF_uc010zlh.1_Nonsense_Mutation_p.R322*	p.R484*	NM_024536	NP_078812	WXS	Illumina HiSeq	Unspecified	Q8IZ52	CHSS2_HUMAN		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)	4	1677	-		Renal(207;0.0183)	484			Lumenal (Potential).		B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Nonsense_Mutation	SNP	ENST00000243776.6	37	c.1450C>T	CCDS2443.1	.	.	.	.	.	.	.	.	.	.	G	37	6.071765	0.97256	.	.	ENSG00000123989	ENST00000243776;ENST00000535926	.	.	.	4.98	2.01	0.26516	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-34.8352	13.9175	0.63908	0.0:0.0:0.5947:0.4053	.	.	.	.	X	484;322	.	ENSP00000243776:R484X	R	-	1	2	CHPF	220113227	1.000000	0.71417	0.999000	0.59377	0.383000	0.30230	4.449000	0.60034	0.312000	0.23038	0.561000	0.74099	CGA		0.667	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130268.1	NM_024536		14	32	0	0	0	0	14	32				
CAPN10	11132	broad.mit.edu	37	2	241535795	241535795	+	Silent	SNP	C	C	T	rs370360650		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr2:241535795C>T	ENST00000391984.2	+	8	1534	c.1338C>T	c.(1336-1338)acC>acT	p.T446T	CAPN10_ENST00000352879.4_Intron|CAPN10_ENST00000270364.7_Intron|CAPN10_ENST00000404753.3_Silent_p.T446T|CAPN10_ENST00000354082.4_Intron	NM_023083.3	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10	446	Domain III 1.				actin cytoskeleton reorganization (GO:0031532)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to insulin stimulus (GO:0032869)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin secretion (GO:0032024)|positive regulation of intracellular transport (GO:0032388)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteolysis (GO:0006508)|type B pancreatic cell apoptotic process (GO:0097050)	cell (GO:0005623)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cytoskeletal protein binding (GO:0008092)|SNARE binding (GO:0000149)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|urinary_tract(1)	27		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		TGGCTGGCACCGCGTGCCATG	0.667																																						uc002vzk.1		NA																	0				ovary(3)|large_intestine(2)|lung(1)	6						c.(1336-1338)ACC>ACT		calpain 10 isoform a		C	,	0,4006		0,0,2003	58.0	63.0	61.0		1338,	-8.2	0.0	2		61	1,8307		0,1,4153	no	coding-synonymous,intron	CAPN10	NM_023083.3,NM_023085.3	,	0,1,6156	TT,TC,CC		0.012,0.0,0.0081	,	446/673,	241535795	1,12313	2003	4154	6157	SO:0001819	synonymous_variant	11132				actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding	g.chr2:241535795C>T	AF089088	CCDS33420.1, CCDS42838.1	2q37.3	2008-05-22			ENSG00000142330	ENSG00000142330			1477	protein-coding gene	gene with protein product		605286				11017071, 11018080	Standard	NM_023083		Approved		uc002vzk.2	Q9HC96	OTTHUMG00000133358	ENST00000391984.2:c.1338C>T	2.37:g.241535795C>T			Somatic				CAPN10_uc002vzl.1_Intron|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_Silent_p.T318T|CAPN10_uc002vzo.1_RNA|CAPN10_uc010fzg.1_RNA|CAPN10_uc002vzp.1_RNA|CAPN10_uc002vzq.1_Intron	p.T446T	NM_023083	NP_075571	WXS	Illumina HiSeq	Unspecified	Q9HC96	CAN10_HUMAN		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)	8	1522	+		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	446			Domain III 1.		A8MVS7|Q4ZFV1|Q8NCD4|Q96IG4|Q96JI2|Q9HC89|Q9HC90|Q9HC91|Q9HC92|Q9HC93|Q9HC94|Q9HC95	Silent	SNP	ENST00000391984.2	37	c.1338C>T	CCDS42838.1																																																																																				0.667	CAPN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257191.3	NM_023083		4	193	0	0	0	0	4	193				
TRIB3	57761	broad.mit.edu	37	20	377164	377164	+	Silent	SNP	C	C	A	rs139447354		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr20:377164C>A	ENST00000217233.3	+	4	1460	c.907C>A	c.(907-909)Cgg>Agg	p.R303R	TRIB3_ENST00000422053.2_Silent_p.R330R	NM_021158.3	NP_066981.2	Q96RU7	TRIB3_HUMAN	tribbles pseudokinase 3	303	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of protein binding (GO:0032092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|regulation of glucose transport (GO:0010827)|regulation of MAP kinase activity (GO:0043405)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|transcription corepressor activity (GO:0003714)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase regulator activity (GO:0055106)			breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|skin(1)	21		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)		GCCAGCTGAACGGCTCACAGC	0.687																																					Melanoma(101;421 2374 19538)	uc002wdm.2		NA																	0				central_nervous_system(2)	2						c.(907-909)CGG>AGG		tribbles 3							44.0	43.0	43.0					20																	377164		2198	4294	6492	SO:0001819	synonymous_variant	57761				apoptosis|cellular lipid metabolic process|insulin receptor signaling pathway|negative regulation of fat cell differentiation|negative regulation of fatty acid biosynthetic process|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein binding|positive regulation of ubiquitin-protein ligase activity|regulation of glucose transport|regulation of MAP kinase activity|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	ATP binding|protein kinase activity|protein kinase binding|protein kinase inhibitor activity|transcription corepressor activity|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity	g.chr20:377164C>A	AF250311	CCDS12997.1	20p13-p12.2	2013-10-03	2013-10-03	2004-05-04	ENSG00000101255	ENSG00000101255			16228	protein-coding gene	gene with protein product		607898	"""chromosome 20 open reading frame 97"", ""tribbles homolog 3 (Drosophila)"""	C20orf97		12791994, 16715410	Standard	XM_005260773		Approved	dJ1103G7.3, TRB3	uc002wdm.3	Q96RU7	OTTHUMG00000031627	ENST00000217233.3:c.907C>A	20.37:g.377164C>A			Somatic				TRIB3_uc002wdn.2_Silent_p.R330R	p.R303R	NM_021158	NP_066981	WXS	Illumina HiSeq	Unspecified	Q96RU7	TRIB3_HUMAN		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)	4	1413	+		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)	303			Protein kinase.		Q53GU4|Q53ZW7|Q6I9Y9|Q8TAI6|Q9H5M8|Q9NUD2	Silent	SNP	ENST00000217233.3	37	c.907C>A	CCDS12997.1																																																																																				0.687	TRIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077441.2	NM_021158		69	120	1	0	5.26e-25	6.03e-25	69	120				
SNRPB	6628	broad.mit.edu	37	20	2443871	2443871	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr20:2443871C>T	ENST00000438552.2	-	5	585	c.423G>A	c.(421-423)gtG>gtA	p.V141V	SNORD119_ENST00000515997.1_RNA|SNRPB_ENST00000381342.2_Silent_p.V141V|SNRPB_ENST00000339610.6_Silent_p.V62V	NM_198216.1	NP_937859.1	P14678	RSMB_HUMAN	small nuclear ribonucleoprotein polypeptides B and B1	141					gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	10						GTGGGGTCATCACCTAAGAGG	0.552																																						uc002wfz.1		NA																	0				ovary(1)	1						c.(421-423)GTG>GTA		small nuclear ribonucleoprotein polypeptide B/B'							29.0	32.0	31.0					20																	2443871		2191	4284	6475	SO:0001819	synonymous_variant	6628				histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	protein binding|protein binding|RNA binding	g.chr20:2443871C>T		CCDS13026.1, CCDS13027.1	20p13	2011-10-11			ENSG00000125835	ENSG00000125835			11153	protein-coding gene	gene with protein product		182282		SNRPB1		1376292	Standard	NM_003091		Approved	COD, SmB/SmB', Sm-B/B', snRNP-B	uc002wfz.1	P14678	OTTHUMG00000031694	ENST00000438552.2:c.423G>A	20.37:g.2443871C>T			Somatic				SNRPB_uc002wga.1_Silent_p.V141V|SNRPB_uc010zpv.1_Silent_p.V62V|SNRPB_uc002wgb.2_Silent_p.V141V|SNORD119_uc010gam.1_5'Flank	p.V141V	NM_198216	NP_937859	WXS	Illumina HiSeq	Unspecified	P14678	RSMB_HUMAN			5	586	-			141					Q15490|Q6IB35|Q9UIS5	Silent	SNP	ENST00000438552.2	37	c.423G>A	CCDS13026.1																																																																																				0.552	SNRPB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077585.2			8	68	0	0	0	0	8	68				
C20orf194	25943	broad.mit.edu	37	20	3297377	3297377	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr20:3297377G>A	ENST00000252032.9	-	18	1599	c.1532C>T	c.(1531-1533)tCc>tTc	p.S511F	C20orf194_ENST00000498079.1_5'Flank|C20orf194_ENST00000453730.2_Missense_Mutation_p.S249F	NM_001009984.2	NP_001009984.1	Q5TEA3	CT194_HUMAN	chromosome 20 open reading frame 194	511										NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	39						AACCAGCCAGGAGCAGAATCT	0.527																																						uc002wii.2		NA																	0					0						c.(1531-1533)TCC>TTC		hypothetical protein LOC25943							89.0	93.0	92.0					20																	3297377		2046	4201	6247	SO:0001583	missense	25943							g.chr20:3297377G>A	AL110249	CCDS42851.1	20p13	2012-10-30			ENSG00000088854	ENSG00000088854			17721	protein-coding gene	gene with protein product		614146					Standard	NM_001009984		Approved	DKFZp434N061	uc002wii.3	Q5TEA3	OTTHUMG00000031742	ENST00000252032.9:c.1532C>T	20.37:g.3297377G>A	ENSP00000252032:p.Ser511Phe		Somatic				C20orf194_uc002wij.3_Missense_Mutation_p.S250F|C20orf194_uc002wik.2_Missense_Mutation_p.S185F	p.S511F	NM_001009984	NP_001009984	WXS	Illumina HiSeq	Unspecified	Q5TEA3	CT194_HUMAN			18	1583	-			511					Q66K86|Q6P2R9|Q9UFX9	Missense_Mutation	SNP	ENST00000252032.9	37	c.1532C>T	CCDS42851.1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.359263	0.61403	.	.	ENSG00000088854	ENST00000252032;ENST00000453730	T;T	0.33654	2.13;1.4	5.83	5.83	0.93111	.	0.057675	0.64402	D	0.000001	T	0.42177	0.1191	M	0.67953	2.075	0.80722	D	1	B;B	0.12630	0.006;0.003	B;B	0.13407	0.009;0.009	T	0.18777	-1.0326	10	0.45353	T	0.12	.	18.958	0.92668	0.0:0.0:1.0:0.0	.	250;511	Q0IIP3;Q5TEA3	.;CT194_HUMAN	F	511;249	ENSP00000252032:S511F;ENSP00000407229:S249F	ENSP00000252032:S511F	S	-	2	0	C20orf194	3245377	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.120000	0.57897	2.781000	0.95711	0.650000	0.86243	TCC		0.527	C20orf194-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077734.1	NM_001009984		21	42	0	0	0	0	21	42				
UQCC1	55245	broad.mit.edu	37	20	33999835	33999835	+	5'UTR	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr20:33999835C>T	ENST00000374385.5	-	0	109				UQCC1_ENST00000542501.1_5'Flank|UQCC1_ENST00000349714.5_5'Flank|UQCC1_ENST00000374384.2_5'Flank|UQCC1_ENST00000407996.2_5'Flank|UQCC1_ENST00000491125.1_5'Flank|UQCC1_ENST00000374377.5_5'Flank|UQCC1_ENST00000359226.2_5'Flank|UQCC1_ENST00000397554.1_5'Flank|UQCC1_ENST00000374380.2_5'Flank|UQCC1_ENST00000540457.1_5'Flank	NM_018244.4	NP_060714.3	Q9NVA1	UQCC1_HUMAN	ubiquinol-cytochrome c reductase complex assembly factor 1							cytoplasmic membrane-bounded vesicle (GO:0016023)|mitochondrion (GO:0005739)											CCTCCTTTTGCCGGCGAAAGA	0.597																																						uc002xcd.2		NA																	0				breast(1)	1						c.e1-1		basic FGF-repressed Zic binding protein isoform							105.0	92.0	96.0					20																	33999835		692	1591	2283	SO:0001623	5_prime_UTR_variant	55245					cytoplasmic membrane-bounded vesicle		g.chr20:33999835C>T	AK001712	CCDS13252.1, CCDS13253.1, CCDS13253.2, CCDS54458.1	20q11.22	2013-09-20	2013-09-20	2013-09-20	ENSG00000101019	ENSG00000101019		"""Mitochondrial respiratory chain complex assembly factors"""	15891	protein-coding gene	gene with protein product	"""Basic FGF-repressed Zic-binding protein"", ""cytochrome B protein synthesis 3 homolog (S. cerevisiae)"""	611797	"""chromosome 20 open reading frame 44"", ""ubiquinol-cytochrome c reductase complex chaperone"""	C20orf44, UQCC			Standard	NM_018244		Approved	FLJ10850, CBP3, BFZB	uc002xcd.3	Q9NVA1	OTTHUMG00000032335	ENST00000374385.5:c.-69G>A	20.37:g.33999835C>T			Somatic				UQCC_uc010zuz.1_Splice_Site|UQCC_uc010zva.1_Splice_Site|UQCC_uc002xce.2_Splice_Site|UQCC_uc002xcg.2_Splice_Site|UQCC_uc010gfb.2_Splice_Site|UQCC_uc010zvb.1_Splice_Site|UQCC_uc002xcf.2_Splice_Site|GDF5_uc010gfc.1_Intron|UQCC_uc010gfd.1_Splice_Site		NM_018244	NP_060714	WXS	Illumina HiSeq	Unspecified	Q9NVA1	UQCC_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00252)		1	1	-								B1AKV5|Q0VF37|Q5T348|Q5T351|Q5T353|Q86YU3|Q86YU4|Q96H66|Q9H438|Q9H452|Q9H9K8|Q9H9R5	Splice_Site	SNP	ENST00000374385.5	37	c.-66_splice	CCDS13252.1																																																																																				0.597	UQCC1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078866.1	NM_018244		3	65	0	0	0	0	3	65				
ACTR5	79913	broad.mit.edu	37	20	37400305	37400305	+	Missense_Mutation	SNP	A	A	T	rs369181430		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr20:37400305A>T	ENST00000243903.4	+	9	1707	c.1670A>T	c.(1669-1671)tAt>tTt	p.Y557F		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	557					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				AGGAAAGAGTATGAAGAAAAG	0.547																																						uc002xjd.2		NA																	0					0						c.(1669-1671)TAT>TTT		ARP5 actin-related protein 5 homolog							107.0	88.0	95.0					20																	37400305		2203	4300	6503	SO:0001583	missense	79913				DNA recombination|double-strand break repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent|UV-damage excision repair	cytoplasm|Ino80 complex	ATP binding|protein binding	g.chr20:37400305A>T	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.1670A>T	20.37:g.37400305A>T	ENSP00000243903:p.Tyr557Phe		Somatic					p.Y557F	NM_024855	NP_079131	WXS	Illumina HiSeq	Unspecified	Q9H9F9	ARP5_HUMAN			9	1695	+		Myeloproliferative disorder(115;0.00878)	557					Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Missense_Mutation	SNP	ENST00000243903.4	37	c.1670A>T	CCDS13308.1	.	.	.	.	.	.	.	.	.	.	A	28.9	4.958378	0.92726	.	.	ENSG00000101442	ENST00000243903	D	0.98585	-5.01	6.05	6.05	0.98169	Actin, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98915	0.9632	M	0.81942	2.565	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.99851	1.1071	10	0.87932	D	0	-14.6092	16.6	0.84812	1.0:0.0:0.0:0.0	.	557	Q9H9F9	ARP5_HUMAN	F	557	ENSP00000243903:Y557F	ENSP00000243903:Y557F	Y	+	2	0	ACTR5	36833719	1.000000	0.71417	0.944000	0.38274	0.869000	0.49853	8.476000	0.90421	2.323000	0.78572	0.533000	0.62120	TAT		0.547	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855		59	84	0	0	0	0	59	84				
CD40	958	broad.mit.edu	37	20	44756820	44756820	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr20:44756820C>G	ENST00000372285.3	+	7	675	c.603C>G	c.(601-603)atC>atG	p.I201M	CD40_ENST00000372276.3_Missense_Mutation_p.L181V|CD40_ENST00000489304.1_3'UTR	NM_001250.4	NP_001241.1	P25942	TNR5_HUMAN	CD40 molecule, TNF receptor superfamily member 5	201					B cell proliferation (GO:0042100)|cellular calcium ion homeostasis (GO:0006874)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|protein complex assembly (GO:0006461)|regulation of immune response (GO:0050776)|regulation of immunoglobulin secretion (GO:0051023)	CD40 receptor complex (GO:0035631)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|enzyme binding (GO:0019899)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10		Myeloproliferative disorder(115;0.0122)				TCCCCATCATCTTCGGGATCC	0.567									Immune Deficiency with Hyper-IgM		OREG0025991	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc002xrg.1		NA																	0				lung(1)|skin(1)	2						c.(601-603)ATC>ATG		CD40 antigen isoform 1 precursor	Simvastatin(DB00641)						190.0	167.0	175.0					20																	44756820		2203	4300	6503	SO:0001583	missense	958	Immune_Deficiency_with_Hyper-IgM	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	B cell proliferation|cellular response to mechanical stimulus|inflammatory response|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein complex assembly	CD40 receptor complex|extracellular region	enzyme binding|receptor activity	g.chr20:44756820C>G	X60592	CCDS13393.1, CCDS13394.1	20q12-q13.2	2014-09-17	2006-03-28	2005-01-14	ENSG00000101017	ENSG00000101017		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11919	protein-coding gene	gene with protein product		109535	"""tumor necrosis factor receptor superfamily, member 5"""	TNFRSF5		7687385, 2998589	Standard	XM_005260617		Approved	p50, Bp50	uc002xrg.1	P25942	OTTHUMG00000033053	ENST00000372285.3:c.603C>G	20.37:g.44756820C>G	ENSP00000361359:p.Ile201Met		Somatic	OREG0025991	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	926	CD40_uc002xrh.1_Missense_Mutation_p.L181V|CD40_uc002xri.1_Missense_Mutation_p.L215V|CD40_uc002xrj.1_RNA|CD40_uc002xrk.1_RNA|CD40_uc002xrl.1_RNA	p.I201M	NM_001250	NP_001241	WXS	Illumina HiSeq	Unspecified	P25942	TNR5_HUMAN			7	680	+		Myeloproliferative disorder(115;0.0122)	201			Helical; (Potential).		E1P5S9|Q53GN5|Q5JY15|Q5U007|Q7M4Q8|Q86YK5|Q9BYU0	Missense_Mutation	SNP	ENST00000372285.3	37	c.603C>G	CCDS13393.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.087|9.087	1.000797|1.000797	0.19121|0.19121	.|.	.|.	ENSG00000101017|ENSG00000101017	ENST00000372285|ENST00000372276	T|T	0.74106|0.80653	-0.81|-1.4	4.58|4.58	-8.3|-8.3	0.01005|0.01005	.|.	14.890700|.	0.00166|.	U|.	0.000007|.	T|T	0.62159|0.62159	0.2405|0.2405	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|B	0.10296|0.02656	0.003|0.0	B|B	0.11329|0.04013	0.006|0.001	T|T	0.48139|0.48139	-0.9061|-0.9061	9|8	0.24483|0.44086	T|T	0.36|0.13	-0.1265|-0.1265	4.9584|4.9584	0.14054|0.14054	0.0825:0.4712:0.1366:0.3096|0.0825:0.4712:0.1366:0.3096	.|.	201|181	P25942|P25942-2	TNR5_HUMAN|.	M|V	201|181	ENSP00000361359:I201M|ENSP00000361350:L181V	ENSP00000361359:I201M|ENSP00000361350:L181V	I|L	+|+	3|1	3|0	CD40|CD40	44190227|44190227	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-4.116000|-4.116000	0.00292|0.00292	-1.318000|-1.318000	0.02289|0.02289	-0.540000|-0.540000	0.04249|0.04249	ATC|CTT		0.567	CD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080376.1	NM_001250		65	144	0	0	0	0	65	144				
TMPRSS15	5651	broad.mit.edu	37	21	19651350	19651350	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr21:19651350C>T	ENST00000284885.3	-	23	2728	c.2695G>A	c.(2695-2697)Gaa>Aaa	p.E899K		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	899	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TGATTTTCTTCCGGTAAACAA	0.323																																						uc002ykw.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						c.(2695-2697)GAA>AAA		enterokinase precursor							36.0	38.0	37.0					21																	19651350		2201	4299	6500	SO:0001583	missense	5651				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity	g.chr21:19651350C>T		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2695G>A	21.37:g.19651350C>T	ENSP00000284885:p.Glu899Lys		Somatic					p.E899K	NM_002772	NP_002763	WXS	Illumina HiSeq	Unspecified	P98073	ENTK_HUMAN			23	2726	-			899			Extracellular (Potential).|Peptidase S1.		Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	c.2695G>A	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146761	0.57151	.	.	ENSG00000154646	ENST00000284885	D	0.88818	-2.43	5.76	5.76	0.90799	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.314329	0.31156	N	0.008158	D	0.83385	0.5243	L	0.33245	0.995	0.44745	D	0.997744	B	0.25351	0.124	B	0.27500	0.08	T	0.78097	-0.2337	9	.	.	.	.	14.2253	0.65855	0.0:0.9267:0.0:0.0733	.	899	P98073	ENTK_HUMAN	K	899	ENSP00000284885:E899K	.	E	-	1	0	TMPRSS15	18573221	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	3.417000	0.52714	2.718000	0.92993	0.650000	0.86243	GAA		0.323	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772		32	62	0	0	0	0	32	62				
ADAMTS5	11096	broad.mit.edu	37	21	28338490	28338490	+	Missense_Mutation	SNP	A	A	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr21:28338490A>C	ENST00000284987.5	-	1	342	c.221T>G	c.(220-222)gTg>gGg	p.V74G		NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	74					defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						GATGTTCTGCACCAGCCCCTT	0.726																																					Esophageal Squamous(53;683 1080 10100 14424 45938)	uc002ymg.2		NA																	0				upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						c.(220-222)GTG>GGG		ADAM metallopeptidase with thrombospondin type 1							33.0	33.0	33.0					21																	28338490		2176	4267	6443	SO:0001583	missense	11096				proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr21:28338490A>C	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.221T>G	21.37:g.28338490A>C	ENSP00000284987:p.Val74Gly		Somatic					p.V74G	NM_007038	NP_008969	WXS	Illumina HiSeq	Unspecified	Q9UNA0	ATS5_HUMAN			1	950	-			74					Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	c.221T>G	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.972975	0.74246	.	.	ENSG00000154736	ENST00000284987	T	0.05925	3.37	4.32	4.32	0.51571	Peptidase M12B, propeptide (1);	0.082635	0.47852	D	0.000201	T	0.10809	0.0264	L	0.34521	1.04	0.80722	D	1	P	0.50272	0.933	P	0.55923	0.787	T	0.32903	-0.9889	10	0.21540	T	0.41	.	12.6223	0.56610	1.0:0.0:0.0:0.0	.	74	Q9UNA0	ATS5_HUMAN	G	74	ENSP00000284987:V74G	ENSP00000284987:V74G	V	-	2	0	ADAMTS5	27260361	.	.	0.912000	0.35992	0.925000	0.55904	.	.	1.797000	0.52628	0.460000	0.39030	GTG		0.726	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1			9	101	0	0	0	0	9	101				
ITSN1	6453	broad.mit.edu	37	21	35166729	35166729	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr21:35166729C>G	ENST00000381318.3	+	17	2197	c.1909C>G	c.(1909-1911)Cga>Gga	p.R637G	AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000437442.2_Missense_Mutation_p.R637G|ITSN1_ENST00000381285.4_Missense_Mutation_p.R637G|ITSN1_ENST00000399326.3_Missense_Mutation_p.R637G|ITSN1_ENST00000399352.1_Missense_Mutation_p.R637G|ITSN1_ENST00000381291.4_Missense_Mutation_p.R637G|ITSN1_ENST00000399353.1_Missense_Mutation_p.R600G|ITSN1_ENST00000399338.4_Missense_Mutation_p.R637G|ITSN1_ENST00000399349.1_Missense_Mutation_p.R637G|ITSN1_ENST00000399355.2_Missense_Mutation_p.R637G|ITSN1_ENST00000399367.3_Missense_Mutation_p.R637G|ITSN1_ENST00000379960.5_Missense_Mutation_p.R637G	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	637	KLERQ.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						AGAACAAGAACGAAAGATCAT	0.373																																						uc002yta.1		NA																	0				ovary(3)|skin(1)	4						c.(1909-1911)CGA>GGA		intersectin 1 isoform ITSN-l							83.0	86.0	85.0					21																	35166729		2203	4300	6503	SO:0001583	missense	6453				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity	g.chr21:35166729C>G	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.1909C>G	21.37:g.35166729C>G	ENSP00000370719:p.Arg637Gly		Somatic				DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Missense_Mutation_p.R637G|ITSN1_uc010gmg.2_Missense_Mutation_p.R600G|ITSN1_uc010gmh.2_RNA|ITSN1_uc002ysw.2_Missense_Mutation_p.R637G|ITSN1_uc010gmi.2_Missense_Mutation_p.R600G|ITSN1_uc010gmj.2_Missense_Mutation_p.R521G|ITSN1_uc002ysy.2_Missense_Mutation_p.R637G|ITSN1_uc002ysx.2_Missense_Mutation_p.R600G|ITSN1_uc002ytb.1_Missense_Mutation_p.R637G|ITSN1_uc002ytc.1_Missense_Mutation_p.R637G|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Missense_Mutation_p.R600G|ITSN1_uc010gml.2_RNA|ITSN1_uc002ytj.2_Missense_Mutation_p.R637G|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Missense_Mutation_p.R571G	p.R637G	NM_003024	NP_003015	WXS	Illumina HiSeq	Unspecified	Q15811	ITSN1_HUMAN			17	2177	+			637			Potential.|KLERQ.		A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	c.1909C>G	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.462100	0.63513	.	.	ENSG00000205726	ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000399338;ENST00000437442;ENST00000399326;ENST00000379960	T;T;T;T;T;T;T;T;T;T;T;T	0.42900	2.57;2.57;2.57;2.57;2.57;2.57;2.57;2.57;1.56;2.57;2.57;0.96	5.76	-0.129	0.13502	.	0.051883	0.64402	D	0.000001	T	0.60932	0.2307	M	0.71036	2.16	0.53688	D	0.999971	D;D;B;D;D;P;D;D;D;D	0.71674	0.997;0.997;0.18;0.961;0.998;0.91;0.978;0.978;0.994;0.989	P;D;B;P;D;B;P;P;D;P	0.69824	0.871;0.927;0.067;0.724;0.914;0.256;0.724;0.724;0.966;0.831	T	0.68254	-0.5457	10	0.87932	D	0	.	16.6423	0.85129	0.6704:0.3296:0.0:0.0	.	600;600;600;637;637;637;637;637;637;600	A8D7D0;A7XZY7;A8CTY7;A8CTY3;F8W7U0;E7ERJ1;A8CTX8;Q15811;Q15811-3;E7ERJ0	.;.;.;.;.;.;.;ITSN1_HUMAN;.;.	G	600;637;637;637;637;637;637;637;637;637;637;637;637;637	ENSP00000382290:R600G;ENSP00000370719:R637G;ENSP00000370691:R637G;ENSP00000370685:R637G;ENSP00000382301:R637G;ENSP00000382289:R637G;ENSP00000382292:R637G;ENSP00000382286:R637G;ENSP00000382275:R637G;ENSP00000387377:R637G;ENSP00000382265:R637G;ENSP00000369294:R637G	ENSP00000369294:R637G	R	+	1	2	ITSN1	34088599	0.931000	0.31567	0.986000	0.45419	0.988000	0.76386	0.253000	0.18296	0.039000	0.15632	-0.152000	0.13540	CGA		0.373	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024		48	84	0	0	0	0	48	84				
LCA5L	150082	broad.mit.edu	37	21	40778524	40778524	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr21:40778524C>T	ENST00000358268.2	-	10	1825	c.1297G>A	c.(1297-1299)Gag>Aag	p.E433K	LCA5L_ENST00000380671.2_Missense_Mutation_p.E433K|LCA5L_ENST00000495240.1_5'UTR|LCA5L_ENST00000288350.3_Missense_Mutation_p.E433K|WRB_ENST00000541890.1_Missense_Mutation_p.S163F			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	433										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				AAATGTTTCTCTTCCCCTGAT	0.333																																						uc002yxu.2		NA																	0					0						c.(1297-1299)GAG>AAG		Leber congenital amaurosis 5-like							65.0	73.0	70.0					21																	40778524		2135	4220	6355	SO:0001583	missense	150082							g.chr21:40778524C>T	AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.1297G>A	21.37:g.40778524C>T	ENSP00000351008:p.Glu433Lys		Somatic				LCA5L_uc002yxv.2_Missense_Mutation_p.E433K	p.E433K	NM_152505	NP_689718	WXS	Illumina HiSeq	Unspecified	O95447	LCA5L_HUMAN			10	1610	-		Prostate(19;1.2e-06)	433			Potential.		D3DSI0|Q3ZCT0	Missense_Mutation	SNP	ENST00000358268.2	37	c.1297G>A	CCDS13665.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.610|8.610	0.888917|0.888917	0.17540|0.17540	.|.	.|.	ENSG00000157578|ENSG00000182093	ENST00000288350;ENST00000380671;ENST00000358268|ENST00000541890	T;T;T|T	0.58506|0.48522	0.33;0.33;0.33|0.81	4.85|4.85	3.96|3.96	0.45880|0.45880	.|.	1.001080|.	0.08059|.	N|.	0.997854|.	T|T	0.44726|0.44726	0.1307|0.1307	L|L	0.47716|0.47716	1.5|1.5	0.24788|0.24788	N|N	0.992777|0.992777	B|.	0.30281|.	0.275|.	B|.	0.27715|.	0.082|.	T|T	0.32025|0.32025	-0.9922|-0.9922	10|7	0.10111|0.34782	T|T	0.7|0.22	-4.9932|-4.9932	7.6902|7.6902	0.28563|0.28563	0.0:0.8059:0.0:0.1941|0.0:0.8059:0.0:0.1941	.|.	433|.	O95447|.	LCA5L_HUMAN|.	K|F	433|163	ENSP00000288350:E433K;ENSP00000370046:E433K;ENSP00000351008:E433K|ENSP00000445363:S163F	ENSP00000288350:E433K|ENSP00000445363:S163F	E|S	-|+	1|2	0|0	LCA5L|WRB	39700394|39700394	0.044000|0.044000	0.20184|0.20184	0.324000|0.324000	0.25361|0.25361	0.021000|0.021000	0.10359|0.10359	1.808000|1.808000	0.38912|0.38912	1.165000|1.165000	0.42670|0.42670	0.655000|0.655000	0.94253|0.94253	GAG|TCT		0.333	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141807.2	NM_152505		59	132	0	0	0	0	59	132				
PCNT	5116	broad.mit.edu	37	21	47851584	47851584	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr21:47851584G>T	ENST00000359568.5	+	38	8313	c.8206G>T	c.(8206-8208)Gag>Tag	p.E2736*	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2736					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GCTGGCTCAGGAGCGGAGCCA	0.637																																						uc002zji.3		NA																	0				ovary(4)|breast(2)|pancreas(2)	8						c.(8206-8208)GAG>TAG		pericentrin							34.0	33.0	34.0					21																	47851584		2203	4300	6503	SO:0001587	stop_gained	5116				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding	g.chr21:47851584G>T	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.8206G>T	21.37:g.47851584G>T	ENSP00000352572:p.Glu2736*		Somatic				PCNT_uc002zjj.2_Nonsense_Mutation_p.E2618*	p.E2736*	NM_006031	NP_006022	WXS	Illumina HiSeq	Unspecified	O95613	PCNT_HUMAN			38	8313	+	Breast(49;0.112)		2736			Potential.		O43152|Q7Z7C9	Nonsense_Mutation	SNP	ENST00000359568.5	37	c.8206G>T	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	G	48	14.561718	0.99801	.	.	ENSG00000160299	ENST00000359568	.	.	.	5.32	5.32	0.75619	.	0.000000	0.34338	N	0.004047	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	18.371	0.90407	0.0:0.0:1.0:0.0	.	.	.	.	X	2736	.	ENSP00000352572:E2736X	E	+	1	0	PCNT	46676012	1.000000	0.71417	0.997000	0.53966	0.146000	0.21551	7.490000	0.81461	2.664000	0.90586	0.655000	0.94253	GAG		0.637	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		18	53	1	0	1.56e-12	1.72e-12	18	53				
PCNT	5116	broad.mit.edu	37	21	47852115	47852115	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr21:47852115G>C	ENST00000359568.5	+	38	8844	c.8737G>C	c.(8737-8739)Gac>Cac	p.D2913H	PCNT_ENST00000480896.1_Intron	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2913					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GTGGCAGAGAGACAAGGAGAA	0.607																																						uc002zji.3		NA																	0				ovary(4)|breast(2)|pancreas(2)	8						c.(8737-8739)GAC>CAC		pericentrin							18.0	22.0	21.0					21																	47852115		2202	4299	6501	SO:0001583	missense	5116				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding	g.chr21:47852115G>C	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.8737G>C	21.37:g.47852115G>C	ENSP00000352572:p.Asp2913His		Somatic				PCNT_uc002zjj.2_Intron	p.D2913H	NM_006031	NP_006022	WXS	Illumina HiSeq	Unspecified	O95613	PCNT_HUMAN			38	8844	+	Breast(49;0.112)		2913			Potential.		O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	c.8737G>C	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994209	0.74703	.	.	ENSG00000160299	ENST00000359568	T	0.01548	4.78	4.7	4.7	0.59300	.	.	.	.	.	T	0.04588	0.0125	N	0.24115	0.695	0.25770	N	0.98484	D	0.76494	0.999	P	0.59703	0.862	T	0.48468	-0.9033	9	0.51188	T	0.08	.	17.0086	0.86400	0.0:0.0:1.0:0.0	.	2913	O95613	PCNT_HUMAN	H	2913	ENSP00000352572:D2913H	ENSP00000352572:D2913H	D	+	1	0	PCNT	46676543	1.000000	0.71417	0.969000	0.41365	0.924000	0.55760	4.899000	0.63245	2.327000	0.79052	0.563000	0.77884	GAC		0.607	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031		6	7	0	0	0	0	6	7				
ISX	91464	broad.mit.edu	37	22	35481475	35481475	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr22:35481475G>A	ENST00000308700.6	+	4	1479	c.527G>A	c.(526-528)cGc>cAc	p.R176H	ISX_ENST00000404699.2_Missense_Mutation_p.R176H	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	176					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						ACTGCTCTGCGCAGGCTGGCT	0.617																																						uc003anj.2		NA																	0				ovary(3)|skin(2)	5						c.(526-528)CGC>CAC		intestine-specific homeobox							130.0	115.0	120.0					22																	35481475		2203	4300	6503	SO:0001583	missense	91464					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr22:35481475G>A	AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.527G>A	22.37:g.35481475G>A	ENSP00000311492:p.Arg176His		Somatic				ISX_uc011amg.1_Missense_Mutation_p.R164H	p.R176H	NM_001008494	NP_001008494	WXS	Illumina HiSeq	Unspecified	Q2M1V0	ISX_HUMAN			4	1478	+			176					Q68DJ5	Missense_Mutation	SNP	ENST00000308700.6	37	c.527G>A	CCDS33640.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.334434	0.24253	.	.	ENSG00000175329	ENST00000308700;ENST00000404699	D;D	0.89617	-2.54;-2.54	5.13	1.81	0.25067	.	1.031180	0.07721	N	0.943663	T	0.72534	0.3472	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.60146	-0.7320	10	0.35671	T	0.21	.	7.3796	0.26847	0.3766:0.4749:0.1484:0.0	.	176	Q2M1V0	ISX_HUMAN	H	176	ENSP00000311492:R176H;ENSP00000386037:R176H	ENSP00000311492:R176H	R	+	2	0	ISX	33811475	0.000000	0.05858	0.001000	0.08648	0.234000	0.25298	-0.051000	0.11885	0.146000	0.19002	-0.247000	0.11927	CGC		0.617	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320662.1	NM_001008494		5	261	0	0	0	0	5	261				
TNRC6B	23112	broad.mit.edu	37	22	40697290	40697290	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr22:40697290G>A	ENST00000454349.2	+	15	4284	c.4073G>A	c.(4072-4074)gGg>gAg	p.G1358E	TNRC6B_ENST00000301923.9_Missense_Mutation_p.G554E|TNRC6B_ENST00000402203.1_Missense_Mutation_p.G554E|TNRC6B_ENST00000335727.9_Missense_Mutation_p.G1248E	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	1358	Silencing domain; interaction with CNOT1 and PAN3.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						TTGAATGTGGGGCTCCCAGAC	0.512																																						uc011aor.1		NA																	0					0						c.(4072-4074)GGG>GAG		trinucleotide repeat containing 6B isoform 1							45.0	48.0	47.0					22																	40697290		2011	4180	6191	SO:0001583	missense	23112				gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding	g.chr22:40697290G>A	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.4073G>A	22.37:g.40697290G>A	ENSP00000401946:p.Gly1358Glu		Somatic				TNRC6B_uc003aym.2_Missense_Mutation_p.G554E|TNRC6B_uc003ayn.3_Missense_Mutation_p.G1248E|TNRC6B_uc003ayo.2_Missense_Mutation_p.G1105E	p.G1358E	NM_001162501	NP_001155973	WXS	Illumina HiSeq	Unspecified	Q9UPQ9	TNR6B_HUMAN			15	4284	+			1358					B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	37	c.4073G>A	CCDS54533.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.2|27.2	4.806059|4.806059	0.90623|0.90623	.|.	.|.	ENSG00000100354|ENSG00000100354	ENST00000301923;ENST00000402203;ENST00000454349;ENST00000400140;ENST00000335727|ENST00000446273	T;T;T;T|T	0.32272|0.13901	1.46;1.46;2.71;2.68|2.55	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.27349|0.27349	0.0671|0.0671	L|L	0.47190|0.47190	1.495|1.495	0.53005|0.53005	D|D	0.999961|0.999961	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.997|.	D;D;D;D|.	0.87578|.	0.975;0.996;0.998;0.913|.	T|T	0.00119|0.00119	-1.2032|-1.2032	10|8	0.22109|0.42905	T|T	0.4|0.14	-1.3469|-1.3469	19.5936|19.5936	0.95526|0.95526	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1358;1248;1248;554|.	Q9UPQ9;A8MYY3;Q9UPQ9-1;Q9UPQ9-2|.	TNR6B_HUMAN;.;.;.|.	E|S	554;554;1358;1248;1248|1044	ENSP00000306759:G554E;ENSP00000384795:G554E;ENSP00000401946:G1358E;ENSP00000338371:G1248E|ENSP00000409429:G1044S	ENSP00000306759:G554E|ENSP00000409429:G1044S	G|G	+|+	2|1	0|0	TNRC6B|TNRC6B	39027236|39027236	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	6.582000|6.582000	0.74049|0.74049	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GGG|GGC		0.512	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding				12	17	0	0	0	0	12	17				
TCF20	6942	broad.mit.edu	37	22	42610152	42610152	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr22:42610152G>A	ENST00000359486.3	-	1	1296	c.1160C>T	c.(1159-1161)tCt>tTt	p.S387F	TCF20_ENST00000335626.4_Missense_Mutation_p.S387F	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	387					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						CATGAGAGGAGATGGGGTAGA	0.512																																						uc003bcj.1		NA																	0				ovary(4)|skin(1)	5						c.(1159-1161)TCT>TTT		transcription factor 20 isoform 1							101.0	103.0	102.0					22																	42610152		2203	4300	6503	SO:0001583	missense	6942				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding	g.chr22:42610152G>A	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.1160C>T	22.37:g.42610152G>A	ENSP00000352463:p.Ser387Phe		Somatic				TCF20_uc003bck.1_Missense_Mutation_p.S387F|TCF20_uc003bnt.2_Missense_Mutation_p.S387F	p.S387F	NM_005650	NP_005641	WXS	Illumina HiSeq	Unspecified	Q9UGU0	TCF20_HUMAN			1	1294	-			387					A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	37	c.1160C>T	CCDS14033.1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.267558	0.59540	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.36340	1.26;1.26	5.85	4.82	0.62117	.	0.082377	0.52532	D	0.000066	T	0.45377	0.1339	M	0.65975	2.015	0.80722	D	1	P;P	0.39131	0.661;0.531	B;B	0.42916	0.402;0.227	T	0.51293	-0.8724	10	0.87932	D	0	-16.6854	16.3522	0.83215	0.0:0.0:0.8669:0.1331	.	387;387	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	F	387	ENSP00000352463:S387F;ENSP00000335561:S387F	ENSP00000335561:S387F	S	-	2	0	TCF20	40940096	1.000000	0.71417	0.980000	0.43619	0.995000	0.86356	9.414000	0.97362	1.456000	0.47831	-0.182000	0.12963	TCT		0.512	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492		62	147	0	0	0	0	62	147				
GRM7	2917	broad.mit.edu	37	3	7188164	7188164	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:7188164C>T	ENST00000357716.4	+	2	819	c.545C>T	c.(544-546)aCg>aTg	p.T182M	GRM7_ENST00000486284.1_Missense_Mutation_p.T182M|GRM7_ENST00000389336.4_Missense_Mutation_p.T182M|GRM7_ENST00000402647.2_Missense_Mutation_p.T182M|GRM7_ENST00000403881.1_Missense_Mutation_p.T182M	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	182	Glutamate binding. {ECO:0000250}.				adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						TATGCATCAACGGCACCCGAG	0.502																																						uc003bqm.2		NA																	0				ovary(4)|lung(3)	7						c.(544-546)ACG>ATG		glutamate receptor, metabotropic 7 isoform a	L-Glutamic Acid(DB00142)						123.0	109.0	113.0					3																	7188164		2203	4300	6503	SO:0001583	missense	2917				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding	g.chr3:7188164C>T	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.545C>T	3.37:g.7188164C>T	ENSP00000350348:p.Thr182Met		Somatic				GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.T182M|GRM7_uc003bql.2_Missense_Mutation_p.T182M	p.T182M	NM_000844	NP_000835	WXS	Illumina HiSeq	Unspecified	Q14831	GRM7_HUMAN			2	819	+			182			Extracellular (Potential).		Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	c.545C>T	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	C	19.22	3.784838	0.70222	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	D;D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54;-2.54	5.74	5.74	0.90152	GPCR, family 3, conserved site (1);Extracellular ligand-binding receptor (1);	0.114252	0.64402	D	0.000019	D	0.96451	0.8842	H	0.95539	3.685	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.996;0.999	D	0.97050	0.9763	10	0.87932	D	0	.	18.8612	0.92273	0.0:1.0:0.0:0.0	.	182;182;182	Q14831-5;Q14831;Q14831-2	.;GRM7_HUMAN;.	M	182	ENSP00000350348:T182M;ENSP00000417536:T182M;ENSP00000373987:T182M;ENSP00000385664:T182M;ENSP00000384585:T182M	ENSP00000350348:T182M	T	+	2	0	GRM7	7163164	1.000000	0.71417	0.949000	0.38748	0.083000	0.17756	7.776000	0.85560	2.873000	0.98535	0.563000	0.77884	ACG		0.502	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		64	56	0	0	0	0	64	56				
RAB5A	5868	broad.mit.edu	37	3	20025262	20025262	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:20025262G>A	ENST00000273047.4	+	6	1131	c.595G>A	c.(595-597)Gta>Ata	p.V199I	RAB5A_ENST00000422242.1_Missense_Mutation_p.V185I	NM_004162.4	NP_004153.2	P20339	RAB5A_HUMAN	RAB5A, member RAS oncogene family	199					blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|GTP catabolic process (GO:0006184)|nervous system development (GO:0007399)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)|regulation of endosome size (GO:0051036)|regulation of filopodium assembly (GO:0051489)|regulation of synaptic vesicle exocytosis (GO:2000300)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytoplasmic side of early endosome membrane (GO:0098559)|cytosol (GO:0005829)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|somatodendritic compartment (GO:0036477)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			lung(1)|urinary_tract(1)	2						AGGAAGAGGAGTAGACCTTAC	0.368																																						uc003cbn.2		NA																	0					0						c.(595-597)GTA>ATA		RAB5A, member RAS oncogene family							99.0	84.0	89.0					3																	20025262		2203	4300	6503	SO:0001583	missense	5868				blood coagulation|protein transport|receptor internalization|regulation of filopodium assembly|small GTPase mediated signal transduction	early endosome membrane|melanosome|plasma membrane	GDP binding|GTP binding|GTPase activity	g.chr3:20025262G>A		CCDS2633.1	3p24-p22	2008-07-18			ENSG00000144566	ENSG00000144566		"""RAB, member RAS oncogene"""	9783	protein-coding gene	gene with protein product	"""RAS-associated protein RAB5A"""	179512		RAB5		1999336	Standard	NM_004162		Approved		uc003cbn.3	P20339	OTTHUMG00000129889	ENST00000273047.4:c.595G>A	3.37:g.20025262G>A	ENSP00000273047:p.Val199Ile		Somatic				RAB5A_uc010hey.2_RNA|RAB5A_uc011awg.1_Missense_Mutation_p.V185I|C3orf48_uc010hez.2_Intron	p.V199I	NM_004162	NP_004153	WXS	Illumina HiSeq	Unspecified	P20339	RAB5A_HUMAN			6	1130	+			199					B4DJA5|Q6FI44	Missense_Mutation	SNP	ENST00000273047.4	37	c.595G>A	CCDS2633.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705951	0.48412	.	.	ENSG00000144566	ENST00000273047;ENST00000422242	T;T	0.68181	-0.09;-0.31	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.48978	0.1530	N	0.08118	0	0.80722	D	1	B;B	0.17268	0.009;0.021	B;B	0.17722	0.013;0.019	T	0.43261	-0.9402	9	.	.	.	-19.037	19.6888	0.95989	0.0:0.0:1.0:0.0	.	185;199	B4DJA5;P20339	.;RAB5A_HUMAN	I	199;185	ENSP00000273047:V199I;ENSP00000411941:V185I	.	V	+	1	0	RAB5A	20000266	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	8.965000	0.93393	2.652000	0.90054	0.591000	0.81541	GTA		0.368	RAB5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252137.2	NM_004162		9	16	0	0	0	0	9	16				
UBP1	7342	broad.mit.edu	37	3	33481236	33481236	+	Silent	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:33481236G>A	ENST00000283629.3	-	1	634	c.105C>T	c.(103-105)taC>taT	p.Y35Y	UBP1_ENST00000283628.5_Silent_p.Y35Y|UBP1_ENST00000447368.2_Silent_p.Y35Y	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	35					angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						ACCTCATGCTGTAAGCGCCGG	0.667																																						uc003cfq.3		NA																	0				kidney(2)	2						c.(103-105)TAC>TAT		upstream binding protein 1 (LBP-1a) isoform a							42.0	46.0	45.0					3																	33481236		2203	4300	6503	SO:0001819	synonymous_variant	7342				negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|viral genome replication	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr3:33481236G>A	AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.105C>T	3.37:g.33481236G>A			Somatic				UBP1_uc003cfr.3_Silent_p.Y35Y|UBP1_uc010hga.2_Silent_p.Y35Y	p.Y35Y	NM_014517	NP_055332	WXS	Illumina HiSeq	Unspecified	Q9NZI7	UBIP1_HUMAN			1	635	-			35					Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Silent	SNP	ENST00000283629.3	37	c.105C>T	CCDS2659.1																																																																																				0.667	UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253249.2	NM_014517		33	27	0	0	0	0	33	27				
SCN11A	11280	broad.mit.edu	37	3	38888755	38888755	+	Silent	SNP	C	C	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:38888755C>A	ENST00000302328.3	-	26	5004	c.4806G>T	c.(4804-4806)gtG>gtT	p.V1602V	SCN11A_ENST00000456224.3_Silent_p.V1564V|SCN11A_ENST00000450244.1_Silent_p.V1602V	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1602					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTCTAAAATCACAGCAATGT	0.413																																						uc011ays.1		NA																	0				skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9						c.(4804-4806)GTG>GTT		sodium channel, voltage-gated, type XI, alpha	Cocaine(DB00907)						117.0	118.0	118.0					3																	38888755		2203	4300	6503	SO:0001819	synonymous_variant	11280				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr3:38888755C>A	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.4806G>T	3.37:g.38888755C>A			Somatic					p.V1602V	NM_014139	NP_054858	WXS	Illumina HiSeq	Unspecified	Q9UI33	SCNBA_HUMAN		Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	26	5005	-			1602			IV.|Helical; Name=S6 of repeat IV; (By similarity).		A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	37	c.4806G>T	CCDS33737.1																																																																																				0.413	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139		4	148	1	0	0.00024832	0.000262325	4	148				
ULK4	54986	broad.mit.edu	37	3	41877374	41877374	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:41877374G>C	ENST00000301831.4	-	18	2208	c.1746C>G	c.(1744-1746)atC>atG	p.I582M		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	582					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		CTACAAGATAGATCAGCTCCC	0.393																																						uc003ckv.3		NA																	0					0						c.(1744-1746)ATC>ATG		unc-51-like kinase 4							137.0	138.0	138.0					3																	41877374		1862	4097	5959	SO:0001583	missense	54986						ATP binding|protein serine/threonine kinase activity	g.chr3:41877374G>C	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.1746C>G	3.37:g.41877374G>C	ENSP00000301831:p.Ile582Met		Somatic				ULK4_uc003ckw.2_Missense_Mutation_p.I582M	p.I582M	NM_017886	NP_060356	WXS	Illumina HiSeq	Unspecified	Q96C45	ULK4_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.214)	18	1947	-			582					A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	37	c.1746C>G	CCDS43071.1	.	.	.	.	.	.	.	.	.	.	G	11.07	1.529721	0.27387	.	.	ENSG00000168038	ENST00000301831	T	0.66815	-0.23	5.56	3.72	0.42706	Armadillo-like helical (1);Armadillo-type fold (2);	0.221632	0.37715	U	0.001962	T	0.50514	0.1620	L	0.29908	0.895	0.80722	D	1	B;B	0.25351	0.074;0.124	B;B	0.24155	0.051;0.051	T	0.44251	-0.9340	10	0.46703	T	0.11	.	6.9664	0.24625	0.1094:0.3219:0.5687:0.0	.	582;582	B4E2M4;Q96C45	.;ULK4_HUMAN	M	582	ENSP00000301831:I582M	ENSP00000301831:I582M	I	-	3	3	ULK4	41852378	1.000000	0.71417	0.995000	0.50966	0.900000	0.52787	1.204000	0.32296	0.769000	0.33313	0.650000	0.86243	ATC		0.393	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989		4	166	0	0	0	0	4	166				
PDE12	201626	broad.mit.edu	37	3	57543358	57543358	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:57543358C>G	ENST00000311180.8	+	1	1355	c.1252C>G	c.(1252-1254)Cta>Gta	p.L418V	PDE12_ENST00000487257.1_Missense_Mutation_p.L418V	NM_177966.5	NP_808881.3	Q6L8Q7	PDE12_HUMAN	phosphodiesterase 12	418					mRNA processing (GO:0006397)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(4)|lung(3)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)		GCTGGAGAAACTAGTTTTGTA	0.468																																					Colon(125;308 1634 19198 50622 50717)	uc003diw.3		NA																	0					0						c.(1252-1254)CTA>GTA		phosphodiesterase 12							71.0	74.0	73.0					3																	57543358		2203	4300	6503	SO:0001583	missense	201626						hydrolase activity	g.chr3:57543358C>G	AK074423	CCDS33772.1	3p14.3	2013-10-11			ENSG00000174840	ENSG00000174840			25386	protein-coding gene	gene with protein product	"""2'-phosphodiesterase"""					15231837	Standard	NM_177966		Approved	DKFZp667B1218, 2'-PDE	uc003diw.4	Q6L8Q7	OTTHUMG00000158599	ENST00000311180.8:c.1252C>G	3.37:g.57543358C>G	ENSP00000309142:p.Leu418Val		Somatic				PDE12_uc003div.2_Missense_Mutation_p.L418V	p.L418V	NM_177966	NP_808881	WXS	Illumina HiSeq	Unspecified	Q6L8Q7	PDE12_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)	1	1378	+			418					B4DTU8|Q8IYU3|Q8NDU2|Q8TE78	Missense_Mutation	SNP	ENST00000311180.8	37	c.1252C>G	CCDS33772.1	.	.	.	.	.	.	.	.	.	.	C	8.996	0.978794	0.18812	.	.	ENSG00000174840	ENST00000487257;ENST00000311180	T;T	0.81163	-1.46;-1.46	5.56	3.77	0.43336	Endonuclease/exonuclease/phosphatase (2);	0.198276	0.45606	D	0.000356	T	0.70351	0.3214	N	0.22421	0.69	0.42742	D	0.993749	B;P	0.34629	0.173;0.46	B;B	0.40329	0.326;0.279	T	0.62803	-0.6777	10	0.21014	T	0.42	-4.1127	11.1862	0.48657	0.0:0.8025:0.1286:0.0689	.	418;418	Q6L8Q7;F6T1Q0	PDE12_HUMAN;.	V	418	ENSP00000420626:L418V;ENSP00000309142:L418V	ENSP00000309142:L418V	L	+	1	2	PDE12	57518398	0.978000	0.34361	0.767000	0.31495	0.992000	0.81027	0.555000	0.23422	0.714000	0.32081	0.655000	0.94253	CTA		0.468	PDE12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351440.2	NM_177966		50	41	0	0	0	0	50	41				
STXBP5L	9515	broad.mit.edu	37	3	121100262	121100262	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:121100262A>G	ENST00000273666.6	+	23	2813	c.2542A>G	c.(2542-2544)Acc>Gcc	p.T848A	STXBP5L_ENST00000471454.1_Missense_Mutation_p.T824A|STXBP5L_ENST00000492541.1_Missense_Mutation_p.T848A|STXBP5L_ENST00000497029.1_Missense_Mutation_p.T822A|STXBP5L_ENST00000472879.1_Missense_Mutation_p.T824A	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	848					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		AAATGACTCTACCATCTCTCC	0.408																																						uc003eec.3		NA																	0				ovary(7)|skin(2)	9						c.(2542-2544)ACC>GCC		syntaxin binding protein 5-like							187.0	177.0	180.0					3																	121100262		1896	4121	6017	SO:0001583	missense	9515				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane		g.chr3:121100262A>G	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.2542A>G	3.37:g.121100262A>G	ENSP00000273666:p.Thr848Ala		Somatic				STXBP5L_uc011bji.1_Missense_Mutation_p.T824A	p.T848A	NM_014980	NP_055795	WXS	Illumina HiSeq	Unspecified	Q9Y2K9	STB5L_HUMAN		GBM - Glioblastoma multiforme(114;0.0694)	23	2682	+			848			WD 11.		Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	37	c.2542A>G	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	A	7.856	0.725112	0.15439	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.41065	1.01;1.01;2.01;2.01;2.01;1.01	5.1	1.35	0.21983	Lethal giant larvae (Lgl)-like, C-terminal (1);	0.413956	0.27558	N	0.018831	T	0.15912	0.0383	N	0.10874	0.06	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.08055	0.003;0.003	T	0.20840	-1.0263	10	0.07813	T	0.8	-0.2672	3.3044	0.06994	0.4888:0.0:0.2395:0.2716	.	824;848	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	A	848;824;824;822;848;791	ENSP00000273666:T848A;ENSP00000420019:T824A;ENSP00000419627:T824A;ENSP00000420287:T822A;ENSP00000420666:T848A;ENSP00000420167:T791A	ENSP00000273666:T848A	T	+	1	0	STXBP5L	122582952	0.009000	0.17119	0.896000	0.35187	0.997000	0.91878	0.815000	0.27253	0.082000	0.17018	0.528000	0.53228	ACC		0.408	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3			108	263	0	0	0	0	108	263				
MED12L	116931	broad.mit.edu	37	3	151148153	151148153	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:151148153C>G	ENST00000474524.1	+	42	6408	c.6370C>G	c.(6370-6372)Cag>Gag	p.Q2124E	MED12L_ENST00000273432.4_Missense_Mutation_p.Q1788E	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	2124	Gln-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GCGGCAGCTCCAGAAGCAGCT	0.537																																						uc003eyp.2		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						c.(6370-6372)CAG>GAG		mediator of RNA polymerase II transcription,							47.0	50.0	49.0					3																	151148153		2203	4300	6503	SO:0001583	missense	116931				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex		g.chr3:151148153C>G	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.6370C>G	3.37:g.151148153C>G	ENSP00000417235:p.Gln2124Glu		Somatic				MED12L_uc011bnz.1_Missense_Mutation_p.Q1788E	p.Q2124E	NM_053002	NP_443728	WXS	Illumina HiSeq	Unspecified	Q86YW9	MD12L_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		42	6408	+			2124			Gln-rich.		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	c.6370C>G	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.502320	0.64298	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.61742	0.16;0.08	5.11	5.11	0.69529	.	0.121439	0.56097	D	0.000023	T	0.63224	0.2493	L	0.32530	0.975	0.80722	D	1	P;P	0.43578	0.811;0.713	P;P	0.54924	0.764;0.585	T	0.65047	-0.6263	10	0.54805	T	0.06	-14.8891	17.2954	0.87169	0.0:1.0:0.0:0.0	.	1788;2124	F8WAE6;Q86YW9	.;MD12L_HUMAN	E	2124;1788	ENSP00000417235:Q2124E;ENSP00000273432:Q1788E	ENSP00000273432:Q1788E	Q	+	1	0	MED12L	152630843	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.238000	0.65366	2.383000	0.81215	0.650000	0.86243	CAG		0.537	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002		47	150	0	0	0	0	47	150				
P2RY1	5028	broad.mit.edu	37	3	152554038	152554038	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:152554038C>T	ENST00000305097.3	+	1	1303	c.467C>T	c.(466-468)cCc>cTc	p.P156L		NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	156					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			GTGGTGTACCCCCTCAAGTCC	0.527																																						uc003ezq.2		NA																	0				lung(1)	1						c.(466-468)CCC>CTC		purinergic receptor P2Y1							112.0	91.0	99.0					3																	152554038		2203	4300	6503	SO:0001583	missense	5028				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chr3:152554038C>T	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.467C>T	3.37:g.152554038C>T	ENSP00000304767:p.Pro156Leu		Somatic					p.P156L	NM_002563	NP_002554	WXS	Illumina HiSeq	Unspecified	P47900	P2RY1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)		1	1303	+			156			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000305097.3	37	c.467C>T	CCDS3169.1	.	.	.	.	.	.	.	.	.	.	C	33	5.243113	0.95272	.	.	ENSG00000169860	ENST00000305097	T	0.61274	0.12	5.76	5.76	0.90799	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.83585	0.5286	H	0.94503	3.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87646	0.2525	10	0.87932	D	0	.	18.9739	0.92728	0.0:1.0:0.0:0.0	.	156	P47900	P2RY1_HUMAN	L	156	ENSP00000304767:P156L	ENSP00000304767:P156L	P	+	2	0	P2RY1	154036728	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.711000	0.84669	2.706000	0.92434	0.655000	0.94253	CCC		0.527	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563		31	135	0	0	0	0	31	135				
P2RY1	5028	broad.mit.edu	37	3	152554042	152554042	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:152554042C>T	ENST00000305097.3	+	1	1307	c.471C>T	c.(469-471)ctC>ctT	p.L157L		NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	157					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			TGTACCCCCTCAAGTCCCTGG	0.532																																						uc003ezq.2		NA																	0				lung(1)	1						c.(469-471)CTC>CTT		purinergic receptor P2Y1							114.0	93.0	100.0					3																	152554042		2203	4300	6503	SO:0001819	synonymous_variant	5028				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chr3:152554042C>T	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.471C>T	3.37:g.152554042C>T			Somatic					p.L157L	NM_002563	NP_002554	WXS	Illumina HiSeq	Unspecified	P47900	P2RY1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)		1	1307	+			157			Cytoplasmic (Potential).			Silent	SNP	ENST00000305097.3	37	c.471C>T	CCDS3169.1																																																																																				0.532	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563		31	138	0	0	0	0	31	138				
P2RY1	5028	broad.mit.edu	37	3	152554482	152554482	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:152554482C>T	ENST00000305097.3	+	1	1747	c.911C>T	c.(910-912)gCc>gTc	p.A304V	RP11-38P22.2_ENST00000460407.1_lincRNA	NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	304					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			AGGGTTTATGCCACGTATCAG	0.478																																						uc003ezq.2		NA																	0				lung(1)	1						c.(910-912)GCC>GTC		purinergic receptor P2Y1							108.0	110.0	110.0					3																	152554482		2203	4300	6503	SO:0001583	missense	5028				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chr3:152554482C>T	U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.911C>T	3.37:g.152554482C>T	ENSP00000304767:p.Ala304Val		Somatic					p.A304V	NM_002563	NP_002554	WXS	Illumina HiSeq	Unspecified	P47900	P2RY1_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)		1	1747	+			304			Helical; Name=7; (Potential).			Missense_Mutation	SNP	ENST00000305097.3	37	c.911C>T	CCDS3169.1	.	.	.	.	.	.	.	.	.	.	C	12.84	2.058394	0.36277	.	.	ENSG00000169860	ENST00000305097	T	0.12984	2.63	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.23492	0.0568	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.05937	-1.0855	10	0.11794	T	0.64	.	18.5615	0.91101	0.0:1.0:0.0:0.0	.	304	P47900	P2RY1_HUMAN	V	304	ENSP00000304767:A304V	ENSP00000304767:A304V	A	+	2	0	P2RY1	154037172	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.711000	0.84669	2.618000	0.88619	0.563000	0.77884	GCC		0.478	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356943.1	NM_002563		5	264	0	0	0	0	5	264				
VEPH1	79674	broad.mit.edu	37	3	156979086	156979086	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:156979086C>A	ENST00000362010.2	-	14	2646	c.2339G>T	c.(2338-2340)aGg>aTg	p.R780M	RP11-550I24.2_ENST00000488040.1_RNA|VEPH1_ENST00000392833.2_Missense_Mutation_p.R735M|VEPH1_ENST00000392832.2_Missense_Mutation_p.R780M|VEPH1_ENST00000543418.1_Missense_Mutation_p.R735M|RP11-550I24.2_ENST00000475102.1_RNA|RP11-550I24.2_ENST00000487238.1_RNA	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	780	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			AGAGCGGTCCCTGCGTTTCTT	0.483																																						uc003fbj.1		NA																	0				breast(3)|ovary(1)|lung(1)	5						c.(2338-2340)AGG>ATG		ventricular zone expressed PH domain homolog 1							77.0	81.0	80.0					3																	156979086		2203	4300	6503	SO:0001583	missense	79674					plasma membrane		g.chr3:156979086C>A	AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.2339G>T	3.37:g.156979086C>A	ENSP00000354919:p.Arg780Met		Somatic				VEPH1_uc003fbk.1_Missense_Mutation_p.R780M|VEPH1_uc010hvu.1_Missense_Mutation_p.R735M	p.R780M	NM_024621	NP_078897	WXS	Illumina HiSeq	Unspecified	Q14D04	MELT_HUMAN	Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)		14	2656	-			780			PH.		D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Missense_Mutation	SNP	ENST00000362010.2	37	c.2339G>T	CCDS3179.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.439821	0.83885	.	.	ENSG00000197415	ENST00000392833;ENST00000362010;ENST00000543418;ENST00000392832	T;T;T;T	0.12361	2.69;2.78;2.69;2.78	5.17	5.17	0.71159	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.39145	0.1067	M	0.72118	2.19	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.80764	0.967;0.994	T	0.20371	-1.0277	10	0.66056	D	0.02	-6.4734	18.6938	0.91593	0.0:1.0:0.0:0.0	.	735;780	Q14D04-2;Q14D04	.;MELT_HUMAN	M	735;780;735;780	ENSP00000376578:R735M;ENSP00000354919:R780M;ENSP00000446258:R735M;ENSP00000376577:R780M	ENSP00000354919:R780M	R	-	2	0	VEPH1	158461780	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.786000	0.62425	2.408000	0.81797	0.655000	0.94253	AGG		0.483	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351845.3	NM_024621		4	226	1	0	0.000602214	0.000633431	4	226				
SERPINI2	5276	broad.mit.edu	37	3	167167167	167167167	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:167167167G>A	ENST00000476257.1	-	8	1286	c.988C>T	c.(988-990)Caa>Taa	p.Q330*	SERPINI2_ENST00000471111.1_Nonsense_Mutation_p.Q330*|SERPINI2_ENST00000461846.1_Nonsense_Mutation_p.Q330*|SERPINI2_ENST00000264677.4_Nonsense_Mutation_p.Q330*			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	330					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						TGCGTCACTTGGGAAACATAC	0.338																																						uc003fer.1		NA																	0				skin(2)|urinary_tract(1)	3						c.(988-990)CAA>TAA		serpin peptidase inhibitor, clade I (pancpin),							82.0	75.0	77.0					3																	167167167		2203	4300	6503	SO:0001587	stop_gained	5276				cellular component movement|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity	g.chr3:167167167G>A	AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.988C>T	3.37:g.167167167G>A	ENSP00000420621:p.Gln330*		Somatic				SERPINI2_uc003fes.1_Nonsense_Mutation_p.Q340*|SERPINI2_uc003fet.1_Nonsense_Mutation_p.Q330*	p.Q330*	NM_006217	NP_006208	WXS	Illumina HiSeq	Unspecified	O75830	SPI2_HUMAN			6	1046	-			330						Nonsense_Mutation	SNP	ENST00000476257.1	37	c.988C>T	CCDS3200.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212013	0.58452	.	.	ENSG00000114204	ENST00000476257;ENST00000461846;ENST00000264677;ENST00000471111	.	.	.	5.63	-0.865	0.10662	.	0.440528	0.24447	N	0.038446	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4868	0.75573	0.0:0.0:0.2545:0.7455	.	.	.	.	X	330	.	ENSP00000264677:Q330X	Q	-	1	0	SERPINI2	168649861	0.001000	0.12720	0.174000	0.22961	0.479000	0.33129	0.318000	0.19504	0.150000	0.19136	0.563000	0.77884	CAA		0.338	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350450.1	NM_006217		3	89	0	0	0	0	3	89				
KLHL6	89857	broad.mit.edu	37	3	183225976	183225976	+	Silent	SNP	G	G	A	rs376809796		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr3:183225976G>A	ENST00000341319.3	-	3	815	c.780C>T	c.(778-780)aaC>aaT	p.N260N		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	260	BACK.				B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			GTAAGCGCACGTTCTCGAGGA	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		19989	0.001		0.0	False		,,,				2504	0.0					uc003flr.2		NA																	0				haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3						c.(778-780)AAC>AAT		kelch-like 6		G		0,4406		0,0,2203	156.0	141.0	146.0		780	-11.7	0.1	3		146	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KLHL6	NM_130446.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		260/622	183225976	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	89857							g.chr3:183225976G>A	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.780C>T	3.37:g.183225976G>A			Somatic				KLHL6_uc003fls.1_RNA|KLHL6_uc003flt.1_Silent_p.N258N	p.N260N	NM_130446	NP_569713	WXS	Illumina HiSeq	Unspecified	Q8WZ60	KLHL6_HUMAN	all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)		3	838	-	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		260			BACK.		B2RB31|D3DNS8|Q8N5I1|Q8N892	Silent	SNP	ENST00000341319.3	37	c.780C>T	CCDS3245.2																																																																																				0.577	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446		89	217	0	0	0	0	89	217				
BOD1L1	259282	broad.mit.edu	37	4	13602595	13602595	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr4:13602595C>G	ENST00000040738.5	-	10	6064	c.5929G>C	c.(5929-5931)Ggt>Cgt	p.G1977R		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1977						nucleus (GO:0005634)	DNA binding (GO:0003677)										GTCATAGGACCCTCACAACCT	0.483																																						uc003gmz.1		NA																	0				ovary(5)|breast(1)	6						c.(5929-5931)GGT>CGT		biorientation of chromosomes in cell division							142.0	136.0	138.0					4																	13602595		2203	4300	6503	SO:0001583	missense	259282						DNA binding	g.chr4:13602595C>G	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.5929G>C	4.37:g.13602595C>G	ENSP00000040738:p.Gly1977Arg		Somatic				BOD1L_uc010idr.1_Missense_Mutation_p.G1314R	p.G1977R	NM_148894	NP_683692	WXS	Illumina HiSeq	Unspecified	Q8NFC6	BOD1L_HUMAN			10	6046	-			1977					Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	c.5929G>C	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	C	14.31	2.497950	0.44455	.	.	ENSG00000038219	ENST00000040738	T	0.09445	2.98	5.55	3.79	0.43588	.	0.317619	0.27159	N	0.020647	T	0.08846	0.0219	L	0.29908	0.895	0.09310	N	1	B	0.18013	0.025	B	0.16722	0.016	T	0.24404	-1.0161	10	0.72032	D	0.01	0.0038	9.5371	0.39229	0.2874:0.5737:0.1388:0.0	.	1977	Q8NFC6	BOD1L_HUMAN	R	1977	ENSP00000040738:G1977R	ENSP00000040738:G1977R	G	-	1	0	BOD1L	13211693	0.000000	0.05858	0.084000	0.20598	0.720000	0.41350	0.463000	0.21972	0.667000	0.31107	0.561000	0.74099	GGT		0.483	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894		44	51	0	0	0	0	44	51				
REST	5978	broad.mit.edu	37	4	57785989	57785989	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr4:57785989C>G	ENST00000309042.7	+	3	1249	c.935C>G	c.(934-936)tCa>tGa	p.S312*	REST_ENST00000514063.1_3'UTR	NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	312					cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					TGTCCTTACTCAAGTTCTCAG	0.328																																						uc003hch.2		NA																	0				skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9						c.(934-936)TCA>TGA		RE1-silencing transcription factor							100.0	104.0	102.0					4																	57785989		2203	4300	6503	SO:0001587	stop_gained	5978				cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding	g.chr4:57785989C>G	U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.935C>G	4.37:g.57785989C>G	ENSP00000311816:p.Ser312*		Somatic				REST_uc003hci.2_Nonsense_Mutation_p.S312*|REST_uc010ihf.2_5'UTR	p.S312*	NM_005612	NP_005603	WXS	Illumina HiSeq	Unspecified	Q13127	REST_HUMAN			3	1282	+	Glioma(25;0.08)|all_neural(26;0.181)		312			C2H2-type 5.		A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Nonsense_Mutation	SNP	ENST00000309042.7	37	c.935C>G	CCDS3509.1	.	.	.	.	.	.	.	.	.	.	C	40	8.478837	0.98829	.	.	ENSG00000084093	ENST00000456010;ENST00000309042	.	.	.	5.93	5.08	0.68730	.	0.000000	0.52532	D	0.000080	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-13.1898	16.7999	0.85611	0.0:0.8709:0.129:0.0	.	.	.	.	X	312	.	ENSP00000311816:S312X	S	+	2	0	REST	57480746	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.678000	0.84035	1.484000	0.48361	-0.176000	0.13171	TCA		0.328	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612		40	44	0	0	0	0	40	44				
CENPE	1062	broad.mit.edu	37	4	104068527	104068527	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr4:104068527C>T	ENST00000265148.3	-	29	4209	c.4120G>A	c.(4120-4122)Gaa>Aaa	p.E1374K	CENPE_ENST00000380026.3_Missense_Mutation_p.E1349K	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1374					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		GCCAAAGTTTCTCTAATATGT	0.323																																						uc003hxb.1		NA																	0				ovary(5)|breast(4)	9						c.(4120-4122)GAA>AAA		centromere protein E							81.0	81.0	81.0					4																	104068527		2203	4300	6503	SO:0001583	missense	1062				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity	g.chr4:104068527C>T	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.4120G>A	4.37:g.104068527C>T	ENSP00000265148:p.Glu1374Lys		Somatic				CENPE_uc003hxc.1_Missense_Mutation_p.E1349K	p.E1374K	NM_001813	NP_001804	WXS	Illumina HiSeq	Unspecified	Q02224	CENPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)	29	4210	-			1374			Potential.		A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	c.4120G>A	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.859677	0.51376	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.72725	-0.68;-0.68	5.03	2.33	0.28932	.	.	.	.	.	T	0.63117	0.2484	M	0.75777	2.31	0.09310	N	1	B;B	0.26318	0.017;0.146	B;B	0.19666	0.007;0.026	T	0.48843	-0.8999	9	0.11794	T	0.64	.	6.6062	0.22726	0.0:0.6896:0.0:0.3104	.	1349;1374	Q02224-3;Q02224	.;CENPE_HUMAN	K	1374;1374;1349	ENSP00000265148:E1374K;ENSP00000369365:E1349K	ENSP00000265148:E1374K	E	-	1	0	CENPE	104287976	0.000000	0.05858	0.700000	0.30305	0.770000	0.43624	0.101000	0.15251	0.151000	0.19162	0.591000	0.81541	GAA		0.323	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				7	100	0	0	0	0	7	100				
IRX4	50805	broad.mit.edu	37	5	1879734	1879734	+	Missense_Mutation	SNP	G	G	T	rs376873295		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr5:1879734G>T	ENST00000505790.1	-	5	1076	c.620C>A	c.(619-621)aCg>aAg	p.T207K	IRX4_ENST00000505938.1_5'UTR|IRX4_ENST00000513692.1_Missense_Mutation_p.T207K|IRX4_ENST00000231357.2_Missense_Mutation_p.T207K	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	207					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		CGGCGGCCACGTCATCTTGTT	0.657																																						uc003jcz.2		NA																	0					0						c.(619-621)ACG>AAG		iroquois homeobox 4							73.0	64.0	67.0					5																	1879734		2203	4300	6503	SO:0001583	missense	50805				heart development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr5:1879734G>T	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.620C>A	5.37:g.1879734G>T	ENSP00000423161:p.Thr207Lys		Somatic				IRX4_uc011cmf.1_Missense_Mutation_p.T68K	p.T207K	NM_016358	NP_057442	WXS	Illumina HiSeq	Unspecified	P78413	IRX4_HUMAN		GBM - Glioblastoma multiforme(108;0.242)	4	739	-			207					B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Missense_Mutation	SNP	ENST00000505790.1	37	c.620C>A	CCDS3867.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199106	0.79015	.	.	ENSG00000113430	ENST00000231357;ENST00000505790;ENST00000513692	D;D;D	0.83250	-1.7;-1.7;-1.7	4.55	4.55	0.56014	Homeodomain-related (1);Homeobox (1);	0.000000	0.85682	D	0.000000	D	0.89146	0.6632	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.90331	0.4352	10	0.66056	D	0.02	-27.8391	16.0968	0.81132	0.0:0.0:1.0:0.0	.	207	P78413	IRX4_HUMAN	K	207	ENSP00000231357:T207K;ENSP00000423161:T207K;ENSP00000424235:T207K	ENSP00000231357:T207K	T	-	2	0	IRX4	1932734	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.259000	0.95561	2.067000	0.61834	0.462000	0.41574	ACG		0.657	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358		35	73	1	0	1.07e-15	1.2e-15	35	73				
ADCY2	108	broad.mit.edu	37	5	7802384	7802384	+	Silent	SNP	G	G	A	rs201615098		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr5:7802384G>A	ENST00000338316.4	+	21	2771	c.2682G>A	c.(2680-2682)ccG>ccA	p.P894P	ADCY2_ENST00000537121.1_Silent_p.P714P	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	894					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.P894P(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CCTCCATTCCGGATTTCAAAG	0.473																																						uc003jdz.1		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(5)|pancreas(1)|skin(1)	7						c.(2680-2682)CCG>CCA		adenylate cyclase 2		G		0,4406		0,0,2203	79.0	78.0	79.0		2682	0.3	1.0	5		79	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ADCY2	NM_020546.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		894/1092	7802384	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	108				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding	g.chr5:7802384G>A	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2682G>A	5.37:g.7802384G>A			Somatic				ADCY2_uc011cmo.1_Silent_p.P714P|ADCY2_uc010itm.1_Silent_p.P90P	p.P894P	NM_020546	NP_065433	WXS	Illumina HiSeq	Unspecified	Q08462	ADCY2_HUMAN			21	2749	+			894			Cytoplasmic (Potential).		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	c.2682G>A	CCDS3872.2																																																																																				0.473	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546		32	53	0	0	0	0	32	53				
FBXL7	23194	broad.mit.edu	37	5	15928296	15928296	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr5:15928296G>A	ENST00000504595.1	+	3	906	c.425G>A	c.(424-426)cGc>cAc	p.R142H	FBXL7_ENST00000510662.1_Missense_Mutation_p.R95H|FBXL7_ENST00000329673.7_Missense_Mutation_p.R130H	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	142	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						CGAGTGTGCCGCCGCTGGTAC	0.672																																						uc003jfn.1		NA																	0				ovary(2)|lung(1)	3						c.(424-426)CGC>CAC		F-box and leucine-rich repeat protein 7							13.0	17.0	16.0					5																	15928296		2070	4213	6283	SO:0001583	missense	23194				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	g.chr5:15928296G>A	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.425G>A	5.37:g.15928296G>A	ENSP00000423630:p.Arg142His		Somatic					p.R142H	NM_012304	NP_036436	WXS	Illumina HiSeq	Unspecified	Q9UJT9	FBXL7_HUMAN			3	906	+			142			F-box.		B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	37	c.425G>A	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	G	34	5.388436	0.95988	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.58358	0.34;0.34;0.34	5.46	5.46	0.80206	F-box domain, cyclin-like (3);F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.65481	0.2695	M	0.79805	2.47	0.80722	D	1	D	0.55605	0.972	P	0.48770	0.589	T	0.68577	-0.5372	10	0.42905	T	0.14	.	19.3032	0.94151	0.0:0.0:1.0:0.0	.	142	Q9UJT9	FBXL7_HUMAN	H	142;95;130	ENSP00000423630:R142H;ENSP00000425184:R95H;ENSP00000329632:R130H	ENSP00000329632:R130H	R	+	2	0	FBXL7	15981296	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.827000	0.99397	2.576000	0.86940	0.561000	0.74099	CGC		0.672	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304		9	15	0	0	0	0	9	15				
CDH10	1008	broad.mit.edu	37	5	24509693	24509693	+	Missense_Mutation	SNP	G	G	C	rs1395027	byFrequency	TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr5:24509693G>C	ENST00000264463.4	-	7	1745	c.1238C>G	c.(1237-1239)tCt>tGt	p.S413C		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	413	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.		S -> F (in dbSNP:rs1395027).		adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S413Y(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		GCTGGAAATAGAATCTGGGTC	0.483										HNSCC(23;0.051)																												uc003jgr.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(6)|pancreas(4)|breast(2)	12						c.(1237-1239)TCT>TGT		cadherin 10, type 2 preproprotein							91.0	90.0	91.0					5																	24509693		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24509693G>C	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1238C>G	5.37:g.24509693G>C	ENSP00000264463:p.Ser413Cys	HNSCC(23;0.051)	Somatic				CDH10_uc011cnu.1_RNA	p.S413C	NM_006727	NP_006718	WXS	Illumina HiSeq	Unspecified	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	7	1570	-			413			Cadherin 4.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.1238C>G	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882766	0.72410	.	.	ENSG00000040731	ENST00000264463	T	0.02709	4.19	5.15	5.15	0.70609	Cadherin (4);Cadherin-like (1);	0.112616	0.64402	D	0.000015	T	0.13713	0.0332	M	0.73962	2.25	0.40726	D	0.982702	D	0.59357	0.985	P	0.60541	0.876	T	0.00259	-1.1870	10	0.56958	D	0.05	.	17.961	0.89085	0.0:0.0:1.0:0.0	.	413	Q9Y6N8	CAD10_HUMAN	C	413	ENSP00000264463:S413C	ENSP00000264463:S413C	S	-	2	0	CDH10	24545450	1.000000	0.71417	0.980000	0.43619	0.976000	0.68499	5.299000	0.65716	2.565000	0.86533	0.650000	0.86243	TCT		0.483	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		43	75	0	0	0	0	43	75				
MRPS30	10884	broad.mit.edu	37	5	44813211	44813211	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr5:44813211C>T	ENST00000507110.1	+	4	895	c.857C>T	c.(856-858)tCa>tTa	p.S286L		NM_016640.3	NP_057724.2	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	286					apoptotic process (GO:0006915)|translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(11)|prostate(1)	20	Lung NSC(6;8.08e-07)					TCTTCAGGCTCAAAAACTGCA	0.373																																						uc003joh.2		NA																	0					0						c.(856-858)TCA>TTA		mitochondrial ribosomal protein S30							88.0	86.0	87.0					5																	44813211		2203	4300	6503	SO:0001583	missense	10884				apoptosis|translation	mitochondrion|ribosome	structural constituent of ribosome	g.chr5:44813211C>T	AF146192	CCDS3951.1	5q11	2012-09-13		2001-11-09	ENSG00000112996	ENSG00000112996		"""Mitochondrial ribosomal proteins / small subunits"""	8769	protein-coding gene	gene with protein product		611991		PDCD9		10640817, 11279123	Standard	NM_016640		Approved	PAP	uc003joh.3	Q9NP92	OTTHUMG00000096967	ENST00000507110.1:c.857C>T	5.37:g.44813211C>T	ENSP00000424328:p.Ser286Leu		Somatic					p.S286L	NM_016640	NP_057724	WXS	Illumina HiSeq	Unspecified	Q9NP92	RT30_HUMAN			4	895	+	Lung NSC(6;8.08e-07)		286					Q96I91|Q96Q19|Q9H0P8|Q9NSF9|Q9NZ76	Missense_Mutation	SNP	ENST00000507110.1	37	c.857C>T	CCDS3951.1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.749133	0.49257	.	.	ENSG00000112996	ENST00000507110	T	0.21932	1.98	5.78	5.78	0.91487	.	0.348665	0.30781	N	0.008887	T	0.31949	0.0813	M	0.63843	1.955	0.58432	D	0.999997	P	0.40000	0.698	P	0.45276	0.475	T	0.01472	-1.1346	10	0.15952	T	0.53	.	20.3668	0.98882	0.0:1.0:0.0:0.0	.	286	Q9NP92	RT30_HUMAN	L	286	ENSP00000424328:S286L	ENSP00000424328:S286L	S	+	2	0	MRPS30	44848968	0.883000	0.30277	0.989000	0.46669	0.122000	0.20287	7.525000	0.81892	2.894000	0.99253	0.655000	0.94253	TCA		0.373	MRPS30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214033.2	NM_016640		21	128	0	0	0	0	21	128				
PDE4D	5144	broad.mit.edu	37	5	59284492	59284492	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr5:59284492C>T	ENST00000502484.2	-	3	318	c.95G>A	c.(94-96)gGa>gAa	p.G32E	PDE4D_ENST00000546160.1_Missense_Mutation_p.G32E	NM_001165899.1	NP_001159371.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	0					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GGGTTCCATTCCGCGGAAAGG	0.428																																						uc003jsb.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(94-96)GGA>GAA		phosphodiesterase 4D isoform 2	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)						146.0	135.0	139.0					5																	59284492		1568	3582	5150	SO:0001583	missense	5144				signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding	g.chr5:59284492C>T		CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000502484.2:c.95G>A	5.37:g.59284492C>T	ENSP00000423094:p.Gly32Glu		Somatic				PDE4D_uc010iwj.1_Missense_Mutation_p.G32E|PDE4D_uc003jse.1_Missense_Mutation_p.G44E	p.G32E	NM_006203	NP_006194	WXS	Illumina HiSeq	Unspecified	Q08499	PDE4D_HUMAN		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	3	308	-		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)	Error:Variant_position_missing_in_Q08499_after_alignment					O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	ENST00000502484.2	37	c.95G>A	CCDS54859.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.641406	0.47153	.	.	ENSG00000113448	ENST00000502484;ENST00000546160;ENST00000505507;ENST00000514552	T;T	0.68181	-0.31;-0.31	5.86	5.86	0.93980	.	.	.	.	.	T	0.64527	0.2606	.	.	.	0.32812	D	0.501524	P;B	0.39759	0.687;0.003	B;B	0.42555	0.391;0.004	T	0.73717	-0.3895	8	0.49607	T	0.09	.	13.3978	0.60865	0.0:0.9282:0.0:0.0718	.	32;32	D6RIG1;Q08499-11	.;.	E	32	ENSP00000423094:G32E;ENSP00000442734:G32E	ENSP00000423094:G32E	G	-	2	0	PDE4D	59320249	1.000000	0.71417	0.949000	0.38748	0.490000	0.33462	2.457000	0.45005	2.772000	0.95346	0.585000	0.79938	GGA		0.428	PDE4D-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368094.3			56	126	0	0	0	0	56	126				
SV2C	22987	broad.mit.edu	37	5	75621244	75621244	+	Missense_Mutation	SNP	A	A	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr5:75621244A>C	ENST00000502798.2	+	13	2498	c.2056A>C	c.(2056-2058)Aac>Cac	p.N686H	SV2C_ENST00000322285.7_Intron	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	686					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		CGTCCTGGGAAACTTAATATT	0.522																																						uc003kei.1		NA																	0				skin(1)	1						c.(2056-2058)AAC>CAC		synaptic vesicle glycoprotein 2C							120.0	115.0	117.0					5																	75621244		1989	4170	6159	SO:0001583	missense	22987				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr5:75621244A>C	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.2056A>C	5.37:g.75621244A>C	ENSP00000423541:p.Asn686His		Somatic					p.N686H	NM_014979	NP_055794	WXS	Illumina HiSeq	Unspecified	Q496J9	SV2C_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)	13	2190	+		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)	686			Helical; (Potential).		Q496K1|Q9UPU8	Missense_Mutation	SNP	ENST00000502798.2	37	c.2056A>C	CCDS43331.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.339646	0.81911	.	.	ENSG00000122012	ENST00000502798	T	0.57752	0.38	5.62	5.62	0.85841	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.70979	0.3286	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.74160	-0.3755	10	0.72032	D	0.01	-28.4364	15.8384	0.78818	1.0:0.0:0.0:0.0	.	686	Q496J9	SV2C_HUMAN	H	686	ENSP00000423541:N686H	ENSP00000423541:N686H	N	+	1	0	SV2C	75657000	1.000000	0.71417	0.928000	0.36995	0.765000	0.43378	9.310000	0.96267	2.137000	0.66172	0.459000	0.35465	AAC		0.522	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4			82	138	0	0	0	0	82	138				
KCNN2	3781	broad.mit.edu	37	5	113831873	113831873	+	Silent	SNP	T	T	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr5:113831873T>C	ENST00000512097.3	+	9	2752	c.1734T>C	c.(1732-1734)agT>agC	p.S578S	RP11-492A10.1_ENST00000514115.1_RNA|KCNN2_ENST00000264773.3_Silent_p.S578S|KCNN2_ENST00000503706.1_Silent_p.S230S			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	578					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	CATCAGAGAGTAGCTAGAAGA	0.458																																						uc003kqo.2		NA																	0				ovary(2)	2						c.(1732-1734)AGT>AGC		small conductance calcium-activated potassium							62.0	63.0	62.0					5																	113831873		2202	4300	6502	SO:0001819	synonymous_variant	3781					integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity	g.chr5:113831873T>C	AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.1734T>C	5.37:g.113831873T>C			Somatic				KCNN2_uc003kqp.2_Silent_p.S230S|KCNN2_uc010jcg.2_RNA|uc003kqr.1_RNA	p.S578S	NM_021614	NP_067627	WXS	Illumina HiSeq	Unspecified	Q9H2S1	KCNN2_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	8	2191	+		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)	578					A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Silent	SNP	ENST00000512097.3	37	c.1734T>C	CCDS4114.1																																																																																				0.458	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250775.2	NM_021614		3	192	0	0	0	0	3	192				
SLC22A4	6583	broad.mit.edu	37	5	131630361	131630361	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr5:131630361C>G	ENST00000200652.3	+	1	226	c.52C>G	c.(52-54)Cag>Gag	p.Q18E	P4HA2_ENST00000471826.1_Intron	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	18					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	GGGGCCCTTCCAGCGCCTCAT	0.617																																						uc003kwq.2		NA																	0					0						c.(52-54)CAG>GAG		solute carrier family 22 member 4	L-Carnitine(DB00583)						72.0	80.0	77.0					5																	131630361		2203	4300	6503	SO:0001583	missense	6583				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity	g.chr5:131630361C>G	AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.52C>G	5.37:g.131630361C>G	ENSP00000200652:p.Gln18Glu		Somatic				uc003kwm.3_Intron|SLC22A4_uc010jdq.1_5'Flank	p.Q18E	NM_003059	NP_003050	WXS	Illumina HiSeq	Unspecified	Q9H015	S22A4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		1	217	+		all_cancers(142;0.0752)|Breast(839;0.198)	18			Cytoplasmic (Potential).		O14546	Missense_Mutation	SNP	ENST00000200652.3	37	c.52C>G	CCDS4153.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.984670	0.93044	.	.	ENSG00000197208	ENST00000200652	D	0.84370	-1.84	4.45	4.45	0.53987	Major facilitator superfamily domain, general substrate transporter (1);	0.190361	0.46758	D	0.000272	D	0.95535	0.8549	H	0.98407	4.225	0.58432	D	0.999996	D	0.76494	0.999	D	0.72982	0.979	D	0.97544	1.0088	10	0.87932	D	0	.	17.6212	0.88082	0.0:1.0:0.0:0.0	.	18	Q9H015	S22A4_HUMAN	E	18	ENSP00000200652:Q18E	ENSP00000200652:Q18E	Q	+	1	0	SLC22A4	131658260	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.265000	0.58865	2.464000	0.83262	0.491000	0.48974	CAG		0.617	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1	NM_003059		26	58	0	0	0	0	26	58				
SLC22A4	6583	broad.mit.edu	37	5	131630460	131630460	+	Missense_Mutation	SNP	C	C	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr5:131630460C>G	ENST00000200652.3	+	1	325	c.151C>G	c.(151-153)Cga>Gga	p.R51G	P4HA2_ENST00000471826.1_Intron	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	51					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	GCACCGCTGTCGAGTGCCGGA	0.672																																						uc003kwq.2		NA																	0					0						c.(151-153)CGA>GGA		solute carrier family 22 member 4	L-Carnitine(DB00583)						37.0	44.0	42.0					5																	131630460		2202	4300	6502	SO:0001583	missense	6583				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity	g.chr5:131630460C>G	AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.151C>G	5.37:g.131630460C>G	ENSP00000200652:p.Arg51Gly		Somatic				uc003kwm.3_Intron|SLC22A4_uc010jdq.1_5'Flank	p.R51G	NM_003059	NP_003050	WXS	Illumina HiSeq	Unspecified	Q9H015	S22A4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		1	316	+		all_cancers(142;0.0752)|Breast(839;0.198)	51			Extracellular (Potential).		O14546	Missense_Mutation	SNP	ENST00000200652.3	37	c.151C>G	CCDS4153.1	.	.	.	.	.	.	.	.	.	.	C	13.11	2.140733	0.37825	.	.	ENSG00000197208	ENST00000200652	D	0.83506	-1.73	4.45	3.58	0.41010	Major facilitator superfamily domain, general substrate transporter (1);	0.309553	0.30118	N	0.010369	D	0.85478	0.5706	M	0.93462	3.42	0.27208	N	0.959988	B	0.18863	0.031	B	0.21151	0.033	T	0.78211	-0.2292	10	0.40728	T	0.16	.	9.4927	0.38969	0.0:0.7615:0.1546:0.0839	.	51	Q9H015	S22A4_HUMAN	G	51	ENSP00000200652:R51G	ENSP00000200652:R51G	R	+	1	2	SLC22A4	131658359	0.876000	0.30132	0.997000	0.53966	0.781000	0.44180	1.557000	0.36299	1.224000	0.43551	0.491000	0.48974	CGA		0.672	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1	NM_003059		24	47	0	0	0	0	24	47				
PCDHB3	56132	broad.mit.edu	37	5	140481978	140481978	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr5:140481978C>T	ENST00000231130.2	+	1	1745	c.1745C>T	c.(1744-1746)cCg>cTg	p.P582L	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	582	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGGCTGAGCCGGGCTACCTG	0.701																																						uc003lio.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1744-1746)CCG>CTG		protocadherin beta 3 precursor							18.0	23.0	21.0					5																	140481978		2172	4213	6385	SO:0001583	missense	56132				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140481978C>T	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1745C>T	5.37:g.140481978C>T	ENSP00000231130:p.Pro582Leu		Somatic				uc003lin.2_5'Flank	p.P582L	NM_018937	NP_061760	WXS	Illumina HiSeq	Unspecified	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1745	+			582			Extracellular (Potential).|Cadherin 6.		B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	c.1745C>T	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	C	15.33	2.802625	0.50315	.	.	ENSG00000113205	ENST00000231130	T	0.21031	2.03	4.24	3.35	0.38373	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.38852	0.1056	M	0.80746	2.51	0.09310	N	1	D	0.60160	0.987	P	0.56700	0.804	T	0.16660	-1.0395	9	0.66056	D	0.02	.	7.8551	0.29478	0.1608:0.7494:0.0:0.0897	.	582	Q9Y5E6	PCDB3_HUMAN	L	582	ENSP00000231130:P582L	ENSP00000231130:P582L	P	+	2	0	PCDHB3	140462162	0.000000	0.05858	0.967000	0.41034	0.891000	0.51852	0.478000	0.22212	2.078000	0.62432	0.556000	0.70494	CCG		0.701	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937		63	115	0	0	0	0	63	115				
FAM217A	222826	broad.mit.edu	37	6	4069240	4069240	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr6:4069240G>C	ENST00000274673.3	-	7	1620	c.1217C>G	c.(1216-1218)tCt>tGt	p.S406C	FAM217A_ENST00000380188.2_5'UTR	NM_173563.2	NP_775834.2	Q8IXS0	F217A_HUMAN	family with sequence similarity 217, member A	406																	ACTTAAAATAGAACTTTTGGG	0.368																																						uc003mvx.2		NA																	0				ovary(1)	1						c.(1216-1218)TCT>TGT		hypothetical protein LOC222826							112.0	117.0	115.0					6																	4069240		2203	4300	6503	SO:0001583	missense	222826							g.chr6:4069240G>C	BC039349	CCDS4489.1	6p25.1	2012-02-07	2012-02-07	2012-02-07	ENSG00000145975	ENSG00000145975			21362	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 146"""	C6orf146			Standard	NM_173563		Approved	MGC43581	uc003mvx.3	Q8IXS0	OTTHUMG00000014159	ENST00000274673.3:c.1217C>G	6.37:g.4069240G>C	ENSP00000274673:p.Ser406Cys		Somatic				C6orf146_uc010jnq.1_Intron|C6orf146_uc003mvy.2_Missense_Mutation_p.S343C	p.S406C	NM_173563	NP_775834	WXS	Illumina HiSeq	Unspecified	Q8IXS0	CF146_HUMAN			7	1557	-	Ovarian(93;0.0925)	all_hematologic(90;0.108)	406					Q5JYK1	Missense_Mutation	SNP	ENST00000274673.3	37	c.1217C>G	CCDS4489.1	.	.	.	.	.	.	.	.	.	.	G	4.464	0.086027	0.08583	.	.	ENSG00000145975	ENST00000274673;ENST00000538080;ENST00000470599	T	0.24538	1.85	4.76	2.06	0.26882	.	1.084530	0.07015	N	0.825817	T	0.18964	0.0455	L	0.55481	1.735	0.09310	N	1	D	0.64830	0.994	P	0.55161	0.77	T	0.11542	-1.0583	10	0.62326	D	0.03	-0.0053	4.1692	0.10322	0.0875:0.1535:0.6004:0.1587	.	406	Q8IXS0	CF146_HUMAN	C	406;253;534	ENSP00000274673:S406C	ENSP00000274673:S406C	S	-	2	0	C6orf146	4014239	0.100000	0.21855	0.000000	0.03702	0.009000	0.06853	2.098000	0.41757	0.206000	0.20587	-3.036000	0.00072	TCT		0.368	FAM217A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352577.2	NM_173563		74	50	0	0	0	0	74	50				
HDGFL1	154150	broad.mit.edu	37	6	22570125	22570125	+	Silent	SNP	G	G	A	rs147735460		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr6:22570125G>A	ENST00000230012.3	+	1	448	c.321G>A	c.(319-321)ccG>ccA	p.P107P	HDGFL1_ENST00000510882.2_Silent_p.P107P	NM_138574.2	NP_612641.2	Q5TGJ6	HDGL1_HUMAN	hepatoma derived growth factor-like 1	107										kidney(1)|large_intestine(3)|lung(7)	11	Ovarian(93;0.163)					GGCCTTGGCCGGAGCCCGAGG	0.687																																						uc003nds.2		NA																	0					0						c.(319-321)CCG>CCA		hepatoma derived growth factor-like 1																																				SO:0001819	synonymous_variant	154150							g.chr6:22570125G>A	AK056824	CCDS34347.1	6p22.2	2008-02-05	2005-04-07	2005-04-07	ENSG00000112273	ENSG00000112273			21095	protein-coding gene	gene with protein product			"""PWWP domain containing 1"""	PWWP1			Standard	NM_138574		Approved	dJ309H15.1	uc003nds.3	Q5TGJ6	OTTHUMG00000016206	ENST00000230012.3:c.321G>A	6.37:g.22570125G>A			Somatic					p.P107P	NM_138574	NP_612641	WXS	Illumina HiSeq	Unspecified	Q5TGJ6	HDGL1_HUMAN			1	448	+	Ovarian(93;0.163)		107					Q96MJ6	Silent	SNP	ENST00000230012.3	37	c.321G>A	CCDS34347.1																																																																																				0.687	HDGFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043500.1	NM_138574		2	3	0	0	0	0	2	3				
SYNGAP1	8831	broad.mit.edu	37	6	33402927	33402927	+	Splice_Site	SNP	A	A	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr6:33402927A>T	ENST00000418600.2	+	6	610		c.e6-1		SYNGAP1_ENST00000428982.2_Splice_Site|SYNGAP1_ENST00000496374.1_Splice_Site|SYNGAP1_ENST00000293748.5_Splice_Site	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1						dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CCTGCCTGCCAGGGCCCGGCT	0.498																																						uc011dri.1		NA																	0				ovary(4)	4						c.e6-2		synaptic Ras GTPase activating protein 1							92.0	89.0	90.0					6																	33402927		2203	4300	6503	SO:0001630	splice_region_variant	8831				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding	g.chr6:33402927A>T	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.510-1A>T	6.37:g.33402927A>T			Somatic				SYNGAP1_uc003oeo.1_Splice_Site_p.R155_splice|SYNGAP1_uc010juy.2_Splice_Site_p.R155_splice|SYNGAP1_uc010juz.2_5'Flank	p.R170_splice	NM_006772	NP_006763	WXS	Illumina HiSeq	Unspecified	Q96PV0	SYGP1_HUMAN			6	705	+								A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Splice_Site	SNP	ENST00000418600.2	37	c.510_splice	CCDS34434.2	.	.	.	.	.	.	.	.	.	.	A	15.54	2.865067	0.51482	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	.	.	.	4.52	3.33	0.38152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.5093	0.39067	0.822:0.178:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SYNGAP1	33510905	1.000000	0.71417	0.859000	0.33776	0.768000	0.43524	8.500000	0.90498	0.744000	0.32741	0.482000	0.46254	.		0.498	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	Intron	4	158	0	0	0	0	4	158				
PCLO	27445	broad.mit.edu	37	7	82582957	82582957	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr7:82582957G>A	ENST00000333891.9	-	5	7649	c.7312C>T	c.(7312-7314)Ctt>Ttt	p.L2438F	PCLO_ENST00000423517.2_Missense_Mutation_p.L2438F|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTTTTAGGAAGAATAGTTGGT	0.517																																						uc003uhx.2		NA																	0				ovary(7)	7						c.(7312-7314)CTT>TTT		piccolo isoform 1							50.0	47.0	48.0					7																	82582957		1848	4085	5933	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82582957G>A	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.7312C>T	7.37:g.82582957G>A	ENSP00000334319:p.Leu2438Phe		Somatic				PCLO_uc003uhv.2_Missense_Mutation_p.L2438F|PCLO_uc010lec.2_5'Flank	p.L2438F	NM_033026	NP_149015	WXS	Illumina HiSeq	Unspecified	Q9Y6V0	PCLO_HUMAN			5	7601	-			2369			Pro-rich.			Missense_Mutation	SNP	ENST00000333891.9	37	c.7312C>T	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	7.252	0.603412	0.14002	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16597	2.33;2.33	4.52	2.39	0.29439	.	.	.	.	.	T	0.07098	0.0180	N	0.03608	-0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.19289	-1.0310	9	0.87932	D	0	.	5.8469	0.18671	0.732:0.0:0.268:0.0	.	2438;2438	Q9Y6V0-5;Q9Y6V0-6	.;.	F	2369;2438;2438	ENSP00000334319:L2438F;ENSP00000388393:L2438F	ENSP00000334319:L2438F	L	-	1	0	PCLO	82420893	1.000000	0.71417	0.106000	0.21319	0.609000	0.37215	4.639000	0.61361	0.200000	0.20447	0.484000	0.47621	CTT		0.517	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		13	11	0	0	0	0	13	11				
GAL3ST4	79690	broad.mit.edu	37	7	99757768	99757768	+	Missense_Mutation	SNP	T	T	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr7:99757768T>C	ENST00000360039.4	-	4	1636	c.1244A>G	c.(1243-1245)gAc>gGc	p.D415G	C7orf43_ENST00000457641.1_5'Flank|C7orf43_ENST00000316937.3_5'Flank|C7orf43_ENST00000419841.1_5'Flank|C7orf43_ENST00000498638.1_5'Flank|GAL3ST4_ENST00000426974.2_Missense_Mutation_p.D353G|GAL3ST4_ENST00000411994.1_3'UTR|GAL3ST4_ENST00000423751.1_3'UTR|GAL3ST4_ENST00000413800.1_Missense_Mutation_p.D415G	NM_024637.4	NP_078913.3	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	415					cell-cell signaling (GO:0007267)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(5)|prostate(1)|upper_aerodigestive_tract(1)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTATTTGGGGTCAGAAGCCTC	0.587																																						uc003utt.2		NA																	0				ovary(3)	3						c.(1243-1245)GAC>GGC		galactose-3-O-sulfotransferase 4							73.0	71.0	71.0					7																	99757768		2203	4300	6503	SO:0001583	missense	79690				cell-cell signaling|oligosaccharide metabolic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi cisterna membrane|integral to membrane|membrane fraction	3'-phosphoadenosine 5'-phosphosulfate binding|galactosylceramide sulfotransferase activity|proteoglycan sulfotransferase activity	g.chr7:99757768T>C	AF316113	CCDS5688.1	7q22.1	2007-04-02			ENSG00000197093	ENSG00000197093		"""Sulfotransferases, membrane-bound"""	24145	protein-coding gene	gene with protein product		608235				11333265	Standard	NM_024637		Approved	FLJ12116	uc003utu.3	Q96RP7	OTTHUMG00000154885	ENST00000360039.4:c.1244A>G	7.37:g.99757768T>C	ENSP00000353142:p.Asp415Gly		Somatic				C7orf43_uc010lgp.2_5'Flank|C7orf43_uc011kjj.1_5'Flank|C7orf43_uc003utr.2_5'Flank|C7orf43_uc003uts.2_5'Flank|GAL3ST4_uc003utu.2_Missense_Mutation_p.D415G|GAL3ST4_uc010lgq.2_Missense_Mutation_p.D353G	p.D415G	NM_024637	NP_078913	WXS	Illumina HiSeq	Unspecified	Q96RP7	G3ST4_HUMAN			3	2261	-	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		415			Lumenal (Potential).		A4D2A8|B4DWL8|D6W5U5|Q8N3P7|Q8WZ17|Q96E33|Q9HA78	Missense_Mutation	SNP	ENST00000360039.4	37	c.1244A>G	CCDS5688.1	.	.	.	.	.	.	.	.	.	.	T	17.49	3.403326	0.62288	.	.	ENSG00000197093	ENST00000413800;ENST00000360039;ENST00000426974	T;T;T	0.15834	2.39;2.39;2.39	5.71	4.57	0.56435	.	0.349867	0.27039	U	0.021221	T	0.31104	0.0786	L	0.58669	1.825	0.40142	D	0.976847	D;D	0.71674	0.99;0.998	P;D	0.69307	0.87;0.963	T	0.03993	-1.0986	10	0.21540	T	0.41	-6.4029	9.2152	0.37342	0.0:0.0844:0.0:0.9156	.	353;415	B4DWL8;Q96RP7	.;G3ST4_HUMAN	G	415;415;353	ENSP00000400451:D415G;ENSP00000353142:D415G;ENSP00000398304:D353G	ENSP00000353142:D415G	D	-	2	0	GAL3ST4	99595704	1.000000	0.71417	0.992000	0.48379	0.638000	0.38207	3.204000	0.51082	2.184000	0.69523	0.459000	0.35465	GAC		0.587	GAL3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337495.2	NM_024637		75	343	0	0	0	0	75	343				
NAPEPLD	222236	broad.mit.edu	37	7	102743965	102743965	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr7:102743965G>C	ENST00000417955.1	-	5	1247	c.1093C>G	c.(1093-1095)Cta>Gta	p.L365V	NAPEPLD_ENST00000455523.2_Missense_Mutation_p.L438V|NAPEPLD_ENST00000427257.1_Missense_Mutation_p.L365V|NAPEPLD_ENST00000341533.4_Missense_Mutation_p.L365V|NAPEPLD_ENST00000465647.1_Missense_Mutation_p.L365V			Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D	365					phospholipid catabolic process (GO:0009395)	extracellular vesicular exosome (GO:0070062)|photoreceptor outer segment membrane (GO:0042622)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TATCTCTCTAGAGCTTCATTC	0.333																																						uc003vbc.2		NA																	0				skin(1)	1						c.(1093-1095)CTA>GTA		N-acyl phosphatidylethanolamine phospholipase D							52.0	49.0	50.0					7																	102743965		2203	4299	6502	SO:0001583	missense	222236				phospholipid catabolic process	membrane	metal ion binding	g.chr7:102743965G>C	BC037350, AY357337	CCDS5729.1	7q22.1	2014-03-14			ENSG00000161048	ENSG00000161048	3.1.4.54		21683	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 18, N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D"""	612334				14634025, 15820312, 18067139	Standard	NM_198990		Approved	FMP30, C7orf18, NAPE-PLD	uc003vbd.2	Q6IQ20	OTTHUMG00000157204	ENST00000417955.1:c.1093C>G	7.37:g.102743965G>C	ENSP00000407112:p.Leu365Val		Somatic				NAPEPLD_uc003vbd.2_Missense_Mutation_p.L365V|NAPEPLD_uc011klj.1_Missense_Mutation_p.L438V|NAPEPLD_uc003vbe.2_RNA	p.L365V	NM_198990	NP_945341	WXS	Illumina HiSeq	Unspecified	Q6IQ20	NAPEP_HUMAN			5	1421	-			365					Q5CZ87|Q769K1	Missense_Mutation	SNP	ENST00000417955.1	37	c.1093C>G	CCDS5729.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810695	0.50421	.	.	ENSG00000161048	ENST00000341533;ENST00000417955;ENST00000465647;ENST00000427257;ENST00000455523	T;T;T;T;T	0.34472	1.42;1.42;1.42;1.42;1.36	5.86	4.98	0.66077	.	0.130927	0.53938	D	0.000057	T	0.49304	0.1549	M	0.82323	2.585	0.46279	D	0.99896	P;P	0.46784	0.884;0.79	P;B	0.47162	0.54;0.271	T	0.52638	-0.8549	10	0.29301	T	0.29	-21.4751	14.6816	0.69020	0.0701:0.0:0.9299:0.0	.	438;365	B4E3B0;Q6IQ20	.;NAPEP_HUMAN	V	365;365;365;365;438	ENSP00000340093:L365V;ENSP00000407112:L365V;ENSP00000419188:L365V;ENSP00000392775:L365V;ENSP00000414364:L438V	ENSP00000340093:L365V	L	-	1	2	NAPEPLD	102531201	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.641000	0.37197	1.487000	0.48415	-0.140000	0.14226	CTA		0.333	NAPEPLD-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347904.1	NM_198990		51	185	0	0	0	0	51	185				
DNAJC2	27000	broad.mit.edu	37	7	102953456	102953456	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr7:102953456A>G	ENST00000379263.3	-	16	1979	c.1729T>C	c.(1729-1731)Tgg>Cgg	p.W577R	PMPCB_ENST00000420236.2_Intron|DNAJC2_ENST00000249270.7_Missense_Mutation_p.W524R|PMPCB_ENST00000249269.4_3'UTR	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	577	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)			endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						ATTTTTTCCCATCTTTCAGGT	0.398																																						uc003vbo.2		NA																	0				kidney(1)	1						c.(1729-1731)TGG>CGG		DnaJ (Hsp40) homolog, subfamily C, member 2							258.0	238.0	244.0					7																	102953456		1842	4087	5929	SO:0001583	missense	27000				'de novo' cotranslational protein folding|chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane	chromatin binding|DNA binding|histone binding|Hsp70 protein binding|ubiquitin binding	g.chr7:102953456A>G	X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.1729T>C	7.37:g.102953456A>G	ENSP00000368565:p.Trp577Arg		Somatic				PMPCB_uc003vbl.2_3'UTR|PMPCB_uc003vbm.2_3'UTR|PMPCB_uc010liv.2_3'UTR|PMPCB_uc010liw.2_3'UTR|PMPCB_uc011kll.1_Intron|DNAJC2_uc003vbn.2_Missense_Mutation_p.W202R|DNAJC2_uc010lix.2_Missense_Mutation_p.W524R|DNAJC2_uc003vbp.2_Missense_Mutation_p.W202R	p.W577R	NM_014377	NP_055192	WXS	Illumina HiSeq	Unspecified	Q99543	DNJC2_HUMAN			16	1980	-			577			SANT 2.		A4VCI0|Q9BVX1	Missense_Mutation	SNP	ENST00000379263.3	37	c.1729T>C	CCDS43628.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.656069	0.88056	.	.	ENSG00000105821	ENST00000249270;ENST00000379263	T;T	0.67345	-0.26;-0.26	5.18	5.18	0.71444	Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.85682	D	0.000000	D	0.90137	0.6918	H	0.99732	4.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.94504	0.7712	10	0.87932	D	0	-6.9596	15.3325	0.74226	1.0:0.0:0.0:0.0	.	524;577	Q99543-2;Q99543	.;DNJC2_HUMAN	R	524;577	ENSP00000249270:W524R;ENSP00000368565:W577R	ENSP00000249270:W524R	W	-	1	0	DNAJC2	102740692	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.823000	0.92018	2.081000	0.62600	0.533000	0.62120	TGG		0.398	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347891.1			141	667	0	0	0	0	141	667				
PSMC2	5701	broad.mit.edu	37	7	102988177	102988178	+	Missense_Mutation	DNP	GC	GC	TT	rs554292187		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr7:102988177_102988178GC>TT	ENST00000435765.1	+	2	430_431	c.19_20GC>TT	c.(19-21)GCc>TTc	p.A7F	DNAJC2_ENST00000412522.1_5'Flank|PSMC2_ENST00000544811.1_5'UTR|PSMC2_ENST00000292644.3_Missense_Mutation_p.A7F|DNAJC2_ENST00000379263.3_5'Flank	NM_002803.3	NP_002794.1	P35998	PRS7_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 2	7					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|osteoblast differentiation (GO:0001649)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	21						TTACCTCGGTGCCGATCAGCGG	0.579																																						uc003vbs.2		NA																	0					0						c.(19-21)GCC>TTC		proteasome 26S ATPase subunit 2																																				SO:0001583	missense	5701				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding	g.chr7:102988177_102988178GC>TT	D11094	CCDS5731.1	7q22.1-q22.3	2010-04-21			ENSG00000161057	ENSG00000161057		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9548	protein-coding gene	gene with protein product	"""proteasome 26S subunit, ATPase, 2"", ""mammalian suppressor of sgv-1 of yeast"", ""protease 26S subunit 7"", ""putative protein product of Nbla10058"""	154365				9473509, 1377363	Standard	NM_002803		Approved	MSS1, S7, Nbla10058	uc003vbs.3	P35998	OTTHUMG00000157206	Exception_encountered	7.37:g.102988177_102988178delinsTT	ENSP00000391211:p.Ala7Phe		Somatic				DNAJC2_uc003vbo.2_5'Flank|DNAJC2_uc010lix.2_5'Flank|DNAJC2_uc003vbp.2_5'Flank|DNAJC2_uc003vbq.1_5'Flank|DNAJC2_uc003vbr.1_5'Flank|PSMC2_uc011kln.1_Missense_Mutation_p.A7F|PSMC2_uc011klo.1_5'UTR	p.A7F	NM_002803	NP_002794	WXS	Illumina HiSeq	Unspecified	P35998	PRS7_HUMAN			1	89_90	+			7					A4D0Q1|B7Z5E2|Q3LIA5|Q9UDI3	Missense_Mutation	DNP	ENST00000435765.1	37	c.19_20GC>TT	CCDS5731.1																																																																																				0.579	PSMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347922.1	NM_002803		35	270	0	0	0	0	35	270				
MFHAS1	9258	broad.mit.edu	37	8	8748457	8748457	+	Silent	SNP	G	G	A	rs150651778		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr8:8748457G>A	ENST00000276282.6	-	1	2698	c.2112C>T	c.(2110-2112)ctC>ctT	p.L704L		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	704										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		GCAGGTAGGAGAGGGCACTCT	0.627																																					Melanoma(103;1201 2045 17515 28966)	uc003wsj.1		NA																	0					0						c.(2110-2112)CTC>CTT		malignant fibrous histiocytoma amplified							55.0	53.0	54.0					8																	8748457		2203	4300	6503	SO:0001819	synonymous_variant	9258							g.chr8:8748457G>A	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.2112C>T	8.37:g.8748457G>A			Somatic					p.L704L	NM_004225	NP_004216	WXS	Illumina HiSeq	Unspecified	Q9Y4C4	MFHA1_HUMAN		COAD - Colon adenocarcinoma(149;0.124)	1	2675	-		Hepatocellular(245;0.217)	704					Q96CI0	Silent	SNP	ENST00000276282.6	37	c.2112C>T	CCDS34844.1																																																																																				0.627	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225		26	40	0	0	0	0	26	40				
MFHAS1	9258	broad.mit.edu	37	8	8748738	8748738	+	Missense_Mutation	SNP	G	G	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr8:8748738G>C	ENST00000276282.6	-	1	2417	c.1831C>G	c.(1831-1833)Caa>Gaa	p.Q611E		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	611	Roc. {ECO:0000255|PROSITE- ProRule:PRU00758}.									endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		AGCAGGTATTGAAAATGGGCC	0.627																																					Melanoma(103;1201 2045 17515 28966)	uc003wsj.1		NA																	0					0						c.(1831-1833)CAA>GAA		malignant fibrous histiocytoma amplified							75.0	65.0	68.0					8																	8748738		2203	4300	6503	SO:0001583	missense	9258							g.chr8:8748738G>C	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.1831C>G	8.37:g.8748738G>C	ENSP00000276282:p.Gln611Glu		Somatic					p.Q611E	NM_004225	NP_004216	WXS	Illumina HiSeq	Unspecified	Q9Y4C4	MFHA1_HUMAN		COAD - Colon adenocarcinoma(149;0.124)	1	2394	-		Hepatocellular(245;0.217)	611			Roc.		Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	c.1831C>G	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.359782	0.41801	.	.	ENSG00000147324	ENST00000276282	T	0.33654	1.4	5.28	5.28	0.74379	ROC GTPase (1);	0.000000	0.64402	D	0.000001	T	0.36690	0.0976	L	0.59436	1.845	0.54753	D	0.999983	P	0.40083	0.702	B	0.36092	0.217	T	0.15093	-1.0449	10	0.32370	T	0.25	.	18.0901	0.89472	0.0:0.0:1.0:0.0	.	611	Q9Y4C4	MFHA1_HUMAN	E	611	ENSP00000276282:Q611E	ENSP00000276282:Q611E	Q	-	1	0	MFHAS1	8786148	1.000000	0.71417	0.782000	0.31804	0.932000	0.56968	7.700000	0.84556	2.736000	0.93811	0.655000	0.94253	CAA		0.627	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225		49	97	0	0	0	0	49	97				
SCARA5	286133	broad.mit.edu	37	8	27737157	27737157	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr8:27737157C>T	ENST00000354914.3	-	8	1765	c.1280G>A	c.(1279-1281)gGa>gAa	p.G427E	SCARA5_ENST00000380385.2_Missense_Mutation_p.G202E	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	427	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)			central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		CACCACGTCTCCGTCCTTCTT	0.637																																						uc003xgj.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1279-1281)GGA>GAA		scavenger receptor class A, member 5							144.0	114.0	124.0					8																	27737157		2203	4300	6503	SO:0001583	missense	286133				cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity	g.chr8:27737157C>T	AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.1280G>A	8.37:g.27737157C>T	ENSP00000346990:p.Gly427Glu		Somatic				SCARA5_uc010luz.2_Missense_Mutation_p.G202E	p.G427E	NM_173833	NP_776194	WXS	Illumina HiSeq	Unspecified	Q6ZMJ2	SCAR5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)	8	1720	-		Ovarian(32;0.0218)	427			SRCR.|Extracellular (Potential).		Q6UXZ1|Q7Z4A1|Q8N4Z7	Missense_Mutation	SNP	ENST00000354914.3	37	c.1280G>A	CCDS6064.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.014632	0.75161	.	.	ENSG00000168079	ENST00000354914;ENST00000380385	T;T	0.35605	1.3;1.3	4.87	3.97	0.46021	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	0.000000	0.85682	D	0.000000	T	0.49745	0.1575	L	0.58354	1.805	0.80722	D	1	P;P	0.51537	0.846;0.946	P;P	0.57057	0.598;0.812	T	0.53394	-0.8445	10	0.87932	D	0	.	13.053	0.58964	0.0:0.8366:0.1634:0.0	.	202;427	Q6ZMJ2-4;Q6ZMJ2	.;SCAR5_HUMAN	E	427;202	ENSP00000346990:G427E;ENSP00000369746:G202E	ENSP00000346990:G427E	G	-	2	0	SCARA5	27793076	0.993000	0.37304	0.952000	0.39060	0.436000	0.31835	3.153000	0.50685	1.132000	0.42129	0.591000	0.81541	GGA		0.637	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	NM_173833		74	151	0	0	0	0	74	151				
CSMD3	114788	broad.mit.edu	37	8	113267588	113267588	+	Missense_Mutation	SNP	A	A	G			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr8:113267588A>G	ENST00000297405.5	-	62	10175	c.9931T>C	c.(9931-9933)Tca>Cca	p.S3311P	CSMD3_ENST00000343508.3_Missense_Mutation_p.S3271P|CSMD3_ENST00000455883.2_Missense_Mutation_p.S3142P|CSMD3_ENST00000352409.3_Missense_Mutation_p.S3241P	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3311	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GAAACCTCTGACTGGTATATA	0.413										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(9931-9933)TCA>CCA		CUB and Sushi multiple domains 3 isoform 1							132.0	119.0	123.0					8																	113267588		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113267588A>G	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9931T>C	8.37:g.113267588A>G	ENSP00000297405:p.Ser3311Pro	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)	Somatic				CSMD3_uc003yns.2_Missense_Mutation_p.S2513P|CSMD3_uc003ynt.2_Missense_Mutation_p.S3271P|CSMD3_uc011lhx.1_Missense_Mutation_p.S3142P	p.S3311P	NM_198123	NP_937756	WXS	Illumina HiSeq	Unspecified	Q7Z407	CSMD3_HUMAN			62	10090	-			3311			Extracellular (Potential).|Sushi 26.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.9931T>C	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	A	19.60	3.857133	0.71834	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	5.19	5.19	0.71726	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000013	D	0.88683	0.6503	H	0.98314	4.2	0.58432	D	0.999997	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.77004	0.981;0.989;0.947	D	0.92912	0.6348	10	0.72032	D	0.01	.	15.2318	0.73395	1.0:0.0:0.0:0.0	.	3142;3311;3271	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	P	3271;3311;2581;3142;3241	ENSP00000345799:S3271P;ENSP00000297405:S3311P;ENSP00000341558:S2581P;ENSP00000412263:S3142P;ENSP00000343124:S3241P	ENSP00000297405:S3311P	S	-	1	0	CSMD3	113336764	1.000000	0.71417	1.000000	0.80357	0.491000	0.33493	5.687000	0.68219	2.187000	0.69744	0.528000	0.53228	TCA		0.413	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		49	88	0	0	0	0	49	88				
FAM83H	286077	broad.mit.edu	37	8	144812752	144812752	+	Start_Codon_SNP	SNP	T	T	C			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr8:144812752T>C	ENST00000388913.3	-	2	126	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	MIR4664_ENST00000583819.1_RNA	NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	1					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CGACGGGCCATGTTGGGGCCA	0.657																																						uc003yzk.2		NA																	0				lung(1)|central_nervous_system(1)|pancreas(1)	3						c.(1-3)ATG>GTG		FAM83H							10.0	11.0	11.0					8																	144812752		1793	3761	5554	SO:0001582	initiator_codon_variant	286077				biomineral tissue development			g.chr8:144812752T>C	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.1A>G	8.37:g.144812752T>C	ENSP00000373565:p.Met1Val		Somatic				FAM83H_uc010mfk.1_5'Flank	p.M1V	NM_198488	NP_940890	WXS	Illumina HiSeq	Unspecified	Q6ZRV2	FA83H_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)		2	70	-	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		1					A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	37	c.1A>G	CCDS6410.2	.	.	.	.	.	.	.	.	.	.	t	19.60	3.857929	0.71834	.	.	ENSG00000180921	ENST00000388913	T	0.20598	2.06	4.62	4.62	0.57501	.	0.392797	0.17618	U	0.167828	T	0.45498	0.1345	.	.	.	0.80722	D	1	D	0.58268	0.982	D	0.67548	0.952	T	0.46400	-0.9194	9	0.87932	D	0	.	13.4887	0.61382	0.0:0.0:0.0:1.0	.	1	Q6ZRV2	FA83H_HUMAN	V	1	ENSP00000373565:M1V	ENSP00000373565:M1V	M	-	1	0	FAM83H	144884740	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	4.104000	0.57790	1.851000	0.53745	0.391000	0.25812	ATG		0.657	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	Missense_Mutation	12	25	0	0	0	0	12	25				
SMARCA2	6595	broad.mit.edu	37	9	2097460	2097460	+	Missense_Mutation	SNP	C	C	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr9:2097460C>A	ENST00000382203.1	+	21	3276	c.3067C>A	c.(3067-3069)Cag>Aag	p.Q1023K	SMARCA2_ENST00000357248.2_Missense_Mutation_p.Q1023K|SMARCA2_ENST00000349721.2_Missense_Mutation_p.Q1023K|SMARCA2_ENST00000382194.1_Missense_Mutation_p.Q1023K			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1023					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		ATATATGTTTCAGCACATTGA	0.353																																						uc003zhc.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(3067-3069)CAG>AAG		SWI/SNF-related matrix-associated							136.0	126.0	130.0					9																	2097460		2203	4300	6503	SO:0001583	missense	6595				chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding	g.chr9:2097460C>A	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3067C>A	9.37:g.2097460C>A	ENSP00000371638:p.Gln1023Lys		Somatic				SMARCA2_uc003zhd.2_Missense_Mutation_p.Q1023K|SMARCA2_uc010mha.2_Missense_Mutation_p.Q956K	p.Q1023K	NM_003070	NP_003061	WXS	Illumina HiSeq	Unspecified	P51531	SMCA2_HUMAN		GBM - Glioblastoma multiforme(50;0.0475)	21	3166	+		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)	1023					B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	c.3067C>A	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366523	0.61513	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.87916	0.6298	M	0.76574	2.34	0.80722	D	1	B;P;P	0.43578	0.417;0.811;0.713	B;P;P	0.60789	0.146;0.879;0.761	D	0.87902	0.2691	10	0.62326	D	0.03	-27.1853	19.5062	0.95116	0.0:1.0:0.0:0.0	.	624;1023;1023	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	K	1023	ENSP00000265773:Q1023K;ENSP00000349788:Q1023K;ENSP00000371638:Q1023K;ENSP00000371629:Q1023K	ENSP00000265773:Q1023K	Q	+	1	0	SMARCA2	2087460	1.000000	0.71417	0.998000	0.56505	0.809000	0.45718	7.716000	0.84723	2.610000	0.88304	0.650000	0.86243	CAG		0.353	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070		64	50	1	0	2.1e-13	2.33e-13	64	50				
PRRC2B	84726	broad.mit.edu	37	9	134350562	134350562	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr9:134350562G>A	ENST00000357304.4	+	15	3101	c.3046G>A	c.(3046-3048)Gag>Aag	p.E1016K	PRRC2B_ENST00000405995.1_Intron|PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Intron	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1016							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						TTTTGGCCGCGAGGCCACCAA	0.562																																						uc004can.3		NA																	0					0						c.(3046-3048)GAG>AAG		HLA-B associated transcript 2-like							28.0	32.0	30.0					9																	134350562		1925	4116	6041	SO:0001583	missense	84726						protein binding	g.chr9:134350562G>A	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.3046G>A	9.37:g.134350562G>A	ENSP00000349856:p.Glu1016Lys		Somatic				BAT2L1_uc010mzj.1_Missense_Mutation_p.E599K|BAT2L1_uc004cao.3_Missense_Mutation_p.E374K	p.E1016K	NM_013318	NP_037450	WXS	Illumina HiSeq	Unspecified	Q5JSZ5	PRC2B_HUMAN			15	3101	+			1016					O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	37	c.3046G>A	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	G	10.27	1.304569	0.23736	.	.	ENSG00000130723	ENST00000357304;ENST00000418650	T	0.01584	4.75	5.61	4.7	0.59300	.	.	.	.	.	T	0.02012	0.0063	L	0.47716	1.5	0.80722	D	1	P;B	0.42357	0.777;0.291	B;B	0.30179	0.112;0.016	T	0.65100	-0.6250	8	.	.	.	.	14.9429	0.71009	0.0:0.0:0.856:0.144	.	312;1016	Q5H9R5;Q5JSZ5	.;PRC2B_HUMAN	K	1016;312	ENSP00000349856:E1016K	.	E	+	1	0	PRRC2B	133340383	1.000000	0.71417	0.403000	0.26384	0.046000	0.14306	4.705000	0.61838	1.330000	0.45394	0.655000	0.94253	GAG		0.562	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				20	10	0	0	0	0	20	10				
UBAC1	10422	broad.mit.edu	37	9	138825301	138825301	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr9:138825301G>A	ENST00000371756.3	-	10	1380	c.1163C>T	c.(1162-1164)aCg>aTg	p.T388M		NM_016172.2	NP_057256.2	Q9BSL1	UBAC1_HUMAN	UBA domain containing 1	388	STI1.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				NS(1)|biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		GACAGGCCCCGTTTCTGGATC	0.562																																					NSCLC(78;973 1398 27381 29552 42415)	uc004cgt.2		NA																	0				skin(2)	2						c.(1162-1164)ACG>ATG		ubiquitin associated domain containing 1							155.0	141.0	146.0					9																	138825301		2203	4300	6503	SO:0001583	missense	10422					Golgi apparatus|plasma membrane	protein binding	g.chr9:138825301G>A	AF176796	CCDS35177.1	9q34.3	2008-02-05	2007-04-20	2007-04-20	ENSG00000130560	ENSG00000130560			30221	protein-coding gene	gene with protein product		608129	"""ubiquitin associated domain containing 1"""	UBADC1		10857748, 8619474	Standard	NM_016172		Approved	GBDR1	uc004cgt.3	Q9BSL1	OTTHUMG00000020920	ENST00000371756.3:c.1163C>T	9.37:g.138825301G>A	ENSP00000360821:p.Thr388Met		Somatic				UBAC1_uc004cgs.1_Intron|UBAC1_uc004cgu.2_RNA	p.T388M	NM_016172	NP_057256	WXS	Illumina HiSeq	Unspecified	Q9BSL1	UBAC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)	10	1381	-		Myeloproliferative disorder(178;0.0511)	388			STI1.		O75500|Q9UMW7	Missense_Mutation	SNP	ENST00000371756.3	37	c.1163C>T	CCDS35177.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857656	0.51376	.	.	ENSG00000130560	ENST00000371756	T	0.25912	1.77	5.49	5.49	0.81192	Heat shock chaperonin-binding (1);	0.000000	0.85682	D	0.000000	T	0.45397	0.1340	L	0.48642	1.525	0.80722	D	1	D	0.89917	1.0	D	0.68192	0.956	T	0.31530	-0.9940	10	0.62326	D	0.03	-26.5658	17.9357	0.89011	0.0:0.0:1.0:0.0	.	388	Q9BSL1	UBAC1_HUMAN	M	388	ENSP00000360821:T388M	ENSP00000360821:T388M	T	-	2	0	UBAC1	137965122	1.000000	0.71417	0.041000	0.18516	0.028000	0.11728	9.265000	0.95647	2.566000	0.86566	0.655000	0.94253	ACG		0.562	UBAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055034.1	NM_016172		86	62	0	0	0	0	86	62				
EHMT1	79813	broad.mit.edu	37	9	140708936	140708936	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr9:140708936C>T	ENST00000460843.1	+	22	3261	c.3234C>T	c.(3232-3234)ctC>ctT	p.L1078L		NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1078	Pre-SET. {ECO:0000255|PROSITE- ProRule:PRU00157}.				chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		GCGGCCAGCTCAGCATGCGCT	0.642																																						uc011mfc.1		NA																	0				breast(2)|pancreas(1)	3						c.(3232-3234)CTC>CTT		euchromatic histone-lysine N-methyltransferase 1							86.0	76.0	79.0					9																	140708936		2203	4300	6503	SO:0001819	synonymous_variant	79813				DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding	g.chr9:140708936C>T	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.3234C>T	9.37:g.140708936C>T			Somatic				EHMT1_uc004coe.2_5'Flank	p.L1078L	NM_024757	NP_079033	WXS	Illumina HiSeq	Unspecified	Q9H9B1	EHMT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)	22	3271	+	all_cancers(76;0.164)		1078			Pre-SET.		B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Silent	SNP	ENST00000460843.1	37	c.3234C>T	CCDS7050.2																																																																																				0.642	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055371.2	NM_024757		48	32	0	0	0	0	48	32				
NLGN4X	57502	broad.mit.edu	37	X	5821254	5821254	+	Missense_Mutation	SNP	G	G	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chrX:5821254G>T	ENST00000381095.3	-	5	2092	c.1465C>A	c.(1465-1467)Cat>Aat	p.H489N	NLGN4X_ENST00000538097.1_Missense_Mutation_p.H489N|NLGN4X_ENST00000381093.2_Missense_Mutation_p.H509N|NLGN4X_ENST00000275857.6_Missense_Mutation_p.H489N|NLGN4X_ENST00000381092.1_Missense_Mutation_p.H489N	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	489					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						TCATCACCATGGGCCGAATCT	0.572																																						uc010ndh.2		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.(1465-1467)CAT>AAT		X-linked neuroligin 4 precursor							89.0	75.0	80.0					X																	5821254		2203	4300	6503	SO:0001583	missense	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:5821254G>T	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1465C>A	X.37:g.5821254G>T	ENSP00000370485:p.His489Asn		Somatic				NLGN4X_uc004crp.2_Missense_Mutation_p.H509N|NLGN4X_uc004crq.2_Missense_Mutation_p.H489N|NLGN4X_uc010ndi.2_Missense_Mutation_p.H526N|NLGN4X_uc004crr.2_Missense_Mutation_p.H489N|NLGN4X_uc010ndj.2_Missense_Mutation_p.H489N	p.H489N	NM_181332	NP_851849	WXS	Illumina HiSeq	Unspecified	Q8N0W4	NLGNX_HUMAN			5	1966	-			489			Extracellular (Potential).		Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	c.1465C>A	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.551632	0.45487	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63	3.93	3.93	0.45458	Carboxylesterase, type B (1);	.	.	.	.	D	0.88511	0.6456	H	0.96080	3.765	0.58432	D	0.999998	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.91635	0.99;0.974;0.999	D	0.92025	0.5629	9	0.66056	D	0.02	.	14.4947	0.67678	0.0:0.0:1.0:0.0	.	546;489;509	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	N	489;509;489;489;489	ENSP00000370485:H489N;ENSP00000370483:H509N;ENSP00000275857:H489N;ENSP00000370482:H489N;ENSP00000439203:H489N	ENSP00000275857:H489N	H	-	1	0	NLGN4X	5831254	1.000000	0.71417	0.436000	0.26797	0.216000	0.24613	8.442000	0.90317	1.579000	0.49836	0.600000	0.82982	CAT		0.572	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		51	16	1	0	2.14e-21	2.43e-21	51	16				
FAM47C	442444	broad.mit.edu	37	X	37028587	37028587	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chrX:37028587C>T	ENST00000358047.3	+	1	2156	c.2104C>T	c.(2104-2106)Ctc>Ttc	p.L702F		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	702								p.L702F(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						AGTGTCCCGTCTCCACCCAGA	0.642																																						uc004ddl.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(2104-2106)CTC>TTC		hypothetical protein LOC442444							50.0	49.0	49.0					X																	37028587		2202	4300	6502	SO:0001583	missense	442444							g.chrX:37028587C>T	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2104C>T	X.37:g.37028587C>T	ENSP00000367913:p.Leu702Phe		Somatic					p.L702F	NM_001013736	NP_001013758	WXS	Illumina HiSeq	Unspecified	Q5HY64	FA47C_HUMAN			1	2118	+			702					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.2104C>T	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	-	11.86	1.763178	0.31228	.	.	ENSG00000198173	ENST00000358047	T	0.22539	1.95	1.03	1.03	0.20045	.	.	.	.	.	T	0.19248	0.0462	L	0.52573	1.65	0.09310	N	1	B	0.30563	0.285	B	0.32342	0.144	T	0.20505	-1.0273	9	0.44086	T	0.13	.	7.9008	0.29734	0.0:1.0:0.0:0.0	.	702	Q5HY64	FA47C_HUMAN	F	702	ENSP00000367913:L702F	ENSP00000367913:L702F	L	+	1	0	FAM47C	36938508	0.002000	0.14202	0.009000	0.14445	0.009000	0.06853	0.093000	0.15086	0.359000	0.24239	0.359000	0.22050	CTC		0.642	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		61	33	0	0	0	0	61	33				
DUSP21	63904	broad.mit.edu	37	X	44703874	44703874	+	Missense_Mutation	SNP	G	G	T	rs200055753		TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chrX:44703874G>T	ENST00000339042.4	+	1	626	c.496G>T	c.(496-498)Gtg>Ttg	p.V166L		NM_022076.3	NP_071359.3	Q9H596	DUS21_HUMAN	dual specificity phosphatase 21	166					peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|skin(3)	19						TAACAACACCGTGCGCATGAT	0.507																																						uc004dgd.2		NA																	0				large_intestine(1)|lung(1)	2						c.(496-498)GTG>TTG		dual specificity phosphatase 21							68.0	58.0	61.0					X																	44703874		2203	4300	6503	SO:0001583	missense	63904					cytoplasm|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity	g.chrX:44703874G>T	AF143321	CCDS14264.1	Xp11.4-p11.23	2011-06-09			ENSG00000189037	ENSG00000189037		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	20476	protein-coding gene	gene with protein product		300678				12408986	Standard	NM_022076		Approved		uc004dgd.3	Q9H596	OTTHUMG00000021401	ENST00000339042.4:c.496G>T	X.37:g.44703874G>T	ENSP00000343244:p.Val166Leu		Somatic					p.V166L	NM_022076	NP_071359	WXS	Illumina HiSeq	Unspecified	Q9H596	DUS21_HUMAN			1	626	+			166					Q0VDA6|Q6IAJ6|Q6YDQ8	Missense_Mutation	SNP	ENST00000339042.4	37	c.496G>T	CCDS14264.1	.	.	.	.	.	.	.	.	.	.	g	15.65	2.897657	0.52121	.	.	ENSG00000189037	ENST00000339042;ENST00000537377	T	0.03860	3.78	3.86	3.86	0.44501	.	0.000000	0.85682	D	0.000000	T	0.09113	0.0225	M	0.85041	2.73	0.58432	D	0.999998	P	0.44877	0.845	B	0.37267	0.245	T	0.11372	-1.0590	10	0.42905	T	0.14	.	12.8179	0.57675	0.0:0.0:1.0:0.0	.	166	Q9H596	DUS21_HUMAN	L	166;165	ENSP00000343244:V166L	ENSP00000343244:V166L	V	+	1	0	DUSP21	44588818	1.000000	0.71417	0.059000	0.19551	0.438000	0.31896	6.440000	0.73435	2.183000	0.69458	0.540000	0.68198	GTG		0.507	DUSP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056323.1	NM_022076		37	19	1	0	7.53e-24	8.59e-24	37	19				
TBX22	50945	broad.mit.edu	37	X	79281105	79281105	+	Silent	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chrX:79281105C>T	ENST00000373294.5	+	4	490	c.462C>T	c.(460-462)taC>taT	p.Y154Y	TBX22_ENST00000373291.1_Silent_p.Y34Y|TBX22_ENST00000442340.1_Silent_p.Y34Y|TBX22_ENST00000373296.3_Silent_p.Y154Y	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	154					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y154*(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TTTTCAGGTACGTCTATCACA	0.502																																						uc010nmg.1		NA																	1	Substitution - Nonsense(1)		lung(1)	lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						c.(460-462)TAC>TAT		T-box 22 isoform 1							91.0	75.0	80.0					X																	79281105		2203	4300	6503	SO:0001819	synonymous_variant	50945				multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:79281105C>T	AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.462C>T	X.37:g.79281105C>T			Somatic				TBX22_uc004edi.1_Silent_p.Y34Y|TBX22_uc004edj.1_Silent_p.Y154Y	p.Y154Y	NM_001109878	NP_001103348	WXS	Illumina HiSeq	Unspecified	Q9Y458	TBX22_HUMAN			5	596	+			154			T-box.		Q5JZ06|Q96LC0|Q9HBF1	Silent	SNP	ENST00000373294.5	37	c.462C>T	CCDS14445.1																																																																																				0.502	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	NM_016954		25	23	0	0	0	0	25	23				
PABPC5	140886	broad.mit.edu	37	X	90690655	90690656	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chrX:90690655_90690656CC>AA	ENST00000312600.3	+	2	293_294	c.79_80CC>AA	c.(79-81)CCa>AAa	p.P27K	PABPC5-AS1_ENST00000456187.1_RNA|PABPC5_ENST00000373105.1_Intron	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	27	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						TGACTTGGACCCAGATGTCACC	0.594																																						uc004efg.2		NA																	0				ovary(1)|lung(1)|pancreas(1)	3						c.(79-81)CCA>AAA		poly(A) binding protein, cytoplasmic 5																																				SO:0001583	missense	140886					cytoplasm	nucleotide binding|RNA binding	g.chrX:90690655_90690656CC>AA	AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	Exception_encountered	X.37:g.90690655_90690656delinsAA	ENSP00000308012:p.Pro27Lys		Somatic				PABPC5_uc004eff.1_Intron	p.P27K	NM_080832	NP_543022	WXS	Illumina HiSeq	Unspecified	Q96DU9	PABP5_HUMAN			2	519_520	+			27			RRM 1.		A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	DNP	ENST00000312600.3	37	c.79_80CC>AA	CCDS14460.1																																																																																				0.594	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832		21	7	0	0	0	0	21	7				
CNGA2	1260	broad.mit.edu	37	X	150911736	150911736	+	Missense_Mutation	SNP	C	C	T			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chrX:150911736C>T	ENST00000329903.4	+	6	794	c.761C>T	c.(760-762)gCc>gTc	p.A254V		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	254					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					CTGCACTTTGCCCGCATGTTT	0.522																																						uc004fey.1		NA																	0				breast(3)	3						c.(760-762)GCC>GTC		cyclic nucleotide gated channel alpha 2							180.0	137.0	152.0					X																	150911736		2203	4300	6503	SO:0001583	missense	1260				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity	g.chrX:150911736C>T	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.761C>T	X.37:g.150911736C>T	ENSP00000328478:p.Ala254Val		Somatic					p.A254V	NM_005140	NP_005131	WXS	Illumina HiSeq	Unspecified	Q16280	CNGA2_HUMAN			7	985	+	Acute lymphoblastic leukemia(192;6.56e-05)		254			Extracellular (Potential).		A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	37	c.761C>T	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.741219	0.49151	.	.	ENSG00000183862	ENST00000329903	D	0.97906	-4.6	5.49	4.62	0.57501	Ion transport (1);	0.187443	0.49305	D	0.000158	D	0.94548	0.8244	L	0.28458	0.855	0.37193	D	0.904034	P	0.43231	0.801	B	0.39971	0.315	D	0.94423	0.7642	10	0.45353	T	0.12	.	12.3798	0.55301	0.1694:0.8305:0.0:0.0	.	254	Q16280	CNGA2_HUMAN	V	254	ENSP00000328478:A254V	ENSP00000328478:A254V	A	+	2	0	CNGA2	150662392	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.774000	0.68906	1.063000	0.40649	-0.237000	0.12165	GCC		0.522	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140		4	126	0	0	0	0	4	126				
RPL10	6134	broad.mit.edu	37	X	153628938	153628938	+	Missense_Mutation	SNP	G	G	A			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chrX:153628938G>A	ENST00000369817.2	+	7	1039	c.463G>A	c.(463-465)Gcc>Acc	p.A155T	RPL10_ENST00000406022.2_Missense_Mutation_p.A104T|RPL10_ENST00000424325.2_Missense_Mutation_p.A155T|SNORA70_ENST00000384436.1_RNA			P27635	RL10_HUMAN	ribosomal protein L10	155					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCTGCGCAGGGCCAAGTTCAA	0.582																																						uc004fkm.2		NA																	0					0						c.(463-465)GCC>ACC		ribosomal protein L10							126.0	118.0	121.0					X																	153628938		2203	4300	6503	SO:0001583	missense	6134				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|endoplasmic reticulum	structural constituent of ribosome	g.chrX:153628938G>A	AB007170	CCDS14746.1, CCDS76059.1	Xq28	2011-04-06			ENSG00000147403	ENSG00000147403		"""L ribosomal proteins"""	10298	protein-coding gene	gene with protein product		312173				9582194	Standard	NM_006013		Approved	NOV, QM, DXS648E, DXS648, FLJ23544, L10	uc004fkm.2	P27635	OTTHUMG00000033189	ENST00000369817.2:c.463G>A	X.37:g.153628938G>A	ENSP00000358832:p.Ala155Thr		Somatic				uc010nuv.1_5'Flank|RPL10_uc004fko.2_Intron|RPL10_uc004fkn.1_Missense_Mutation_p.A155T|RPL10_uc004fkp.1_3'UTR|RPL10_uc004fkq.1_Intron|RPL10_uc004fkr.1_Missense_Mutation_p.A80T	p.A155T	NM_006013	NP_006004	WXS	Illumina HiSeq	Unspecified	P27635	RL10_HUMAN			6	651	+	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		155					A3KQT0|D3DWW6|Q16470|Q2HXT7|Q53FH7|Q6FGN8|Q8TDA5	Missense_Mutation	SNP	ENST00000369817.2	37	c.463G>A	CCDS14746.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.984960	0.93044	.	.	ENSG00000147403	ENST00000369817;ENST00000424325;ENST00000436473;ENST00000344746;ENST00000406022;ENST00000427682;ENST00000428169	T;T;T;T	0.78481	-1.17;-1.17;-1.17;-1.18	4.95	4.95	0.65309	Ribosomal protein L10e/L16 (2);	0.068766	0.56097	U	0.000030	D	0.86892	0.6042	M	0.92923	3.36	0.80722	D	1	P;P	0.42296	0.775;0.456	B;P	0.48738	0.328;0.588	D	0.89937	0.4070	10	0.72032	D	0.01	-16.2467	14.6627	0.68885	0.0:0.0:1.0:0.0	.	104;155	F8W7C6;P27635	.;RL10_HUMAN	T	155;155;155;155;104;65;65	ENSP00000358832:A155T;ENSP00000413436:A155T;ENSP00000341730:A155T;ENSP00000385621:A104T	ENSP00000341730:A155T	A	+	1	0	RPL10	153282132	1.000000	0.71417	0.995000	0.50966	0.965000	0.64279	8.853000	0.92222	2.042000	0.60477	0.600000	0.82982	GCC		0.582	RPL10-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127774.5	NM_006013		4	114	0	0	0	0	4	114				
SLC16A12	387700	broad.mit.edu	37	10	91203593	91203605	+	Frame_Shift_Del	DEL	TCCACAAAAAAAA	TCCACAAAAAAAA	-			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr10:91203593_91203605delTCCACAAAAAAAA	ENST00000341233.4	-	4	512_524	c.122_134delTTTTTTTTGTGGA	c.(121-135)attttttttgtggagfs	p.IFFVE41fs	SLC16A12_ENST00000371790.4_Frame_Shift_Del_p.IFFVE71fs	NM_213606.3	NP_998771.3	Q6ZSM3	MOT12_HUMAN	solute carrier family 16, member 12	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|skin(1)|stomach(1)	14						TGTCTGGAACTCCACAAAAAAAATTGAGATACA	0.371																																						uc001kgm.2		NA																	0				skin(1)	1						c.(121-135)ATTTTTTTTGTGGAGfs		solute carrier family 16 (monocarboxylic acid																																				SO:0001589	frameshift_variant	387700					integral to membrane|plasma membrane	symporter activity	g.chr10:91203593_91203605delTCCACAAAAAAAA		CCDS7404.1, CCDS7404.2	10q23.32	2013-07-18	2013-07-18		ENSG00000152779	ENSG00000152779		"""Solute carriers"""	23094	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 12"""	611910	"""solute carrier family 16 (monocarboxylic acid transporters), member 12"", ""solute carrier family 16, member 12 (monocarboxylic acid transporter 12)"""				Standard	NM_213606		Approved	MCT12	uc001kgm.3	Q6ZSM3	OTTHUMG00000018714	ENST00000341233.4:c.122_134delTTTTTTTTGTGGA	10.37:g.91203593_91203605delTCCACAAAAAAAA	ENSP00000343022:p.Ile41fs		Somatic					p.I41fs	NM_213606	NP_998771	WXS	Illumina HiSeq	Unspecified	Q6ZSM3	MOT12_HUMAN			4	513_525	-			41_45			Cytoplasmic (Potential).		Q5M9M9|Q5T7J2|Q6ZV76	Frame_Shift_Del	DEL	ENST00000341233.4	37	c.122_134delTTTTTTTTGTGGA																																																																																					0.371	SLC16A12-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_213606		12	73	NA	NA	NA	NA	12	73	---	---	---	---
FFAR2	2867	broad.mit.edu	37	19	35940788	35940790	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:35940788_35940790delCTG	ENST00000599180.2	+	2	252_254	c.172_174delCTG	c.(172-174)ctgdel	p.L62del	FFAR2_ENST00000601590.1_Intron|FFAR2_ENST00000246549.2_In_Frame_Del_p.L62del			O15552	FFAR2_HUMAN	free fatty acid receptor 2	62					cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to fatty acid (GO:0071398)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipid storage (GO:0019915)|mucosal immune response (GO:0002385)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of interleukin-8 secretion (GO:2000484)|regulation of acute inflammatory response (GO:0002673)|regulation of peptide hormone secretion (GO:0090276)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(6)|skin(1)|urinary_tract(1)	22	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CGACCTCCTCCTGCTGCTGCTGC	0.645																																					GBM(40;139 809 9833 23358 48736)	uc002nzg.2		NA																	0				central_nervous_system(1)	1						c.(172-174)CTGdel		free fatty acid receptor 2																																				SO:0001651	inframe_deletion	2867					integral to plasma membrane	G-protein coupled receptor activity|lipid binding	g.chr19:35940788_35940790delCTG	AF024690	CCDS12461.1	19q13.1	2012-08-08	2006-02-15	2006-02-15		ENSG00000126262		"""GPCR / Class A : Fatty acid receptors"""	4501	protein-coding gene	gene with protein product		603823	"""G protein-coupled receptor 43"""	GPR43		9344866	Standard	NM_005306		Approved	FFA2R	uc010eea.3	O15552		ENST00000599180.2:c.172_174delCTG	19.37:g.35940797_35940799delCTG	ENSP00000473159:p.Leu62del		Somatic				FFAR2_uc010eea.2_In_Frame_Del_p.L62del	p.L62del	NM_005306	NP_005297	WXS	Illumina HiSeq	Unspecified	O15552	FFAR2_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)		2	252_254	+	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		62			Helical; Name=2; (Potential).		B0M0J9|Q4VAZ3|Q4VAZ5|Q4VBL5	In_Frame_Del	DEL	ENST00000599180.2	37	c.172_174delCTG	CCDS12461.1																																																																																				0.645	FFAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466120.3	NM_005306		8	90	NA	NA	NA	NA	8	90	---	---	---	---
SIGLEC8	27181	broad.mit.edu	37	19	51961617	51961619	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-CN-4735-01A-01D-1434-08	TCGA-CN-4735-10A-01D-1434-08	 	 	 	 	 	 	 	Untested	Somatic	Phase_I	WXS	none	NA	NA	Illumina GAIIx	369ebdf4-ee27-414d-978d-3698711fae98	e30d9a49-8c83-4451-93ac-fd99ae71b265	g.chr19:51961617_51961619delGCA	ENST00000321424.3	-	1	89_91	c.23_25delTGC	c.(22-27)ctgccc>ccc	p.L8del	SIGLEC8_ENST00000340550.5_In_Frame_Del_p.L8del|SIGLEC8_ENST00000430817.1_In_Frame_Del_p.L8del|SIGLEC8_ENST00000597352.1_5'Flank	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	8					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CAGagcaggggcagcagcagcag	0.596																																						uc002pwt.2		NA																	0				ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5						c.(22-27)CTGCCC>CCC		sialic acid binding Ig-like lectin 8 precursor																																				SO:0001651	inframe_deletion	27181				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity	g.chr19:51961617_51961619delGCA	AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.23_25delTGC	19.37:g.51961626_51961628delGCA	ENSP00000321077:p.Leu8del		Somatic				SIGLEC8_uc010yda.1_In_Frame_Del_p.L8del|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_In_Frame_Del_p.L8del	p.L8del	NM_014442	NP_055257	WXS	Illumina HiSeq	Unspecified	Q9NYZ4	SIGL8_HUMAN		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)	1	90_92	-		all_neural(266;0.0199)	8					Q7Z728	In_Frame_Del	DEL	ENST00000321424.3	37	c.23_25delTGC	CCDS33086.1																																																																																				0.596	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442		7	140	NA	NA	NA	NA	7	140	---	---	---	---
